Está en la página 1de 95

I

595.7
U74
E.J.2
UNAL - Medellin

IIDlimWllffl'"liD' III
64000000009477

Facultad de Ciencias
U niversidad N acional de Colotnbia
Sede Medellin.

;.~-,-

., ~, !, ~n 1'-1 At:IONt\L D~Cot.OM~


, It ..,,1.H II ,....

! 1'':' (\ 1, I' BTBLlO'!'ECj\~


'1\ 1 II H~C \ .• EFE" G0MF
UNAL - Medellfn

II°l~ilffiliifI"InIII

64000000009477

-
Facultad de Ciencias

U niversidad N acional de Colotnbia

Sede Medellin.

"" .~.;, COlO:v\IH "


1 I . n
• 1 ~ -ClONAl
______nil
'~ ,- .
- . • M~ 1I1111'"

I B1BLlOT F I\~
I " ,n l ' '/
. r ' \ "En" (,I i\1I
" ,. \ I
TITUl.O
PRINe "'10. ()f EN I (l1\UlI n<.IA fORFNSr:
A IORES

S.\N(11' A U ({IIII ~ II ( I.
I , :r N II II I\(:I{I') () lA , MIII '; ,,~ ,'\r I C rr~N(IA<;
":'
HN,ICAC; R")M ll 1 1 ~ ' A<'; , , ',\ L ,\ ell! ,,).\\\
\ 'rRS\[I"'E .- , ( If _ - ­
I), ~ I ( ' 1< A I 0 1Nl IA<; flA<;I( A,,(Bln l 'c i A - - 11"'11111'~~.
, \ ~LI()1 r el\ '
(III ( UIAR) :- I'TO \ ' £ n ,,( )'\\1
'j \ 1 ,I
Dpt I Nil \',\ \ Y\F, ' .
UN I\ ' II,'; II I I' ,\( H ' NA I I II · l\ II \ 'I\W I/\ SIIlI
MI PIIII.I.
TABLA DE CO TENrD
IIA I R MIA I Afl(ll ( IMlII)(~ I NI ' I ,

I NV I o.; lI ~ ; Afll ' I ~ t\ 1 N I;NI II\I( II \ >(.1,\ I I A

U I\I!'R<;IJ) 11 1'1 J\NI I( 'U I A

, 1.1. - I N II ·R n w D I ~';) ';\'i I ;<; « I l({tll.


INTRODUCCION A LA ENTOMOLOGlA FORENSE ...... .

,,('1')("» (Uo.; A ) J ARTROPOoo FAUNA DE IMPORTANCIA FORENSE ...


C ( ~ '1< I IIN;\ 1·1 G I< 1,,( 1 111 ' IN \, I <., I H ,AI It l I

S I C; II '~I /\ II I A M( 11.1' l I IW I I I' 1. /\ UNIVI'F';rr ' /\11 ESTA DOS DE DESCOMPOSICION DEL CADAVER ..... ... ..

N'\I I' I AI I I I <1\1 1~II\1 A S I IlI Mil I " IN .

IS M il M llR( I Ill ' I .A !-,( 'I( II Il A I I I l [~ I >1'1 1\ III Generalidades sobre los estados de descomposici61'l ....... .. ..

f. It ' M ( I I (1( ,I, I ( 1!{ 1 N"I

..­ EVIDENCIA ENTOMOL6GICA EN EL LUGAR DE LOS 1­

Recolecci6n de la evidencia .............. .. .... .... .. ............................. .. .


r,~ \1\;1 I'.... (I R \~I(lN RI <, IIH I' I <. "'il{ \"<.]1'11 I ., . Materiales y equipo para colectar muestras en tomol6gica~
1i1(11.( I(;( ) (1\ IS<. ('/\ Nil" ),'. 1< I) \,IV 1'1 \ I' ' ,\I l,IHlI~' III Consideraciones importantes en el momenta de la recoleo
IN VI'<'; II(; ,\ ( I( ) I 'N S III ~ Ir\ III .\ 1 1'IHI ' I ~ H 111'1 11 Registro de datos climatol6gicos ............ .... .... .............. ...............
I . N I VI Il<; I P,\ II Ill, I I 1(( '~III I. \ 11I·<; 111' I I 2(l(l1 ,
Colecci6n y preservaci6n de especimenes ....................... ..... .. ..
Recolecci6n de la evidencia entomol6gica durante la auto
"'I IIlFI .I~ I'I< I ~ l rR I l". I · 111111, cll ' '() I II'H I A II;(I <.; tJ
Recolecci6n de la ev idencia entomol6gica en cuerpos ente
11/,\1111 111 1'11' I ~<; I <; I·/'., F «' IIlI l .. ;I A i'l lIIr:-:SI I' N
Recolecci6n de la evidencia entomo16gica en estructuras er
1 1'1 1 ' \ 11111\ , EN I I C TiI Il'I I 1I1 I ' \'I'<', I(;A( In' Y FN

~ (l I (I~ IH1 ,\r<'; I' N I(l\ ' I " 1 \ '1 ,II C II I l(IR llr" \ ~ , 11f)1 ' 1'I PROCEDIMIENTOS EN EL LABORA TORIO ........ .'............. ..

\RI'I\
Preservaci6n de insectos ..... '.. ... .. '........ ' ... '..... ,......... ....... ...... .........
Cria en condiciones de laboratorio .. .. ....... ... .. ...... ....................... .
PAII I ,I\NIlIH \ GIII" 1 p, I 111"i1 Arlr Procedimientos para la identificaci6n de los insectos del on
1'.~ l l ' l l l .' \ N II 111111 1l(.I ,\ S I \I() '.I"'" I II I I IFC ;Hi\N lr Anahsis de datos entomol6gicos ............................. ................ .. ..
G I<I 'I ·".~ I ~1I 1 1 ,\ 1'1 I N\, I ·,IIl.\U(IN 111"111 I I (lOI.
11,\ I C, 1.\ I Xl U N( 1' 1,\11 ,\ ,\ I ')'. I'I!II' FI I '''' PI 1"J\F<'IIC i\ ­ rtCNICAS MOLECULARES EN ENTOMOLOGlA FOREr
~ 1( 1, I , I , ll"" II ~ • . I \ J'(I IU'N', 1 I I I~IP ,,'1 \ ' " IN\ I ~ I I ­
UNA APROXIMACION.. ,.. .. ..... ....... .... ...... ..... ...... .. .. ....... .... ... ......
~;.\I ' 111.\ \ " I \I 1/ .\ <,1 11'<';'" PI ' J I~ . \l 1<. I r N '-, 1';1 r~I' rr, A
Extracci6n de ADN a partir de insectos con Grind Buffer .... .
~ I"," , II " II !J" I ( ;1 ' 1111 ('R II ''< I~'Y'\ ,
Reacci6n de polimerizaci6n en cadena PCR .. ......... .. .. ............ ..

ForOCRMIA P ORTADA : J\NIlFI.t.; I ( I·l ( )


BIBLIOGRAFIA
FOI OC:RMIi\S ; FI~ /\ ( 1"< ( I RAM\'IN RI'"'' I~ I 1'1.)

01"1' 0 Y OIi\C: n"MAClON :I\Nlm r'.c, r l 1l<1 \

Ill ll. II\ AC 10"1" : h 1'1H11 I ) h-'rnandt'7 (;arhl(> r


o

rfTU\O
PRI nrlos nF EN I"OMOIOc(" FORI· SF

AUTormo;
SANDRA UrwlI 5< tfl I.
I Nt ,I 11·.1< '\ tv :R( IN< It-.I ,\ , M /I I" It,/\ I N l ' lI'Nt 1/\<'

[)( "- ' 1( HZ/\ 1·1\j 0 1 "l( 1/\"


HA",,·/\s Bit 1/\1 Ll If(
RASIC I\,,(lh 11( '( ;1/\

M( ' I P
/\<;

III III~ )

PIXINT!

Ur I\ ' I·"" "' /\I I N/\t 1\' III IH: ('(1IlII\III I AS I111'

11 111·IIIN .
j )(
TABLA DC 'ONTE ID ')
11 /1 IIZII II /\ I /\ I " \I, 'MI l i lt'\( 1 Nil I

1« 10. ,1/\ F I II

..:s
-
I NV I ."; li t ;,\1 II lR /\ I I N 1('MI I') ~

U N I V I·I,,<.;II 1/\ 1) I II 1\ t--, I II ~ .\I 1/1

Y 1·1 e r N I 1' 1< I I II, 1) 1'" /\<;1 ·<' ( '\ IN liZ' II

INTRODUCCI6N A LA ENTOMOLOGiA FORENSE............ .. .................................... ................ 9

,,('Dl n (l'<''' )
J ARTROPODO FAUNA DE I MPORTANClA FORENSE ... ............... ...................... ........ ................15

C , O I'I Jl Ni\ 11 GlnI"' l ll· 11 \' 1" " 1,,\, I" I'N

1<; 11 .1,\ 11\ II M, 'I H Iii AI< I" 1.11 UNIVI I~ '111/\1'
ESTADOS DE DESCOMPOSIClON DEL CADA VER ......... ............ ....... ..... .............. .......... ............ 35

J
11 \ I< I N '" I )I : CI ,,( ll\\l1I1I SI III MIIII I 1 IN .

1_" Mil MIIR\ I I ll' III <" 'M' 11'1 ),\1 I I U I« ' 1' 1 , I II
Generalidades sobre los estados de descomposici6n ..... .. ..... .. .. ...... ............ .. ....... .. ....................... 40

I N I (' 1( 11 , \( .111 II ' Id N"I

U'
EVIDENClA ENTOMOL6GICA EN EL LUGAR DE LOS HECHOS ............................ .. ...... ...... 45

("'

c/J
Recolecci6n de la evidencia ....... ................................................................ ......... ...... ......... .... ................. 47

<.. M<RN"...'I II I
h<I\N( 14 (I Ri\,,('''J RI'o.;lIH I' , \
S Materiales y equipo para colectar muestras entomoJ6gicas

-I..
Consideraciones importantes en el momento de la recolecci6n .............................................. .. ...48

fhll, ,,-,(\(Ms<' IA " " ',\I ") 'I"!( III :\lK I \I l.ln 'II'''1

Registro de datos climatol6gicos ...... ...... ......... ...... .................. ............ .......... .................. .............. ........ 49

,'~
, ' r " I I\. 1\1 II') I NSI II II.\ II( ,1 !tll l ( II. ,\I~ 1'11 11

Colecci6n y preservaci6n de especimenes .......................................................................................... 52

IINIVI'R<;IIlI\l'I '1 ( 'II \~ I III ,\ "1 "11 1' 1 12001 .

Recolecci6n de la evidencia entomol6gica durante la autopsia


UN(IIlI: I ' l ' fll ~ lrR\ ..... rc; n ll ll,IN l r "'UIII 1111\11/('''1

Recolecci6n de la evidencia entomol6gica en cuerpos enterrados


11,11 111' I" 1'1 11'<;1" I'N F N I I '~ I \ 11.\ ,,- ;1 " Il l l<I·,\~ 1 I·N
d Recolecci6n de la evidencia entomol6gica en estructuras encerradas ........ .... .......... ........... ...... 53

\ (1\( I~lflill . E . II (;H III'() I'I I I'I·" III:M I(JN Y I N

( (II (1~IiHIII'''' I '.) I(l\rI N I"" 1'-. '" ,,\I 'M' m I1I'Q II \PI I I '\j 1'1

,\ HI II

:e
CI(
PROCEDrMIENTOS EN EL LA BORATORlO ....... .. ................................................... ............... ......... 55

?
<:"
Preservaci6n de insectos ..... .... ......... .. ....... ... .... .......... .............. ..... .......... ...... ..... ....................................... 57

/~ Cria en condiciones de laboratorio ...... ..... ....... ... ......... ................. ...... ........ ........ ...................... ......... .... 59

r""11I i\'JPK I \ <"'1I<J\l I ~ 1 H i lI /\1'11


\: Procedimientos para la identificaci6n de los insectos del orden Diptera ............. ... ......... .... ..... 6 1

1'.... 11 111 '1'\, 11· Rilli , "- ,I·' " I XI\I' ;I ~II~ I HI 1I"i ll l.lIl\ " I"
() Analisis de datos entomo16gicos ..... ....... ...... ....... ........ .................. ..... .... ......... ........... ......... .. ....... ...... .... 73

e l"'1 '< 1"'1 1\1I 1.1 ,I 1'1' f '\'1' ·111,,\' 1\1', 1l1",I'I ! I 200 1.

TECNICAS MOLECULARES EN ENTOMOLOGiA FORENSE:

~
I III '''I ,II1(I I' IN( 1'1 ,\1 1,1,1 1' ", PIll'\!! "1'. 1'1 1 '1'·1 1' ,"­

UNA APROXIMACl6N .... ....... ................ ..... .... ........ ....... ................... ....... .............. .. ........ ... ... .. ............... 77

l ,,'IN I N \," I " "'ll \( .i " I! IIU " ;1 (I '~1" II 1\1 ',J I " 1 , I I

'; i\"(lI~ "Y I ~ h\ll/ ,I' ;Jl II" ; I " 11I' ';1!.\I ~ 'IN''' I'' l l h t ''IIl JI
\.0 Extracci6n de ADN a partir de insectos con Grind Buffer ... ............................................. .. ............ 82

I III\( 1'I " '~1 1I 1 ( .f N IHIl C ,OI, ·,,'hl\\.


1
Reacci6n de polimerizaci6n en cadena PCR ...... .......... ................................ .................... .......... ......... 86

(
1;0 1OC.R"F'A PORTAn,, : I\NI 11, IS h w! 1
~ BIBLIOGRAFlA
FOl OC.RAFIAS: f 'RIIM 'N I I R /'~ I( ')N RI <; 1HI-!' )
,J
v

DIC; I'N O y DIr\(;RA lA('fO : I 'I~ r <; T( '''' 1


..J

0
-.,2:)
11Ul MI III J I ',

,-.r~·'T() . I'F BIBII<YfEC'J\:-,


., ,. '1'1 . . " rrr " \.11 P
El presente texto es el resultado del trabajo conjunto entre dos estudiantes del grupo
semilla de investigaci6n y el profesor en un intento por conceptualizar y difundir el
trabajo en Entomologia forense. En Colombia esta es un area con enormes po­
z tencialidades y una excelente forma de utilizar la Entomologfa clasica y molecular
al servicio de la humanidad.
-0
o- Si bien en Colombia el trabajo en Entomologia forense es reciente, durante los

~
ultimos tres anos se ha producido informaci6n de excelente calidad y se ha mo­
tivado un trabajo inves tiga ti v~ que vale la pena destacar.
z
w Para el caso de la Universidad Nacional de Colombia sede Medellin, la incur­
(f) si6n en este pequeno-gran mundo de la Entomologia Forense y la apropiaci6n
w de algunas tecnicas para estudiar insectos de importancia forense , no podria
cr: haberse llevado a cabo sin el apoyo de la Direcci6n de Investigaciones DIME.
a.. Gracias a la direcci6n de ivestigaciones se financi6 el primer proyecto cuyos
resultados constituyeron la base para desarrollar una linea de investigaci6n.
Gracias al apoyo institucional de la sede y a Colciencias, se involucraron los
estudiantes bajo la metodologia de aprender aprendiendo en un proyecto de
gran responsabilidad academica y social.

Acunando 10 expresado por el entom610go Aleman Mark Benecke, uno de los


entom610gos forenses que ha promovido y apoyado el trabajo en Entomologia forense
en Colombia, son tres las carencias en Entomologia Forense a nivel mundial:

-Mas j6venes investigadores trabajando en este campo, que no es uno de los mejo­

res remunerados y que aparece para muchos como un campo poco excitante.

-Discusi6n abierta sobre las estimaciones de «Intervalo Post Mortem» con base en

insectos y su aplicabilidad en terminos legales y

-Acceso a la informaci6n por investigadores, cientfficos y aficionados de todo el

mundo.

5610 asi se podra generar discusi6n y experimentaci6n en todas las culturas "inde­

pendientemente del acceso a las instituciones en las que se trabaje 0 de la consecu­

ci6n de literatura especializada de alto costo".

El presente texto representa un esfuerzo en este sentido y constituye una respues­

ta a la necesidad de difusi6n y popularizaci6n de los principios basicos de

Entomologia Forense en Colombia. Esto ultimo ya que desafortunadamente para

nuestro pais, existen algunos investigadores colombianos que se empenan en im­

pedir la difusi6n de cualquier estudio en el area que no sea de su autoria.

Los alcances del texto se limitan a difundir los principios basicns sobre Entomologia

forense, realizar una aproximaci6n al tema yen particular en el NeotT6pico incluyen­

do la actualizaci6n en procedimientos y trabajo de laboratorio.

No se realiza descripci6n detallada de casos particulares 0 se discuten los aspectos

legales para la utilizaci6n de insectos como evidencia en Colombia.

Gracias al Doctor Charles Porter del CDC de Atlanta y al Dr J. Wells de la Sociedad

Europea de Entomologia forense por SU orentaci6n y apoyo.

La entomologfa forense, 0 medico comi


cuerpos humanos como elemento d
entomolog f ns es reconoc da com
relevancia tormacI6n qlle pu
tes desarro

protesor d
Megnin . ....~-ifC1
cuerpo detil....ull'..1h
En 1

11
Sistematica Molecular

La entomologfa forense, 0 medico crimin al, hace referencia al estudio de insectos asociados a
cuerpos humanos como elementos de uso potencial en medicina legal. Actualmente , la
entomologfa forense es reconocida como una subdisciplina de las ciencias forenses y, por la
relevancia de la informacion que puede aportar en relacion con un cadaver, ha alcanzado importan­
tes desarrollos.
La utilizacion de insectos en investigaciones legales no es reciente ; no obstante, su estudio
sistematico en cuanto a identificacion taxon6mica de las especies asociadas a cadaveres y los
avances para precisar su validez como prueba legal si 10 son. EI primer documento escrito que
menciona la resolucion de un caso de homicidio con ayuda de insectos data del ano 1234 a.c.;
sin embargo , la utilizacion de insectos en el ambito legal y la publicacion de artfculos que
describen casos concretos, solo aparece a principios del siglo XIX.
\ Actualmente, la entomologfa forense se util iza como una herramienta en la resolucion de
casos criminales en Europa, Estados Unidos y Canada, y es un campo con desarrollos
investigativos importantes en el mundo, incluyendo paises suramericanos como Brasil,
Argentina, y mas recientemente, Colombia. '
EI primer caso escrito de Entomologfa forense aparece relatado en un documento de la China
medieval, IIamado «Hsi Yuan Lu », escrito por un magistrado de la epoca . En este documento,
se menciona el asesinato de un granjero, cuyo autor fue hallado con la ayuda de moscasc
Tomando como base el patron de las heridas que presentaba la vfctima , se dedujo que una hoz
habfa sido el «arma asesina». Para encontrar el autor del crimen , el magistrado ordeno a los
granjeros reunirse luego y colocar sus hoces sobre el suelo. Las moscas comenzaron a congre­
garse sobre la hoz «asesina,i; atrafdas por las trazas invisibles de tejido 0 sangre de la victima.
Asi , las sospechas que recayeron sobre el dueno, fueron confirmadas cuando el mismo confeso
ante la evidencia de las moscas que era el autor del crimen. En apartes del mismo documento,
se encuentra descrita la presencia de las moscas en los cuerpos en descomposicion, su
colonizacion de los orificios naturales, el tiempo de aparicion y la duracion de la infestacion; asf
mismo,el efecto de los traumas en la atraccion de dichos insectos.
La entomologia forense tiene una larga historia en Europa. En 1767, el biologo Karl Von Linne
afirm6 que tres moscas devoraban un caballo tan rapido como 10 haria un leon, refiriendose a que
eran capaces de producir grandes masas de larvas y consumir rapidamente un cadaver.
En 1831, Orfila, un medico frances, despues de haber presenciado innumerables exhumaciones
,destaco y analiza el papel que cumplen las larvas de insectos en la descomposici6n de un
'cadaver. En 1855, Bergeret expuso el primer caso de Entomologia forense, que incluyo una
estimacion del tiempo despues de la muerte 0 « Intervalo Post Mortem», IPM .
En 1878, el medico frances Paul Camille Brouardel, basandose en el trabajo de Bergeret,
describio el caso de un nino momificado despues de la autopsia. EI cadaver present6 gran
cantidad de artropodos, incluyendo larvas de mariposas y adultos de acaros. Con la ayuda Perier,
profesor del Museo de Historia Natural de Paris, y el veterinario de la armada Jean Pierre
Megnin, se preciso el estado y tiempo de las larvas y acaros 10 que !levo a sugerir que el
cuerpo debia haber sido abandonado por 10 menos cinco meses atras.
En 1881, el medico aleman Reinhard publico el primer estudio sistematico en entomologia
forense con base en moscas de la familia Piophilidae, que fueron encontradas sobre cuerpos
exhumados. En 1886, Hofmann, considerado uno de los pioneros de la entomologia forense,
presento un informe entomologico bas ado en numerosas exhumaciones, en el que se registra la
presencia de moscas de la familia Phoridae, conocidas actualmente como las moscas de los
ataudes.

ENTOMOLOGtA FORENSE 11
Facultad de Ciencias

Entre 1883 Y 1898 Megnin publico una serie de articulos, de los cuales el mas famoso es «La prueba invaluable en casos de homicidios multip i
Faune des Cadavres: Application I 'e entomologie a la medicine legale». Megnin fue quien promo­
via el concepto ecologico de sucesion para determinar los intervalos despues de la muerte, al Es claro que la entomologia forense tiene un gran ~
considerar que los insectos se alimentan de un cadaver en secuencias que el denomino «olas ». como apllcados Prueba de ello 10 constituye la cre
en los InStl,tutOS de medicina legal de gran numero
En 1895, investigadores canad ienses retomaron los trabajos de Megnin , haciendo enfasis en la entomologla por much os magistrados en dichos pc
necesidad de validar los metodos y las tecnicas para diferentes paises, considerando las varia­ socledades america,na y Europea de entomologie
ciones geograficas y climaticas . como entes que reunen los investigadores de univl
De esta misma epoca, se conoce uno de los primeros trabajos realizados en Estados Unidos , en un esfuerzo por validar ~os procedimientos y alca
donde los voluntarios para la industria animal describieron los hallazgos entomologicos en :nente , eXlste un consenso mundial sobre lar nece
mas de 150 cuerpos humanos. Ademas de los insectos , se menciono el tipo de suelo , la Id~ntificacion ~orrecta de los insectos de importancia
profundidad a la cual se hallaron los cadaveres y la posible relacion suelo-insecto . graflcas, con enfasls en ecosistemas y areas geogr~

Los trabajos mas significativos hacia 1899 fueron realizados por investigadores de Alemania En Suramerica, los trabajos en entomologia foren
y Austria . Dichos trabajos estan relacionados con patrones de mordida de cucarachas y Estos se han realizado principalmente en Argentina y
hormigas en cuerpos de niiios en descomposicion . Finalmente, la publicacion de dos libros Oliveira y Carvalho. En Peru, se describio muy recie
sobre entomologia forense en Francia y Alemania por Jean Fabre y Alfred Brehm , se tancia forense en Callao .
considera el punto de partida para los logros actuales en entomologia medicocriminal de la En Argentina ,. el trabajo sistematico se inicio a part l
region central en Europa. recopllaron la informacion no publicada hasta la fecr
En el siglo XX, empezaron a publicarse listas de especies de artropodos de importancia forense y de Ide~tificacion taxonomica de insectos de i'mportc
yaspectos relacionados con su ecologia y metabolismo .Tambien sobre la utilidad de insectos, do tam bien .de ~orma reciente insectos como prueba e
especialmente del orden Diptera, como terapia larval. Otros trabajos Importantes incluyen el de Maruluis (21
me~te de una de las pocas claves taxonomicas para i
En 1907, se realizo en Gran Bretaiia uno de los trabajos mas fundamentales y extensos sobre America .
Coleoptera (cucarrones) de importancia forense. Hacia 1920, se obtuvieron avances importan­
tes en cuanto al reconocimiento de los insectos en cadaveres y su variacion, dependiendo de las En Bras il, se han realizado diversos estudios sobre
condiciones de la muerte .En 1950, se utilizaron por primera vez insectos acuaticos para asoclada a cadaveres en zonas urbana, rur ,
determinar el intervalo de inmersion de un cadaver. Finalmente, los mayores avances en IPM panta~osos . Tambien, se ha utilizado insectos como I
en Europa se obtuvieron entre 1940 y 1950 . en R~o de Janeiro: En este pais tambien se ha public
taxonomlcas para Dlptera de importancia forense.
Hacia 1970, se iniciaron los primeros trabajos en una de las aplicaciones de la entomologia
forense, conocida como entomotoxicologia . Esta aplicacion ha permitido avanzar desde la En Colombia, el trabajo mas antiguo 10 constituye e
determinacion aproximada del tiempo despues de la muerte, hasta el conocimiento de las muerte (1944) , en el cual el medico Alonso Restrepo desl
causas de la misma . Utilizando tecnicas como inmunohistoquimica y cromatografia, es en el cementerio de San Pedro de Medelin.
posible identificar sustancias quimicas 0 toxinas en los tejidos de un insecto . En
entomotoxicolog ia, los insectos se convierten en fuentes alternas para analisis toxicologicos En 1999, se realizron dos trabajos pioneros sobre Er
que buscan detectar drogas 0 metabolitos relacionados con la muerte. Unlv~rsldad del Valle, (Olaya y Carrejo) , y el segundo, E
Martinez). En ellos, se colectaron e identificaron los in
Fuera de Europa , la entomologia forense solo se popularizo a partir de 1980, gracias a Marcel descomposicion de cadaveres. EI primero se realizo :
Leclercq ( Belgica) y Pekka Nuorteva (Universidad de Helsinki, Finlandia) . A partir de esta humano: E~ este mis,mo ano, Martinez, del grupo Insec
fecha, se promovio la investigacion basica y aplicada en entomologia forense en paises Cauca, /idero la creaclon de la Red Suramericana de Interc.
como Estados Unidos, Japon , Rusia y Canada . Foren~e. Tambien, en 1999, el Instituto de Medicina L
En los ultimos aiios, Estados Unidos aparece como uno de los paises que mas ha desarro­ Bogota el pnmer curso internacional de Entomologfa fore
lIado y aplicado la entomologia forense como prueba legal. forense aleman Mark Beneck.

A partir de los anos ochenta , la utilizacion de moleculas como el acido desoxirribonucleico, En el 2000, Restrepo y colaboradores de la Universidad
(ADN) , ha abierto enormes posibilidades y aplicaciones para la entomologia forense . toman­ Naclonal de ,Medicina Legal y Ciencias Forenses (Antioq l
do como base procedimientos moleculares , se ha avanzado hacia la identificacion rapida ron la duraclon de los estados de descomposicion del cere
y acertada de los insectos encontrados en un cadaver 0 en la escena del crimen . Asi mismo, dos asociadas en dos zonas de vida del Valle de Ab
se ha posibilitado la diferenciacion de razas geogrMicas de una misma especie y se ha descnbleron la entomofauna asociada a la descomposit
de Medellfn .
logrado identificar ADN humano en el contenido gastrico de insectos . Esto ultimo permite
generar una medida independiente de asociacion entre insectos y victimas , como una

ENTOMOLOGiA FOR E SE
12
Sist matica Molecular

prueba invaluable en casos de homicidios multiples 0 fosas comunes.


blico una serie de artfculos, de los cuales el mas famoso es «La

In I 'e entomologie a la medicine legale». Megnin fue quien promo­


Es claro que la entomologfa forense tiene un gran potencial, tanto en sus aspectos basicos
Jcesion para determinar los intervalos despues de la ~uerte, al
como aplicados . Prueba de ello 10 constituye la creacion de departamentos entomologicos
alimentan de un cadaver en secuencias que el denomlno «olas».
en los institutos de medicina legal de gran numero de pafses, la demanda de servicios de
lienses retomaron los trabajos de Megnin, haciendo enfasis en .Ia entomologfa por muchos magistrados en dichos paise s y la formalizacion reciente de las
los y las tecnicas para diferentes paises, considerando las vana­ sociedades americana y Europea de entomalogfa forense. Estas sociedades aparecen
como entes que reunen los investigadores de universidades e institutos de medicina legal ,
lS .
en un esfuerzo por validar los procedimientos y alcances de la entomolo.9fa forense. Actual­
ace uno de los primeros trabajos realizados en Estado~ Unidos, mente, existe un consenso mundial sobre la necesidad de continuar trabajando para la
a industria animal describieron los hallazgos entomologlcos en identificacion correcta de los insectos de importan~ia forense en diferentes condiciones geo­
s. Ademas de los insectos, se menciono el tipo de suelo, la graficas, con enfasis en ecosistemas y areas geogrElficas particulares .
Iron los cadaveres y la posible relacion suelo-insecto
En Suramerica , los trabajos en entomologia forense son relativamente pocos y recientes.
os hacia 1899 fueron realizados por investigadores de Alemania Estos se han realizado principal mente en Argentina y Brasil , por Oli va, Centeno y Maldonado,
3stan relacionados con patrones de mordida de cucarachas y Oliveira y Carvalho. En Peru, se describio muy recientemente la artropodofauna de impor­
os en descomposiCion . Finalmente, la publicacion de dos Ilbros tancia forense en Callao.
en Francia y Alemania por Jean Fabre y Alfred. Brehm , se
En Argentina, el trabajo sistematico se inicio a partir de 1993, por Oliva y Ravioli, quienes
I para los logros actuales en entomologfa medlcocrrmlnal de la
recopilaron la informacion no publicada hasta la fecha e iniciaron los estudios sucesionales
y de identificacion taxonomica de insectos de importancia forense . Estos autores han incluir
)ublicarse listas de especies de artropodos de importancia forense do tambien de forma reciente insectos como prueba en medicina legal (Oliva y Ravioli 2004) .
su ecologfa y metabolismo.Tambien sobre la utili dad de Insectos, Otros trabajos importantes incluyen el de Maruluis (2003) gracias al cual se dispone actual­
era, como terapia larval . mente de una de las pocas claves taxonomicas para insectos de importancia forense en Sur
America.
Bretana uno de los trabajos mas fundamentales Y extensos sobre
mportancia forense. Hacia 1920, se obtuvi~ron avances importan­ En Brasil, se han realizado diversos estudios sobre la caracterizacion de la entomofauna
Ito de los insectos en cadaveres y su varraClon, dependlendo de las asociada a cadaveres en zonas urbana, rurales y en ambientes humedos y
1950, se utilizaron por primera vez insectos acuaticos para pantanosos.Tambien, se ha utilizado insectos como prueba para resolver casos criminales
nersion de un cadaver. Finalmente, los mayores avances en IPM en Rio de Janeiro . En este pais tam bien se ha publicado muy recientemente algunas claves
)tre 1940 y 1950 . taxonomicas para Diptera de importancia forense.
primeros trabajos en una de las aplicaciones de la entomologfa En Colombia, el trabajo mas antiguo 10 constituye el libra Meditaciones biologicas sobre la
)motoxicologfa. Esta aplicacion ha permltldo avanzar desde la muerte (1944), en el cual el medico Alonso Restrepo describe sus observaciones entomologicas
del tiempo despues de la muerte, hasta el conoclmlento d~ las en el cementerio de San Pedro de Medelfn.
izando tecnicas como inmunohistoqufmica Y cromatografla, es
.ncias qufmicas 0 toxinas en los tejidos de un insect?. En En 1999, se realizron dos trabajos pioneros sobre Entomologia forense. EI primero, en la
:tos se convierten en fuentes alternas para anal isis toxlcologlcos Universidad del Valle, (Olaya y Carrejo), y el segundo, en la Universidad del Cauca (Idrobo y
as 0 metabolitos relacionados con la muerte. Martinez). En ellos, se colectaron e identificaron los insectos relacionados con el proceso de
descomposicion de cadaveres. EI primero se realizo sobre canido y el segundo en hfgado
!Iogfa forense solo se popularizo a partir de 1980, gracias a Marcel
humano. En este mismo ano, Martfnez , del grupo Insectos de la Muerte de la Universidad del
l Nuorteva (Universfdad de Helsinki, Finlandla) . A partir de ~sta
Cauca, lidero la creacion de la Red Suramericana de Intercambio de Informacion sobre Entomologia
,stigacion basica y aplicada en entomologfa forense en palses
Forense. Tambien, en 1999, el Instituto de Medicina Legal y Ciencias Forenses, realizo en
on, Rusia y Canada. Bogota el primer curso internacional de Entomologfa forense con la participacion del entomologo
~ os Unidos aparece como uno de los pafses que mas ha desarro­
forense aleman Mark Beneck.
Dgia forense como prueba legal.

En el 2000, Restrepo y colaboradores de la Universidad de Antioquia can el apoyo dellnstituto


ia la utilizacion de moleculas como el acido desoxirribonucleico ,
Nacional de Medicina Legal y Ciencias Forenses (Antioquia-Choco), describieron y caracteriza­
C p'o sibilidades y aplicaciones para la entomologia fo:ens~. to~an­ ron la duracion de los estados de descomposicion del cerdo Sus scrofa y las familias de artropo­
ItOS moleculares, se ha avanzado hacia la identlflcaclo,n raplda dos asociadas en dos zonas de vida del Valle de Aburra. En el mismo ano, Uribe y Wolff
~ncontrados en un cadaver 0 en la escena del crimen . ~Sl mlsmo, describieron la entomofauna asociada a la descomposicion del cerdo en un area de la ciudad
enciacion de razas geograficas de una misma es~e.cle y se ha de Medellfn.
lumano en el contenido gastrico de insectos . Esto ultimo permlte
~ pendiente de asociacion entre insectos y victimas , como una

E NTOMOLOGIA FORENSE 13
Facultad de Ciencias

En Cali, Barreto y colaboradores, registraron las primeras especies de importancia forense para
Colombia, en las familias Calliphoridae , Muscidae (Diptera) y Silphidae (Coleoptera) colectadas
de cadaver humano.
Para el 2002, se realizaron los primeros trabajos de extraccion y amplificacion de ADN el male rial en descom OSIC
mitocondrial de dipteros de importancia forense en el laboratorio de Sistematica Molecular de la clalments, on atraidos par
Universidad Nacional de Colombia, sede Medellin. ,..-"i1iillooo.... te. los diferentes t I' olrecen
numera de Ins os.
A partir del 2003, diversos grupos han publicado trabajos significativos de entomologia forense .
En estos trabajos se realiza la descripcion de la fauna asociada a cadaveres de diferentes
zonas del pais , la comparacion de patrones de descomposicion - sucesion de insectos en
diferentes ambientes y los ciclos de vida de algunas especies (Wolff et.a!., 2001, Jimenez
et.al., 2002 ; Ospina 2003 ; Camacho, 2003; Daza - Yussef 2003).
Recientemente, (2004) se publico uno de los pocos trabajos de entomotoxicologia en Colom­
bia, en el cual Wolff y colaboradores de la Universidad de Antioquia, con el entomologo
aleman Mark Benecke, detectaron y cuantificaron Paration en insectos de importancia forense
mediante Cromatograffa Uquida de Alta Presion, HPLC. Los insectos fueron colectados de
conejo en la ciudad de Medellin.
Previamente, en ellnstituto Nacional de Medicina Legal de Bogota se iniciaron los estudios
enfocados hacia la deteccion de sustancias toxicas , como cianuro y barbituricos, en cuer­
pos en avanzado estado de descomposicion.
A la fecha , en Colombia se investiga sobre entomologia forense en diversas instituciones y
centros , como ellnstituto de Medicina Legal y Ciencias Forenses de Bogota, la Universidad
Distrital Francisco Jose de Caldas , ellnstituto de Ciencias de la Universidad de Antioquia, la Aas de importancla rorans pu
Universidad del Cauca, la Universidad del Valle, la Universidad Pedagogica y Tecnologica de enclas en las cual s 10 InsElC1CJS
Colombia de Tunja y la Universidad Nacional de Colombia sedes Medellin y Bogota. :l;oM~jos . stan enfocados h

A pesar de que las condiciones del tropico gene ran una gran diversidad de insectos y del

enorme trabajo taxonomico y ecologico que demanda la entomologia forense, en Colombia

existen investigaciones significativas sobre esta area. Estas investigaciones, constituyen

sin duda, el inicio formal de un area con importantes implicaciones, pero cuyos logros y

aplicaciones vale la pena difundir.

ENTOMOLOGIA FORENS '


14
iores, registraron las primeras especies de importancia forense para
3.lIiphoridae, Muscidae (Diptera) y Silphidae (Coleoptera) colectadas

Inlos primeros trabajos de extraccion y amplificacion de ADN el matenal en descomposlclon como fuent
importancia forense en el laboratorio de Sistematica Molecular de la clalmente. son atraidos por fluidos como or
lombia, sede Medellin. · ·11"-""' te, los dlferenles tejidos ofrecen una sucesion d
numero de msecto .
rupos han publicado trabajos significativos de entomologia forense.
~a la descripcion de la fauna asociada a cadaveres de diferentes
acion de patrones de descomposicion - sucesion de insectos en
; ciclos de vida de algunas especies (Wolff et.a!. , 2001, Jimenez
Camacho, 2003; Daza - Yussef 2003) .
publico uno de los pocos trabajos de entomotoxicologia en Colom­
laboradores de la Universidad de Antioquia , con el entomologo
tecta ron y cuantificaron Paration en insectos de importancia forense
jquida de Alta Presion, HPLC. Los insectos fueron colectados de
!dellin.
to Nacional de Medicina Legal de Bogota se iniciaron los estudios
cion de sustancias toxicas, como cianuro y barbituricos, en cuer­
je descomposicion . clasificaci6n el range mas amplto es e/ d
r __ n descendente. al esquema de clasificaci6n ..agrupa- los org
3e investiga sobre entomologia forense en diversas instituciones y
rr-:a.z..:lI" m, subphyllum. clase orden, familia, enero y especle.
de Medicina Legal y Ciencias Forenses de Bogota , la Universidad
~ Caldas, el Instituto de Ciencias de la Universidad de Antioquia, la 'Ies de tmportancia foranse pueden variar entre palses y un entre h
Universidad del Valle, la Universidad Pedagogica y Tecnologica de ancias en las cuales los msoclo aparecen s relatlvamente const
)niversidad Nacional de Colombia sedes Medellin y Bogota. '~IJMIIflJos, estan enfocados hacla Ie ldenhf rupo d
~iones del tropico generan una gran diversidad de insectos y del

co y ecologico que demanda la entomologia forense , en Colombia

oc dos a cadav r
ignificativas sobre esta area. Estas investigaciones, constituyen
CC()~}IclIS oonodd:lS como nerafagas, d
de un area con importantes implicaciones , pero cuyos logros y

m Import nf ya qu
difundir.

• FORENSE
Sis tematica Molecular

, registraron s pnm r Los artr6podos estan entre los primeros y mas importantes invertebrados que colonizan un cada­
horidae, Muscidae (Dipt ver y que siguen una secuencia de sucesi6n que es posible predecir.

Los insectos utilizan el material en descomposici6n como fuente de alimentaci6n y como lugar
os prlmeros trab 10 d de reproducci6n. Inicialmente, son atraidos por fluidos como orina, saliva, materia fecal y
portancia loren en ella sangre . Posteriormente, los diferentes tejidos ofrecen una sucesi6n de habitat, que favorecen el
bia, sada M lin. desarrollo de un gran numero de insectos.

Para utilizar los insectos en las diferentes aplicaciones de la entomologia forense , es necesa­
rio identificarlos taxon6micamente 10 cual constituye uno de los aspectos que mayor trabajo
requiere . La identificaci6n de las especies encontradas en el sitio de la muerte 0 en el cadaver se
realiza tomando como base las caracterfsticas morfologicas muy especfficas de los insectos.
Estas caracteristicas se encuentran en el adulto 0 en los estados inmaduros de los insectos como
los huevos, las larvas 0 las pupas .

La identificaci6n de los insectos de importancia forense se basa en el sistema de clasificaci6n


biologica. Este sistema se basa en la creaci6n de grupos dentro de grupos con diferentes rangos,
es universal y permite nombrar los organismos e intercambiar informacion entre los investigado­
res de todo el mundo .

En el sistema actual de clasificacion el rango mas amplio es el de reino y el mas pequeno es el


de especie . En orden descendente, el esquema de clasificaci6n que «agrupa » los organismos
vivos es: reino , phyllum, subphyllum , clase , orden , familia, genero yespecie.

Aunque las especies de importancia forense pueden variar entre paises y aun entre habitat, el
patron basico de secuencias en las cuales los insectos aparecen es relativamente constante, y la
mayorfa de los trabajos , estan enfocados hacia la identificacion de grupos de insectos como
indicadores forenses.

La mayorfa de artr6podos y por ende , de insectos asociados a cadaveres en descomposici6n ,


se incluyen en tres categorias ecol6gicas conocidas como necr6fagas , depredadoras y omnivoras.
Las especies necr6fagas son consideradas las mas importantes ya que se alimentan de los
tejidos cadavericos.

Aunque la mayorfa de las especies necr6fagas y depredadoras estan incluidas entre los grupos
de insectos conocidos comunmente como moscas y cucarrones, a continuacion se hace una
breve referencia a los artropodos en general , se menciona su ubicaci6n taxonomica, algunas
caracteristicas morfol6gicas para la identificacion y aspectos de importancia forense .

ENTOMOLOClA FORENSE 17
Facultad de Ciencias

Subphvllul11 Chelicera I
Clasificc1ci6n tal on6nLica descripcilm de 10 artropodo
Clase A rachnid
, ciadllS ,1 c, d,1veres '11 d )Sc )rnpc sici6n .

Phyllum Arthropoda Orden Acari


Conocidos como acaros. De tamano pequeno, menos dl
Los artropodos son un grupo bastante amplio y variado, que comprende aproximadamente el Estos artropodos son inconspicuos y generalmente viaja
80% de las especies animales . Se caracterizan por poseer un cuerpo con simetrfa bilateral y polizones sobre las moscas 0 los cucarrones, que los lIev,
estan recubiertos por una cutfcula rigida de quitina que forma su exoesqueleto. Los movi­ cadaveres en estados tardios del proceso de descomposi,
mientos de los artropodos son posibles gracias a las membranas articulares . La muda
Se alimentan de huevos y pequenas larvas de otros insectc
periodica es una parte fundamental del proceso de metamorfosis por hacer posible el creci­
nos son fauna natural del suelo y pueden ser depred
miento de estos animales , permitiendo que se desprendan de la exuvia (piel dejada por los
fungivoros 0 detritivoros . La mayoria de las especies pue
estados anteriores al mudar) y formen su nueva epidermis con una nueva capa de quitina. Los
colectadas en muestras de suelo, bajo los cadaveres. J
artropodos poseen musculatura estrfada, su sistema nervioso tiene forma de escalera de
acaros se han colectado, en casos de violacion, del are"
cuerdas y casi siempre poseen ojos compuestos.
de la victima , y mediante tecnicas moleculares, se ha det
La sistematica del Phyllum Arthropoda no esta totalmente definida , debido a que es un grupo de do el ADN del atacante presente en las heces fecales Sl
gran tamano y diversidad ; esto hace que cada autor prensente una propuesta propia para su los aca ros.
clasificacion. EI siguiente es uno de los esquemas propuesto por Hickman & Roberts 1994:

Subphylum l.helice-r, t, Orden: Escorpionida


Clase Ml'r(lStol11L1l.1 Conocidos como escorpiones. Son de tamano variable. Su
esta dividido en cefalotorax 0 prosoma y abdomen u opish
Clase Py nph0n1d~l
que consta de cinco segmentos sin apendices y termina
Clase Ari:l hnid(l telson 0 vesfcula (con aguijon y una glandula venenos c
Subphylum l rllslac .1 depredadores oportunistas de otros organismos encontra<
bre un cadaver. Algunos investigadores sugieren que pue<
Clase Rl'111 ip:lel i" mentarse de flu idos 0 tejidos del cadaver mismo.
Clase C£.phillo -,Hida
Clase Br,1I1l"hil)pnda
Clase Me) illupoda
Clase i"vl.lI<1Cll~lr.1CLl
Subphylum L oirLllllid
Orden Aranae
Clase Chilnpll L.1
Clase Di.f1h lPlltic1 Conocidos como aranas. Son de tamano variable . EI cuer~
Clase In..,l'dc dividido en cefalotorax 0 prosoma (cabeza mas torax que pc
patas) y abdomen u opistosoma.Poseen tres 0 cuatro pa
ojos simples ubicados sobre el cefalotorax; son depredadore:
tunistas de larvas y adultos de otros artropodos, ninguna e:
es carronera y su presencia es oportunista.

ENTOMOLOGIA FORENSE
Sistemati ca Molecular

f Subphvllul11 Chelicerata
;xon6mi a y descripd6n de los arb'6p d s Clase Arachn ida
D. a c" dil er's en dl.'scompcsi il n.

Phyllum Arthropoda . Orden Acari


Conocidos como acaros. De tamano pequeno, menos de 1 mm.
Estos artropodos son inconspicuos y generalmente viajan coma
)0. bastante amplia y variada, que camprende aproximadamente el
polizanes sabre las moscas 0 los cucarranes, que los lIevan a las
les. Se caracterizan par paseer un cuerpa can simetria bilateral y
cadaveres en estados tardfos del procesa de descomposicion.
cuticula rfgida de quitina que farma su exaesqueleta. Las mavi­
san pasibles gracias a las membranas articulares. La muda Se alimentan de huevos y pequenas larvas de otros insectos ; algu­
dam ental del pracesa de metamarfasis par hacer paslble el crecl­ nos san fauna natural del suela y pueden ser depredadares,
permitienda que se desprendan de la exuvia (piel dejad~. par las fungivoros 0 detritivoros. La mayarfa de las especies pueden ser
.) y farmen su nueva epidermis can una nueva capa de qUltlna. Las colectadas en muestras de suelo, bajo los cadaveres. Algunos
atura estriada, su sistema nerviasa tiene farma de escalera de acaros se han colectado , en casos de violacion, del area genital
)seen ajas campuestas. de la victima, y mediante tecnicas moleculares, se ha determina­
Arthrapada no. esta tatalmente definida, debida a que es un grupa de do el ADN del atacante presente en las heces fecales secas de
esta hace que cada autar prensente una prapuesta prapla para su los acaros.
lS una de las esquemas propuesta par Hickman & Raberts 1994:

Orden: Escorpionida
'he! icera ta
Conocidos como escorpiones. Son de tamano variable . Su cuerpo
11ero~tt Hl1cl ta esta dividido en cefalotorax 0 prosoma y abdomen u opistosoma,
)vcno~onjda que consta de cinco segmentos sin apendices y term ina en un
\.rachnida telsan 0 vesicula (con aguijon y una glandula venenosa) . San
depredadores apartunistas de otras organismas encontrados sa­
bre un cadaver. Algunos investigadares sugieren que pueden ali­
mentarse de fluidos 0 tejidos del cadaver mismo .

Jniramlcl
Orden Aranae
:hill)plKlll
Conacidas como aranas . Son de tamana variable . EI cuerpo esta
Dipil-,pndi:l
dividida en cefalatorax 0 prosama (cabeza mas torax que parta las
IIbei2tcl pat as) y abdomen u opistosoma.Paseen tres 0 cuatro pares de
ojos simples ubicados sobre el cefalotorax; son depredadores opor­
tunistas de larvas y adultos de otros artropodos, ninguna especie
es carronera y su presencia es oportunista.

ENTOMOLOGlA FORENSE 19
FORENSE
Facultad de Ciencias

SlIbph\'lllll1l ~ nl t,KL'C1

Clase Hexapoda 0 Insecta

Clase Malacostraca
Se caracterizan por poseer tres pares de patas. Los insectc
Orden Isopoda . mas del 85% de los artr6pod0 9 encontrados en un cada
detamano variable; el cuerpo consta de tres partes principah
Tamano por 10 general pequeno. Cuerpo aplanado lateralmente, con za, t6rax y abdomen; la cabeza posee las partes externas d
siete pares de apendices toraxicos , dos pares de antenas y aparato to bucal, las antenas y los ojos simples (ocelos) y compuE
t6rax posee tres pares de patas y casi siempre dos pares de
bucal con mandfbulas masticadoras.
1.Son los primeros en arribar a los restos . Los 6rdenes de
Viven en lugares humedos y sombreados; son asociados con restos mas importantes en entomologfa forense son: Diptera (m
de animales en putrefaccion y pueden ser recolectados, de cadave­ Coleoptera (cucarrones).
res en cualquier estado de descomposici6n.

Subd.1SL'· Apterigote

!:>ubph~ IUIll Unirr,lIni.l


Orden Protura
Ciase hilopoda Son insectos pequenos, con antenas de cuatro segmentos;
de ojos compuestos y poseen ocelos laterales.
EI abdomen es de seis segmentos, las alas estan ausentl
De tamano variable. De cuerpo deprimido, elongado, en forma de seen una estructura para saltar, localizada terminal y ventr
gusano segmentado, antenas largas (14 0 mas segmentos); poseen sobre el abdomen. Estos insectos son habitantes comunes
ocelos, un par de mand fbulas y dos pares de maxilas. se encuentran 10; Aunque son detritivoros sue len encontrarse en material ar
asociados a la fase de esqueletizacion . descomposici6n .

Clase Diplop od a
Orden Diplura
En algunos esquemas de clasificaci6n taxon6mica recient(
Cuerpo elongado, en forma de gusano segmentado, con antenas cor­ que hacen parte de Hexapoda, se tratan como grupo separad
tas (menos de diez segmentos). La mayor parte de los segmentos insectos.
estan fusionados dos ados (diplosomitas), con dos pares de patas
en cada diplosomita . Poseen un par de mandfbulas y un labio infe­ Son diminutos ; no poseen ojos ; las antenas son
rior. Se encuentran general mente en lugares humedos y la mayorfa multiarticuladas con todos los artejos provistos de musculo
de las especies son fit6fagas, aunque pueden haber algunas que se mas de diez segmentos (filiformes). No poseen alas. Se asoci
alimenten de tejido animal en descomposici6n. cipalmente con material vegetal en descomposici6n y suelen
trarse en el suelo, bajo el cadaver.

ENTOMOLOGtA FORENSE
Sistematica :Molecular

Subph, Hum rllsl,lll'<


Clase Hexapoda 0 Insecta

Clase Malacostraca
Se caracterizan por poseer tres pares de patas . Los insectos suman
. mas del 85% de los artr6podos encontrados en un cadaver. Son
Ord en Isopoda detamano variable ; el cuerpo consta de tres partes principales : cabe­
za, t6rax y abdomen ; la cabeza posee las partes externas del apara­
Tamano por 10 general pequeno. Cuerpo aplanado lateralmente , con
to bucal , las antenas y los ojos simples (ocelos) y compuestos . EI
siete pares de apendices toraxicos, dos pares de antenas y aparato t6rax posee tres pares de patas y casi siempre dos pares de alas. Fig
bucal con mandfbulas masticadoras . 1.Son los primeros en arribar a los restos. Los 6rdenes de insectos
mas importantes en entomologfa forense son : Diptera (moscas) y
Viven en lugares humedos y sombreados ; son asociados con restos
Coleoptera (cucarrones) .
de animales en putrefacci6n y pueden ser recolectados, de cadave­
res en cualquier estado de descomposici6n .

Subclas ': Apterigote

ubph 11um Unil'rdllli.l


Orden Protura
Son insectos pequenos, con antenas de cuatro segmentos; carecen
Clase hilopoda de ojos compuestos y poseen oce/os laterales.
EI abdomen es de seis segmentos, las alas estan ausentes y po­
De tamano variable . De cuerpo deprimido, elongado , en forma de seen una estructura para saltar, localizada terminal y ventra/mente
gusano segmentado, antenas largas (140 mas segmentos) ; poseen sobre el abdomen . Estos insectos son habitantes comunes del sue­
ocelos , un par de mandfbulas y dos pares de maxilas. se encuentran 10; Aunque son detritfvoros suelen encontrarse en material animal en
asociados a la fase de esque/etizaci6n . descomposici6n .

Clas ip lopoda Orden Diplura


En algunos esquemas de clasificaci6n taxon6mica recientes , aun­
Cuerpo e/ongado, en forma de gusano segmentado, con antenas cor­ que hacen parte de Hexapoda, se tratan como grupo separado de los
tas (menos de diez segmentos) . La mayor parte de los segmentos insectos .
estan fusionados dos ados (diplosomitas) , con dos pares de patas Son diminutos ; no poseen ojos ; las antenas son /argas
en cad a diplosomita. Poseen un par de mand ibulas y un labio inf~ ­ mu/tiarticu/adas con todos los artejos provistos de musculos y con
rior. Se encuentran genera/mente en lugares humedos y la mayona mas de diez segmentos (filiformes) . No poseen alas. Se asocian prin­
de las especies son fit6fagas , aunque pueden haber algunas que se cipa/mente con material vegetal en descomposici6n y suelen encon­
alimenten de tejido animal en descomposici6n. trarse en el suelo, bajo el cadaver.

\
FORENSE Fo~E
_________[A__ 21
Facultad de Ciencias lIr,l 1 (n"it' tll , I" trll~ turd" (',U,l tl'ristil'as abe.

Orden Thy anura


Son pequenos y su cuerpo es elongado u oval. Las antenas son
largas y filiformes . EI abdomen posee pequenos apendices lIama­
dos estilos y tres filamentos terminales iguales ; no poseen alas . )(

Los tisanuros 0 pececillos de plata son comunes en casas y bode­


...
ctJ
'0
gas. Su asociaci6n a restos en descomposici6n esta relacionada t­
mas frecuentemente COil los ultimos estados de descomposici6n,
cuando los restos se han secado .

til: clast': Pterygota

Orden Blaltndeu
Conocidas como cucarachas.Varfan, en tamano desde pequenas
hasta muy grandes . Poseen un cuerpo de forma oval-elongada,
aplanada . La cabeza esta escondida debajo del pronoto. EI apara­
to bucal es masticador. Poseen ojos compuestos bien desarrolla­
dos; las antenas son largas y filiformes ; poseen dos pares de
alas, el primer par coriaceo (tegminas) , el segundo par
membranosas . Estas ultimas se ecuentran bajo las alas anterio­
res . Las cucarachas tienen una amplia distribuci6n y son
omnivoras. Su asociaci6n con restos en descomposici6n es opor­
tunista. Se alimentan de tejidos en descomposici6n y fluidos; su
actividad como carroneras es principalmente nocturna .
'>o
:E
ctJ
N
Q)
.c
ctJ
U
Orden 0 rmapterJ
!2
a
Tamano pequeno 0 mediano; cuerpo elongado; piezas bucales c:
masticadoras; ojos compuestos presentes, ocelos ausentes; an­ arJ)
QJ
tenas largas de numerosos segmentos. Poseen dos pares de alas, ::liE
el par anterior corto y endurecido y el segundo par son alas
membranosas que se pliegan bajo las anteriores . Los cercos es­
tan modificados en pinzas escierotizadas (tijeras) . Los dermapteros
se alimentan de material vegetal en descomposici6n, pero se
encuentran en grandes cantidades bajo los cadaveres , en espe­
cial en zonas humedas .

ENTOMO LOGiA F ORENSE


22
(/) ~
('U 0

Orden Thy anura < .!Je:- t:


~('U Q)

/
Son pequenos y su cuerpo es elongado u oval. Las antenas son ~j E
0
'0 0 "C
largas y filiformes. EI abdomen posee pequenos apendices Ilama­ m­ .0
~.B «
dos estilos y tres filamentos terminales iguales; no poseen alas. >< <->0
fgo
...
CO
Los tisanuros 0 pececillos de plata son comunes en casas y bode­
gas. Su asociacion a restos en descomposicion esta relacionada
'0
I- ~~
.s:!'5.
mas frecuentemente COl) los ultimos estados de descomposicion, tV=
.r~
cuando los restos se han secado.

SL1bclil~l" Pterygota

Orden Blattodea
Conocidas como cucarachas.Varfan, en tamano desde pequenas
hasta muy grandes. Poseen un cuerpo de forma oval-elongada,
aplanada. La cabeza esta escondida debajo del pronoto. EI apara­
to bucal es masticador. Poseen ojos compuestos bien desarrolla­
dos; las antenas son largas y filiformes; poseen dos pares de
alas, el primer par coriaceo (tegminas), el segundo par
membranosas. Estas ultimas se ecuentran bajo las alas ante rio­
res. Las cucarachas tienen una amplia distribucion y son
omnfvoras. Su asociacion con restos en descomposicion es opor­
tunista. Se alimentan de tejidos en descomposicion y fluidos; su
actividad como carrofieras es principal mente nocturna.

o>
~
CO
N
Q) o
.0 Qi
CO '5
U <->
Orden Dermaptem (/)
w
o
Tamano pequeno 0 mediano; cuerpo elongado; piezas bucales (5
c
masticadoras; ojos compuestos presentes, ocelos ausentes; an­ o
(J)
ten as largas de numerosos segmentos. Poseen dos pares de alas, Q)
:liE
el par anterior corto y endurecido y el segundo par son alas
membranosas que se pliegan bajo las anteriores. Los cercos es­
tan modificados en pinzas esclerotizadas (tijeras). Los dermapteros
se alimentan de material vegetal en descomposicion, pero se
encuentran en grandes cantidades bajo los cadaveres, en espe­
cial en zonas humedas.

, FORENSE
E NTOMOLOG'iA FORENSE 23
Facultad de Ciencias

Familia Histeridae
Son insectos pequefios de forma ovalada , de color negro I
Los elitros son cortos (no tanto como Staphylinidae), exp
Orden Coleoptera los dos Liltimos segmentos abdominales . Los miembros de
Se conocen como cucarrones 0 escarabajos. Poseen un tamafio
milia se encuentran generalmente asociados a los procesos
variable (diminutos 0 grandes) ; el aparato bucal es masticador.
composicion y putrefaccion .
EI tipo de antenas es muy variado.Las alas anteriores son
Tambien son depredadores, ya que se alimentan de larvas
esclerotizadas formando los elitros, que protegen las alas posterio­
de otros insectos. Se esconden bajo el cadaver durante la
res membranosas.
dia y son muy activos en la noche .
Unos pocos son apteros (sin alas). Las larvas son en forma de gusa­
En Suramerica se ha registrado Saprinus aeneus y 5
no, con tres pares de patas. La cabeza es esclerotizada.
patagonicus, asociados a cadaveres .
En un cadaver, los coleopteros tienen una participacion muy activa,

debido a que pueden ser carrofieros (familias Silphidae y Dermestidae)

o depredadores ( familias Histeridae y Carabidae) , dependiendo del


estado de descomposicion .

Familia Silphidae
Las especies mas comunes de este grupo son relativamen t
des y a menudo de colores lIamativos . Ocurren en los cad

tanto de animales como de humanos.

Son de cuerpo blando y algo aplanado . Las antenas son cla\


capitadas. Poseen longitud variable. En el caso del genero

el pronoto es amarilloso, con una mancha negra en el centr<


Los adultos dejan sus huevos sobre el cadaver y se alimentc
Familias de este Orden con Importancia Forense:
del material en descomposicion como de las larvas de otro~
tos.

Familia Dermestidae
Los dermestidos son cucarrones pequefios, en general pilosos 0 cu­
Familia Staphylinidae
biertos con escamas, de cuerpo oval 0 elongado y con antenas
Son insectos delgados y alargados y se reconocen porque po .
cortas y clavadas. Las larvas son general mente de color cafe y estan
elitros muy cortos. Los elitros generalmente no son mucho I
cubiertas por pelos largos .
gos que su ancho combinado, y una considerable porcion do
Son comunes en las fases tardias de la descomposicion ; los esta­
men queda expuesta .
dos inmaduros no ocurren antes de que los restos esten secos .
Estos coleopteros ocurren principal mente en materiales en c
Tanto las larvas como los adultos se alimentan de piel seca, cabellos
posicion , particularmente en el estiercol 0 en carrofia, a la qUE
o cualquier otro tejido seco de origen animal. Para el tropico, es de pocas horas despues de la muerte , y permanecen activos a
gran importancia la especie Oermestes maculatus. del proceso de descomposicion .
Tanto larvas como adultos pueden ser depredadores 0 necr
Hace falta trabajar para la identificacion hasta especie de est"
en Suramerica.

ENTOMOLOGIA FORENSE
Sistematica Molecular

Familia Histeridae
Son insectos pequenos de forma ovalada, de color negro briliante.

Los elitros son cortos (no tanto como Staphylinidae) , exponiendo

)rden Coleoptera los dos ultimos segmentos abdominales. Los miembros de esta fa­

milia se encuentran general mente asociados a los procesos de des­

;e conocen como cucarrones 0 escarabajos . Poseen un tamano

composicion y putrefaccion.

'ariable (diminutos 0 grandes); el aparato bucal es masticador.

Tambien son depredadores, ya que se alimentan de larvas y pupas

:1 tipo de antenas es muy variado.Las alas anteriores son

de otros insectos. Se esconden bajo el cadaver durante la luz del

lsclerotizadas formando los elitros , que protegen las alas posterio­

dfa y son muyactivos en la noche.

es membranosas.

En Suramerica se ha registrado Saprinus aeneus y Saprinus

Jnos pocos son apteros (sin alas) . Las larvas son en forma de gusa­
patagonicus, asociados a cadaveres.

10 , con tres pares de patas. La cabeza es esclerotizada.

::n un cadaver, los coleopteros tienen una participacion muy activa,

jebido a que pueden ser carroneros (familias Silphidae y Dermestidae)

) depredadores (familias Histeridae y Carabidae) , dependiendo del

~stado de descomposicion .

Familia Silphidae
Las especies mas comunes de este grupo son re lativamente gran­
des y a menudo de colores Ilamativos . Ocurren en los cadaveres
tanto de ani males como de humanos . '
Son de cuerpo blando y algo aplanado . Las antenas son clavadas 0
capitadas. Poseen longitud variable . En el caso del genero Silpha,
el pronoto es amarilioso, con una mancha negra en el centro.
Los adultos dejan sus huevos sobre el cadaver y se alimentan tanto
este Orden con Importancia Foren e: del material en descomposicion como de las larvas de otros insec­
tos .

Familia Dermestidae
Familia Staphylinidae
Los dermestidos son cucarrones pequenos, en general pi/osos 0 cu­

biertos con escamas, de cuerpo oval 0 elongado y con antenas


Son insectos delgados y alargados y se reconocen porque poseen los

cortas y clavadas. Las larvas son generalmente de color cafe y estan


elitros muy cortos. Los elitros general mente no son mucho mas lar­

gos que su ancho combinado, y una considerable porcion del abdo­

cubiertas por pelos largos.

Son comunes en las fases tardias de la descomposicion; los esta­


men queda expuesta.

dos inmaduros no ocurren antes de que los restos esten secos .


Estos coleopteros ocurren principalmente en materiales en descom­

Tanto las larvas como los adultos se alimentan de piel seca, cabelios
posicion , particularmente en el estiercol 0 en carrona, a la que arriban

o cualquier otro tejido seco de origen animal. Para el tropico, es de pocas horas despues de la muerte, y permanecen activos a 10 largo

del proceso de descomposicion.

gran importancia la especie Dermestes maculatus.


Tanto larvas como adultos pueden ser depredadores 0 necrofagos .

Hace falta trabajar para la identificacion hasta especie de esta familia

en Suramerica.

E NTOMOLOGIA FORENSE 25
f acultad de Ciencias

Orden Diptera
Constituye uno de los ordenes con mayor numerode dE
Familia Clerid ae Los adultos son de tamano variable . Poseen un solo r;
membranosas y las dos alas posteriores estan tran!
Poseen antenas con once segmentos, filiformes, serriformes, en estructuras Ilamadas halterios.
pectiniformes 0 claviformes . Son alargados, aplanados 0 modera­
damente convexos y pubescentes; son de col ores ilamatlvos. , EI aparato bucal esta diseiiadp para succionar 0 absorbl
Poseen tarsos con 16bulos generalmente en los segmentos 2 y 3 0 Las antenas son cortas, co n fo rma variable, desde filifon
aristadas .Las larvas poseen forma de gusano sin ape
2 Y 4. . . f
Necrobia rufipes ha sido registrado como de Importancla orense es te orden se desprenden dos su b6rdenes : Nem,
para suramerica. Brachycera . Au nque en ambos ocurren familias de irr
forense , las mas significativas pertenecen al suborden Br
En este suborden, los adultos son moscas de tamanc
con antenas de menos de cinco segmentos . Los adultc
ser depredadores y parasitos de otros insectos . Las
Brachycera no tien en cabeza esclerotizada 0 s610 de fl
ci al. La cabeza es retractil. EI adulto emerge de la pupa a
Familia Tenebrionidae una abertu ra en forma de " T " 0 de un casquete cifcula r e
anterior del pupa rio.
Varian desde menos de 2 mm hasta alrededor de 50 mm de longi­

tud . La forma del cuerpo es variable, desde alargada y delgada


Las familias Sarcophagidae y Calliphoridae del suborden B
hasta convexa y muy robusta , 0 extremadamente aplanada .
son las mas utiles en las investigaciones de muerte y sc
minantes en los estados tempranos de la descom
Generalmente son de col ores oscuros, negro 0 cafe . Como caracte­
cadaverica . Las familias Stratiomyidae, Muscidae y Pi
res diagnosticos debe observarse la combinaci6n de su f6rmula tarsal
tienen tam bien gran utilidad forense .
5-5-4 y las antenas filiformes, serriformes 0 agrandadas ~radual­

mente e insertadas bajo bordes laterales, con forma de replsa en la


En el suborden Nematocera se incluyen moscas con
cabeza.
filiformes y mas largas que la cabeza. Entre las familias m;
nes asociadas a los restos estan:
En algunas especies , los ojos estan completamente divididos , pro­

duciendo una porci6n dorsal y otra ventral.


Tip ulidae , Psychodidae , Ce ratopogoni dae, Ch ironl
Strogylium sp. es un genero importante para Colombia y Brasil.
Mycetophilidae y Sciaridae. La mayoria de estas mosca~
lectadas de los cadaveres , cerca de cuerpos de agua 0 en
tes muy humedos .

ENTOMOLOGlA FOREN
26
Si ~ te matica Molecular

Orden Diptera
Constituye uno de los ordenes con mayor numerode de insectos.
Familia Cleridae Los adultos son de tamafio variable. Poseen un solo par de alas
membranosas y las dos alas posteriores estan tran sformadas
Poseen antenas con once segrnentos , filiformes, serriformes, en estructuras Ilamadas halterios.
pectiniformes 0 claviformes. Son alargados , aplanados 0 modera­ EI aparato bucal esta diseii ado para succionar 0 absorber flu idos.
damente convexos Y pubescentes; son de colores lIamatlvos. . Las antenas son cortas, con forma variable, desde filiformes hasta
Pose en tarsos con lobulos general mente en los segmentos 2 y 3 0 aristadas .Las larvas poseen forma de gusano sin apendices .De
2 Y 4. . . f este orden se despren den dos subo rden es: Ne mat ocera y
Necrobia rufipes ha side registrado como de Importancla orense Brachycera. Aunque en ambos ocurren fam ilias de importancia
para suramerica. forense, las mas significativas pertenecen al suborden Brachycera.
En este suborden, los adultos son moscas de tamafio variable,
con antenas de menos de cinco segmentos. Los adultos pueden
ser depredadores y parasitos de otros insectos. Las larvas de
Brachycera no tienen cabeza esclerotizada 0 solo de forma par­
cial. La cabeza es retractil. EI adulto emerge de la pupa a traves de
una abertura en forma de " T " 0 de un casquete circular en la parte
Fam ilia Tenebrionidae anterior del pupario .
Varian desde menos de 2 mm hasta alrededor de 50 mm de longi­ Las familias Sarcophagidae y Calliphoridae del suborden Brachycera
tud. La forma del cuerpo es variable , desde alargada y delgada son las mas utiles en las investigaciones de muerte y son predo­
hasta convexa Y muy robusta , 0 extremadamente aplanada. minantes en los estados temprano s de la desc omposic ion
Generalmente son de colores oscuros, negro 0 cafe . Como caracte­ cadaverica. Las familias Stratiomyidae, Muscidae y Piophilidae
res diagnosticos debe observarse la combinacion de su formula tarsal tienen tam bien gran utilidad forense .
5-5-4 y las antenas filiformes , serriformes 0 agrandadas gradual­ En el suborden Nematocera se incluyen moscas con antenas
mente e insertadas bajo bordes laterales, con forma de repisa en la
filiformes y mas largas que la cabeza. Entre las fami lias mas comu ­
cabeza .
nes asociadas a los restos estan :
En algunas especies , los ojos estan completamente divididos , pro­
Tipulidae , Psychodidae , C erato pogonidae , Ch irono midae,
duciendo una porcion dorsal y otra ventral.
Mycetophilidae y Sciaridae . La mayoria de estas moscas son co­
Strogylium sp. es un genero importante para Colombia y Brasil.
lectadas de los cadaveres , cerca de cuerpos de agua 0 en ambien ­
tes muy humedos.
Facultad de Cicn ias

Familia Sepsidae

Familia Stratiomyidae Son las lIamadas moscas carroneras negras. Son pel
color negro brillante, a veces con matices rojos; su
Los adultos tienen el abdomen plano y poseen areas de colores dife­ esferica y su abdomen reducido en la base.
rentes 0 transpa rentes en algunos urotergitos. Su tamano es varia­
ble. Los adultos esta.n presentes en los cadaveres, alimentandose Muchas especies tienen una mancha oscura a 10 largo (
de los flufdos durante la etapa te mprana del proceso de descompo­ costal del ala.
sici6n . Las larvas se alimentan durante la etapa media y tardf.a. Las larvas viven en los excrementos y en varios tipos .
en descomposici6n, los adultos se encuentran en ma
del material del cual se alimentan las larvas.
Las larvas de esta familia han sido colectadas aliment;
cadaveres humanos durante la fermentacion caseica y ,
fermentacion amoniacal.
Se conoce relativamente poco sobre la biologfa de los
neotropicales de esta familia y las descripciones de SL
Familia Phoridae inmaduros.
Son de tamano diminuto 0 mediano, de color negro, cafe 0 amarilloso
y de apariencia jorobada . Familia Piophilidae
Poseen una ve naci6n alar simple muy caracterfstica . EI femur tra­ Son moscas de color negro brillante, de menos de E
sero es aplanado lateralmente . Se alimentan de una gran variedad longitud. Las larvas son carroneras y se encuentran a rr
de material organico en descomposici6n . Algunas se pueden des a­ cadaveres que han sido abandonados por algun tiempc
rrollar en hongos y otras pueden ser parasitos . En el estadlo larval
Son caracterfsticas de la fase de descomposicion caseic;
algunas especies son depredadoras. Megacelia scalaris es una de
es la especie mas frecuentemente asociada a cadaVerE
las especies de importancia forense para suramerica. composicion en suramerica .

Familia Sarcophagidae
Son moscas de color negro, con Ifneas toraxicas grise!
men ajedrezado. Las antenas poseen las aristas plumo~
Familia Muscidae la mitad.
Conocid as como moscas comunes. Pueden ser sapr6fagas 0 Las hembras no depositan huevos sino larvas vivas, de
depredadoras. Pueden encontrarse en carrona de vertebrados. AI en el cadaver en areas cercanas a las aberturas natu
revisar los trabajos de Argentina, Peru , Brasil y Colombia, aparecen cuerpo, ojos, nariz, boca, ofdos, ana y genitales. Las larv,
como de importancia forense la Musca domestica y Ophf(a forma cilfndro conica, con su parte anterior agudizada y
chalcogaster, entre otras. mo posterior truncado. Cuando lIegan a la madurez, aban
cadaver y se transforman en pupas, por 10 cual es n
buscarlas alrededor del cadaver por 10 menos hasta 10
Junto con la familia Calliphoridae son las primeras en lie
restos y aunque sus larvas se alimentan de la carrona,
son depredadoras, especial mente de larvas de califoridos .
tropico se ha registrado como de importancia forense San
(Iiopygia) ruficornis, y Patonella intermutans.
Sistematica Molecular

Familia Sepsidae

Familia Stratiomyidae Son las Ilamadas moscas carraneras negras. Son pequenas, de
color negro brillante, a veces con matices rojas; su cabeza es
Los adultos tienen el abdomen plano y poseen areas de colores dife­ esferica y su abdomen reducido en la base.
rentes 0 transparentes en algunos urotergitos . Su tamano e~ varia­
ble. Los adultos estan presentes en los cadaveres, allmentandose Muchas especies tienen una mancha oscura a 10 largo del margen
de los fl ufdos durante la etapa temprana del proceso de descompo­ costal del ala.
siciOn. Las larvas se alimentan durante la etapa media y tardfp.. Las larvas viven en los excrementos yen varios tipos de materia
en descomposicion , los adultos se encuentran en masas , cerca
del material del cual se alimentan las larvas.
Las larvas de esta familia han sido colectadas alimentandose de
cadaveres humanos durante la fermentacion caseica y antes de la
fermentaci6n amoniacal.
Se conoce relativamente poco sobre la biologia de los miembros
neotropicales de esta familia y las descripciones de sus estados
Familia Phoridae inmaduros.
Son de tamano diminuto 0 mediano, de color negro, cafe 0 amarilloso
Familia Piophilidae
y de ap ariencia jorobada.
Poseen una venaci6n alar simple muy caracteristica . EI femur tra­ Son moscas de color negro brillante, de men os de 5.0 mm de
sera es aplanado lateral mente. Se alimentan de una gran variedad longitud. Las larvas son carroneras y se encuentran a menudo en
de material organico en descomposicion . Algunas se pueden desa­ cadaveres que han side abandonados por algun tiempo.
rro llar en hongos y otras pueden ser parasitos. En el estadlo larval Son caracterfsticas de la fase de descomposici6n caseica. P casei
algunas especies son depredadoras. Megacelia scalaris es una de es la especie mas frecuentemente asociada a cad ave res en des­
las especies de importancia forense para suramerica. composici6n en suramerica.

Familia Sarcophagidae
Son moscas de color negro, con lineas toraxicas grises y abdo­
men ajedrezado. Las antenas poseen las aristas plumosas hasta
Familia Muscidae la mitad.

Conocidas como moscas comunes. Pueden ser sapr6fagas 0 Las hembras no depositan huevos sino larvas vivas, dejandolas
depredadoras. Pueden encontrarse en carrona de vertebrados AI en el cadaver en areas cercanas a las aberturas naturales del
revisar los trabajos de Argentina, Peru , Brasil y Colombia , aparecen cuerpo, ojos, nariz, boca, oidos, ana y genitales. Las larvas tienen
co mo de importancia fo rense la Musca domestica Y Ophlra forma cilindro c6nica, con su parte anterior agudizada y el extre­
chalcogaster. entre otras . mo posterior truncado. Cuando lIegan a la madurez, abandonan el
cadaver y se transforman en pupas, por 10 cual es necesario
buscarlas alrededor del cadaver por 10 menos hasta los 6.0 m .
Junto con la familia Calliphoridae son las primeras en lIegar a los
restos y aunque sus larvas se alimentan de la carrona , tambien
son depredadoras, especialmente de larvas de calif6ridos. Para el
tr6pico se ha registrado como de importancia forense Sarcophaga
(/iopygia) ruficornis, y Patonella intermutans.

ENTOMOLOGfA FORENSE 29
Facultad de Ciencias

Fami lia Calliphoridae lnse to. co le -tado en c 'rdo C( In) modeln animal par" est
I

de 12< dd \'eres) fauna llsonada en MI


Son moscas ubicuas . Poseen el tamano de una mosca casera 0 un
La~ tntLlgr<lfias l'slan nrd 'nadas cn OJ
poco mas grandes. Son de color azul 0 verde metalico con tonalida­

des cobrizas. Las antenas poseen las aristas plumosas hasta el api­
ce.

Las larvas de algunas especies, como Phaenicia sericata y Phormia

regina criadas en condiciones asepticas pueden usarse en el trata­

miento de ostiomielitis; Chrysomyinae es la subfamilia de mayor im­

portancia forense .

La mayorfa de los calif6ridos son carroneros. Las hembras depositan

masas de huevos (entre 50 y 200) sobre los restos de animales y las

larvas se alimentan de los tejidos en descomposici6n.

AI igual que la familia Sarcophagidae las larvas tienen forma cilindro ­


conica, con su parte anterior agudizada y el extremo posterior trunca­

do.

Calliphora sp. Chrysomya a/biceps, Chrysomya megacepha/a ,


Chrysomya putoria, C.ch/oropyga, Luci/ia eximia, Phaenicia sericata,
Cochliomya macel/aria , Hemi/ucilia segmentaria, Hemi/uci/ia
semidiaphana son la mas frecuentes en suramerica.

Orden Hym.enoptera
Los adultos, conocidos comunmente como abejas, hormigas y avis­
pas , pueden ser diminutos 0 grandes.
La mayorfa poseen dos pares de alas membranosas, pero estan
ausentes en algunas formas. Las partes bucales son variables ,
masticadoras 0 succionadoras. Las antenas son filiformes 0
geniculadas . Los ojos compuestos son bien desarrollados.
EI primer segmento abdominal esta fusionado al metatorax, cons­
trenido posteriormente para formar una cintura entre el t6rax y el
abdomen . Las hembras presentan un ovopositor 0 un aguijon para
pertorar los tejidos tanto ani males como de plantas. Las larvas son en
forma de gusano.
Las relaciones de este grupo con los cadaveres en descomposicion
varian desde la alimentacion directa de los fluidos, hasta el parasitis­
mo y la depredaci6n de otros insectos.
Las hormigas, como depredadoras, pueden ser un factor significativo
en el proceso de descomposicion y pueden retardarlo por depredar la
poblaci6n de larvas de otros insectos presentes en el cadaver.Las
abejas y las avispas se alimentan directamente de los fluidos ricos en
minerales y de los tejidos en solucion. Tambien pueden parasitar las
larvas y los adultos tanto de moscas como de cucarrones y otros
artropodos.

Insectos de los 6rdenes Lepidoptera y Hemiptera son tam bien aso­


ciados frecuentemente a cadaveres en descomposicion . En el primer
orden , los adultos son atraidos por los flufdos , yen el segundo , su
papel es baslcamente de depredacion.

ENTOMOLOGIA F ORENSE
30
Sistematica Molecular

Int.\:' tus, colL'clado en ' 'rdll como m ) ~ -I . I .


amilia Calliphoridae , lit' \l anlmcl relra t.':-'[lIdws obre - [,ldo de d
ompo!>icilin
d • ~atla\ Qr~ ... )' launa iN) 'id lal' ll \!!tot! 'Jiin (Ant. ol).
)n moscas ubicuas. Poseen el tamano de una mosca casera 0 un I a totogralJa s estilJl orJl n,]d.l en <lrd 11 de apanCloll.
)co mas grandes. Son de color azul 0 verde metalico con tonalida­
3S cobrizas . Las antenas poseen las aristas plumosas hasta el api­

as larvas de algunas especies, como Phaenicia sericata y Phormia


19ina criadas en condiciones asepticas pueden usarse en el trata­
liento de ostiomielitis; Chrysomyinae es la subfamilia de mayor im­
ortancia forense.
a mayorfa de los calif6ridos son carroneros. Las hembras depositan
lasas de huevos (entre 50 y 200) sobre los restos de animales y las
lrvas se alimentan de los tejidos en descomposici6n.
II igual que la familia Sarcophagidae las larvas tienen forma cilindro ­
6nica, con su parte anterior agudizada y el extremo posterior trunca­
10.
-:;alliphora sp . Chrysomya albiceps, Chrysomya megacephala,
-;hrysomya putoria, C.chloropyga, Lucilia eximia, Phaenicia sericata,
~ochliomya macel/aria, Hemilucilia segmentaria ,Hemilucilia
:;emidiaphana son la mas frecuentes en suramerica.

Orden Hymenoptera
-os adultos, conocidos comunmente como abejas, hormigas y avis­
;:>as, pueden ser diminutos 0 grandes .
La mayorfa poseen dos pares de alas membranosas, pero estan
ausentes en algunas formas.Las partes bucales son variables ,
masticadoras 0 succionadoras. Las antenas son filiformes 0
geniculadas. Los ojos compuestos son bien desarrollados.
EI primer segmento abdominal esta fusionado al metat6rax, cons­
trenido posteriormente para formar una cintura entre el t6rax y el
abdomen . Las hembras presentan un ovopositor 0 un aguij6n para
perforar los tejidos tanto animales como de plantas. Las larvas son en
forma de gusano.
Las relaciones de este grupo con los cadaveres en descomposici6n
varian desde la alimentaci6n directa de los fluidos, hasta el parasitis­
;mo y la depredaci6n de otros insectos.
Las hormigas, como depredadoras, pueden ser un factor significativ~
en el proceso de descomposici6n y pueden retardarlo por depredar la
poblaci6n de larvas de otros insectos presentes en el cadaver.Las
. abejas y las avispas se alimentan directamente de los fluidos ricos en
,minerales y de los tejidos en soluci6n . Tambien pueden parasitar las
: larvas y los adultos tanto de moscas como de cucarrones y otros
•artr6podos.
I
Insectos de los 6rdenes Lepidoptera y Hemiptera son tambien aso­
ciados frecuentemente a cadaveres en descomposici6n. En el primer
orden , los adultos son atraidos por los fluidos, yen el segundo , su
papel es basicamente de depredacion .

FORENSE ENTOMOLOGiA FORENSE


-----~=- 31
Facultad de Ciencias

ENTOMOLOGiA FORENSE
32
Sistematica Molecular

ENTOMOLOGlA FORENSE 33

~:tola1111S cuniculus lamb n sa ha en


9S un animal pequeno, de f
jo S8 ha usado m en inves11gatlia

ENroMOLOGIA F OR SE
34
foren e, al estudlo
n'Tr'!h'\nJ ';' del cuerpo y
compoSIClon as de g

·~~\r.iadas a un cadaver coma camUnt d.


combinar aspectos de desarrollo, campor
JlIifIIIjllftlJ,)t'

rmaci6n /0 mas cartera posible .

¥'..,.~~ :e~ii ~~ es en madelos animaJes aparecen coma una metoda/agra que f cllits no
asoCJaclon de insectos en stado particuleres de descom 6n
estados mmaduros y el estab/ecimiento de los Clclos de da n co
ctos como la reallzacion de curvas de crecimiento. la eshmaci6n
cion, la incidencia de estados inmaduros en diferen es areas del ""'-'UK]
clan acumuladas de temperatura de las masas d larvas
a de aphcaciones como al IPM y Ie entomotoxlcologlB.

ISfH~M:.nsocjados a los difarantes astados de descomposlclon, as nec~Slllrto


bei~lsd!l~f nto de vista biologico, la muert no un evento sino un p
,a n ,-,-, tt>.'ftLlo..!:(_cl ml nza una n de f n6menos de tura/eza quimlC8 y blac!tel'ilima
p e ooi6n ,En est proceso I Insectos parecen rlttll~lJnerne
Facultad de Ciencias
traves del proceso forman junto con otros facto res un entorno atractivo para una serie de «operado­

res» que van apareciendo en forma sucesiva dependiendo del tipo de producto que se este forman­
AI r~(11izar csludios J . dlS '(lmplISiLi(ln en tnlKldus iH
do en el momento.

ten r en ClIl'lltn la~ ~igllicnte" Lon iUt'radtJnL's:


Los primeros «operadares» aparecen atraidos por las emanaciones de la fermentacion butfrica de

los acidos grasos que dan origen a la adipocira 0 grasa de cadaver; los siguientes son atraidos por

la fermentacion caseica, producida por la descomposicion de sustancias albuminoideas ; posterior­

mente, aparecen los atraidos por la fermentacion amoniacal que licua los tejidos blandos y par
• Los pesos de los cerdos utilizados en estudios forenses rea
ultimo, aparecen aquellos atraidos por los restos de la humedad cadaverica.
generalmente entre 10 Y 20 Kg .
EI proceso de putrefaccion de un cadaver como tal se ha dividido en varias etapas . Estas etapas

son: el estado en fresco 0 de autolisis, el enfisematoso 0 cromatico, el de reduccion muscular 0


• Es muy importanle realizar un registro fotografico de las es~
colicuativa, el de post-reduccion muscular, y el de reduccion esqueletica, esqueletizacion 0 de
dos de descomposici6n .
restos secos. (Fig 2.a-e).

• En los estudios con modelos animales debe registrarse los


Con las diferentes condiciones ambientales , y aun con el peso del cerdo, se ha encontrado que el
para estimar las tasas de remoci6n de biomasa en cada eta
tiempo de las fases de descomposicion varia, pera la estructura comunitaria de la artopodofauna

cadaverica es mas 0 menos constante.


• La .mayorfa de tecnicas de colecta y anal isis de artropodc
utlilzan en Sur America, son cualitativas 0 seimcualitativas' E
Cada estadio de la putrefacci6n de un cadaver atrae selectivamente una 0 varias especies determi­
o ausencia de artropodos. 1\10 obstante, es necesario reali~a
nadas. EI papel de las especies es variable y no todas participan activamente en la reducci6n de los
que considere los cambios de descomposicion fisico-qufm
restos.
pero que a la vez permita evaluar la diversidad ecologica a r
nidades.
En la tabla 1 se mencionan las familias de artropodos mas frecuentes en el neotropico en relaci6n

con la descomposicion de un cadaver y las diferentes etapas .


Es necesario calcular indices de diversidad relativa, equitabi
Asi mismo, coeficientes de correlacion entre las colectas SE
En general, las especies asociadas a cadaveres pertenecen a una de las siguientes categorfas:
cionar las especies necr6fagas y depredadoras, determinar
las eva/uaciones y su frecuencia, las especies ausentes y las
Especie necrOfagas: una de las evaluaciones.
Son las que se alimentan directamente del cuerpo . Incluye insectos del orden Diptera (familias
Calliphoridae y Sarcophagidae) y coleopteros (familias Silphidae y Dermestidae) . • Debe repetirse el muestreo para cada estado de descomposi
trada sabre el suelo, en el cuerpo, debajo del cuerpo, alredE
Especi s dcpredadoras y parasitas de necrOfago : trampas colocadas para tal fin .
Este es el segundo grupo mas significativo del cadaver. Incluye insectos del orden Coleoptera
(familias Silphidae, Staphylinidae e Histeridae), Diptera (familias Calliphoridae y Stratiomyidae) e • Para Colombia la variacion en el periodo de descomposicio
Hymenoptera parasitos de las larvas y pupas de dipteros. estudios realizados entre 106 Y 184 dias.
No obstante, en Colombia, hace falta estudios mas detallados
Especies omnivoras: posicion en diferentes areas y condiciones climaticas .
Se incluyen aqui grupos como las avispas, hormigas y otros coleopteros que se alimentan tanto
del cuerpo como de los artropodos asociados.
• Aunque la sucesion es predecible, es importante comparar I
dlferentes grados de sinantropia: eusinantr6pico (urbano) ,
Especie accidentale: asinantropico (semirural) . Tambien es necesario precisar las
especies presentes
Aqui se incluyen las especies que utilizan el cuerpo como una extension de su habitat normal, par
ejemplo colembolos, aranas, ciempies yacaros.
No todos los cadaveres se encuentran en tierra y es frecuente encontrar algunos sumergidos en
agua dulce 0 salada. La fauna cadaverica asociada a ecosistemas acuaticos no es tan conocida
como la terrestre. En Colombia, no se ha realizado estudios sobre sucesion en cuerpos sumergi­
dos.

ENTOMOLOGfA FORENSE
Sistematica Molecular

En entomologia forense , el estudio de las condiciones ffsicas del cuerpo y la fauna asociada al
proceso de descomposicion es de gran importancia.

Para conocer la fauna , los patrones de sucesion y su variacion con respecto a condiciones particu­
lares geograficas, climaticas e incluso diarias, se han utilizado modelos ani males en descomposi­
cion, de los cuales el mas comun es el cerdo blanco, Sus scrota, este modelo comparte algunos
caracteres fisiologicos con los humanos, como el hecho de ser omnivoro, tener fauna y flora
intestinal semejante, poseer poco pelo y piel similar. La carne de cerdo es barata y su utilizacion
para estudios forenses tiene menos restricciones que un cadaver humano.

EI conejo domestico Oryctolagus cuniculus tambien se ha empleado en estudios de sucesion de


fauna cadaverica, debido a que es un animal pequeno, de facil manipulacion con un proceso de
descomposicion rapido. EI conejo se ha usado mas en investigaciones entomotoxicologicas.

Basandose en modelos animales, se ha caracterizado la dinamica de los procesos de descompo­


sicion de los cadaveres que deben ser considerados como sistemas que albergan y soportan una
comunidad de artropodos .

studiar los insectos asociados a un cadaver como comunidad , es relevante si se considera, que la
entomologia forense debe combinar aspectos de desarrollo, comportamiento y ecologia de insec­
tos para suministrar informacion 10 mas certera posible.

Los estudios sucesionales en modelos ani males aparecen como una metodologia que facilita no
solo el conocimiento y la asociacion de insectos en estados particulares de descomposicion, sino
tambien la recoleccion de estados inmaduros y el establecimiento de los cic/os de vida en condicio­
nes de laboratorio . Aspectos como la realizacion de curvas de crecimiento , la estimacion de tasas
de probabilidad de aparicion , la incidencia de estados inmaduros en diferentes areas del cuerpo y
los calculos sobre las variaciones acumuladas de temperatura de las masas de larvas, constituyen
la base para el desarrollo de aplicaciones como ellPM y la entomotoxicologia.

AI estudiar los insectos asociados a los diferentes estados de descomposicion , es necesario con­
siderar que, desde el punto de vista biologico, la muerte no es un even to sino un proceso. Cuando
sobreviene la muerte, comienza una serie de fenomenos de naturaleza quimica y bacteriana que se
conocen con el nombre de putrefaccion .En este proceso los insectos aparecen rapidamente.

La descomposicion de los tejidos y la materia organica se da con mayor 0 men or velocidad, depen­

diendo de facto res internos como la microbiota y el estado de nutricion del cuerpo 0 externos, como

la temperatura ambiental y la humedad .

La temperatura, la humedad, la aridez , la lIuvia, el pH , los traumas en el cuerpo, la profundidad a la

que se encuentra el cadaver, la proporcion del cuerpo enterrada y el tipo de superficie donde se

encuentra,son aspectos importantes que pueden afectar la descomposicion y los facto res de suce­

sian.

Oespues de la muerte, las bacterias y los hongos que viven normalmente en el cuerpo, se multipli­
can activamente y se difunden por las vias linfaticas y sangufneas . Inicialmente, mientras existe
oxigeno, proliferan los microbios aerobios .Cuando el oxigeno se consume , aparecen los
microorganismos anaerobios cuya accion es descomponer las sustancias albuminoideas, trans­
formandolas en sustancias mas sencilla, 10 cual conlleva a la produccion de gases . Asi ocurre una
serie de fermentaciones que hacen parte del proceso de putrefaccion . Los productos que surgen a

ENTOMOLOGiA FORENSE 37
Sistematica Mole cular

Ito con otros facto res un entorno atractivo para una serie de «operado­
forma sucesiva dependiendo del tipo de producto que se este forman­ A I rC(llizar l'studlO'" Jt' dl'scuml nsi ·j(m 'n mil It'hls .Hlim.lk·s l'S import.mll'

tener en cuentn las !">iguicnlc. . considl'racilllll'S:

parecen atraidos por las emanaciones de la fermentaci6n bu!irica de


gen a la adipocira 0 grasa de cadaver; los siguientes son atraldos por
lucida por la descomposici6n de sustancias albumlnoldeas; posterIor­ • Los pesos de los cerdos utliizados en estudios forenses realizados en suramerica, varian
s por la fermentaci6n amoniacal qU,e licu~ los tejidos blandos y por generalmente entre 10 Y 20 Kg .
aidos por los restos de la humedad cadaverlca.
je un cadaver como tal se ha dividido en varias etapas. Estas etapas • Es muy importante realizar un registro fotografico de las especies enc;ontradas y los esta­
=> aut61isis el enfisematoso 0 cromatico, el de reducci6n muscular 0
dos de descomposicion.
~i6n mus~ular, y el de reducci6n esqueletica, esqueletizaci6n 0 de
• En los estudios con modelos animales debe registrarse los cambios de peso del animal ,
para estimar las tasas de remoci6n de biomasa en cada etapa .
~s ambientales, y aun con el peso del cerdo, se ha encontrado que el
)mposici6n varia, pero la estructura comunitaria de la artopodofauna • La mayorfa de tecnicas de colecta y analisis de artropodos asociados a cerdo que se
constante . utilizan en Sur America, son cualitativas 0 seimcualitativas; es decir, describen presencia
o ausencia de artropodos. No obstante, es necesario realizar un analisis cuantitativo total
6n de un cadaver atrae selectivamente una 0 varias especies determi­ que considere los cambios de descomposici6n fisico-quimicos ocurridos en el cadaver
es es variable y no todas participan activamente en la reducci6n de los pero que a la vez permita evaluar la diversidad ecol6gica a nivel de especie en las comu- ,
nidades.

3.S familias de artropodos mas frecuentes en el neotropico en relacion Es necesario calcular indices de diversidad relativa, equitabliidad y dominancia.

1 cadaver y las diferentes eta pas. Asi mismo, coeficientes de correlacion entre las colectas semanales, que permitan rela­

cionar las especies necr6fagas y depredadoras, determinar las especies comunes entre

)ciadas a cadaveres pertenecen a una de las siguientes categorfas: las evaluaciones y su frecuencia, las especies ausentes y las especies presentes en solo

una de las evaluaciones.

jirectamente del cuerpo. Incluye insectos del orden Diptera (familias • Debe repetirse el muestreo para cad a estado de descomposicion e incluir la fauna encon­
dae) y coleopteros (familias Silphidae y Dermestidae). trada sobre el suelo, en el cuerpo , debajo del cuerpo, alrededor, volando cerca y en las
y parasitas de n crOfago : trampas colocadas para tal fin.

mas significativo del cadaver. Incluye insectos del orden Coleoptera • Para Colombia la variacion en el periodo de descomposicion del cerdo varia segun los
linidae e Histeridae), Diptera (familias Calliphoridae y StratlomYldae) e estudios realizados entre 106 Y 184 dias .
las larvas y pupas de dipteros. No obstante, en Colombia, hace falta estudios mas detail ados sobre patrones de descom­
posicion en diferentes areas y condiciones climaticas.

omo las avispas, hormigas y otros coleopteros que se alimentan tanto • Aunque la sucesion es predecible, es importante comparar la actividad y la sucesi6n en
ropodos asociados. diferentes grados de sinantropia : eusinantr6pico (urbano), hemisinantropico (rural) y
aSinantropico (semirural) . Tambien es necesario precisar las variaciones diarias para las
especies presentes
les que utilizan el cuerpo como una extension de su habitat normal , por
as , ciempies y acaros.
: encuentran en tierra y es frecuente encontrar algunos sumergidos en
~ na cadaverica asociada a ecosistemas acuati~os no es tan conocida
h"lbia, no se ha realizado estudlos sobre suceslon en cuerpos sumergl-

E NTOMOLOGiA FORENSE 39
Facultad de Ciencias

G NERALIDADES ~OBR L S ·5T AD S DE DE OMPOSICI IN

Estado en fresco.

Comienza desde el momento del fallecimiento hasta que se hace notable la distension abdominal.
No hay presencia de olores asociados al cadaver. La temperatura interna desciende drasticamente
(algor mortis), enfriando el cuerpo. Los insectos dejan sus huevos sobre los orificios naturales, en
las heridas producidas por el arma y en los sitios donde hay acumulacion de liquidos corporales
entre el suelo y el cadaver.

Estado Enfisematoso.

Los cadaveres presentan distension abdominal producida por la acumulacion de gases.


Estados de descomposici6n, autor, cludad y duraci6n
Como resultado de la respiracion anaerobia de las bacterias en el interior del cuerpo, hay timpanismo

abdominal y, reticulado venoso por efecto de la acumulacion de los gases. EI ana se extruye y se
Camacho
Uribe ,
percibe un fuerte olor a putrefaccion.
Ti mperatura Bogota
La temperatura interna aumenta por efecto de las reacciones de rompimiento qufmico que se

Medellin 24°
gene ran al interior del cuerpo, como la descomposicion de los acidos grasos mediante la fermen­
resco 2
tacion butirica. Se producen olores que atraen especificamente las fam ilias de dipteros Calliphoridae,

Sarcophagidae y Sepsidae.

Inchado 13 5
Reducci6n muscular.
D. actlva 5 6
Los cadaveres presentan lesiones diferentes a las producidas por el arma ofensora, como por
ejemplo el rompimiento de la piel ocasionado por la alimentacion de las larvas. Se observa una D.avanzada 41 48
apariencia desinflada y la licuefaccion de los tejidos es muy notoria. La fermentacion butfrica
favorecida por una alta humedad relativa y una temperatura ambiental moderada, produce la Restos secas 123 160
adipocira que a su vez , da paso a la fermentacion caseica . Los tejidos adquieren una apariencia
cremosa de color pardo negruzco. Duraci6n total 184 2 10
Estado de "Post reducci6n muscular:'

La fermentacion caseica , cede el paso a la fermentacion amoniacal, estado en la cual el cadaver


presenta fuertes olores . AI final d8 este estado la mayoria de los tejidos blandos han desapareci­
do gracias a la accion de los coleopteros y la reduccion en la poblacion de larvas de dipteros es
muy notoria, debido a que migran fuera del cuerpo para em pupar.

Estado de esqueletizaci6n:

Queda muy poco de 10 que fue el cuerpo , se observan los huesos limpios a excepcion de un poco
de cartilago y remanentes de piel. No hay olor asociado a los restos y es co mun encontrar
durante este estado coleopteros de la familia Dermestidae y gran cantidad de acaros.
AI comparar los trabajos de sucesion realizados y publicados en Colombia en diferentes ciuda­
des, se presentan las siguientes variaciones en el numero de dias:

40 E OMOLOCIA FOREiNSE
Sistema tica Molecular

SOBRE L 5 EST AD DE DESCOMPOST ION

lei fallecimiento hasta que se hace notable la distensi6n abdominal.


)ciados al cadaver. La temperatura interna desciende drasticamente
rpo. Los insectos dejan sus huevos sobre los orificios naturales, en
Irma y en los sitios donde hay acumulaci6n de liquidos corporales

ensi6n abdominal producida por la acumulaci6n de gases. Estados de descomposicion , autor, cludad y duracion en dias de cad a estado
In anaerobia de las bacterias en el interior del cuerpo, hay timpanismo
o por efecto de la acumulaci6n de los gases. EI ana se extruye y se Camacho Uribe
:lcci6n. Temperatura Restrepo
Bogota Medellin 24 0
3nta por efecto de las reacciones de rompimiento quimico que se Girardota(Anioquia)'
como la descomposici6n de los acidos grasos medi ante la fermen­ Fresco 2 1
xes que atraen especificamente las familias de dipteros Calliphoridae, 1
Hlnchado 13 5 3
D. actlva 5 6 2
;iones diferentes a las producidas por el arma ofensora, como por
. piel ocasionado por la alimentaci6n de las larvas. Se observa una D. avanzada 41 48 2
:uefacci6n de los tejidos es muy notoria. La fermentaci6n butirica
edad relativa y una temperatura ambiental moderada, produce la Restos secos 123 160 97
::ISO a la fermentaci6n caseica. Los tejidos adquieren una apariencia
uzco. Duraci6n total 184 210 106
I muscular."

~ e el paso a la fermentaci6n amoniacal , estado en la cual el cadaver


nal de este estado la mayoria de los tejidos blandos han desapareci­
cole6pteros y la reducci6n en la poblaci6n de larvas de dipteros es
jgran fuera del cuerpo para empupar.

~
e
el cuerpo, se observan los huesos limpios a excepci6n de un poco
e pie!. No hay olor asociado a los restos y es comun encontrar
ros de la familia Dermestidae y gran cantidad de acaros.
! sucesi6n realizados y publicados en Colombia en diferentes ciuda­

ntes variaciones en el numero de dias:

FORENSE
i"acultad de Cic nc ias

..
b. Estado Enfisematoso ,
0 cromatico. Observese e I re t'ICU 1ad 0 v enoso

que da al cadaver un
color azulado .
c. Estado de red ucci6n muscular. La licuefacci6n de los tejidos fOl
continuidad.La temperatura y la humedad relativa pueden hacer (
producirse la adipocira 0 grasa de los cadaveres (sustancia crerno
Fotogra fi as to mad as por Fra ncisco Restrepo .

ENTOMOLOGiA FORENSE
Sis[ema[ica Molecul ar

:rom<l.tico. Observese el reticulado venosO que da al cadaver LIn c. Estado de reducci6n muscular. La licuefacci6n de los tejidos forma una soluci6n de
color azulado. continuidad.La temperatura y la humedad relativa pueden hacer que se prolongue el proceso, aI
producirse la adipocira 0 grasa de los cadaveres (sustancia cremosa de color pardo negruzco).

Fotog ra fias to mada s po r Fra nci sco Res tre po.

ENlDMOLOGtA FORENSE 43
FORENSE
Facultad de Ciencias

OC sion 10 t61
~~~'rrK'>ntnc:. indeseabl que deban lavars 0
muy importantes y su recolecci6r r

e. Estado de Esgueletizaci6n 0 de restos secos. los huesos se encuentran


totalmente limpios de cualquier clase de tejido blando 0 carnlago y no hay
olor asociado a estos.

ENTOMOLOGiA FORENSE
44
oc sion s 10 patol 0 nI
ntos indeseables que deben lavars 0 r'Atlrnn::n
muy importantes y su recolecci6n debe 5 r OUlIOBO!)!)8

de que la elildencia entomol6 lCB no S9 plerd


normal de un cadaver. 10 que se conoce como cadena de cu
mo que garanttza la autenllcldad de los element s m rial
!'I~,_u.~irtose de que pertenezcan I . Esc procedimiento
ue el primer fun rio a I escena d be prot
nvestlgaci6n. G 1m nt ,
m. como una barrer que im

isqlleletizacion 0 de restos secos. los hllesos s~ encuentran


[pios de cualquier clase de tejido blando 0 cartllago y no hay
olor asociado a estos.
Sistematica Molecular

Los insectos 0 muestras entomol6gicas encontradas en una escena de muerte 0 una esce­
na de crimen pueden considerarse pruebas de importancia en medicina legal.

Tanto las pruebas m6viles, lIamadas asf por que pueden trasladarse de la escena de la
muerte y que generalmente son muestras biol6gicas, como las pruebas fijas que s610 pue­
den preservarse mediante fotografias , dibujos 0 levantam iento de impresiones, son de gran
importancia en la investigaci6n yen la acusaci6n 0 absolucion de un sospechoso.

Las muestras entomol6gicas consideradas pruebas moviles, deben ser coleetadas y proce­
sadas de un modo adecuado , ya que de ello depende el acierto en las inferencias forenses
que de elias se deriven .

Los insectos 0 sus partes ya sea para la identificaci6n taxon6mica 0 para el establecimiento
en condiciones de laboratorio, deben colectarse y preservarse cuidad osamente.

Recolecci6n de la eVldencla.

Aunque en algunas ocasiones los pat610gos consideran los insectos asociados a los cada­

veres como elementos indeseables que deben lavarse 0 retirarse , los insectos pueden con­

vertirse en pruebas muy importantes y su recolecc i6n debe ser cu idadosa en la escena de

la muerte.

Como una forma de que la evidencia entomologica no se pierda 0 destruya durante el

procesamiento normal de un cadaver, esta 10 que se conoce como cadena de custodia. Este

es un procedimiento que garantiza la autenticidad de los elementos materiales recolecta­

dos, asegurandose de que pertenezcan al caso investigado . Este procedimiento es obliga­

torio e implica que el primer funcionario de la ley que arribe a la escena debe proteger el

mayor numero de pruebas que permitan comenzar una investigacion. Generalmente, se

asegura la zona en un perfmetro aproximado de hasta 50 m, como una barrera que impide el

dano de las pruebas .

Las muestras entomologicas deb en ser colectadas, empacadas y etiquetadas apropiada­

mente .

EI entom610go forense debe tener la precauci6n de no irrumpir prematuramente en la reco­

lecci6n de la evidencia y tener len cuenta consideraciones como no caminar inadvertida­

mente por la escena de los hechos, evitar destruir impresiones de calzado 0 huellas de

lIantas de ve hfculos, no mover elementos 0 perturbar el cadaver, no tocar 0 manipular ele­

mentos que puedan tener huellas digitales y no mover un elemento sin el permiso explfcito

de la persona a cargo de la investigacion.

Los materiales necesarios para la coleccion de los insectos y en general de artropo­


dos en la escena de un crimen , incluyen :redes entomologicas aereas
elaboradasenmuselina (Fig 3) . Viales de diferentes capacidades para colectar insectos,frascos
de boca ancha con tapa rosca y pinzas de presi6n leve para colectar larvas.

quel >t1za~i In l J
,., d cu, Iqu; >r I
lur ":>...~, ...,,

ENTOMOLOGiA F ORENSE 47
Facultad de leOClas

\:.,.- .. 0:,. : ­

t,. '1 VI'RS~)M)....tJ "t' 1(1NA L 1)12 CUU'MII_ '


\I" ~ .... l .1 II~

",:rTO . l or [lID ' IO'FC\ .


, ~ I " T ! . . .. L. r" Co \) , f r
Los datos climatologicos son esenciales en el momento de determir
casos las bajas temperaturas demoran el cicio de vida de los insectc
10. Una vez escritas las observaciones sobre la escena, se procede
tura y humedad relativa .

Hay diversas clases de temperaturas que' deben tomarse para ser


muerte:
Figura 3: Red entomoI6gica

Temperatura ambiente del aire: lerda a unos 60.0 cm de altura sob


Tambien debe incluirse pinzas de relojero de punta curvada, palillos dentales, pinceles delgados, Temperatura de la superficie del suelo: obtenida colocando el termt
etiquetas de papel, lapiz de grafito negro No 2, pala de mano, toallas de papel, camara letal, sueto.
soluciones para preservar los especimenes, guantes desechables (preferiblemente sin talco) , Temperatura en la interfase del cadaver: se obliene colocando el te
goteros, para colectar insectos pequeiios en fl uidos), aspirador de insectos, linterna y baterias de suelo.
repuesto, reg las con divisiones en cm. y mm., papel milimetrado, acumuladores de frio 0 hielo Temperatura de la masa de larvas: se obtiene insertando el term6n
seco con aserrin para mantener vivos fos especimenes mientras son transportados, contenedo­
res de icopor, cuaderno de anotaciones de campo y hojas de datos: formulario del estudio de la Otras temperaturas del suelo:

escena de la muerte y registra de identificacion de los insectos .


Temperatura del suelo bajo el cadaver: tomada en el momenta en q
Temperatura del suelo entre 1.0 y 2.0 mt del lugar donde fue dejadt
cadaver.

Consideracione importantes en el momento de la recoleccion: Temperatura del suelo a diferentes profundidades:

se toman diferenteslecturas a: 5.0 cm, 10.0 cm y 20 .0 cm de

Reg istrar y describir la escena.


profundidad .

Recolectar todos los datos c1imatologicos disponibles.

Recolectar la informacion sobre la artropodofauna en el cadaver de ser posible antes de que este
Las lecturas de temperatura siempre deben hacerse protegiendo e
sea removido del lugar.

Recolectar la artropodofauna sobre y hasta 6. 0 m alrededor del cadaver.

Para estimar la duraci6n de la exposici6n del cadaver ala luz del sol ,
Despues de la remocion de un cadaver, recolectar la artropodofauna directamente donde estaba el

mente el entorno : vegetacion como arboles, arbustos, malezas 0 edi1


cadaver y hasta un metro alrededor del lugar.

Registrar debidamente y tan completo como sea posible el form ulario del estudio de la escena de
La necesidad de tomar las diferentes temperaturas radica en que s
la muerte.(ver adelante).
puesto a la luz directa del sol, la temperatura interna es mas cer
Determinar hasta donde sea posible los insectos que esten volando 0 arrastrandose alrededor del
superficie y la actividad metabolica de las larvas y las bacterias al ir
cadaver.
significativamente . Esto puede acelerar el proceso de descomposi,
Det rminar las areas con mayor infestaci6n por insectos asociados al cadaver 0 a zonas alrede­
significativas a 10 largo del dia .
dor de este.

Determinar si hay depredacion por parte de otras insectos como coleopteros, avispas u hormigas

o seiiales de parasitismo.

Determinar la posicion exacta del cadaver, la posicion de las extremidades, la posicion de la

cabeza y la cara y que partes del cuerpo estan en contacto con el sustrato .

Determinar las areas de luz y sombra sobre el cadaver en un cicio normal de dia solar.

Determinar cualquier evento inusual natural 0 artificia l, que podrfa alterar los etectos del ambiente

sobre el cadaver como mu tilacion por carroneo, zonas del cue rpo quemadas , cubiertas, sumergi­

das, enterradas, etc.

Estas observaclones deb en ir acompaiiadas de fotografias, filmaciones en video y esquemas que


permitan recordar todos los elementos de la escena del crimen.

EmoMOLOGIA FORENSE
48
Sisremalica ;VI()Iccular

I NIVFI(SI!J,\[) 'uLOMHI '


Regislrn lit' lalll<; dimcllnlugicp:,o

I I I ' )1'1 .. . ,- .. G .) ! ! Los datos climatologicos son esenciales en el momento de determinar eII.P.M. ya que en algunos
casos las bajas temperaturas demoran el cicio de vida de los insectos y las altas pueden acelerar­
10. Una vez escritas las observaciones sobre la escena, se procede a tomar los datos de tempera­
tura y humedad relativa.

Hay diversas clases de temperaturas que deben tomarse para ser asociadas con la escena de la
muerte:
Figura 3: Red entomo16gica

Temperatura ambiente del aire: leida a unos 60.0 cm de altura sobre el cadaver.
.s de relojero de punta curvada, palillos dentales, pinceles delgados, Temperatura de la superficie del suelo : obteni da colocando el termometro sobre la superficie del
grafito negro No 2, pala de mano, toatlas de papel, camara letal. suelo.
as especimenes, guantes desechables (preferiblemente sin talco) , Temperatura en la interfase del cadaver: se obtiene colocando el term6metro entre el cadaver y el
JS pequerios en fluidos), asplrador de insectos, !interna y baterfas de
suelo .
les en cm. y mm., papel milimetrado, acumuladores de frio 0 hielo Temperatura de.la masa de larvas: se obtiene insertando el termometro en el centro de la masa.
mer vivos los especfmenes mientras son transportados, contenedo­
Inotaciones de campo y hojas de datos: formulario del estudio de la Otras temperaturas del suelo:
,tro de identiticaci6n de los insectos.
Temperatura del suelo bajo el cadaver: tom ada en el momen ta en que el cadaver es removido .

Temperatura del suelo entre 1.0 y 2.0 mt dellugar donde fue dejado el

cadaver.

tantes en el momento de la recolecci6n: Temperatura del suelo a diferentes profundidades:

se toman diferenteslecturas a: 5.0 cm , 10.0 cm y 20.0 em de

Ina.
profundidad.

cl imatol6gicos disponibles.

Jbre la artropodofauna en el cadaver de ser posible antes de que este


Las lecturas de temperatura siempre deben hacerse protegiendo el term6metro de la luz

la sobre y hasta 6.0 m alrededor del cadaver. Para estimar la duraci6n de la exposicion del cadaver ala luz del sol , se debe observar cuidadosa­
un cadaver. recolectar la artropodofauna directamente don de estaba el mente el entorno: vegetacion como arboles. arbustos, malezas 0 edificios, ventanas, paredes, etc.
rededor del lugar.
n completo como sea posible el formulario del estudio de la escena de La necesidad de tomar las diferentes temperaturas radica en que si un cuerpo se encuentra ex­
puesto a la luz directa del sol, la temperatura interna es mas cercana a la temperatura de la
~ posible los insectos que esten volando 0 arrastrandose alrededor del superficie y la actividad metabolica de las larvas y las bacterias al interior del cadaver, aumentan
significativamente. Esto puede acelerar el proceso de descomposicion y ocasionar variaciones
hayor infestaci6n por insectos asociados al cadaver 0 a zonas alrede­ significativas a 10 largo del dia.

~ion por parte de otros insectos como coleopteros , avispas u hormigas

~
acta del cadaver, la posici6n de las extremidades. la posicion de la
es del cuerpo estan en contacto con el sustra!o.
y sombra sobre el cadaver en un cicio normal de dia solar.
to inusual natural 0 artificial, que podria atterar los etectos del ambiente
tilaci6n por carroneo, zonas del cuerpo quemadas , cubiertas, sumergi­

n ir acom panadas de fotog rafias, film aciones en video y esquemas que


f elementos de la escena del crimen .

• FORENSE E NTOMOLOGIA PORENS 49


Facultad de Ciencias

EVIDENCIA DE CARRONEO,_ _ _ __ _ __ _ __

FORMULARIO PARA EL ESTUDIO DE LA ESCENA DE MUERTE .


TEMPERATURAS EN LA ESCENA DE MUERTE. (En grados cen t
Ambiental_ _. Superficie corporal __. Interfase cuerpo­
Caso No :_ _ _ _ __ Fecha : dd _ _ mm _ _aa_ _
Superficie del suelo_ _. A 10 cm__ .A 20 cm__ .Mas
Nombres: _ _ _ _ _ _ _ .. __ _Apellidos:_ _ _ _ _ _ __ _ __
Temperatura del agua (sf es acuatico)__. Otras _ __
Edad: Sexo:_ _ __
( Estas temperaturas deben ser tomadas periodicament6
despues de haber sido removido e/ cadaver)
Fecha en que desapareci6: dd__mm__aa__

Fecha en que fue hallado: dd __mm__aa__


NUMERO DE MUESTRAS COLECTADAS.
Localidad:_ __ __ _ _ __ _ _ __ _ __ _ __ __ _ __
Larvas Preservadas _ _. Vivas _ _Total
Descripci6n dellugar: _ _ _ __ _ _ __ _ _ _ _ __ _ _ __ _
Adultos Preservados___ Vivos_ __ Total

DATOS CLiMATlcos.
AREA DE LA ESCENA DE LA MUERTE .
Soleado__Parcialmente nublado . Nublado _ _
Seco_ _. Humedo __. Lluvioso __. Dfa __. Noche_
RURAL._ _ _ _ _ _ _ _ _ __ Humedad relativa _ _%.
Bosque__. Cultivo __de_ _ __ _ _ . Pastizal __. Matorral __
Borde de camino __. Area erosionada_ _. Edificaci6n cerrada Observaciones :
Edificaci6n abierta_ _ .Otras,_ _ _ _ _ __ _ __ _ _ __ __

URBANA,_ __ _ __ _ __ _
Edificaci6n cerrada__.Edificaci6n abierta_ _ . Lote baldfo_ _
Pavimento__. Basurero_ _ . Otras_ _ _ _ __ _ __ _ __ _

HABITAT ACUATICO._ _ __ __ Registro de la Humedad Rei ti va:


Estanque__. Lago __. Quebrada_ _ . Ri6 _ _ . Playa _ _. Mar__ . Asf como las variac iones en la temperatura pueden interferir en Ie
Otras,_ _ _ _ _ __ _ _ __ _ _ _ _ _ __ __ _ _ _ __ relativa influye tambiEm en el proceso. En un cuerpo que se en(
tejidos tenderan a tener una apariencia momificada. A diferencia (
en una zona humeda, desarrollara con el tiempo una fermentaci6n
EXPOSICION DEL CUERPO
cira. En ambos casos la artropodofauna encontrada sera difere
AI aire libre_ _. Enterrado __. Profundidad cm.
descomposici6n variara de un caso a otro .
Sumergido__. Parcial __ .% del cuerpo _ _.Total_ _ .
La humedad relativa se mide con un higr6metro y esta se debe
cadaver y no en un solo punto . Esto es debido a que en amt
VESTIDURAS.
humedad relativa puede variar significativamente dependiendo del
Completas__. Parcial __. Desnudo_ _. % del cuerpo vestido _ _ cuerpo. Es recomendable una medici6n sobre el cadaver a uno~
entre 1.0 y 2.0 m alrededor del cuerpo sobre la vegetaci6n en es
ESTADO DE DESCOMPOSICION . lugar abierto. En el caso de un lugar cerrado basta con tomar la hun
Fresco__.Enfisematoso _ _.Reducci6n muscular_ _ .Post reducci6n muscular __. En la medida de 10 posible debe conocerse las temperaturas y Ie
Restos secos __. Adipocira_ _.Otras,_ __ _ __ _ previos al hallazgo del cadaver. Estos datos pueden ser proporcio
gico mas cercano .
Observaciones: _ _ _ __ _ __ _ __ __ _ _ _ __ _ _ _ _ __ _ _ _

ENTOMOLOGiA FORENSE
50
Si stematica Molecular

EVIDENCIA DE CARRONEO_ __ __ _ _ _ _ _ _ __ __

TEMPERATU RAS EN LA ESCENA DE MUE RTE. (En grados centfgrados)


DE LA ESCENA DE MUERTE.
Ambiental_ _. Superficie corporal __. Interfase cuerpo-suelo__ .
Superficie del suelo _ _. A 10 cm _ _.A 20 cm_ _.Masa de larvas _ _
Fecha: dd __mm-_aa-- Temperatura del agua (sf es acuatico) __. Otras _ _ _ _ _ _ _ __ _
Apellidos:_ _ __ _ _ __ _ L--­ ( Estas temperaturas deb en ser tomadas peri6dicamente por 10 menos hasta 2 0 3 dfas
despues de haber sido removido el cadaver)
nm_ _aa_ _
NUMERO DE MUESTRAS COLECTADAS .
m__aa-_ Larvas Preservadas_ _. Vivas_ _Total
Adultos Preservados_ _. Vivos _ _ . Total _ _.

DATOS CLiMATICOS.
Soleado_ _Parcialmente nublado _ _. Nublado_ _
::RTE.
Seco _ _ . Humedo_ _. Lluvioso_ _. Dfa_ _. Noche
Humedad relativa _ _% .

Ie . Pastizal __. Matorral _ _


Observaciones:
~a erosionada_ _ . Edificaci6n cerrada_
_.
'as_ __ _ _ _ _ _ _ _ - - -­

:dificaci6n abierta __. Lote baldfo __.


_ _ .Otras,- -- - - - - - -- -­
Registro de la Humedad Relativa :
Asf como las variaciones en la temperatura pueden interferir en la descomposici6n, la humedad
_. Quebrada__ . Ri6 __. Playa__. Mar_ _. relativa influye tambien en el proceso. En un cuerpo que se encuentre en una zona seca, los
tejidos tenderan a tener una apariencia momificada. A diferencia de 10 anterior, un cuerpo dejado
en una zona hLlmeda, desarrollara con el tiempo una fermentaci6n butfrica que producira la adipo­
cira. En ambos casos la artr6podofauna encontrada sera diferente; igualmente, el proceso de
descomposici6n variara de un caso a otro .
do_ _. Profundidad cm.
.% del cuerpo .Total La humedad relativa se mide con un higr6metro y esta se debe tomar en las proximidades del
cadaver y no en un solo punto . Esto es debido a que en ambientes abiertos y naturales la
humedad relativa puede variar significativamente dependiendo del tipo de vegetaci6n que rodee el
cuerpo. Es recomendable una medici6n sobre el cadaver a unos 60.0 cm de altura y otras dos
_ - ' Desnudo __. % del cuerpo vestido _ _
entre 1.0 y 2.0 m alrededor del cuerpo sobre la vegetaci6n en especial si el cadaver esta en un
lugar abierto. En el caso de un lugar cerrado basta con tomar la humedad relativa sobre el cadaver.
IN. I En la medida de 10 posible debe conocerse las temperaturas y la precipitaci6n total de los dfas
150_ _ ·
Reducci6n muscular__.Post reducci6n muscu ar_ _.
previos al hallazgo del cadaver. Estos datos pueden ser proporcionados por el instituto climatol6­
ocira .Otras _ _ __ _ _ __ gico mas cercano.
I ~

ENTOMOLOGiA FORENSE 51
Ij:3f10 5
Facultad de leOCias

oleecion y preservaci6n de los esp dmene En los cadaveres frescos la cara es el lugar de mayor actividad e
particular prefieren los orificios nasales y el tejido blando de los ojm
En casos de violacion y muerte se puede hallar insectos preferiblem
Existen varias tecnicas de recoleccion del material entomologico sobre el cadaver que varian de­ y anal, 0 en las heridas abiertas provocadas por el arma of ens ora.
pendiendo de las condiciones y circunstancias en que se encuentre el cadaver.
Se debe revisar la zona pubica y el cuero cabelludo en busca de ec1
Tecnica de Jameo: para 'esta tecnica es necesario tener un poco de experiencia y se emplea ya que mediante pruebas moleculares se puede determinar el AI
principalmente para colectar insectos en vuelo. Los insectos se matan en la camara letal y se violencia sexual.
trasfieren a frascos can Etanol al 75% 0 Isopropanol al 96 % para ser trasportardos allaboratorio
Otros sitios de actividad entomologica son: los orificios naturales d
para su posterior identificacion.
das, el cabello, las heridas ante mortem en el cuerpo, tracto respira l
Aspiracion de insectos : esta tecnica se realiza con un frasco aspirador de insectos el cual se usa

Algunas veces los cuerpos son refrigerados antes de hacer la autop!


para extraer los insectos que se encuentren en la jama 0 en proximidades del cadaver y no sobre

tomar desde algunas horas hasta dias. Es importante conocer por CI


este.

do el cuerpo y a que temperatura; tambien se debe registrar la~


Recoleccion directa: se emplea basicamente para colectar del suelo 0 alrededor del cadaver. Los
autopsias y del interior del veh iculo donde son transportados los cu
insectos que caminan, se entierran 0 se arrastran , pueden ser colectados utilizando pinzas, espatulas,

pinceles, palillos dentales, 0 incluso los dedos.

Es muy importante etiquetar inmediatamente cada vial con toda la informacion pertinente y cad a caleedon de evidcncia entomologica en cuerpos e.nte
etiqueta debe como minimo inciuir, el numero de muestra, la fecha, la hora, ellugar (Departamento, Cuando un cadaver ha sido enterrado, la artropodofauna cadaverica
Municipio, Corregimiento, Vereda) y el numero del caso. que cubre el cuerpo. EI proceso de descomposicion es mas lento d~
mas constante y se dificulta el acceso a los insectos que ovopc
La mejor oportunidad para colectar insectos sabre un cadaver y emplear los datos proporcionados cadaveres . Los insectos col ectad os comunmente sobre un cadaver
por estos como evidencia a Ja investigacion , es sobre el cuerpo en ellugar de los hechos. Si no es tenecen a las familias Calliphoridae, Sarcophagidae y Phoridae. I~
posible, el mejor momento para colectarlos es durante la autopsia. EI entomologo forense deberfa Silphidae y Staphylinidae e Himenopteros como las hormigas a prof
estar presente durante la autopsia e involucrado en la recoleccion de la evidencia entomologica; cm hasta 10.0 cm.
no obstante, el medico legista deberia estar capacitado para colectar este tipo de muestras . La recoleccion de los especimenes en el lugar de una exhumacio
descrito anteriormente. EI entomologo debe colectar las muestras I
Reeoleeci6n de la evideneia entomo16gica durante 1a autopsia . posterior evaluacion de los organismos encontrados. Los artropodos
dos y marcados asegurandose de anotar la profundidad a la que fu

La recoleccion de la evidencia entomologica puede hacerse conjuntamente con el medico legista.


Rccolecci6n de evidencia enLomologica en tructuras e
Generalmente despues de que un cadaver es encontrado y se Ie han practicado las diligencias
legales, es encerrado en una bolsa para ser transportado a la morgue. En la bolsa dependiendo Las estructuras encerradas ofrecen una barrera fisica en la dispers
el estado en que se encuentre el cadaver, se encontraran estados inmaduros y adultos de diversos estado de putrefaccion produce y que sirven como atrayentes Uno
artropodos. Esta evidencia no debe ser pasada por alto y las muestras deben ser colectadas y es el tiempo que ha permanecido el cadaver en ese lugar. Debe I
marcadas. Una vez abierta la bolsa, se debe revisar su interior en busca de insectos, que muy acercarian como resultado de la produccion de los diferentes olore:
probablemente se han desplazado hacia las paredes interiores debido al cambio en la temperatura descomposicion . Por ejemplo, si se encuentra principal mente mosc
y por el movimiento del cadaver durante su transporte. EI entomologo debe colectar los artropodos de un I. P.M. mas corto que si encontraramos moscas Piophilidae.
y marcarlos nombrando la parte del cuerpo mas cercana de donde fueron colectados (cabeza, durante la descomposicion casefca 10 que sugeriria un I.P.M. mas I
extremidades, dorso, etc.).

Cuando el cadaver esta sobre la mesa de autopsias, el entomologo junto con el medico exam ina­
dor deben determinar las caracterfsticas que presenta el cuerpo, si el cadaver esta vestido debe
revisar los bolsillos y los pliegues que hacen las prendas, ya que en estas se puede hallar huevos,
larvas, pupas y adultos.
Despues de haber removido las vestiduras y haberlas examinado, se debe fotografiar las partes del
cuerpo con masas de larvas y colectar especimenes representativos de cada sitio con las tecnicas
descritas anteriormente.

J
E NTOMOLOGtA FORENSE
52
Sistematica Molecular

n y preservacion de los especimene En los cadaveres frescos la cara es el lugar de mayor actividad entomol6gica, las moscas en
particular prefieren los orificios nasales y el tejido blando de los ojos para ovopositar.
En cas os de violaci6n y muerte se puede hallar insectos preferiblemente en las zonas uro-genital
)Ieccion del material entomologico sobre el cadaver que varfan de­ y anal, 0 en las heridas abiertas provocadas por el arma of ensora.
y circunstancias en que se encuentre el cadaver.
Se debe revisar la zona pubica y el cuero cabelludo en busca de ectoparasitos (piojos 0 acaros),
tecnica es necesario tener un poco de experiencia y se emplea ya que mediante pruebas moleculares se puede determinar el ADN del agresor en casos de
nsectos en vuelo. Los insectos se matan en la camara letal y se violencia sexual.
al 75% 0 Isopropanol al 96 % para ser trasportardos allaboratorio
Otros sitios de actividad entomol6gica son: los orificios naturales del CraneD y orificios por heri­
das, el cabello, las heridas ante mortem en el cuerpo, tracto respiratorio y tracto bUCO-8sofagico.
~cnica se realiza con un frasco aspirador de insectos el cual se usa
Algunas veces los cuerpos son refrigerados antes de hacer la autopsia; este procedimiento puede
;e encuentren en la jama 0 en proximidades del cadaver y no sobre
tomar desde algunas horas hasta dias. Es importante conocer por cuanto tiempo estuvo refrigera­
do el cuerpo y a que temperatura; tam bien se debe registrar las temperaturas del cuarto de
3 basicamente para colectar del suelo 0 alrededor del cadaver. Los autopsias y del interior del vehiculo donde son transportados los cuerpos hasta la morgue .
ran 0 se arrastran, pueden ser colectados utilizando pinzas, espatulas,
Icluso los dedos .
lmediatamente cada vial con toda la informacion pertinente y cada Recoleccion de evidencia entomologica en cuerpo enterrados.
:Iuir, el numero de muestra, la fecha, la hora, ellugar (Departamento, Cuando un cadaver ha sido enterrado, la artropodofauna cadaverica se Iimita a la cantidad de tierra
~da) y el numero del caso. que cubre el cuerpo. EI proceso de descomposici6n es mas lento debido a que la temperatura es
mas constante y se dificulta el acceso a los insectos que ovopositan en la superficie de los
3ctar insectos sobre un cadaver y emplear los datos proporcionados cadaveres. Los insectos colectados comunmente sobre un cadaver que haya sido enterrado per­
investigacion, es sobre el cuerpo en ellugar de los hechos. Si no es tenecen a las familias Calliphoridae, Sarcophagidae y Phoridae. Igualmente, cole6pteros como
a colectarlos es durante la autopsia. EI entom610go forense deberia Silphidae y Staphylinidae e Himen6pteros como las horm igas a profundidades que van desde 2.5
)psia e involucrado en la recolecci6n de la evidencia entomol6gica; cm hasta 10.0 cm.
I deberfa estar capacitado para colectar este tipo de muestras. La recolecci6n de los especfmenes en el lugar de una exhumaci6n es similar al procedimiento
descrito anteriormente . EI entom610go debe colectar las muestras del suelo y cernirlas para una
posterior evaluaci6n de los organismos encontrados. Los artr6podos colectados deben ser monta­
cia entomologica durante la aulopsia .
dos y marcados asegurandose de anotar la profundidad a la que fueron hallados .

. entomol6gica puede hacerse conjuntamente con el medico legista.


Recoleccion de evidencia entomol6gica en e tructura encerr.lda .
Je un cadaver es encontrado y se Ie han practicado las diligencias
bolsa para ser transportado a la morgue. En la bolsa dependiendo Las estructuras encerradas ofrecen una barrera fisica en la dispersion de los aerosoles que cada
•el cadaver, se encontraran estados inmaduros y adultos de diversos estado de putrefacci6n produce y que sirven como atrayentes Uno de los aspectos a determinar
~ debe ser pasada por alto y las muestras deben ser colectadas y es el tiempo que ha permanecido el cadaver en ese lugar. Debe considerarse queinsectos se
I bolsa , se debe revisar su interior en busca de insectos, que muy acercarfan como resultado de la producci6n de los diferentes olores asociados a cad a estado de
zado hacia las paredes interiores debido al cambio en la temperatura descomposici6n . Por ejemplo , si se encuentra principalmente moscas Calliphoridae se sospecha
3r durante su transporte. EI entom610go debe colectar los artr6podos de un I.P.M. mas corto que si encontraramos moscas Piophilidae . Estas ultimas son frecuentes
Irte del cuerpo mas cercana de donde fueron colectados (cabeza , durante la descomposicion casefca 10 que sugerirfa un I.P.M. mas largo.

'Ia mesa de autopsias, el entom610go junto con el medico examina­


Icteristicas que presenta el cuerpo, si el cadaver esta vestido debe
,es que hacen las prendas, ya que en estas se puede hallar huevos,

ISvestiduras y haberlas examlnado, se debe fotografiar las partes del


colectar especfmenes representativos de cada sitio con las tecnicas

ENSE ENTOMOLOGiA FORENSE 53


o

...<.....,,,,,AJ GI c I; Alcohol etthea; 0


80.0 -100.0
20.0 ml
KOlroselO 10.0 ml
100
· isten tatic i\l()kcular

Cuando los insectos provenientes de una investigacion lIegan al laboratorio, estos deben ser
procesados tan rapido como sea posibl e. lnicialmente, se debe hacer un registro especificando el
caso y los proeedimientos a real izar con las muestras entomologieas. Esto prineipalmente con el
fin de mantener la cadena de custodia.
Una parte de los estados inmaduros vivos coleetados, S8 destinan para la identifieaeion taxon6miea
y posibl e estimacion de IPM. Otra pa rte se colocan en recipientes para cria con dietas especiales
y bajo condiciones controladas para facilitar la continuaci6n del cicio y la obtencion de adultos.
En el neotropico, la identificaci6n taxonom ica de la mayoria de insectos de importancia forense, es
muy ditrcil con base en estados inmaduros , por 10 cualla crfa es muy importante .
Los especimenes muertos se montan en alfileres entomol6gicos 0 se envasan en medios preservantes
y se etiquetan con la informacion adeeuada .
C uando se colectan larvas de eole6pteros en una escena de mu erte , es necesario separarlas de
las demas ya que estas son depredadoras de larvas de dipteros. Adiei onalmente, es importante
colectar mas larvas de moscas para alimentar las de los coleopteros y poderlos mantener en el
laboratorio.
Para separar los inseetos , las muestras de suelo deben ser proeesadas mediante el uso del
embudo de berlesse. Este embudo posee una plataforma enrejada y una lampara que sostiene la
mu estra. Los artropodos colectados pasan a traves de la malla huyendo del calor y la luz de la
lampara hacia un fraseo coleetor ubieado al fin al del emb udo que contiene alcohol etilico al 70 "Ia .

Pres 'n'Jd6n dl' ln~ectos.

Soluciones para matar y preservar :

EI etanol (ETOH) al 70% se usa para matar y preservar especimenes ad ultos y larvas. EI etanol
comercial posee una concentraci6n del 95 % (v/v), por 10 cual se debe rebajar con agua doble­
mente destilada (H2 0 dd) . Para ello, se miden 70 partes de ETOH al 95% y se adicionan 25
partes de agua.
A continuaci6n se deseriben algunos el ementos 0 soluciones qufmieas que sirven para matar 0
preservar los especfmenes colectados en una escena de muerte 0 eriados en ellaboratorio.
Camara letal. Es un lrasco de boca ancha, en cuya tapa se ha adherido un algod6n que se
em papa con unas cuantas gotas de acetato de etilo. EI frasco debe taparse rapidamente y
no se debe respirar los vapores. EI algod6n debe reempaparse con el acetato despues de
varios dras de uso .

K.A.A.D . : Keroseno; Acido Acetico Glacial; Alcohol etnico; Dioxano


Etanol al 95 % 80.0 - 100.0 ml
Acido Acetico Glacial 20.0 m l
Keroseno 10.0 ml
Dioxano 10.0 ml

ENroMoux;1A FORENSE 57
Facultad de Ciencias

Despues de matar la laNa, esta se transfiere del K.A.A.D a etanol a170% - 80%. Dicha solucion Solucl6n de PampeJ.
se emplea solo para malar laNas .
Formalina (Formadelhido a110% en agua)
XA : Xilol; Alcohol Etanol
Alcohol etflico 95%
Xyleno 50 .0ml
ACido Acetico Glacial
Elanol al 95% 50.0 ml
H 2 0 dd (Agua destilada)
X:AAD. : Xileno ; Alcohollsopropilico ; ACid0 Acetico Glacial; Dioxano
irve para p rese ar todos los estados d el cido de v ida.
Xileno 40.0 ml
Alcohollsopropflico 60.0ml
Acido Acetico Glacial 50 .0ml
n,l en ndiuones d' i.:lboraturio
Dioxano 40.0 ml
Solo para matar laNas, no para preseNarlas. Igual que con el KAA.D.
Establecer crias en ellaboratorio es de gran importancia en Entomoll
Otra forma para matar laNas es inlroduciendolas por unos segundos en un vasa de agua De las crias puede obtenerse una gran cantidad de informacion ta
con sales digestivas (sal de frutas 0 alka seltzer) para que evacuen todo su contenido implicaciones en las estimaciones de IPM y demas inferencias en fo
gastrico; luego se introducen en agua hiNiendo por 10 menos 30 segundos (para fijar las
estructuras externas) y luego se lIevan ala solucion de Kh ale 0 a la solucion de Hood, para La estimacion del IPM es mas diffcil con laNas muy jovenes por 10
su preseNacion . condiciones de lab oratorio permite obtener resultados mas confiable
determinada. Asi mismo, las CUNas de crecimiento y desarrollo, tabl
Soluci6n de Kahle.
dancia que se derivan de las crias,son determinantes en las aplicc
Etanol al 95% 30.0ml forense .
ACido Acetico Glacial 4.0 ml
En Colombia los estudios en este aspecto son pocos; los mas signil
Formaldehido 12.0 ml en ellnstituto Nacional de Ciencias forenses en convenio con la Univ
H 2 0 dd (Agua destilada) 60 .0ml Jose de caldas ».(Camacho 2003).

Esta soluci6n se emplea para matar adultos y larvas y preservar los especimenes larvales. Cuando se recogen los estados inmaduros y se lIevan al laboratori,
Solucion de Hood . especial a la presencia de parasitoides que podrfan afectar el desarrc
las evaluaciones forenses 0 el desarrollo del cicio de vida.
Etanol al 75% 95 .0ml
Glicerina 5.0 ml Los especimenes usados para crfas en ellaboratorio deben revisarse,
nes en las pupas 0 coloraciones anormales en las laNas . Entre los pa
EI mismo uso que la anterior.
estan los Hymenoptera de las familias Pteromalidae y Encyrtidae.
Soluciones para preservar insectos acucitico 0 de cuerpo blando.
Otro aspecto que debe considerarse, es la presencia de laNas dep
Alcohol etflico al 90% - 95% para preseNar huevos , laNas y pupas. fuertemente por el alimento, 10 cual puede generar adultos mas I
Fluido de Carnoy : afectadas.
La dispersion de las laNas antes de empupar y los comportamientos ·
Acido Acetico Glacial 10.0 ml objeto de estudio en ellaboratorio. Estos procesos asi como los patn
Alcohol etilico 95% 60.0 ml efectos muy importantes en la ecologia de las especies, particulam
des.
Cloroformo 30% 30 .0ml Existen pocos estudios relacionados con depredacion, dispersi6n y c
con gran potencial de invesligacion en Colombia en especial para el c,
Calliphoridae .
Existen evidencias que sugieren que en el neotropico, las laNas d
G.a/biceps son depredadoras facullativas de otras moscas del mi

ENTOMOLOG F ORENSE
58
Sistematica Molecular

ta se transfiere del K.AAD a etanol a170% - 80%. Dicha solucion Soluci6n de Pampel.
,rvas. Formalina (Formadelhido al1 0% en agua) 10.0 ml
01 Alcohol etrlico 95% 30.0 ml
50.0ml
Acido Acetico Glacial 7.0ml
50.0 ml
H 2 0 dd (Agua destilada) 53 .0 ml
0; Alcohol Isopropflico; Acid0 Acetico Glacial; Dioxano
Sirvepara preserv ar todos los estados del cicio de vida.
40.0ml

flico 60.0 ml

31acial 50.0ml
rlCI en condicion ~s de lablH"<ltorin
40.0ml

:Ira preservarlas Igual que con el K.AAD. Establecer crfas en ellaboratorio es de gran importancia en Entomologfa forense.

arvas es introduciendolas por unos segundos en un vasa de agua De las crias puede obtenerse una gran cantidad de informacion taxonomica y ecologica con

.al de frutas 0 alka seltzer) para que evacuen todo su contenido implicaciones en las estimaciones de IPM y demas inferencias en forense .

Jucen en agua hirviendo por 10 menos 30 segundos (para fijar las


luego se lIevan ala solucion de Khale 0 a la solucion de Hood, para La estimacion del IPM es mas diffcil con larvas muy jovenes por 10 cual el establecimiento en '

condiciones de laboratorio permite obtener resultados mas confiables con base en una especie

determinada. Asi mismo, las curvas de crecimiento y desarrollo, tablas de probabilidad y abun­

dancia que se derivan de las crias,son determinantes en las aplicaciones de la Entomologfa

30.0 ml forense.

Glacial 4 .0 ml En Colombia los estudios en este aspecto son pocos; los mas significativos son los realizados

12 .0 ml en ellnstituto Nacional de Ciencias forenses en convenio con la Universidad distrital «Francisco

Jose de caldas» .(Camacho 2003).

3. destilada) 60.0 ml
ara matar adultos y larvas y preservar los especimenes larvales. Cuando se recogen los estados inmaduros y se lIevan allaboratorio, debe prestarse atencion

especial a la presencia de parasitoides que podrian afectar el desarrollo de los insectos yalterar

las evaluaciones forenses 0 el desarrollo del cicio de vida.

95.0 ml
Los especfmenes usados para crfas en ellaboratorio deben revisarse en busqueda de perforacio­

5.0 ml
nes en las pupas 0 coloraciones anormales en las larvas. Entre los parasitoides mas importantes

or. estan los Hymenoptera de las familias Pteromalidae y Encyrtidae.

ar insectos acuatico 0 de cuerpo blando.


Otro aspecto que debe considerarse, es la presencia de larvas depredadoras y que compiten

r 95 % para preservar huevos, larvas y pupas. fuertemente por el alimento, 10 cual puede generar adultos mas pequenos en las especies

afectadas.

La dispersion de las larvas antes de empupar y los comportamientos depredadores tam bien son

~ Glacial 10.0 ml objeto de estudio en ellaboratorio. Estos procesos asi como los patrones de agregacion, tienen

efectos muy importantes en la ecologfa de las especies, particularmente a nivel de comunida­

p95% 60.0 ml
des.

30 .0ml Existen pocos estudios relacionados con depredacion, dispersion y agregacion,esta es un area

con gran potencial de investigacion en Colombia en especial para el caso de moscas de la familia

Calliphoridae.

Existen evidencias que sugieren que en el neotropico, las larvas de algunas especies como

C.a/biceps son depredadoras facultativas de otras moscas del mismo genero afectando los

A FORENSE ENTOMOLOGIA FORENSE 59


Facultad de Ciencias

patrones de migracion y agrupacion de otros insectos del mismo orden.


Dieta artificial esteril para alimentar larvas de Lucil/ia sericatc
EI comportamiento depredador de C. a/biceps tiene efectos como la reduccion en los tamanos

Higado de vaca
poblacionales, la aparicion de adultos mas pequenos y el desplazamiento de especies nativas,
1.0 parte
tales aspectos pueden afectar las inferencias forenses.
Agar Bacto
1.0 parte
Fermento de levadura 0 tripsina 02
P ., . 5,0.51
ln icio v condjcio nt!s dt! las (rias re~araclon : EI higado de vaca y el Agar Bacto en proporcion 1:1
Se Introduce el hfgado de vaca fres ..

En el caso de los insectos de importancia forense el medio mas practico y economico para por 5 dias a 20°C _240C. co en un reClplente, se cierra, s
establecer crias en el laboratorio es el higado; este se coloca en el interior de una camara de
emergencia de adultos, preferiblemente con las paredes exteriores recubiertas por una pantalla
oscura; asi el hfgado no se deshidrata por efecto de la luz.
A los cinco dfas, se lava el hi ad
caliente del Agar Bacto al 3'1< i .

0 Con ,agua destllada. EI higa


Se puede emplear frascos grandes de boca ancha, recubiertos por una bolsa 0 cartulina negra autoclave y se vacia en cajas~' a ~o~uclon se autoclava a 130°C
asegurc'mdose que el frasco quede bien tapado con muselina muy fina para evitar la fuga de las ml de tripsina. e pe n e 15.0 ml. Cuando se enfria
larvas cuando migran para empupar. Una dificultad de este metodo de cria es que produce olor
desagradable por la descomposicion de los tejidos.
Existen tambien algunos medios artificiales que tienen como ventaja la manutencion de las crias
en cultivos inalterados ademas de evitar el olor causado por la putrefaccion de los cultivos con
carne. Algunos de los medios ya estandarizados contienen carne, hueso, leche en polvo y huevo
(ver receta al final). Tambien puede emplearse comida para perros en lata y pescado. Algunos
Procedimjent(l~ p':lI'a I. id 'ntifi 'ilti6n d In t:.'do'
trabajos de laboratorio como los de dispersion de C. a/biceps en Brasil, senalan como alternativa
dietas con carne de caballo 0 sardina. La viabi lidad de las larvas crfadas en carne de caballo es Se hace enfasis en este grupo or .

mayor del 89%. Esta carne permitio obtener larvas de mayor peso, con consecuencias importan­ de la dificultad en su identific P, StU abu,ndancla y relevancia,y frecl
tes en el potencial de reproduccion de los adultos en condiciones de laboratorio. . aClon axonomlca al nivel de especie.
Los dlpteros de las familias Calliphoridae .
para la determinacion del IPM P l Y Sarcophagldae son los insl
Las camaras de emergencia de los adultos deben tener una capa de arena esterilizada en el
el estudio detallado de s ·' 1 °dr 0 tanto, es necesana su identificac
fondo de unos 2.50 cm 0 3.00 cm para que las larvas migren y empupen en su interior. En una . u CIC 0 e Vida y los camb'
vanaciones ambientales como I t lOS que estos ci
base puesta sobre la arena , se adiciona aproximadamente 100-130 9 de hfgado en trozos 0 de a emperatura y la humedad.
4.0 a 6.0 onzas de medio artificial. Generalmente, se pueden ubicar entre 10 a 15 larvas por Es necesario conocer las caracteristic d .
camara. Cuando emergen los adultos, se pueden colectar colocandolos por un tiempo en el permitan identificarlas a nivel de es . as e los estados Inmaduros (hl
refrigerador 0 durmiendolos con CO 2 como la forma del esqueleto cef ie~,e"para ello se emplean medidas r
Antes de hacer el montaje de los adultos se debe esperar por 10 menos 48 horas, para que el .. a 0- anngeo y los espiraculos caudall
patron de coloracion alar y corporal se establezcan definitivamente . En la familia Calliphoridae debe ob
los espiraculos protoracicos (con 1ge~~~~ las bandas cefalicas de rr
aberturas y peritremo abierto 0 ad Ig,ltOS), forma de los espirac
Algunas dietas artUiciales para cria en el laboratorio: cerra 0 segun la especie.
En el adulto general mente los cara .
Para larvas de Diptera y la coloracion. cteres Importantes estan en la venacic

Ingrediente Cantidad En el caso de la familia Sarcopha 'd .


mesotorax,metatorax yen la mayori~'d a7 es Importante observar las t
Carne y hueso 140.0 9
caudales aparecen como ab rt e os segmentos abdominales de I
Leche en polvo 30.0 9 . e uras vertlcales rodeadas por un peritrerr
En la hteratura especializada s b 'd . . . ,
Huevo en polvo 30.0 9 pOca informacion sobre las e~pre I entlficaclon de adultos de la familia C,
eCles presentes en el tropico.
Agente gelificante (agar) 5.0 9 Uno de los generos que mas se esta tr b .
se encuentra las dificultades t . a ajando actualmente es Chrysc
Formaldehido 1.0 ml . axonomlcas y de similitud rf I ' .
genero, s.u relativa reciente IIegada al tro' (I mo 0 oglca er
Agua (No destilada) a 65°C 597.0 ml ' . plCO a gunas especles) y su com~
A~e~as especles de este genero tienen r .
Esta dieta se suplementa con un pequeno trozo de carne 0 de higado, para habituar las larvas. mlasls en diversos animales . 9 an Importante en medicina

ENTOMOLOO F ORENSE
60
Er
Sistematic Molecular

Oieta artificial esteril para alimentar larvas de Lucillia sericata


lcion de otros insectos del mismo orden.
. de C. a/biceps tiene efectos como la reduccion en los tamanos Higado de vaca 1.0 parte
ldultos mas pequenos y el desplazamiento de especies nativas, Agar Bacto 1.0 parte
las inferencias forenses.
Fermento de levadura 0 tripsina 0.25 , 0.5 0 1.0 ml
Preparacion: EI h igado de vaca y el Agar Bacto en proporcion 1: 1
lS
Se introduce el hfgado de vaca fresco en un recipiente , se cierra, se sella y se deja descomponer
importancia forense el medio mas practico y economico para por 5 dias a 20°C - 24°C.
rio es el hfgado ; este se coloca en el interior de una camara de A los cinco dias , se lava el hfgado con agua destilada . EI hfgado se mezcla con la solucion
Jlemente con las paredes exteriores recubiertas por una pantalla caliente del Agar Bacto al 3%. La solucion se autoclava a 130°C por 20 minutos. Se retira del
shidrata por efecto de la luz . autoclave y se vacia en cajas de petri de 15.0 ml. Cuando se enfria, se Ie adiciona 0.25, 0.50 1.0
ldes de boca ancha, recubiertos por una bolsa 0 cartulina negra ml de tripsina.
ede bien tapado con musellna muy fina para evitar la fuga de las
pupar. Una dificultad de este metoda de crfa es que produce olor
)sicion de los tejidos .
JS artificiales que tienen como ventaja la manutencion de las crias
; de evitar el olor causado por la putrefaccion de los cultivos con
Pro edimientos para la identitka "j<.'m de inSI..'l"lllS dellH'd 11 Dipt 'ra .
{a estandarizados contienen carne, hueso, leche en polvo y huevo
uede emplearse comida para perros en lata y pescado . Algunos
s de dispersion de C. a/biceps en Brasil, sen alan como alternativa
Se hace enfasis en este grupo por su abundancia y relevancia,y frecuencia de aparicion,ademas
,ardina. La viabilidad de las larvas criadas en carne de caballo es
de la dificultad en su identificacion taxonomica al nivel de especie.
mitio obtener larvas de mayor peso, con consecuencias importan­
:cion de los adultos en condiciones de laboratorio . Los dipteros de las familias Calliphoridae y Sarcophagidae son los insectos de mayor importancia
para la determinacion deiIPM . Por 10 tanto, es necesaria su identificacion taxonomica, asi mismo,
je los adultos deben tener una capa de arena esterilizada en el el estudio detallado de su cicio de vida y los cam bios que estos ciclos pueden sufrir con las
cm para que las larvas migren y empupen en su interior. En una variaciones ambientales como la temperatura y la humedad.
~ adiciona aproximadamente 100-130 9 de hfgado en trozos 0 de
Es necesario conocer las caracteristicas de los estados inmaduros (huevos, larvas y pupas) que
iicial. Generalmente, se pueden ubicar entre 10 a 15 larvas por
permitan identificarlas a nivel de especie; para ello se emplean medidas morfometricas, y caracteres
; adultos, se pueden colectar colocandolos por un tiempo en el
como la forma del esqueleto cefalo- faringeo y los espiraculos caudales de las larvas.
nC0 2
los adultos se debe esperar por 10 menos 48 horas , para que el En la familia Calliphoridae debe observarse las bandas cefalicas de microespinas en las larvas,
poral se establezcan definitivamente . los espiraculos protoracicos (con 10 a 11 digitos) , forma de los espiraculos caudales , numero de
aberturas y peritremo abierto 0 cerrado segun la especie .

,ra cria en el laboratorio: En el adulto generalmente los caracteres importantes estan en la venacion de las alas,los genitales
y la coloracion.
En el caso de la familia Sarcophagidae es importante observar las bandas de espinas en el
Cantidad
mesotorax,metatorax yen la mayoria de los segmentos abdominales de las larvas. Los espiraculos
140.0 9 caudales aparecen como aberturas verticales rodeadas por un peritremo abierto.
30,Og En la literatura especializada sobre identificacion de adultos de la familia Calliphoridae, encontramos
poca informacion sobre las especies presentes en el tropico.
30.0 9
Uno de los generos que mas se esta trabajando actualmente es Chrysomya. Entre las razones
:(agar) 5.0 9
se encuentra las dificultades taxonomicas y de similitud morfologica entre especies del mismo
1.0 ml genero, su relativa reciente lIegada al tropico (algunas especies) y su comporta miento depredador.
597 .0 ml Ademas especies de este genero tienen gran importante en medicina veterinaria por causar
miasis en diversos animales.
n pequeno trozo de carne 0 de higado, para habituar las larvas.

ENiOMOLOGtA FO~ 61
NSE
Facultad de Ciencias

Para el especies de Elste genero, existe una clave taxonomica que permite diferenciar especies Cl<:lVl' ta onomicil para 1'1S e'ipCCl 'S LIt' I" (,lnliUcl Calliph
con base en carateristicas morfologicas de larvas de tercer instar ( Wells et al. 1999).
Argentinu. (/Uclll Mlo... Mariluis 2002)
Recientemente, se ha realizado un trabajo exhaustivo en relacion con las genitalias y existe una
metodologia descrita para trabajar con los mismos (Rognes y Paerson 2004).
Estudios de microscopia electronica de barrido de los huevos senalan que no existen diferencias 1. Nervadura basal setosa en la cara superior; ampolla mayor renifor
significativas que puedan usarse como diagnosticas de especie (David et al. 2003). Nervadura basal desnuda en la cara superior; ampolla mayor oval,

Hasta el momenta no hay ninguna clave que describa las especies que se encuentran en Colombia. 2. Nervadura basal setosa en la cara infe~ior; arista plumosa en 1/5 a
Se presenta dos claves taxonomicas para la identificacion de formas adultas de las especies de la .. ... ..... ..... Sarcc
familia Calliphoridae, la primeraArgentina, elaborada par Juan Carlos Mariluis (2002) y la segunda
- Nervadura basal desnuda en la cara inferior; arista plumosa en los:
publicada por Rubens Pinto de Mello (2003), para especies enconlradas en el Brasil.
En un capitulo adicional se trata la oblencion y ulilizacion de caracteres moleculares como ADN
longitud ...... .. ...... .... . . .. . , . . . . .. .. ,.. ... ... ...... .... .. .... ....... ...... ..... .
mitocondrial para la idenlificacion de las especies y razas geogrMicas. 3. Palpo largo, normal. ..
Es importanle considerar la exislencia de olras claves taxonomicas para diferenciar especies
- Parafacialia desnuda; dos setas preintraalares ........ ...... ...... ..... .. . .
afrolropicales, nearticas y tropicales de Dipelra de importancia forense. Enlre elias estan la de
Dear 1985 la de Wells y Kurahashi 1987 y la de Rognes 2002. 4 Parafacialia setosa; setas preintraalares ausentes .... .... .. ... ..... ... .. .

5. Escuamula inferior total mente pilosa

- Escuamula inferior pilosa en la base, el resto sin pilosidad.

6. Espiraculo protoracico y escuamula inferior blancos .... .. ...... .. ...... .

- Espiracu lo protoracico y escuamula inferior cas tarios .... .......... ... ..

7. Setas estigmaticas ausentes; 4- 6 setas propleurales; Bucca amari

- Una seta estigmatica robusta; una seta propleural y a veces otra peql
.. ..... ..... - .... .... ... ... " .. .. ..... . " " ... ................. , ... ........... .

8, Parafrontalia con pelos claros en el exterior de la hilera frontal de se


patas amarillo - anaranjadas; hembras con una 0 dos setas fronto

- Parafrontalia con pelos negros en el exterior de la hilera lrontal de SE

patas negras; hembra sin seta Ironto orbital proclinada ..

9.Parafacialia setosa ; sin mech6n paracuamal; escuamula inferior Pile

- Parafacialaia desnuda;con mech6n parascuamal; escuamula Inferior dl

ENTOMOLOGIA FORENSB
62
Sistematica M lecular

lave taxoIlt)mi L para t<l~ espnci s de tel tamili.l .llliphoridae PI' -.cntes 'n
existe una clave taxon6mica que permite diferenciar especies
Argentina . (Juan Clrl()~ Marilui" 200::?)
6gicas de larvas de tercer instar ( Wells et al. 1999).
m trabajo exhaustivo en relaci6n con las genitalias Y existe una

H con los mismos (Rognes y Paerson 2004).

1. NeNadura basal setosa en la cara superior ; ampolla mayor reniforme ............ ......... .... .. 2

lica de barrido de los huevos senalara que no existen diferencias


NeNadura basal desnuda en la cara superior ; ampolla mayor ovalada ... ... ...... ........ .. ... .......... 9

~ como diagn6sticas de especie (David et al. 2003).

2. NeNadura basal setosa en la cara Inferior; arista plumosa en 1/5 a 1/3 0 mas de- su longitud
I clave que describa las especies que se encuentran en Colombia.

. ... Sarconesia ch/orogaster


icas ara la identificaci6n de formas adultas de las especies de la
\rge~ina, elaborada par Juan Carlos Mariluis (2002)y la segunda - NeNadura basal desnuda en la cara inferior; arista plumosa en los 2/3 0 mas de su

Aello (2003), para especies encontradas en el BrasIl. longitud .... .... .. ...... .. ...... .... ...... .... .... .... ......... ...... ... ... .. .. .... ..... ............ ........ ... .. ... ........ ... ... ..... .... 3
la obtenci6n Y utilizaci6n de caracteres moleculares como ADN
3. Pal po largo , normal......... ... . ... .... ...... ....... ........... .......... ....... .......... ................ .. .. .. ..... . .4

In de las especies y razas geograficas.


stencia de otras claves taxon6micas para diferenciar e~p~ci~s - Parafacialia desnuda ; dos setas preintraalares ..... .. ... ... .. .... .. .. ......... . . Para/ueil/ia pseudo/yeea

cales de Dipetra de importancia forense. Entre elias estan a e 4 Parafacialia setosa; setas preintraalares ausentes .......... .. .. .. .................... ...... .... .. ....... .... .. .. 5

lshi 1987 Y la de Rognes 2002.


5. Escuamula inferior total mente pilosa . .............. ... .. ..... .. .. ........ . . .... 6

Escuamula inferior pilosa en la base , el resto sin pilosidad....... .... .. .. Compsomyiops fu/vierura

6. Espiraculo protoracico y escuamula inferior blancos ...... .. .. ...... .. .. .. ......... ... . ... ... ........... .. .. .... 7

- Espiraculo protoracico y escuamula inferior castanos ... .. .. .. ........ Chrysomya megaeepha/a

7. Setas estigmaticas ausentes; 4- 6 setas propleurales; Bucca amarilla 0 anaranjada oscura


...... ................ .... . .. ........ ............... ........ ............. .. .... .. ... "... .......... .. ..... ... Chrysomya a/biceps

- Una seta estigmatica robusta ; una seta propleural y a veces otra pequena; Bucca negruzca
. . . . . . . . ...... . .. .. ................ .. ...... ................ ............. .. .. ......... .... ...... ................. Chrysomya eh/oropyga

8. Parafrontalia 'con pelos claros en el exterior de la hilera frontal de setas; macho con basicosta y
patas amarillo - anaranjadas; hembras con una 0 dos setas fronto - orbitales prociinadas
.......... .... .. .... ....... .. ... Coehliomya maeel/aria

- Parafrontalia con pelos negros en el exterior de la hilera frontal de setas; macho con basicosta y
patas negras; hembra sin seta fronto orbital prociinada .... ..... .. .. ... ..
.. .... ................ ..... ... ........ ... .. ........ ..... .. ..... Coehliomya hominivorax

9.Parafacialia setosa ; sin mech6n paracuamal; escuamula inferior Pilosa .... ......... ....... ..... .... 13

- Parafacialaia desnuda;con mech6n parascuamal ; escuamula Inferior desnuda .. ............... ... .. ......... 10

ENTOMO LOGlA F OREN E 63


Facultad de icncias

10.Con tres setas acrosticales postsutural s ...... .. ... ..... .. ... .. .. ...... .... ....... .... .. .. .. .. .. . ..... .. .. ...... ... 11
9. Tergito V sin cerdas discales ..... .. ... .... ....
- Con dos setas acrosticales postsuturales .. ... 12 . .. ... .. .... .. .
- Tergito V con cerdas discales . . . . . . . . . . . . . . . . . . . , .
11 . Metaesterno, entre las patas medi nas y posteriores setu loso ..... .... ...... .... Phaenicia sericata

Metaesterno, entre las patas medianas y posteriores desnudo . ' . .. Phaenicia cuprina 10. Ma rgen porterior de los tergitos abdominales con bandas violet
...... , ..... ...... .
12. Torax , en vision posteridr, con la parte anterior del pronoto sin pru inosidad entre los callos ... . . . . . . . . . . ........ .... ... .. .... ... .....

humerales .. Phaenicia c/uvia Margen posterior de los tergitos abdominales sin bandas violetas

13. Bucca totalmente negra; basicos a neg ra .. .... .. ....... ..... .. ..... .. .. ... .. . . Calliphora nigribasis
11 . Tergito IV con una ser' I
Ie comp eta de cerdas marginales; tibias mE
... .... ... .... ..... ..

Tomado textualmente de Rossi et.al 2002 - Tergito IV solamente con cerdas latera-marginales .

12. Alas con fuertes manchas Oscuras a 10 largo de la nervadura costal ..


.............. ...... "

. . . . ... ........... . . . .. . ... . ..... . . . . ..... , .. . . . .

pre"t'nte" en Rr<l"i l. (Ruben... pinto loll' \,1 ·11 ) 20(3) Alas ligeramente y uniformemente incrustradas

13.Cerdas preacrosticales ausentes; cerda post-humeral presenfe


. . . . .. . . . .. . . . ... . . . . •
1. Nervadura media con fuerte cu rvatura ; estigma superior del t6rax con un unico operc ulo . .. ....... .. .... .. .H.
.. .. . . .... ... ... ... .. .. ..... . .... .. ... .. (Mesembrineflinae) ... .2 .~ .~~~~~ post-humeral ausente; Asas con mancha Oscura a 10 largo de

- Nervadura media, distintamente angulosa; estigma posteri or con dos operculos . .. .. ... . . .. .... 14
14. Base de la nervad d'
ura ra lal con pelos en parte dorsal ... ........ ..
2. Machos con una anchura de fren te casi como en las hem bras .. ... .. ... .... ..
.Albuquerquea latifrons (Mello, 1967) - Base de la nervadura radial desnuda dorsalmente
..... ..... .... .. " ....... .

- Machos con ancho de frente normal .. .3 15. Base de la nervadura radial pilosa ventral mente, !ejos de los pelos (

3. Patas en su mayor parte negras abdomen azul 0 verde metalico


.. ... ...... ... .. .. .. .. .. .. Laneela nigripes (Gulmaraes, 1977)
'" Sarconesia chi
- Patas en su mayor parte amarillosas ...... .. .. .. .. .. . .... 4
- Base de la nervadura radial sin pelos ventrales ; T6rax y abdomen verc

4. Callo humeral con 3 cerdas .(Mesemb rinella) ... .......... .5

16. Caliptera toraxica con pelos en toda la superficie dorsal ..


- Callo humeral con 2 cerdas ....... 9

- Caliptera toraxica desnuda, con pel os apenas en el tercio basal 0 en


5. Base de la nervadura radial con cilios en la parte uperior ..... ......... ...... ... ....... ... ... . ..... ... .. ... . .... .6
. . . . . . . .. . . . . . . . . . . . . . . .. . . . . . ... . . . .. ..
- Base de la nervadura ra dial desnuda en la parte superior ..... .. .. .... .. .. . ... . . .. ... ... .... .. 7 17. Estigma respiratorio toraxico anterior grisaseo;
machos con largas f
6.Esclerito subcostal ciliado .. . M. Beflardiana (Aldrich, 1992)
.... .... ...... ··· .......... C. n
- Esclerito subcostal desnudo . .. .. .. .. .... .. ... .. M. peregrina (Aldrich 1925) - Estigma respiratorio toraxico anterior blanco, los ojos de l macho sin fa

7. Abdomen con porosidad forman do manchas redondead s donde nacen los pelos . . . . . . . . .. ..• . . , ...... .. .

... ....... ..... . .. .... .. . . . . M. batesi (Aldrich. 1925) 18. Cerda estigmatica (abajo del estigma anterior) ausente

- Abdomen con porosidad uniformemente distribuida, cu ando est ' presente . .... ..... .. .... .8 .. ..... ...... ..
. .... .. .... . ·· · ··· ···· .. · .. .. ·.. ·· .............. · . ... .. .. ... C.,
8. Alas fuertemente incrustradas a 10 largo de la nervadura cos tal ... ........ .Semihyakina (Mello , 1967)
- Cerda estigrmatica presente " .. .. .. .... . .

... C.
. Alas uniforme y verdaderamente incrustradas .... ..... .. ... .. .. .. ... .. .... ...... M. bicolor (Fabricius, 1805)
19. Caliptera toraxica sin pelos en la parte dorsal . .... ... .. ..

64
Si tcm:iDca MulecWar

,uturales
" .11
9. Tergito V sin cerdas discales .. , .(Eumesembrinella). .. .. " .. """" ,10
,1 2

,uturales Tergito V con cerdas discales ,. ... (Huascaromusca)." ........."" .... 13


~ d iana s y posteriores setuloso "',. ,., Phaenicia sericata
1O. Margen porterior de los tergitos abdominales con bandas violetas
~d i anas ' res d esnudo ,. "" ". " ... ,, .. .. " ., Phaenicia cuprina
y post eno E pauciseta (Aldrich, 1922)
3. parte anterior del pronoto sin pruino~idad ent re los callos - Margen posterior de los tergitos abdominales sin bandas violetas . .. ,', ... ......... ... .. , ..,,11
.... .... ................. : ...... .......... .. ....... . .
,,. Phaenicia c/uvia
11, Tergito IV con una serie completa de cerdas marginales; tibias medias y posteriores negras
sta negra ." ' .. .. . " " ,," " " ... Calliphora nigribasis
d . " .. " .. .. •
' " ,.," " " .. , ......... ,.... .. " .,, " ' ''' ,E quadri/ineata(Fabricius , 1805)

- Tergito IV solamente con cerdas latero-marginales ., ., .. ... ....... .. .. .. ... ,12


Tomado textualmente de Rossi et.al 2002
12, Alas con fuertes manchas oscuras a 10 largo de la nervadura costal
,. E randa (walker, 1849)
ic ,)dulto~ d' lJs c'''P "ie~ de I. filmdid Calliphorid'lL'
Alas ligeramente y uniformemente incrustradas , ... E Besnoin (Seguy 1925)
pinto de Mello 2(03) 13,Cerdas preacrosticales ausentes; cerda post-humeral presente ... ,.... .." ...... ,," ...... ."" .. "
" ' .. ,,' " .. ,. H. aneiventris (Wiedemann , 1830) ,

-vatura; estigma superior del torax con un unico operculo - Cerda post-humeral ausente; Asas con mancha oscura a 10 largo de la nervadura costal
, ,, ,,,,,,,,,, . '. (Mesembrinellinae) ,. ' .. 2 "" ... H purpurata (Aldrich , 1922)

angulosa ; estigma posterior con dos opercu los .14 14, Base de la nervadura radial con pelos en parte dorsal ,.. (Chrysomyinae) , .... ,15

Ite casi como en las hembras . .. .. ,,, ..... Base de la nervadura radial desnuda dorsalmente ' ,(Calliphorinae) ... .. .. " .. .. ,31
.... ,,,,,,,,,.., Albuquerquea /atifrons (Mello, 1967)
15, Base de la nervadura radial pilosa ventralmente , lejos de los pelos dorsales; torax grisaseo y
.. 3
mal abdomen azul 0 verde metalico" " " ... ...... .. .... . . , Sareonesia ch/orogaster (wiedemann, 1830)
3.S ... . . . .. .. ... . ....... ... .... . ... . Lanee/a nigripes (Guimaraes , 1977)
Base de la nervadura radial sin pelos ventrales; T6rax y abdomen verde 0 azul metalico
.. 4 .... '" ,," " " 16
1I0sas ,.
,(Mesembrinella) ", .. , ." " " , ,, ...5 16, Caliptera toraxica con pelos en toda la superficie dorsal .. ,," "" .".". (Chrysomia)

.. .9 - Caliptera toraxica desnuda, con pelos apenas en el tercio basal 0 en la mitad interna
" .. ,"., .. ,',." .. ,." ... . .,.. ,.,""' ,.,.. ,.""., .19
,ncilio s en la parte superior .. " ,6

..... 7 17, Estigma respiratorio toraxico anterior grisaseo; machos con largas facetas en los ojos,
;nuda en la parte superi or " .
."", .. ",, .. , " " , , " " " , " ' , .... ,.... ..,,",," " , .,C, megaeepha/a (Fabricius , 1805)
M. Bellardiana (Aldrich, 1992)
- Estigma respiratorio toraxico anterior blanco, los oJos del macho sin facetas alargadas
, M. peregrina (Aldrich 1925) ,., ', .." .. '" ." ", .. "".18

lando manchas redondeadas donde nacen los pelos 18, Cerda estigmatica (abajo del estigma anterior) ausente ", .. , .. .. '
, M. batesi(Aldrich, 1925)
,C, a/biceps (Wiedemann, 1830)
) rmemente distribuida, cuando esta presente .. . ,", .... " .. ,.",8
- Cerda estig rmatica presente . ... C. putoria (Wiedemann , 1830)
s a 10 largo de la nervadura costal . .. ,Semihyaki na (Mello, 1967)
19, Caliptera toraxica sin pelos en la parte dorsal , .. 20
~ te incrustradas" " . . .... .. .. .. .... . .. M. bie% r (Fabricius, 1805)

lEN E ENTOMOLOGtA F REN5Il 65


Facultad de lencias

- Caliptera toraxica con pelos en el tercio basal 0 en la mitad interna .... .......... .. .................... .24
- Machos con parafacialia y bandas fronto-orbitales oscuras en fondo

20. Patas oscuras ; Alas con manchas en la regi6n costal .. reflejos brillantes y plate ados; estern ito V, con abertura posterior en Ie
pronunciada; caliptera superior con pelos en la superiicie dorsal ...
.... C/oroprocta idioidea (Robineau-Devoidy, 1830) .. Callintrogopsis costa/is (Towsend, 1935)

- Patas amarillas; Alas con manchas poco acentuadas en el tercio distal , siendo mas fuertes junto
a la neNadura costal.. ..................... (Hemilucilia) .. ...... ..... .... 21 29. Cerdas por-genales (barba) brancas y brillantes .

21. Macho con frente normal, sin cerda frontoorbital proclinada . . .. .22 - Cerdas pos-genales (barba) de color a.naranjada brillante .......

- Macho con la frente prominente, con cerdas frontoorbitales inclinadas ...... .. .. .......... .. .23 30.Frente y cara amarillosas. Frente del macho con 0,012 mm de and
amarilla en la mitad proximal.
22. T6rax con escleritos pleurales amarillosos; espiraculos anterior y posterior amarillos.
.......... . . ... H. Segmentaria (Fabricius, 1805) 31. Caliptera inferior desnuda en su parte superior; parafacialia gener,
desnuda; mech6n de pelos parascuamal presente ........ (Ll
T6rax con escleritos pleurales totalmente verde 0 azul metalico; espiraculo anterior amarilloso y
posterior castano ....................... . ..... H. Semidiaphana (Rondani, 1850) - Caliptera inferior pilossa; parafacialia parcialmente setosa;mech6n
ausente .............. ..................... .. (Calliph
23. Abdomen verde 0 azul metalico, con los terguitos I y II amarillosos, con una estrecha banda
longitudinal mediana terminando en la margen posterior del tergito III ............. .. ............... ... 32. Esclerito subcostal con cerdas erectas; triangulo ocelar grande alcc

.H. Souza/opesi (Mello, 1972) distancia hasta la lunula. . ......... ... (Phaenicia) ..

24. Palpos cortos y muy delgados . .. (Cochliomyia). . . .. .... ........ . ...25 33. Tres cerdas acrosticales pos-suturales

- Palpos normales .. .... ... ..... ..... .. ...... .. .... . .. ..26 - Dos cerdas acrosticales pos suturales ........... ..

25.Tergito V con pilosidad densa y clara, ventral mente C. macel/aria (Fabricius 1805)
34. Color cobrizo en todo el cuerpo. Segmentos genltales bien desarrc

- Tergito V con pilosidad oscura ventralmente .. C hominivorax (Cocquerel, 1858)

26. Patas en su mayor parte rojizas; cerdas pre-dorsocentrales ausentes; pelos en el tercio - Color verde azul metalico; segmentos genitales pequenos ............. .

basal de la caliptera toraxica ............ .... ..... .. ... ............. Compsomyiops fulvicrura (R. D., 1830) 35. Coloracion del cuerpo azul oscura con porosidad negra; frente del
de ancho de la cabeza. Cerdas acrosticales: 3 presuturales ........
- Patas oscurecidas; cerdas pre-dorsocentrales presentes; pelos en la mitad interna de la ..... .. Calliphora Vicil
Caliptera toraxica ............ .. ........ ... ................ . .. (Paralucilia) .. ......... . .. ...... 27 - Coloraci6n del cuerpo azul oscura con porosidad negra; frente del m
27. Mesonoto con brillo metalico purpura 0 verde azulado; visto oblicuamente, por detras, el la cabeza , cerdas acrosticales: 2 pre-suturales y 3 pos-suturales

(pre-escuto) presenta porosidad plateada densa, sin bandas longitudinales distinguibles


... ......... .......... 28
Tomada textualmemte de Mello
- Mesonoto purpura, azul 0 verde, sin embargo sin brillo metalico; visto oblicuamente por

detras presenta bandas oscuras distintas, separadas por bandas de porosidad ceniza plateada
... .29

28. Machos con parafacialia y bandas fronto-orbitales oscuras en fondo tam bien oscuro,

sin reflejos negros brillantes; el estern ito V no esta fuertemente hendido, posteriormente
en forma de V. Caliptera superior desnuda .. .. P fu/vinota (Bigot , 1877)

ENTOMOLOGIA FORENSE
66
Sistematica Molecular

... . ...... .... .24


- Machos con parafacialia y bandas fronto-orbitales oscuras en fondo del mismo color, con
n el tercio basal 0 en la mitad interna .
reflejos brillantes y plateados; esternito V, con abertura posterior en forma de V bien
las en la regi6n costal .... .... pronunciada; caliptera superior con pelos en la superiicie dorsal
Callintrogopsis costalis (Towsend , 1935)
u-Devoidy, 1830) .. .. .... .. .. .. . .. .. ................ .... .. P Nigrofacialis (Mello, 1969)

el tercio distal, siendo mas fuertes junto


~chas acentu~~~~.~n....
29. Cerdas por-genales (barba) brancas y brillantes ... P Borgmeieri (Mello, 1969)
poco .(Hemilucilia).. . .. 21
- Cerdas pos-genales (barba) de color anaranjada brillante ... .30
.. , ... .. 22
n cerda frontoorbital proclinada ....
30.Frente y cara amarillosas. Frente del macho con 0,012 mm de ancho de la cabeza . Caliptera
. . . . . . .. ........ .. ....
.... 23
ente , con cerdas frontoorbitales inclinadas . amarilla en la mitad proximal" ..... .. ... P. paraensis (Mello, 1969)

les amariliosoS ; espiraculos anterior y posterior amarillos.: . . 31. Caliptera inferior desnuda en su parte superior; parafacialia generalmente totalmente
.. .... , .... .. .... ..... .... . H. Segmentaria (FabricIus, 1805) desnuda; mech6n de pelos parascuamal presente . .... .(Luciliini) .. ... .. .... .. .... ... 32
azul metalico' espiraculo anterior amarilloso Y
les tota Imen te verde 0 ' . - Caliptera inferior pilossa ; parafacialia parcialmente setosa;mech6n de pel os pa rasscuamal
H. Semidiaphana (Rondanl, 1850)
ausente " .. ..... " ... ..... .. . .... .. ... .. .. . ..(Calliphorini) . . .35

:alico, con los terguitos I Y 11 amariliosoS , con una estrecha banda 32. Esclerito subcostal con cerda s erectas; triangulo ocelar grande alcanzando la mitad de la
"ndo en la margen posterior del tergito 111 . distancia hasta la lunula ". ..,,'.. ... .(Phaenicia) . " ... "" " .... .33
.. . H Souzalopesi (Mello, 1972)
33. Tres cerdas acrosticales pos-suturales .34
,,25
.. .. ... .... . . (Cochliomyia)
"dos - Dos cerdas acrosticales pos suturales .. .. Phaenicia eximia (1 819)
26
34. Color cobrizo en todo el cuerpo. Segmentos genitales bien desarrollados " ."
C. macellaria (Fabricius 1805)
Isa y clara, ventralmente
............ ... .... " " .. P cuprina (Wiedemann, 1819)
"C. hominivorax (Cocquerel , 1858)
;cura ventralmente ... " ... .. .
- Color verde azul metcilico; segmentos genitales pequeFios .... " .. P Sericata (Meigen, 1826)
rOJizas; cerdas pre-dorsocentrales ausentes; pelos en el tercio
35. Coloracion del cuerpo azul oscura con porosidad negra; frente del macho midiendo 0,07 mm
........ Compsomyiops fulvicrura (R. D. , 1830)
Ixica ." ...... de ancho de la cabeza . Cerdas acrostic ales: 3 presuturales ..... . ..... ... .......... .. .... .. ........ .

...... ..... ...... .." ..... .. " .... .... .. .. ....... " ........ .. .. Calliphora Vicina (Robineau - Devoidy, 1830)

as pre-dorsocentrales presentes ; pelos en la mitad interna de la

... ... .. (Paralucilia) ..... . ..27 - COloraci6n del cuerpo azul oscura con porosidad negra; frente del macho 0,05 mm de ancho de
la cabeza, cerdas acrosticales : 2 pre-suturales y 3 pos-suturales
.alico purpura 0 verde azulado ; visto oblicuamente , por detras, el ... ......... .. .. . ......... ... ..... " .... " . . . .. ... . ... .... .. .... " ........ .. Calliphora lopesi (Mello, 1962)
lorosidad plateada densa, sin bandas longitudinales distinguibles ...
...28
Tomada textllalmemte de Me llo 2003. Tradllcida por los autores.
10 verde , sin embargo sin brillo metalico; visto oblicuamente por

oscuras distintas, separadas por bandas de porosidad ceniza PI~tea~~9


~ . ... ... ... "'

\a y bandas fronto-orbitales oscuras en fondo tambien oscuro,

' fuertemente hendido, posteriormente


ri ll antes; el esternito V no esta
P fulvinota (Bigot , 1877)
,tera superior desnuda ....

ENlOMOLOGiA FORENSE 67
FORENSI!
Facultad de Ciencias

IIustraci6n de algunos caracteres morfol6gicos diagnosticos para el Orden

Diptera utilizados en las claves taxon6micas

Fig 4: Vena cion longitudinal de las alas. 1. caliptera inferior; 2. calfptera superior; 3. tegula;
4. basicosta; C. costa; Sc subcosta; R radio; M media.

Fig. 7. Difrentes aparatos bucales de in ectos

Fig 5: Tipos de antenas. filiforme, plumosa, moniliforme, setacea, capitada, aristada.

ENTOMOLOGiA FORENSE
68
' is[emarica i\ {olecubr

3.racteres morfologicos diagnosticos para el Orden


:ilizados en las claves taxonomicas

le las alas. 1. caliptera inferior; 2. caliptera superior; 3. tegula;


:a; C. costa; Sc subcosta; R radio; M media.

I
dllftl.pr...m"

Fig. 7. Difrentes aparatos bu cal s de insectos dip teros.

filiforme, plumosa, moniliforme, se tacea, capitada, aristada .


Diferencia de 10 espiraculo caud
en la familia de diptero Sarcopha
y Calliph ridae.

Calliphoridae

Peritrerno cerrndo

Cica triz ecd isia

pjra ulo ca
paralel( ~

Sarcophagidae
Peritremo Clbierto

Sin cica triz ecd lsi a I

E piniculo caudal de Lucillia illustris,


Calliphoridae

Peritremo ccrrud

o prcsi6n d I peri tremo entre el


spiracul m d io y I ma.:, e terno

icatriz c disial

E NTOMOLOGIA F OREN E
Si tematica Molecular

Diferencia de los espinkul 5 caudale

en las familia de dipter arcophagida

y Calliphoridae.

Calliphoridae

Cicatriz

Espir<kulos casi
paralelo

Sarcophagidae
Peritremo abierto

Sin cicatriL ecdbial

Espinkulo caudal de Lucillia illLlstri I

Calliphoridae

Peritr rno cerrado

epresi6n del peritrem ) entr " 1:1


espirckulo medio y el ma e tern

Cicatriz ecdisial

ENTOMOLcx:;lA FORENSE 71
Facultad de Ciencias

Espiraculo caudal de Chrysomyia rufifacies , ANAu I DEDATO


OMOLOGIC

Calliphoridae Existen diversas razones para emplear insectos y otros artropodos cor
muerte.
Los insectos son generalmente los primeros en descubrir el cadaver, er
zo por ocultar el cuerpo. Las moscas Calliphoridae y Sarcophagidae a
larvas sobre un cadaver poco tiempo despues de haber ocurrido la
Depresion del peritrerno evidencia del tiempo de descomposicion.
a ambos lados del Los insectos arriban a un cadaver en una secuencia predecible, 10 qu
llama sucesion ecologica ; asi, la ausencia de insectos donde deberic
espiraculo medio bien evidencia invaluable en cualquier investigacion que merece inves

EI principal papel del entomologo forense consiste en determinar con


cuando ocurrio la muerte de un individuo , esta informacion es el prine
investigacion criminal y constituye la aplicacion tradicional de la Enton
Cicatriz ecdisial
EL IPM se basa en las estimaciones del tiempo minimo de actividad d
Peritrerno muy engrosado en descomposicion.
Un LP.M. preciso es de vital importancia en las investigaciones de homi
los sospechosos y brinda ayuda en la identificacion de un cadaver er
desaparecidas conocidas. La estimacion de IPM suministrada por el E
serie de presunciones que son validas, pero un error en cualquiera dE
sesgar la exactitud del tiempo estimado.
Para determinar el tiempo transcurrido desde la muerte usando la e'
Espiracu10 caudal de Sarcophaga sp. aplican dos metodos. EI primero utiliza la edad de las larvas y la tasa d
EI segundo utiliza la sucesion de insectos en la descomposicion dE
pueden utilizarse por separado 0 conjuntamente dependiendo del ti
Sarcophagidae estudiando. Por 10 general , en las primeras fases de la descompm:
basan en el estudio del crecimiento de una 0 dos especies de insecto~
En las fases mas avanzadas se utiliza la composicion y grado de creci
artropodos encontrada en el cuerpo y se compara con patrones con()(
para el habitat y las condiciones mas proximas.
Estimar el LP.M. involucra una serie de tiempos entre maximos y n
reritr m abi rto muerte y el descubrimiento del cadaver ademas del conocimiento taxol
con exactitud especies con tiempos.
EI tiempo maximo esta determinado por las especies de artropodos I
del tiempo" disponibles para la actividad de estas especies. Conocer
especies, puede ser uti I para hacer una estimacion preliminar del tie l
expuesto.
Las "ventanas del tiempo" hacen referencia a las condiciones climatil
Depr ion prohmda del p ritrem
de temperatura, humedad relativa y exposicion solar.
a ambo lados del espiraculo medio
EI intervalo minimo es determinado estimando la edad de desarrollo
encontrados y colectados al descubrir el cadaver.
A veces las condiciones climaticas y la presencia de algunos vertebra
puede dificultar la estimacion del LP.M. Esto, debido a que puede afe.
Sin ciea triz ecdisial comunidad de artropodos de importancia forense.

ENTOMOLOGIA FORENSE
72
Sistematica Mo lecular

ANAuST DE DATOS ENT MOLOGICO


a1 de Chrysomyia rufifacies ,

Existen diversas razones para emplear insectos y otros artropodos como evidencia en estudios de

muerte.

Los insectos son general mente los pri meros en descubrir el cadaver, en especial si hubo un esfuer­

zo por ocultar el cuerpo . Las moscas Calliphoridae y Sarcophagidae arriban y dejan sus huevos 0

larvas sobre un cadaver poco tiempo despues de haber ocurrido la muerte apareciendo como

evidencia del tiempo de descomposici6n .

Los insectos arriban a un cadaver en una secuencia predecible, 10 que en terminos biol6gicos se

llama sucesi6n ecol6gica ; asi, la ausencia de insectos donde deberfan estar presentes, es tam­

bien evidencia invaluable en cualquier investigaci6n que merece investigarse.

EI principal papel del entom610go forense consisteen determinar con la mayor exactitud posible

cuando ocurri6 la muerte de un individuo, esta informacion es el principal elemento en cualquier

investigaci6n criminal y constituye la aplicaci6n tradicional de la Entomologia forense.

EL IPM se basa en las estimaciones del tiempo minimo de actividad de los insectos en un cuerpo

en descomposici6n .

'osado Un I.P.M. preciso es de vital importancia en las investigaciones de homicidio ya que permite reducir

los sospechosos y brinda ayuda en la identificaci6n de un cadaver en relaci6n con las personas

desaparecidas conocidas. La estimaci6n de IPM suministrada por el entom610go se basa en una

serie de presunciones que son validas , pero un error en cualquiera de esas presunciones puede

sesgar la exactitud del tiempo estimado.

Para determinar el tiempo transcurrido desde la muerte usando la evidencia de los insectos se

ludal de Sarcophaga sp. aplican dos metodos . EI primero utiliza la edad de las larvas y la tasa de desarrollo de las mismas.

EI segundo utiliza la sucesi6n de insectos en la descomposici6n del cuerpo. Ambos metodos

pueden utilizarse por separado 0 conjuntamente dependiendo del tipo de restos que se esten

estudiando. Por 10 general , en las primeras fases de la descomposici6n, las estimaciones se

basan en el estudio del crecimiento de una 0 dos especies de insectos, particularmente dfpteros.

En las fases mas avanzadas se utiliza la composici6n y grado de crecimiento de la comunidad de

artropodos encontrada en el cuerpo y se com para con patrones conocidos de sucesi6n de fauna

para el habitat y las condiciones mas pr6ximas.

Estimar el I.P.M . involucra una serie de tiempos entre maximos y minimos probables entre la

muerte y el descubrimiento del cadaver ademas del conocimiento taxonomico que permita asociar

abierto con exactitud especies con tiempos.

EI tiempo maximo esta determinado por las especies de artr6podos presentes en las "ventanas

del tiempo" disponibles para la actividad de estas especies . Conocer los habitos y la mezda de

especies, puede ser util para hacer una estimacion preliminar del tiempo que el cLJerpo ha sido

expuesto.

Las "ventanas del tiempo" hacen referencia a las condiciones dimaticas, usual mente de niveles

de temperatu ra , humedad relativa y exposici6n solar.

el peritrem

EI intervalo minimo es determinado estimando la edad de desarrollo de los insectos inmaduros

iracul m dio
encontrados y colectados al descubrir el cadaver.

A veces las condiciones climaticas y la presencia de algunos vertebrados carroiieros y hormigas

puede dificultar la estimaci6n dell.P.M. Esto, debido a que puede afectarse la composicion de la

comunidad de artr6podos de importancia forense.

riz ecdisial

E NTOMOLOGiA FORENSE 73
Facultad de Ciencias
. . tos y como pueden alterar el proceso de crecimiento.
Clas en !nsec ., d'
Los estudios realizados en ellaboratorio, raramente duplican las condiciones asociadas con cual­ ,, ., ro one la identificacl~n de ca ave
quier investigaci6n de muerte , pero los estudios realizados en exteriores en condiciones ambienta­
Con base en esta aplicaclon tamble~ seJ alFrnentarse de los telldo s del ca~
les y con las especies locales, pueden constituir una mejor referencia.
ec
los mismos que se extrae del.!ns °fuente de obtenci6n de ADN cuando c
hemolinfa del insecto se convlerte en
En los ultimos ailos, se ha logrado avanzar significativamente en las tecnicas y metodos para la
os 0 negativos para ADN.
determinaci6n del IPM. Entre los trabajos mas significativos estan los (Schoenely et.al., 1991)
poe . ., resenta un conjunto de circunstan<
qienes desarrollaron un protocolo para recolecci6n de especfmenes relacionados con los cadave­
ada caso de investlgaclo n de muerteops'lciones y principios comunes que I
C
. .sten unas sup
res. Adicionalmente, formularon un algoritmo para calcular ellPM a partir de datos de sucesi6n de
10 hacen unlcO, pero e,xl

artr6podos.
para cada investigaclon .

Wells y LaMotte 1995, desarrollaron un modelo estadistico que correlaciona el peso y la edad de

las larvas. Igualmente, (Von Zuben et.a/1996) propusieron un modelo matematico para estudiar la
Para analizar los dal )s:
dispersi6n de las mismas en estado post alimentario. Tal aspecto es de gran relevancia dado que

su desconocimiento puede lIevar a subestimar eIIPM. Por ejemplo, al no considerarse las pupas
. descomposlci6n de los restos.
mas alejadas del cadaver, se puede omitir informaci6n sobre los individuos mas viejos afectando
Primero determine la fase de I fases son unicamente una
elcalculo del IPM .
1, Manteng a siempre presente qd~fe raeSntes partes de un cadaver P
. ., que las Ie
Una prioridad en el Neotr6pico es construir las lineas base de variaci6n en peso y crecimiento para
la descompOSICIO n y. . , ' mo tiempO. ,
las especies en funci6n de la temperatura . Para conocer la descripci6n detallada de una metodolo­
fases de descomposl~lon al mls cie si es posible) los especlm
pe
dentifique (familia, genero y es .
gia reciente de estimaci6n deilPM en el Neotr6pico (Brasil), considerando las variaciones de tem­
2. I en ellabora tono. Orr
peratura diarias y el microclima alrededor del cadaver, remitirse a Oliveira y Mello 2004.
dencia Y crie algu~os . , 'fica estacional de los especi
n
Determine la distnbuclo geog
ra
~ grandes. Registr~ estas
3. ro II dades de los mas .a I
En Colombia, se han construido en laboratorio, curvas de crecimiento para Calliphora sp y Lucillia
dos de desar 0 Y e. I cadaver 0 durante la autopsl ,
sericata. Estas moscas, aparecen como las primeras colonizadoras en la ciudad de Bogota.
Durante el levantaml~n~o de insectOs Y la forma Y la cau~a e
No obstante, los datos precisos sobre sus ciclos de vida, no estan publicados y los resultados
4. cuerpo hay may?r ~ctlvldad de ante mortem de venenos, tOXI~
parciales fueron presentados en un congreso de la Sociedad Colombiana de Entomologia, (Camacho
5. Pregunte si haY. lndl~IOr~~ed~s~~jidO al ser analizadas muestr,
2003).
las larvas al altmen a I t sa de desarrollo larval.
usadas que pueden afectar a a
La identificaci6n de las especies de mayor ocurrencia en nuestro medio, la construcci6n de tablas
. . sectos en las escenas de muerte, de
de vida y las variaciones a nivel regional y local son una prioridad de investigaci6n para Colombia
No olvide que la ausencla d~!n al de eventos " post mortem" , 10 an
antes de que los insectos puedan usarse de rutina para la determinaci6n deiIPM .
ocurrir, indica una secuenc,la tn~:~ible para los insectos . Sin embar~~
fue mantenido en un lug ar !nac ceso de descomposici6n es. u~a pO~1 I
La evidencia entomol6gica tambien puede aportar informaci6n en relaci6n con el sitio donde ocurri6
insectos a traves de todo .el pro cadaver en descomposlclon: aun E
la muerte. Los insectos y los acaros lIegan a establecerse como poblaciones en ciertas partes del
insectos son capaces de Invadlr un onde a los diferentes artropodo :
cadaver y la ausencia de dichas poblaciones sugiere que el cadaver fue removido y que la muerte
fase de descomposici6n no corresp har que el proceso ha sido Inte",
ocurri6 en otro sitio 0 que los restos fueron inaccesibles a los insectos.
colectados , entonces se debe sospec
Es necesario diferenciar los insectos asociados a las zonas rurales y urbanas y los diferentes
manera. f" tes elementos para realizar
patrones cuando se trata de lugares abiertos 0 cerrados 0 cuando el cadaver se encuentra en
' I go no posee su IClen .,
cuando el entomo 0 d suministrar informaCion .
ecosistemas particulares, como acuaticos por ejemplo.
investigaci6n, debe abstenerse e

La evidencia entomol6gica aporta elementos que permiten dilucidar la forma en que ocurri6 la muer­

te, ya que los sitios corporales don de se concentra la mayor actividad de insectos , a menudo

reflejan lugares de lesiones ante mortem.

La detecci6n de drogas y metabolitos en insectos conocida como entomotoxicologia, es una apli­

caci6n que permite identificar sustancias t6xicas involucradas en la muerte .

La utilizaci6n de larvas de moscas en investigaciones toxicol6gicas en cadaveres fue propuesta por

Beyer et.al. (1980). Goff et.al. (1989). Estos autores fueron los primeros en encontrar coca ina en

larvas de insectos asociados con la descomposici6n de cadaveres.

Sustancias como morfina, cocaina, diazepan, y antidepresivos como amitriptilina y nortriptilina, se

han detectado en insectos por medio de metodos inmuhohistoquimicos . Sin embargo, en el corto

plazo es necesario incurrir en estudios para precisar los niveles de acumulaci6n de dichas sustan­

ENTOMOLOGIA Fo 15£
74
Sistematica Molecular

iDrio, raramente duphcan


. Ias con d'IClones
. . das con cua I-
asocla
cias en insectos y como pueden alterar el proceso de crecimiento.
s estudios realizados en exteriores en condiciones ambienta­
Con base en esta aplicacion tam bien se propone la identificacion de cadaveres mediante el ADN de
~nconstituir una mejor referencia .
los mismos que se extrae del insecto. AI alimentarse de los tejidos del cadaver y de sus celulas , la
vanzar significativamente en las tecnicas y metodos para la hemolinfa del insecta se convierte en fuente de obtencion de ADN cuando los restos del cadaver son
lbajos mas significativos estan los (Schoenely et.a/., 1991) pocos 0 negativos paraADN.
'a recoleccion de especfmenes relacionados con los cadave­
Igoritmo para calcular ellPM a partir de datos de sucesi6n de Cada caso de investigacion de muerte presenta un conjunto de circunstancias y peculiaridades que
10 hacen unico, pero existen unas suposiciones y principios comunes que deben tenerse en cuenta
un modelo estadistico que correlaciona el peso y la edad de para cad a investigaci6n.
t.a/1996) propusieron un modelo matematico para estudiar la
Jost alimentario. Tal aspecto es de gran relevancia dado que Par.:! an.:!lizar I dato. :
ubestimar eIIPM . Por ejemplo, al no considerarse las pupas
omitir informacion sobre los individuos mas viejos afectando 1. Primero determine la fase de descomposicion de los restos.
Mantenga siempre presente que las fases son unicamente una simple caracterizacion de
lstruir las lineas base de variacion en peso y crecimiento para la descomposici6n y que las diferentes partes de un cadaver pueden estar en diferentes
ltura. Para conocer la descripcion detallada de una metodolo­ fases de descomposicion al mismo tiempo.
1 el Neotropico (Brasil), considerando las variaciones de tem­ 2. Identifique (familia , genero y especie si es posible) los especfmenes colectados como evi­
edor del cadaver, remitirse a Oliveira y Mello 2004. dencia y crie algunos en ellaboratorio.
3. Determine la distribuci6n geografica y estacional de los especimenes colectados y los esta­
3.boratorio, curvas de crecimiento para Calliphora sp y Lucillia dos de desarrollo y edades de los mas grandes. Registre estas identificaciones.
)mo las primeras colonizadoras en la ciudad de Bogota. 4. Durante el levantamiento del cadaver 0 durante la autopsia, determine en que sitios del
Ire sus ciclos de vida, no estan publicados y los resultados cuerpo hay mayor actividad de insectos y la forma y la causa de la muerte.
'ngreso de la Sociedad Colombiana de Entomologia, (Camacho 5. Pregunte si hay indicios de usa, ante mortem de venenos, t6xicos, drogas 0 alcohol, ya que
las larvas al alimentarse de tejido, al ser analizadas muestran trazos de las sustancias
usadas que pueden afectar la tasa de desarrollo larval.
Tlayor ocurrencia en nuestro medio, la construcci6n de tab las
)nal y local son una prioridad de investigacion para Colombia No olvide que la ausencia de insectos en las escenas de Imuerte, donde general mente deberian

wse de rutina para la determinacion deiIPM . ocurrir, indica una secuencia inusual de eventos "post mortem» , 10 anterior sugiere que el cadaver

fue mantenido en un lugar inaccesible para los insectos. Sin embargo, la exclusi6n completa de los

uede aportar informacion en relaci6n con el sitio donde ocurri6 insectos a traves de todo el proceso de descomposicion es una posibilidad muy remota , por que los

legan a establecerse como poblaciones en ciertas partes del insectos son capaces de invadir un cadaver en descomposici6n, aun en condiciones extremas. Si la

aciones sugiere que el cadaver fue removido y que la muerte fase de descomposici6n no corresponde a los diferentes artropodos y a la edad de los insectos

ron inaccesibles a los insectos . colectados, entonces se debe sospechar que el proceso Iha sido intervenido 0 modificado en alguna

asociados a las zonas rurales y urbanas y los diferentes


manera.

abiertos 0 cerrados 0 cuando el cadaver se encuentra en


por ejemplo. Cuando el entom610go no posee suficientes elementos para realizar aportes significativos en una

investigacion, debe abstenerse de suministrar informacion.

que permiten dilucidar la forma en que ocurri6 la muer­


""' ",ntr,<,
se concentra la mayor actividad de insectos, a menudo

. en insectos conocida como entomotoxicologia, es una apli­


ias t6xicas involucradas en la muerte.
investigaciones toxicologicas en cadaveres fue propuesta por
. Estos autores fueron los primeros en encontrar cocaina en
mposicion de cadaveres.
lIa~:t::ual , y antidepresivos como amitriptilina y nortriptilina, se
de metodos inmuhohistoquimicos. Sin embargo, en el corto
para precisar los niveles de acumulacion de dichas sustan-

E NTOMOLCX:;lA FORENSE 75
Sistematica Molecular

Desde 1985 la identificaci6n de material biol6gico con base en ADN es una poderosa herramienta
para las investigaciones en medicina forense.

Aunque las metodologfas moleculares son de uso relativamente reciente , para las Ciencias forenses

yen particular para la entomologfa forense existen en la actualidad aplicaciones muy importantes

basadas en la utilizaci6n de moleculas como el ADN.

Las moleculas y en particular el ADN, poseen caracterfsticas como la resistencia a la degradacion

ambiental, la particularidad del organismo de cual se obtienen y la cantidad y calidad de informa­

cion que proveen. Estas caracterfsticas las hacen deseables para tip,iflicar e identificar con precision

cualquier organismo.

EI ADN utilizado en entomologfa forense se obtiene del nucleo de las celulas de los insectos 0 de

las mitocondrias, organelas involucradas con los procesos energeticos de la celula. Igualmente, es

posible aislar e lidentificar el ADN della sangre presente en el tracto digestivo de un insecta que se

ha alimentado sobre una persona 0 animal. Por 10 tanto, las tecnicas moleculares tienen gran

utji,idad en la identificacion taxonomica de los insectos 0 artropodos de importancia forense y en el

establecimiento de relaciones de asociacion entre una persona y su atacante.

Las heces de los insectos, los puparios, y los restos de los mismos, se constituyen en fuente

importante de ADN permitiendo asociaciones entre organismos sin necesidad de "observar" el con- •

tacto entre ellos.

Hasta hace algun tiempo existfan pocos trabajos publicados sobre la utilizacion de ADN por

entomologos forenses; sin embargo, en los ultimos arios esta situacion ha cambiado de forma

dramatica. Brasil y Colombia no han side ajenos a la implementacion de estas tecnicas que para

los tiempos actuales no son tan complejas ni costosas como se cree. (Ver protocolos al final) .

Vale la pena aclarar que como es obvio Estados Unidos, Alemania, Francia, y Japan en razon de su

desarrollo y capacidades tecnologicas, poseen los mayores avances en tecnicas moleculares rela­

cionadas con la entomologfa forense y validacion como pruebas en medicina legal.

En el Neotropico, las aplicaciones moleculares de la entomologfa constituyen un area de gran

potencial para la Entomologia forense .

EI ADN mitocondrial por su forma de herencia materna, permite relacionar la variabilidad genetica

con la distribucion geografica. En Entomologfa forense y en especial para estudiar moscas de la

familia Calliphoridae, se han empleado metodologias moleculares para amplificar la region de con­

trol y el gen Citocromo oxidasa y Citocromo B. Con base en estos tres genes se ha podido tipificar

razas geogrcificas de aprox'imadamente 10 especies de Diptera de importancia forense de diferen­

tes pafses y razas geograficas de dos especies en Colombia y Brasil.

En cuanto al ADN nuclear se ha utilizado principal mente espaciadores entre genes ITS y ADN total

(nucleo y mitocondrias) amplificado al azar, RAPDS.

La identificacion taxonomica de insectos utilizados para estimar eIIPM, se realiza generalmente

con base en caracteres mortologicos. Cuando se colectan adultos estos se identifican hasta la

categorfa de familia y especie si es posible, en este caso los caracteres diagnosticos son mas

evidentes que cuando se trata de estados inmaduros en los cuales es tambien dificilliegar hasta

especie.

En las escenas de muerte, tambien se colectan huevos 0 larvas que son lIevadas allaboratorio para

criarlas hasta obtener adultos. Lo anterior implica el establecimiento exitoso de crfas con la nece­

sidad de un tiempo adicional que permita la obtencion de los adultos y la identificaci6n de las

especies. En este caso puede haber dificultades no solo por la muerte de las larvas si no tambien

por la ausencia de caracteres diagnosticos de especie de los estados inmaduros.

ENTOMOLOGiA FORENSE 79
Facultad de Ciencias

. racterizar la probable variacion inti


EI ADN posibilita la identificaci6n adecuada de especies a partir de cualquiera de sus estados ya

Hace falta trabajar para precisar Y cf ra las del neotropico. Es de mer


sean inmaduros 0 adultos y aun de partes de estos asi esten parcialmente descompuestos.

estas y otras especies Y en especla pa aliza en tiempoS tan corto


La identificaci6n de las especies con base en el ADN puede realizarse gracias a la variabilidad
d' de tecnicas moleculares se re . .
entre individuos 0 especies que presenta el ADN 10 cual se conoce como polimorfismo. La variabi­
por me 10 . ' . ti aciones cnmtnales. ..
importante en termtnOS de Inves 9 t ' 'dad proveen informacion
lidad puede ser en la longitud de la secuencia de nucle6tidos que conforman la cadena del ADN 0
. dasconaneno n ,
Las dos tecnicas menclona .' directa de las mismas aparece co
en el orden de los pares de bases (Aden ina, Guanina, Timina , Citosina) . Una secuencia que iden­

cias de ADN P?r 10. que la obten~~; En articular las secuencias de AI


de espe~1 '. fPorenses se utiliza para precIs
tifica un organismo, 0 un grupo de organismos agregados en una categoria taxonomica, se conoce

como un marcador molecular.


Precisar la vanablhdad
. . en otras clenclas ' ..
aetualmente ruttnano . 'b . es partieulares especlflcas.

La mayoria de los trabajos realizados en entomologia forense consisten en encontrar y validar


cies y poblaciones eon dlstn uelon ,

marcadores especificos de especie. Los mayo res esfuerzos y progresos se han obtenido para

. ' modernas como FISH (Hibridc


moscas de las familias Calliphoridae y Sarcophagidae.
Trabajos con eromosom~s y tecnlcas . 2001)
Existen diversas tecnicas para buscar estos marcadores que varian en el tipo de ADN (nuclear 0
usado para este fin. (pa~lse - Maltempl. tra el potencial de las tecnic
mitocondrial , de cadena sencilla 0 doble, repetitivo 0 no, codificante 0 espaciador), la calidad y la
Como una aplieacion adlclonal se encu~nvolucrados en el metabolisl
cantidad de ADN obtenido y los costos.
onoeer los genes tn ,
sian de genes para c endencia en entomotoxiCologla. .
Entre las tecnicas mas usadas estan los RAPDS " amplificaci6n al azar de ADN polim6rfico», los

metabolitos 10 cual es de tr.asc d' lara identificar moseas de Calli


Las seeuencias de ADN mltoeo~ na: Europa en Estados Unidos
RFLPS: variaci6n en longitud de fragmentos de restriccion , secuenciacion u obtenci6n de secuen­

han empleado en diversos palses vee taxono~ica molecular para I


cias y microsatelites.

La obtencion directa de secuencias mediante productos de PCR es la tecnica que ha empezado a


l
inclusive acaba de p~bliearse u~a~ealOS estudios hacen referencia a
implementarse para diferenciar razas geograficas de especies del genero Chrysomya. Proxima­

En Colombia Y Brasilia mayona . ' x C a/biceps C. mace I,


mente se publicara los resultados del anal isis filogeografico de este genero en Antioquia en rela­
. I te C hommlvora , . ,
Chryso~iinae, espeela m~n 'relaciona con su importancia no ~(
cion con su introducci6n al pais, su comportamiento depredador y su importancia en medicina

EI interes en estas e~p.eeles se . a ue son causantes de mla


veterinaria y forense.
sino tam bien en medlctna vetennana, Y q cepc'lo' n de C mecellarii
Para ampliar ace rca de las tecnicas moleculares y sus limitaciones remitirse a Molecular
. de elias con ex . .
hecho de que la mayona . d nte 25 ailos. La introducel
Systematics (Hillis et.al. 1996) .
Suramerica (Brasil) haee aproxlma a~euiente en aspectos relacio
Ni RAPDS ni RFLPS se han utilizado en Colombia en Entomologia forense. No obstante, a conti­
portantes en la fauna na~iva y por eons~e extracci6n de ADN Yla a
nuaci6n se hace una breve descripcion de las tecnicas y ejemplos de sus aplicaciones en
A continuaci6n se descnbe el proces~ "amb'le' n a modo de ilustrc
entomologia forense.
., d secuenclas. I. .
Oxidasa para la obtenc~on e tra las relaciones de filogenl'
Los RAPDS usan fragmentos pequeiios de ADN lIamados cebadores 0 "Primer» para amplificar
to de secuencias Yun arbol que mues
muchas regiones de ADN de una sola muestra ai, mismo tiempo. Los productos obtenidos se

separan de acuerdo a su tamaiio por electroforesis, yen esta una banda 0 pico de una longitud es
sp. . . '. . detail ada de los procedimientos molecul
Para una descnpclon mas I ' l's'ls de secuencias, favor ref
considerado como un "gen". Un perfj!, de band as es caracteristico de un especimen y de los orga­
.. asi como e ana I .
la selecClon de genes, G de Sistematica Molecular, Un!'
nismos mas estrechamente relacionados con el (poblaciones y especies), por 10 tanto, una vez
Entomologia Molecular del rupo
que se obtenga el patr6n de un individuo no conocido, puede compararse con el de otros espedmenes

sede Medellin.
y as! identificarse.

Usando esta metodologia se ha identificado con exito puparios vados encontrados en escenas de

muerte que no pudieron identificarse por metodos tradicionales y que en ausencia de otras pruebas

se convirtieron en la mejor fuente para estimar IPM (Benecke 1998).

EI principio de RFLPS se basa en cortar el ADN con enzimas de restricci6n y separarlas de

acuerdo a su longitud en un campo de electroforesis.

EI ADN nuclear 0 mitocondrial es amplificado mediante la tecnica de reaccion en cadena de la

polimerasa PCR y despues de cortarse , los fragmentos multiples producidos se usan como mar­

cadores para identificar especies.

Con base en esta metodologia y con ADN ribosomal nuclear, se han creado marcadores para

identificar 10 especies de moscas de importancia en entomologia forense en las familias (Calliphoridae,

Muscidae y Sarcophagidae) (Ratcliff et al. 2003)

Ocho enzimas de restricci6n han permitido identificar al nivel de especie: Sarcophga bul/ata, S.

Crassipalpis, Phormia regina, Protophormia terraendrae, Cochliomyia macel/aria, Caliphora vivina,

Cynomyopsis cadaverina, Bufolucilia silva rum, Musca autumnalis y Musca domestica. Estas es­

pecies son algunas de las mas importantes en Illinois para asistir a los investigadores criminales

en determinar el tiempo y la localidad de la muestra.

E!'.'TOMOLOGiA F ORENSE
80
Sistematica Molecular

:uada de especies a partir de cualquiera de sus estados ya


Hace falta trabajar para precisar y caracterizar la probable variacion intraespedfica y regional para

lrtes de estos asi esten parcialmente descompuestos.


estas y otras especles y en especial para las del neotropico . Es de mencionar que la identificacion

base en el ADN puede realizarse gracias a la variabilidad


por medio de tecnicas moleculares se realiza en tiempos tan cortos como 6 horas 10 cual es

nta el ADN 10 cual se conoce como polimorfismo. La variabi­


importante en terminos de investigaciones criminales .

:;uencia de nucleotidos que conforman la cadena del ADN 0


Las dos tecnicas mencionadas con anterioridad, proveen informacion indirecta sobre las secuen­

enina, Guanina, Timina, Citosina). Una secuencia que iden­


cias ?e ADN por I? que la obtencion directa de las mismas aparece como la mejor alternativa para

lnismos agregados en una categoria taxonomica, se conoce


precisar la vana.blll~ad de espe~ies . En particular las secuencias de ADN mitocondrial cuyo uso es

a~tualmente ~utlnano en ?tr~s clenclas forenses, se utiliza para precisar la variabilidad entre espe­

s en entomologia forense consisten en encontrar y validar


cles y poblaclones con dlstnbuciones particulares espedficas.

Los mayores esfuerzos y progresos se han obtenido para


f Sarcophagidae . Trabajos con cromosomas y tecnicas modernas como FISH (Hibridacion in situ) tambien se han

r estos marcadores que varian en el tipo de ADN (nuclear 0


usado para este fin. (Parise - Ma'itempi. 2001)

ble, repetitiv~ 0 no, codificante 0 espaciador) , la calidad y la


~~mo una aplicacion adicional se encuentra el potencial de las tecnicas de secuenciacion y expre­

)s.
slon de ~enes para conocer los genes involucrados en el metabo'lismo de sustancias qu imicas y

los RAPDS "amplificacion al azar de ADN polimorfico», los


metabolitos 10 cual es de trascendencia en entomotoxico'iogia.

nentos de restriccion, secuenciacion u obtencion de secuen­


Las secuencias de ADN mitocondrial para identificar moscas de Calliphoridae y Sarcophagidae se

~an empleado en diversos paises de Europa, en Estados Unidos, en Canada y Japon, donde

lediante productos de PCR es la tecnica que ha empezado a


inclusive acaba de publicarse una clave taxonomica molecular para la familia Calliphoridae.

3 geograficas de especies del genero Chrysomya . Proxima­


En Colombia y Brasilia mayo ria de los estudios hacen referencia a las especies de la subfamilia '

I anal isis filogeografico de este genero en Antioquia en rela­


Ch.ryso~iinae , especial mente C. hominivorax, C. a/biceps, C. ma cel/aria , C. putoria, y C. rufifacies.

comportamiento depredador y su importancia en medicina


E.I Interes .~n estas e~pecies se relaciona con su importancia no solo en la entomologia forense ,

sino tamblen en medlcina veterinaria, ya que son causantes de miasis en animales. Asi mismo al

hecho de que la mayoria de elias con excepcion de C. mecellaria son especies introducida~ a

as moleculares y sus limitaciones remitirse a Molecular


Suramerica (Brasil) hace aproximadamente 25 anos. La introduccion ha tenido implicaciones im­

I en Colombia en Entomologia forense. No obstante, a conti­


portantes en la fauna nativa y por consiguiente en aspectos relacionados con ella.

pcion de las tecnicas y ejemplos de sus aplicaciones en


A c~ntinuacion se describe el proceso de extraccion de ADN y la amplificacion del gen Citocromo

OXldasa para la obtencion de secuencias. Tambieln a modo de ilustracion se incluye un alineamien­

,nos de ADN Ilamados cebadores 0 "Primer» para amplificar


to de secuencias y un arbol que muestra las relaciones de filogenia entre especies de Chrysomya

;ola muestra al mismo tiempo. Los productos obtenidos 5e


sp.

. electroforesis, yen esta una banda 0 pico de una longitud es


Para una descripcion mas detallada de los procedimientos moleculares, del diseno de cebadores y

il de band as es caracteristico de un especimen y de los orga­


la seleccion de genes, as! como el anal isis de secuencias, favor referirse al manual de Tecnicas en

lados con el (poblaciones y especies), por 10 tanto, una vez


Entomologia Molecular del Grupo de Sistematica Molecular, Universidad Nacional de Colombia

JO no conocido, puede compararse con el de otros especfmenes


sede Medellin .

,tifjcado con exito puparios vados encontrados en escenas de


por metodos tradicionales y que en ausencia de otras pruebas
lra estimar IPM (Benecke 1998).
I cortar el ADN con enzimas de restriccion y separarlas de

de electroforesis.
lmplificado mediante la tecnica de reaccion en cadena de la
trse , los fragmentos multiples producidos se usan como mar­
on ADN ribosomal nuclear, se han creado marcadores para

t
portancia en entomologia forense en las familias (Calliphoridae,
et al. 2003)

rmitido identif,icar al nivel de especie: Sarcophga bul/ata, S.

ohormia terraendrae, Cochliomyia macel/aria, Caliphora vivina,


'ia si!varum, Musca autumnalis y Musca domestica . Estas es­
ortantes en Illinois para aSistir a los investigadores criminales
de la muestra.

Er-.'TOMOLOGiA FORENSE 81
Facultad de Ciencias ! ' ;- '-'TO I'f: BIBLH),!' F( A';:)
II '.Ie )Tr:l .'.··FFF ·· (if. lL

E trucdon de AD apartir de in ct s con «buffer d macerad<


Procedimiento

La extracci6n del AON se realiza por medios mecanicos, lisis, tempE


precipitaci6n con alcohol.
Material Biologico
Coloque el insecta preservado en Isopropanol en un vial de 1,5 r
Para realizar la extracci6n, las muestras pueden estar secas , congeladas 0 pre~ervadas en
buffer macerado. .
isopropanol 0 etanol. Menos de 1 mg de tejido es suficiente para obtener AON . La meJor fuente de
Marque dos juegos de crio viales para cad a ejemplar y disp6ngal
AON mitocondrial en insectos es musculos abductores y de vuelo.
Use un macerador (de venta comercial) para cad a ejemplar. ME
insecta en el buffer, observe muy bien las paredes del vial , CU i
Materiales de laboratorio pequenos y esclerotizados la maceraci6n no es facil , recuerde ql
completamente macerado y el buffer debe observarse un poco turbio.
Crio viales de 1.5 ml esteriles. Utilice un par de viales por cada muestra.

descarte para lavado los maceradores en el recipiente indicado.


Micro pipetas 20 ul, 100 ul, Y 200 ul.

Tan pronto como el insecta este macerado coloque el vial en bai


Puntas esteriles para cad a una de las micropipetas a utilizar.

durante 30 minutos. EI bano debe estar prendido con anterioridac


Maceradores esteriles, uno por cad a muestra.

muestras halla alcanzado la temperatura deseada .


Gradilla con capacidad para viales de 1,5 ml.

Retire el vial del bano y adicione 14 uL de acetato de pota?io 8 MI


Guantes sinteticos.

Coloque el vial en hielo (escarcha) durante 30 minutos .


Reloj 0 «timer»

Centrifugue a 14000 rpm durante diez minutos. Transcurridos los


Beaker de descarte: uno para puntas maceradores y tubos, otro para descarte de muestras.

sobrenadante a un nuevo crovial previamente marcado.


Papel absorbente.

Para proceder a precipitar el AON adicione 200 uL, de etanol al1 01


Nevera de icopor.

a -20°C 0 -80°C durante 24 horas.


Hielo (escarcha).

Luego de las 24 horas centrifugue a 14000 rpm durante 20 minut


Oescarte el sobrenadante volteando el vial sobre un beaker de d l
Lave depositando 200uL de etanol al 70 % Y girando el vial entre
Reactivos sobrenadante.
Repita ellavado con 200 uL de etanol al 100% Y descarte nuevan
Buffer de macerado ( 10 mM Tris HCL, 50 mM de NACI 50nM EOTA, 1% 808), esterilizado
Voltee los viales sobre una servilleta de papel para secar la mues l
por autoclave y con pH ajustado 7,5.
Cuando la muestra este seca resuspenda en agua 0 en buffer de
Acetato de potasio 8 M.
Guarde los viales debidamente rotulados a -80°C.
Etanol al 70% .
Etanol al1 00% .
Isopropanol al1 00% a temperatura ambiente.
EI AON que se extrajo puede guardarse segun el objetivo del trabajo y
investigador. Para tiempos prolongados se recomienda guardar el ADN
entre -20°C y - 80°C. Para tiempos menos prolongados se utiliza di
Equipos y almacenamiento en allcuotas a temperaturas entre -20°C y - 80°C.

Bano seco (65 °C opcional; para una rapida hidrataci6n del AON) .
Centrifuga refrigerada a 14.000 revoluciones por minuto.
8ecador al vacio.

ENTOMOLOGIA FORENSE
82
~ ....
lhHVHR, lTlt\ n NN' IONAL 011 COI.OMIlI/'
!'o1 II ~I 0'1 I {"'I

P:~ "'H) rl- B1BLlOTFCA!:>


, istematica Molecular
q 111}TF1 , , ' [YF-" G ) I~

. d in ecto can «buffer de mac rado»


Procedimiento

La extraccion del AON se realiza por medios mecanicos, lisis, temperatura, cel~trifugacion y
precipitacion con alcohol.

Coloque el insecto preservado en Isopropanol en un vial de 1,5 mL y adlcione 100 uL de

~ stras pueden estar secas, congeladas 0 preservadas en


buffer macerado.

je tejido es suficiente para obtener AON. La mejor fuente de


Marque dos juegos de crfo viales para cad a ejemplar y dispongalos en una gradilla.

usculos abductores y de vuelo.


Use un macerador (de venta comercial) para cada ejemplar. Macere completamente el

insecto en el buffer, observe muy bien las paredes del vial , cuando son insectos muy

pequenos y esclerotizados la maceracion no es facil , recuerde que el insecto debe estar

completamente macerado y el buffer debe observarse un poco turbio. Luego de la maceracion,

lice un par de viales por cad a muestra.


descarte para lavado los maceradores en el recipiente indicado.

10 ul.
Tan pronto como el insecto este macerado coloque el vial en bano Marfa 0 seco a 65°c

e las micropipetas a utilizar.


durante 30 minutos . EI bano debe estar prendido con anterioridad para que al colocar las

'ida muestra.
muestras halia alcanzado la temperatura deseada.

s de 1,5 ml.
Retire el vial del bano y adicione 14 uL de acetato de potasio B Molar.

Coloque el vial en hielo (escarcha) durante 30 minutos.

Centrifugue a 14000 rpm durante diez minutos . Transcurridos los 10 minutos transfiera el

ntas maceradores y tubos , otro para des carte de muestras .


sobrenadante a un nuevo crovial previamente marcado.

Para proceder a precipitar el AON adicione 200 uL, de etanol al1 00% a cad a vial y guarde

a -20°C 0 -BODC durante 24 horas.

Luego de las 24 horas centrifugue a 14000 rpm durante 20 minutos.

Oescarte el sobrenadante volteando el vial sobre un beaker de descarte.

Lave depositando 200uL de etanol al 70 % Y girando el vial entre sus dedos, descarte 81

sobrenadante.

Repita ellavado con 200 uL de etanol al 100% Y descarte nuevamente el sobrenadante.

HCL, 50 mM de NACI50nM EOTA, 1%505), esterilizado


Voltee los viales sobre una servilieta de papel para secar la muestra.

7,5.
Cuando la muestra este seca resuspenda en agua 0 en buffer de almacenamiento

Guarde los viales debidamente rotulados a -BODC.

ra ambiente.
EI AON que se extrajo puede guardarse segun el objetivo del trabajo y las consideraciones del
investigador. Para tiempos prolongados se recomienda guardar el AON sin diluir a temperaturas
entre -20°C y - BODC . Para tiempos menos prolongados se utiliza dilucion en ddh 20 0 TBE
Y almacenamiento en alfcuotas a temperaturas entre - 20°C y - BODC .

Iuna rapida hidrataci6n del AON) .

w oluciones por minuto.

ENTOMOLOG1A FOREf\'SE 83
Facultad de Ciencias

Diagrama de flujo de Ia e tracci6n con Buffer de macerad .

Buffer de macerado
100ul
-----.~ L-M_a_c_e_r_a_r____ ~I · Despues de las 24
Centrifugar a 1
20 minutos. De~
horas sobrenadante

~ insecto
1
Bano Marfa a 65°c
30 minutos

Lavar 200 1.11 de


vial + macerado etanol al 70 %
descartar sobrenadante

Acetato de Hielo

potasio 8 M 30 minutos

14 jJl

!
centrifugar a
Sobrenadante a un 14000 rpm
nuevo vial 10 minutos. Lavar con 200 1.11
de etanol al 100%
Descartar el sobrenadante
ADN extrafdo

Nevera -20°c
24 horas

200 ~I Etanol (frio) RE


Secar al vacfo 0 voltear ag
100% sobre papel absorbente

ENTOMOLOGiA FORENSE
84
Sistematica Molecular

on Buff r de macerado.

Macerar
L-_----~
l Oespues de las 24
horas
Centrifugar a 14rpm
20 minutos. Descartar
sobrenadante

-0- insecto
Bano Maria a 65°c
30 minutos

Lavar 200 IJI de


etanol al 70 %
descartar sobrenadante

_------.. Hielo
30 minutos

centrifugar a
14000 rpm

J 10 minutos. Lavar con 200 IJI


de etanol al 100%
Descartar el sobrenadante
AON extrafdo

Nevera -20 DC
24 horas
Resuspender100ulde

Secar al vado 0 voltear agua destilada esteril 0

sobre papel absorbente


TE

Guardar a-80°

ENTOMOLOGiA FORENS 85
Facultad de Ciencias

Procedimi nto
Reacci6n ue poiimerizaci6n en cadena peR
NOTA: todos los reactivos deben estar conservados en frio pre!
La reacci6n de polimerizaci6n en cadena (PCR), es una herramienta de biologfa molecular tan -80°C. La taq- polimerasa solo se sacara del congelador a -20'
sensible que una sola molecula de ADN puede ser detectada al complementarse el proceso de inmediatamente despues de servida se guarda nuevamente .
amplificaci6n . Se realiza una reacci6n de PCR de 50 uL. Esta reacci6n contiE
los cebadores para amplificar el fragmento 0 gen deseado, los (
Protocolo de PCR cadenas sintetizadas y la enzima Taq polimerasa.
EI resultado final es una gran cantidad amplificada del gen de il
Materiales
Marque los viales a utilizar, dispongalos en una gradilla y
Micropipetas de 2 uL, 200 uL Y 100 uL .. Descongele el ADN de los especimenes , pipetee los uL de
Puntas esteriles. una de los viales de PCR. Conserve los en hielo mientras SE
Guantes sinteticos. reactivos .
Viales esteriles de 1,5 uL. En un vial de 1,5 ml se prepara la mezcla adicionando agua, b
Viales esteriles para PCR . cebador 1 y cebador 2 en las cantidades necesarias.
Gradilla. Adicione la Taq-polimerasa (0,5 uL) (debe estar en el cong
Servilleta. en que se va adicionar ala mezcla) . EI buffer 10x y el MgCI
Nevera de icopor. antes de agregarse a la mezcla, agitandolos durante unos
Marcadores indelebles . La cantidad de microlitros adicionados, depende del numer
Hielo (escarcha). Se adicionan los microlitros correspondientes de la mezcl,
Recipiente para cfescarte . reaccion de PCR donde previamente depositamos el ADN c
el termociclador t an pronto como sea posible y se inicia la ·
Reactivos que se este utilizando .

Buffer de 1Ox sin MgCI 2 Los productos de PCR 0 genes amplificados para obtener
MgCI 2 24 mm.
verifican en geles de agarosa (ver Manual tecnicas molecularE
Deoxinucle6tidos (A,T,G,C) 10 m.m.
Taq-polimerasa. Una vez obtenidas las secuencias se alinean mediante progr
ADN previamente extrafdo (nunca mezcle ADN extrafdo de varios insectos) .
para detectar y analizar la variabilidad y buscar las secuencia!
Cebadores.
especies 0 razas de insectos de interes.
Agua bidestilada.

Equipos

Termociclador (amplifica el ADN)

ENTOMOLOGiA FORENSE
86
Sistematica Molecular

Proccd i mien t<,


imerizaci6n en cadena peR
NOTA: todos los reactivos deben estar conservados en frio preferiblemente entre -20°C y
)a (PCR), es una herramienta de biologfa molecular tan -80 D C . La taq- polimerasa solo se sacara del congelador a -20°C en el momenta de servir e
II puede ser detectada al complementarse el proceso de inmediatamente despues de servida se guarda nuevamente.
Se realiza una reacci6n de PCR de 50 uL. Esta reacci6n contiene el AD N extraido del insecto,
los cebadores para amplificar el fragmento 0 gen deseado, los oligonucleotidos para formar las
cadenas sintetizadas y la enz,ima Taq polimerasa.
EI resultado final es una gran cantidad amplificada del gen de interes.

Marque los viales a utilizar, dispongalos en una gradilla y coloquelos en hielo.

) uL.. Descongele el ADN de los especimenes, pipetee los uL de ADN (0,2 a 2) en cada

una de los viales de PCR. Conservelos en hielo mientras se procede a preparar la mezcla de
reactivos .
En un vial de 1,5 ml se prepara la mezcla adicionando agua, buffer10x, MgCI 2 , Deoxinucleotidos,
cebador 1 y cebador 2 en las cantidades necesarias.
Adicione la Taq-polimerasa (0,5 uL) (debe estar en el congelador hasta el momenta
en que se va adicionar ala mezcla). EI buffer 10x y el MgCI 2 deberan ser homogenizados
antes de agregarse a la mezcla, agitandolos durante unos minutos en ei vortex.
La cantidad de microlitros adicionados, depende del numero de reacciones a realizar.
Se adicionan los microlitros correspondientes de la mezcla a cada uno de los tubos de
reaccion de PCR donde previamente depositamos el ADN del insecto. Se coloca cada vial en
el termociclador t an pronto como sea posible y se inicia la el proceso segun el perfil termico
que se este utilizando.

Los productos de PCR 0 genes amplificados para obtener las secuencia de nucleotidos, se
verifican en geles de agarosa (ver Manual tecnicas moleculares, Sistematica Molecular 2004) .
.m.

Una vez obtenidas las secuencias se alinean mediante programas especificos y se comparan
a mezcle ADN extraido de varios insectos).
para detectar y analizar la variabilidad y buscar las secuencias marcadoras 0 tipificantes de las
especies 0 razas de insectos de interes.

ENTOMOLOCiA F ORENSE 87
Facultad de Ciencias

Alineamlento de secuencias de ADN de 12 especles del genero Crysomya de Colombia y Brasil.


Gen Citocromo oxidasa. LlIcilia sericala
Chl)'somya a/biceps 1'GATTTA GCTA rrCTCTlTAC ATTTAGc
Chrysomy a ch/oropyga TGAT1'TAG TATTTTC1' TTTA CATTTAG(
Cada nucle6tido indicado por una base nitrogen ada (A= Adenina, G=Guanina,C=Citosina.T=Timina) representa un Chrysomya inc/illala TGATTTAGCTATTTTCT CTAC TTTAG(
Chrysomya marginalis TGATTTAG TA1'TTTTTCTTTA CA CT fAG(
carater tax6nomico comparado. Una secuencia de n pares de bases corresponde a n caracteres comparados.
Chrysomya megacepha/a TGATTTGGC1'AT TTTTT nTACACTTAGC
Note las regiones similares (iguaJ base entre dos secuencias) y la variabilidad entre especies, que permite Chrysomya norrisi TGATTTAGCTATTTTlTCTCTTCACTTAG(
tipificar especies de un mismo genero con especies morfol6gicamente similares 0 indistinguibles . Tambien Chl}'somya pingllis TGATTTAGCTATTTrCTCTJ'TACATTTAG(
CIII:vsomya pl.llorill TGA1'TTAG CTATTTTC1' 'TlTACAClTAGC
puede evaluarse las relaciones evolutivas y correlacionarse la variabilidad genetica con la geogrMica.
Chrysomya rufl/a<:i('s TGAnTAGCTATTTTCTCTH ACATTTAGC
Chrysomya semimefa/lica TGATTTAGCTATTTTCT TC TT ATTTAGO
Chrysomya varipes TGATTIAGCTATnTCTCTCTTCATTTAGC
Lucilia sericala
Chl}'somya a/biceps - - - - -- - - -- - - - -ACTTITA CCTCCTGCAlTAA
Chrysomya ch/oropysa - - - - - -- - - -- - - - -ACTITTACCTCCT GCAITAA
Llicilia sericala
Chrysulllya il1clil1a/a - - - - - - - -- - - - -- -AClTlTACCTCCTG n TAA
Chrysomya a/biceps GAGCTGTAA 1TITAlTACAACTGTAAlTl
Ch,ysomya fIIm g ina/is - - - - - - - - -- - - - -- AClTlTACCTCCTG AITAA
Chrysomya ch/oropyga GAGCTGTAAATTTTATTACAACTG1'AATrP
Chry.WJlllya fII egacl!pha/u TTTCCACGAATAAATAATATAA GTTT TIGA TACCTC CTGCATTAA
CllIy>omya inc/inala GAGCTGTAAATTTTAlTACAACTGTAATrI
Ch, ysomya /lorrisi lTTCCCACGAATAAATAATATAAGTITCTGAC1TITACCTCC'TGCAlTAA
Chrysomya marginates GAGCTGTAAATTTTATTAC ACTGTTATT,-<\
Chrysomya pingllis - - - - - - - - -- - - - -- ACnTTACCT TGCT TAAA
CllIysomya megacepha/a GAGCCGTA AATT1'TATTA CAACTGTTAlTA
Chrysomya p"lorill ACG AATAAATAATATAAG' - rCTGACTTTTACCTCCTGCATJAA
Ch/J1somya norrisi GAGCTGTAAA1'TTCATTACTAC1'GTAATTI
C/IIYI'oI1lJ'a l'I!ftj(u:il!s CACGAlTAAATAATATAAGT lTCTGAC TACCTCCTG AnAA
Chrysomya pingllis GAGCTGTAAA1TfTAlTACAACTyTAAlTI
Chrysomya semimelallica AITTCCT GACTAAATAATATAAGTT ITTGA TITTA CCT CTGCTT1AA
Chrysomya pUloria GAGCTGTAAAlTTTATTACAA TGTAATTP
Chlysomya varipes ATTCCCTCGAATAAATAATAfAAGlTnTGAClTlTACCTCCTGCA[-rAA
Chrysomya rufl/acies GAGCTGTAAA TICATTACAA TGTAATTP
Chrysomya semimelallica GAG CAGTAAATnTAlTACAA CAGTAATTA,
C'llIysomya varipes GAG 'TGTAAATTTTATTACTACAGTTATTA
Lucilia sericala
Chrvsomya a/biceps n - fAC fATIAGT AGTAGTATAGTACi AAAATGGAG TG GAACAGGATGA
Chrysomya ch/oropyga CTC1ArTArTAGTAAGTAGTATAGTAGAAAATGGGG CTGGAACAGGATGA
Ch,ysomya inc/inala TCiACTATJ AGTAAGTAGTATAGTAGAAAATGGAG TGGAACAGGATGA
Lucilia sericala

Ch,ysomya marginalis CTITACTA [ AG AAGTAGTATAGTAGAAAATGGAGC1'GGAACAGGATGA


Chrysomya a/biceps
ACAlTTGACCGAA1'AC CATTATI GT rGP
Ch,:vsomya lIIegacepha/a CTTTA TATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGATGA
Chrysomya ch/oropyga
ACA1'T1'GACCGAATACCA1'TATTCGTT1'GA
Chrysomya norr;I'i CTITAlTAfTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGATGA

Chrysomya inc/inOla
ACAnTG , TCGAATACCTTTATTTGTTTGA
Chrysomya /lorrisi AC1ATTGTJAGTAAGTAGTATAGTAGAAAATGGGG CTGGAA 'AGGATGA

Chrysomya margina lis


ACAlT1'GATCGAATA CTTTI'I.TTCGTATGA
Ch,:vsofllya pingl/is CfTlATfAl AGTAAGTAGTATAGTAGAGAATGGGG TGGAACAGGATGA

Chrysomya megucepha/a
ACATT1'GATCGAA1'ACCTrT lTTG1'ATGAl
Ch,),.wmya pUlnria CTTTAlTATTAGTAAGTAGTATAGTAGAAAATGGGGCTGGAACAGGATGA

Chrysomya norrisi
ACA1'TTG ACCGAATA CCnTATITGnTGA
Chrysomya mfl/ucies CT 'TA IATJAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGATG A

Chrysomya pingllis
ACATlTGACCGAA1'AC TTTATTCGTTTGA
Chrysomya semimelallica CnTAlTATTAG'ITAG TAGTATAGTAGAAAACGGAGCTGGAACAGGATGA

Chrysomya puloria
ACAlTTGATCGAA1'AC lTTATTTGTA1'GA
Chrysomya rllfl/acies
ACA1'TTGATCGAATACCTJ' TAr rrGTATGAl
Chrysomya semimelal/ica
ACAT1'1'GATCGAATACCT1'1'ATTCGTTTGAT
LI/cilia sericala
Chrysomya varipes
ACTTTTGATCGAATACCTTTATTTGTITG AT
Chrysomya a/biceps ACTGTTTATCCACC fATCATCTAATAlTGCCCATGGTGGTGCATCAGT
Chrysomya ch/oropyga ACTGTlTACCCACC1'TTATCA1'CTAATATTGCTCACGGTGGAGCA1'CAGT
Chrysomya ;nclina/a AC1'GTrTACCCAC nTATCA1'CTAATATrGCCCATGGAGG1'GCA1'CAGT
Luci/ia sericala
Chrysomya marginalis ACT T1'1'ATCCAC TrTATCATCTAATATTGC1'CA1'GGTGGAGCA1'CAGT
Chrysomya a/biceps ATTATTAT1'AT1'A1'C Tn 'A CCAGTAl A Jel
Chrysomya megacepha/a ACTG1TTATCCAC ''TTTATCATCTAATATTG CACA1'GG1'GGAGCATCAGT
CIII:vsomya ch/oropyga ATTA1'1'ATTAT1'A1'CTT1'ACCAGTATTAGCO
Ch,ysomya norrisi ACTGTITACCCAC CnTATCATCTAATAfTGCTCACGGAGGAGClTCAG1'
Chl:vsomy a inc/inola AT1'ATTATTGT1'ATCTTIACCAGTATTAGCA
Chlysomya pinguis ACAGT ITACCCACCTITATCATC1'AATAlTGCTCACGGAGGAGCHCAG1'
CllIysomya marg inalis A1'Cl'TTTA1'TATTATCA1'TACCA GTATTAG C
Chrysomya puforia ACTGCn 'ACCCACCnTATCTrC1'AATATTG(" T ATGGAGGAGCATCAGT
Chrysomya meg acepha/a ATC1'1'1'1'A1'TAT1'ATCATTACCAGTA 'TAG CG
Chrysomya nl/I/acies ACTGTTTAC C CCnTATClTCTAATATTGCT ~ TTGGAGGAGCA1'CAGT
Chrysomya norrisi ATTAT1'ATTA1'TATCTTTACCAGTAlTAGC
Chrysomya Semimefa/lica AC1'G1'1'TAC CCA CCr rrA1' CTAATATCGCTCATGGAGGAGCA1'CAGT
Chrvsomya pinglliS ATCTTTTATTAT1'ATCnTAC AGTATTAGCA
Chrysomya varipes ACAGnTACCCTCCTC1'ATCTTCTAATATrGCTCA1'GGAGGAGCT1'C1'GT
Chrysomya p"loria ATTATTA1'TATTA1'C1T TACCAGTATTAGC
Chrysomya rllfi/acies A1'TATTATTAT1'A1'CTT1'ACCAGTATTAGC(
Chrysomya semimelallica ATTA1'TATTATTATCATTACCAGTATTAGCA

ENTOMOLOGiA FORENSE
Sistematica Molecular

de 12 especies del genera Crysomya de Colombia y Brasil.


Lucilia sericata
ren Citocromo oxldasa. Chrysomya a/biceps TGATTTAGCTATTTTCTCTTIA ATTTAGCCGGAATTTCTTCAATTTTAG
Chrysomya ch/oropyga TGATTTAGC T TTTICTCTTTACATTTAGCTGGGATTTCTTCAATIITAG
Chrysomya in clinala TGATTTAGCTATTTfCTCAC TACATTlAGCTGGAATTTCCT AATTTTAG
>genada (A= Adenina, G=Guanina,C=Citosina,T =Timina) representa un Chrysomya marginalis TGATTTAGCTATTTTTTCTTTACACTTAGCT GAATTTCATCAATTTTAG
leia de n pares de bases corresponde a n caracteres comparados, Chrysomya megacepha/a TGATTTGGCTATTTTTTCTTTACACTTAGCTG ' AATTTCATCAATTTTAG
~ dos secuencias) y la variabilidad entre e~pecies, que permite Chrysomya norrisi TGATTTAGCTATTTTTTCTCTTCACTTAGCAGGAATTTCTTCAATTTTAG
Chrysomya pinguis TGATTTAGCTATTTTCTCTTTACATTTAGCAGGAATTTCTrCA AlTTTAG
~species morfol6gicamente similares 0 indistinguibles, Tambien
Chrysomya pulOri£! TGATTTAG TATTTTC TC TTTACACTTAGCAG GAATTT C TT~AAT CTTAG
correlacionarse la variabilidad genetica con la geogrcifica , Chlysomya rufifacies TGATTTAGCTATTTTCTCTTT CATTTAGCAGGAATTTCTTCAATTTTAG
Chrysomya semimelallica TGATTTAGCTATTTTCTCTCTTCATTTAGC CGGAATTTC TCAATTTTAG
Chrysomya varipes TGATTTAGCTATITTCTCTCTTCATTTAGCAGGAATTTCTTCAATTTTAG

______________________ACTnlACCTCCTGCATTAA
_______________________ACnLITACCTCCTG ATTAA
Lucilia sericala
______________________ACTTHACCTCCTGCTnAA Chrysomya a/biceps GAGCTGTAAA1TnATTACAACTGTAATTAAT TACGATCTACAGGAATT

- - - - - - -- - - - -ACTI - fACCTCCTGCATTAA Chrysomya chloropyga GAGCTGTAAATTTTATTACAACTGTAATTAATAT CGATCT CAGGAATf

A CG AATAAATAATATAAGTTTTTGACT fTTACCTCCTG ' ATTAA Chrysomya inc/in ala GAGCTGTAAATrTTATfACAACTGTAATfAATATACGA CTACAGGAATf

:'ACGAATAAATAATATAAGTfTCrGA TI AC TCCTGCATTAA Chrysomya marginates GAGCTGTAAATTTTATfACAACTGTfATTAATATACGATCTACAGGAATC

_ _________________ ACTITTACCT CTGCTCTAAA Chrysomya megacepha/a GAGCCGTAAATTTTATTA CAACTGTTATTAATATACGATCTACAGGAAJT


CACG AATAAATAATATAAGTTr 'TGA l TITACCTCCTGC/\ fAA Ch,ysomya norrisi GAGCTGTAAATnCATTACTACTGTAATfAAiATACGATCT CAGGAATT
::: A GAlTAAATAATATAAGTTTCTGACTTTTAC TC 'TGCATTAA Chrysomya pinguis GAGCTGTAAATTTfATTACAACTGTAATTAATATACGAT TACAGGAATT
TCGACTAAATAATATAA(;nl'T TGAClTTTACCTC TGCrHAA Chrysomya pUlOria GAGCTGTAAATTTTATTACAACTGT ATfAATATACGAT T,'\ 'AGGAATf
crCGAATAAATAATATAAGTTTTTGACTTTTACCTCCTGCATrAA Chl)'somya rufuacies GAGCTGTAAACTTCATTACAACTGTAATTAATATACGATCTACAGGAATT
Chrysomya semimetallica GAGCAGTAAATTTTATTACAACAGTAATTAATATACGATCAACAGGAATT
Chrysomya varipes GAGCTGTA A ATTTTATTACTACAGTTATTAATATACGATCAACAGG A ATf

fATrAGTAAGTAGTATAGTAGAAAA1'GGAGCTGGAACAGGATGA
ATrAGTAAGTAGTATAGTAGAAAATGGGGCTGGAA AGGATGA
fATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGATGA Lucilia sericala
rATTAGTAAG AGTATAGTAGAAAATGGAGCTGGAACAGGATGA Chlysomya a/biceps ACATTTGACCGAATACCATfATTCGTTTGATCTGTAGTfATTACTGCTCT
ATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGATGA Chrysomya ch/oropyga ACATTTGACCGAATACCATTATTCGTTTGATCTGTAGTTATTACTGCTCT
rATrAGTAAGTAGTATAGTAClAAAATGGAGCTGGAACAGGATGA Chrysomya inc/inala ACATTTGATCGAATACCTTTATITGTnGATCT T GTA TTACTG CTTf
'GTTAGTAAGTAGTATAGTAGAAAATGGGGCTGGAACAGGATGA Chrysomya marginalis ACATTTGATCGAATACCTTTATTCGTATGATCTGTAGTTATTACTG CTCT
fATrAG1AAGTAGTATAGTAGACiAATGGGGCTGGAA 'AGGATGA Chrysomya meRacepha/a ACATTTGATCGAATACCTTTATTTGTAT GATCTGT GTTATT CTGCTCT
rATTAGTAAGTAGTATAGTAGAAAATGGGGCTGGAACAGGATGA Chrysomya norrisi ACATTTGACCGAATACCTnATTTGTnGATCTGTAGTTATTACTG TCT
rATrAGTAAGTAGTATAGTAGAAAATGGAGCTGGAA 'AGGATGA Chrysomya pinguis ACATnGACCGAATACCTTTATrCGTTTGATCTGTAGTfATfACTGCTCT
'ATTAGTrAGTAGTATAGTAGAAAA ,CiAGCTGGAACAGGATGA Chrysomya pllloria ACATTTGATCGAATACCTITATTTGTATGATCTGTAGTTATTACTGCTCT
Chrysomya rufifa~ies ACATTTGATCGAATACCTTT TTTGTATGATCTGTAG rATTACTGCTCT

Chrysomya semimelallica ACATTTGATCGAATACCTTTATfCGTTTGATCTGTAGTTATTACTGCTCT

Chrysomya varipes ACTfTTGATCGAATACCTITATTTGTTTGATCAGTAGTAATTACAG C TT

TTATCCACCTTTATCATCTAAT TTGCCCATGGTGGTGCATCAGT
'fACCCACC'ITTATCATCTAATATTGCTCACGGTGGAGCATCAGT
fACCCACCTTTATCATCTAATATTGCCCATGGAGGTGCATCAGT Lucilia sericala
TATCC A CCTTTATC ATCTA ATATn;CTCATGGTGGAGCATCAGT Chrysomya a/biceps ATTATTAliATTATCTTTACCAGTATTAGCAGGAGCTATf CTATATTAT
ATCCACCTTTATCATCTAATATTGCACATGGTGGAG 'ATCAGT Chrysomya ch/oropyga ATTATTATTATTATCTTTACCAGTATTAGCCGGAGCTATTACTATACTAT
TACCCAC TATCATCTAATATTGCTCACGGAGGAGCTICAGT Chrysomya inclinala ATTATTATTGT TCTTTACCA GTATTAGCAGGAGCTATTACTATA CTAT
TACCCACCTnATCATCTAATATTGCTCACGGAGGAGCTTCAGT Chrysomya marginulis ATCTTTTATTATTATCATTA CAGTATTAGCCGGTGCAATfACTATATTAT
ACCCACC1TfATCTTCTAATATTGCTCATGGAGGAGCATCAGT Chrysomya megacephala ATCTTTTATTATTATC TTA CC GTATTAGCGGGTG ATTACTAT TTAT
ACCCACCTnATCTTCTAATATTGCTCTTGGAGGAGCATCAGT Chrysomya lIorrisi ATTATTATTATTATCTfTACCAGTATTAGCTGGAGCTATTACTATATfAT
CCCACCTHATCTTCTAATATCGCTC ATGGAGGAGCATCAGT Chrysomya pinguis ATCTTTTATTATTAT TfTAC AG TATTAGCAGGA CTATfACTATACTAT
ACCCTC T fATCTTCTAATATTGCTCATGGAGGAGCTTCTGT Chrysomy a pUloria ATTATTATTATTATCTrTACCAGTATIAG CTGGAGCTATTACTATATTAT
Chrysomya ruflfacies ATTATTATTATTATCTTTACCAGTATf GCCGGAGCT TTACTATATTAT
Ch,ysomya semimelallica ATTATTATTATTATCATTACCAGTATTAGC AGGA GCTATTACTATATTAT

ENTOMOLOC1A FORENSE 89
Facultad de Cienc.ias

ATATTAGCT TTGGTTTATTAGGATTl
Luci/ia serica/a Lucilia serica/ a TATTAG CTATTGGTTTATTAGGATTT
Chrysomya a/biceps TA ACT'G ACCGAAATTTAAACACT r ATTCTITGACCCAGCAGGAGGAGGA
Chr ysomya a/biceps ATATTAGCT TTG GTTTATTAGG~TT I
Chrysomya ch/oroPJ,~ga TAACAGACCGAAATCTAAATACTI ATICTI~rGACCC A GC A ,GAGG AGGA
Chl:y somya ch/oropyga ATACTAGCAATTGGTTTATTAGGATT(
Chrysomya inc/ina/a TAA TGATC AAAT lTAAArACTTC ATTCTITGATCCAGCAGGAGGGGGA
Chrysomya il1 c/inata ATATTAG CTATTGGTCTATTAGGATT:
Chrysomya mtlrgillalis TAACTGATCGAAATITAAATACTT ATT rrGATCCAGCAGGA(i ,AGGA
Chry somya marg inalis
ATATTAGCTATTGGATTATTAGGAl .
Chrysomya lIIegacepha/a TAACTGAf GA A ATITAAATAC TTCATI TITGATCCAGCAGGAGGGGGA
Chry somya meg acephal a
ATATTAG CTATTGGTTTATTAGGATl l
Chrysomya norrisi TGA CTGATCGAAATITAAATACATCATICTTTGATCCAGCTGGAGGAGGA Chrysomya norrisi
ATACTAGCTATTGGTTTATTAGGATT
Chrysomya pingllis • TAA CTGATCGAAATITAAATACTfCATT TTTGATCCAGCAGGAGGAGGT Chrysomya ping uis
ATACTAGCTATTGGTCTATTAGGATTl
CllI)'somya p"lUria
Chrysomya rujifacies
TAACTGACCGAAATCTAAATACTTCATTCTITGATCCAGCAGGAGGAGGA
T ACTGACCGAAATTTAAATACrrCA CTI GACCCAGCAGGAGGAGGA
Chrysomya pu/oria

Chrysomya rujiJacies .

ATACTAG CTATTGGTCTATTAGG
ATAT1'AG CTATTGGATTATTAGG~TT
n:
Cllly somya semime/a/lica TAACTGACCGAAATCTAAATACTTCATTCTT GATC GGCAGGAGGGG ,A Chry so my a semime /alil ca
ATATTAGCTATTGGATTATTAGGA-r;
Chlysomya varipes TAACAGACCGAAATCTrAATA ATC ATTCTTTG ATCCTGCAGGAGGAGGA Chryso mya varipes
*... * ••••••••••••••••••••••• •

TACTGTTGGAATAGACGTAGATA~TC
Luci/ia sericala ACATCCAGAAGT Luci/ia sericata
TACTGTTGGAATAGACGTAGATAC f C
Chrysomya a/biceps GATCCTA1TITATA CCAACAClTATTl T GATTCTTTGGACATCCAGAAGT Chlysomya a/biceps
TACTGTTGG ATAGACGTAGACA~TC
Chry.,omya chrupyga GACCC AATTTTAT CC AACACTIGTTCTGATTCTTTGGGCATCCAGAAGT Chry somya ch/oropyga
CACTGTTGGAATAGACGTTGATACC,C

Chlysamya inclinala GATCCTATTITATACCAACATITATT TGATTCTITGGTCATC TGAAGT Chryso mya inclinata


TACTGTAGGAATGGATGTAGATAC1C
Chrysomya marginalis JATCCTATTTTAT C ACA1TTATfTTG ATTCTTTGGACATCCAGAAGT Chrysomya marg inalis
CACTGTAGGAATGGATGTAGATACTC
Chrys()mya megacepha/a ACCCT A r TTATATC ACA CTTATTfTG TTCTTTGGTCATCCAGAAGT Chrysomya mega cepha /a
TACTGTTGGAATAGAC GTAGATAC~(
Chryso mya norrisi GATCCTATTTTATACCM \CACITATrJ'TGATrCTTTGGTCAT 'CAGAAGT Chrysomya norris i
TACTGTAGGAATAGACGTAGATAC' rC
Chrysomya pinguis GAT CTATTITATAC AAe A ATTTTGATrCTITGGTCATC 'AGAAGT Ch rysomya pinguis
TACTGTTGGAATAG ACCiTAGACACA
Chrysomya pu/uria GATCCTA1TTTATAT A ACA1TTAITrTGATTCTTTGGACATCCTGAAGT Chlysomya pu/oria TA TGTTGGAATAGACGTAGATACT(
Chrysomya ruf!l'acie.s GACCCTATITfATAC A ACATITATTC GATrCTTTGGGCACCCTGAAGT CllI)'somya ruflJacies . TACTGTTGGAATAGACGTTOATACTC
Chrysomya semimelalica GACCCAATTTT TATCAACATTTATH TGATTCTTTGGA CATCCAGAA GT Chryso mya se mimeta/h ca TACAGTAGG ATAGACGTTGATAC.~
Chrysomya varipes GATCCAAnTIATACCAAC ATTTTGATTCTITGGACACCCTGAAGT Chry somya varipes '" •••••••• ** ** •• *.*..... **
•••••••••
TAATTATTGCTGTACCAACTGGA~
Luci/ia serica/a TT TAIT fTAATTTTA 'CTGGATICGGAATAATTTCACATATTATTAGT
Luci/ia serica/a TAATTATTGCTGTACCAACTGGAA
Chryso mya a/biceps TTATATTITAAITITAC GGATTCGGAATAATTTCACATATTATT GTC
Chrysomya a/biceps TAATTATTGCTGTTCCAACTGGAA:
Chrysomya chloropyga TTATATTTTAATTTTACCTGGATICGGA ATAATTTCTCATATTATTAG TC
Ch,y som ya chloropyga TAATTATTGCTGTACCAACTGGAA
Chrysomya inc/ina/a TTATATrTTAA m "TACCTGGATTCGGAATAATTTCTCATATIATT GTe:
Chrysomya inc/ inala TAATTATTGCTGTACCAACTGGAAl
Chrysomya margillalis TTATATTTTAATTTTAC GG ATTCGGAATAATTTCTCATATIATIAGTC
Chrysomya margina/is T \ATTATTGCTGTACTAACTGGAAl
Ch,y solllya lI1egacepha/a TTATATTTTAATTTTAC TGGATTCGGAATAA1TICTCATATTATTAGTC Chrysomya megacepha /a I TAATTATTGCTGTACCAACTGGAJ
Ch,ymmya norrisi TTATAITfTAATTTT CCiGGATTr GGAATAATTTCTCATATTATTAGTC Chrysomya norris i TAATTATTGCTGTACCAACTGGAI
Chrysomya pinguis TTATAHTTAATTTTACCT'GGATT 'GGAATAATTTCTCAT TTATIAG TC Chrysomya pinguis TAATTATTGCTGTACCAACTGGAJ
Chlysomya pII/oria TTATAT ITTAATTTTACCTGGATr 'GGAATAATTTCTCATATIATTAGTC Chryso mya puloria TAATT TTGCTGTACCGACTGGAJ
Chrysamya I'llfiJa cie lTATATTTTA ATI fA CCTG TTCGGAATAATTl'CCCATATTATT GTC Chrysomya ruflfa cies . TAATTATTGCCGTACCTACTGGAA
Chry somya semime/allictl TTATA TTTAATTITA CCTGGATTTGGAATAATTTCTCATATTATTAGTC Chry somya semim etalilca TAATTATTGCTGTA CU \ACTGGAA
Chrysamya varipes TTATA I"TTIAATTTTACCTGGATTTGGAATAATITCTCATATIATTAGTC Chrysomya varipes •••••••••• • • ,. •••••••••••• **
••••••••••••••••••••••••••••••••••••••••••••••••
CTTTATGGTACTCA ATTAAACTA
Lucilia serica/a AAGAATCAGGAAAGAAGGAAACTITCGGATCTITAGGAATGATTl'ATGCT
Luci/ia sericata CTTTATGGTA T AATTAAAC fAl
Chrysomya a/biceps AAGAAJ'CAGGAAAGAAGGAAA TITCGGATCTITAGGAATGATTTATGCT
Chrysomya a/biceps CTTTATGGTACTC AATTAAAC:AT
Chlysomya ch/oropyga AAGAATCAGGAAA GAAGGAAA TITCGGATCTTTAGGAATGATTTATGCT
Chrysomya ch/oropyga CTTTATGGTACTCAATTAAACTAl
Chrysomya inciinata AAGAArCAGGAAA GAAG AAACTIT GGATCTTTAGGAATAATTTATGCT
Chrysomya in clinala CTTTATGGAACACAATTAAATTAC
Chrysamya marginalis AAGAATCAGGAAAAAAG GAAA 'ATrrGGATCT IT GGAATAATITATGCA
Chrysomya marf!, inalis CHT TGG ACTCAATTAAATTAT
Chrysomya mcgacephal a AAGAAI'CAGGAAAAAAG AAA C1T fGGATCTTTAGGAATAATTl'ATG A
Chry somya megacepha/a CTTTACGGAACACAATTAAATTP
Chrysomya norrisi AAGAATCAGGTAAGAAG AAACTITCG ATC:l AGGAATAATTTATGCT
Chrysomya norrisi CTTTATGGAACTCAATTAAATTA
Chrysomya pingui s AAGAAIT AGGTAAGAAGGAAACTmGGATCA ITAGGAATAATlT ATGCT
Chrysomya pinguis CTTTACGGAACAC ATTAAATTI
Chrysomya putoria AAGAATCAGGAAAAAAGGAAACTTTCGGATCTTTAGGAATGATTIATGCT
Chrysomya pulo ria CTTTACGGAACACAATTAA TT~
C hry somya rufifacies AAGAATCAGG AAAGAAGGAAA C CGGGTCITfAGGGATGATTTATG T
Chryso mya ruflJac ies , CTTTATGGAAC TCAATTAAACTA
Chrysomya semimetallica AA ,A TCAGGAAAAAAG GAAACTTTCGG TCATTAGGAATAATITATGCT'
Chryso mya semime/a//l ca CTTTATGGAACTCAATIAAACTI
Chrysomya varipes AAGAATCAGGTAAAAAGGAAACArf'CGGTTC ATTAGGGATGATTTATGCC
Chryso mya varipes ••••••• ••••*••••• ** •••• *
** . . . .................. ** ••••• • * ........... *

ENTOMOLOGIA FORENSE
Sistematica Molecular

Lucilia serieala ATATTAGCTATTGGTTTATTAGGATTTATTGTATGAGCTCATCACATGTT


=GAAATTIAAAC cn An TIT A CCAGCA~~AGGAGGA Chrysomya albieeps ATATTAGCTATTGGTTTATTAGGA'ITTATTGTATGAGCTCATCACATGTT
=GAAAT TAA ATA 'CATICTITGACCCAG AG ~AGGAG~A Chrysomyo chloropyga ATATTAGCTAfTGGTTTATTAGGATTTATTGTATGAGCTCATCACATGTT
CGAAl\T TTAAATACTrCAlTCTITGATCCAGCAGGAGGGC,C,A Chrysomya inC/inala ATACTAGCAATTGGTT ArTA GGA rCATTGTATGAGCTC TCATATATT
~G \ \ATTTAAATA r ATICTHGA1CCAGCAGGAGGAGGA Chrysomya marginalis ATATTAG C'TATTGGTCTATTAGGATTTATTGTATGAG CTCAT ATATArT
:--G f ;ATTT AATA TTCAHCTfTG, T ~ AG CAGGAGGGGGA
r AAA1TTAAATACAT ATl'CTITGATCCAGCTGGAG,C:AGGA
rCGAA JTfAAATACTT ~ AnCTrTGATC }\GCA?GAGCIA?GT
Chrysomya megaeephala
Chrysomya norrisi
ATATTAG CTATTG GATTATTA GGATTTATTGTATGAGCTCATCACATATT
ATATTAGCTATTGGTTT TTAGGAlTC TTGTATGAGCTCATCATATATT
Chrysomya pinguis ATACTAGCTATTGGTTTATIAGGATTTATTG1ATGAGCTCACCATATATT
' CGAAATCfAAATACTT ATT ' TTTGA C GCAGGAGGAGGA Chrysomya puloria ATACTAG CTATTGGTCTATTAGGATTTATTGTATGAGCTCACC ACATGTT

'CCA AATIT AA1Acn AnClTCGA CCAG CAGGAGGAGGA Chrysomya ruflfacies ATACTAGCTATTGGTCTATTAGGATTTATTGTATGAGCTCACCACATATT

CGJAAAT AAATACHCArTCTTCGATCCGGC GGAGGGGGA Chrysomya semimelal/iea ATATTAG 'TATTGG TTATTAGGATTT TTGTATGAGCTCATCATATATT

CCGAAAT T rAATACATCAn . 11 JATCCfCrCAGGAGGAGGA Chrysomya varipes ATATTAGCTATTG GATTATTAGGAITrATTGTTTGAGCTCATCATATATT


*** ............ . ........ * ••••• *.**+.*...... **

ACATCCAGAAGT Lucilia sericala TACTGTTGGAATAGACGTAGATACTCGAGCTTACTTCACTrCAGCTACAA


~nTTATAC AACACTTArrTTCrAnCTTIGGACATCC:AGAAGT Chrysomya albieeps TACTGTTGGAATAGACGTAGATA TCGAGCTTAlTTCACTTCAGCTACAA
,ITITATACCAA ACTroTTCTGAHCrTTG~. C T~~AGAAa.T Chrysomya ehloropyga TA CTGTTGGGATAGACGTAGACACTCGAGCTTACITTACTTCAGCTACAA
\TTITATACCAACA1TIAr GATT ' TfTGG r ATC~ GAAG~ Chrysomya inc/inala CACTGTTGGAATAGACGTTGATAC CGAGCTTACTTCACTTCAGCTACAA
r rTAT C AACATTTAITnGATTCTITGGACAT CAGAAGl Chrysomy a marginalis TACTGTAGGAATGG ATGTAGATACTCGAGCATATTTTACTTCAGCTACAA
TTTlATATCA ACACTTATTITGATTCTTTGGT ATC, A~AAG r Chrysomya megaeephala CACTGTAGGAATGGATGTAGATACTCGAGCATATTTCACTTCAGCTACAA
ATTTTATA CAA ' ACTTA1T IT JAn TITGG1CATC~A(~AA~T Chrysomya norrisi TACTGTTGGAATAGACGTAGATA ACGAGCTTACTl ACATCAGCTACAA
Ar rnATACCAACAl ATrnG AHCTTTGGTCAT CAC~AAGT Chrysomya pinguis TACTGTAGGAATAGACGTAGATACTCGAGCTTACTTCACTTCAGCTACAA
A rTATATCAA ' ATrTAT GATTCTTTGGACAT~ GAA~T Chrysomya puloria TACTGTTGGAATAGACGTAGACACACGAG T TATrTCACTTCAGCTACAA
i-\TTTTATA CAACAITIAnC 'GATTCTTTGGGCACC ~ ~AA~T Chrysomya rufifacies TACTGTTGGAATAGACGTAGATACTCGAGCTrATlTCACTCAGCTACAA
\TTTTATAT AA CAT rTAnTTGA TTTTGGACATCC~.~AAG ,r Chrysomya semimelalliea TACTGTTGGAATAGACGTTGATACTCGAGCTTATTTTACTTCAGCTACAA
\ATITr.'-\TA CAACATliATTTTGATTCTrrGGACACCC JGAAG r Chrysomya varipes
.*
TACAGTAGGAATAGACGlTGATACACGAGCTTACTlTACTTCAGCTACTA
'" ** * • •• • • • * ** *•••* .* •• •••••••••• '"
~r ITAATITTACCTGGAHCGGAATAATITCACATATTAn:AGTC Lucilia sericala TAATTAlTGCTGTACCAACTGGAATTAAGATITTCAGTTGATTAGCTACT
TTTTAATTTIACCTGGATTCGGAATAATTTCA~ATA .. AGT
A!1 C: Chrysomya albiceps TAATTATTGCTGTACCAA TGGAATTAAAATTTTCAGTTGATTAG TACT
ITTTAATTTTAC TGGATTC(lGAATAATI CTCATAl rAITAG~C Chrysomya ehloropyga TAATTATTGCTGTTCC AACTGGAATTAAGATTTTCAGTTGAlTAG AACT
,TTTTAATITrACCfGGATT GGAATAATfTCTCA!ATTAnAGl ~ Chrysomya inc/inala TAATTATTGCTGTACCAACTGGAATTAAGATTTTrAGTTGATTAGCAACT
ITITAATTrTACCTGGATTCGGAATAA'rnC CAfATTATTA~T , Chrysomya marginalis TAATTATTGCTGTACCAACrGGAATTAAAATTTTTAGTTGACTAGCAA CT
~ Tn~ATTfTACCTGG"TTCGGAATAATTTCTCA!ATTATTAGT Chrysomya megacephala TAATTATTGCTGTACTAACTGGAATTAAAATTTTTAGTTGATTAGCAACT
AGTC Chrysomya norrisi TAAlTATTGCTGTACCAACTGGAATl ,\AAATTTTTAGTTGATTAGCAACT
\Tl ' rTAATITTACCTGGATrTGGAATAAITr CTCATAITA:rr
CTGGArrCGGAAT ATITCTCATATrAITAGTC Chrysomya pinguis TAATTATTGCTGTACCAACTGGAATTAAAATTTlTAGTTGAlTAGCTACT
\TInA! \ITITA" J " TT GTe
\TITTAATTTTAC 'TGGAnCGGAATAA1TIC1 CATATlA A, Chrysomya puloria TAATTATTGC:TGTACCAACTGGAATTAAGAT I··IICAGTTGATTAGCAACT
TITT\ATTTIACCTGC'ATTCG(jAATAATTTCCCATATrATTA~TC Chrysomya rujifaeics TAATTATTGCTGTACCGACTGGAATTAAGATTTTCAGTTGATTAGCAACT
Tn~ATTTTAC ~TGGArTTGGAATAATr~CTCATAT:rATTAG:rC Chrysomya semimelal/iea TAATTATTG CGTACCTACTGGAATTAAAATTTTTAGTTGATTAGCAACT
i-\TTTTAAnTTA CTGGATTrGGAAfAATl rc rCAT ITATTAG 1C Chrysomya varipes TAATTATTGCTGTACCAACTGGAATTAAGATTTTTAGTTGATTAGCAACT
~* •••••• *•• *•••••• **... •••••••••••••••••••••••• *********•••• ****.**.*...... * ..... ... ** * *** * •••

CAGGAAAGAAGGAAACTTICGGATCTTTAGGAATGATITAT~CT Lueilia sericala CTTTATGGTACTCAATTAAACTArTCTCCAGCTAC'rlTATGAGClTTAGG


AGGAAAGAAGGAAACTITCGGATCTrrAGGAATGATITATG~ Chrysomya albiceps CTTTATGGTACTCA AITAAA CTATTC CCC AGCTACTTTATGAGCTTTAGG
CAGGAAAGAAGGAAAClTTCGGAT TlTAGGAATGAnTA~GCl Chrysomya ehloropyga CTTTATGGTACTCAATTAAACTATTCTCCAGCTACATTATGAGCTTTAGG
' AGGAAAGAAGGAAACrnCGGAT ~TITAGGAAr.AATfTAl ~~ Chrysomya inelinala CTTTATGGTACTCAATTAAACTAlTCTCCAGCTACTTTATGAGCTTTAGG
. AGGAAAAAAGGAAACATfTGGAT Tl- rAGG AA1AAITTATGC:A Chrysomya marginalis CTTTATGGAACACAATTAAATTACTC CCCAGCTACCTTATGAGCTTTAGG
CAGGAAAAAAGGAAACCTTTGGAfCn-r GGAATAA:n~TGCA Chrysomya megaeephala CTTTATGGAACTCAATTAAATTATTCTCC AGCTACATTATGAG CCTTAGG
rC A(iGTAAGAAGGAAA lTrCGGATCTITAGGAAT~AITl ATGC~ Chrysomya norrisi CTTTACGCAACACAATTAAAlTATTCTC 'AGCTACTCTATGAG TTTAGG
T 'AGGTAAGAAGGAAAcrTITGGATCAnAGGAA1AA,rTTATGc; Chrysomya pinguis CTTTATGGAACTCAATTAAATTATTCACCAGCTACATTATGAGCTCTAGG
. AGGAAAAAAGGAAACT ITCGGAT 'TTTAGGAATGArIiATGC ~ Chrysomya puloria CTTTACGGAACACAATTAAATTATTCTCCAGCTACTTTATGAGCTTTAGG
'CAGGAAAGAAGGAAACTl 'CGGGT TITAGGGATGA:r::TAT~C1 Chrysomya ruflfaeies C1TTACGGAACACAATTAAATTATTCTCCAGCTACTTTATGAGCTTTAGG
rCAG.
' GAAAAAAGGAAA TIT GGATCATTAGGAAr.~Al ITA1GC~ Chrysomya semimelalliea CTTTATGGAACTCAATTAAA CTATTCCCCAGCTACTTT TGAGCTTTAGG
r GGTAAAAAGGAAACAITCGG'I ATTAGGGA1GATlTATGC Chrysomya varipes CTTTATGGAACTCAATTAAA TATfCCC:CTGCTACTTTATGAGCTTTAGG
""... ..... .. ** ••••••••••••••••• * * ** .......
***** ** ** ... "'* ....... ** ** ** •••* *** ****.... . *. *

ENTOMOLOGiA FORENSE 91
Facultad de Ciencias

Lucilia sericala ATTTGTATTTTTATTTACTGTAGGAGGATTAA TG GAGTTLJrlT r GCTA


Cluysamya a/bi 'eps AT TGlA'l TTTT 1\ TG TALJGAGGA rT ACTGG AGTTGTTTTAGCTA
hryso ml'a ch/oropyga ATrl'G'rA Tn-ATTTACTGTAGll GATT GGAC,TIGTTTTAG TA
hrl'sumya illclinala CTTAn A 'TGTA GGAG G 1 A ACTGGAllTA GTTTT CTA
'hr)',\OIIll'a lIIargiliafis ATTTGTA I TTATTT CTGTAGG AGGA ITAACTGGAGTTCiTTTTAGCTA
Chrysomya lIIegacepha/a ATTIG TAT lCii'A'l ITA 'TGT GG AG(jA r AA 'T GGAGTAG TTTTAGC TA
'hrysomva norrisi ATIC ~TATT1TT TTTA TGTA GG AG ATrAA Ci\GGAGTTGrtTYAGCTA
Chrysomya pil1g llis /\T IT 'I'ATTTTTATIT CTGTAll(jACiGACTAAC'.4,CiGAGTTGn AG A A
Chrysomya pllloria AI TTGTATT ATTTA TGTAGGAGG ATTA TG ,A TTGnTrAGCAA
Chrysomya rt(fi[acies CiTTCG'lA r ITATTTACTG TAGGAGGATTACCT GAGTTCiTTCTAGCTA

Chrysomya semililelallica TTT GTATTTTTATTT C CiTAGGAGliA'1 TAACTGGACiTTG TTTTAGCTA

Chrysomya vuripes ATTTGl n n A


** •••••••••••• *.......
TGTAGG AGGl rA AC TGGAG TTG1T lT GC A

** .............. ..

ATT IT CAG I rGAfATT TTC TTCATGACACAT TTATGTAGTTG CTCAT


Lllcilia sericala
Chrysomya a/biceps ATTCTTCA ATTGATATTATT TTCATGACACt\TATTATGTA ,TAGC1CAT
Chry umya ch/oropygo ATT TTCA ATTGATATT TTCTACATGATA CA I TTATGTAG T GCTCAT
Chrysomya inc- fi llala ACT TT AATTG ATATTAT rTTA CATGACA CATAT1ArGTAGTAGCTCAC
Chryso mya IIIO/p,i na /is ATTCAT 'TATTGATA A'ITTTACATGA1A CAT nArGT GTAGCTCA C
Chryso mya megacep ha /u A CATCTATT rAC ATT ATTTT AT GATA CATAC TAT iT , TAG TC C
Chryso mya nurrisi ATTc CTATTG rATIATTTTAC ATGATACTIACTATGTA GT/\ C r 'AC
Chrysomya pil1guis ACTCTTCTATTG TATTATT TTACATGATA CA[ATTATGTA TAGC 'AC
Chryso mya p ulorio CAT( A ATTGACATTATTTT CATG ATACLJTATTATGTAGT Ci CTCAC
Chrysomya rufi/uc ies ATT TCA ATT CATTATTTTA ATGACACATACTATGTAGTA r 'T 'AC
Chry omya semimela l/ica ATT "ITCT n 'GA LI\T TATTCTA ATGAC A CATATTAT T GTT GC C C
Chrysomya vuripes ACTCTT ' Gl - r G TATTATTTTAC TG ATACATA TA'rGTAG TAGCT
• •••• *** ••••••••••••• ** •••••••••• ** ••

Lucilia sericara TTCCACTATGTA1T ATCAATAGCiAGCTG "ITCGCIArT TAG AGGGTT


Chrysomya a/biceps TTCCA TATGTATTATCAATAGGAG TGTATTCGCT TTATAGCAGGGTT
Cillysumyu ch/oropyga IT ' AT GTATTATCAATAGGAGL'I'GTATTT GCTA ATAG CAGG TT
Chlysomya inclinala TrCCA T TGTATT TCAATAGG AG TGTATTTGCTATIATAG 'AGGATT
Chrysomya murg illalis n 'c ATT ATGT rCTlT A ATAG GAGCTGTI\TTCGC1ATTMAG ' AGGATT
Chrysomya megacepha/a TTCCATTATG TTCTITC AATA GG AG -T GTATTTGCT,\"ITATAG 'A J rATT
Cluysolllya no rris i TTC '/\ TATGTATTAT ATAGGAG CTG TAn-TG CTA TA GCT ,GATT
Chr),somyu pinguis TIC A1TATGHCTTTCTATA GAGCTGTATTTGCTAn ATA GCT ,GTTT
Chrysomya putoria TICCAJTATCiTIClAfCAATGGGAGCTGTAIITGCTATrATAGCAGCiATT
Chrysamya rlIfiJac;ies TTCCATTACGT' TTATCA ATGGG AG TGTATTTG CTATTATAG AG ATT
Chrysamya semimelal/ica -ITCCATT TGTATIAT CAATAGGAG CTGT TTTGC TAl ATAG CAGGATT
Chrysamya ""ripes
............. * • ••••••• *.. ...............

TTCCATIATGTTTI TCAATGGGAG TGTATTTGCTATIATAGCA GGATT

Cada secuencia corresponde a un individuo con 400 pares de bases comparadas. Las secuencias

deben alinearse manualmente y posteriormente con la ayuda de un algoritmo mate matico median­

te un software como CLUSTAL 0 MEGA.

Un alineamiento es una comparacion nucleotido a nucleotido de una secuencia 0 cadena de ADN.

La comparacion se hace para todas las especies en bloques de 50 nucleotidos .

Gracias al polimoriismo entre especies existen fragmentos de secuencias presentes 0 caracteris­

ticas en una especie y no en otra

Con base en secuencias de ADN para el genero Chrysomya se conoce que C_ a/biceps
C. rufifacies y C. putoria, constituyen Ifneas monofileticas que se separaron hace mas de un
millon de anos . Las secuencias del gen Citocromo oxidasa permiten diferenciar claramente las
especies del genero que se confunden moriologicamente en el troipico y con base en RFLPS
puede disenarse una prueba diagnostica para cada especie y aun para cada raza 0 variante geo­
grafica de una especie . La variabilidad geogratica es diferenciable y cuantificable con base en las
secuencias permitiendo precisar los niveles intra e interespecificos y utilizar fragmentos de se­
cuencias como marcadores moleculares.

ENTOMOLOG A FORE1\ISE
92
Sistematica Molecular

Chrysomya semimetallica

Lucilia sericata

". * .............................. * •
Chrysomya marginalis

Chrysomya inclinata

r CA iTTGATATTA
Chrysomya chloropyga
................................ *.

:ACT TGTAriAf-C'AATAGG G

Chrysomya putoria

Chrysomya megacephala

..... *.... ..................... ** ••


Chrysomya pinguis

I
iduo con 400 pares de bases comparadas , Las secuencias
~ II'\' I'I'n':>nto
con la ayuda de un algoritmo matematico median­
Chrysomya norrisi
ucleotido a nucleotido de una secuencia 0 cadena de ADN ,
especies en bloques de 50 nucleotidos,
existen fragmentos de secuencias presentes 0 caracterfs­
Chrysomya varipes

el genera Chrysomya se conoce que C, albiceps


Ifneas monofileticas que se separaran hace mas de un
Citocramo oxidasa permiten diferenciar claramente las Chrysomya albiceps
n morfologicamente en el troipico y con base en RFLPS
ca para cad a especie y aun para cad a raza 0 variante geo­
geografica es diferenciable y cuantificable con base en las
les intra e interespecfficos y utilizar fragmentos de se-
Chrysomya rufifacies

ENTOMOlOGIA FORENSE 93
Facult'ld de iencias

Dado que no es del alcance del presente texto profundizar en el analisis molecular, se
remite a textos especializados y a la literatura citada al final sobre secuenciaci6n y taxo­
nomfa molecular. Tambien, los resultados finales del anal isis molecular de Diptera de im­
portancia Forense con base en secuencias pr6ximo a publicarse. .
Se incorporan los protocolos basicos de extracci6n y amplificaci6n del ADN a partir de
insectos, como una forma de difusi6n de protocol as que sin duda seran una de las herra­
mientas mas utiles para los entom610gos forenses en el futuro.

Es importante aclarar. que cuando se usan tecnicas moleculares s610 se toma una porci6n

de musculo toracico retirada con culdado mediante una incisi6n en el area del ala del insec­

to. Asi puede guardarse los especimenes como colecci6n de referencia y complementar las

inferencias moleculares con las realizadas usando caracteres morfol6gicos ,10 cual cons­

tituye la metodologia ideal.

Las tecnicas moleculares en Entomologia forense, no son la panacea, pero sin duda cons­
Uuslracione .
tituyen una de las herramientas que mas se proyecta al futuro en Colombia y el mundo .

Las ilustraciones fueron redibujadas por Federico Fernandez G


EI futu ro de la Entomologia forense en Colombia esta por construir y se precisa de la

integraci6n de tecnicas y disciplinas pero sobre todo, del trabajo y discusi6n conjunta de
GONZALES, R; CARREJO, N.S.1992. Introducci6n al estudio d
los diversos grupos que a ella se dedican.
Cali , Colombia. P 197.

MCALPINE, J.F. et.al. Manual of Neartic Diptera (Monograph/AI


Minister of supply and services. Canada 1993. p 674.

MC GAVIN , G.2001 . Essential Entomology. Oxford University. r

SERNA, F.J. 1996. Entomologia general, guia para reconocer 6rdE


de Colombia, Medellin, Colombia. P110 .

MOWC[A FORl!NSE
94
Sistema tica Molecular

nte texto profundizar en el anal isis mol~cul,ar, se


literatura citada al final sobre secuenclaclon y taxo­
dos finales del anal isis molecular de Dlptera de Im­
,ncias proximo a publicarse. .
de extracd6n y amplificacion del ADN a partir de
de protocolos que sin duda seran una de las herra­
gas forenses en el futuro .

. usan tecnicas moleculares solo se toma una porcion


lado mediante una incision en el area del ala dellns~c­
' nes como coleccion de referenda Y complementar as
Jizadas usando caracteres morfologicos ,10 cual cons­

)Iogia forense, no son la panacea, per.o sin duda ~ons­


mas se proyecta al futuro en Colombia Y el mun o.
Las ilustraciones fueron redibujadas por Federico Fernandez Gartner de los siguientes textos :

~ en Colombia esta por construir y se, precisa de la GONZALES, R; CARREJO, N.S.1992. Introducci6n al estudio de los Diptera. Universidad del Valle.

. pero so bre todo , del trabajo Y discuslon conJunta de Cali , Colombia. P 197 .

dican.
MC ALPINE , J.F. et.a!. Manual of Neartic Diptera (Monograph/Agriculture Canada; 27-28) . Ottawa:

Minister of supply and services. Canada 1993. p 674.

MC GAVIN , G.2001 . Essential Entomology. Oxford University. New York, United States. P 318.

SERNA, F.J . 1996. Entomologfa general, guia para reconocer 6rdenes y familias. Universidad Nacional

de Colombia, Medellin, Colombia. P11 O.

ENTOMOLOGiA FORE.NSE 95
Facultad de Ciencias

BIBLIOG RAFiA BULLINGTON, S.W. Forensic Entomology


http://ourworld.compuserve . com I 7 home pages/Sbullingt<
ANDERSON GS. 1995. The use of insects in death investigations: An analysis of forensic entomology
cases in British Columbia over a five year period. Canadian Soc Forensic Sci J.; 28: 277-292 CATTS EP; HASKELL NH, 1990. Entomology and death: a pn
Joyce's Print shop, Inc.,180 pp
ANDERSON, G.S. AND VANlAERHOVEN, S.L. 1996. Initial studies on insect succession on CATTS, E.O. & M.L. GOFF. 1992. Forensic entomology in cri
carrion in Southwestern British Columbia. J Forensic Sci, 41,(4) : 617-625 Review of Entomology, Standford, 37: 253-272 .

ANDERSON GS. 1997.The use of insects to determ ine time of decapitation : A case study from
CAMACHO G.2003 . Sucesion de la entomofauna cadaverica 1
British Columbia. J Forensic Sci. (5): 947-950
especies colonizadoras, utilizando como biomodelo cerdo blar
Bogota. En : Memorias XXX congreso SOCOLEN. (Santiago DI
AMENDT, J.; R. KRETTEK; C. NIESS; R. ZEHNER & H. BRATZKE. 2000. Forensic entomology in
Germany. Forensic Science International, Limerick, 113 : 309-314 .
CENTENO N, MALDONADO M, OLlVAA. 2000. Preliminary fc
domestic pig in Argentina. In: Abstracts of the XXI Internation,
ARNALDOS, ISABEL 2001. An initial study on the succession of sarcosaprophagous Diptera
Iguazu, Brazil, August 2000),2: 758.
(Insecta) on carrion in the southeastern Iberian peninsula. International Journal of Legal Medicine.
114: (3): 156-162
CHU, H. F. 1949. How to know the immature insects. WM.C . BI
Iowa. 234 pp
AVNEESH GUPTA; PUNEET SETIA. Forensic entomology - past, present and future. Aggrawal ' s
internet journal of forensic medicine and toxicology. 5 (1) (2004) 50 - 53.
D' ALMEIDA, JOSE MARIO AND OLIVEIRA, VANDERLEIA C
para a criacao, em laboratorio, de Chrysomya C. megacephal,
BARTHOLO J., APARECIDA F, RODRIGUES P, SOUZA G, DEL BIANCO L, VON ZUBEN C. J, Calliphoridae. Entomologia y Vectores (Brasil) . 9: (1) 79-91
NOGUEIRA, M, CONDE W. A. 2002. Larval Dispersal and Predation in Experimental Populations
of Chrysomya albiceps and Cochliomyia macellaria (Diptera: Calliphoridae). DAZA, M; YUSSEFF Z. 2003 Caracterizacion de la entomofc
cadaverica empleando el cerdo (Sus scrofa) como patron para la
97(8) : 1137-1140, en el municipio de Tunja. En: Memorias XXX congreso SOCOL

BEYER, J.C.; ENOS, W.F; STAJIC, M. 1980. Drug identificacion trough analylisis of maggots. J DAVID, J.A de 0, ROCHA, T; CAETANO, I.H .2003. Eggs ultram(
Forensic Sci. 25 411-41? megacephala and Chrysomya albiceps (Diptera: CalliphoridE
supplemenr B, Sept 2003. XIX congreso of the Brazilian societ
BHARTI, MEENAKSHI.2003. Insect faunal succession on decaying rabbit carcasses in Punjab,
India. J Forensic Sci . 48:(5): 1133-1143 EARLY M, GOFF M L. 1987. Arthropod succession patterns i
Oahu, Hawaii. Journal Med Entomol; 23: 520-31
BARRETO, M; BURBANO ,M. E ; BARRETO, P.(2000) Flies (Calliphoridae, Muscidae) and Beetles
(Silphidae) from human cadavers in Cali, Colomhia. Mem inst Oswaldo Cruz, 97: (1) 137 - 138 ESPINAL. L.S. 1992 Geograffa ecologica de Antioquia: ZonE
Colombia. Facultad de Ciencias y facultad de Ciencias Agrope
BENECKE, M. 1998.Six forensic entomology cases: Description and commentary. J Forensic
Sci.; 43 (4): 797-805 GOFF ML, EARLY M, ODOM CB, TULLIS K. 1986. A preliminal
with exposed carrion in the Hawaiian Islands. Proc Hawaii En
BORROR, D.J.; C.A. TRIPLEHORN, AN D N.F. JOHNSON. 1989. An introduction to the study of
insects, 6ta Edition. Sanders College Publishing, Philadelphia. 875 p. GOOFF, M.L; OMORI, A.I; GOOOBROO, J.R. 1989. Effect of co
rate of Boetcherisca peregrina (Dfptera Sarcophagidae) . J. Me
BOUREL, B; FLEURISSE, L; HEOOUIN V, CAILLIEZ ,J.C. ; CREUSY, C. GOFF, ML, GOSSET,
0.2001. Inmunohistochemical contribution to the study of morphine metabolism in Calliphoridae GOFF ML, FLYNN MM. 1991 . Determination of post mortem
larvae and implications in forensic entomotoxicology. J Forensic Sci 46.(3): 596 - 599 case study from the Hawaiian Islands. J Forensic Sci; 36: 607·

ENTOMOLOGfA FORE SE
96
Sis tcm:itica Molecular

BIBLIOGRAFIA BULLINGTON, S.W. Forensic Entomology


http: // ourworld .compuserve . com I 7 home pages/Sbuilington/#D

ICtS in death investigations: An analysis of forensic entomology CATTS EP; HASKELL NH, 1990. Entomology and death: a procedural guide. Clemson, SC:
'ear period. Canadian Soc Forensic Sci J.; 28: 277-292 Joyce's Print shop, Inc., 180 pp

l OVEN, S.L. 1996. Initial studies Oil insect succession on CATTS, E.O. & M.L. GOFF. 1992. Forensic entomology in criminal investigations. Annual
1bia. J Forensic Sci, 41 ,(4): 617-625 Review of Entomology, Standford, 37: 253-272.

1sects to determine time of decapitation : A case study from CAMACHO G.2003. Sucesi6n de la entomofauna cadaverica y ciclos de vida de las primeras
947-950 especies colonizadoras, utilizando como biomodelo cerdo blanco (Sus scrofa) en la Sabana de
Bogota. En: Memorias XXX congreso SOCOLEN. (Santiago DE Cali,Colombia, Julio 2003)
>; R. ZEHNER & H. BRATZKE. 2000. Forensic entomology in
:e International, Limerick , 113: 309-314 . CENTENO N, MALDONADO M, OLIVA A. 2000. Preliminary foundings of necrophagous Fauna on
domestic pig in Argentina . In: Abstracts of the XXI International Congress of Entomology (Foz do
ial study on the succession of sarcosaprophagous Diptera Iguazu, Brazil , August 2000) , 2: 758.
rn Iberian peninsula. International Journal of Legal Medicine.
CHU, H. F. 1949. How to know the immature insects. WM .C. Brown Company publishers Dubuque
Iowa. 234 pp
•. Forensic entomology - past, present and future. Aggrawal's
and toxicology. 5 (1) (2004) 50 - 53 . D' ALMEIDA, JOSE MARIO AND OLIVEIRA, VANDERLEIA CRISTINA DE. 2002. Dietas artificiais
para a criacao, em laboratorio, de Chrysomya C. megacephala, C. albiceps e C. putoria Dipteraa :
DRIGUES P, SOUZA G, DEL BIANCO L, VON ZUBEN C. J, Calliphoridae. Entomologia y Vectores (Brasil). 9: (1) 79-91
. Larval Dispersal and Predation in Experimental Populations
rnyia macel/aria (Diptera: Calliphoridae) . DAZA, M; YUSSEFF Z. 2003 Caracterizaci6n de la entomofauna asociada a la descomposici6n
cadaverica empleando el cerdo (Sus scrofa) como patrOn para la descomposici6n cadaverica humana
en el municipio de Tunja. En: Memorias XXX congreso SOCOLEN (Julio 2003 Cali,Colombia) .

DAVID, J.A de 0, ROCHA, T; CAETANO, I.H .2003. Eggs ultramorphology of the blow flies Chrysomya
, M. 1980. Drug identificacion trough analylisis of maggots. J
megacephala and Chrysomya albiceps (Diptera: Calliphoridae). Acta microscopica, volumen 2,
supplemenr B, Sept 2003. XIX congreso of the Brazilian society for microscopy and Microanalisis.
ct faunal succession on decaying rabbit carcasses in Punjab,
EARLY M, GOFF ML. 1987. Arthropod succession patterns in exposed carrion on the island of
1143 Oahu, Hawaii. Journal Med Entomol; 23: 520-31
A RRETO, P.(2000) Flies (Calliphoridae, Muscidae) and Beetles
ESPINAL. L.S. 1992 Geograffa ecol6gica de Antioquia: Zonas de vida Universidad Nacional de
Cali, Colomhia. Mem inst Oswaldo Cruz , 97: (1) 137 - 138
Colombia. Facultad de Ciencias y facultad de Ciencias Agropecuarias Sede Medellin. 146 pp
entomology cases: Description and commentary. J Forensic
GOFF ML, EARLY M, ODOM CB, TULLIS K. 1986. A preliminary checklist of arthropods associated
with exposed carrion in the Hawaiian Islands. Proc Hawaii Entomol Soc.; 26: 53-57
N, AND N.F. JOHNSON. 1989. An introduction to the study of
GOOFF, M.L; OMORI, A.I; GOODBROD, J.R. 1989. Effect of cocoines in tissues on the development
e Publishing, Philadelphia. 875 p. rate of Boetcherisca peregrina (Diptera Sarcophagidae) . J. Med. Entomo!. 26: 91 - 93.
OUIN V CAILLIEZ ,J.C. ; CREUSY, C. GOFF, ML, GOSSET,
GOFF ML, FLYNN MM. 1991. Determination of post mortem interval by arthropod succession : a
tribution'to the study of morphine metabolism in Calliphoridae
case study from the Hawaiian Islands. J Forensic Sci; 36: 607-614
ntomotoxicology. J Forensic Sci 46.(3) : 596 - 599

ENTOMOLOGJA FORENSE 97
Facultad de Ciencias

GOFF M.L. 1993. Festfn de pruebas: Insectos al servicio forense . Memorias de la reunion anual
de la AAFS. Febrero 16. en Boston Massachussets. En Informe cientffico Patologfa forense No
JANNACONE, Jose. Arthropofauna of forensic importa
4. Instituto de Medicina legal y ciencias forenses.
Rev. Bras. Zoo!., Mar. 2003, vo1.20, no.1, p.85-90.
GOFF ML. 1991. Comparison of insect species associated with decomposing remain recovered
IDROBO. C.J.; MARTINEZ W. A. 2000. Interrelaciones de in
inside dwellings and outdoors on the island of Oahu, Hawaii. J forensic Sci. 36:(5) . 748 .
. descomposicion. Laboratorio de Bioantropologia Universidad
En : Memorias XXVII Congreso SOCOLEN. (Medellin, Colom
GOMES, L; ZUBEN, C. J Y otros 2002. Comportamento da dispersao larval radial posalimentar
em moscas-varejeiras do genero Chrysomya Diptera: Calliphoridae : busca por novas fontes de
JIMENEZ S, LATORR E L, ROMAN A, USAQUEN W. 21
alimento. Entomologia y Vectores (Brasil) 9: (1) : 115-132
entomologica en el cuerpo de cerdo domestico (Sus scrofa)
Nacional de Bogota. En: Resumen XI congreso Nacional de
GONZALEZ, R; CARREJO, N. 1992. Introduccion al estudio de los diptera. Santiago de cali,
"desastres y derecho internacional humanitario" . CD.
editorial Universidad del Valle Colombia. 197p.
JUNQUEIRA A. C; AZEREDO-ESPIN A.M. 2002. Chrysomya
GRASSBERGER, MARTIN AND REITER, CHRISTIAN.2002 Effect of temperature on development
control region : Characterization and variability. In: The 2002 E
of liopygia (= Sarcophaga) argyrostoma (Robineau - Desvoidy) (Diptera : Sarcopheagidae) and i~s
Lauderdale, FL Display Presentations, Section D. Medical al
forensic im HOBISCHAK NR, ANDERSON GS 2002. Time of submergence uSing aquatic
en : http://esa.confex.com/esal2002/techprogram/session_1(
invertebrate sucession and decompositional changes. J Forensic Sci: 47 (1): 142 - 151 .
plications. J Forensic Sci. 47: (6) : 1332-1336
KRUGER, R; BRETANHA P; and others 2003. Cicio oe vida
Macquart Diptera, Sarcophagidae. Entomologia y Vectores (I
GRASSBERGER, M,FRIEDRICH, E and otherS.2003 The blowfly Chrysomya albiceps
(Wiedemann) (Diptera : Calliphoridae) as a new forensic indicator in Central Europe. International
KURALTASHI, ~.2002 . Key to the calliphoridae adults of fore
Journal of Legal Medicine.117:(2): 75-81
Pp 127- 138. InN Greenberg, B I Kunichi, S.E. 2002. Entor
indicatives. Cambridse university
GREENBERG B. 1990. Behavior of post feeding of some Calliphoridae and a Muscidae (Diptera).
Annals of the entomological society of America . 83(6)
LAURENC E, B. R. 1986. Old world blowflies in the new worle

GREENBERG B. 1991. Flies as forensic indicators. J of Medical Entomology. 28 ( 5) MADEIRA. N.G.2001 . Seria Chrysomya albiceps (Diptera Calli
Bras. Med . Vet. Zootec.; v. 53; nO. 2; p. 157-161
GRUPO DE ENTOMOLOGIA FORENSE INSTITUTO DE MEDICINA LEGAL Y CIENCIAS
FORENSES, DIVISION DE INVESTIGACION CIENTIFICA. Aproximacion al intervalo post mortem
MARK BENECKE.1998. Random Amplified Polymporphic DN)
(IPM) utilizando curvas de crecimiento y desarrollo y sucesion ecologica en ellnstituto Nacional necrophageous insects (diptera, coleoptera) in criminal forensl
de Medicina Legal y Ciencias Forenses, Bogota. En : Memorias XXX congreso SOCOLEI\J . Forensic Science International 98:157-168
(cali, Colombia Julio 2003)
MAGANA C. 2001 . La entomologia Forense y su aplicacion a I
HASKELL N.H. McSHAFFREY D.G.; HAWLEY D.A.; WILLIAMS R.E; Aracnet 7-bol. S.E.A 28:49-57.
PLESS J.E. 1989. use of aquatic insects in determining submersion interval.
J Forensic Sci. 34 (3) : 622 - 632 MAGANA, C. HERNAN DEZ M. S. Aplicaciones de la entomc
medico legales . En: resumenes IX congreso Iberico de ent~r
HICKMAN, C.P. and L. S. ROBERTS. 1994. Animal Diversity. Wm. C. Brown, Dubuque, IA. http :// www.entomologia.resiris.es

HILLIS, D.M., C. MORITZ, MABLE, B.K. 1996. Molecular Sistematics. Second edition . Sinauer MALDONADO MA. 2003. Datos preliminares de la sinantl
Associates. Inc. Sunderland. Massachusetts, USA. Calliphoridae del sur de la provincia de Cordoba, Argentina
Internacional sobre Control Epidemiologico de Vectores. Ciudad I
HOBISCHAK NR, ANDERSON GS 2002. Time of submergence using aquatic invertebrate 2003. Poster Nro . 2, pp: 36.
sucession and decompositional changes. J Forensic Sci: 47 (1) : 142 - 151.
MANN RW, BASS WM . 1990. Time since death and decompo
and observations in case and experimental field studies . J For,

ENTOMOLOGiA FORENSE
98
Sistematica Molecular

Insectos al servicio forense . Memorias de la reunion anual


assachussets. En Informe cientffico Patologfa forense No IANNACONE, Jose. Arthropofauna of forensic importance in pig carcass in Callao, Peru.
Rev. Bras. Zoo!., Mar. 2003, vo1.20, no.1, p.85-90.
as forenses.

:;t species associated with decomposing remain recovered IDROSO. C.J.; MARTINEZ W. A. 2000 . Interrelaciones de insectos asociados a hfgado humano en
Isl and of Oahu, Hawaii. J forensic Sci. 36:(5). 748. descomposicion. Laboratorio de Bioantropologia Universidad del Cauca. Popayan. Cauca Colombia.
En: Memorias XXVII Congreso SOCOLEN . (Medellin , Colombia Julio 2000)
)2 . Comportamento da dispersao larval radial posalimentar
ysomya Diptera: Calliphoridae : busca por novas fontes de JIMENEZ S, LATORRE L, ROMAN A, USAQUEN W. 2002. Estudio preliminar de sucesion
entomologica en el cuerpo de cerdo domestico (Sus scrofa) en la estacion de carabineros Parque
'asil) 9: (1): 115-132
Nacional de Bogota. En : Resumen XI congreso Nacional de Medicina Legal y Ciencias Forenses.
~. Introduccion al estudio de los diptera. Santiago de cali, "desastres y derecho internacional humanitario". CD .
)ia. 197p.
JUNQUEIRA A. C; AZEREDO-ESPIN A.M. 2002. Chrysomya putoria (Diptera: Calliphoridae) mtDNA
rER, CHRISTIAN.2002 Effect of temperature on development control region: Characterization and variability. In: The 2002 ESAAnnual Meeting and Exhibition Fort
la (Robineau - Desvoidy) (Diptera : Sarcopheagi?ae) and its Lauderdale, FL Display Presentations, Section D. Medical and Veterinary Entomology. Disponible
DERSON GS 2002. Time of submergence uSing aquatic en: http://esa.confex.com/esa/2002ltechprogram/session_1075.htm
Isitional changes. J Forensic Sci: 47 (1): 142 - 151.
KRUGER, R; BRETANHA P; and others 2003. Cicio de vida de Sarcophaga (Liopygia) crassipalpis
32-1336
Macquart Diptera, Sarcophagidae. Entomologia y Vectores (Brasil). 10;(1): 85-98
E and others.2003 The blowfly Chrysomya albiceps
e) as a new forensic indicator in Central Europe. International KURALTASHI, t-!.2002. Key to the calliphoridae adults of forensic importance in the oriental region .
Pp 127- 138. InN Greenberg, B / Kunichi, S.E. 2002 . Entomology and the low Flies as forensic
-81
indicatives. Cambridse university
)ost feeding of some Calliphoridae and a Muscidae (Diptera) .
LAURENCE, B. R. 1986. Old world blowflies in the new world . Parasitology today (2): 77 - 79
of America. 83(6)
MADEIRA. N.G.2001. Seria Chrysomya albiceps (Diptera Calliphoridar) uma especie benefica? Arq.
msic indicators. J of Medical Entomology. 28 ( 5)
Bras. Med. Vet. Zootec .; v. 53; n°. 2; p. 157-161
~ENSE INSTITUTO DE MEDICINA LEGAL Y CIENCIAS
GACION CIENTIFICA. Aproximacion al intervalo post mortem MARK BENECKE.1998. Random Amplified Polymporphic DNA (RAPD) typing of and use in practice
necrophageousinsects (diptera, coleoptera) in criminal forensic studies: validation and use in praxi.
1tO y desarrollo y sucesion eco'logica en ellnstituto Nacional
Forensic Science International 98:157 -168
ses, Bogota. En: Memorias XXX congreso SOCOLEN .
MAGANA C. 2001 . La entomologia Forense y su aplicacion a la medicina legal. Data de la. Muerte.
Aracnet 7 -bol. S.E.A 28:49-57 .
; HAWLEY D.A.; WILLIAMS R.E;

cts in determining submersion interval.

MAGANA, C. HERNANDEZ M. S. Aplicaciones de la entomologia forense en las investigaciones


medico legales. En: resumenes IX congreso Iberico de entomologia (Julio 2000). disponible en :
http:// www.entomologia.resiris.es
1994. Animal Diversity. Wm . C. Brown , Dubuque , IA.

MALDONADO MA. 2003. Datos preliminares de la sinantropia y capacidad vectorial de las


, B.K. 1996. Molecular Sistematics. Second edition . Sinauer Calliphoridae del sur de la provincia de Cordoba, Argentina. En: Resumenes del VI Simposio
setts, USA. Internacional sobre Control Epidemiologico de Vectores. Ciudad de Buenos Aires (Argentina), Octubre
2003. Poster Nro. 2, pp: 36.
2002. Time of submergence using aquatic invertebrate
ges. J Forensic Sci: 47 (1): 142 - 151.
MANN RW, BASS WM. 1990. Time since death and decomposition of the human body: Variables
and observations in case and experimental field studies . J Forensic Sci. 35: (1) 103.

E NTOMOLOGlA FORENSE 99
Facultad de Ciencias

MARl LUIS, J.C. 2002. Key to common adult blowflies of South America . Pp 94 -1 00. In: Greenberg,
B. Kunich, J.C. 2002 . Entomology an the law. Flies as forensic indicators. 306 pp. Cambridge REVERTE COMA J M. 1991 entomologia Forense en Antro
University press. Secreta ria General Tecnica. Centro de Publicaciones Madric

MEGNIN. P. la faune des cadavers. Aplicaci6n de la entomologia a la medicina legal. Madrid RICHARDS E.N.; GOFF M.l. 1991 . Arthropod succession 0 1
Saturnino Calleja Editor 1894. tropical habitats on Hawaii Islands. J Medical Entomology. 3

MEMORIES VII European congress of entomology. (Thessaloniki, Grece October 2002) ROSSI, G.; MARl LUIS J .C; SNCHACK J.A ; SPINELLI G.R
Calliphoridae) de la provincia de Buenos Aires . COBIOBO #
MEEN'A KSHI B, DEVINDER S. Insect faunal succession on decaying rabbit carcasses in Punjab,
India. J Forensic Sci. 34 (5) :1133-1143 SCHOENLY, K.; Rhine, S., 1991 . An experimental field prol
interval using multidisciplinary indicators .
OLAYA M. L.A. 2000. Estudio de la entomofauna sucesional en el cadaver de un canido en J . Forensic Sci. 36:(5) 1395 - 1415
condiciones de campo. Biologia- Entomologia. Universidad del Valle . Cali. Valle del Cauca.
En:Memorias XXVII Congreso SOCOlEN (Medellin, Colombia, Julio 2000) SCHOENLY, K.; GOFF, M. L; EARLY, M., 1992. A basic alg
interval from arthropod successional data.
OSPINA M.F. 2003.lnsectos necr6fagos encontrados en la zona de Mosquera (Cundinamarca).En: J . Forensic Sci, 37:(6) 808 - 823.
Memorias XXX congreso SOCOlEN (Santiago de Cali , Colombia, Julio 2003)
SHERMAN, R; MY-TIEN TRAN J. 1995 A simple, stelrile food
PARISE-MALTEMPI, P Arancini, R 2001 . C-banding and FISH in Chromosomes of the blow flies sericata (Diptera: Calliphoridae) . Medical and veterinary ento
Chrysomya megacephala and Chrysomya putoria (Diptera, Calliphoridae). Mem inst oswaldo cruz
96(3) 371- 377.
SMITH, K.E, WALL, R.1998. Estimates of population densil
sericata (Diptera Calliphoridae). Bulletin of entomological re:
PETERSEN. A. 1973. larvae of insects (An introduction to Neartic species) . OhioState University.
Edwards Brothers Inc. Ann Arbor Michigan.

PINTO DE MELLO, RUBENS. 2003 Chave para a identificacao das formas adultas das especies TOMBERLIN, J.K. & P.H. ADLER . 1998. Seasonal colonizati
da familia Calliphoridae (Diptera, Brachycera , Cyclorrhapha) encontradas no Brasil. Entomologia y water and on land in an open field in South Carolina. Journal
Vectores (Brasil). 704-709.
10: (2) :. 255-268
TURNER B.; HOWARD T. 1992. Metabolic heat generation in (
PRIMER CURSO INTERNACIONAL DE ENTOMOLOGIA FORENSE. 1999. Instituto Nacional de
for forensic entomology. Medical and Veterinary Entomology.
Medicina legal y Ciencias Forenses. Santafe de Bogota.
URIBE .A.; WOLFF M. 2000. Sucesi6n de insectos carronE
RATCLIFFE, S.T; WEBB, D.W; WEINZIEVER, R.A; ROBERTSON, H.M.2003
Medellin - Colombia. Universidad de Antioquia . Medellin Col (
PCR -RFlP Identification of Diptera (Calliphoridae, Muscidae and Sarcophagidae) - a generally
de Biologia. Universidad de Antioquia. Medellin Colombia.
aplicable method . J Forensic Sci. 48 (4) :783 - 785.
VANCEGM.; VAN DYKJ.K.; ROWLEYW.A.1995 .Adevicefc
RATCLIFFE, S.T; WEBB, D.W; WEINZIEVER, R.A; ROBERTSON, H.M.2003
with carrion in water. J Forensic Sci. 40 (3) 479 - 482
PCR -RFlP Identification of Diptera (Calliphoridae, Muscidae and Sarcophagidae) - a generally
aplicable method. J Forensic Sci . 48 (4):783 - 785.
VINCENT, S. VIAN, J.M. CARLOTI M,P. Partial secuencing (
gene I: a tool for the identification of european species of blow fi
RESTREPO. A. 1944. Meditaciones biol6gicas sobre la muerte. Editorial Bedout. Medellin, Colombia.
J Forensic Sci; 45 (4) : 820 - 823.
p396
VON ZUBEN, C.J.; BASSANEZI, R.C.; DOS REIS, S.F.; GO[
RESTREPO C., FR. VALDERRAMA R.; MARIN M.A; CADAVID G.A. 2000 Artr6podofauna
Theoretical approaches to forensic entomology: I. Mathematica
cadaverica asociada con los estados de descomposici6n del intervalo post mortem en el cerdo Sus
J Appl. Entomol. 120: 379 - 382
scrofa, en dos medios ecol6gicos diferentes. Tesis de grado. Departamento de Biologia. Universidad
de Antioquia. Medellin Colombia.

E NTOMOLOGi FORENSE
100
Sistematica Molecular

3.dult blowflies of South America. Pp 94 -1 00. In: Greenberg,


REVERTE COMA JM. 1991 entomologfa Forense en Antropologfa forense . Ministerio de justicia
the law. Flies as forensic indicators . 306 pp. Cambridge
Secreta ria General Tecnica. Centro de Publicaciones Madrid

RICHARDS E.N.; GOFF M.L. 1991. Arthropod succession on exposed carrion in three contrasting
Aplicacion de la entomologfa a la medicina legal. Madrid
tropical habitats on Hawaii Islands. J Medical Entomology. 34 (3): 328 - 339

ROSSI, G.; MARlLUIS J.C; SNCHACK J.A ; SPINELLI G.R. 2002. Dipteros vectores (Culicidae y
of entomology. (Thessaloniki, Grece October 2002)
Calliphoridae) de la provincia de Buenos Aires . COBIOBO # 4, PROBIOTA # 3. En: www
: faunal succession on decaying rabbit carcasses in Punjab,
SCHOENLY, K.; Rhine, S., 1991. An experimental field protocol for investigating the postmortem
I
interval using multidisciplinary indicators.
J. Forensic Sci. 36:(5) 1395 -1415
entomofauna sucesional en el cadaver de un canido en
)tomologia . Universidad del Valle. Cali. Valle del Cauca .
SCHOENLY, K.; GOFF, M. L; EARLY, M., 1992. A basic algorithm for calculating the postmortem
-EN (Medellin, Colombia, Julio 2000)
interval from arthropod successional data.
J. Forensic Sci, 37:(6) 808 - 823.
)Sencontrados en la zona de Mosquera (Cundinamarca).En:
Santiago de Cali, Colombia, Julio 2003)
SHERMAN, R; MY-TIEN TRAN J. 1995Asimple, stelrile food source for rearing the larvae of Lucilia
sericata (Diptera: Calliphoridae). Medical and veterinary entomology, (9) 395 - 398
'001. C-banding and FISH in Chromosomes of the blow flies
mya putoria (Diptera, Calliphoridae) . Mem inst oswaldo cruz
SMITH, K.E, WALL, R.1998 . Estimates of population density and dispersal in the blow fly Lucilia
sericata (Diptera Calliphoridae). Bulletin of entomological research 88 p 65 - 73.
~ts (An introduction to Neartic species) . OhioState University.
ligan.

Chave para a identificacao das formas adultas das especies TOMBERLIN, J.K. & P.H. ADLER. 1998. Seasonal colonization and decomposition of rat carrion in
:hycera, Cyciorrhapha) encontradas no Brasil. Entomologia y water and on land in an open field in South Carolina. Journal of Medical Entomology, Lanham, 35 :
704-709.

TURNER B.; HOWARD T. 1992. Metabolic heat generation in dipteran aggregations. A consideration
DE ENTOMOLOGiA FORENSE. 1999. Instituto Nacional de for forensic entomology. Medical and Veterinary Entomology. 6. pp 179 - 181
, Santafe de Bogota.
URIBE .A.; WOLFF M. 2000. Sucesi6n de insectos carrofieros en cerdo blanco (Sus scrofa) en
~ZIEVER, R.A; ROBERTSON, H.M.2003 Medellin - Colombia. Universidad deAntioquia. Medellfn Colombia . Tesis de grado. Departamento
(Calliphoridae, Muscidae and Sarcophagidae) - a generally de Biologfa. Universidad deAntioquia. Medellin Colombia.
I (4):783 - 785.

~ZIEVER'
VANCE GM.; VAN DYK J.K.; ROWLEY W.A. 1995. A device for sampling aquatic insects associated
R.A; ROBERTSON, H.M.2003 with carrion in water. J Forensic Sci. 40 (3) 479 - 482
(Calliphoridae, Muscidae and Sarcophagidae) - a generally
(4):783 - 785. VINCENT, S. VIAN, J .M. CARLOTI M,P. Partial secuencing of the Cytochrome oxydase b subunit
gene I: a tool for the identification of european species of blow flies for postmortem interval estimation .
iol6gicas sobre la muerte. Editorial Bedout. Medellin, Colombia. J Forensic Sci; 45 (4) : 820 - 823.

VON ZUBEN, C.J.; BASSANEZI, R.C.; DOS REIS, S.E; GODOY, W.A.C; VON ZUBEN EJ.; 1996.
~A R.; MARiN M.A; CADAVID G.A. 2000 Artr6podofauna Theoretical approaches to forensic entomology: I. Mathematical model of postfeeding larval dispersal.
de descomposici6n del intervalo post mortem en el cerdo Sus J Appl. Entomol. 120: 379 - 382
'rentes. Tesis de grado. Departamento de Biologfa. Universidad

ENTOMOLOGiA FORENSE 101


WOLFF M, URIBE A. ORTIZ A, DUQUE P. 2001. A preliminary study of forensic entomology in
Medellin, Colombia. Forensic Science International. 120:53-59

WOLLF, M; BUILES, A; ZAPATA, G; BENECKE, M. 2004 Detection of parathion (0, O-diethyl 0­


(4- nitrophenyl) phosphorothioate) by HPLC in insects of forensic importance in Medellin , Colombia.
Aggrawal 's internet journal of forensic medicine and toxicology. 5 (1) 6 - 11

WAYNE DL, GOFF ML: 1994. The black soldier fly Hermetia illucens (Diptera: Stratiomyidae) as a
Potential measure of human post mortem inteNal. ObseNation and case histories. J forensic Sci.
39, 235.

WAYNE DL. Case histories of the use of insects in investigation . Federal Bureau of Investigation.

Washington D.C .

http://www.missouri.edulcafnr/Entomology/ casestudies.htm/

WELLS D.J.; GREEN BERG B. 1994. Effect on the red imported ant (Hymenoptera: Formicidae)
and post feeding carrion fly laNae (Diptera: Calliphoridae, Sarcophagidae) J. Med. Entomology. (1)
:171-174

WELLS, J.D; LAMOTTE, J.R., 1995. Estimating maggot age from weight using inverse prediction.
J. Forensic Sci. 40: 585 - 590.

WELLS, J.D, SPERINLLlNG, F. 1999. Molecular phylogeny of chrysomya albiceps and C.


Rufifacies (Diptera: Calliphoridae). J. Med. Entomol36 (3); 222 - 226

WELLS, J.D, SPERLING, F. 2001. DNA - based identification or forensically important Sistematica Molt
Chrysomyinae (Diptera, Calliphoridae). Forensic Science International 120: 110 -115.

WELLS, J.D, LUANT, N. AND VILLET, M.H. 2003. Evolution of forensically important fliesN
mitochondrial DNA supports the recent derivation mann from c. Chloropyja (Wiedemann). Medical
and veterinary entomology. (17)4 : XV - XX .Inpress as of oct 2- 2003

Grupo de Investigaci6n : Sistematica Molecular

El grupo de investigaci6n esta adscrito a la Escuela


cias. Participan profesores de la Universidad Nacic
que trabajan conjuntamente con otras universidades I
y la Universidad Javeriana . Las Ifneas de investi:
molecular y Genetica de poblaciones.

Reconocido recientemente por Colciencias y con un !


tes de diferentes carreras, el grupo de investigaci6n F
ci6n de j6venes investigadores capaces de participaJ
en Sistematica Molecular con aplicaciones en an
Entomologia Agricola y Conservaci6n molecular.

E NTOMOLOGIA F RENSE
102
~U E P. 2001 . A preliminary study of forensic entomology in
International. 120:53-59

3ENECKE, M. 2004 Detection of parathion (0, O-diethyl 0­


~PLC in insects of forensic importance in Medellin, Colombia.
c medicine and toxicology. 5 (1) 6 - 11

.ck soldier fly Hermetia illucens (Diptera: Stratiomyidae) as a


tem interval. Observation and case histories. J forensic Sci.

! of insects in investigation. Federal Bureau of Investigation.

lology/ casestudies.htm/

. Effect on the red imported ant (Hymenoptera: Formicidae)


Itera: Calliphoridae, Sarcophagidae) J . Med. Entomology. (1)

Estimating maggot age from weight using inverse prediction .

99. Molecular phylogeny of chrysomya albiceps and C.


Med. Entomol 36 (3); 222 - 226

I. DNA - based identification or forensically important


Sistematica Molecular
~) . Forensic Science International 120: 110 -115.

LET, M.H. 2003. Evolution of forensically important fliesN


lt derivation mann from c. Chloropyja (Wiedemann) . Medical
'- XX .Inpress as of oct 2- 2003

Crupo de lnvestigaci6n : Sistematica Molecular:

El grupo de investigaci6n esta adscrito a la Escuela de Biociencias, Facultad de Cien­


cias . Participan profesores de la Universidad Nacional de Colombia, sede Medellin,
que trabajan conjuntamente con otras lmiversidades como la Universidad de Antioquia
y la Universidad Javeriana . Las lineas de investigaci6n son Ecologia, Taxonomia
molecular y Genetica de poblaciones.

Reconocido recientemente por Colciencias y con un grupo semilla que reu.ne estudian­
tes de diferentes carreras, el grupo de investigaci6n proyecta su trabajo hacia la forma­
ci6n de j6venes investigadores capaces de participar y liderar procesos investigativos
en Sistematica Molecular con aplicaciones en areas como Entomologia Forense,
Entomologia Agricola y Conservaci6n molecular.
Impreso en los TaUeres de
(7/ . . . .IFU........ )

~
Medellin 2004