Está en la página 1de 6

SOLUCIÓN SIMULACRO PRE PARCIAL BIOLOGÍA 2019 - SECRETARÍA ACADÉMICA - CECiMe

(Conducción UniTE + Viento de Abajo)


1) Una célula renal extraída de un proceso neoplásico benigno presenta una osmolaridad de 300 mOsm. Su membrana es totalmente
impermeable al CO3-2 y a cualquier polisacárido y presenta un coeficiente de reflexión de 0,5 para el H+ y de 0,2 para la glucosa.
Teniendo una solución A de 10-1 M de H2Co3 y una solución B de 0,002 M de glucógeno.
Tache lo que no corresponda.
a) El interior celular será HIPOOSMÓTICO / ISOOSMÓTICO / HIPEROSMÓTICO, respecto a la solución A.
Si la concentración de la solución A es de 10-1 M (es decir, 0,1 M), tenemos que realizar un pasaje de unidades a mM para
trabajar con la misma escala en la que figura la osmolaridad celular (mOsm).
1 M -------- 1000 mM
0,1 M ------ 100 mM
Sabiendo que la cantidad de partículas en las que se disocia el H2CO3 (i) es de 3 (H+, H+, CO3-2), calculamos la osmolaridad:
OSMH2Co3 = concentración x i
OSMH2Co3 = 100 mM x 3
OSMH2Co3 = 300 mOsm
b) El interior celular será HIPOOSMÓTICO / ISOOSMÓTICO / HIPEROSMÓTICO, respecto a la solución B.
También para el caso de la solución B, tenemos que realizar en primer lugar el pasaje de unidades.
1 M ------------ 1000 mM
0,002 M ------ 2 mM
El glucógeno, por más de que sea un polisacárido formado por varios monómeros (glucosa), al colocarlo en solución NO se
disocia en sus monómeros constituyentes (i=1), para realizarlo es necesario utilizar enzimas u otros agentes hidrolizantes.
OSMglucógeno = 2 mM x 1
OSMglucógeno = 2 mOsm
La solución B será HIPOOSMÓTICA respecto al interior celular; mientras que el interior celular será HIPEROSMÓTICO
respecto a la solución B.
c) La solución A será HIPOTÓNICA / ISOTÓNICA / HIPERTÓNICA respecto al interior celular por lo que HABRÁ / NO HABRÁ
flujo neto de solvente.
Para calcular la tonicidad (osmolaridad efectiva) tenemos que considerar tanto la osmolaridad como la permeabilidad de la
membrana. La permeabilidad es diferente para cada una de las partículas que integran el H2CO3 por lo que debemos utilizar
las osmolaridades correspondientes a cada partícula.
Dos de las tres partículas en las que se disocia el H2CO3 son H+ (⅔), mientras que una de las tres partículas es CO3-2 (⅓).
OSMH+ = ⅔ OSMH2Co3 OSMCO3 = ⅓ OSMH2Co3
OSMH+ = ⅔ 300 mOsm OSMCO3 = ⅓ 300 mOsm
OSMH+ = 200 mOsm OSMCO3 = 100 mOsm
Luego debemos multiplicar las osmolaridades de cada partícula por sus respectivos coeficientes de reflexión para calcular la
tonicidad (osmolaridad efectiva).
OSMefectiva = (OSMH+ x coeficiente de reflexión del H+) + (OSMCO3 x coeficiente de reflexión CO3-2)
OSMefectiva = (200 mOsm x 0,5) + (100 mOsm x 1)
OSMefectiva = 100 mOsm + 100 mOsm
OSMefectiva = 200 mOsm
La solución será entonces hipotónica respecto al interior celular, habiendo flujo neto de solvente (de la solución A al interior
celular)
d) La solución B es sometida a un hidrolizado total por medio de dos enzimas que catalizan la ruptura de los enlaces α (1 → 2) y
α (1 → 4) / α (1 → 6) y α (1 → 4) / α (1 → 6) y β (1 → 4), obteniéndose una solución isoosmótica respecto al interior celular; la
molécula de glucógeno estaba formada por 150 / 300 / 450 moléculas de glucosa. Dicha solución será HIPOTÓNICA /
ISOTÓNICA / HIPERTÓNICA respecto al interior celular.
El glucógeno, para ser hidrolizado de manera total, las enzimas deben catalizar la hidrólisis de los enlaces que conforman el
polisacárido. El glucógeno presenta un esqueleto central formado por glucosas unidas por enlaces α (1 → 4) con
ramificaciones que se desprenden de este esqueleto por enlaces α (1 → 6). Estos son los enlaces que serán hidrolizados de
manera catalítica por las enzimas.
Al hidrolizar el glucógeno, se obtiene una solución isoosmótica respecto al interior celular, por lo que la osmolaridad de la
solución de glucógeno pasará de ser de 2 mOsm a ser de 300 mOsm. La concentración del glucógeno no se ve afectada, la
única variable que se modifica es el número de partículas en las que se disocia el glucógeno (i) que altera consecuentemente
la osmolaridad:
OSMglucógeno = concentración x i
300 mOsm = 2 mM x i
300 mOsm / 2 mM = i
150 = i
Al despejar el índice de Van’t Hoff (número de partículas) podemos determinar el número de glucosas que formaban parte de
la molécula de glucógeno.
Para calcular la tonicidad (osmolaridad efectiva) debemos multiplicar la osmolaridad por el coeficiente de reflexión de la
glucosa (0,2):
OSMefectiva = 300 mOsm x 0,2
OSMefectiva = 60 mOsm
La solución será entonces hipotónica respecto al interior celular.

2) Una molécula de sulfato cúprico de color azul al reducirse se convierte en óxido cuproso de color rojo (reactivo de Fehling). Marque
con una cruz aquellas moléculas que podrán reducir el sulfato cúprico.
- GLUCOSA …X… - LACTOSA …X…
- GALACTOSA … … X
- AMILOSA ……
- FRUCTOSA … ... X
- GLUCÓGENO ……
- SACAROSA …… - MALTOSA …X..
Lo que nos dice el enunciado (más allá de lo rebuscado) es que tenemos que señalar las moléculas con poder reductor. El poder
reductor lo tendrán aquellas moléculas que tengan el oxidrilo (-OH) del carbono anomérico libre.

3) Teniendo los siguientes ácidos grasos I. Ácido esteárico (18:0) II. Ácido linolénico (18:3 n-3) III. Ácido araquidónico (20:4 n-6)
Marque con una cruz según corresponda.

ÁCIDO GRASO I II III

Ácido graso esencial X

Ácido graso semiesencial X

Ácido graso con mayor punto de fusión X

Ácido graso con menor punto de fusión X

Ácido graso sólido a temperatura ambiente X


4) La insulina es una proteína que se encuentra disuelta en el plasma sanguíneo y cumple la función de regular las concentraciones
de glucosa en sangre. Es sintetizada en las células β pancreáticas de los Islotes de Langerhans como un precursor “preproinsulina” de
110 aminoácidos que luego sufrirá modificaciones.
a) Mencione que tipo de proteína es de acuerdo a la estructura tridimensional que adopta: GLOBULAR
b) Responda verdadero (V) o falso (F):
- Los puentes de hidrógeno son las fuerzas que se encuentran estabilizando la estructura primaria de esta proteína F
(es el enlace peptídico el que estabiliza la estructura primaria de la proteína determinada por la secuencia de
aminoácidos)
- La estructura secundaria se encuentra estabilizada por los puentes de hidrógeno que se forman entre los grupos R
de los aminoácidos F (los puentes de hidrógeno estabilizan la estructura secundaria de las proteínas pero estos se
dan entre los grupos amino y carboxilo del esqueleto del aminoácido NO entre los grupos R)
- La estructura terciaria se encuentra estabilizada solamente por interacciones débiles F (la estructura terciaria - y
también la cuaternaria - se encuentra estabilizada por puentes de hidrógeno, fuerzas de Van der Waals,
interacciones hidrofóbicas, interacciones electrostáticas que son fuerzas débiles y por LOS PUENTES DISULFURO
QUE SON ENLACES COVALENTES FUERTES.
c) ¿Cuántos nucleótidos trifosfatados y cuántos enlaces de alta energía son necesarios para sintetizar esta proteína
precursora? ¿Cuántos codones y cuántos nucleótidos presentará el ARNm?
- NTPs: 330
NUCLEÓTIDO ENLACES DE NTPs PARA ENLACES DE
S ALTA LA SÍNTESIS ALTA
TRIFOSFATA ENERGÍA DE LA ENERGÍA
DOS (NTPs) PREPROINSU PARA
LINA PREPROINSU
LINA

ACTIVACIÓN (por aminoácido) 1 ATP 2 110 220

INICIACIÓN (por cadena 1 GTP 1 1 1


polipeptídica)

ELONGACIÓN (por enlace peptídico) 2 GTPs 2 109 x 2 = 109 x 2 =


218 218

TERMINACIÓN (por cadena 1 GTP 1 1 1


polipeptídica)

TOTAL 5 NTPs 6 330 440


- Enlaces de alta energía: 440
- Codones: 110. Cada codón se corresponderá con un aminoácido; por ende la relación entre codón aminoácido es
de 1:1, teniendo la misma cantidad de codones que de aminoácidos
- Nucleótidos: 330. Cada codón está formado por 3 nucleótidos; por ende, para calcular la cantidad de nucleótidos
que integran el ARNm debemos multiplicar por 3 el número de codones.

d) El ARNm que le da origen presenta un porcentaje de A de 10%, 30% de U y 50% de C *


- ¿Cuál es el porcentaje de G del ARNm? 10%. El porcentaje de las bases de G debe sumar, junto con el resto de las
bases nitrogenadas, un 100%.
100% = 10% (A) + 30% (U) + 50% (C) + X% (G)
100% - 10% (A) - 30% (U) - 50% (C) = X% (G)
10% = X% (G)
- ¿Cuál es la longitud (en N° de nucleótidos) del ARNm? 330. No lo pueden calcular con los datos que se dan en el
enunciado d), pero es una pregunta que ya hicimos en el inciso anterior (cantidad de nucleótidos).

- ¿Cuál es el porcentaje de bases nitrogenadas en el gen correspondiente? (suponiendo que el ARNm no sufre
modificaciones post-transcripcionales)

ARNm CADENA MOLDE CADENA TOTAL DE BASES TOTAL DE BASES


DEL ADN CODIFICANTE DEL DEL ADN EN UN DEL ADN EN UN
ADN 200 % 100%
(dividir por dos los
valores de la
comuna anterior)

10% A 10% T 10% A 40% A 20% A

30% U 30% A 30% T 40% T 20% T

50% C 50% G 50% C 60% C 30% C

10% G 10% C 10% G 60% G 30% G

%A %T %G %C

20% 20% 30% 30%


* (valores totalmente arbitrarios que no se corresponden con los reales)

5) La siguiente vía metabólica C+ → F → K- presenta los siguientes valores:


- G°C+ = 5 kcal/mol - EaC→F = 5,7 kcal/mol
- G°F = 8 kcal/mol - EaF→K = 4,5 kcal/mol
- G°K- = 12 kcal/mol
a) Realice un gráfico donde se evidencie la variación de energía libre en función del progreso de la reacción de ambas reacciones.
Calcular y ubicar en el esquema el ΔG°C → F , el ΔG°F → K , y el Estado Activado de ambas reacciones. Ubicar, a su vez, la energía de
activación de ambas reacciones.
- ΔG°C → F
El ΔG° de cualquier reacción se calcula restándole a la energía libre de los productos, la energía de los
reactivos:
ΔG°C → F = G°F - G°C+
ΔG°C → F = 8 kcal/mol - 5 kcal/mol
ΔG°C → F = 3 kcal/mol
- ΔG°F → K
ΔG°F → K = G°K- - G°F
ΔG°F → K = 12 kcal/mol - 8 kcal/mol
ΔG°F → K = 4 kcal/mol
- Estado Activado C → F =
El Estado Activado es la energía que tienen que alcanzar las moléculas reactivas para que pueda
producirse la reacción; en cambio, la energía de activación es la energía que le tenemos que agregar a la
energía (que ya tienen) los reactivos para que alcancen el estado activado.
ESTADO ACTIVADO = G°C+ + Ea
ESTADO ACTIVADO = 5 kcal/mol + 5,7 kcal/mol
ESTADO ACTIVADO = 10,7 kcal/mol
- Estado Activado F → K =
ESTADO ACTIVADO = G°F + Ea
ESTADO ACTIVADO = 8 kcal/mol + 4,5 kcal/mol
ESTADO ACTIVADO = 12,5 kcal/mol
- ¿Alguna de las reacciones será espontánea en condiciones estándar? (SI / NO)
Las reacciones se consideran espontáneas cuando ΔG (ojo, NO su ΔG°) es menor a 0, es decir tiene un signo negativo.
No tenemos datos para valorar la espontaneidad de la reacción en condiciones reales porque no conocemos el ΔG. Sin embargo,
podemos decir que NINGUNA DE LAS DOS REACCIONES SERÁ ESPONTÁNEA EN CONDICIONES ESTÁNDAR porque el ΔG° de
ambas reacciones es mayor a 0 (es decir, es positivo).
- Para que se produzca la primer reacción en condiciones celulares podríamos acoplarla a otra reacción EXERGÓNICA /
ENDERGÓNICA cuyo ΔG° sea por lo menos menor a - 3 kcal/mol.
Para que se pueda producir una reacción en condiciones reales (celulares) que no es espontánea en condiciones estándar debemos
acoplar la reacción a otra que libere energía que pueda ser utilizada. El ΔG° resultante de acoplar las reacciones debe ser menor a 0
(es decir, negativo) para que la reacción pueda producirse; el ΔG°resultante será igual a la suma de los ΔG° específicos de cada
reacción teniendo que ser dicha suma negativa.
ΔG°resultante < 0
ΔG°resultante = ΔG°C → F + ΔG°de reacción acoplada
Juntamos ambas ecuaciones:
ΔG°C → F + ΔG°de reacción acoplada < 0
3 kcal/mol + ΔG°de reacción acoplada < 0
ΔG°de reacción acoplada < -3 kcal/mol
a) La enzima “B” cataliza la reacción C+ → F permitiendo que la reacción ocurra de manera más veloz al disminuir la Energía de
activación.
La velocidad de reacción es inversamente proporcional a la Energía de activación (Ea); las enzimas disminuyen esa energía de
activación permitiendo que ocurran de manera más rápida. RECORDAR QUE LAS ENZIMAS NO ALTERAN LA ESPONTANEIDAD
DE LA REACCIÓN (EL ΔG°) SOLO PERMITE QUE FUNCIONEN DE MANERA MÁS RÁPIDA.
Mencione dos aminoácidos que esperaría encontrar en el sitio activo de la enzima:
- GLUTAMATO
- ASPARTATO
El sitio activo debe ser complementario al sustrato (el reactivo C+) para que pueda “atraerlo” y catalizar la reacción. Si el reactivo tiene
carga positiva, el sitio activo tendrá que tener carga negativa para que puedan producirse interacciones electrostáticas que posibiliten
la unión.
A una concentración 100 mM de la enzima, la Vmax de la reacción es de 200 mM/seg a un pH de 7,3 y una T° de 36,8°C (condiciones
óptimas de funcionamiento). Teniendo 50 mM de enzima, para alcanzar una velocidad de 50 mM/seg (a pH y T° óptimas) necesitamos
0,2 mM de C+. La molécula final de la vía metabólica (K-) actúa como un inhibidor no competitivo de la enzima. Tache lo que no
corresponda:
- El km de la enzima es de 0,1mM / 0,2 mM / 0,4 mM
La Vmax de la reacción catalizada a una concentración de 100 mM de enzima es de 200 mM/seg (con condiciones óptimas
de pH y T°). Si pasamos a tener la mitad de la concentración de enzima (50 mM), reducimos también a la mitad la cantidad
de sitios activos y por ende la Vmax del funcionamiento de la enzima que pasa a ser de 100 mM/seg. El km de la reacción es
la concentración a la cual se obtiene la mitad de la Vmax; si para alcanzar la mitad de la velocidad máxima (50 mM/seg)
necesitamos una concentración de sustrato de 0,2 mM de C+. Por ende, esta última concentración es la correspondiente al
km.
- La Vmax de la enzima (a una concentración de 50 mM) es de 100 mM/seg / 50 mM/seg / 200 mM/seg
La fundamentación está en el inciso anterior.
- A un pH de 6 y una T° de 35°C la Vmax de la enzima (a una concentración de 50mM) podría ser de 70 mM/seg / 100 mM/seg
/ 150 mM/seg
El funcionamiento que tenemos en condiciones óptimas de pH y T° con una concentración de enzima de 50 mM es de 100
mM/seg (porque tenemos la mitad de la concentración de enzima y por ende la mitad de los sitios activos). Si salimos de las
condiciones óptimas, la velocidad máxima de funcionamiento de la enzima será menor.
- Sería esperable encontrar un aminoácido POLAR CON CARGA / NO POLAR en el sitio de unión del inhibidor en la enzima
como por ejemplo LISINA / ALANINA.
El producto de la vía metabólica (K-) actúa como un inhibidor no competitivo de la enzima. Este tipo de inhibición donde el
producto de la vía inhibe a una de las enzimas se conoce como feedback negativo. Como el inhibidor K- presenta una carga
negativa, el sitio de unión a la enzima debe tener carga positiva YA QUE DEBE TENER UNA COMPLEMENTARIEDAD DE
CARGAS CON EL INHIBIDOR. Los aminoácidos positivos (lisina, arginina y histidina) se encuentran dentro del grupo de
aminoácidos polares con carga y es probable encontrarlos en el sitio de unión a la enzima.
- La presencia del inhibidor alterará EL km / LA Vmax de la enzima.
El inhibidor no competitivo se une a la enzima generando un cambio conformacional que impide la unión del sustrato al sitio
activo. Esto es similar a lo que ocurre cuando retiramos enzima de la solución, el parámetro cinético que se verá afectado es
la Vmax.

6) Mencione cuatro enzimas que intervendrán en el proceso de replicación celular en una E.coli y explique brevemente la función que
cumplirán:

NOMBRE DE LA FUNCIÓN
ENZIMA

HELICASA CATALIZA LA RUPTURA DE LOS PUENTES DE HIDRÓGENO MEDIANTE LA HIDRÓLISIS DE


ATP PERMITIENDO LA SEPARACIÓN DE LAS DOS HEBRAS DEL ADN.

ADN PRIMASA SE TRATA DE UNA ARN POLIMERASA QUE CATALIZA LA SÍNTESIS DE LOS CEBADORES DE
ARN OTORGÁNDOLE A LA ADN POLIMERASA EL EXTREMO 3’ OH LIBRE APAREADO QUE
NECESITA PARA INICIAR LA SÍNTESIS.

ADN POLIMERASA ES LA ENZIMA QUE CATALIZA LA SÍNTESIS DE LAS CADENAS ADELANTADA Y REZAGADA
EN EL SENTIDO 5’ A 3’. EL SUSTRATO QUE NECESITA SON LOS NUCLEÓTIDOS
TRIFOSFATADOS. ADEMÁS DE ESTO NECESITA UNA CADENA MOLDE, EL EXTREMO 3’ OH
LIBRE APAREADO (LO BRINDA EL CEBADOR) Y SALES MAGNÉSICAS.

ADN TOPOISOMERASA ES UNA ENZIMA QUE EVITA EL SUPERENROLLAMIENTO DEL ADN.

7) Teniendo la siguiente secuencia de nucleótidos de un ARNm y guiándose con el código genético que se encuentra en el Trabajo
Práctico N° 6, escriba la secuencia de aminoácidos del péptido:
5′ CCCUGAUGCGUCAUGAUUGGUAUGCAGCAUUUAAAUUUAAAUAAGCAUCA 3’
NH2 -met - arg- his- asp - try - tyr - ala- ala -phe- lys - phe- lys- COOH
Recuerden que deben encontrar el primer codón de inicio “AUG” y establecer el marco de lectura hasta hallar el codón de stop (UAA,
UGA, UAG). Para traducir la secuencia de aminoácidos necesitamos el código genético (se encuentra en el trabajo práctico de
mecanismos genéticos básicos II); si no contamos con esta información no podemos establecer la secuencia de aminoácidos.

8) Indique los transportadores presentes en la membrana plasmática de una célula muscular cardíaca y explique cuál es el tipo de
transporte y de donde se obtiene energía para el transporte del Ca+2 en cada uno de los transportadores:

Nombre del transportador Tipo de transporte Fuente de energía

Ca+2 ATPasa ACTIVO PRIMARIO HIDRÓLISIS DE ATP

Intercambiador Na+/Ca+2 Ca+2: ACTIVO SECUNDARIO Ca+2: DISIPACIÓN DEL GRADIENTE DE


Na+: DIFUSIÓN FACILITADA Na+
Na+: DISIPACIÓN DE SU PROPIO
GRADIENTE (Na+)

Canal de Ca+2 DIFUSIÓN FACILITADA DISIPACIÓN DE SU PROPIO


GRADIENTE
¿Qué ocurrirá con los siguientes parámetros (↑, =, ↓) en presencia de monóxido de carbono (CO) y de 2,4 DNP?

CO 2,4 DNP

Gradiente de Ca+2 ↓ ↓

Función de la Ca+2 ATPasa ↓ ↓

Ciclo de Krebs ↓ ↑

Producción de CO2 ↓ ↑

El monóxido de carbono es un inhibidor de la cadena de transporte (del complejo citocromo oxidasa) impidiendo el transporte de los
electrones y por ende el bombeo de protones en contra de su gradiente de concentración por parte de los complejos I, II y III. Sin este
gradiente, la ATP sintasa no podrá sintetizar ATP a través de la disipación del gradiente de protones (porque este gradiente
disminuye). El bloqueo del transporte de electrones evitará la oxidación del NADH Y FADH2 .Si estos complejos no se oxidan, se
interrumpe la descarboxilación oxidativa y el ciclo de krebs y por ende la producción de CO2.
Sin este ATP, no es posible mantener el gradiente de calcio por la ATPasa de Ca+2

El 2,4 DNP es un desacoplante que disipa el gradiente de protones disminuyendo la producción de ATP a través de la ATP sintasa.
Sin embargo, todo el aparato de producción censa que cae la concentración de ATP y eso conlleva una tasa de oxidación mayor de
las moléculas, aumentando el transporte de electrones y por ende, el ciclo de Krebs y la producción de CO2
La disminución de la concentración de ATP generará una disminución del gradiente de Ca+2 por una menor función de la ATPasa de
Ca+2