Está en la página 1de 80

RESUMEN EJ ECUTIVO 

En  el  Ecuador,  las  leguminosas  (importantes  fuentes  de  proteína)  son  generalmente  cultivadas  en 
suelos  pobres  especialmente  en  nitrógeno,  lo  cual  constituye  un  factor  crítico  de  sus  bajos 
rendimientos. Para incrementar estos, una alternativa es el aprovechamiento de la fijación biológica 
de  nitrógeno  al  asociarse  simbióticamente  con  microorganismos  del  suelo,  concretamente  con  la 
bacteria del genero Rhizobium. 
Este proyecto se inició solicitando a centros internacionales de investigación microbiológica, cepas 
de  la  bacteria.  Paralelamente  se  procedió  al  aislamiento  de  cepas  nativas  provenientes  de  suelos 
ecuatorianos,  para  formar  un  banco  germoplásmico  del  microsimbionte  de  los  cultivos  de  fréjol, 
arveja, alfalfa, soya y maní. A continuación se realizó la caracterización fenotípica y genética de la 
bacteria  asociada  a  los  cultivos  de  fréjol  y  maní,  por  cuanto  son  leguminosas  cuyos  centros  de 
origen  se  encuentran  en  la  región  de  Latinoamérica,  siendo  que  en  el  caso  del  fréjol,  uno  de  sus 
centros de origen es precisamente el Ecuador. Esto permite suponer que la diversidad genética de la 
bacteria  en  el  Ecuador  es  amplia,  lo  que  podría  originar  una  especificidad  simbiótica  entre  el 
microorganismo  y  la  planta.  La  caracterización  de  las  cepas  de  fréjol  fue  complementada  con  un 
estudio de compatibilidad genética entre Rhizobium y el cultivo. 
Posteriormente,  el  proyecto  llevó  a  cabo  el  estudio  de  la  estimación  del  potencial  de  fijación  de 
nitrógeno  de  las  cepas  de  cada  una  de  las  leguminosas,  bajo  condiciones  de  invernadero  y  de 
campo.  En  fréjol,  se  estudió  también  la  competitividad  de  las  mejores  cepas  por  nodulación,  para 
conocer la cepa más competitiva y poder usarla como inoculante. 
En  una  segunda  fase,  se  recolectaron  turbas  y  otros  materiales  (soportes):  turba  de  Chimborazo, 
turba de Lloa, turba de Alaska, capa rosa, ceniza, zeolita, y un sustrato a base de vaina seca molida 
de fréjol mezclado con compost, para ser evaluados como potenciales portadores de Rhizobium en 
la  elaboración  de  inoculantes.  Los  soportes  fueron  sometidos  a  un  análisis  físico,  químico  y 
biológico, y evaluados en su capacidad de mantener viable a la bacteria por lo menos durante cuatro 
meses. 
La investigación de campo fue de carácter participativa conjuntamente con los agricultores quienes 
desempeñaron  un  rol  importante  en  la  difusión  de  los  resultados,  con  un  efecto  multiplicador.  La 
difusión sobre la tecnología de los  inoculantes  y el uso del producto generado por el proyecto fue 
reforzada a  través  de  medios  como  trípticos,  días  de  campo,  talleres,  y  programas  de  radio.  Estos 
últimos,  en  colaboración  directa  con  miembros  de  la  Fundación  GAIA,  quienes  forman  parte  del


proyecto  Comminandes,  el  mismo  que  tiene  por  objetivo  generar  tecnologías  ambientalmente 
amigables  como  el  compost  enriquecido  con  inoculantes  microbianos,  a  fin  de  mejorar  los 
rendimientos de cultivos y la fertilidad de los suelos de la región Interandina. 
Paralelamente  al  proceso  de  investigación,  el  proyecto  ha  ido  implementando  un  laboratorio  de 
Microbiología de Suelos  en el Departamento de Protección Vegetal de la Estación Santa Catalina, 
del  INIAP,  con  equipos,  reactivo  y  material  necesarios  para  el  manejo  de  la  bacteria  y  la 
elaboración de inoculantes. 
Como  resultados,  el  estudio  de  caracterización  de  cepas  de  fréjol  y  de  maní,  demuestra  la  alta 
heterogeneidad de la bacteria en suelos Ecuatorianos. El estudio de la compatibilidad genética entre 
la bacteria y el cultivo de fréjol, encontró que la diversidad genética de la bacteria es mayor cuando 
se asocia a cultivares “locales”. Esto implica que existe cierta especificidad entre los simbiontes  y 
por  lo  tanto  se  recomienda  elaborar  inoculantes  con  cepas  aisladas  de  suelos  pertenecientes  a 
regiones  donde  la  variedad  de  leguminosa  es  predominante.  Este  mismo  comportamiento  de 
especificidad simbiótica  podría existir en la asociación maní­Bradyrhizobium, pero en este caso, se 
requiere de estudios complementarios para un mejor entendimiento de este fenómeno. 
El proyecto seleccionó cepas eficientes en fijación biológica de nitrógeno. En fréjol las cepas UMR 
1478  y  UMR  1481,  en  maní:  ECUM­P8­6,  ECUM­L102,    en  arveja  ECUA  –I1,  ECUA­Z2,  en 
alfalfa UMR 6008, TAL 380, y en soya: CIAT 151, UMR 6001, ECUS­001, ECUS1­SJ. Este banco 
germoplásmico  de  la  bacteria  se  encuentra  almacenado  en  el  laboratorio  y  bajo  condiciones  de 
liofilización. 
En cuanto a la competitividad de cepas asociadas al fréjol, el estudio logró conseguir antisueros de 
calidad y en suficiente cantidad para las cepas estudiadas, permitiendo tener un stock suficiente de 
antisueros para futuros estudios serológicos de Rhizobium. 
El INIAP dispone de un stock de turba de Chimborazo, que después de un análisis físico, químico y 
biológico,  se  la  identificó  como  un  buen  portador  de  Rhizobium,  al  compararla  con  otros  siete 
materiales catalogados como potenciales portadores. 
La  difusión  de  los  resultados  del  proyecto  ha  permitido  que  el  número  de  agricultores  que  usan 
inoculantes, incremente, comprobado mediante diagnósticos realizados  en las Provincias del Cañar 
(comunidad  Virgen de  la Nube) y  de Pichincha (Chaupiloma­Tabacundo). La difusión también se 
ha realizado a través de eventos nacionales e internacionales. 
Sobre la base de los  resultados  de la investigación se recomienda: 1)  complementar el estudio de 
caracterización de cepas de maní, 2) una evaluación de campo de cepas representativas de cada uno 
de los grupos obtenidos  en el análisis genético de RFLP de las cepas de maní, 3) la evaluación en 
experimentos  demostrativos,  y  en  varios  sitios  de  una  misma  región,    de  varias  cepas  para


compararlas  con las  cepas  “nativas”, 4) realizar un  estudio sobre la respuesta de la inoculación al 
fósforo, sus niveles, y formas de aplicación. El fósforo es un elemento esencial en el proceso de la 
fijación  del  nitrógeno,  y  en  los  suelos  andinos  (Andisoles),  éste  elemento  es  adsorbido  por  las 
partículas del suelo, dificultando la absorción por el cultivo, 5)  mayor difusión de la tecnología en 
otras regiones  donde el proyecto no tuvo mayor presencia, especialmente en la Costa Ecuatoriana, 
donde la implementación de un laboratorio para la elaboración de inoculantes es recomendable, ya 
que  los  agricultores  de  la región  necesitan  proveerse  fácil  y  constantemente  de  los  inoculantes, al 
momento preciso de la siembra. 
La  interacción  directa  con  centros  internacionales  de  investigación  agrícola,  permitió  la 
capacitación  de  personal  del  proyecto,  especialmente  en  técnicas  moleculares,  como  la 
caracterización genética de “Bradyrhizobium”  asociada al cultivo de maní. La capacitación incluyó 
cursos  teórico  práctico  relacionados  con  Microbiología  de  Suelos,  y  visitas  de  investigadores 
internacionales,  permitiendo  una  estrecha  interacción  principalmente  en  el  intercambio  de 
información  científica.  Los  resultados  del  proyecto  además  han  sido  fundamentales  como 
antecedentes de propuestas de proyectos aprobadas por entidades como FUNDACYT. 
Este  proyecto  sin  duda,  contribuirá  con  una    agricultura  de  bajos  insumos,  caracterizada    por  la 
reducción  de  la  dependencia  de  los  fertilizantes  químicos,  los  cuales  son  costosos  y  representan 
fuentes de contaminación de los recursos suelo y agua. 

2. IDENTIFICACIÓN DEL PROYECTO 

Código:  PROMSA IQ­CV­081 

Titulo:  “Selección de cepas de Rhizobium adaptadas a condiciones de campo, y su uso como 


inoculantes de leguminosas de la Sierra y Costa Ecuatoriana”. 

Dur ación:  Agosto del 2001 al 31 de Diciembre del 2003. 

Institución base: INIAP. Estación Santa Catalina. 

Instituciones colabor ador as nacionales: Universidad Central, IASA. 

Instituciones colabor ador as inter nacionales: Universidad de Minnesota, CIAT, Universidad de la 


Plata.


Investigador es:  Dr.  Gustavo  Bernal,  Ing.  Alfonso  Suárez,  Ing.  Diego  Campaña,  Ing.  Mauricio 
Jerez, Lic. Cristina Salvador, Dr. Peter Graham, Dr. Mario Aguilar. 

Tema del pr oyecto: Microbiología de Suelos. 

Rubr o pr incipal: Arveja, fréjol, alfalfa, soya, maní. 

Tipo de institución ejecutor a: Centro de Investigación Agropecuaria.


3. CUADRO DE CONTENIDO DEL INFORME 

Justificación del proyecto   ..................................................................................................................  6 
Objetivos de la investigación ..............................................................................................................  10 
Actividades desarrolladas ....................................................................................................................  11 
Resultados obtenidos ...........................................................................................................................  30 
Discusión de los resultados .................................................................................................................  50 
Situación inicial del grupo meta ..........................................................................................................  54 
Estimación de efectos e impactos ........................................................................................................  54 
Producto del proyecto ..........................................................................................................................  56 
Logros adicionales ...............................................................................................................................  58 
Limitaciones en el desarrollo del proyecto ..........................................................................................  59 
Conclusiones y recomendaciones ........................................................................................................  60 
Lecciones aprendidas ..........................................................................................................................  62 
Bibliografía ..........................................................................................................................................  63 
Anexos .................................................................................................................................................  68 
Fecha y firma del investigador principal .............................................................................................  81 

TABLA DE CONTENIDO  CUADROS, FIGURAS Y ANEXOS 

Cuadro 1. .........................................................................................................................................  27 
Cuadro 8.1 .......................................................................................................................................  31 
Figura 8.1 ........................................................................................................................................  32 
Figura 8.2 ........................................................................................................................................  33 
Figura 8.3 ........................................................................................................................................  34 
Figura 8.2 y Cuadro 8.2 ..................................................................................................................  35 
Cuadro 8.3 .......................................................................................................................................  36 
Cuadro 8.4 y Cuadro 8.5 .................................................................................................................  37 
Fig. 8.5 ............................................................................................................................................  39 
Fig. 8.6 ............................................................................................................................................  40 
Cuadro 8.6 .......................................................................................................................................  41, 42, 43 
Cuadro 8.7 .......................................................................................................................................  43, 44 
Cuadro 8.8 y Cuadro 8.9 .................................................................................................................  45 
Cuadro 8.10 .....................................................................................................................................  47 
Cuadro 8.11 y Figura 8.7 ................................................................................................................  48 
Figura 8.7 ........................................................................................................................................  49 
ANEXOS, Cuadro 1 .......................................................................................................................  67 
Cuadro 2, Cuadro 3 y Cuadro 4 ......................................................................................................  68 
Cuadro 5 y Cuadro 6 .......................................................................................................................  69 
Cuadro 7 y Cuadro 8 .......................................................................................................................  70 
Cuadro 9 y Cuadro 10......................................................................................................................  71


4. J USTIFICACIÓN DEL PROYECTO 

El  Ecuador  ha  experimentado  un  considerable    incremento  de  su  población  con  la  mayor 
concentración  en áreas urbanas, con  7'196.000 habitantes  versus  4'741.000 del área rural. Para el 
año 2020 se   estima  que la población urbana  aumentará a 12'269.000 mientras  que  la población 
rural será de  4'635.000 habitantes (FAO, 1999).  Esto  implica que la producción de alimentos en el 
Ecuador debe duplicarse para el año 2020, por lo que sin duda,  el mayor reto será el de  producir de 
manera  sustentable,    cantidades  de  alimentos  nutricionales  y  disponibles  para  la  mayoría  de  la 
población.  Se  estima  que  el  90%  de  las  familias    pobres  del  Ecuador  carece  de  una  adecuada 
alimentación (UNICEF, 1999), y que  el consumo de proteína en el país alcanza niveles de 50 ­ 85 
g  proteína/día,  mientras  que  el  de  calorías  varia  entre  1800  a  2500/día  con  valores  inferiores 
asociados con las regiones más  pobres. Bajo este contexto, las leguminosas como el fréjol, arveja, 
soya,  maní,  etc.,    juegan  un  papel  de  relevancia  en  la  seguridad  alimenticia,  como  fuentes  de 
proteínas y calorías para la población ecuatoriana, mientras que otras  leguminosas como la alfalfa 
son pastos importantes en la producción pecuaria (carne y leche) de vastas zonas del país. 

Las leguminosas en la región  interandina son sembradas especialmente por el pequeño y mediano 
agricultor  en  suelos  bajos  en  contenido  de  nutrientes  especialmente    nitrógeno  (INIAP,  1994)    y 
algunos  micro­nutrientes. La mayoría de los suelos de la Sierra son además susceptibles a  niveles 
de erosión  hídrica que en las partes altas  estos son de  magnitud considerable.  La alfalfa, aunque 
es  sembrada  en  terrenos  de  menor  inclinación  y  aptos  para  la  producción  pecuaria,  sin  embargo 
sufre  también  de  deficiencias  nutricionales  debido  a  las  características  de  los  suelos  donde  se  la 
cultiva,  lo cual afecta directamente su rendimiento y consecuentemente el rendimiento animal. 

Los suelos del litoral Ecuatoriano  presentan también problemas nutricionales como por ejemplo en 
regiones de las Provincias de Los Ríos y Manabí. Las constantes lluvias a las que son expuestos  en 
determinada época del año son la causa principal de la deficiencia de nitrógeno y otros elementos, 
los cuales son lavados o lixiviados, disminuyendo considerablemente la fertilidad de los suelos.  La 
disminuida  fertilidad    viene  a  constituir  un  factor  fundamental  de  los  bajos  rendimientos  de  las 
leguminosas  tanto  en  la  Sierra  como  en  la  Costa  Ecuatoriana,  afectando  la  economía  de  los 
agricultores. Para incrementar los rendimientos de las leguminosas, existen dos maneras de hacerlo: 

1) Aumentando el uso de fertilizantes químicos nitrogenados. Lamentablemente, estos son causa de 
la deterioración del suelo y del agua, contaminándolos  y  perjudicando la calidad y el uso de estos


recursos.  Por  otro  lado,  los  costos  elevados  en  el  Ecuador  de  los  fertilizantes  nitrogenados,    los 
requerimientos  altos de energía para su producción, o simplemente  la dificultad de transportarlos a 
las fincas de los pequeños agricultores, limitan el uso en la producción agrícola. 

2)  Aprovechando  la  fijación  biológica  de  nitrógeno  por  parte  de  las  leguminosas  al  asociarse 
simbióticamente  con  las  bacterias  del  género  Rhizobium  (rizobios).  Estos  organismos  del  suelo, 
responsables  del  80%  de  la  fijación  biológica  del  nitrógeno,  tienen  la  capacidad  de  convivir 
simbióticamente con la leguminosa en los nódulos radiculares, los cuales son órganos especiales de 
las raíces, en los que tiene lugar  el proceso biológico de la  fijación  del nitrógeno atmosférico.  Las 
leguminosas,  dependiendo  del  cultivo  y  la  variedad,  y  de  los  rizobios,  son  capaces  de  fijar  hasta 
300­400    kg  N/ha    (Brockwell  and  Bottomley,  1995).    Sin  embargo,  en  áreas  nuevas,    las 
leguminosas a ser sembradas requieren de la inoculación con Rhizobium específico y eficiente, que 
permita lograr incrementos significativos en sus rendimientos. 

Identificado el problema de la deficiencia nutricional (especialmente N) de algunos suelos agrícolas 
ecuatorianos,  el  INIAP  a  través  de  la  Unidad  de  Microbiología  del  Departamento  de  Protección 
Vegetal  de  la  Estación  Santa  Catalina,    inició  hace  aproximadamente  15  años,    investigación  en 
fijación  biológica  de  nitrógeno  (FBN)  en  colaboración  con  la  Facultad  de  Agronomía  de  la 
Universidad  Central.  Las  actividades  comprendieron  recolecciones  de  cepas  (razas)  a  nivel 
nacional,  y  evaluaciones  de  la  capacidad  fijadora  en  los  cultivos  de  arveja,  chocho,  haba  y  fréjol. 
Los  estudios  en  su  mayoría  fueron  llevados  a  cabo  bajo  condiciones  de  invernadero  y  en  algunos 
casos  se probaron  combinaciones  de cepas  y leguminosas. Adicionalmente, se recolectaron turbas 
dentro  del  Callejón  Interandino  (Estévez  y  Constante  1993),  seleccionándose  algunas  como 
acarreadores potenciales de los rizobios. 

Posteriormente,  la  Unidad  responsable  del  proyecto  llevó  a  cabo  investigación  colaborativa  con 
instituciones   nacionales e internacionales. Así por ejemplo con el NifTAL  de Hawai se  evaluó el 
medio selectivo BJSM (Bradyrhizobium japonicum selective medium)  para verificar la calidad de 
inoculantes  de  Bradyrhizobium  para  soya.  Los  resultados  mostraron  que  la  mayoría  de  los 
inoculantes evaluados y comercializados en el mercado ecuatoriano son de calidad extremadamente 
baja,  con    poblaciones  máximas    de  1  x  10 2  bacterias/g  de  inoculante    (Bernal  y  Estévez,  1994), 
cuando el nivel permitido en países con sistemas de control de calidad (ej. Canadá) es de 10 8  ­ 10 9 
bacterias/g  de  inoculante,  o  de  10 3 ,  10 4  y  10 5  rizobios/semilla  pequeña,  intermedia  y  grande, 
respectivamente  (www.rhizobium.umn.edu).    Además,  algunos    inoculantes  evaluados    mostraron


niveles  altos de contaminación (con hongos y otras bacterias) que  afectan la sobrevivencia de los 
rizobios  en  la  turba  (portador  de  la  bacteria)  y  por  lo  tanto  la  validez  del  inoculante  como  una 
alternativa  de  fertilización  nitrogenada.  Estos  datos,  indudablemente    han  sido  causa  para  que  los 
agricultores,  y algunos técnicos e investigadores agrícolas, hayan dado poco valor a la práctica de 
la inoculación. 

Con la experiencia e información acumulada en el INIAP, el grupo de microbiólogos de la  Unidad 
Responsable  del  Proyecto,  a través  del  proyecto  colaborativo  CRSP  (Universidad  de  Minnesota  – 
INIAP),  inició  en  1995  la  producción  a  nivel  experimental,  del  inoculante  Rhizoiniap,  para  fréjol 
arbustivo  cultivado  principalmente  por  pequeños  y  medianos  agricultores  de  Carchi  e  Imbabura, 
regiones donde el proyecto CRSP ha tenido sus mayores impactos. El inoculante ha sido elaborado 
casi en su totalidad utilizando turba importada. 

Los  miembros  de  las  UVTT  (Unidades  de  Validación  y Transferencia  de  Tecnología)  del  INIAP, 
han  sido  los  responsables  de  validar  el  inoculante  en  parcelas  demostrativas  y  conjuntamente  con 
agricultores  de  ambas  provincias.    Se  han  reportado  resultados  positivos  en  el  rendimiento  de 
algunas variedades  de fréjol, siendo una de las razones precisamente la respuesta  a la inoculación 
con Rhizoiniap. Entre las variedades se encuentra la  variedad  JeMa, la cual fue introducida por el 
proyecto CRSP y entregada al agricultor por el Programa Nacional de Leguminosas (PRONALEG). 

El incremento en rendimiento (70 kg/ha) debido a la inoculación en fréjol, reportado por pequeños 
agricultores  del Carchi, constituyo  un importante precedente para iniciar esta investigación con el 
fin  de  seleccionar  cepas  nativas  y  no  nativas,  genéticamente  estables  y  adaptadas  a  condiciones 
adversas  de  campo,  que  presenten  respuesta  a  la  inoculación.  En  este  proyecto,  se  considero  la 
evaluación  de  cultivares  de  cada  leguminosa,  aptos  en  fijación  bajo  condiciones  de  campo,  y  la 
búsqueda de materiales  apropiados como portador de la bacteria y la evaluación de la esterilización 
de los portadores. Posteriormente a la investigación, se ha institucionalizado un sistema de control 
de  calidad  para  la  producción  de  inoculantes.  Todos  estos  aspectos  señalados  son  vitales  como 
componentes  integrales  de  estrategias  en  el  cultivo  de  las  leguminosas,  que  optimicen  su  efectiva 
nodulación, fijación de nitrógeno, y mayor rendimiento. 

Existen  estudios  en  el  exterior  que  han  demostrado  muy  claramente  incrementos  significativos  en 
rendimiento como resultado de la inoculación con Rhizobium. Así por ejemplo, en varias regiones 
frejoleras del Brasil se ha reportado  incrementos de hasta 900 kg/ha  (Hungria y Vargas, 2000). En


soya  cultivada  en  el  Estado  de  Wisconsin  (Estados  Unidos)  se  ha  logrado  incrementos  de  hasta 
1060 kg/ha (Oplinger, 1998), en alfalfa sembrada en Texas 445 kg/ha (Evers, 1996), y en maní 170 
kg/ha  como  media  de  30  experimentos  ejecutados  por  siete  universidades  norteamericanas 
(www.histick.com). 

Esta propuesta de investigación en el Ecuador incluyó las siguientes leguminosas: maní y soya en la 
Costa,  fréjol,    arveja    y  alfalfa  en  la  Sierra.  La  demanda  de  esta  investigación  se  justificó 
principalmente  por  los  siguientes  aspectos:  a)  las  leguminosas:  fréjol,  maní,  soya  y  arveja  son  de 
gran importancia nutricional para consumo humano, en tanto que  la alfalfa es   para la producción 
pecuaria.  Estos  cultivos  tienen  su  relevancia  económica  para  agricultores  de  la    Sierra  y  Costa 
Ecuatoriana. En esta última región, la leguminosa hortícola (ej. fréjol) están desarrollándose de una 
manera considerable con fuerte  inclinación  hacia la agroindustria, y con  la apertura del área de la 
Península  un mayor impulso de estos cultivos es evidente (Suárez 1999, comunicación personal). 

b) Estas leguminosas constituyen rubros significativos tanto por la superficie cosechada,  así como 
su  distribución  geográfica.  Por  ejemplo,  el  fréjol  seco  cuya  superficie  cosechada  es  de  61.520 
ha/año (FAO, 1999) abarca casi todas las provincias de la Sierra,  y últimamente algunas provincias 
de la Costa. El cultivo de la soya  abarca 55.000 ha, especialmente en las Provincias de Los Ríos, 
Manabí y Guayas. 

c)  A  pesar  de  la  importancia  de  estas  leguminosas,  los  rendimientos  siguen  siendo  bajos.  Así  por 
ejemplo, se estima que para fréjol, a nivel nacional y de pequeños agricultores, el rendimiento es de 
673,3 kg/ha en grano seco y de 1500 kg/ha en vaina (FAO, 1999). Otro ejemplo es la a soya, la cual 
alcanza un rendimiento aproximado de 2 t/ha. 

d) El uso del fertilizante nitrogenado, representa para la mayoría de los agricultores, un insumo muy 
costoso en el mercado local, repercutiendo directamente en la baja productividad agrícola de estos 
cultivos. 

e)  En  el  país,  los  estudios  relacionados  con  el  tema  no  han  considerado  aspectos  integrales  que 
permitan  desarrollar  un  programa  continuo  de  selección  de  cepas  genéticamente  estables  y 
adaptadas a condiciones de campo. Tomando en cuenta un criterio “holístico”, se podría producir de 
manera  constante  y  racional  inoculantes  que  garanticen  el  incremento  de  los  rendimientos  de  las 
principales leguminosas. Además, el proyecto consideró rubros nuevos e importantes como el maní.


f) Esta investigación constituye un complemento a los trabajos llevados a cabo por el PRONALEG 
del INIAP, en  el  mejoramiento  de rubros  prioritarios  para consumo  humano  y animal. Se trata de 
incrementar  los  rendimientos  de  las  leguminosas  a  través  del  aprovechamiento  biológico  de 
nitrógeno, y como consecuencia también el de los cultivos  asociados o subsecuentes, especialmente 
en condiciones del pequeño y mediano agricultor. Con relación a la alfalfa, gran parte del nitrógeno 
fijado por la planta,  es retornado al ecosistema donde se convierte en disponible en la rotación con 
cereales. Sin duda, ésta  alternativa biológica de fertilización constituye un componente clave de la 
agricultura sostenible  y de los sistemas  de manejo de suelos, contribuyendo con la protección del 
medio ambiente  y con el equilibrio del ecosistema. 

Los beneficiarios del  proyecto son directamente los agricultores principalmente de la Sierra y Costa 
quienes  disponen  de  cepas  altamente  fijadoras  de  N.  Otros  beneficiarios  son  los  Centros  de 
Investigación  y  Universidades  del  Ecuador  y  algunos  institutos  internacionales,  así  como  también 
las empresas agrícolas comercializadoras de productos agropecuarios. 

5. OBJ ETIVOS DE LA INVESTIGACIÓN. 

Objetivos gener ales 

a) Contribuir con el incremento del rendimiento de importantes leguminosas de consumo humano y 
animal a través de la selección de cepas de Rhizobium eficientes en fijación de nitrógeno y estables 
bajo condiciones de campo. 

b)  Contribuir  con  la  conservación  de  los  recursos  naturales  (suelo,  agua)    a  través  del  uso  de 
leguminosas  como  componentes  esenciales  en  el  mejoramiento  de  la  fertilidad  de  los  suelos, 
propiciando la disminución de fertilizantes nitrogenados. 

Objetivos específicos (Investigación a desar r ollar se) 

1) Incrementar el banco germoplásmico de Rhizobium para leguminosas nativas y no nativas del 


Ecuador,  debidamente caracterizado (fenotípica y genéticamente). 

2)  Evaluar  bajo  condiciones  de  invernadero  y  campo,    el  potencial  simbiótico  (efectividad  e 
infectividad) de las cepas de  Rhizobium, en cada leguminosa.

10 
3) Evaluar y seleccionar turbas y otros materiales como soporte de Rhizobium. 

4) Evaluar la esterilización de los portadores. 

5) Difundir los resultados obtenidos. 

6) Institucionalizar un sistema de control de calidad de los inoculantes producidos por el INIAP. 

6. ACTIVIDADES DESARROLLADAS. 

Objetivo 1. 

1a. Solicitud, recolección y caracterización de cepas 

1b .Almacenamiento de las cepas. 

Objetivo 2. 

2 a.  Estudio de la compatibilidad genética entre Rhizobium y el cultivo de fréjol. 

2 b.  Estimación del potencial fijador de nitrógeno de las cepas de Rhizobium en invernadero. 

2 c.  Estimación del potencial fijador de nitrógeno bajo condiciones de campo. 

2 d.  Estudio de la competitividad de las cepas por nodulación, en el cultivo de fréjol. 

Objetivo 3. 

3 a.  Recolección de turbas 

3 b.   Análisis físico, químico y biológico. 
3 c. Interacción rizobio­turba (portador) 

3 d. Evaluación de materiales alternativos

11 
Objetivo 4. 

4 a. Evaluación de la esterilización de los portadores. 

Objetivo 5. 

5.1 Difundir los resultados y el uso de los productos generados por el proyecto. 

Objetivo 6. 

6.1 Institucionalizar un sistema de control de calidad de los inoculantes producidos. 

7. DESCRIPCIÓN DE LAS ACTIVIDADES. 

Actividad 1a. Solicitud, recolección y caracterización de cepas. 

A través  de solicitudes realizadas por el INIAP al Departamento de Microbiología de Suelos de la 
Universidad  de  Minnesota,  al  Centro  Internacional  de  Agricultura  Tropical  (CIAT),  a  la 
Universidad  de  la  Plata  (Argentina)  y  otros  centros  internacionales  de  investigación  en  fijación 
biológica  del  nitrógeno,  se  lograron  incrementar  el  material  genético  de  cepas  de  Rhizobium 
pertenecientes a leguminosas no nativas del Ecuador. Entre estas están las de soya, alfalfa, y arveja, 
cultivos  que  no  son  originarios  de  la  Zona  Andina. Para  el  caso  del  fréjol,  y  del  maní,  se  realizó 
recolecciones  de  suelos  y  de  la  leguminosa  en  varias  regiones  del  país,  para  luego  proceder  al 
aislamiento de las cepas asociadas con la leguminosa. 

Es necesario enfatizar que en el cultivo haba pallar (Costa), en un inicio incluido en el proyecto para 
la correspondiente selección de cepas de su microsimbionte Rhizobium,  no se llevó a cabo ningún 
estudio por razones de presupuesto. Esta decisión fue informada verbalmente en Reunión de Grupo 
de Referencia, al anterior Oficial de Proyectos del NRI (Dr. Francisco Muñoz), quien no objetó la 
misma. 

Para el aislamiento  y purificación  de  la bacteria desde los  nódulos  radiculares  de todas  las  demás 


leguminosas involucradas en el estudio,  se siguió la metodología de rutina utilizada por el INIAP. 
Para esto, se utilizó el medio de cultivo a base de levadura, manitol, agar (LMA) con el indicador

12 
rojo  congo  (10  ml/L).  Los  aislamientos  bacterianos  fueron  incubados  a  26ºC  durante  10  días,  y 
además fueron sembrados en medio conteniendo púrpura de bromocresol (10 ml/L) como indicador 
de contaminación. 

La  conservación  de  las  cepas  bacterianas  se  realizó  en  tubos  conteniendo  medio  de  cultivo  LMA 
inclinado, y tubos  liofilizados. En el primer caso  las cepas fueron sembradas  en el medio inclinado 
contenido  en  tubos de vidrio con tapa rosca, incubados  en estufa  durante  5­7 días  a 26  0 C, para 
luego ser almacenados  a 4 0 C. 

Para la liofilización, los aislamientos puros se hicieron crecer en cajas Petri con LMA. Para esto, se 
preparó una solución de peptona al 20%, y otra de sucrosa al 10%, para luego ser esterilizado por 
separado (15 minutos a 121 0 C). Las soluciones estériles fueron mezcladas para luego vestirse sobre 
la  caja  Petri  y  frotar  la  superficie  del  medio  con  la  ayuda  de  un  asa  de  platino,  hasta  formar  una 
suspensión  bacteriana  homogénea.  Se  tomaron  alícuotas  de  200 ml  de  la  suspensión  bacteriana  en 
tubos  eppendorf  (1.5  ml  de  capacidad)  previamente  esterilizados,  y sellados  cada uno con algodón 
estéril. 

Las bacterias  fueron  liofilizadas por 24  horas a ­54ºC utilizando  un  liofilizador (marca Labconco),  y 


luego  de  lo  cual  fueron  cerrados    y  almacenados    en  refrigeración  (4 o C).  Como  procedimiento 
complementario, se realizó recolección de suelos en regiones donde la leguminosa es predominante. 
Las cepas  fueron aisladas a través de la  prueba de infección (Somasegaran y Hoben, 1994)  usando 
la  leguminosa  correspondiente  (como  planta  huésped)  a  cada  región  de  donde  el  suelo  fue 
recolectado.    Se  inoculó  a  cada  hospedero,  diluciones  sucesivas  del  correspondiente  suelo  para 
posteriormente proceder al aislamiento de la bacteria a partir de los nódulos formados en las raíces 
de la planta. 

Car acter ización de las cepas. 

Car acter ización fenotípica 


La caracterización fenotípica se realizó únicamente con el germoplasma de Rhizobium asociado con 
los cultivos de fréjol y de maní, por cuanto son simbiontes de cultivos cuyos centros de origen están 
en  América  del  Sur,  lo  que  hace  suponer  la  existencia  de  una  gran  diversidad  de  la  bacteria  en 
suelos  Ecuatorianos,  por  lo  que  se  justifica  la  caracterización  de  la  bacteria  simbionte,  en  ambos 
cultivos. En cuanto al germoplasma de Rhizobium asociado con arveja, alfalfa, y soya, éste fue ya

13 
estudiado y documentado en trabajos previos realizados por la Facultad de Ciencias Agrícolas de la 
Universidad  Central  del  Ecuador,  en  colaboración  con  el  INIAP.  La  caracterización  de  las  cepas 
asociadas  al  cultivo  de  fréjol  se  realizó  en  el  Laboratorio  de  Microbiología  de  Suelos  de  la 
Universidad  de Minnesota, cuya descripción no se  menciona en  éste informe,  ya que la  misma se 
encuentra detallada en el artículo de Bernal y Graham (2001). En cuanto a la caracterización de las 
cepas asociadas al maní, ésta se realizó en el Laboratorio del Departamento de Protección Vegetal 
de  la  Estación  Experimental  Santa Catalina  –INIAP, siguiendo  la  metodología  de  Amarger  et  al., 
(1997).  Se  utilizaron  noventa  y  tres  aislamientos  recolectados  en  las  provincias  de  Manabí  y  Loja. 
Además,  se  utilizaron  cepas  bien  caracterizadas,  fenotípica  y  genéticamente,  como  estándares  o 
controles. 
Para la inoculación en los distintos  medio de cultivo se utilizaron suspensiones fisiológicas frescas 
de los aislamientos conteniendo 10 5 cel/ml; para lo cual, una colonia aislada fue transferida a medio 
levadura  manitol  (LM),  luego  incubada  por  26  0 C  (12  días)  hasta  lograr  una  concentración  de 
10 9 cel/ml.  Por  dilución  en  agua  estéril  se  llevó  a  una  concentración  final  de  10 5 cel/ml.    La 
concentración de  células  fue determinada utilizando  la metodología de Mac Farland  sugerida por 
Somasegaran y Hoben (1994). 
A partir de las suspensiones bacterianas (10 5  cel/ml), se tomaron 50 ml y depositados  dentro  de un 
alvéolo    de  un  plato  de  ELISA.  Con  la  ayuda  de  un  inoculador  multipunto  de  48  descargas,  los 
aislamientos fueron transferidos  sobre la superficie de cada uno de los distintos medios de cultivo. 

Tiempo de cr ecimiento 
Los aislamientos fueron sombrados en medio LMA. Se determinó dos rangos de crecimiento: 3 ­5 
días  para  rizobios  de  crecimiento  rápido,  y  de  7­12  días  para  rizobios  de  crecimiento  lento.  Los 
aislamiento se incubaron a 26 0 C, y las lecturas se hicieron a los 5 y 12 días, respectivamente. 

Mor fología de las colonias 
Las  colonias  formadas  en  los  medios  de  cultivo  fueron  clasificadas  en  tres  categorías:  acuosas 
translúcidas, acuosas blancas opacas, y cremosas opacas. 

Acidificación o alcalinización  del medio LMA 
Los  microsimbiontes  de  maní  fueron  sembrados  en  medio  LMA  conteniendo  azul  de  bromotimol 
(0.25 g/100ml). Las cajas de Petri fueron incubadas a 26  0 C determinándose la acidificación (color 
amarillo) o alcalinización (color azul) producido por los microorganismos.

14 
Utilización de diferentes fuentes de car bono  y nitrógeno 
Se  siguió  el  método  descrito  por  Bernal  y  Graham  (2001).    Se  utilizaron  soluciones  de  fuentes  de 
carbono  y  nitrógeno  incluidos  sorbosa,  tartrato,  D­glucoronic,  eritritol,  dulcitol,  citrato,  lactato, 
glicina, triptófano, tirosina, cada una  usada en una concentración final de 1g∙L ­1  en un medio basal. 
El crecimiento de los microorganismos fue determinado a los 7 días de incubación. 

Resistencia a antibióticos 
Los  aislamientos  fueron  probados  en  su  capacidad  de  resistir  a  los  antibióticos:  estreptomicina, 
espectinomicina, kanamicina, ácido nalidíxico, contenidos en medio TYA (triptona, levadura, agar). 

Toler ancia a metales pesados 
Se probó la tolerancia a: AlCl3.6H2O (500 ug/ml), Pb (CH3COO)2 (500 ug/ml), CuCl2.2H2O (100 
ug/ml), y ZnCl2 (100 ug/ml), contenidos en medio TYA. La presencia o ausencia de crecimiento de 
los aislamientos fue determinado luego de ser incubados a 26 0 C durante 10 días. 

Toler ancia a pH del medio 
Los aislamientos fueron probados en su capacidad de crecer en medio TYA a pH 4.5; 5.0; y 8.5. El 
crecimiento fue determinado luego de incubar los cultivos a 26 0 C durante 7 días. 

Toler ancia a concentr aciones de NaCl 


Se siguió  el  método descrito por Bernal y Graham (2001). Se probó  el crecimiento de  las  cepas  a 
concentraciones  de  0.5%;  1.0%;  2.0%   NaCl  en  medio  TYA.  Las  cajas  fueron  incubadas  a  26  0 C 
durante 7 días. 

Las fuentes  de carbono y nitrógeno, así como los  antibióticos, metales  pesados  y cloruro de sodio 


fueron esterilizados por filtración, utilizando filtros Acrodisc 13 (GelmanSciences) de 0.2 mm, para 
luego ser añadidos a  los distintos medios estériles. 

Análisis estadístico 
La presencia  (1),  o ausencia  (0),  de  crecimiento  de  las  cepas  en  los  diferentes  medios  de  cultivo, se 
registró  en  una  matriz  de  datos  binarios  en  el  programa  NTEDIT  del  paquete  estadístico  NTSYS­pc 
versión 2,0 (Applied Biostatistics Inc, 1998).

15 
La similitud entre cepas fue calculada de la matriz de datos binarios, entre pares de cepas, utilizando 
la  opción  S IMQUAL,  mediante  el  coeficiente  de  Simple  Match  Coeffient  (SMC).  Sobre  la  matriz 
obtenida se aplicó la técnica de “cluster analysis” empleando el método de agrupamiento UPGMA 
(Media  Aritmética  No  Ponderada;  Sneath  &  Sokal,  1973)  mediante  la  opción  SAHN 
CLUSTERING  del  paquete  NTSYS.  Finalmente,  mediante  la  opción  TREE  DISPLAY  fueron 
visualizados  los  agrupamientos  o  relaciones  entre  cepas,  generándose  el  dendograma  (fenograma) 
mostrando las relaciones fenotípicas. 

Car acter ización genética. 


Por la razón anotada en la caracterización fenotípica, solo las cepas asociadas a los cultivos de fréjol 
y  maní,  fueron  caracterizadas  genéticamente.  Para  esto,  se  seleccionaron  cepas  representativas  de 
cada grupo del dendograma generado en el análisis fenotípico. Las cepas de fréjol se caracterizaron 
en el Departamento de Microbiología de Suelos de la Universidad de Minnesota (Bernal y Graham, 
2001),  y  las  cepas  de  maní  se  caracterizaron  en  el  Instituto  de  Bioquímica  y  Biología  Molecular 
(IBBM)  de  la  Facultad  de  Ciencias  Exactas  de  la  Universidad  de  La  Plata  –  Argentina.  A 
continuación  se  detalla  únicamente  la  metodología  utilizada  en  la  caracterización  genética  de  las 
cepas de maní (Aguilar M. comunicación personal), ya que la descripción de la metodología para la 
caracterización  de  las  cepas  asociadas  al  fréjol,  se  encuentra  detallada  en  el  artículo  de  Bernal  y 
Graham (2001). 

Aislamiento de ADN genómico de las cepas. 
Se  utilizó  el  método  de  extracción  con  resina  (Walsh  et  al.  1991).  Tres  colonias  crecidas  en  medio 
LMA, fueron suspendidas en 300 ml de ClNa (1M), dentro de un tubo eppendorf, y homogenizadas por 
agitación. Después de incubar a temperatura ambiente durante 20 minutos, se centrifugó a 14000 rpm 
por 3 minutos. El sobrenadante fue descartado para luego colocar en el tubo 300 ml de agua bi destilada 
estéril. Se procedió a agitar y centrifugar en las mismas condiciones descritas anteriormente. Al  pellet 
obtenido se le adicionó 150 ml de una suspensión acuosa (6% p/v) de resina (Chelex 100, BIO­RAD) 
en agitación, se dejó incubar 20 minutos a 56  0 C, y posteriormente 8 minutos a 99 0 C. Las muestras se 
conservaron a ­20 0 C hasta el momento de ser utilizadas.

16 
Análisis del genoma bacter iano 

a.  Condiciones  generales de PCR y electroforesis 
Todas  las  amplificaciones  se  realizaron  en  un  termociclador  (Biometra  UNO­Thermoblock).  Los 
productos de amplificación, en alícuotas de 3­5 ml, fueron separadas mediante electroforesis horizontal 
en geles de agarosa (0.8­ 2.5 %) conteniendo buffer TBE (tris­boro, EDTA) (0.5X) y bromuro de etidio 
(5x10 ­4  mg/ml)  y  visualizados  en  un  transiluminador  de  luz  ultra  violeta  (UV).  Los  geles  fueron 
preparados en recipientes de electroforesis de 7 x 10 cm o 15 x 10 cm (BIO­RAD), y las fuentes de 
poder utilizadas fueron PowerPac 200 y 300 (BIO­RAD) y EC290­50. 

b. Digestión de fragmentos amplificados por PCR. 

Las  digestiones    se  realizaron  a  partir  de  alícuotas  de  4  a  10 ml  de  la  mezcla  de  reacción    de  PCR 
incubadas  con endonucleasas  de restricción  siguiendo las condiciones  especificadas por el fabricante 
(3 U por reacción). Se incubó toda la noche a 37 0 C (o a 65 0 C), de acuerdo a la temperatura óptima de 
la  endonucleasa utilizada. Los productos    de  las  digestiones    fueron separados  por  electroforesis    en 
geles horizontales de agarosa  (2.5 %) en buffer TBE 0.5X. La electroforesis  fue llevada a cabo a 80 V 
durante 3h, en el mismo buffer. 

c.    Patrones  de  bandas  (fingerprints)  de  ADN  total  usando  los  cebadores  (primers)  rep  (ERIC  y 
REP). 

Para conocer  el grado de similitud entre los aislamientos, se realizó el análisis del genoma  bacteriano 
completo según De Bruijin, citado por Aguilar (2003), mediante el empleo de cebadores (primers)  rep: 
ERIC  y  REP.    Para  ERIC­PCR,  se  emplearon  los  cebadores    E1  (5’­ 
ATGTAAGCTCCTGGGGATTCAC­3’) y E2  (5’­AAGTAAGTGACTGGGGTGAGCG­3’). 

El  volumen  de reacción   fue  de  10 ml conteniendo  2.5 ml  de  las preparaciones con resina, buffer  de 
polimerasa (10  mM Tris­Cl pH 9:  25  o C), 3  mM  MgCl2 , 200 mM  de  cada  dNTP, 1.5 mM  de  cada 
primer y 0.55 U de Taq polimerasa.  Las amplificaciones  de ADN se llevaron a cabo con el siguiente 
ciclo de temperaturas:

17 
95 0 C Þ  5 minutos 
94 0 C Þ  1 minutos 
52 0 C Þ  1 minutos  X 35 ciclos 
65 0 C Þ  8 minutos 
68 0 C Þ  16 minutos 

Para REP­PCR se utilizo también la técnica sugerida por De Bruijin (1992). Para esto se empleó los 
cebadores  Rep­1  (5’–IIIICGICGICATCIGGC­3’)  y  Rep­2  (5’–ICGICTTATCIGGCCTAC­  3’).    El 
volumen  de  reacción  fue  de  15 ml,  conteniendo  la  misma  mezcla  de  reacción  para  ERIC,  pero 
utilizando  3.2 ml  de  DNA  molde  y  1 mM  de  cada  primer.  La  amplificación  se  llevó  a  cabo  con  el 
siguiente ciclo de temperaturas: 

95 0 C Þ  5 minutos 
94 0 C Þ  1 minutos 
40 0 C Þ  1 minutos  X 35 ciclos 
65 0 C Þ  8 minutos 
65 0 C Þ  16 minutos 

Los  perfiles  (patrones  de  bandas)  obtenidos  después  de  la  corrida  de  electroforesis  y  visualizados, 
fueron analizados para su comparación, utilizando el programa GEL Compare. 

d.  Análisis por RFLP (Restriction Fragment Lenght Polimorphism)  de la región íntergénica 16S­ 
23S rRNA. 

La  amplificación  de  la  región  íntergénica  16S­23S  rRNA  se  llevó  a  cabo  en  cada  uno  de  los 
aislamientos  utilizando  los  primers  FGPS1490  (16f)  y  FGPL  132’(23r)  cuyas  secuencias  son  16f 
5’TGCGGCTGGATCACCTCCTT3’, 23r 5’CCGGGTTTCCCCATTCGG3’. El primero  deriva de 
una secuencia conservada en el extremo 3’ del gen 16S rRNA y el segundo deriva del extremo 5’ 
del gen 23S rRNA próximo a la región intergénica (Laguerre et al. 1996). 

Las reacciones comprendieron un volumen final de 25 ml. El contenido de ADN fue de 2.5 ml de las 


preparaciones con resina, 10mM Tris­Cl pH 9: 25 o C de buffer polimerasa, 2.5 mM de MgCl2,  200 mM

18 
de cada dNTP, 1 mM de cada primer, y 1 U de Taq polimerasa. Las amplificaciones se llevaron a cabo 
con el siguiente ciclo de temperaturas: 

95 0 C Þ  5 minutos 
94 0 C Þ  1 minutos 
55 0 C Þ  1 minutos  35 ciclos 
72 0 C Þ  2 minutos 
72 0 C Þ  3 minutos 

El análisis de RFLP  fue de  dos grupos de aislamientos  obtenidos por diferenciación en el tamaño 
del  producto  de  su  PCR.  Las digestiones se realizaron  con  las  enzimas  de restricción Msp1, TAQ  I, 
Hae III, RsaI, AluI. El volumen de reacción fue de 8 ml conteniendo: producto de PCR  6ml, BSA 0.1
ml, Buffer  10X 1X, Enzima 3 U. 

Actividad 1b. Almacenamiento de las cepas. 

Para    ambos  casos,  solicitud  de  cepas,    y    selección  (aislados  del  suelo  o  directamente  de  la 
leguminosa),  el  material  germoplásmico  fue  almacenada  apropiadamente  a  través  del  proceso  de 
liofilización (secado en frío y al vacío) de cada cepa, o en glicerol bajo temperatura de –70° C. El 
almacenamiento  se  realizó  en  el  Laboratorio  de  la  Sección  de  Microbiología  del  Departamento 
Nacional de Protección Vegetal (DNPV) de la Estación Santa Catalina. 

Actividad  2 a.  Estudio de la compatibilidad genética entre Rhizobium y el cultivo de fréjol. 

A  través  de  evidencias  arqueológicas,  se afirma  que  el  fréjol  (Phaseolus  vulgaris)  tiene  su  origen 
tanto  en  Mesoamérica  (México,  Guatemala),  como  en  los  Andes  de  América  del  Sur,  y  estudios 
moleculares  realizados  en  el  Centro  Internacional  de  Agricultura  Tropical  (CIAT),  identifican  al 
Ecuador y a la región norte del Perú como un tercer mayor acervo genético del fréjol (Tohme et al. 
1995). Se conoce además, que el germoplasma de fréjol de Mesoamérica es genéticamente diferente 
al de los Andes (Koinange and Gepts, 1992). Esto se ha comprobado a través de hibridaciones entre 
cultivares de ambas regiones, dando como resultado deformaciones y letalidad en la F1. En base a 
esto,  se  asume  que  a  través  de  la  coevolución  del  cultivo  de  fréjol  y  su  Rhizobium,  ésta  bacteria 
también presenta diferencias en la asociación con hospederos  pertenecientes a diferente región.

19 
Por  lo  tanto,  para  conocer  si  la  nodulación  de  fréjol  por  su  respectivo  Rhizobium  es  efectivo  o 
inefectivo, lo cual depende de la compatibilidad genética entre ambos simbiontes,  se llevó a cabo 
una investigación de especificidad  por nodulación en jarras Magenta (Vincent, 1970) conteniendo 
arena estéril e irrigada con solución nutritiva modificada "Summerfield" (McDermott and Graham, 
1990). Las variedades de fréjol común usadas fueron Bolón M6, Bolón Cañicapac y Bolón Mater. 
Además  se incluyó la variedad Puebla 152 de  origen  Mesoamericano, para la comparación.  Cada 
variedad fue inoculada con todas sus respectivas cepas consideradas en el estudio. Se usaron suelos 
de  Cotacachi  (norte  del  Ecuador),  Cañicapac,  Mangucusana  y  Mater  (sur  del  Ecuador),  y  de 
Poconichim  (México),  para  contrastar.  Las  plantas  fueron  colocadas  por  cinco  semanas  en  una 
cámara  de  crecimiento  (Conviron  PGW  36).    A  las  cinco  semanas,  se  evaluó  el  color 
(verde/clorosis),  el  crecimiento  de  las  plantas,  el  número  más  probable  (NMP)  de  rizobios,  y  la 
diversidad genética (usando la prueba Box A1R­PCR). Así se determinó la combinación compatible 
leguminosa­cepa de Rhizobium. Esta actividad se  llevó a cabo en los laboratorios  de Microbiología 
de Suelos de la Universidad de Minnesota. 

Actividad  2  b.    Estimación  del  potencial  fijador  de  nitrógeno  de  las  cepas  de  Rhizobium  en 
invernadero 

Los experimentos fueron instalados en los invernaderos de la sección de Microbiología (DNPV) de 
la  Estación  Experimental  Santa  Catalina  del  INIAP.  Para  fréjol  se  utilizó  la  variedad  Bolon  M6, 
para  arveja  la  variedad  Roxana.  Las  variedades  de  soya  y  maní,  fueron  Vinceña  y  Caramelo 
respectivamente.  La  actividad  para  estas  dos  últimas  leguminosas  se  realizó  en  los  laboratorios  e 
invernaderos  de la Estación Pichilingue  del INIAP. En alfalfa,  esta actividad fue realizada hace 8 
años por el Departamento de Protección Vegetal de la Estación Santa Catalina, por lo que las cepas 
seleccionadas  en  ese  entonces  fueron  utilizadas  directamente  en  el  experimento  de  campo.    Con 
relación a los tratamientos, éstos fueron el resultado de la combinación de la variedad por las cepas 
de Rhizobium. Se incluyeron tratamientos sin inocular (control absoluto),  y con nitrógeno (solución 
de NOK 0.05% (control fertilizado), utilizados para comparación de las cepas. Todos los ensayos de 
invernadero  se  dispusieron  en  un  diseño  de  bloques  completamente  al  azar  (DCA)  con  tres 
repeticiones.  La  unidad  experimental  estuvo  constituida  por  la  unión  de  dos  jarras  Magenta 
autoclavables,  superpuestas  una  sobre  la  otra  y  comunicadas  por  una  mecha  de  algodón.  La  jarra 
superior sirvió de maceta para sembrar una semilla previamente esterilizada y germinada. La jarra 
inferior  sirvió  de  recipiente  para  colocar  la  solución  nutritiva  y  agua,  de  acuerdo  a  los 
requerimientos de cada cultivo. Las variables cualitativas y cuantitativas tomadas en consideración

20 
para  la  evaluación  de  la  capacidad  simbiótica  en  invernadero  fueron:  coloración  de  la  planta, 
número y peso seco de nódulos (mg/100 nódulos), peso fresco (g/planta) y peso seco (g/planta).  Se 
utilizó un diseño completamente al azar y la selección de las cepas se realizó al nivel del 5%.  Así 
se  conoció la efectividad fijadora de nitrógeno de las cepas de cada leguminosa, bajo condiciones 
de invernadero. 

Manejo del ensayo 

Ester ilización y ger minación de semillas. 


Las semillas fueron esterilizadas superficialmente siguiendo el método sugerido por Vincent (1970). 
La semilla fue tratada con etanol (96%) durante tres minutos, hipoclorito de sodio (5%) durante tres 
minutos,  y  lavadas  por  ocho  veces  con  agua  destilada  estéril.  Posteriormente  las  semillas  fueron 
germinadas  en  placas  de  Petri  conteniendo  agar  (1.5%)  e  incubadas  a  26ºC  durante  3­5  días 
dependiendo de la leguminosa. 

Siembr a e inoculación. 
Dos  semillas  germinadas  fueron  luego  transferidas  a  jarras  Magenta  conteniendo  turba  y  piedra 
pómez (relación 3:1) estéril. El inoculante bacteriano se preparó a partir de una colonia aislada en 
medio  de  cultivo  LMA,  y  transferida  a    medio  líquido  (LM)  e  incubado  a  26ºC.  Los  cultivos 
crecidos conteniendo 10 8  cel/ml se diluyeron a 10 5 cel/ml, y se tomaron 10 ml para ser depositados 
(10 6  cel/ml)  sobre  la  corona  de  la  raíz  de  la  semilla  germinada,  evitando  la  dispersión  del 
inoculante.  Las  macetas  fueron  colocadas  bajo  invernadero  a  una  temperatura    de  15­24  ºC 
(dependiendo de la leguminosa), con una  humedad relativa de 45­50%. 

Raleo, r iego y tutor eo. 


Transcurridos 10 días después de la siembra, se procedió a dejar la planta más vigorosa por unidad 
experimental (jarra). El riego se realizó cada vez que el cultivo lo requería, para esto se utilizó agua 
destilada  estéril  y  medio  Somasegaran­N  aplicado  en  la  jarra  inferior,  para  que  el  agua  suba  por 
capilaridad a la planta. Cuando las plantas tuvieron 15 días (caso maní), éstas fueron sujetadas con 
hilo plástico a un soporte de alambre tendido en la parte superior del invernadero. 

Actividad 2 c.  Estimación del potencial fijador de nitrógeno bajo condiciones de campo.

21 
Como en el ambiente natural (suelo)  las raíces  de las leguminosas interactúan con los rizobios en 
presencia de otros microorganismos  y en presencia del nitrógeno del suelo,  las cepas previamente 
evaluadas  en  invernadero,  fueron  probadas  bajo  condiciones  de  campo,  en  diferentes  sitios  de  la 
región donde predomina la  leguminosa. La metodología seguida fue la recomendada por el CIAT 
(1988). 

Para  fréjol,  los  experimentos  fueron  localizados  en  Tumbaco  y  Pifo  (Provincia  de  Pichincha) 
utilizando  las  variedades  INIAP TOA  412,  y  la  línea promisoria  Canario  SCC2  (del  Programa  de 
Leguminosas del INIAP). 

Los experimentos de arveja se llevaron a cabo en Cañar y Chimborazo, con la variedad Roxana. En 
alfalfa,  los  experimentos  se  ejecutaron  en  Chimborazo,  utilizando  la  variedad  Abunda  Verde.  En 
este último caso, las pruebas de campo se realizaron en colaboración con voluntarios del Cuerpo de 
Paz.  En soya, el trabajo de campo tuvo lugar en Los Ríos, usando la variedad Vinceña, y el estudio 
de  maní  se  realizó  en  Loja  con  las  variedades  Caramelo  e  INIAP  380  (del  Programa  de 
Leguminosas, Estación Boliche­INIAP). 

Manejo del exper imento 

Pr epar ación del suelo 
Con la maquinaria adecuada se procedió a preparar el suelo mediante una labor de arada y dos  de 
rastra para luego surcarla a 0.40­0.60 cm (de acuerdo a cada leguminosa) entre surcos. Se efectuó el 
trazado de las parcelas (unidades experimentales) y bloques. 

Fer tilización, e inoculación de la semilla. 
Antes de la siembra se procedió a fertilizar todas las parcelas con fósforo, potasio, y micronutrientes 
de  acuerdo  al  análisis  de  suelos  y  requerimientos  de  cada  leguminosa.  Se  aplicó  urea  (46%) 
únicamente en las unidades experimentales del tratamiento nitrogenado. La semilla fue inoculada al 
momento  de  la  siembra  usando  las  cepas  en  turba.  Las  dosis  fueron  de  10  g  de  inoculante  por 
kilogramo de semilla (soya, fréjol, maní, arveja), y 50 g por Kg de semilla en alfalfa. 

Riego y siembr a, y cosecha. 
Antes  de  la  siembra  se  realizó  un  riego  ligero  para  garantizar  el  establecimiento  de  la  bacteria  y 
buen crecimiento de  la planta. La siembra se efectuó en forma manual con  el sistema  de golpes  a

22 
cada 30 cm de distancia entre plantas. En cada sitio se depositó cuatro semillas para seleccionar 3 
plántulas a los 10 días. La cosecha se realizó en forma manual al estado de maduración del cultivo. 
Cada  tratamiento  fue  colocado  en  fundas  previamente  identificadas.  En  alfalfa,  la  siembra  de  la 
semilla  inoculada  se  realizó  a  “chorro  continuo”  inmediatamente  después  de  la  inoculación,  y  la 
semilla fue cubierta con una ligera capa del suelo. 

Factor es, tr atamientos, diseño exper imental. 


Los  factores  en  estudio  fueron  las  variedades  y  las  cepas.  Los  tratamientos  resultaron  de  la 
combinación de los factores  en estudio, bajo un diseño experimental de bloques completos al azar 
con arreglos factoriales de acuerdo al número de variedades y cepas en cada leguminosa. La unidad 
experimental  estuvo  constituida  por  parcelas  (6­8  m 2 )  de  siete  surcos  conteniendo  16­20  plantas 
(dependiendo  de  la  leguminosa).  Las  parcelas  estuvieron  separadas  por  un  metro  de  distancia,  y 
entre bloques por 2 m. La unidad experimental neta consta de los surcos centrales de cada parcela. 

Par ámetr os analizados. 


Las variables a tomarse fueron: a) peso fresco del follaje (g/planta). Cuando el cultivo alcanzó 50% 
de la floración se extrajo seis plantas tomadas al azar de los tres surcos centrales realizando un corte 
en la base del tallo. b) peso seco del follaje. El mismo material indicado anteriormente fue secado 
en una estufa a 70ºC durante 48 horas para luego determinar el peso seco en g/planta, c) peso seco 
de  nódulos  después  de  ser  mantenidos  por  48  horas  a  60º  C,  d)  porcentaje  de  nitrógeno  total.  El 
valor  de  nitrógeno  se  obtuvo  por  el  método  de  Kjeldahl  en  los  laboratorios  del  Departamento  de 
Suelos de la Estación Santa Catalina, e) rendimiento. Se pesó el número total de granos cosechados 
en las plantas hechas un muestreo, y el dato obtenido se expresó en kg/ha. 

Una variedad de cualquier  leguminosa puede restringir la nodulación de determinada cepa o sero­ 
grupos de rizobios, lo cual determina una especificidad entre la planta y el rizobio, repercutiendo en 
el proceso simbiótico. Por esta razón, se realizó pruebas  de campo  en fréjol  y  maní, que  incluyan 
diferentes variedades por leguminosa.  Así se logró identificar cepas efectivas en fijación biológica 
de nitrógeno al hacer simbiosis con variedades utilizadas por el agricultor. 

Actividad 2 d.  Estudio de la competitividad de las cepas por nodulación en fréjol. 

En fréjol se llevó  a cabo un estudio de  competición de las  cepas  por nodulación, para conocer la 


cepa de mayor agresividad en formar nódulos en la raíz de la planta, y bajo condiciones de campo.

23 
La identificación de  las cepas se realizó utilizando sueros pertenecientes a las cepas seleccionadas 
previamente. Para esto se siguió la metodología sugerida por Somasegaran y Hoben (1994). Como 
alternativa  pudo  haberse utilizado  la  reacción    BOX­PCR  de  Versalovic  et  al.  (1994),  generando 
"fingerprints"  mediante  electroforesis,  pero  la  técnica  utilizada  en  el  proyecto  fue  la  de  serología, 
por cuanto es una técnica más barata y sencilla que la técnica molecular. 

Obtención de antígenos 
Para la obtención de los antígenos, los cultivos bacterianos se hicieron crecer en LMA a 26ºC. La 
pureza  se  verificó  al  final  del  tiempo  especificado  para  el  crecimiento  (4  días).  Se  seleccionaron 
colonias  puras  de  las  cepas  y  se  hicieron  crecer  en  medio  líquido,  hasta  la  concentración  de  10 8 
celulas/ml. La suspensión se  distribuyó  en pequeños  viales  estériles  en proporciones  de 2  ml para 
inyecciones. A cada una de las  muestras se agregó formol (1ml de solución al 1% para 100 ml de 
suspensión) y se conservaron a 4º C. 

Obtención de antisuer os 
Para la obtención de antisueros se usó una aguja de tamaño mediano (graduación 23, 0.5 mm) para 
inocular  en  la  gran  vena  marginal  de  la  oreja  de  conejos  de  buen  desarrollo.  Las  suspensiones 
bacterianas fueron inoculadas de la siguiente manera: el primer día se inoculó 1 ml  de suspensión 
bacteriana  inerte  en  forma  subcutánea.  A  los  7  días  se  repitió  el  procedimiento  y  a  los  14  días  se 
inoculó  en  forma  intravenosa  1  ml  de  suspensión  bacteriana  viva.  Siete días  después  de  la  última 
inyección se recogió una muestra (2 ml) desde la vena de la oreja. La sangre se pasó a un tubo de 
prueba  con  tapón  de  rosca  estéril.  Se  dejó  coagular  la  sangre  a  temperatura  ambiente  durante  dos 
horas, y se separó el coagulo introduciendo un aplicador de madera alrededor del mismo. Luego se 
refrigeró  durante  toda  la  noche.  El  suero  claro  se  decantó  en  un  tubo  de  prueba  evitando  que  las 
células  rojas  de  la  sangre  entren  al  tubo.  Se  determinó  el  título  de  aglutinación  de  la  siguiente 
manera:  Se  pipetearon  0.4  ml  de  antisuero  patrón  para  pasarlos  a  un  tubo  de  16  x  125  mm 
conteniendo  9.56  ml  de  solución  salina  (0.85%).  Se  mezclaron  bien  dando  una  dilución  del 
antisuero de 1/25. Se etiquetó el tubo con el número 1, y se utilizaron 10 tubos adicionales con 2.5 
ml de solución salina cada uno. Los tubos fueron rotulados del 2 al 11. Usando  pipetas nuevas se 
prepararon  diluciones  hasta  1/25000.  Los  tubos  1  y  2  fueron  conservados  para  usarlos 
posteriormente  en  caso  de  ser  necesario.  Las  diluciones  se  probaron  con  la  cepa  inoculada 
(homóloga).  La  última  dilución  que  presentó  anticuerpos  en  reacción  visible  fue  la  que  indicó  el 
título. Determinado el título, se procedió a sangrar el conejo mediante inyección cardiaca, retirando 
lentamente 50 ml. La sangre se colocó en tubos de boca ancha para facilitar la separación del suero.

24 
El  suero  se  mantuvo  a  temperatura  ambiente  por  una  hora,  y  luego  a  4ºC  por  12  horas  para  la 
coagulación.  Por  centrifugación  (2000  rpm)  durante  10  minutos  se  separó  el  suero  del  resto  del 
coagulo sanguíneo. El suero así obtenido fue preservado con una solución de mertiolato (0.1 ml de 
una solución al 1% para cada 10 ml de suero) y bajo refrigeración. 

Reconocimiento de antígenos homólogos por  inmunodifusión. 

Se colocaron 100 ml de una solución salina al 0.85% conteniendo azida de sodio ( 0.075%) en un 
matraz Erlenmeyer de 250 ml, se agregaron 0.75 g de agar Noble y se sometió a ebullición en baño 
María, para luego ser colocado en placas de Petri, para la solidificación. Se trazó el contorno de la 
base de una placa Petri sobre un papel blanco. Se sacó una plantilla de 6 círculos  equidistantes de 
0.4  cm  de  diámetro  en  un  patrón  hexagonal  en  el  centro  del  contorno  de  una  placa.  Un  séptimo 
orificio  se  hizo  en  el  centro  del  patrón  hexagonal  y  se  pintaron  los  círculos.  La  placa  Petri 
(conteniendo agar) se colocó sobre la plantilla. El patrón de los círculos fue visible a través del agar. 
Se  cortaron  los  orificios  dentro  del  agar  usando  un  sacabocados  de  0.4  cm,  eliminando 
cuidadosamente los tapones de agar con alfileres o cualquier otro implemento apropiado. Se colocó 
una gota de agar fundido para sellar la base del orificio. 
Para  las  reacciones  de  inmunodifusión,  se  prepararon  las  suspensiones  de  antígeno  (1x10 10 
células/ml).  Las  muestras  fueron  tratadas  con  calor  por  una  hora  a  100  °C,  y  dos  gotas  de  cada 
antígeno  se  colocaron  en  sus  respectivos  orificios.  La  suspensión  estándar  de  las  cepas  conocidas 
fue  colocada  en  las  cavidades  superiores  e  inferiores,  mientras  que  la  de  las  desconocidas  fue 
colocada en las cuatro cavidades laterales. La cavidad central recibió el antisuero sin dilución. Las 
cavidades  fueron  llenadas  cuidadosamente  hasta  el  tope,  usando  pipetas  Pasteur  de  extremidades 
finas y se volvieron a colocar las tapas de las cajas. La base de la placa de difusión fue marcada con 
la  identidad  de  cada  antígeno.  Las  placas  se  incubaron  a  temperatura  ambiente,  en  un  ambiente 
saturado de humedad, para luego realizar observaciones después de 24 y 48 horas. 

Evaluación de la competencia entr e cepas. 

Determinación de la población de rhizobios nativos en el suelo. 
La determinación de la población de Rhizobium nativo del suelo se realizó siguiendo la metodología 
sugerida por el CIAT (5). Para esto, se utilizó fundas plásticas de crecimiento conteniendo 20 ml de 
solución  nutritiva,  por  cada  funda.   La  semilla  de  fréjol  (variedad  Yunguilla)  se  esterilizó  usando 
hipoclorito  al  5%  durante  5  minutos,  para  luego  ser  lavadas  en  agua  estéril.  Las  semillas  fueron

25 
transferidas a placas con agar para la germinación, y una vez germinadas, fueron transferidas a las 
fundas de crecimiento.  Para la inoculación del suelo, éste fue diluido hasta 10 ­8 . Se inoculó el suelo 
en cada una de las fundas con 4 repeticiones, incluyéndose fundas de crecimiento correspondientes 
al  testigo  o  control.  A  las  tres  semanas  de  crecimiento  se  cosecharon  las  plantas  para  proceder  al 
registro de nódulos, con presencia (+) o ausencia (­). Utilizando las tablas estadísticas de Fisher, se 
procedió a calcular la población rhizobiana del suelo. 

Pr epar ación del inoculante 
Para  la  preparación  del  inoculante  se  tomaron  colonias  puras  de  las  cepas  UMR  (1899,  1478  y 
1481),  para  sembrarse  en  medio  líquido  levadura  manitol.  Cuando  el  crecimiento  celular  en  los  3 
diferentes medios fue suficiente (10 9  cel/ml), las cepas con una misma concentración celular fueron 
mezcladas e inyectadas asépticamente a fundas auto clavadas estériles de polipropileno conteniendo 
turba, de acuerdo a los  tratamientos  previamente  establecidos. Los  inoculantes  fueron incubados  a 
25ºC  durante  una  semana.  La  calidad  del  inoculante  se  evaluó  mediante  recuento  de  células  en 
placa. 

Estudio de campo 
El  experimento  de  campo  se  realizó  en  un  terreno  de  500  m 2  localizado  en  Pifo  (Provincia  de 
Pichincha),  con  un  historial  de  potrero,  sin  uso  de  leguminosas,  y  deficiente  en  nitrógeno.    El 
experimento  tuvo  un  diseño  de  bloques  completos  al azar  con  siete  tratamientos  y  4 repeticiones, 
utilizándose la variedad Yunguilla, tipo arbustiva, precoz y probada en experimentos anteriores de 
fijación biológica de nitrógeno. La inoculación de la bacteria se hizo al momento de la siembra de la 
semilla. Se utilizaron además  dos  tratamientos  de control: uno sin nitrógeno  y sin inocular, y uno 
con nitrógeno sin inocular.

26 
Cuadr o 1.  Tratamientos utilizados en el estudio de campo, para la evaluación de la competitividad 
entre cepas, asociadas al cultivo de fréjol. 

T1  UMR 1899 
T2  UMR 1481 
T3  UMR 1478 
T4  UMR 1899 X UMR 1478 
T5  UMR 1899 X UMR 1481 
T6  UMR 1478 X UMR 1481 
T7  UMR 1899 X UMR 1478 X UMR 1481 
T8  Control –N 
T9  Control +N 

Pr ácticas cultur ales y manejo del cultivo. 
Se prepararon surcos a una distancia de 60 cm. y se dividieron en 36 bloques  de 2,40 m x 2,40 m 
cada  uno.  Los  bloques  fueron  marcados  claramente  con  sus  respectivos  tratamientos,  para 
posteriormente dar un riego antes de la siembra. Se sembraron tres semillas por golpe, y a distancias 
de 30 cm, y sembrándose primeramente los tratamientos no inoculados (­N y +N).  A los 15 días de 
la siembra se realizó un raleo, dejando una sola planta por cada golpe. 

Muestr eo. 
A la época de la floración, se cosecharon 3 plantas por bloque, para luego proceder a la extracción 
de 50 nódulos. Estos fueron sometidos a un análisis de inmunodifusión para identificar las cepas de 
Rhizobium  que  habían  colonizado  y  formado  nódulos  en  las  plantas  de  fréjol.  Conociendo  la 
capacidad competitiva de las cepas conjuntamente con la capacidad fijadora de nitrógeno, es posible 
la elaboración de inoculantes. 

Actividad 3 a.  Recolección de turbas 

Se  consideró  como  base  a  los  estudios  de  Constante  (1993),  y  de  Estévez  y  Constante  (1993), 
incluyéndose  además  otras  turbas  y  materiales  que  presentaron  propiedades  que  permitieron 
considerarlas como acarreadores apropiados de la bacteria. Las turbas recolectadas fueron secadas, 
molidas, tamizadas  en una  malla de 180 mm y posteriormente  empacadas  en fundas  de polietileno 
de baja densidad y humedecidas hasta el 50% de su capacidad de absorción.

27 
Actividad 3 b.   Análisis físico y químico de los soportes. 

Se realizó la caracterización física y química de los soportes: 1) turba de Chimborazo, 2) turba de 
Lloa,  3)  turba  de  Alaska,  4)  capa  rosa,  5)  ceniza,  6)  zeolita,  y  7)  sustrato  a  base  de  vaina  seca 
molida de fréjol mezclado con compost. Se dio énfasis al tamaño de las partículas y al contenido de 
materiales   no deseables  que dificultan el normal procesamiento de extracción, secado y  molienda 
del material. También se determinó la capacidad de cada soporte en la retención de humedad para lo 
cual se empleó la técnica de rutina usada en el Laboratorio de Suelos de la Estación Santa Catalina. 
La caracterización química incluyó: contenido de amonio, nitrato, carbono, potasio intercambiable, 
porcentaje  de  materia orgánica, fósforo, potasio  y pH.  Para la determinación  de pH se prepararon 
suspensiones en una relación 2:5 de la muestra en agua destilada y las medidas se registraron con la 
ayuda de un pHmetro. El pH de los  soportes  se ajustó a 6.5­7.0 con CaCO3. Los análisis  de P, K, 
Ca, Mg, Cu, Fe, Mn, Zn, B fueron realizados  por el método de Olsen modificado a excepción del 
boro en donde se uso curcumina. 

La  determinación  de  la  población  microbiana  se  la  realizó  únicamente  en  turbas.  Para  esto,  se 
utilizó  50  gramos  de  turba  y  colocados  en  450  ml  de  agua  destilada  estéril,  para  ser  agitado 
vigorosamente por 30  minutos. A continuación se procedió a realizar diluciones  hasta 10 8 . De las 
diluciones  10 3  hasta  10 6  se  tomaron  100  ul  y  colocados  en  cajas  Petri  conteniendo  medios  de 
cultivos apropiados para bacterias, hongos y actinomicetes. Los platos Petri fueron incubados a 25­ 
30ºC  por  cinco  días.  Posteriormente  se  determinó  las  poblaciones  de  bacterias,  hongos  y 
actinomicetes. 

Actividad 3 c.  Interacción rizobio­turba (portador). 

Se ha comprobado en experimentos llevados a cabo en otros países, que una cepa puede sobrevivir 
bien    en  una  turba  y  no  en  otra,  u  otro  sustrato.  Se  consideró  como  parámetros,  el  crecimiento 
(células/gramo de turba) y la sobrevivencia de la bacteria en determinados intervalos de tiempo. La 
técnica  utilizada  estuvo  basada  en  el  procedimiento  descrito  por    Gómez  et  al.  (1997).  Los 
portadores  (50  g)  de  cada  uno  fueron  impregnados  con  25  ml  de  suspensión  bacteriana,  a  una 
concentración de 10 9 ufc/ ml. El material inoculado se incubó por ocho días a 26 ºC de temperatura. 
cada semana se homogenizó removiendo las fundas.

28 
Actividad 3 d. Evaluación de materiales alternativos 

Los soportes fueron inoculados después de la esterilización al vapor. La preparación del inoculante, 
y  la  enumeración  de  los  rhizobios  se  realiza  siguiendo  la  metodología  descrita  por  Chao  y 
Alexander  (1984),  Graham­Weiss  et  al.  (1987),  y  la  de  Kostov  y  Lynch  (1998).  El  estudio  fue 
llevado a cabo en el Departamento de Protección Vegetal de  la Estación Santa Catalina. 

Actividad 4 a. Evaluación de la esterilización de los portadores. 

Con la colaboración de la Comisión Ecuatoriana de Energía Atómica (CEEA) se está ejecutando un 
experimento  que permita determinar el  efecto  de  los  métodos  de  esterilización de  la turba y otros 
soportes,  en  la  sobrevivencia  de  los  rizobios  durante  el  proceso  de  almacenaje  del  inoculante.  Sé 
está evaluando los métodos de esterilización al vapor usando autoclave (15 psi  durante 1 hora)  y el 
de irradiación. La metodología a seguirse fue la sugerida por Date y Roughley (1977). El material 
plástico  de  empaque  del  inoculante  también  está siendo  evaluado  en  éste  estudio,  para  saber  si  el 
material afecta o no la sobrevivencia de la bacteria durante el almacenamiento del inoculante. 

Actividad 5.1  Difusión de resultados y productos generados por el proyecto. 

La difusión de los resultados se ha dado principalmente a través de: 1) días de campo en fincas de 
agricultores  donde  las  leguminosas  tienen su  importancia, 2) trípticos, y 3) seminarios  o talleres  a 
nivel nacional e internacional.  Estos se describen en: “Productos del proyecto”. La difusión de los 
resultados y productos se ha realizado siguiendo la metodología utilizada por la Fundación GAIA. 
Es  necesario  enfatizar  que  la  difusión  se  ha  realizado  conjuntamente  con  ciertos  resultados 
correspondientes al Proyecto Comminandes. Así por ejemplo, el uso de inoculantes de Rhizobium y 
el uso del compostaje en arveja y alfalfa en las Provincias del Cañar, Chimborazo y Pichincha. Se 
ha  elaborado  adicionalmente  documentos  del  proceso  y  uso  del  compost  en  leguminosas 
conjuntamente con inoculantes de Rhizobium. 

Actividad 6.1 Institucionalizar un sistema de control de calidad de los inoculantes. 

Actualmente se apoya la institucionalización de un sistema de control de calidad de los inoculantes 
a través del laboratorio destinado a su producción.  El sistema de control de calidad está basado en 
un programa que considera los siguientes factores:

29 
a)  Elaboración  de  antisueros  para  las  cepas  inoculantes.  El  uso  de  antisueros  permite  evaluar 
periódicamente  la  pureza  de  las  cepas.  Se  está  usando  la  técnica  serológica  (ELISA)  para  la 
identificación de las cepas. 

b)  Crecimientos  de  la  bacteria    en  diferentes  y  apropiados  medios  de  cultivo,  y  a  través  de 
reacciones  de autenticación (ej. tinción gram), y chequeos frecuentes  del pH del medio de cultivo. 
De  esta  manera  se  controla  el  crecimiento  de  contaminantes  como  otras  bacterias  u  hongos,  que 
generalmente son  rápidos en crecimiento generando acidez (pH bajo) del medio. 

c)  Viabilidad del producto. Antes de colocar en el  mercado, la viabilidad del producto está siendo 
analizada a través del número de células viables  de la cepa específica en inoculante fresco. 

d)  El  producto  debidamente  procesado  y  empaquetado  lleva  fecha  de  expiración  y  las 
recomendaciones  necesarias  para  el  agricultor,  con  énfasis  en  el  tipo  de  Rhizobium,    su 
correspondiente    leguminosa,  la  población  bacteriana  (células/gramo),    y  dosis  de    aplicación.  El 
producto listo para su distribución, es almacenado bajo refrigeración (5° C). 

8. RESULTADOS OBTENIDOS. 

Actividad 1a. Solicitud, recolección y caracterización de cepas. 

El  INIAP  dispone  de  un  banco  germoplásmico  de  Rhizobium  para  fréjol,  arveja,  alfalfa,  soya  y 
maní. Este material genético esta listo para la elaboración de inoculantes, y para el intercambio con 
instituciones de investigación en fijación biológica de nitrógeno, nacionales e internacionales. 
Los resultados de la caracterización genotípica y genética de las cepas asociadas al cultivo de fréjol 
se encuentran detallados en la publicación de Bernal y Graham (2001). A continuación se describe 
los resultados de la caracterización fenotípica y genética de las cepas asociadas al cultivo del maní. 
El dendograma (fig.8.1), muestra la relación fenotípica de los 93 aislamientos de “Bradyrhizobium” 
asociados  al  cultivo  de  maní.  El  dendograma  generado  muestra  la  presencia  de  tres  grupos  bien 
diferenciados  de  los  cuales  se  seleccionaron  29  aislamientos  representativos  (Cuadro  8.1).  Del 
grupo uno fueron seleccionados 13, del grupo dos 7, y del grupo tres 9 aislamientos.

30 
Cuadr o 8.1. Aislamientos de Bradyrhizobium sp. recolectados en las provincias de   Manabí y Loja 
representativos de los grupos generados por el análisis fenotípico. 

No.  Código de amplificación  Cepa  Or igen 


1  1  ECUM­L102  Loja 
2  2  ECUM­P5  Portoviejo 
3  3  ECUM­P7­2  Portoviejo 
4  4  ECUM­P2­3  Portoviejo 
5  5  ECUM­P22­2  Portoviejo 
6  6  ECUM­P20­1  Portoviejo 
7  7  ECUM­L27  Loja 
8  8  ECUM­L124  Loja 
9  9  ECUM­P11  Portoviejo 
10  11  ECUM­P13­2  Portoviejo 
11  12  ECUM­P13­4  Portoviejo 
12  13  ECUM­L53  Loja 
13  14  ECUM­P12  Portoviejo 
14  15  ECUM­L23  Loja 
15  16  ECUM­L66  Loja 
16  17  ECUM­L51  Loja 
17  18  ECUM­P15­1  Portoviejo 
18  20  ECUM­L83  Loja 
19  21  ECUM­L82  Loja 
20  22  ECUM­P17  Portoviejo 
21  23  ECUM­L85  Loja 
22  24  ECUM­L91  Loja 
23  25  ECUM­L62  Loja 
24  26  UMR 6011  Universidad de Minessota 
25  28  CIAT 3550  Colombia 
26  29  CIAT 5013  Colombia 
27  30  CIAT 14  Colombia 
28  31  ECUM­L105  Loja 
29  32  ECUM­P10­1  Portoviejo

31 
L81 
L91 
L115 
Figur a 8.1 Dendograma en base a la caracterización fenotípica de la colección de 93  3080 
P94 
aislamientos de “Bradyrhizobium” asociados al cultivo de maní en el  P15­1 
L61 
CIAT3825 
L93 
Ecuador P6­1 
P3
L102 
CIAT3555 
CIAT3551 
P10­3 
L113 
L36 
P91 
L42 
L112 
L45 
P93 
P12 
L22 
L96 
P16­3 
P21 
L103 
L125 
L101 
P8­5 
L104 
P82 
L52 
P2­1 

1  L94 
L15 
P19 
L116 
P13­1 
CIAT865 
CIAT3548 
P71 
L55 
L76 
P1
P16­1 
L126 
L95 
P16­2 
P13­3 
P20­1 
3077 
CIAT14 
P20 
P92 
CIAT6 
P6­2 
CIAT3824 
P14 
CIAT3550 
P2­2 
L51 
CIAT5013 
P11 
L62 
6011 
P86 
L124 
L74 
P84 

2  L105 
L82 
3081 
3079 
P17 
P2­3 
P13­2 
L83 
L85 
CIAT866 
L53 
L54 
L63 
L66 
P10­2 
3  L23 
L27 
P5
P10­1 
P13­4 
P72 
P22­2 

0.29  0.47  0.64  0.82  1.00 


Coefficient 

32 
Car acter ización molecular . 

El patrón de bandas (fingerprint) de 29 aislamientos (Cuadro 8.1) representativos de los grupos de 
la  caracterización  fenotípica,  demostró  una  gran  variedad  de  perfiles  lo  cuál  sugiere  que  desde  el 
punto de vista del análisis general del genoma de cada aislamiento, las cepas de la bacteria asociada 
al  cultivo  de  maní  en  el  Ecuador,  son  muy  diversas.  No  se  encontraron  patrones  de  bandas 
idénticos, y tampoco fue posible establecer una  asociación  entre los patrones (fingerprints) y lugar 
de origen del aislamiento (Figura 8.2 y  8.3). 

Figur a 8.2. Dendrograma mostrando la relación de 29 aislamientos de “Bradyrhizobium” asociados al maní. 
Los aislamientos fueron seleccionados de los grupos generados en el dendograma del análisis 
fenotípico. El método usado fue ERIC­PCR.

33 
Figur a 8.3. Dendrograma mostrando la relación de 29 aislamientos de “Bradyrhizobium” asociados al 
cultivo de maní. Los aislamientos fueron seleccionados de los grupos representativos del 
análisis fenotípico. El método utilizado fue REP­PCR.

34 
Análisis RFLP 
De  la amplificación  de la región intergénica 16S­23S rRNA de los  29 aislamientos, se  obtuvieron 
dos  grupos  que  se  diferenciaron  por  el  tamaño  del  producto  PCR.  Los  tamaños  fueron  de  950  y 
1200   (Cuadro 8.2) 12 aislamientos no amplificaron y no se prosiguió con su análisis 

Figur a 8.2. Perfiles de la región intergénica 16S­23S RNAr de 29 aislamientos de  “Bradyrhizobium”. 

Cuadr o 8.2. Grupos diferenciados por el tamaño de pares de bases obtenidos del producto 
PCR de la región intergénica 16S­23S rRNA. 

No.  CEPA  Origen  Tamaño de banda (bp) 


1  ECUM­L102  Loja  950 
2  ECUM­P5  Portoviejo  1200 
3  ECUM­P2­3  Portoviejo  1200 
4  ECUM­P20­1  Portoviejo  950 
5  ECUM­L27  Loja  1200 
6  ECUM­L124  Loja  950 
7  ECUM­P13­4  Portoviejo  950 
8  ECUM­P12  Portoviejo  950 
9  ECUM­L23  Loja  1200 
10  ECUM­L51  Loja  950 
11  ECUM­L83  Loja  950 
12  ECUM­L91  Loja  950 
13  UMR 6011  U. de Minnesota  950 
14  CIAT 3550  Colombia  950 
15  CIAT 5013  Colombia  950 
16  CIAT 14  Colombia  950 
17  ECUM­L105  Loja  950

35 
El producto de la amplificación de los 17 aislamientos fue sometido al análisis RFLP con enzimas 
de restricción. A cada perfil resultante de la incubación con una endonucleasa se le asignó una letra 
distintiva (cuadros 8.3 y 8.4), y a partir de esa matriz se compararon los distintos aislamientos. Se 
obtuvieron 10 grupos  (cuadro 8.5), algunos de los cuales tuvieron mayor representación que otros; 
así  por  ejemplo  el  grupo  1  comprendió  a  los  aislamientos  1,  10  y  17  mientras  que  el  grupo  10 
comprendió cinco aislamientos: 6,11,14,15,16. 

El análisis desde el punto de vista de los sitios de aislamiento indica que el grupo 1 tiene una buena 
representación en la colección de aislamientos de Loja ya que tres aislamientos comparten el grupo 
1. Asimismo, el grupo 10 con dos aislamientos aparece como abundante en Loja.  Examinando los 
asilamientos  de  Portoviejo,  se  observa  que  el  grupo  6  tiene  una  mayor  representación  en  la 
colección de aislamientos analizada. 

Cuadr o 8.3. RFLP de la región intergénica 16S­23S RNAr del producto de la amplificación de 17 
aislamientos de Bradyrhizobium,  asociados al cultivo de maní. 

No.  CEPA  Alu I  Hae  Taq I  Msp I  Rsa 1 


III 
1  ECUM­L102  A  A  A  A  A 
2  ECUM­P5  B  B  A  B  B 
3  ECUM­P2­3  C  C  B  C  B 
4  ECUM­P20­1  D  A  B  D  C 
5  ECUM­L27  B  D  C  E  D 
6  ECUM­L124  D  E  D  D  C 
7  ECUM­P13­4  D  F  ­  F  ­ 
8  ECUM­P12  D  F  E  G  C 
9  ECUM­L23  E  D  E  H  E 
10  ECUM­L51  A  A  E  A  A 
11  ECUM­L83  D  E  E  G  C 
12  ECUM­L91  D  G  F  D  F 
13  UMR 6011  D  A  D  I  G 
14  CIAT3550  D  F  D  D  C 
15  CIAT5013  D  E  D  ­  H 
16  CIAT14  D  E  D  D  H 
17  ECUM­L105  E  A  D  A  A

36 
Cuadr o 8.4. Matriz obtenida a partir de perfiles de la incubación con endonucleasas de 17 
aislamientos de “Bradyrhizobium” asociados al cultivo de maní. 

Enzimas de Restricción 
Alu I  Hae III  Taq I  Msp I  Rsa 1 
A = 1­10­17  A = 1­4­10­13­17  A = 1­2  A = 1­10­17  A = 1­10­17 
B = 2­5  B = 2  B = 3­4  B = 2  B = 2­3 
C = 6  C = 3  C = 5  C = 3  C = 4­6­8­11­14 
D = 4­6­7­8­11­12­  D = 5­9  D = 6­13­14­15­16­  D = 4­6­12­14­16  D = 5 
13­14­15­16  17 
E = 9  E = 6­11­15­16  E = 8­9­10­11  E = 5  E = 9 
F = 7­8­14  F = 12  F = 7  F = 12 
G = 12  G = 8­11  G = 13 
H = 9  H = 15­16 
I = 13 

Cuadr o 8.5. Grupos obtenidos a partir de la incubación con endonucleasas de 17 aislamientos de 
“Bradyrhizobium” asociados al cultivo de maní. 

Gr upo  Cepas  Descr ipción 


1  1­10­17  ECUM­L102­ ECUM­L51­ ECUM­L105 
2  2  ECUM­P5 
3  3  ECUM­P2­3 
4  4  ECUM­P20­1 
5  5  ECUM­L27 
6  7­8  ECUM­P13­4­ ECUM­P12 
7  9  ECUM­L23 
8  12  ECUM­L91 
9  13  UMR 6011 
10  6­11­14­15­16  ECUM­L124­ ECUM­L83­CIAT 3550­ CIAT 5013­ 
CIAT 14 

Los  resultados  del  análisis  genético  de los  aislamientos  de  “Bradyrhizobium” asociados  al  cultivo 
de  maní,  y  colectados  en  las  Provincias  de  Manabí  y  Loja,  muestran  que  la  población  del 
microsimbionte    es  muy  heterogénea  dentro  de  2  grupos  de  bacterias  de  crecimiento  lento  y 
crecimiento rápido. La heterogeneidad se encuentra a nivel de sitio de aislamiento, observando que 
las situaciones de similitud se encuentran entre aislamientos provenientes de sitios geográficamente 
distanciados entre sí. 

Actividad 1b. Almacenamiento de las cepas. 

El  banco  germoplásmico  del  microsimbionte  perteneciente  a  los  cultivos  de  fréjol,  arveja,  alfalfa, 
soya  y  maní,  se  encuentra almacenado  en  la  sección  de  Microbiología  del  DNPV,  Estación  Santa

37 
Catalina. Las cepas están almacenadas bajo liofilización  y tubos de vidrios con medio de cultivo, y 
a una temperatura de 4º C. Las cepas liofilizadas podrán ser mantenidas en ese estado por dos años, 
y las cepas en tubos de vidrio con medio de cultivo podrán ser mantenidas por cuatro meses. 

Actividad  2 a.  Estudio de la compatibilidad genética entre Rhizobium y  fréjol. 

La estimación de la diversidad genética fue mayor cuando se usaron los cultivares locales de fréjol. 
Las  figuras  8.5  y  8.6  muestran  los  perfiles  Box  A1R­PCR  de  aislamientos  de  los  suelos  de 
Cañicapac y Mater. El agrupamiento es evidente de acuerdo al hospedero usado, lo cual demuestra 
la compatibilidad genética (especificidad) entre el Rhizobium colectado en suelos ecuatorianos y sus 
respectivos hospederos locales.

38 
Fig 8.5. Dendograma Box A1R­PCR mostrando los aislamientos de fréjol (variedad local Bolon B1) 
y la variedad introducida (I) sembrados en suelo de Cañicapac C. Se incluyen las cepas 
referencias: UMR 6917, UMR1632, UMR1899, y UMR6815.

39 
Fig. 8.6 Dendograma Box A1R­PCR mostrando los aislamientos de fréjol (variedad local Machete 
MA), y la variedad introducida Imbabello (I), sembradas en suelo de Mater (M). Se incluyen 
las cepas referencia: UMR 6917, UMR 1632, UMR 1899, y UMR 6815.

40 
Actividad  2  b.  Estimación  del  potencial  fijador  de  nitrógeno  de  las  cepas  de  Rhizobium  en 
invernadero. 

La  estimación  de  la  capacidad  de  fijación  de  nitrógeno  en  invernadero,  de  las  cepas 
correspondientes a los cultivos de fréjol, arveja, alfalfa, soya y maní, se determina una vez realizado 
los análisis estadísticos de cada una de las variables analizadas (ver apéndices). 

Cuadr o  8.6. Cepas  seleccionadas  por  cada  leguminosa  con  relación  a  la  capacidad  de  fijación  de 
nitrógeno  bajo  condiciones  de  invernadero.  Las  variables  consideradas  para  la  selección  fueron: 
color de la planta, número y peso seco de nódulos  (mg/100 nódulos), peso fresco (g/planta) y peso 
seco (g/planta) de la parte aérea de la planta. 

ARVEJ A 

No.  CEPA  ORIGEN  OBSEVACIONES 


1.  ECUA­M19  Zhoray  Las cepas fueron recolectadas en las 
2.  ECUA­P1  Pindiling  Provincias de Cañar y Azuay. 
3.  ECUA­S5  Cojitambo 
4.  ECUA­I1  Ingapirca 
5.  ECUA­M39  Pindiling 
6.  ECUA­M52  Vaqueria 
7.  ECUA­M35  Pindiling 
8.  ECUA­Z1  Zhoray 
9.  ECUA­M53  Vaqueria 
10.  ECUA­V1  Verde Loma 
11.  ECUA­M38  Cojitambo 
12.  ECUA­M51  Vaqueria 
13.  ECUA­M11C  Zhoray 
14.  ECUA­P3  Pindiling 
15.  ECUA­JC1  Cojitambo 
16.  ECUA­M48  Verde Loma 
17.  ECUA­S3  Zhoray 
18.  ECUA­Z2  Zhoray

41 
MANI 

No.  CEPA  ORIGEN  OBSEVACIONES 


1.  ECUM­P5  Portoviejo  Las cepas fueron recolectadas en 
2.  ECUM­P16­1  Portoviejo  localidades de las Provincias de 
3.  ECUM­L126  Loja  Manabí y Loja 
4.  ECUM­L15  Loja 
5.  ECUM­P1  Portoviejo 
6.  UMR 3081  Universidad de Minnesota 
7.  ECUM­P10­3  Portoviejo 
8.  ECUM­L105  Loja 
9.  ECUM­P17  Portoviejo 
10.  ECUM­P6­1  Portoviejo 
11.  ECUM­P13­1  Portoviejo 
12.  ECUM­P2­3  Portoviejo 
13.  ECUM­P10­1  Portoviejo 
14.  ECUM­P13­4  Portoviejo 
15.  ECUM­P9­1  Portoviejo 
16.  ECUM­L94  Loja 
17.  ECUM­P16­3  Portoviejo 
18.  ECUM­P9­3  Portoviejo 
19.  ECUM­P7­1  Portoviejo 
20.  ECUM­L76  Loja 
21.  ECUM­L104  Loja 
22.  ECUM­L115  Loja 
23.  ECUM­P7­2  Portoviejo 
24.  ECUM­P21  Portoviejo 
25.  ECUM­P11  Portoviejo 
26.  UMR 6011  Universidad de Minnesota 
27.  ECUM­P3  Portoviejo 
28.  ECUM­L74  Loja 
29.  ECUM­P22­2  Portoviejo 
30.  ECUM­P2­1  Portoviejo 
31.  ECUM­L81  Loja 
32.  ECUM­L52  Loja 
33.  ECUM­L112  Loja 
34.  ECUM­P13­3  Portoviejo 
35.  ECUM­P8­6  Portoviejo 
36.  ECUM­L63  Loja 
37.  ECUM­L45  Loja 
38.  UMR 3080  Universidad de Minnesota 
39.  ECUM­L36  Loja 
40.  ECUM­P15­1  Portoviejo 
41.  ECUM­L102  Loja 
42.  UMR 3079  Universidad de Minnesota

42 
SOYA 

No.  CEPA  0RIGEN  OBSERVACIONES 


1.  CIAT 51  Colombia 
2.  6001  Universidad de Minnesota 
3.  ECUS­005  Quevedo  Provincia de Los Ríos 
4.  ECUS­10S3  Quevedo 
5.  TAL 571  Niftal 
6.  ECUS1­SJ  Quevedo 
7.  ECUS­P1  Quevedo 
8.  ECUS­001  Quevedo 

FREJ OL 
Las cepas para fréjol fueron probadas directamente en campo ya que los estudios de invernadero se 
realizaron en la investigación de Bernal y Graham (2001). 

ALFALFA 
Las cepas fueron probadas directamente en campo. El estudio de selección en invernadero se realizó 
en 1984 como parte de un estudio colaborativo entre el INIAP y la Facultad de Ciencias Agrícolas. 
Los ensayos de campo se realizaron con la colaboración del Cuerpo de Paz. 

Actividad 2 c.  Estimación del potencial fijador de nitrógeno bajo condiciones de campo 

Cuadr o  8.7.  Cepas seleccionadas por cada leguminosa con relación a la capacidad de fijación de 


nitrógeno,  bajo  condiciones  de  campo.  Las  variables  consideradas  para  la  evaluación  fueron: 
número y peso seco de nódulos (mg/100 nódulos), peso fresco (g/planta) y peso seco (g/planta) de 
la parte aérea de la planta, y porcentaje de nitrógeno. 

ARVEJ A 

No.  CEPA  ORIGEN  OBSERVACIONES 


1.  ECUA­ I1  Ingapirca  Aislamientos  del  banco  base  del  Dr.  Venancio  Arana 
(Universidad  Central  del  Ecuador­Facultad  de  Ciencias 
Agrícolas). 
2.  ECUA­Z2  Zhoray 
3.  ECUA­ P3  Pindiling 
4.  ECUA­M53  Vaqueria 
5.  ECUA­M35  Pindiling 
6.  ECUA­Z1  Zhoray 
7.  *CL 05  U. Central  Utilizada como control. 
8.  *CL 14  U. Central  Control 
9.  *CL 09  U. Central  Control 
10.  *CA 34L  U. Central  Control

43 
MANI 

No.  CEPA  ORIGEN  OBSERVACIONES 


1.  ECUM­L45  Loja 
2.  ECUM­L81  Loja 
3.  ECUM­P8­6  Portoviejo 
4.  ECUM­L102  Loja 

SOYA 

No.  CEPA  ORIGEN  OBSERVACIONES 


1.  CIAT 51  Colombia 
2.  6001  U. de Minnesota 
3.  ECUS­001  Quevedo 
4.  ECUS1­SJ  Quevedo 

FREJ OL 

No.  CEPA 
ORIGEN  OBSERVACIONES 
1.  UMR 1478  U. de Minnesota 
2.  UMR 1481  U. de Minnesota 
3.  UMR  1899  U. de Minnesota 

ALFALFA 

No.  CEPA  ORIGEN  OBSERVACIONES 


1.  6008  U. de Minnesota  Las pruebas se realizaron en la provincia de 
2.  TAL 380  Niftal  Chimborazo con la colaboración del Cuerpo de Paz. 

Actividad 2 d.  Estudio de la competitividad de cepas asociadas al cultivo de fréjol. 

Análisis antigénico de las cepas de Rhizobium etli (UMR 1478 y 1481) y de la cepa de Rhizobium 
tropici (1899) mediante inmunodifusión. 

Deter minación del título de aglutinación. 

La determinación del título de aglutinación se  muestra en  el cuadro 8.8. Se observa que todos  los 


sueros  de las cepas muestran valores  elevados  en cuanto al título de aglutinación. Estos resultados 
indican  que  los  sueros  obtenidos  pueden  ser  utilizados  para  realizar  las  reacciones  de 
inmunodifusión.

44 
Cuadr o 8.8.  Titulación 

CEPA  DILUCION 
1:25  1:50  1:100  1:200  1:400  1:800  1:1600  1:3200  1:6400  1:12800  25600 
UMR1899(a)  +++  +++  +++  +++  ++  ++  ++  +  +  +  + 
UMR1899(b)  +++  +++  +++  +++  +++  ++  +  +  +  +  + 
UMR1481(a)  +++  +++  +++  ++  ++  ++  ++  +  +  +  ­ 
UMR1481(b)  +++  +++  +++  +++  ++  ++  +  +  +  +  ­ 
UMR1478(a)  +++  +++  +++  +++  ++  ++  ++  +  +  +  + 
UMR1478(b)  +++  +++  +++  +++  +++  +++  ++  +  +  ­  ­ 

Pr ueba de r eacción cr uzada. 

Esta prueba fue utilizada para verificar la existencia de reacción cruzada entre cepas. Se utilizó la 
misma técnica utilizada en  la titulación. Los  sueros  pertenecientes  a cada una de las  cepas  fueron 
probados  contra antígenos  de  las  otras  cepas. Se observó que  la cepa de Rhizobium tropici (UMR 
1899) reaccionó con todos  los  sueros  utilizados,  mientras  que  las  cepas  de Rhizobium etli  (UMR 
1478 y 1481) reaccionaron únicamente con sus correspondientes sueros. 

Cuadr o 8.9. Número Más Probable (NMP) de Rhizobium en el suelo. 

Suelo de Pifo 
Dilución  R1  R2  R3  R4 
10 2  +  +  +  +  4 

10  +  +  +  ­  3 
10 4  +  ­  ­  ­  1 

10  ­  ­  ­  +  1 
10 6  ­  ­  ­  +  1 

10  ­  ­  ­  ­  0 

10  ­  ­  ­  ­  0 
Testigo  ­  ­  ­  ­  0 
Total  10 

Según la tabla de número más probable (NMP), y considerando 6 diluciones (S=6), los números de 
rizobios/ml de la dilución 10 2  son de 5.8 x 10 1 . De acuerdo con la fórmula: NMP=  m x d / v x n

45 
Donde:  m= número más probable (por ml) en la primera dilución 
d= dilución de la primera dilución considerada 
v= volumen inoculado (1ml); 
n= volumen o peso del suelo 

Por lo tanto, para el suelo de esta parcela en Pifo, el promedio y desviación estándar son iguales a 
5.8 x 10 2  células de Rhizobium por gramo de suelo. El bajo contenido de células de Rhizobium en la 
parcela utilizada indica que el suelo es apropiado para realizar estudios de competitividad. 

Evaluación de las r elaciones de competitividad entr e cepas.­ 

Esta  etapa  de  la  investigación  se  encuentra  en  proceso  de  evaluación.  Los  nódulos  colectados  de 
cada tratamiento fueron sembrados y purificados en levadura manitol agar (LMA) y posteriormente 
serán  sometidos  al  análisis  de  inmunodifusión.  Este  proceso  utiliza  las  cepas  UMR  1478 
(Rhizobium etli), UMR 1481 (R. etli), y la UMR 1899 (R. tropici). 

Actividad 3 a.  Recolección de los soportes 

Siete soportes recolectados y procesados se encuentran almacenados en la bodega del Departamento 
de Protección Vegetal, Estación Santa Catalina del INIAP. 

Actividad 3 b.   Análisis físico y químico de los soportes. 

La  mayoría  de  soportes  utilizados  contuvieron  un  alto  porcentaje  de  materia  orgánica,  con 
excepción de la zeolita que es netamente mineral. El pH de cada material varió de ligeramente ácido 
a alcalino, lo que determinó la cantidad y el neutralizante  a utilizar (Cuadro 8.10).

46 
Cuadr o 8.10.  Análisis  de los materiales utilizados en la preparación de soportes para inoculantes. 
Cutuglagua ­ Pichincha 2003. 

Análisis  C. Rosa  Ceniza  Zeolita  T. Chimb  T. LLoa  Compost  T. Alaska 


pH  4.2 Ac  8.8Al  5.1Ac  5.5LAc  6.3LAc  7.7 LAl  6.5LAc 

NH 4(ppm)  69.00 A  44.00M  72.00A  166.00A  172.00A  90.00A  42.00M 

P (ppm)  63.00 A  183.00A  10.00M  36.00A  14.00M  160.00A  5.00B 

K(meq/100ml)  0.14B  0.88A  0.20M  0.41ª  0.62A  3.60A  0.77A 

M.O. %   16.80 A  19.80A  0.60  11.20ª  9.40A  9.90A  44.10A 

Bases(meq/100ml)  22.89  24.50  15.11  18.94  18.22  27.90  14.47 

C/N  **  29.93  3.53  19.75  11.84  11.30  ** 

Inter pr etación 
pH  Elementos 
Ac = Ácido                                           N=  Neutro  B = Bajo 
Lac = Liger. Ácido  LAl = Lige. Alcalino  M = Medio 
PN = Prácticamente neutro                    Al = Alcalino  A = Alto 
** No se realizó el análisis. 

Análisis biológico de las tur bas. 
El  análisis  biológico  de  las  turbas  no  mostró  diferencias  significativas  con  relación  a  poblaciones 
microbianas.  Como  promedio  las  turbas  presentaron  poblaciones  de  1  x  10 4  bacterias  /g,   1  x  10 5 
actinomicetes/g, y 2 x10 3  hongos/g de turba. Es necesario indicar la presencia de mayor número de 
actinomicetes  y  la  presencia  de  hongos  benéficos  como  es  el  caso  de  Trichoderma .  Esto  permite 
sugerir el uso de las turbas como inoculante microbiano en la preparación de compost. Dentro del 
grupo de los actinomicetes, bacterias y hongos  del suelo se encuentran especies solobilizadores de 
fósforo  y  también  especies  antagónicas  a  patógenos  del  suelo,  que  podrían  mejorar  la  calidad  y 
eficiencia de un compost. 
Actividad 3 c.  Interacción rizobio­portador. 

Númer o de r izobios en cada sopor te. 

Los  inoculantes  preparados  con  la  turba  proveniente  de  la  Provincia  del  Chimborazo  dieron  un 
promedio de 7.50x10 8  ufc/g de inoculante a los 120 días (cuadro 8.11). La turba de Alaska 3.41x10 8 
ufc/g  de  inoculante.  El  soporte  a  base  de  ceniza    1.77x10 8  ufc/g  de  inoculante  fueron  los  que

47 
presentaron  mayor  supervivencia  después  de  120  días  de  almacenamiento  a  4ºC.  El  compost 
presentó  una  concentración  de  1.10x10 8  ufc/g.  Los  sustratos  que  no  cumplieron  con  la 
concentración estándar exigida (1x10 8 ) fueron: la capa rosa, zeolita, la turba de Lloa, y el soporte a 
base de vaina de fréjol con materia orgánica. 

Evaluación de mater iales alter nativos como sopor te de la bacter ia, hasta los 120 días. 

Cuadr o  8.11.  Datos  reales  para  unidades  formadoras  de  colonias  por  gramo  de  inoculante  en  la 
evaluación de sustratos como alternativas para portadores. 

SUSTRATOS (S)  8 días  15 días  30 días  60 días  90 días  120 días 


ufc/g ino  ufc/g ino  Ufc/g ino  Ufc/g ino  ufc/g ino  ufc/g ino 
8  8  8  8  8 
1. Capa rosa  1.43x10  bc  1.05x10  abc  1.97x10  bc  1.21x10  abc  1.20x10  bc  5.43x10 7  cd 
2. Ceniza  6.06x10 8 ab  2.60x10 8 abc  6.92x10 8 ab  3.63x10 8 ab  2.70x10 8 ab  1.77x10 8 abc 
3. Zeolita  3.41x10 8 ab  2.02x10 8 abc  1.03x10 8  c  7.03x10 7  bc  8.97x10 7  bc  4.01x10 7  cd 
4. T Chimborazo  1.63x10 9 a  1.16x10 9 a  1.94x10 9 a  1.09x10 9 a  1.10x10 9 a  7.50x10 8 a 
5. T.  Lloa  4.01x10 6  d  3.39x10 7  c  6.84x10 7  c  2.57x10 7  c  2.34x10 7  c  1.06x10 7  d 
6. Compost  4.79x10 8 ab  1.14x10 9 a  5.58x10 8 ab  2.38x10 8 abc  2.24x10 8 ab  1.00x10 8  bc 
7. Turba alaska  1.41x10 8  bc  4.44x10 8 ab  2.44x10 8  bc  8.28x10 8 ab  6.34x10 8 ab  3.41x10 8 ab 
8. Vaina de fréjol  6.35x10 7  c  3.98x10 7  bc  3.72x10 6  d  1.33x10 6  d  0.00            d  0.00              e 

10 

8  s1 Capa rosa 
Log (x+1) ufc/g ino 

7  s2 Ceniza 
s3 Zeolita 

s4 T. Chimborazo 
5  s5 T. Lloa 
4  Compost 
s7 Turba alaska 

s8 Vaina de fréjol 



0  50  100  150 
Días 

Figur a 8.7. Log ufc/ g de inoculante para 8, 15, 30, 60, 90, 120  en el experimento evaluación de 
sustratos como alternativa de portadores.

48 
Actividad 4 a. Evaluación de la esterilización de los portadores. 

Este estudio no se realizó dentro del plazo establecido del proyecto, por falta de tiempo, pero podría 
llevarse a cabo en un período de ampliación del proyecto. Para esto se ha buscado la colaboración 
de  la  Comisión  Ecuatoriana  de  Energía  Atómica,  quines  disponen  de  una  fuente  radioactiva  la 
misma que servirá como herramienta en la metodología de esterilización de los portadores. El otro 
método  constituye  la  esterilización  al  vapor  utilizando  un  autoclave  del  laboratorio  del 
Departamento de Protección Vegetal. 

Se  compararán  los  dos  métodos  de  esterilización  conociéndose  cual  de  ellos  es  el  mejor  en  el 
mantenimiento  de  la  viabilidad  de  la  bacteria  Rhizobium,  el  mismo  que  será  utilizado  para  la 
preparación de los inoculantes en la leguminosas en estudio. 

Actividad 5.1  Difusión de los resultados y el uso de los productos generados por el proyecto. 

En  el  caso  de  arveja  y  alfalfa,  las  actividades  han  sido  constantemente  transmitidas  a  los 
agricultores  de  la  comunidad,  a  través  de  la  radio  “AS  la  radio”  en  Chaupiloma­Tabacundo 
(Pichincha), y  a través de la radio Ingapirca en la comunidad de Virgen de la Nube (Cañar).   Estas 
actividades  están  siendo  conducidas  con  la  colaboración  directa  de  la  Fundación  GAIA,  la  cual 
participa también como colaboradora del Proyecto Comminandes (anexo 2). 

Las actividades de difusión incluyen a) información general del proyecto, b) información acerca de 
la importancia de los inoculantes de Rhizobium y del compost como bio­fertilizantes y mejoradores 
del suelo, y c) entrevistas con expertos en agricultura. 

Se  ha  iniciado  un  programa  de  radio  denominado  “Pakarina  de  Los  Andes”  perteneciente  a  la 
emisora  “AS  la  Radio”  de  Tabacundo,  el  mismo  que  es  producido  y  dirigido  por  gente  de  la 
localidad.  El  programa  enfatiza  en  temas  relacionados  con  la  importancia  de  las  leguminosas,  los 
inoculantes, y el uso del compost, manejo del suelo, y agricultura orgánica. Complementariamente 
se  incluyen  aspectos  relacionados  con  la  revalorización  de  las  prácticas  de  agricultura  ancestral 
como el uso de leguminosas, la elaboración del compost y aplicaciones.  Como evidencia de estos 
eventos radiales, se guardan las grabaciones de los temas presentados semanalmente, especialmente 
en  la  radio  “AS  la  radio”  de  Tabacundo.  Además  las  actividades  de  ambos  proyectos  han  sido

49 
cubiertas  por  los  diarios  “Heraldo”  y  “El  Tiempo”  en  Cañar,  y  “El  Chasqui”  de  Chaupiloma 
(Tabacundo). 

Actividad  6.1. Institucionalización de un sistema de control de calidad del inoculante. 

El  Departamento  de  Protección  Vegetal  de  la  Estación  Santa  Catalina  (INIAP),  cuenta  con  una 
sección  de  Microbiología  de  Suelos,  para  la  producción  de  inoculantes  de  fréjol,  arveja,  alfalfa, 
soya,  y  maní.  Se  tiene  un  sistema  de  control  de  calidad  basado  en  la  elaboración  de  antisueros 
(fréjol),  crecimiento  de  la  bacteria  en  apropiados  medios  de  cultivo,  viabilidad  del  producto 
(número  de  células/gramo  de  inoculante),  y  empaquetamiento  del  producto  debidamente 
identificado  con  fecha  de  expiración,  recomendaciones,  tipo  de  Rhizobium,  y  su  correspondiente 
leguminosa. 

9. DISCUSIÓN DE RESULTADOS. 

Con relación a la caracterización de las cepas, esta se realizó solo con los aislamientos asociados al 
fréjol  y al  maní tal como se  explica en  los  métodos. Los  resultados  obtenidos  en fréjol   muestran 
que los aislamientos de bacterias aisladas en el Ecuador, presentan una gran diversidad genética. La 
investigación  ha  mostrado  que  (i)  las  cepas  de  R.  etli  del  Ecuador  asociadas  al  cultivo  de  fréjol, 
muestran separación fenotípica y genotípica del Rhizobium asociado con el fréjol de Mesoamérica, 
con algunas subdivisiones. 

En  el  caso  de  los  aislamientos  asociados  al  cultivo  de  maní,  se  observó    a  través  de  la 
caracterización  fenotípica  tres  grupos  de  aislamientos,  algunos  de  los  cuales  presentan 
características  fenotípicas  similares  a  cepas  del  género Rhizobium.    Los  resultados  de  las  pruebas 
genéticas  muestran gran heterogeneidad  en base a los  estudios  de ERIC­PCR, REP­PCR, y RFLP 
de  la  región  intergénica  16S­23S  rRNA.  Se  recomienda  realizar  estudios  moleculares 
complementarios  (ej.  Gene  16S  rRNA,  hibridación  del  ADN),  para  poder  confirmar  la  posición 
taxonómica  de  estos  aislamientos  asociados  al  cultivo  de  maní.  Al  respecto  Taurian  et. al  (2002), 
indican  que  el  cultivo  de  maní  es  asociado  con  cepas  pertenecientes  tanto  al  género  Rhizobium 
como al género Bradyrhizobium. 
Los resultados obtenidos con los aislamientos asociados al fréjol, muestran que el uso de cultivares 
locales  o  introducidos  en  el  caso  del  fréjol,  puede  influenciar  la  diversidad  genética  de  las  cepas 
aisladas, esto también podría darse en el caso del maní.

50 
La coevo lución del hospedero y su microsimbionte podría ser un factor de las diferencias reportado 
en este estudio entre el Rhizobium del Ecuador y de Mesoamérica. La separación de P. vulgaris en 
estos  dos  centros  de  origen  data  a  5000  años  (Kaplan  1965),  con  una  incompatibilidad  genética 
ahora evidente entre representativos de ambos acervos genéticos (Singh y Gutiérrez, 1984 y Gepts 
and  Bliss,  1985).  Por  lo  tanto,  es  muy  probable  que  un  aislamiento  a  largo  plazo  de  hospederos 
específicos y su Rhizobium en cada centro de origen debiera conducir a cierto nivel de especificidad 
en  sus  asociaciones.  Esto  podría  darse  también  en  el  caso  de  maní,  por  lo  que  se  sugiere  mayor 
estudio en la asociación del maní con su microsimbionte. Bernal (1993) reportó ya diferencias en la 
velocidad de la nodulación de cultivares, por parte del Rhizobium perteneciente a los dos diferentes 
acervos genéticos en el caso de fréjol. El mismo autor en 1993 evaluó la velocidad de nodulación de 
cepas  de  Ecuador  en  variedades  representativas,  encontrando  que  los  cultivares  Mesoamericanos 
Durango y Puebla 152 eran significativamente más lentos para nodular con las cepas Ecuatorianas. 
Entre  los  factores  que  pueden  contribuir  a  la  heterogeneidad  y  a  las  diferencias  en  la  respuesta 
simbiótica  entre  las  cepas  de  fréjol  del  Ecuador,  está  la  dependencia  local  sobre  los  “landraces”, 
incluyendo cultivares volubles  en lugar de variedades  mejoradas, la práctica en el sur del Ecuador 
de  sembrar  y  mantener  mezclas  varietales,  y  la  topografía  irregular  y  aislamiento  de  los  valles 
Interandinos donde el fréjol es un cultivo de subsistencia. Estudios adicionales se requieren tanto en 
la  bacteria  asociada  a  fréjol  como  a  la  de  maní,  para  definir  de  mejor  manera  la  extensión  e 
importancia de la especificidad y la coevolución en esta simbiosis. 

Las  diferencias  en  el Rhizobium  asociado  a  cultivares  representativos  de  los  diferentes  centros  de 
origen de un cultivo, podría tener implicaciones  en el campo. Tanto Chaverra y Graham (1992), y 
Bernal (1993) reportaron especificidad entre cultivares de fréjol y su microsimbionte, lo cual podría 
también existir en maní. Esto permite afirmar de la necesidad de elaborar inoculantes de Rhizobium 
con cepas nativas de la región donde la leguminosa requiere de inoculación. 

Con relación a las  cepas  seleccionadas  (ver productos), el proyecto contribuye a la producción  de 


las  leguminosas,  con  la  presencia  de  cepas  de  buena  respuesta  a  la  inoculación  en  fréjol,  arveja, 
alfalfa,  soya  y  maní,  en  base  a  los  parámetros  analizados  como  peso  seco  de  la  parte  aérea,  peso 
seco  de  nódulos,  porcentaje  de  nitrógeno,  y  rendimiento.  Así  por  ejemplo  en  fréjol,    las  cepas  de 
Rhizobium etli, especialmente la cepa UMR 1478 se destacó en el rendimiento de grano fresco, peso 
seco y peso seco de nódulos. En este caso de fréjol, los resultados obtenidos se corroboran con los 
estudios realizados por  (Bernal y Graham, 2001, Graham P.H. 1999) quienes usaron la prueba de la 
velocidad de nodulación, la misma que mostró que las cepas ecuatorianas UMR 1478, 1481, 1468

51 
son eficientes en nodular al hospedero, y a nivel de invernadero mostraron ser buenos fijadores  de 
nitrógeno. 

Con  respecto  a  las  variables  analizadas,  la  que    tuvo  mayor  influencia  en  la  determinación  de  la 
eficiencia de fijación de nitrógeno fue el peso seco. Al respecto Castellanos y Peña­Cabrales  (1989) 
afirman, que el peso seco explica de buena manera la eficiencia de fijación biológica, en donde, la 
producción de materia seca es de primordial importancia y la producción de semilla es secundaria. 
Sin embargo, en fréjol por ejemplo, en donde el producto utilizado es  el grano o la vaina verde, el 
efecto  de  la  nodulación  debe  ser  observado  preferiblemente  llevando  a  las  plantas  hasta  la 
fructificación  completa,  siendo  el  rendimiento,  la  variable  más  razonable  para  predecir  el 
comportamiento simbiótico. La ventaja de haber usado la variable rendimiento es, que esta es  una 
variable de rutina en todos los ensayos de las leguminosas. Con relación al porcentaje de nitrógeno, 
la extracción de nitrógeno puede ser secundaria en la determinación de la eficiencia de fijación de 
nitrógeno. 

Al  momento  el  Departamento  de  Protección  Vegetal  dispone  de  cepas  altamente  fijadoras  de 
nitrógeno,  probadas  a  nivel  de  campo,  y  de  un  sistema  de  control  de  calidad  del  inoculante.  Para 
esto  se  han  seguido  las  metodologías  sugeridas  por  Controux  (1991).  Para  el  proceso  de 
inoculacion, al momento se cuenta con medios de divulgación como trípticos, los cuales explican el 
proceso de inoculación y siembra de leguminosas que debe seguir el agricultor (Bernal et al. 2002). 

En el estudio de sustratos,  se comprobó que la turba proveniente de la Provincia del Chimborazo 
mantiene  una  sobrevivencia  adecuada  de  la  bacteria,  como  por  ejemplo  las  cepas  de  fréjol 
pertenecientes a la especie Rhizobium etli: UMR 1478 la misma que tuvo una sobrevivencia por 120 
días. Si bien  el valor de pH de algunos  portadores  utilizados  en  el proyecto no  es  el más  indicado 
para  la  supervivencia  del  Rhizobium,  el  agregado  de  CaCO3  (5­15%)  permitió  obtener  un  pH 
adecuado (6.5­7.0 ) para la viabilidad de las bacterias. De los tres materiales mencionados, la turba 
de la Provincia de Chimborazo (Fig. 7.7) presentó las mejores características para mantener viable a 
la  bacteria  UMR  1478.  Esto  se  corrobora  con  los  trabajos  realizados  por  Cevallos  y  Rodríguez 
(2003), quienes  experimentaron con bacterias  gram – y  gram + excepto Rhizobium, determinando 
que para las primeras el material de la Provincia de Chimborazo presentó las mejores condiciones. 
Estos  resultados  permiten  señalar  a  la  turba  de  Chimborazo  como  potencial  portador  en  la 
producción de inoculantes.

52 
El  sustrato  a  base  de  ceniza    aparece  también  como  un  sustrato  con  mayor  concentración  de 
unidades formadoras por gramo de inoculante.  Respecto al uso de  ceniza como portador  Sparrow 
y  Ham  (1981),  en  sus  trabajos  con  Rhizobium  phaseoli,  determinaron  que  éste  material,    fue 
exitosamente usado como soporte. 

La zeolita (mineral aluminosilicato hidratado), pese a su naturaleza, ofreció una buena sobrevivencia 
en  los  tres  primeros  registros  debido a su  capacidad  de retención de agua, y a la disponibilidad  de 
ciertos  nutrientes.  Al  respecto,  los  estudios  realizados  por  Graham­Weiss  et  al.  (1987)  con 
vermiculita  (silicatos  de  hierro  aluminio  y  magnesio  hidratados),  determinaron,  que  sustratos  con 
estas  características  deben  ser suplementados  con  materia orgánica  para mantener sus cualidades 
por un período más largo. 

El sustrato preparado especialmente con restos de vainas de fréjol no fue funcional, se debió en gran 
medida  a  los  tiempos  de  esterilización,  puesto  que,  los  ensayos  realizados  con  respecto  a  este 
parámetro, han utilizado primordialmente turbas. Los tiempos obtenidos en estos experimentos han 
sido aproximados a otros materiales alternativos, no siendo siempre los más adecuados. 

10. SITUACION INICIAL Y ACTUAL DEL GRUPO META. 

El  conocimiento  del  grupo  meta  sobre  el  uso  de  los  inoculantes  de Rhizobium  en  leguminosa  era 
limitado.  Podría  mencionarse  que  pocos  agricultores  de  la  Sierra  y  Costa  conocían  la  presencia  y 
uso de los inoculantes. No existía información de las prácticas de inoculación. El grupo meta tiene 
actualmente conocimiento de la presencia de inoculantes elaborados a base de Rhizobium.  Algunos 
agricultores  de  la  Sierra  dedicados  a  producir  fréjol,  alfalfa,  arveja  en  la  Provincia  del  Cañar  y 
Chimborazo,  y  los  agricultores  que  cultivan  soya  en  la  Provincia  de  Los  Ríos  y  maní  en  las 
Provincias  de  Loja  y  Manabí,  conocen  los  principales  pasos  a  seguir  para  la  inoculación  de  las 
cepas  de Rhizobium en la semilla. Conocen  de ciertas cepas  competitivas  y fijadoras  de nitrógeno 
que  fácilmente  pueden  ser  conseguidas  en  el  INIAP  y  usadas  en  los  respectivos  cultivos  y 
difundidas a otros agricultores de cada región. 

11. ESTIMACION DE EFECTOS E IMPACTOS. 

Efectos tecnológicos 
Sin duda la tecnología generada por el proyecto viene a constituir un componente importante dentro

53 
del nuevo enfoque de la agricultura limpia u orgánica. Esta alternativa de fertilización biológica es 
clave dentro de los sistemas de manejo de suelos para su recuperación y aumento de la fertilidad. 

Esta  tecnología  conjuntamente  con  el  uso  del  compost  combinado  con  otros  microorganismos  del 
suelo  (micorrizas,  y  bacterias  promotoras  de  crecimiento  vegetal)  vendrían  a  complementarse 
dentro  de  las  prácticas  de  fertilización  de  las  leguminosas,  las  mismas  que  son  muy  importantes 
como cultivos de rotación en los diferentes sistemas agrícolas. 

Además la tecnología generada contribuye considerablemente con la protección del medio ambiente 
al reducir el uso de los agroquímicos, y por lo tanto contribuye con el equilibrio del ecosistema. 

Efectos Económicos 

En la mayoría de suelos en los que realiza agricultura en el Ecuador se puede apreciar una creciente 
disminución de su fertilidad. Esta situación pone de manifiesto un deterioro permanente del suelo, 
con  consecuencias  nefastas  si  no  se  incorporan  inmediatamente  alternativas  que  controlen  este 
problema.  Esto  se  agravaría  con  la  reducción  de  los  ingresos  de  los  productores,  y  escasas 
superficies  apropiadas  para  la  agricultura  originando  un  problema  económico.  Esto  trae  como 
consecuencia  un  aumento  progresivo  en  el  uso  de  fertilizantes,  lo  cual  incrementa  los  costos  por 
unidad  producida.  La  utilización  de  inoculantes  en  las  leguminosas  dentro  de  los  sistemas  de 
producción  agrícola,  logra  una  mayor  disponibilidad  de  nutrientes  que  permiten  un  rendimiento 
sostenibles de los cultivos, y una mayor tasa de retorno, ya que disminuye el costo de ciertos rubros 
principalmente fertilizantes, mano de obra y transporte. 

La  utilización  de  inoculantes  es  una  alternativa  de  bajo  costo  y  de  fácil  manejo  que  permite  dar 
respuesta a uno de los graves problemas de la agricultura ecuatoriana, como es el déficit nutricional 
de nitrógeno en los suelos. Si se compara el precio (US $ 60) de cuatro sacos de fertilizante químico 
18­460 más dos sacos de urea (US $ 22) usados en fréjol, versus el precio de US $ 5 de un paquete 
de  200  g  del  inoculante  generado  por  el  proyecto  (  dosis:  5g/0.5  kg  de  semilla)  más  el  costo  de 
fertilizante químico (20 kg N/ha, dosis baja recomendada a la siembra), la reducción del  fertilizante 
nitrogenado  sería  significativa,  y  más  rentable  si  la  incorporación  del  inoculante  se  la  realiza  en 
semilla de calidad (Mendoza, 2003). 

Otro ejemplo del  beneficio económico de la fijación biológica de nitrógeno,  es el caso de la alfalfa

54 
en  la  región  del  medio  oeste  de  los  Estados  Unidos,  donde  también  predominan  las  fincas 
familiares.  El  uso  de  la  alfalfa  en  rotación  con  el  maíz  reduce  sustancialmente  el  empleo  de 
fertilizantes  químicos, sin causar bajas en la producción. El beneficio neto estimado oscilaba entre 
US $ 50­90 millones en toda la región (Peterson y Russelle, 1991). 

Efectos Ambientales. 

La  fijación  biológica  de  nitrógeno  (FBN)  contribuye  globalmente  con  cerca  de  la  mitad  del 
nitrógeno  utilizado  en  el  cultivo  de  las  plantas.  La  otra  mitad  procede  casi  en  su  totalidad  del 
amonio  sintetizado  vía  Haber  Bosch  con  un  gasto,  para  conseguir  el  H2  y  la  alta  temperatura  y 
presión requeridas, del 1 % de la energía consumida en el ámbito mundial. Hoy día la FBN cobra 
más  valor,    ya  que  puede  evitar  el  uso  abusivo  de  fertilizantes  nitrogenados  con  el  consiguiente 
ahorro en el consumo de energía y la disminución de la degradación del medio ambiente. 

Los  resultados  y  productos  generados  por  el  proyecto  van  dirigidos  a  la  sostenibilidad  de  la 
producción agrícola, ya que con el racional y adecuado manejo del nitrógeno, se contribuye al uso 
de  una    agricultura  de  bajos  insumos,  caracterizada    por  la    reducción  de  la  dependencia  de  los 
fertilizantes  químicos,  los  cuales  a  más  de  ser  costosos  representan  un  peligro  ambiental  como 
fuentes de contaminación y degradación principalmente de los recursos suelo y agua. 

12. PRODUCTOS DEL PROYECTO . 

11.1 Cepas (inoculantes) de la bacter ia Rhizobium par a leguminosas. 

Tres cepas para fréjol: UMR 1478, UMR 1481, y UMR1468. 
Dos cepas para maní: ECUM­L 102, ECUM­P8­6 
Tres cepas para arveja: ECUa­I1, ECUA­Z2, ECUA­P3. 

Dos cepas para alfalfa: UMR 6008, TAL 380 
Cuatro cepas para soya: CIAT 51, UMR 6001, ECUS­001, ECUS1­SJ 

11.2 Tr ípticos: 

1.  Inoculación de la semilla de leguminosas con la bacteria Rhizobium.

55 
2.  Inoculación con Rhizobium  de la semilla del cultivo de soya. 
3.  Estudio  en  campo  de  la  fijación  simbiótica  de  nitrógeno  en  dos  variedades  de  fréjol,  con 
tres cepas de Rhizobium etli. 
4.  Identificación  de  cepas  eficientes  en  fijación  biológica  de  nitrógeno  para  producción  de 
inoculante en maní. 
5.  Evaluación de sustratos como alternativa de portadores de Rhizobium. 

11.3 Publicaciones: 

1.  Diversidad del Rhizobium asociado con Phaseolus vulgaris L. en Ecuador y evaluación de 
la  capacidad  fijadora  de  nitrógeno  de  tres  cepas  en  dos  variedades.  Revista  Rumipamba. 
Facultad de Ciencias Agrícolas. Universidad Central del Ecuador. 
2.  Selección  de biotipos  prominentes  de Bradyrhizobium sp. en  el cultivo  de  maní  (Arachis 
hipogeae) en  las  provincias  de Manabí  y Loja. Revista Rumipamba. Facultad de Ciencias 
Agrícolas. Universidad Central del Ecuador. 

11.4 Días de campo 

1.  En  Chuquipata,  Provincia  del  Cañar  (arveja).  Participaron                  .  Se  realizó  el  19  de 
Noviembre del 2002. 
2.  En  la  Provincia  de  Loja  (maní).  Participaron  agricultores  de  la  Granja  el  Almendral  y 
técnicos. Se realizó el 20 de Marzo del 2003. 
3.  En Chambo, Chimborazo (alfalfa). Participaron agricultores de la zona de Chambo y 
técnicos del Cuerpo de Paz. Se realizó el 17 de Noviembre del 2002. 
4.  En Tumbaco, Pichincha (fréjol). Participaron estudiantes y docentes de la Facultad de 
Ingeniería Agronómica de la Universidad Central. Se realizó el 11 de Junio del 2002. 
5.  En Pifo, Pichincha (fréjol).  Participaron agricultores de la zona de Pifo  y estudiantes de la 
Facultad de Ingeniería Agronómica de la Universidad Central. Se realizó el 13 de 
Diciembre del 2003. 
6.  En la Granja Chaltura, Imbabura (fréjol). Participaron estudiantes de la Facultad de 
Agronomía de la Universidad Técnica del Norte. Se realizó en Febrero del 2002.

56 
11.5  Labor ator io  de  Microbiología  de  Suelos  en  el  Depar tamento  de  Pr otección    Vegetal. 
Estación Santa Catalina, INIAP. 

13. LOGROS ADICIONALES. 

Colaboración con los proyectos: a) “Fijación biológica de nitrógeno en leguminosas forrajeras de la 
Costa”  de  la  Universidad  Técnica  Estatal  de  Quevedo,  concretamente  con  el  Ing.  Gorky  Díaz.  b) 
Proyecto  COMMINANDES.  Así  por  ejemplo  el  uso  de  los  inoculantes  de  Rhizobium  (proyecto 
PROMSA) conjuntamente con el uso del compost generado por el proyecto COMMINANDES ha 
permitido que los agricultores de la comunidad Virgen de la Nube en el Cañar,  y la comunidad de 
Chaupiloma  de  la  Provincia  de  Pichincha,  hagan  uso  de  ambas  tecnologías  logrando  resultados 
satisfactorios. También comunidades de la Provincia de Chimborazo conjuntamente con miembros 
del Cuerpo de Paz llevan a cabo experimentos usando estas tecnologías (anexo 3). 

Los  resultados  y  productos  del  proyecto  permiten  usarlos  como  parte  de  un  paquete  tecnológico 
orientados hacia una agricultura ecológica, limpia u orgánica. Los resultados conjuntamente con los 
del Proyecto COMMINANDES han sido difundidos tanto en la comunidad científica Ecuatoriana e 
Internacional, concretamente en los siguientes eventos: 1) Taller: Formulación del Plan Nacional de 
Innovación  en  Agricultura  Orgánica”  realizado  en  la  Estación  Experimental  Tropical  Pichilingue 
del  INIAP  (Octubre  2003),  2)  Taller:  Marco  conceptual  y  Normativa  de  la  Agricultura  Orgánica, 
realizado en la Estación Experimental Pichilingue del INIAP (Octubre 2003), 3) Primer Encuentro

57 
Mesoamericano y  del Caribe y Tercer Encuentro Nacional  de Investigadores, Experimentadores  y 
Técnicos en Agricultura Orgánica, realizado en la Escuela Centroamericana de Ganadería, Atenas, 
Costa Rica (Agosto 2003). 

La  interacción  directa  con  Centros  de  Investigación  Internacional,  así  como  por  ejemplo  con  la 
Universidad de Minnesota (Estados  Unidos) y con la Universidad de la Plata (Argentina). En este 
ultimo caso,  gracias a la colaboración del Dr. Mario Aguilar del Laboratorio de Biotecnología de la 
U. de  la Plata, este laboratorio permitió  la  capacitación del Egresado Mauricio Jerez  en técnicas 
moleculares y concretamente con la caracterización genética de cepas de Bradyrhizobium asociadas 
al cultivo de maní. 

La  capacitación  de  los  Ings.  Diego  Campaña  y  Aracely  Jaramillo  (colaboradora  del  proyecto 
Comminandes),  y  del  Egdo.  Mauricio  Jerez  en  los  cursos:  1)  Curso  teórico  práctico  de 
Microbiología Ambiental, organizado por la Universidad Católica del Ecuador (PUCE), durante los 
meses  de  Agosto  y  Septiembre  del  2003.  2)  Curso  teórico  práctico  de  Microbiología  Agrícola, 
organizado por la PUCE (Septiembre 2003). 

La visita de la Dra. Marcela Franco de la Universidad Javeriana de Colombia, y del Dr. Rene Novo 
de  la  Universidad  de  Cuba,  permitió  el  inicio  y  continuación  de  una  estrecha  interacción 
principalmente relacionada con el intercambio de información científica. 

Los  resultados  del  proyecto  también  han  sido  fundamentales  como  antecedentes  de  propuestas  de 
proyectos  aprobados.  Así  por  ejemplo,  el  perfil  del  proyecto  PFNR­03­008  “Establecimiento  y 
mantenimiento  de  un  cepario  de  micorrizas  nativas  de  soya  y  cacao  que  incrementen  sus 
rendimientos y contribuyan con la conservación de los recursos suelo y agua” ha sido seleccionado 
por el Comité de Proyectos de Investigación del FUNDACYT, para la presentación de la propuesta 
en extenso (anexo 4). 

14. LIMITACIONES EN EL DESARROLLO DEL PROYECTO . 

1.  Retraso  del  inicio  del  proyecto.  El  investigador  principal  (IP)    estuvo  fuera  del  país  en  la 
fecha  en  que  debía  iniciarse  el  proyecto  (Enero  2001),  ya  que  estuvo  terminando  sus 
estudios  de Doctorado (Ph.D.) en la Universidad de Minnesota. El proyecto sé inicio siete 
meses después (Agosto 2001).

58 
2.  El  proyecto    tuvo  que  suspender  temporalmente  la  ejecución  de  diferentes  actividades 
planificadas debido al problema de la “devolución del IVA”. Experimentos de laboratorio, 
invernadero y campo fueron suspendidos por casi tres meses, así como la conservación del 
valioso  germoplasma  de  la  bacteria  Rhizobium  y  de  otros  microorganismos  colectados 
durante algunos años por el Instituto, debido precisamente a la falta de reactivos y material 
de laboratorio necesarios para su conservación. 

Se realizaron todas las consultas pertinentes en la Estación Santa Catalina para solucionar el 
“problema de la devolución del IVA” de parte del SRI, pero lamentable fue difícil encontrar 
alternativas viables y rápidas, que permitan la continuidad inmediata del proyecto. En este 
punto  es  necesario  enfatizar  que  el  manejo  administrativo­financiero  fue  responsabilidad 
exclusiva de las áreas Financiera y de Contabilidad de la EESC. El proyecto contribuyó con 
los  demás  proyectos  PROMSA  de  la  Estación  Santa  Catalina,  para  contratar  dos 
profesionales  contadoras  específicamente para las actividades  de  manejo  de los  fondos  de 
cada proyecto. Por tal razón, los investigadores de ninguna manera fueron responsables de 
solucionar  un  problema  estrictamente  administrativo.  Con  estos  antecedentes,  el 
investigador principal del proyecto se permitió solicitar por escrito al Director General del 
INIAP se digne convocar a varias reuniones con carácter urgente y con la presencia de las 
autoridades de la Estación Santa Catalina, Director  Financiero, Director de Planificación, y 
técnicos  involucrados,  con  el  fin  de  encontrar  una  solución  definitiva  y  en  conjunto  al 
problema en mención. 

3.  La  salida  del  Ing.  Alfonso  Suárez  del  proyecto,  quien  desempeñaba  las  funciones  de 
investigador principalmente en las actividades de campo. 

4.  El  exceso  de  trámites  burocráticos  del  Instituto  y  la  lentitud  en  el  flujo  de  recursos 
económicos definitivamente fueron también grandes obstáculos para la ejecución rápida y a 
tiempo de las actividades. 

15. CONCLUSIONES Y RECOMENDACIONES. 

El proyecto  ha permitido la formación  de un banco germoplásmico de  la bacteria  Rhizobium, con 


cepas para los cultivos de fréjol, arveja, alfalfa, soya y maní. Las cepas  se encuentran almacenadas

59 
bajo el proceso de liofilización, el mismo que permite una viabilidad de por lo menos cinco años. 
Con  relación  al  estudio  de  la  compatibilidad  genética  entre  la  bacteria  y  el  cultivo  de  fréjol,  el 
proyecto  concluye  que  la  diversidad  genética  de  la  bacteria  es  mayor  cuando  se  usan  cultivares 
locales. Esto indica que existe cierta especificidad y por lo tanto se recomienda usar inoculantes con 
cepas  aisladas  de  suelos  pertenecientes  a  regiones  donde  la  leguminosa  es  nativa.  Este 
comportamiento  podría  darse  en  la  asociación  maní­Bradyrhizobium,  pero  se  requiere  de  estudios 
complementarios. 

El proyecto ha seleccionado cepas eficientes en fijación biológica de nitrógeno, para los cultivos de 
fréjol, arveja, alfalfa, soya y maní. En fréjol las cepas UMR 1478 y UMR 1481, en maní: ECUM­L 
102,  ECUM­P8­6,  en  arveja  ECUA  –I1,  ECUA­Z2,  en  alfalfa  UMR  6008,  TAL  380,  y  en  soya 
(invernadero): CIAT 151, UMR 6001, ECUS­001, ECUS1­SJ. 

Todas  las  cepas  en  mención  fueron  estadísticamente  similares  al  tratamiento  nitrogenado,  y 
superiores  (estadísticamente  diferentes)  al  testigo  sin  inocular,  tanto  en  los  parámetros  de 
rendimiento  y  porcentaje  de  nitrógeno.  En  fréjol,    la  cepa  UMR  1478  tuvo  una  respuesta  en 
rendimiento  de  8554.53  kg/ha  en  peso  fresco,  siendo  estadísticamente  igual  al  rendimiento  del 
tratamiento  nitrogenado,  el  cual  fue  superior  con  un  promedio  de    10121.88  kg/ha.  En  maní,  las 
cepas ECUM­P8­6 y ECUM­L102 fueron las que mostraron valores superiores tanto en rendimiento 
(kg/ha),  como  en  porcentaje  de  nitrógeno.  Así,  las  cepas  ECUM­P8­6  y  ECUM­L102  rindieron 
1248.27 kg/ha y 1234.36 kg/ha respectivamente versus 1247.92 kg/ha del tratamiento con nitrógeno 
y  1038.43  kg/ha  del  tratamiento  testigo.  En  nitrógeno,  las  cepas  mostraron  valores  de  3.91  %  y 
4.00%  respectivamente,  versus  4.00%  y  3.91%  de  los  testigos.    En  cuanto  a  variedades,  el 
rendimiento de la variedad INIAP­380 fue superior  al de la variedad Caramelo. 

El  estudio  de  competitividad  de  cepas  asociadas  al  fréjol,  permitió  conseguir  la  elaboración  de 
antisueros de calidad y en suficiente cantidad para las cepas en estudio. Esto permite tener un stock 
de antisueros para futuros estudios serológicos de Rhizobium. 

El INIAP dispone de un stock de materiales que después de un análisis físico, químico y biológico, 
muestran  ser  de  calidad,  para  ser  utilizada  como  buen  portador  de  la  bacteria  Rhizobium.  Se 
identificó en base a los sustratos disponibles localmente,  el mejor sustrato (Turba de Chimborazo) 
como buen portador de la bacteria Rhizobium.

60 
La  difusión  de  los  resultados  ha  permitido  que  el  número  de  agricultores  que  usan  inoculantes, 
incremente, comprobado  mediante un  diagnóstico  en las Provincias  del Cañar (comunidad  Virgen 
de la Nube)  y de Pichincha (Chaupiloma­Tabacundo). Esta actividad se ha visto reforzada por los 
programas de radio en ambos sitios. 

Se  ha  institucionalizado  un  sistema  de  control  de  calidad  de  los  inoculantes  producidos 
para los cultivos de fréjol, arveja, alfalfa, soya y maní. 

Recomendaciones 

Nuevamente  es  necesario  enfatizar  que  el  proyecto  se  inicio  con  siete  meses  de  retraso.  El  inicio 
estuvo  programado  para  Enero  del  2001  pero  recién  en  Agosto  de  ese  año,  pudo  iniciarse  las 
actividades  cuando  el  investigador  principal  del  proyecto  retorno  al  país  después  de  culminar  sus 
estudios  de  doctorado  (Ph.D.)  en  la  Universidad  de  Minnesota.  Por  lo  tanto  se  recomienda  y  se 
solicita  a  la  vez  continuar  con  algunas  actividades  inconclusas  del  proyecto,  concretamente:  1)  el 
método de esterilización de la turba, 2) pruebas de inmunodifusión en el estudio de competitividad 
entre cepas  de Rhizobium, 3) culminación del  estudio de  efectividad de cepas  bajo condiciones  de 
campo en soya. Estas actividades podrían ser culminadas en un período de extensión del proyecto. 

Sobre la base de  los  resultados  de  la caracterización  de  las  cepas  asociadas  al cultivo  de  maní, se 
recomienda complementar con otros  estudios  tanto de laboratorio como  de campo. Se recomienda 
una  evaluación  de  campo  de  las  cepas  representativas  de  cada  uno  de  los  grupos  obtenidos  en  el 
análisis genético del RFLP, para ver su comportamiento como fijadoras de nitrógeno. 

Se recomienda realizar experimentos  demostrativos  en  la provincia de Manabí (zonas  maniceras), 


donde  se  evalúen  las  cepas  de  la  colección  (cepas  nativas  y  cepas  importadas),  por  existir  cierto 
grado de especificidad con el cultivo según los resultados obtenidos en Loja. 

Si bien es cierto que los  estudios  de campo se ejecutaron en suelos pobres, se recomienda realizar 


investigación sobre la respuesta de la inoculación al fósforo, sus niveles, y formas de aplicación. El 
fósforo es un elemento esencial en el proceso de la fijación del nitrógeno, y en los suelos andinos 
(Andisoles)  el  fósforo,  es  adsorbido  por  las  partículas  del  suelo,  dificultando  la  absorción  por  el 
cultivo.

61 
Mayor  difusión  de  la  tecnología  en  otras  regiones  donde  el  proyecto  no  tuvo  mayor  presencia, 
especialmente en la Costa Ecuatoriana. Se recomienda la implementación de un laboratorio para la 
elaboración de inoculantes en la Costa. Los agricultores necesitan proveerse fácil y constantemente 
de los inoculantes al momento preciso de la siembra. 

Continuar  con  el  sistema  de  producción  de  inoculantes,  incluyendo  el  control  de  calidad  del 
producto garantizando la eficiencia y uso por parte del agricultor. 

16. LECCIONES APRENDIDAS. 

En cada experimento el trabajo conjunto con el agricultor permitió que este pueda observar de una 
manera  directa  las  fortalezas  y  limitaciones  que  puede  ofrecer  el  proceso  de  la  inoculación  de  las 
semillas de leguminosas. 

El agricultor ha aprendido el procedimiento de inoculación de la semilla. En cada visita realizada se 
puede  observar  el  interés  que  el  agricultor  pone  en  el  proceso.  Cada  vez  es  mayor  el  número  de 
agricultores interesados en el inoculante. 

Las  conversaciones  con  técnicos  y  agricultores,  permitieron  establecer  una  mayor  difusión  de  los 
conocimientos generados por el proyecto, sobre inoculantes. Estos cada vez son mas conocidos por 
el agricultor. 

El proyecto ha permitido adquirir una destreza de los investigadores responsables en la solución de 
problemas administrativos y financieros relacionados con el manejo del proyecto. A pesar de que no 
fue  responsabilidad  de  los  técnicos  el  manejo  administrativo  del  mismo  (ver  “limitaciones  en  el 
desarrollo  del  proyecto”),  sin  embargo  los  investigadores  involucrados  pusieron  toda  la  energía 
necesaria  para  motivar  al  personal  de  Contabilidad  de  la  Estación  Santa  Catalina  (INIAP),  y  así 
acelerar  el  flujo  de  los  fondos  para  responder  y  cumplir  eficientemente  con  los  objetivos  del 
proyecto.

62 
17. BIBLIOGRAFIA. 

1. AGUILAR MARIO. 2003. Comunicación personal. Jefe del Laboratorio de Biología Molecular. 
Universidad de la Plata, Argentina. 

2.  AMARGER,  N.,  MACHERET,  V.  AND  LAGUERRE,  G.  1997.  Rhizobium  gallicum  sp.  nov. 
and  Rhizobium giardinii sp. nov., from Phaseolus vulgaris nodules. Int. J. Syst. Bacteriol. 47, 996­ 
1006. 

3.  BERNAL,  G.  1993.  Characterization  of  Ecuadorian  and  argentine  bean­  rhizobia  and  their 
specificity with Phaseolus vulgaris L. of different  gene pools. Tesis  M.Sc. Minnesota, University 
of Minnessota, Faculty of graduate school. p. 2­10 

4.  BERNAL,  G., and  GRAHAM,  P.H.  2001.  Diversity  in  the  rhizobia  associated  with  Phaseolus 
vulgaris  L.  in  Ecuador,  and  comparisons  with  Mexican  bean  rhizobia.    Canadian  Journal  of 
Microbiology. 47, 526­534. 

5.  BERNAL, G.; SUAREZ, A; JEREZ, M; CAMPAÑA, D. 2002. Inoculación de la semilla de 
leguminosa con la bacteria rhizobium. Instituto Nacional de Investigaciones Agropecuarias. 
Plegable Nro. 195. 

6.  BERNAL G. y ESTEVEZ C.1994. Evaluación de inoculantes importados de soya utilizando el 
medio  BJSM (Bradyrhizobium japonicum  selective medium). Revista INIAP. 

7.  BROCKWELL,  J;  BOTTOMLEY,  P.  1995.  Recent  advances  in  inoculant  technology  and 
prospec for  the future. Soil Biol. Biochem (G. B.) 27(4/5):683 

8.  CASTELLANOS, J.Z.; PEÑA­CABRIALES, J.J. 1989. Características agronómicas del fríjol 
asociados a la capacidad de fijación de N2 en el centro de México. Bean Cowpea. CRSP.7p. 

9. CATROUX, G. 1991. Inoculant quality Standard and controls in France. In: Expert consultation 
on  legume  inoculant  production  and quality  control.  Rome.  FAO.  Ed.  Thompson.  V.A.  Rome.  P: 
113­120.

63 
10.    CEVALLOS,  J.  Y  RODRÍGUEZ,  R.  2003.  Sustratos  para  bacterias  Gram+  y  Gram­.  Quito, 
Instituto  Agropecuario Superior Andino. (Comunicación Personal). 

11. CIAT. Centro Internacional de Agricultura Tropical. 1988. Simbiosis leguminosa­Rhizobium. 

Manual  de métodos de evaluación, selección y manejo agronómico. Ed. Proyecto CIAT­UNDP de 

evaluación, selección, y manejo de la simbiosis leguminosa­Rhizobium para aumentar la fijación de 

nitrógeno. Sección de Microbiología de Suelos del Programa de Pastos Tropicales y Sección de 

Microbiología de Suelos del Programa de fréjol. Cali, Colombia. 178 p. 

12. CONSTANTE, D. 1993. Influencia de cuatro portadores en la eficiencia y Competitividad de 

Rhizobium   meliloti  en campo. Tesis Ing. Agr. Quito, Universidad Central del Ecuador, Facultad 

de Ciencias Agrícolas. 74p. 

13.   CHAO W. L. AND ALEXANDER M. 1984. Mineral soils as carriers for Rhizobium 

inoculants. Appl. Environ. Microbiol. 47, 94­97 

14. CHAVERRA, M.H., AND GRAHAM, P.H. 1992. Cultivar variation in traits affecting early 

nodulation of common bean. Crop Sci. 32: 1432­1436. 

15.  DATE  R.  AND  ROUGHLEY  R.  1977.  Preparation  of  legume  seed  inoculants.    Treatise  on 
Dinitrogen Fixation. Section IV. Agronomy and Ecology (R. W. F. Hardy and A.H. Gibson,  Eds.), 
pp. 243­275. Wiley, New York. 

16. DE BRUIJIN. 1992. Use of repetitive (repetitive extragenic palindromic and enterobacterial 
repetitive intergenic consensus) sequences and the polymerasa chain reaction to fingerprint the 
genomes of Rhizobium meliloti isolates and other soil bacteria. Applied and Environmental 
Microbiology. 58: 2180­2181. 

17. ESTEVEZ Y CONSTANTE D. 1993. Study of Ecuadorian peat sources for their suitability as 
inoculant carriers, and inoculant response in alfalfa. 14th. North American Conference on  Symbiotic

64 
Nitrogen Fixation, University of Minnesota, July 25­29, 1993. 

18.  FAO 1999.  Web site:  www.fao.org 

19. GEPTS, P., AND BLISS, F.A. 1985. F1 hybrid weakness in the common bean: differential 
geographic origin suggests two gene pools in cultivated bean germplasm. J. Hered. 76, 447­ 450. 

20. GÓMEZ M., SILVA N., HARTMANN A., SAGARDOY M. AND CATROUX G. 1997. 
Evaluation of commercial soybean inoculants from Argentina. World J. Microbiol. Biotech. 3, 167­ 
173 

21. GRAHAM­WEISS, L.; BENNET,M.; and PAAU, A.1987. Production of bacterial inoculant by 
direct fermentation on nutrient­suplement vermiculite. Applied and Environment  Microbiology. p. 
2138­2140 

22.  GRAHAM P.H. 1999. Web site: www.rhizobium.umn.edu 

23. HUNGRIA M. AND VARGAS M.A.T. 2000. Environmental factors affecting N2  fixation in 
grain l  legumes in the tropics, with an emphasis on Brazil.  Field Crops Research 65: 151­164. 

24.   HUNGRIA,  M.,  ANDRADE,  D.D., COLOZZI, A.,  AND  BALOTA  E.L.  1997.  Interactions 
among  soil organisms and bean and maize grown in monoculture or intercropped. Pesq. Agropec. 
Bras. 32, 807­818. 
25.  INIAP. 1994.  Informe Anual del Departamento de Manejo de Suelos y Aguas. pp: 60­65. 

26. KAPLAN, L. 1965. Archeology and domestication in American Phaseolus (Beans). Econ. Bot. 
19, 358­368. 

27. KOINANGE, E.M.K., AND GEPTS, P. 1992. Hybrid weakness in wild Phaseolus vulgaris L. J. 


Hered. 83, 135­139. 

28. KOSTOV O. AND LYNCH J.M. 1998. Composted sawdust as a carrier for Bradyrhizobium, 
Rhizobium and Azospirillum in crop inoculation. World J. of Microbiol. and Biotech. 14, 389­  397.

65 
29. LAGUERRE G., FERNANDEZ, M.P, EDEL V.E., NORMAND, P., AND AMARGER, N. 
1993.  Genomic heterogeneity among frech Rhizobium strains isolated from Phaseolus vulgaris L. 
Int. J. Syst. Bacteriol. 43, 761­767. 

30.  MCDERMOTT  T.  AND  GRAHAM  P.  1990.  Competitive  ability  and  efficiency  in  nodule 
formation  of Bradyrhizobium  japonicum strains. Appl. Environ. Microbiol. 56: 3035­3039. 

31. MENDOZA LUIS, 2003. Departamento de Planificación, INIAP. Quito, Ecuador. 

32. OPLINGER E. S. 1998. Extensions Agronomist, University of Wisconsin. 

33. PETERSON T.A. AND RUSSELLE M.P. 1991. Alfalfa and the nitrogen cycle in the corn belt. 
J. Soil Water Conserv. 46: 229­233. 

34. SINGH, S.P., AND GUTIERREZ,  J.A. 1984. Geographical distribution of the DL1 and DL2 
genes causing hybrid dwarfism in Phaseolus vulgaris L., their association with seed and their 
significance to breeding. Euphytica, 33, 337­345. 

35. SNEATH, H.F. AND SOKAL, R.R. 1973. Numerical taxonomy. The principles and practice of 
numerical classification. Eds. D. Kennedy; R.B. Park. San Francisco, W.H. Freeman. Pp 573. 

36.  SOMASEGARAN Y HOBEN, 1994. Handbook for rhizobia. Springer Laboratory, 450 pp. 

37. SPARROW,S.D.; HAM, G. 1981. Survival of Rhizobium phaseoli in Six Carrier Materials.Univ 

of Minnesota Journal Series No 11. p. 181­184. 

38.  SUÁREZ CARMEN. 1999. Líder del Programa de Protección Vegetal del INIAP. Ecuador. 

39.  TEMPLETON, A. Y LAWRANCE, J. 1988. FRAG­LENGTH: algorithm for the calculation of 
molecular weights. Software distributed by the authors. 

40.  THOMPSON, J.  1984.  Production  and  Quality  Control  of  Carrier­based    legume  Inoculants, 
International  Crops  Research  Institute  for  the  Semi­Arid  Tropics.  Andhra  Prade  (India) 
Information bulletin no. 17. 32 p.

66 
41.  TOHME, J., GONZALEZ, D.O., BEEBE, S., AND DUQUE, M.C. 1995. AFLP Analysis of 
gene  pools of a wild bean core collection. Crop Sci. 36, 1375­1384. 

42.    UNICEF.  1999.    Tomado  del  diario  “El  Universo”  del  Ecuador    (www.eluniverso.com) 
Diciembre 1999. 

43.  VERSALOVIC J., SCHNEIDER M., DE BRUIJN F. AND LUPSKI. 1994. Genomic 
fingerprinting of bacteria using repetitive sequence­based polymerase chain reaction. Methods 
Mol. Cell. Biol.5,  25­40. 

44. VINCENT J. 1970. A manual for the practical study of the root­nodule bacteria. IBP. Handbook 
No 15, Blackwell Scientific Publ. pp. 164. 

45.  WALSH,  P.S.,  METZGER,  D.A.,  AND  HIGUCHI,  R.  1991.  Chelex  100  as  a  medium  for 
simple  extraction  of  DNA  for  PCR­based  typing  from  forensic  material.  Bio  Techniques.  10:506­ 
513. 

18. ANEXOS. 

Anexo 1. Análisis estadistico de los experimentos de invernadero y campo. Estudio de la capacidad 
de fijación biológica de nitrógeno. 

Cuadr o  1.  ADEVA  para  el  variable  peso  fresco  en  el  ensayo  evaluación  de  cepas  de  soya. 
Invernadero. Pichilingüe – Los Ríos 2004. 

Fuente de var iación  Gr ados de liber tad  Suma de Cuadr ados  Cuadr ados Medios 


Tratamientos  9  31.15  3.462 
Repeticiones  3  11.90  3.965 
Error  27  59.83  2.216

67 
Cuadr o  2.  Promedios  y  Rangos  de  significación  para  la  variable  peso  fresco  en  la  evaluación  de 
cepas de soya  Pichilingüe – Los Ríos 2004 

Descr ipción  Pr omedios g/planta  Rango (Tuquey 5% ) 


TESTIGO NITROGENADO  9.975  A 
ECUS1­SJ  8.773  ab
TAL­571  8.573  ab
CIAT 51  8.515  ab
ECUS­001  8.392  ab
ECUS­005  8.345  ab
6001  7.858  ab
ECUS­1053  7.850  ab
TESTIGO ABSOLUTO  7.710  ab 
ECUS­P1  6.318  b 

Cuadr o  3.  ADEVA  para  la  variable  peso  seco  en  el  ensayo  evaluación  de  cepas  de  soya. 
Invernadero. Pichilingüe – Los Ríos 2004. 

Fuente de var iación  Gr ados de liber tad  Suma de Cuadr ados  Cuadr ados Medios 


Tratamientos  9  25.71  2.857 ns 
Repeticiones  3  11.57  3.858 ns 
Error  27  36.98  1.370 

Cuadr o  4.  Promedios  de  peso  seco  obtenidos  en  la  evaluación  de  cepas  de  soya.  Invernadero. 
Pichilingue – Los Ríos 2004. 

Descripción  Pr omedios g/planta 
TESTIGO NITROGENADO  6.222 
TAL 571  4.770 
ECUS1­SJ  3.878 
ECUS­001  3.865 
CIAT 51  3.74 
6001  3.733 
ECUS­005  3.722 
ECUS­1053  3.593 
ECUS­P1  3.557 
TESTIGO ABSOLUTO  3.443

68 
Cuadr o 5. Análisis de varianza para las variables evaluadas en el estudio de variedades de fréjol y 
cepas de Rhizobium etli bajo condiciones de campo. Tumbaco­ Pichincha 2003. 

FUENTES DE  GRADOS DE  CUADRADOS MEDIOS 


VARIACIÓN  LIBERTAD  Peso seco  Peso seco  Rendimiento.  %  de N 
follaje  nódulos 
Total  39 
Tr atamientos  9  16.11**  0.30*  14780279.86**  0.35* 
Var iedades (V)  1  37.08**  0.06 ns  32105113.69**  0.42 ns 
Cepas (C)  4  15.63*  0.63**  25168044.23**  0.52* 
c5 vs  1  28.72*  0.90*  54523767.76**  1.64** 
c1,c2,c3,c4  1  21.66*  1.44**  33968195.44**  0.35 ns 
c4 vs c1,c2,c3  1  0.55 ns  0.18 ns  469616.77 ns  0.02 ns 
c1 vs c2,c3  1 11.59 ns  0.02 ns  11710597.31*  0.07 ns 
c2 vs c3  4  11.35 ns  0.02 ns  61307.04 ns  0.16 ns 
V x C  3  12.54 ns  0.25 ns  3908466.42 ns  0.23 ns 
Repeticiones  27  4.41  0.13  2019735.46  0.14 
Er r or  Exp. 
Pr omedio g/mata  16.09 g/planta  2.31 g/mata  7786.84 kg/ha  3.68 %N 
CV %   13.05  15.39%  18.25%  10.28% 

Cuadr o  6.  Promedios  y  Pruebas  de  significación  para  los  factores  variedades  y  cepas  en  las 
variables en estudio en la evaluación de variedades de fréjol y cepas de Rhizobium etli 
bajo condiciones de campo. Tumbaco­ Pichincha 2003. 

Descripción  Pr omedios 
Peso seco  Peso seco  Rendimiento  %  de N 
g/planta  nódulos  kg/ha 
g/mata 
Factor  variedades 

v2 INIAP Canario SCC2  17.05  a  2.34  6890.95  b  3.79 


v1 INIAP 412 Toa  15.13      b  2.27  8682.74  a  3.58 

Factor  Cepas 

c5 Fertilizado y sin cepa  17.78   a  2.01          c  10121.88  a  4.09  a 


c3 UMR 1478  17.10   a   b  2.53  a   b  8554.53    a  b  3.56  a  b 
c1 UMR 1481  15.93   a   b  2.38  a   b  c  7995.75        b  3.68  a   b 
c2 UMR 1468  15.40   a   b  2.60  a  6843.49        b  c  3.69  a   b 
c4 Testigo  14.24        b  2.02      b  c  5418.56            c  3.40       b

69 
Cuadr o  7.  Promedios  para  la  interacción  variedades  por  cepas  en  las  variables  en  estudio  en  la 
evaluación de variedades de fréjol y cepas de Rhizobium etli bajo condiciones de campo. Tumbaco­ 
Pichincha 2003. 

Pr omedios 
Descripción  Peso seco  Peso seco  Rendimiento  %  de N 
g/planta  nódulos  kg/ha 
g/mata 

Interacción VxC  19.59  2.60  7659.94  3.86 


18.56  1.94  10874.13  3.96 
v2c3  3.58 
v1c5  17.04  2.43  7035.88 
17.01  2.08  9369.63  4.22 
v2c1  3.80 
v2c5  16.78  2.56  5870.74 
14.85  2.06  4518.56  3.49 
v2c2  3.79 
v2c4  14.81  2.33  8955.63 
14.61  2.46  9449.13  3.26 
v1c1  3.59 
v1c3  14.02  2.64  7816.25 
13.63  1.97  6318.56  3.31 
v1c2 
v1c4 

Cuadr o  8.  Análisis  de  los  materiales  utilizados  en  la  preparación  de  soportes  para  inoculantes. 
Cutuglagua ­ Pichincha 2003.

ANÁLISIS C. ROSA CENIZA ZEOLITA M. M. COMPOST TUR.


CHIMB LLOA ALASK
pH 4.2 Ac 8.8Al 5.1Ac 5.5LAc 6.3LAc 7.7 LAl 6.5Lac
NH4(ppm) 69.00 A 44.00M 72.00A 166.00A 172.00 90.00A 42.00M
A
P (ppm) 63.00 A 183.00A 10.00M 36.00A 14.00 160.00A 5.00B
M
K(meq/100 0.14B 0.88A 0.20M 0.41A 0.62A 3.60A 0.77ª
ml)
M.O. % 16.80 A 19.80A 0.60 11.20A 9.40A 9.90A 44.10ª
Bases(meq/ 22.89 24.50 15.11 18.94 18.22 27.90 14.47
100ml)
C/N ­­­­­­­ 29.93 3.53 19.75 11.84 11.30
Interpretación
pH Elemento
s
Ac = Ácido N= Neutro B = Bajo
Lac = Liger. Ácido LAl = Lige. Alcalino M =
PN = Prácticamente neutro Al = Alcalino Medio
A = Alto

70 
Cuadr o 9.  Análisis de varianza para unidades formadoras de colonia por gramo de inoculante, en 
el  estudio  evaluación  de  sustratos  como  alternativas  para  portadores.  Cutuglagua­ 
Pichincha 2003. 

FUENTE DE  GRADO S DE 


VARIACIÓN  LIBERTAD  CUADRADOS MEDIOS 
8 días  15 días  30 días  60 días  90 días  120 días 
Total  31
Sustratos  7  2.52**  1.39**  2.71**  3.57**  35.43**  33.33** 
Error  24  0.09  0.22  0.09  0.24  0.17  0.10 

Promedio  log (x+1) ufc/g inocu.  8.24  8.33  8.25  8.05  7.25  7.00 


Promedio de ufc/g de inoculante  1.74x10 8  2.14x10 8  1.78x10 8  1.12x10 8  1.78x10 7  1.00x10 7 
CV%  3.71  5.60  3.63  6.02  5.63  4.52

Cuadr o  10.  Datos  reales  para  unidades  formadoras  de  colonias  por  gramo  de  inoculante  en  la 
evaluación  de  sustratos  como  alternativas  para  portadores  Cutuglagua  ­  Pichincha 
2003. 

SUSTR ATOS  8 días  15 días  30 días  60 días  90 días  120 días 


(S)  ufc/g ino  ufc/g ino  ufc/g ino  ufc/g ino  ufc/g ino  ufc/g ino 
S1 Capa rosa  1.43x10 8  bc  1.05x10 8 abc  1.97x10 8  bc  1.21x10 8 abc  1.20x10 8  bc  5.43x10 7  cd 
s2 Ceniza  6.06x10 8 ab  2.60x10 8 abc  6.92x10 8 ab  3.63x10 8 ab  2.70x10 8 ab  1.77x10 8 abc 
s3 Zeolita  3.41x10 8 ab  2.02x10 8 abc  1.03x10 8  c  7.03x10 7  bc  8.97x10 7  bc  4.01x10 7  cd 
s4 T. chimborazo  1.63x10 9 a  1.16x10 9 a  1.94x10 9 a  1.09x10 9 a  1.10x10 9 a  7.50x10 8 a 
s5 T.  Lloa  4.01x10 6  d  3.39x10 7  c  6.84x10 7  c  2.57x10 7  c  2.34x10 7  c  1.06x10 7  d 
s6 Compost  4.79x10 8 ab  1.14x10 9 a  5.58x10 8 ab  2.38x10 8 abc  2.24x10 8 ab  1.00x10 8  bc 
s7 Turba alaska  1.41x10 8  bc  4.44x10 8 ab  2.44x10 8  bc  8.28x10 8 ab  6.34x10 8 ab  3.41x10 8 ab 
S8 Vaina de  6.35x10 7  c  3.98x10 7  bc  3.72x10 6  d  1.33x10 6  d  0.00            d  0.00              e 
fréjol 

Anexo 2. Breve información del proyecto COMMINANDES: 

Título  del  Proyecto:  Producción  ecológica  de  papa  en  áreas  peri­urbanas  de  los  Andes, 
combinando compostaje e inoculantes microbianos. 

Definición del problema: 

En el Ecuador la papa es un cultivo de importancia económica en la Región Interandina, y 
últimamente es común en áreas peri­urbanas. Lamentablemente la producción del cultivo es 
baja (5­8 T/ha) como resultado de varios factores abióticos (propiedades físicas y químicas 
del  suelo)  y  bióticos  (ej.  enfermedades  de  la  raíz).  Además,  por  un  lado  los  costos  de 
fertilizantes y pesticidas para contrarrestar estos problemas son altos e inaccesibles para el 
pequeño y mediano productor, y por otro lado el mal manejo de estos insumos perjudica al 
medio ambiente especialmente a los recursos suelo y agua. 

71 
J ustificación del problema: 

El  reciclaje  de  restos  orgánicos  originados  en  agro­industrias  de  la  papa,    utilizando  el 
poder enzimático de los microorganismos del suelo, a un producto útil y seguro (compost) 
es postulado como una opción practica dirigida a mejorar la producción de papa y de otros 
cultivos  de  áreas  peri­urbanas  (y  urbanas).  Además  del  reciclaje  de  los  restos  vegetales 
(leguminosas,  gramíneas,  hortalizas,  etc)  y  animales  (estiércol),  el  manejo  de  los 
microorganismos  benéficos  del  suelo  (micorrizas,  Rhizobium,  bacterias  promotoras  de 
crecimiento),  ha  sido  propuesto  como  una  importante  practica  agrícola  para  reducir  los 
insumos  químicos  (fertilizantes  y  pesticidas),  y  para  mejorar  el  potencial  ecológico  y 
sustentable de los suelos en sistemas peri­urbanos y también urbanos. Estos bio­protectores 
de  plantas  y  bio­fertilizantes  pueden  ser  manejados  cambiando  la  calidad,  cantidad  y 
tiempo  de  aplicación  del  compost.  Estas  dos  tecnologías  (bioprotectores/biofertilizantes  y 
compost)  han  mostrado  ser  eficientes  independientemente,  pero  ninguna  o  muy  poca 
información existen sobre el efecto cinegético de ambas tecnologías. 

El objetivo de esta investigación es investigar la combinación del compost con inoculantes 
(bio­fertilizantes  /  bio­protectores)  basándose  en  microorganismos  nativos  a  fin  de  1) 
Adicionar un valor a los restos orgánicos producidos por las agro­industrias y agricultores 
de áreas peri­urbanas, 2) Reducir el uso de los  fertilizantes químicos  y de pesticidas,  y 3) 
Estimular  la  capacidad  colectiva  local  (asociaciones  de  agricultores  y  ONG’s)  para 
desarrollar  sistemas  de  compostaje  a  micro­escala  y  de  manejo  de  inoculantes  a  partir  de 
microorganismos del suelo. 

Ámbito y cobertura 

Este proyecto está dirigido a los agricultores de sistemas agrícolas donde la papa juega un 
rol  importante,  y  localizados  en  áreas  peri­urbanas  de  la  Región  Interandina.  Los 
productores  dispondrán  de  compost,  el  mismo  que  vendrá  a  constituir  en  un  insumo  de 
fertilización  orgánica  mejorando  las  condiciones  del  suelo,  y  de  inoculantes  basado  en 
microorganismos  del  suelo  los  que  vendrán  a  constituir  en  promotores  de  crecimiento

72 
vegetal  y  de  bio­fertilizantes.  El  proyecto  es  parte  de  un  consorcio  formado  por Ecuador, 
Bolivia, Cuba, Francia, Irlanda y Bélgica. 

Fecha Inicio Proyecto: 01­01­2003 
Fecha Finalización:  01­01­2005 
Instituciones co­ejecutoras: 
­ INIAP: Departamento Nacional de Protección Vegetal (DNPV) 
Departamento de Suelos 
Programa de Papa (Proyecto Fortipapa) 
­ CIP (Sede Quito). 
­ FAO 
­ Fundación GAIA. 
­  Agricultores/  productores  de  Chaupiloma  (Tabacundo­Pichincha),  y  Virgen  de  la  Nube 
(Cañar). 
­ Gobiernos locales (Municipios). 

Objetivo principal: Contribuir con la producción ecológica de papa en la Región Interandina. 

Objetivos del proyecto. 
1. Obtener compost de calidad. 
2.  Obtener  biofertilizantes  a  base  de  hongos  micorrízicos  y  bacterias  promotoras  de 
crecimiento  vegetal en papa y otros cultivos de la Región Interandina. 

Anexo  3.    Infor me  del  Dr.  J onathan  Haskett*  sobre  el  uso  de  la  tecnología  de 
inoculantes de Rhizobium, en la Provincia del Chimborazo. 

De: "Jonathan Haskett" <jhskt2nd@mindspring.com> 
Para: <g3bernal@punto.net.ec> 
Asunto: Re:_Felíz_Nuevo Año. 
Fecha: Lunes, 12 de Enero de 2004 15:25

73 
1) How farmers feel about the use of inoculants?. Are they happy? 
Most  farmers  are  happy  with  this  technology.  One  farmer  reported  that  his  peas  matured 
more rapidly and all matured at the same time, making harvest more easy. Another farmer 
reported that his  innoculated alfalfa grew as well  as alfalfa recieving chicken  manure, but 
for half the cost at first harvest (note: he added phosphorus fertilizer and micro­nutrients). 
Other farmers are very pleased by the results and have been passing on the information to 
their neighbors. 

One farmer did not like the results he got with innoculum in beans. He maintained that the 
innocualted beans grew more poorly than those not innoculated. This was difficult to verify 
and to determine because he subsequently changed his story saying that the beans actually 
grew just as well. This is the only instance of someone not being happy with the innoculum 
that  I  have  encountered.  (note: that the original  complaint  was  made  when  the  gentleman 
was apparently intoxicated). 

2) What more do farmers need in relation with this technology? 
Access,  is  THE  main  problem.  Farmers  need  a  ready,  consistent  supply  of  innoculum, 
WHEN  the  need  it.  Planting  decisions  are  often  driven  by  weather  and  can  be  quite 
variable.  The  lag  time  between  requesting  the  inoculums  and  getting  it  is  a  problem. 
Inoculums  should  also  be  supplied  in  smaller  bags  so  farmers  can  inoculate  smaller 
quantities of seeds. This is because there is no refrigeration and it is difficult to reseal bags 
and keep them at the correct humidity. So bags should be considered single use and sized 
for smaller amounts of seeds. 

3) How many "field days" have you had there in the community? 
I  have  done  one  formal  field  day.  I  have  done  numerous  charlas  with  farmers  in  small 
groups or individually. I find this to be much more effective, especially if we go ahead and 
plant the farmer's field that day. The multiplier effect them comes in when and if the farmer 
talks to his/her neighbors. I have seen this multiplier effect in action. 

4) What kind of methods are you using to difuse the Rhizobium technology there?

74 
I have done numerous charlas with farmers in small groups or individually. I find this to be 
much more effective than field days, especially if we go ahead and plant the farmer's crop 
that  day.  The  multiplier  effect  them  comes  in  when  and  if  the  farmer  talks  to  his/her 
neighbors. I have seen this multiplier effect in action. 

5) Please explain that inoculants supply are going to be through Peace Corp members. 
Myself  and  three  other  Peace  Corps  volunteers  have  actively  promoted  and  distributed 
inoculums at our sites. These sites are widely dispered and  isolated. Three of the sites are 
entirely indigenous and in each of the three inoculums was an entirely new technology that 
nobody had ever heard of before. We have been providing the inoculums on a trial basis at 
no cost. Eventually I would like inoculums to be commercially available but at a cost that 
poor people can afford. 

6) What other research do you think is necessary to carry out under field conditions. 
Side by side inoculums trials with different strains would be invaluable, to determine which 
strains are superior and whether they are better than  native strains. Another critical aspect 
to determine would be response to phosphorus fertilizer and  micro­nutrients. That is what 
level of P is optimal, what form (super phosphate, rock phosphate) is optimal, and how this 
can be related to locally available soil tests or other (cost free indicators). 

Of  some  interest  would  also  be  the  potential  use  of  inoculated  legumes  as  green­ 
manure/mulches in fruit crops such as strawberries and tomato ­ de ­ arbol. 
However the strain experiments and the P fertilization experiments are much more critical. 
Hope  this  is  useful,  if  you  need  more  information  or  more  detailed  descriptions  let  me 
know. cheers, Jonathan. 

*  El  Dr.  Jonathan  Haskett  es  Ph.D.  graduado  en  la  Universidad  de  Minnesota.  Es 
especialista en Fertilidad de Suelos y actualmente se encuentra trabajando como voluntario 
del Cuerpo de Paz  en comunidades de la Provincia del Chimborazo.

75 
Anexo 4: Aprobación de propuesta (FUNDACYT).

76 
Anexo 5: Trípticos. 

5.1 Inoculación de la semilla de leguminosas con la bacteria Rhizobium. 
Gustavo Bernal, Alfonso Suárez, Mauricio Jeréz, Diego Campaña 
Plegable No. 195 (INIAP­PROMSA) 
Departamento Nacional de Protección Vegetal 
Estación Santa Catalina, INIAP. 
Agosto 2002 
(Plegable realizado) 

Pr opósito. 

La bacteria del genero Rhizobium tiene  la capacidad de fijar el  nitrógeno  del aire y convertirlo  en 


una  forma  que  las  leguminosas  puedan  aprovecharlo  para  su  desarrollo  y  buen  rendimiento.  Este 
proceso tiene lugar después de la germinación de la semilla,  en los nódulos (bolitas) formados en la 
raíz de la planta. 

La inoculación de las semillas con Rhizobium es una práctica de fertilización biológica nitrogenada 
que remplaza a la fertilización química. Con esta practica, se reducen los costos de fertilización, así 
como también la contaminación del suelo y del agua. 

Recomendaciones gener ales. 

El inoculante preparado a base de turba (tierra negra) debe ser tratado con ciertas precauciones, por 
cuanto  este  reúne  a  millones  de  bacterias,  las  mismas  que  necesitan  condiciones  adecuadas  para 
sobrevivir.  La  concentración  del  producto  es  de  10 9  células  viables  de Rhizobium  por  gramo  del 
inoculante. 

Ver ifique la fecha de vencimiento del inoculante. 

Verifique  que  el  inoculante  sea  apropiado  para  la  leguminosa  a  ser  sembrada.  Por  ejemplo  el 
inoculante de semilla de fréjol solo funciona en este cultivo.

77 
Solicite el inoculante por  lo menos 15 días antes de la siembr a. 

De preferencia use el inoculante inmediatamente después de comprarlo. 
Si la siembra de la semilla no es inmediata, conserve el inoculante antes de usarlo a una temperatura 
de 4 º C (parte baja de la refrigeradora), o en un lugar fresco por un máximo de cuatro meses. Evite 
almacenarlo junto con pesticidas o sustancias toxicas. 

¿Cuánto del inoculante debo usar  por  peso de semilla? 

La cantidad de inoculante a utilizarse depende del tamaño de la semilla. 

­ Para una leguminosa  de 1 a 10 semillas por gramo  (ej. Soya, Fréjol, Maní, Arveja, etc.),    utilice: 
10 gramos (2 cucharadas pequeñas llenas) de inoculante por kilogramo de semilla. 
­  Para una leguminosa de 11­20 semillas por gramo (ej.Leucaena), utilice: 20 gramos de inoculante 
por kilogramo de semilla. 
­ Para una leguminosa de 20 semillas o más por gramo (ej. Trébol, Alfalfa, Pueraria,    Centrosema), 
utilice: 50 gramos de inoculante por kilogramo de semilla. 

¿Cómo debo inocular  la semilla? 

­ Prepare una solución azucarada al 15%.  Para esto, coloque 15 gramos (3 cucharadas pequeñas) de 
azúcar negra en 85 mL (poco menos que media taza) de agua.  Agite vigorosamente hasta que el 
azúcar  se  diluya  por  completo.  La  cantidad  a  preparar  depende  de  la  cantidad  de  semilla  a 
sembrarse. Prepare solo lo necesario. 

­  Coloque  una  cantidad  apropiada  de  la  solución  azucarada  sobre  la  semilla  (ej.  contenida  en  un 
balde), hasta que todas las semillas obtengan un aspecto brilloso. No adicione más solución. 

­  Coloque  el  inoculante  y  mezcle  con  la  semilla  usando  un  palo  o  estaca.  La  distribución  del 
inoculante  debe  ser  homogénea,  sin  que  se  formen  grumos.  Seguir  mezclando  hasta  que  las 
semillas  empiecen  a  despegarse  una  de  la  otra.  Cada  semilla  debe  estar  cubierta  de  inoculante 
mostrando un color oscuro  homogéneo. 

­ Seque la semilla bajo sombra evitando que el inoculante se despegue de la semilla.

78 
¿Cuándo debo sembr ar  la semilla? 

­  De  preferencia  siembre  la  semilla  inmediatamente  después  de  la  inoculación  y  cúbrala  con  el 
suelo. El suelo debe estar suficientemente húmedo. Lo ideal es sembrar en horas de la mañana (7­ 
10 A.M). Evite temperaturas altas y días muy soleados. 

­  Evite  almacenar  la  semilla  inoculada,  pues  la  bacteria  Rhizobium  puede  perder  la  efectividad 
debido  a  toxinas  producidas  por  la  semilla,  y  desecamiento  de  las  células.  Además  la  semilla 
podría ser atacada por insectos o enfermedades. 

¿Qué debo hacer  si el suelo es muy ácido o muy básico? 

­ Si el suelo es ácido (pH 4­5) es recomendable cubrir las semillas recién inoculadas con carbonato 
de  calcio  hasta  que  todas  las  semillas  tengan  una  coloración  blanca  (pellet).  Siembre 
inmediatamente. 

­ Si el suelo es básico (pH 8 ­8.5) es recomendable recubrir la semilla con roca fosfórica después de 
la inoculación. Siembre inmediatamente. 

5.2 Estudio de la fijación simbiótica de nitrógeno de 3 cepas de Rhizobium etli en dos variedades de 
fréjol, bajo condiciones de campo (se adjunta). 
5.3 Evaluación de sustratos como alternativas de portadores de la bacteria Rhizobium (se adjunta). 
5.4 Selección de cepas eficientes en fijación biológica de nitrógeno, para producción de inoculante 
en maní (se adjunta). 
5.5  Inoculación de semilla de maní con bacteria Rhizobium  ( se adjunta) 
5.6 Tríptico en arveja (en revisión) 
5.7 Tríptico en soya (en revisión)

79 
20. FIRMA DE RESPONSABILIDAD 

ENTREGA­RECEPCIÓN DEL INFORME FINAL DEL PROYECTO IQ­CV­081 
Número total de páginas: 
Nombre y firma del Investigador Principal  del Proyecto  Fecha 
13­01­2004 

Gustavo Ber nal, Micr obiólogo de Suelos Ph.D. 


Responsable del Departamento Nacional de Protección Vegetal 
Estación Experimental Santa Catalina, INIAP. 

NOTAS IMPORTANTES 

­  El Informe Final del proyecto ha sido remitido el día martes 13 de enero del 2004. La razón 
del  envío  en  esta  fecha  se  debe  a  que  la  toma  de  datos  de  experimentos  que  todavía  se 
encuentran en campo (caso soya) fue realizada los últimos días del mes de diciembre/2003, 
de acuerdo al cronograma de actividades. 
­  Mayores  detalles  en  relación  con  los  estudios  de  la  selección  de  cepas  de  Rhizobium 
asociadas a los cultivos de fréjol y de maní se encuentran en las Tesis de Grado de los Ings. 
Diego  Campaña  y  Mauricio  Jerez.  El  presente  informe  presenta  solo  un  resumen  de  las 
tesis. 
­  Los informes trimestrales fueron realizados y entregados a tiempo. 
­  Los  inventarios  de  los  bienes  adquiridos  con recursos del proyecto  están siendo remitidos 
en el informe financiero final del proyecto, el mismo que esta a cargo del Departamento de 
Contabilidad de la Estación Santa Catalina, INIAP.

80