Está en la página 1de 38

Revista Argentina de

Año 20 • Nº 3 • 2009
REUMATOLOGÍA

Año 20 • Nº 3 • 2009
Sociedad Argentina de Reumatología

SOCIEDAD ARGENTINA
DE REUMATOLOGÍA
Revista Argentina de

REUMATOLOGIA
Fundada por el Dr. Armando Maccagno

SOCIEDAD Presidente Directores Comité Científico Nacional


ARGENTINA DE Dr. Horacio O. Venarotti José Maldonado Cocco Alfredo Arturi
REUMATOLOGÍA Julio Hofman Alberto Berman
Vicepresidente Luis J. Catoggio
Dr. Bernardo Pons Estel Gustavo Citera
Diana Dubinsky
Presidente anterior inmediato Comité de Revisión Ernesto Gutfraind
Dr. Alfredo S. Arturi Daniela Battaglia Juan Carlos Marcos
Rafael Chaparro del Moral Silvia Martins
Secretario Susana Metta Osvaldo D. Messina
Dr. Osvaldo D. Messina Virginia Ortiz Sergio Paira
Mariano Rivero Adriana Pérez Dávila
Tesorero Oscar Rillo
Dr. Gustavo C. Casado Comité de Honor Horacio Venarotti
Roberto Arana Diana Zoruba
Vocales Titulares Carlos Battagliotti
Dra. Eleonora Lucero María L. Sormani de Fonseca Comité Científico Internacional
Dr. Alejandro Nitsche Carlos Onetti Graciela S. Alarcón
Dr. Gustavo Citera Simón Palatnik Mary Carmen Amigo
Dr. Enrique Soriano Ana A. Porrini Roberto Arinoviche
Dr. Rodolfo Pardo Hidalgo Luis Seijo Juan Canoso
Dra. María Gallo De Sprazzato Alberto Strusberg Ricardo Cervera
Luis R. Espinoza
Vocales Suplentes Emilio Martín Mola
Dr. Eduardo Scheines Yehuda Shoenfeld
Dr. Alejandro Alvarellos María E. Suárez Almazor
Dra. Silvia Larroude

Revisores de Cuentas
Dr. Miguel Plaza
Dra. Mercedes García

Foto de tapa: Publicación trimestral La Revista Argentina de Editada por


“El alquimista”, © MV Comunicación & Reumatología se distribuye MV Comunicación &
Pintura de 1853 de Marketing® 2009 exclusivamente entre los Marketing®
williams fettes douglas. profesionales de la medicina.
Reservado todos los derechos. Director: Máximo Oberländer
Ninguna parte de esta publicación La Revista Argentina de Carlos Pellegrini 1327 - 2do “C”.
puede ser reproducida en ninguna Reumatología es una publicación Ciudad Autónoma de Buenos Aires.
forma o medio alguno, electrónico de la Sociedad Argentina de Tel.: (54.11) 4393-8223
o mecánico, incluyendo las fotoco- Reumatología (SAR). E-mail:
pias, grabaciones u otro sistema de Austria 2467, piso 7, of. A, info@mvcomunicacion.com
información sin la autorización por (1425) Buenos Aires.
escrito del titular del copyright. ISSN 0327-4411 www.mvcomunicacion.com
[ sumario ]

8 Editorial
Biofármacos y biosimilares

11 Artículo original
Anticuerpos antipéptidos cíclicos
citrulinados como marcadores de
diagnóstico y actividad en artritis
reumatoidea temprana

20
Artículo original
Determinantes de discapacidad funcional
en pacientes con espondilitis anquilosante
en Argentina

26
Artículo original
Caracterización inmunogenética de
pacientes con espondilitis anquilosante en
Argentina

37
Comité de Drogas de Alta Tecnología
(CODAT) Sociedad Argentina de
Reumatología
[ contents ]

8 Editorial
Biopharmaceuticals and Biosimilars

11 Articles
Anti-cyclic citrullinated peptide antibodies
as diagnostic and activity markers in early
rheumatoid arthritis

20
Articles
Risk factors for functional disability in
patients with ankylosing spondylitis in
Argentina

26
Articles
Immunogenetic profile of ankylosing
spondylitis in Argentina

37 “High Technology Drugs Committee” -


Argentinian Society of Rheumatology
[ editorial ]

Biofármacos y biosimilares
Pablo Matar
Doctor en Bioquímica, Investigador Adjunto CONICET, Facultad de Ciencias Médicas, Universidad Nacional de Rosario.

¿Qué es un biofármaco? El perfil de seguridad de los biofármacos utilizados


para el tratamiento de la artritis reumatoidea ha mejorado
Una definición clásica de biofármaco utilizada tanto en
con el avance de la tecnología empleada en su producción.
ámbitos académicos como en la industria es: “producto
Algunas de las nuevas plataformas tecnológicas incluyen
medicinal, terapéutico, profiláctico, o de diagnóstico in
la utilización de animales transgénicos, librería de fagos
vivo, cuyo principio activo es de naturaleza biológica y es
y linfocitos B humanos inmunizados in vitro. Un desafío
producido por biotecnología”. Los biofármacos pueden ser
adicional es el desarrollo de biofármacos dirigidos contra
proteínas recombinantes, anticuerpos monoclonales, vec-
nuevos y diferentes blancos moleculares identificados por
tores de material genético, fragmentos de anticuerpos, oli-
estudios genómicos y proteómicos, como el receptor de
gonucleótidos antisentido, vacunas, y otros. En la actua-
IL-6 (Tocilizumab, anticuerpo monoclonal humanizado),
lidad, uno de cada cuatro medicamentos disponibles en el
otras citoquinas implicadas en la patogénesis de las en-
mercado farmacéutico es un biofármaco, los cuales se utili-
fermedades inflamatorias, como IL-12 e IL-15, y algunas
zan en el tratamiento de diversas patologías, como cáncer,
quinasas intracelulares como JAK-3 y Syk.
anemias, alteraciones de la hemostasia, enfermedades neu-
rológicas, hematológicas, endocrinológicas y metabólicas,
y también en trasplantes y enfermedades autoinmunes. ¿Cómo se produce un biofármaco?
La producción de anticuerpos monoclonales por tecnología
Biofármacos en la terapia biológica de la del hibridoma y sus modificaciones, y la de proteínas re-
artritis reumatoidea combinantes por ingeniería genética, son procesos extraor-
dinariamente complejos consistentes en numerosas etapas
Las opciones terapéuticas para la artritis reumatoidea se
sometidas a estrictos controles de calidad. Los biofármacos
han incrementado enormemente en la última década con
son producidos a partir de sistemas biológicos vivos (bacte-
el desarrollo de diferentes biofármacos. Estos incluyen
rias, hongos, levaduras, células de mamíferos, tejidos de ori-
antagonistas de TNF-α (Infliximab, un anticuerpo mo-
gen vegetal o animal, animales de laboratorio). El proceso
noclonal quimérico que neutraliza TNF-α tanto en su
completo incluye técnicas de biología molecular e ingenie-
forma soluble como unida a membrana; Etanercept, una
ría genética, complejos sistemas de producción industrial a
proteína de fusión quimérica soluble que reconoce tam-
gran escala, tecnología especializada en aislamiento, purifi-
bién a TNF-β; y Adalimumab, un anticuerpo monoclonal
cación y análisis de productos biológicos y formulación del
totalmente humano), bloqueantes de señales co-estimula-
producto para ser administrado en pacientes. Importantes
torias para la activación de linfocitos T, como Abatacept
características diferencian a los biofármacos de las tradi-
(proteína de fusión soluble CTLA-4-Ig), y deplecionantes
cionales drogas químicas, como su elevado peso y tamaño
selectivos de linfocitos B, tal el caso de Rituximab (anti-
molecular, estructura tridimensional compleja e inestable,
cuerpo monoclonal quimérico anti-CD20).
micro-heterogeneidad, inestabilidad física y química, posi-
bles impurezas de difícil caracterización, actividad biológica
Correspondencia condicionada por el proceso de producción y características
pmatar@arnet.com.ar farmacocinéticas y farmacodinámicas particulares.

Revista Argentina de Reumatología • Año 20 • Nº 3 8


Cada etapa del proceso global de producción de un Marco regulatorio
biofármaco es un área de permanente investigación y de-
Las agencias de control de medicamentos carecen hasta el
sarrollo. Cualquier cambio en algunas de estas etapas pue-
momento de una legislación actualizada para el análisis de
de tener un profundo efecto sobre la actividad biológica
documentación tendiente a la aprobación de copias de bio-
y perfil de seguridad del producto final. Las consecuen-
fármacos. Para llenar ese vacío, la Organización Mundial
cias no deseadas más significativas de las modificaciones
de la Salud está elaborando un documento definitivo que
en algunas de las etapas del proceso de producción de un
contendrá los lineamientos básicos e indispensables para
biofármaco son los cambios en eficacia, seguridad e in-
la evaluación de los biosimilares. Este documento estará
munogenicidad. La singularidad de cada proceso de pro-
disponible antes de la finalización del año 2009 en http://
ducción de un biofármaco en particular ha conducido a la
www.who.int/biologicals/en/. En el mes de junio de 2009,
afirmación de que “el producto es el proceso”.
se publicó en el mismo sitio un documento preliminar para
su discusión pública. En este documento se destacan los
¿Existen genéricos de biofármacos? principios básicos para la aprobación de productos bioló-
gicos similares o copias de biofármacos innovadores: 1) es-
Algunas empresas de biotecnología están intentando de-
tricta evaluación de calidad, estudios pre-clínicos y clínicos
sarrollar copias de biofármacos originales, a las que de-
respecto al biofármaco de referencia; 2) los productos biosi-
nominan “biosimilares”. Esta situación está motivando
milares no son drogas genéricas, y por lo tanto los requisi-
profundos debates en ámbitos científicos, asistenciales y
tos para la aprobación de genéricos no son aplicables a estos
en organismos de control. Los expertos en cada área co-
fármacos; 3) los biofármacos de referencia y los biosimila-
inciden en afirmar que un biosimilar no es igual a un ge-
res requieren una regulación apropiada y efectiva para mi-
nérico. Contrariamente a lo que sucede con los productos
nimizar riesgos y maximizar sus beneficios; 4) la decisión
medicinales de síntesis química, para los cuales es posi-
de autorizar la sustitución automática de un biofármaco de
ble obtener fórmulas similares (genéricos) capaces de ser
referencia por uno copia estará regulada exclusivamente
comparadas por métodos físico-químicos y evaluadas a
por la legislación vigente en cada país y deberá estar funda-
través de ensayos de bioequivalencia, los biofármacos son
mentada en datos científicos y evidencia clínica teniendo en
moléculas únicas, cuya formulación final es altamente de-
cuenta el riesgo potencial de esta clase de fármacos.
pendiente del proceso global de producción, lo que hace
prácticamente imposible obtener copias a la manera de los
genéricos tradicionales. Cada biofármaco debe ser carac- Presente y futuro
terizado mediante ensayos pre-clínicos y estudios clíni-
La complejidad de los biofármacos, su investigación, de-
cos apropiados para evaluar su actividad biológica y tera-
sarrollo industrial y el control de su utilización para el
péutica, no siendo aplicables los principios de similitud y
tratamiento de enfermedades humanas, requiere de una
equivalencia de los clásicos medicamentos genéricos.
legislación particular y actualizada que contemple el cum-
La consecuencia clínica más relevante de la utilización
plimiento de todos los requisitos necesarios para su apro-
intercambiable de un biofármaco innovador por una copia
bación por las agencias de control, siendo indispensables
que no ha sido sometida a ensayos clínicos apropiados, es la
los datos aportados por ensayos clínicos diseñados para
inmunogenicidad. No existe ningún sistema analítico de la-
evaluar la eficacia y seguridad de cada uno de ellos, así
boratorio capaz de predecir la inmunogenicidad de un bio-
como también de las modificaciones en los procesos de
fármaco in vitro. En todos los casos se debe recurrir a en-
elaboración que se puedan implementar.
sayos clínicos que contemplen la evaluación de la respuesta
inmune hacia un fármaco determinado. La utilización de
biosimilares que no hayan cumplido con los exhaustivos Bibliografía
controles de calidad pre-clínicos y clínicos a los cuales son 1. Wurm FM. Manufacturing of biopharmaceuticals and impli-
sometidos los biofármacos originales, puede causar reaccio- cations for biosimilars. Kidney Blood Press Res 2007;30(suppl
nes anafilácticas, neutralización del producto, alteraciones 1):6-8.
farmacocinéticas y/o farmacodinámicas por formación de 2. Weaver AL. The impact of new biologicals in the treatment of
complejos inmunes, e incluso falta de eficacia terapéutica. rheumatoid artritis. Rheumatology 2004;43(Suppl. 3):iii17-iii23.
3. Khraishi M. Comparative overview of safety of the biologics
in rheumatoid artritis. J Rheumatol 2009;36 Suppl 82:25-32.

Revista Argentina de Reumatología • Año 20 • Nº 3 9


[ artículo original ]

Anticuerpos antipéptidos cíclicos citrulinados


como marcadores de diagnóstico y actividad en
artritis reumatoidea temprana
Debora Ingrid Sohn1, Ana María Berón1, María Selva Pino2, Maria Cristina Lunic1,3, Luis Seijo4, Gustavo
Nasswetter4,5
Reumatóloga¹. Bioquímica2. Psicoterapeuta3. Reumatólogo4. Jefe de división5. División Reumatología, Hospital de Clínicas José de San Martín,
Universidad de Buenos Aires.

Resumen Summary
Objetivos: Determinar el valor diagnóstico de los Ac aCCP de segun- Objetives: To determine the diagnostic value of Ac ACCP second
da y tercera generación para AR de reciente comienzo y compararlos and third generation in the early AR compared to the diagnostic
con el valor diagnóstico del FR. Evaluar la actividad de la enfermedad value of FR. To assess disease activity by DAS28 score to establish
mediante el score DAS28 al establecer el diagnóstico de AR. the diagnosis of RA.
Resultados: Se analizaron los datos de 149 pacientes (75,3% mujeres Results: We analyzed data from 149 patients (75.3% women and
y 24,7% varones). La edad media de los pacientes fue 58 ± 14. Al final del 24.7% males). The average age of patients was 58 ± 14. At the end of
estudio, 61 (40,9%) cumplieron criterios para AR. Los valores de cribaje the study, 61 (40.9%) met criteria for RA. The values of screening for
de estos anticuerpos demuestran una sensibilidad superior para las dos these antibodies demonstrated a higher sensitivity for the two gen-
generaciones de Ac aCCP con respecto al FR, con una especificidad simi- erations of Ac aCCP with respect to the FR, with a similar specificity
lar para todos los anticuerpos. La actividad de la enfermedad al momento for all antibodies. Disease activity at diagnosis by DAS28 score was
del diagnóstico medida por DAS28 fue similar en todos los grupos. similar in all groups.
Conclusiones: Los resultados indican que no existen diferencias Conclusions: The results indicate that there were no statistically
estadísticamente significativas en los valores de cribaje entre los Ac significant differences among two generations of Ac aCCP for the
anti CCP de las dos generaciones para el diagnóstico de AR. Los va- diagnosis of RA, with a large difference with respect to the RF. The
lores de cribaje de estos anticuerpos demuestran una sensibilidad values of screening for these antibodies demonstrated a higher
superior para las dos generaciones de Ac aCCP con respecto al FR, sensitivity for the two generations of Ac aCCP with respect to the
con una especificidad similar para todos los anticuerpos. No hubo FR, with a similar specificity for all antibodies. The activity at the
diferencias en la actividad de la enfermedad al inicio. onset of the disease was similar for all the groups.

Palabras clave: artritis reumatoidea temprana, artritis reumatoi- Key words: early rheumatoid arthritis, rheumatoid arthritis, Ac
dea, Ac anti CCP, factor reumatoideo, DAS28. aCCP, rheumatoid factor, DAS28.

Correspondencia
Hospital de Clínicas José de San Martín, Universidad de Buenos Aires.
División Reumatología. Av. Córdoba 2351, 8º piso, CP 1120. Ciudad
autónoma de Buenos Aires, Argentina.
Tel y Fax: 5411-5950-8998/5411-4823-5685.
debysohn@yahoo.com.ar

Revista Argentina de Reumatología • Año 20 • Nº 3 11


Introducción ELISA de segunda generación que mejoró la sensibilidad
y especificidad de los primeros ensayos12. Por tratarse
El término artritis reumatoidea (AR) fue acuñado por Sir
de una técnica semicuantitativa, permite su estandariza-
Alfred Baring Garrod en 1852, aceptado por el Empire
ción y la posibilidad de ser utilizada por la mayoría de
Rheumatism Council en 1922 y por el American Rheuma-
los laboratorios de inmunología para su aplicación en la
tism Association en 1941 (actualmente American College
práctica clínica13. No sustituyen al factor reumatoideo
of Rheumatology, ACR)1. Es una enfermedad inflamato-
(FR) pero aportan datos complementarios importantes
ria, de etiología desconocida, caracterizada por poliartritis
para el diagnóstico temprano y pronóstico de la enferme-
simétrica de grandes y pequeñas articulaciones, compro-
dad y, por lo tanto, influyen en las conductas actuales de
miso sistémico y evolución crónica, progresiva y discapa-
tratamiento5,6.
citante con un impacto socioeconómico importante.
Diversos trabajos han podido demostrar la sensibili-
El diagnóstico de enfermedad es principalmente clíni-
dad y especificidad de los Ac aCCP2 en la artritis reuma-
co. Hasta ahora no existen hallazgos al examen ni prue-
toidea. En resumen, todos ellos muestran una sensibilidad
bas de laboratorio patognomónicas. El ACR desarrolla
de aproximadamente entre 65 y 75% para la artritis reu-
en 1987 un grupo de criterios para la clasificación pero
matoidea, con una alta especificidad que ronda el 95-99%,
muchos pacientes no los cumplen en especial al comienzo
con un valor predictivo positivo de 83% y un valor pre-
de la enfermedad, retrasando el diagnóstico. Este es un
dictivo negativo del 79%15,16. La determinación conjunta
problema relevante ya que el pronóstico de la enferme-
del FR y los Ac aCCP, al inicio de los síntomas, mostró
dad depende en gran medida de un tratamiento precoz 2 y
un valor predictivo positivo del 100%17,18. Riedemamm y
una demora de tan solo 3 meses en iniciar el tratamiento
Kavanaugh, en una revisión publicada en 2005, hallaron
adecuado reduce la oportunidad de remisión de la enfer-
medad 3. un odds ratios de 37,8 para desarrollar AR en pacientes
El único marcador serológico incluido en los crite- con poliartritis de reciente comienzo, sin diagnóstico pre-
rios de clasificación del ACR es el Factor Reumatoideo vio con CCP2 positivo y de 15,9 en individuos sanos con
IgM (FR), cuyas desventajas son su baja especificidad y CCP positivo11.
su aparición tardía (no colabora en el diagnóstico precoz Actualmente se postula que 70-80% de las AR son
de AR)1,4. Por estos motivos, la búsqueda de marcadores Ac aCCP positivo y estas determinan un “subgrupo o
tempranos de la enfermedad se ha profundizado en los variante” más severa de la enfermedad con mayor activi-
últimos tiempos, teniendo en cuenta su importancia para dad desde el comienzo (DAS28), mayor destrucción ar-
iniciar un tratamiento adecuado y precoz que intente de- ticular (progresión radiográfica por score van der Heijde
tener el daño articular. modificado), peor respuesta a los DMARDS y mayor de-
Los anticuerpos antipéptidos cíclicos citrulinados (Ac terioro de la función articular a largo plazo (HAQ)12-15.
aCCP) son un grupo de autoanticuerpos específicos para En una cohorte de 125 pacientes con diagnóstico de AR
AR dirigidos contra residuos citrulinados de la filagrina seguidos longitudinalmente por 10 años, se observó que
que prometen cumplir los requisitos para ser un marcador los Ac aCCP son predictores independientes de progre-
precoz de enfermedad5,6. sión radiográfica por score van der Heijde modificado
No fue hasta 1998, cuando Schellekens y colaborado- (OR = 4,0)16 .
res comprobaron que los autoanticuerpos no se dirigían Por otro lado, estos anticuerpos suelen permanecer es-
contra toda la molécula de filagrina sino contra ciertos tables durante el curso de la enfermedad, lo que apoya la
fragmentos citrulinados de esta molécula, y comprobaron teoría de las variantes dentro de la AR4.
que la citrulinización era necesaria para que las moléculas En el año 2005 comenzaron a estar disponibles en el
de filagrina fuesen reconocidas por los autoanticuerpos mercado equipos de ELISA con antígeno de tercera ge-
específicos de la AR7. neración (CCP3) que permiten detectar anticuerpos anti
Schellekens y col desarrollan un primer estudio con CCP3 IgG. Algunos pacientes con AR tienen en el suero
la técnica de enzimoinmunoanálisis (ELISA) utilizando anticuerpos que no reaccionan con el antígeno de segunda
péptidos citrulinados de filagrina, con el que obtuvieron generación (Ac aCCP2 negativo), pero sí lo hacen al en-
una sensibilidad del 76% y una especificidad del 96% frentarlos a otras proteínas citrulinadas, lo que sugiere la
para AR. El mismo grupo de trabajo consiguió, mediante existencia de otros epítopes antigénicos que no están pre-
el ciclado de algunos de los péptidos, el desarrollo de un sentes en la secuencia del antígeno CCP229. Posteriormen-

12
te, se agrega el CCP3.1; el antígeno utilizado en el equipo matorio que consultaron al servicio de Reumatología del
de ELISA es el mismo que el del CCP3 (tercera genera- Hospital de Clínicas, entre marzo 2004 y marzo de 2005.
ción) pero contiene un conjugado que permite detectar Criterios de exclusión:
anticuerpos anti CCP3 clase IgA además de los habituales Pacientes que no concurren a las citas de seguimiento
anticuerpos anti CCP3 IgG18. y control.
Como revisión de estos últimos 10 años de trabajo con Todos los pacientes incluidos en el trabajo firmaron el
Ac aCCP (desde que Schellekens y colaboradores desa- consentimiento informado correspondiente.
rrollan el primer estudio), podemos sintetizar que estos
autoanticuerpos son: Definiciones:
1. Marcadores serológicos específicos para AR tem- Se establece el diagnóstico de AR a todo paciente con
prana. poliartritis, bilateral y simétrica de pequeñas y grandes
2. Predictores tempranos de variantes o subgrupos de articulaciones que cumplan con los criterios de clasifica-
AR más severa. ción del ACR 1987 (Tabla 1).
3. Indicadores tempranos de progresión del daño y El resto de los pacientes que no cumplieron con estos
función articular. criterios fueron clasificados en otras enfermedades reu-
4. Existe una predisposición genética (HLADRB1 y máticas de acuerdo a los criterios que reunieron al final
PTPN22) para el desarrollo de este subgrupo de AR del estudio.
severa. DAS28: disease activity score.
5. Se constata una asociación positiva con tabaco en pa-
cientes genéticamente predispuestos (HLADRB1)19. Variables independientes:
Se analizaron las siguientes variables:
FR por la técnica de aglutinación de látex en placa.
Objetivos
Ac aCCP por ELISA de 2º y 3º generación (CCP3 y
• Determinar el valor diagnóstico (sensibilidad, especi- CCP3.1).
ficidad y valor de verosimilitud) de los Ac aCCP de Valoración clínica. Cada paciente fue evaluado con un
segunda y tercera generación para AR en pacientes con promedio de 4,5 veces a lo largo del estudio.
poliartritis/poliartralgias de reciente comienzo y com- Evaluación de la actividad de la enfermedad por
pararlos con el valor diagnóstico del FR. DAS28.

• Evaluar actividad de la enfermedad mediante el score Las extracciones de sangre se realizaron en fecha
DAS2820-21 al establecer el diagnóstico de AR en cada próxima a la primera consulta en tubos con aceleradores
uno de los siguientes grupos y calcular el porcentaje de de la coagulación, el suero fue separado dentro de las 2 hs,
pacientes en cada grupo: frizándose las muestras a –20º C hasta su procesamiento.
1. CCP3 positivo y FR negativo; El FR (IgM) se determinó por aglutinación de partí-
2. CCP3 positivo y FR positivo; culas de látex Artritest (Wienner®) semicuantificándose
3. CCP3 negativo y FR positivo; por diluciones al medio; se consideraron positivos valores
4. CCP3 negativo y FR negativo. superiores o iguales a la dilución 1/40.
En este trabajo se utilizó la técnica de aglutinación
para determinar el FR, debido a esto podría haber alguna
Material y métodos discrepancia con otros trabajos que utilizan como método
la nefelometría o el ELISA.
Criterios de inclusión: Para la detección semicuantitativa de los Ac anti CCP
1) Pacientes de ambos sexos, mayores de 16 años, con en el suero de los pacientes se realizó un enzimoinmu-
poliartritis de 6 semanas a 6 meses de evolución sin diag- noensayo por adsorción. Se utilizaron equipos ELISA
nóstico previo que consultaron al servicio de Reumatolo- QUANTA lite: CCP, CCP3 y CCP3.1 marca INOVA. Se
gía del Hospital de Clínicas, entre marzo 2004 y marzo consideran positivos valores iguales o mayores de 20 UA.
de 2005. INOVA llama al equipo de segunda generación de an-
2) Pacientes con poliartralgias sin componente infla- tígeno ELISA CCP en lugar de ELISA CCP2.

Revista Argentina de Reumatología • Año 20 • Nº 3 13


El antígeno del equipo ELISA CCP3 es el mismo an- dio, del servicio de Reumatología del Hospital de Clínicas
tígeno de tercera generación que el del equipo CCP3.1. “José de San Martín” en cada consulta. Los datos recolec-
Difieren en el conjugado, con el primero se detectan sólo tados en dicha planilla se almacenaron en computadora
anticuerpos anti CCP3 isotipo IgG mientras que con el (PC) a través del programa Microsoft Office Excel 2007®,
conjugado del segundo equipo se detectan anticuerpos Windows XP Professional®.
anti CCP3 tanto en el isotipo IgG como en el IgA.
Se realizó una evaluación por reumatólogos exper- Almacenamiento y procesamiento estadístico:
tos al momento de la consulta y cada 15 semanas por un Los datos fueron volcados en una base de datos (Mi-
período de 1,5 años. En cada consulta se evaluaron los crosoft Excel 2003) y luego fueron analizados empleando
datos expresados en la planilla de registro de datos. Los el paquete estadístico (Medcalc 9.1 y VCCstat 2.0). Para
diagnósticos se realizaron en el momento de la consulta todas las variables se estableció su distribución de frecuen-
final. cias y/o porcentajes en relación con el total de casos. Para
aquellas medidas en escala ordinal o superior, se compu-
Se registraron los siguientes datos para el cálculo de la taron las siguientes estadísticas: número de casos, valor
escala DAS28 (primera consulta): mínimo hallado, valor máximo hallado, media aritmética,
Número de articulaciones dolorosas (N.A.D.). Rango: desvío típico y error típico. Cuando fue necesario se reali-
0-28 zaron las estimaciones de valores de cribaje (sensibilidad,
Número de articulaciones tumefactas (N.A.T.). Rango especificidad, poderes predictivos y razones de verosimi-
0-28 litud), sus respectivos intervalos de confianza del 95% y
Eritrosedimentación o Proteína C Reactiva. se graficaron las curvas ROC junto con la estimación del
Evaluación global de la enfermedad por el paciente, área bajo la curva (ABC).
por EAV.
Resultados
Para el conteo articular no se consideran las articula-
ciones de pies, tobillos y caderas. Descripción de la muestra:
Se analizaron los datos de 149 pacientes (75,3% muje-
Cálculo del DAS28: res y 24,7% varones).
Puede utilizarse con o sin evaluación global y, en El promedio de edad fue 58 ± 14 (mínimo = 22, media-
acuerdo a ello, contar con tres o cuatro ítems a volcar en na = 58, máximo = 88).
dos fórmulas diferentes: Al final del estudio, 61 (40,9%) cumplieron criterios
DAS - 28 - 4 (4 variables) = 0,56 (√ N.A.D.-28) + 028 (√ de clasificación suficientes para AR; 17 (11,4%) para LES;
N.A.T-28) + 0,70 (In VSG) + 0,014 (E.G.P.) 3 (2%) para Artritis Psoriásica; 7 (4,7%) para Poliartritis
DAS - 28 - 3 (3 variables) = 0,56 (√ N.A.D. 28) + 0,28 Indeterminada; 50 (33,6%) para Fibromialgia y 11 (7,4%)
(√ NAT 28) + 0,70 (In VSG) × 1,08 + 0,16 para otras patologías.
El rango del DAS28 va de 0 a 9,4. El análisis de los diferentes métodos de diagnóstico
Interpretación del DAS28: para la detección de artritis reumatoidea se observa en las
DAS28 ≤3,2 = baja actividad. Tablas 1 y 2.
DAS28 >3,2 - ≤5,1 = moderada actividad. En estas tablas se describen los anticuerpos que pre-
DAS28 >5,1 = alta actividad. sentaron los pacientes que cumplieron criterios suficientes
para AR al final del estudio. Se tomaron los resultados
para el cálculo de sensibilidad y especificidad que se des-
Diseño
criben en las tablas.
Se realizó un estudio comparativo intrasujeto, prospecti- Los valores de cribaje de estos anticuerpos demuestran
vo, observacional, descriptivo y longitudinal. Con mues- una sensibilidad superior para las dos generaciones de Ac
tras cegadas e independientes. aCCP con respecto al FR, con una especificidad similar
Procesamiento de datos: para todos los anticuerpos. Los valores predictivos positi-
Se utilizó una planilla de registro de datos, que fue lle- vos también fueron similares para todos los anticuerpos.
nada a mano por reumatólogos entrenados para este estu- Es de destacar que la razón de verosimilitud (RVP) fue

14
superior para los Ac aCCP principalmente para el Ac aC- tenían características demográficas similares, todos los
CP3, con una amplia diferencia con respecto al FR. Esto pacientes fueron evaluados al inicio de la enfermedad y
indica que si el resultado del test es mayor, estos pacientes ninguno de ellos estaba en tratamiento al momento de la
presentan más chances de tener la enfermedad. Además determinación del DAS28.
la RVP es independiente del número de determinaciones El 37,7% (grupo 1) de los pacientes con AR tuvieron
realizadas a diferencia de los valores predictivos, lo cual es Ac aCCP positivo y FR negativo; en ese grupo, llamativa-
útil en el caso de muestras pequeñas, sin perder exactitud mente el porcentaje de mujeres (95%; 22:1) fue mayor a lo
en los resultados. El PPP se asocia a la sensibilidad y el descrito en la bibliografía (70%; 3:1).
PPN a la especificidad y dependen del número de deter- El DAS28 al inicio de la enfermedad- promedio fue
minaciones realizadas, por tal motivo es posible encontrar 5,85 (3,75 a 8,25).
resultados discordantes en este trabajo. De los 61 pacientes con diagnóstico final de AR, 32
En este gráfico se comparan las áreas bajo la curva presentaron FR negativo y dentro de este subgrupo 23
(ABC) ROC evidenciando que los anticuerpos aCCP tie- fueron positivos para CCP3 y 24 para CCP3.1.
nen valores más cercanos al 1 que es el valor ideal. En este
caso el Ac aCCP 3.1 es el que presenta un valor superior.
Discusión
Con esta determinación estadística, podemos diferenciar
a la población sana de la enferma utilizando este método La determinación del RVP fue muy útil en nuestro traba-
de diagnóstico. jo ya que nos permitió independizar del número de casos
Si observamos el trazado de la curva ROC, vemos que estudiados a diferencia de los valores predictivos positivos
la curva de este anticuerpo tiene un valor levemente su- y negativos (PPP y PPN).
perior que el resto de los Ac aCCP, y mucho mayor que La curva ROC es otra medida estadística que sirve
el FR. para comparar test de diagnóstico; la curva que obtuvi-
Si analizamos las diferencias entre las ABC, hallamos mos sugiere que el Ac aCCP tiene mayor sensibilidad y es-
valores estadísticamente significativos al comparar los Ac pecificidad que el FR ya que sus valores son más cercanos
aCCP y el FR, con un valor más significativo al comparar al vértice superior izquierdo. Ese vértice expresa un valor
el FR y el CCP3.1, ya que éste es el que presentaba el valor de sensibilidad y especificidad de 100%. En un estudio
más alto. Los intervalos de confianza del 95% se hallan prospectivo con AR establecida, Münevver y col compa-
comprendidos en valores de más de una decena, debido a raron la sensibilidad y especificidad de ambos anticuerpos
que las determinaciones realizadas fueron escasas. encontrando resultados similares13.
La comparación entre los métodos fue representada en El ABC también fue calculado y comparado para am-
el Gráfico 1. bos anticuerpos, obteniendo diferencias estadísticamente
Las curvas ROC demuestran dos grupos de pruebas: significativas a favor del Ac aCCP. Si evaluamos el ABC,
las de los Ac aCCP y las del FR. Para los Ac aCCP, las existe una leve diferencia a favor del Ac anti CCP3.1
curvas son muy similares entre sí y más cercanos al punto con respecto al Ac anti CCP3. El intervalo de confianza
0,1 que sería la clasificación perfecta, sin falsos positivos. (IC95%) obtenido no se halló entre la misma decena debi-
Se observa una ligera superioridad para el Ac aCCP 3.1. do a que el número de casos evaluados fue escaso.
La curva del FR está más cercana al punto 0,5, en el espa- La actividad de la enfermedad al inicio de la enferme-
cio ROC; ese punto indica que la mitad sería VP y la otra dad fue similar en todos los grupos. El Ac aCCP no fue un
mitad FP. Ya que el valor del eje de las X expresa los FP y marcador de mayor actividad al inicio de la enfermedad en
el eje de las Y los VP, esto puede comprenderse bien. nuestro estudio. En un estudio de Niewold y col, realizado
La Tabla 5 describe los porcentajes de pacientes en- en AR establecida y bajo tratamiento de DMARDS, tam-
contrados en cada grupo de anticuerpos. En el grupo 2 se poco se halló correlación entre el Ac aCCP y parámetros
presentaron el mayor número de pacientes. La actividad de actividad de la enfermedad como VSG, PCR, HLA,
de la enfermedad al momento del diagnóstico medida por DAS y EAV13. Sin embargo, Münevver y col encontraron
DAS28 fue similar en todos los grupos (p >0,05). A pesar una correlación mayor entre el Ac aCCP y la actividad de
de que en la literatura el Ac aCCP es un marcador de ma- la enfermedad en comparación con el FR14 .
yor actividad, nosotros no hallamos diferencias al menos
al inicio de la artritis. Es de destacar que todos los grupos

Revista Argentina de Reumatología • Año 20 • Nº 3 15


Conclusiones Dg. final de AR
Los resultados indican que existen diferencias significa-
FR Pos Neg Total
tivas en el valor diagnóstico de los Ac aCCP y del Factor
Reumatoideo. La sensibilidad fue mayor y la especificidad Pos 29 3 32
similar al FR. Un resultado similar fue obtenido por Kita- Neg 32 85 117
hara y col para AR temprana y establecida 30 .
Total 61 88 149
Habría una diferencia a favor del ELISA CCP3 si con-
sideramos la RVP. Esto indica que el paciente que tiene Dg. final de AR
este Anticuerpo positivo tiene más chances de tener Artri-
tis Reumatoidea que el que tiene FR positivo. Ac aCCP2 Pos Neg Total
Los AC aCCP al inicio de la enfermedad fueron más Pos 48 3 51
frecuentes que el FR en forma aislada (44% vs. 6,5%), y
Neg 13 85 98
la asociación de ambos (41%). Por lo que probablemente
su aparición es más precoz que el del FR. Nosotros no Total 61 88 149
evaluamos en forma longitudinal a nuestra población para
confirmar esta hipótesis. Dg. final de AR
Nuestro trabajo presenta algunas limitaciones: el nú- Ac aCCP3 Pos Neg Total
mero de pacientes fue escaso, el estudio se extendió por un
Pos 51 3 54
año y medio, y no realizamos una nueva determinación de
estos anticuerpos. Neg 10 85 95
Mayor número de pacientes, mayor tiempo de estudio Total 61 88 149
y un número superior de determinaciones de los anticuer-
pos podrían aportar más datos acerca del valor pronóstico Dg. final de AR
de Ac anti CCP.
Ac aCCP3.1 Pos Neg Total
Aún no existe consenso sobre qué método debería rea-
lizarse para el diagnóstico de la AR; muchos optan por Pos 52 5 57
realizar las dos técnicas para mejorar la especificidad. El Neg 9 83 92
FR está incluido en los criterios diagnósticos de AR de
1987; de acuerdo a nuestros resultados, los Ac anti CCP Total 61 88 149
son específicos para AR y podrían ser considerados como
Tabla 1. El análisis de los diferentes métodos de diagnóstico para la
otro criterio diagnóstico de Artritis Reumatoidea en el fu-
detección de artritis reumatoidea.
turo. Más estudios clínicos deberían realizarse para con-
firmar estos datos.

Valores de Cribaje FR (IC95%) Ac aCCP2 (IC95%) Ac aCCP3 (IC95%) Ac aCCP3.1 (IC95%)

Sensibilidad 48% (35 – 61) 79% (66 – 88) 84% (72 – 91) 85% (73 – 93)
Especificidad 97% (88 – 99) 97% (88 – 99) 97% (88 – 99) 94% (87 – 98)
VPP 91% (75 – 98) 94% (80 – 99) 94% (81 – 99) 91% (78 – 97)
VPN 73% (64 – 80) 87% (78 – 93) 90% (81 – 95) 90% (74 – 96)
RVP 13,9 (4,4 – 43,7) 23,1 (7,5 – 70,7) 24,5 (8,1 – 74,9) 15 (6,3 – 35,3)

RVN 0,54 (0,42 – 0,69) 0,22 (0,13 – 0,35) 0,17 (0,09 – 0,30) 0,15 (0,08 – 0,28)

Tabla 2. Valores de cribaje para los distintos anticuerpos.

16
Método ABC* EE** IC95%

FR 0,698 0,052 0,598 a 0,786


Ac aCCP2 0,854 0,037 0,769 a 0,917

Sensibilidad
Ac aCCP3 0,879 0,034 0,798 a 0,936
Ac aCCP3.1 0,887 0,033 0,807 a 0,942

Tabla 3. Comparación entre los distintos métodos diagnósticos.


*ABC: área bajo la curva; ** EE: error estándar

FR ~ Ac. aCCP2 Especificidad 100

Diferencias entre ABC 0,156


Gráfico 1. Curva de los distintos métodos diagnósticos empleados
Error estándar 0,057 para la detección de AR.

95% intervalo de confianza 0,045 – 0,267


Nivel de significación p = 0,006 Bibliografía
FR ~ Ac aCCP3 1. Arnett FC, Edworthy SM, Bloch DA et al. The American
Rheumatism Association 1987 revised criteria for the clas-
Diferencias entre ABC 0,180 sification of rheumatoid arthritis. Arthritis Rheum 1988;
31:315-24.
Error estándar 0,057 2. Boers M. Understanding the window of opportunity con-
95% intervalo de confianza 0,069 – 0,292 cept in early rheumatoid arthritis. Arthritis Rheum 2003;
48(7):1771-4.
Nivel de significación p = 0,002 3. Verstappen SM, Jacobs JW, Bijlsma JWJ et al. Five-years fol-
lowup of rheumatoid arthritis patients after early treatment
FR ~ Ac aCCP3.1 with disease-modifying antirheumatic drugs versus treatment
according to the pyramid approach in the first year. Arthritis
Diferencias entre ABC 0,189 Rheum 2003; 48:1797-1807.
Error estándar 0,057 4. Rönnelid J, Wick MC, Lampa J, et al. Longitudinal analysis
of citrullinated protein/peptide antibodies (anti-CCP) dur-
95% intervalo de confianza 0,077 – 0,300 ing 5 year follow up in early rheumatoid arthritis: anti-CP
status predicts worse disease activity and greater radiologi-
Nivel de significación p = 0,001 cal progression. Ann Rheum Dis 2005; 64:1744-9.
5. Gómez A. Anticuerpos anti-PCC. Rev Esp Reumatol. 2005;
Tabla 4. Diferencias entre ABC de los distintos métodos diagnósticos. 32 (3):85-7.

Grupos Pacientes n (%) Mujeres n (%) Varones n (%) DAS 28

Ac aCCP3+ / RF- 24/61 (39,0) 23 (95,8) 1 (4,4) 5,84 (3,82 – 7,57)


Ac aCCP3+ / RF+ 27/61 (44,2) 16 (59,3) 11(40,7) 5,88 (3,73 – 8,70)
Ac aCCP3- / RF+ 2/61 (3,2) 1 (50,0) 1 (50,0) 5,32 (3,75 – 6,23)
Ac aCCP3- / RF- 8/61 (13,1) 6 (75,0) 2 (25,0) 5,88 (4,38 – 7,50)

Tabla 5. Actividad de la enfermedad en los diferentes grupos.

Revista Argentina de Reumatología • Año 20 • Nº 3 17


6. Gómez Centeno A. Anticuerpos antipéptidos citrulinados en Overview and Perspective of the Diagnostic Abilities of this
artritis reumatoidea. Rev Esp Reumatol 2004; 31 (4):165-8. Serological Marker for Early Rheumatoid Arthritis. Clinic
7. Schellekens GA, De Jong BA, Van den Hoogen FH et al. Cit- Rev Allerg Immunol 2008; 34:36-39.
rulline is an essential constituent of antigenic determinants 16. Syversen SW, Gaarder PI, Goll, GL et al. High anti-cyclic
recognized by rheumatoid arthritis-specific autoantibodies. J citrullinated peptide levels and an algorithm of four variables
Clin Invest 1998; 101:273-81. predict radiographic progression in patients with rheuma-
8. Schellekens GA, Visser H, De Jong BA et al. The diagnostic toid arthritis: results from a 10-year longitudinal study. Ann
properties of rheumatoid arthritis antibodies recognizing a Rheum Dis 2008; 67:212-217.
cyclic citrullinated peptide. Arthritis Rheum 2000; 43:155-63. 17. Mittermayer S, Murray B, Kiyumitzu H et al. A comparison
9. Steiner G, Nell V, Eberl G et al. Autoantibodies in very early of the frequency of autoantibodies to cyclic citrullinated pep-
rheumatoid arthritis: diagnostic tools or pathogenic players? tides using a third generation CCP assay (CCP3) in systemic
Arthritis Res. 2003; 5:S37. sclerosis, primary billiary cirrhosis and rheumatoid arthritis.
10. Nishimura K, Sugiyama D, Kogata Y et al. Meta-analysis: Di- Clin Rheumatol. 2008; 27:77-83. DOI: 101007/s10067-007-
agnostic Accuracy of Anti–Cyclic Citrullinated Peptide Anti- 0656-4.
body and Rheumatoid Factor for Rheumatoid Arthritis. Ann 18. Vieira LEA, Pereira IA, D’dorsi E et al. Rheumatoid arthritis
Intern Med 2007; 146:797-808. diagnosis: a comparative study of second and third genera-
11. Riedemann JP, Muñoz S, Kavanaugh A. The use of second tion anti-cyclic citrullinated peptide (CCP) ELISAs. Arthritis
generation anti-CCP antibody testing in Rheumatoid arthri- Rheum 2007; 56: S724.
tis-A systematic review. Clin Exp Rheumatol 2005; 23:s69- 19. Niewold, M.J. Harrison and S.A. Paget. Anti-CCP antibody
s76. testing as a diagnostic and prognostic tool in rheumatoid ar-
12. Klareskoga L, Widhea M, Hermanssona M and Rönnelid thritis. Q J Med 2007; 100:193–201.
J. Antibodies to citrullinated proteins in arthritis: pathol- 20. Prevoo MLL, van‘ t Hof MA, Kuper HH, van Leeuven MA,
ogy and promise. Current Opinion in Rheumatology 2008; van de Putte LBA, van Riel PLCM: Modified disease activ-
20:300-305. ity scores that include twenty-eight-joint counts. Develop-
13. Serdaroflu M, Çakirbay H, Defer O, et al. The association ment and validation in a prospective longitudinal study of
of anti-CCP antibodies with disease activity in rheumatoid patients with rheumatoid arthritis. Arthritis Rheum 1995;
arthritis. Rheumatol Int. 2008 DOI 10.1007/s00296-008- 38:44-48.
0570-3. 21. Fransen J, Stucki G, van Riel PLCM: Rheumatoid Arthritis
14. Machold KP, Stamm TA, Nell VP et al. Very recent onset Measures. Disease Activity Score (DAS), Disease Activity
rheumatoid arthritis: clinical and serological patient charac- Score 28 (DAS28), rapid assessment of disease activity in
teristics associated with radiographic progression over the Rheumatology (RADAR), and Rheumatoid Arthritis dis-
first years of disease. Rheumatology 2007; 46:342-349. ease activity index (RADAI). Arthritis Rheum 2003; 49,
15. Van Venrooij WJ, Zendman AJ. Anti-CCP2 Antibodies: An (5S): 214-224.

18
[ artículo original ]

Determinantes de discapacidad funcional en


pacientes con espondilitis anquilosante en
Argentina
M. F. Marengo, E. E. Schneeberger, S. Gagliardi, J. A. Maldonado Cocco, G. Citera
IREP (Instituto de Rehabilitacion Psicofisica - Buenos Aires - Argentina).

Resumen Summary
La espondilitis anquilosante (EA) es una enfermedad crónica que Ankylosing Spondylitis (AS) is a chronic disease, characterized by
se caracteriza por dolor lumbar, rigidez, limitación de la movilidad inflammatory back pain, stiffness, limitation in spinal mobility fati-
espinal, fatiga y depresión que conducen a pérdida de la capacidad gue and depression leading to loss in functional capacity. Objective:
funcional. El objetivo de este estudio fue determinar las principales To identify main variables associated to functional disability in AS
variables asociadas a discapacidad funcional en pacientes con EA. patients.
Pacientes y métodos: Se incluyeron pacientes con EA (criterios de Material and Methods: AS patients older than 16 years accor-
NY modificados) mayores de 16 años. Se recolectaron datos demo- ding to New York modified criteria were included. Demographic,
gráficos, nivel educacional, demanda física diaria laboral, por medio socioeconomic and laboral characteristics were collected. Functio-
de la escala de Jaime Pujol. La actividad de la enfermedad y la nal capacity was observed using the Bath Ankylosing Spondylitis
capacidad funcional fueron evaluadas por los cuestionarios BASDAI Functional Index (BASFI) and the Health Assessment Questionnaire
y BASFI, respectivamente. También se realizaron HAQ-A y HAQ-S. for the Spondyloarthropathies (HAQ-S) and disease activity using
Todos los pacientes completaron además cuestionarios de calidad Bath Ankylosing Spondylitis Disease Activity Index (BASDAI). Quality
de vida (ASQoL), de depresión (CES-D) y escala de fatiga (FSS), los of life, depression, and fatigue were respectively evaluated using
cuales fueron previamente validados al español en Argentina en ASQoL, CES-D, FSS Questionnaire which were previously validated
nuestro centro. Para el análisis estadístico, correlación de Pearson into Spanish in our centre.
de las principales variables. Las variables continuas fueron compa- Results: 64 patients were included, 88% male, median age 44 years
radas por test de Student y ANOVA. Las posibles variables asociadas (IQR: 33.25-53) and median disease duration 17 years (IQR: 10.25-
a discapacidad funcional fueron analizadas por regresión lineal. 28). Mean score for BASFI was 45.35 mm (IQR: 16.8-64). BASFI had
Resultados: Se incluyeron 64 pacientes, 88% varones, con una a very good correlation with HAQ-S (r: 0.83), p <0.0001, depression
edad mediana de 44 años (RIQ: 33,25-53) y un tiempo mediano de (r: 0.47), fatigue (r: 0.53), and quality of life (r: 0.77) (p <0.0001) and
evolución de la enfermedad de 17 años (RIQ: 10,25-28). La mediana negative correlation with education level (r: -3.41, p = 0.006). No
de BASFI fue 45,35 mm (RIQ: 16,8-64), la mediana de HAQ-A fue association was found between BASFI and peripheral joint involve-

Correspondencia
Gustavo Citera. IREP, Echeverría 955, Capital Federal.
gustavocitera@gmail.com

20
0,5 (RIQ: 0,15-1) y HAQ-S fue 0,7 (RIQ: 0,32-1,2). El BASFI presentó ment, or the degree of physical demand on job. In multivariate analy-
una excelente correlación con HAQ-A (r: 0,77) y HAQ-S (r: 0,83), p sis disease activity was the only variable associated with BASFI.
<0,0001. El BASFI presentó muy buena correlación con las escalas Conclusion: Disease activity is the main variable that impairs
de depresión (r: 0,47), fatiga (r: 0,53), calidad de vida (r: 0,77) (p functional capacity in AS patients.
<0,0001) y una correlación negativa con los años de educación (r:
-3,41, p = 0,006). No hubo diferencias significativas en el BASFI Key words: ankylosing spondylitis, disability, social impact.
entre pacientes con y sin compromiso periférico, como tampoco
entre los pacientes con reemplazo articular. Al comparar el BASFI
con los distintos grados de demanda física diaria de los pacientes,
no encontramos diferencias significativas. En la regresión lineal uti-
lizando como variable dependiente el BASFI, el BASDAI fue la varia-
ble que se asoció con mayor intensidad (B: 0,628, p =<0,0001).
Conclusiones: La actividad de la enfermedad fue la principal varia-
ble asociada a discapacidad funcional en pacientes con EA, justifi-
cando un 60% de las variaciones del BASFI.

Palabras clave: espondilitis anquilosante, discapacidad, impacto


social.

Introducción taciones funcionales en EA; mientras que el mayor nivel


educativo, historia familiar de EA, la práctica de ejercicios
La Espondilitis Anquilosante (EA) es una enfermedad in-
regulares y el acceso de soporte social eran protectores
flamatoria crónica que afecta principalmente a hombres y
de las mismas5,6. El conocimiento de los factores que in-
mujeres jóvenes. Se caracteriza por el compromiso de las
fluyen sobre la capacidad funcional es de importancia, ya
articulaciones sacroilíacas, columna vertebral, caderas y
que una intervención temprana evitaría la progresión de la
en menor medida articulaciones periféricas. Las principa-
discapacidad, mejorando el estado de salud.
les manifestaciones son el dolor, la rigidez, la disminución
de la movilidad espinal y la fatiga1,2. Los cambios radio- El objetivo de nuestro estudio fue identificar los factores
gráficos comienzan en las articulaciones sacroilíacas y asociados a limitaciones funcionales en pacientes con EA.
ascienden progresivamente involucrando al resto de la co-
lumna vertebral3.Tanto los síntomas inflamatorios como Material y métodos
el daño estructural producen limitaciones funcionales, los
cuales influyen en la calidad de vida de los pacientes. Se realizó un estudio de corte transversal donde se inclu-
Estudios previos han identificado factores determi- yeron pacientes con EA según criterios de Nueva York
nantes de la discapacidad funcional en EA. Los factores modificados7, con una edad mayor a 16 años, atendidos en
de riesgo tradicionales incluyen el compromiso de arti- el Servicio de Reumatología del Instituto de Rehabilita-
culaciones periféricas, compromiso de cadera y colum- ción Psicofísica (IREP).
na cervical, menor edad al comienzo, la edad avanzada, Se obtuvieron datos a través de un cuestionario pre-
enfermedades comórbidas, sexo masculino y la actividad diseñado realizado por dos reumatólogos, teniendo en
de la enfermedad. Sin embargo, muchos de estos estudios cuenta las siguientes variables:
carecían de análisis estadísticos apropiados y no tenían en Sociodemográficas: sexo, edad, estado civil (soltero,
cuenta la totalidad de variables implicadas en la funcio- casado, viudo, separado), escolaridad (primaria, secunda-
nalidad4. Ward reportó que la presencia de enfermedades ria, terciaria) y el número de años efectivos.
comórbidas, el tabaquismo, y trabajos con mayor deman- Relacionadas a la enfermedad: edad de comienzo,
da física eran los principales factores asociados a las limi- tiempo de evolución, actividad inflamatoria medida a tra-

Revista Argentina de Reumatología • Año 20 • Nº 3 21


vés de Bath Ankylosing Spondylitis Disease Activity In- dición y el tiempo de evolución de la enfermedad al dejar
dex (BASDAI)8, y capacidad funcional por Bath Ankylo- de trabajar.
sing Spondylitis Functional Index (BASFI)8, Health d) Trabajos previos (tipo, períodos de tiempo y motivo
Assessment Questionnaire versión argentina (HAQ-A)9 de cambio o abandono).
y modificada para espondilitis (HAQ-S)10, cuestionario En cuanto al análisis estadístico, los cuestionarios
de depresión: Center for Epidemiological Studies Depres- CES-D, FSS y ASQoL fueron específicamente valida-
sion Scale (CES-D)11,12 y de fatiga: Fatigue Severity Scale dos para este estudio, siguiendo los lineamientos previa-
(FSS)13; por último evaluamos la calidad de vida por medio mente establecidos. Los cuestionarios BASDAI, BASFI,
de un cuestionario específico para espondilitis: Ankylo- HAQ-A y HAQ-S fueron previamente validados en
sing Spondylitis Quality of Life (ASQoL)14. Todos los ín- nuestro centro8,9,21.
dices fueron validados al español en Argentina y testeados Las variables continuas fueron graficadas en histogra-
previamente. mas con curva de distribución. En caso de distribución
Consignamos antecedentes de compromiso de articu- no normal, las mismas fueron transformadas a logaritmo
laciones periféricas y de reemplazo articular. Además se o raíz cuadrada, con el fin de utilizar tests paramétricos
interrogó sobre hábitos tóxicos (alcohol, tabaquismo, uso (prueba de T de Student para muestras independientes,
de drogas) y enfermedades comórbidas (cardiovasculares, con prueba de Levene para homogeneidad de varianzas y
respiratorias, gastrointestinales, traumáticas, neuropsi- ANOVA). Las variables categóricas fueron comparadas
quiátricas, entre otras). por Chi 2 o test exacto de Fisher. Se realizó correlación de
Evaluación laboral: Pearson entre las principales variables.
a) Situación actual (ocupado, desocupado). Las variables asociadas a discapacidad funcional fue-
b) Tipo de trabajo actual, consignándolo en 8 cate- ron analizadas por regresión lineal múltiple utilizando el
gorías según la Clasificación Internacional Uniforme de valor de BASFI como variable dependiente.
Ocupaciones, estipuladas por la Oficina Internacional del Para el análisis se utilizó el paquete estadístico SPSS
Trabajo en Ginebra de 199115: 1) Miembros del poder eje- versión 11.5.
cutivo y de los cuerpos legislativos y personal directivo de
la administración pública y de empresas, 2) Profesiona- Resultados
les científicos e intelectuales, 3) Técnicos y profesionales
de nivel medio, 4) Empleados de oficina, 5) Trabajadores Se incluyeron 64 pacientes con EA, de los cuales el 89,1%
de los servicios y vendedores de comercio y mercados, eran de sexo masculino. La mediana de edad fue de 44
6) Agricultores y trabajadores calificados agropecuarios años (RIQ: 33,2-53), el 78,8% de los pacientes presenta-
y pesqueros, 7) Oficiales, operarios y artesanos de artes ban enfermedades comórbidas, siendo la más frecuente la
mecánicas y oficios, 8) Operadores de instalaciones, má- hipertensión arterial. El 26,2% se encontraban desocupa-
quinas y montadores, trabajadores no calificados, 0) Fuer- dos (Tabla 1).
zas armadas.
c) Demanda física del trabajo, clasificada según Jaime Edad (años) m (RIQ) 44 (33,2-53)
Pujol16 en: “Sedentario” levanta 5 kg como máximo, inclu-
Sexo masculino n (%) 57 (89,1%)
ye estar sentado, pararse y caminar. “Liviano” levanta 10
kg como máximo, incluye caminar o estar de pie o estar Años efectivos de educación m (RIQ) 13 (10-17)
sentado por mucho tiempo, mientras se utilizan los brazos Edad de inicio de la enfermedad (años) m (RIQ) 20 (16,2-30)
o pies, empujando o atrayendo objetos. “Medio” levanta
25 kg como máximo, levantar y transportar a menudo Tiempo de evolución (años) m (RIQ) 17 (10,3-25)
objetos de más de 12 kg. “Pesado” levantar y transportar Compromiso articular periférico n (%) 31 (48,4)
objetos de más de 25 kg y “Muy pesado” levanta objetos
Reemplazo de caderas n (%) 13 (20,3)
que pesan más de 50 kg, incluye levantar y transportar
frecuentemente objetos de más de 25 kg. Presencia de comorbilidad n (%) 48 (78,7)
También consignamos el tiempo en meses desde el Desocupación n (%) 16 (26,2%)
inicio del trabajo hasta la actualidad o, en caso de estar
desocupado, el tiempo en meses desde que está en esa con- Tabla 1. Características demográficas y clínicas en 64 pacientes con EA.

22
En cuanto a las características de la enfermedad, la me- Finalmente, realizamos un análisis de regresión múl-
diana de duración de la EA fue de 17 años (RIQ: 10,3-25), tiple utilizando el BASFI como variable dependiente e
con una edad de inicio a los 20 años (RIQ: 16,2-30). La incluimos como variables independientes a aquéllas más
mediana de BASFI fue de 45,4 (RIQ: 18,1-66,1), HAQ-A frecuentemente asociadas en estudios previos. Encontra-
y HAQ-S de 0,5 (RIQ: 0,15-1) y 0,7 (RIQ: 0,32-1,2), res- mos que sólo la actividad de la enfermedad (BASDAI) se
pectivamente. Los pacientes se encontraban activos de la asoció significativamente con peor capacidad funcional
enfermedad, con índices elevados de depresión y fatiga y (Tabla 4).
mala calidad de vida (Tabla 2).

BASDAI m (RIQ) 40,7 (16,9-64,7) Variables BASFI X (SD) p

BASFI m (RIQ) 45,4 (18,1-66,1) SÍ 44,5 +/- 27


Sexo masculino ns
NO 42,2 +/- 35
HAQ-A m (RIQ) 0,5 (0,15-1)
SÍ 47,2 +/- 25,7
HAQ-S m (RIQ) 0,7 (0,32-1,2) Compromiso periférico ns
NO 40,4 +/- 30,8
Depresión m (RIQ) 0,66 (0,38-1,05) SÍ 47,3 +/- 26,3
Reemplazo de caderas ns
Fatiga m (RIQ) 3,7 (2,6 -4,8) NO 43,6 +/- 28,54

Calidad de vida m (RIQ) 5,5 (2-10) Enfermedades SÍ 46,6 +/- 26


ns
comórbidas NO 35,3 +/- 32
Tabla 2. Capacidad funcional y otras variables asociadas en 64 pa- SÍ 40 +/- 28,4
Ocupación ns
cientes con EA. NO 54,5 +/- 24,7
SÍ 37,4 +/- 25
El BASFI correlacionó significativamente con HAQ-S Demanda física alta ns
NO 40,8 +/- 29,5
(r: 0,83), con la actividad de la enfermedad (r: 0,72), con de-
SÍ 48,6 +/- 26,9
presión (r: 0,47), fatiga (r: 0,53) y calidad de vida (r: 0,77) e Tabaquismo ns
NO 39,4 +/- 28,7
inversamente con los años de educación (r: -3,41).
En el análisis univariado, no encontramos asociación del Tabla 3. Comparación de distintas variables en pacientes con BASFI
BASFI con ninguna de las variables analizadas (Tabla 3). como variable dependiente.

Coeficiente
Coeficientes no estandarizados
estandarizado
Modelo t p
B Error típico Beta

(constante) -5,619 14,960 -0,376 0,709


Edad 0,200 0,236 0,098 0,848 0,400
Años de educación -0,260 0,588 -0,041 -0,442 0,660
Duración de la enfermedad 0,336 0,240 0,153 1,403 0,166

BASDAI 0,603 0,103 0,628 5,861 0,000

CES-D 9,483 5,941 0,159 1,596 0,116

Fatiga 1,971 1,874 0,111 1,052 0,298

Enfermedades comórbidas -2,707 6,221 -0,039 -0,435 0,665

Tabla 4. Principales variables asociadas a capacidad funcional. Regresión lineal múltiple. Variable dependiente BASFI.

Revista Argentina de Reumatología • Año 20 • Nº 3 23


Discusión avanzada, la actividad de la enfermedad y la depresión los
únicos factores vinculados con la falta de trabajo21.
La discapacidad funcional es la principal responsable de la
Al igual que en el estudio de Ward5, el mayor nivel
desocupación y de los costos atribuibles a la enfermedad,
educativo de nuestros pacientes se asoció con menor dis-
ambos impactan en gran medida en la calidad de vida de
capacidad funcional. Esto podría explicarse por una ma-
los pacientes con EA17.
yor facilidad de acceso a seguros de salud y adaptación
Nuestro grupo se propuso estudiar la discapacidad
social acorde. Otro reporte del mismo autor demostró que
funcional y los factores que la determinan, ya que los da-
los pacientes con bajo nivel educativo tienen peor calidad
tos publicados en la literatura son controvertidos debido
de vida18.
al escaso número de pacientes y ausencia de grupo con-
Concluimos, que en nuestro estudio, la limitación fun-
trol. Además se incluyeron índices que evalúan aspectos cional de los pacientes con EA correlacionó positivamente
psicológicos y calidad de vida por medio de cuestionarios con la actividad de la enfermedad, la depresión, la fatiga
específicos para EA. y la calidad de vida, y en forma negativa con el nivel de
En nuestro estudio, la discapacidad funcional corre- educación. En el análisis multivariado, la actividad de la
lacionó positivamente con la actividad de la enfermedad, enfermedad fue la principal y única responsable del dete-
la depresión, la fatiga y la calidad de vida, y en forma ne- rioro de la capacidad funcional, explicando el 60% de las
gativa con el nivel de educación. La mayor actividad de variaciones del BASFI.
la enfermedad fue el principal responsable del deterioro No encontramos relación con demanda física laboral,
de la capacidad funcional. Estos datos demuestran, a su tipo de trabajo o presencia de reemplazos articulares.
vez, la importancia del control estricto de la enfermedad El conocimiento de los principales factores asociados
independientemente del tiempo de evolución. a la discapacidad funcional de los pacientes con EA per-
Son muy pocos los estudios que tuvieron en cuenta as- mitiría implementar estrategias terapéuticas más agresivas
pectos que impactan en la calidad de vida de los pacientes. con el fin de minimizar el deterioro físico y su impacto
Ariza-Ariza evaluó el deterioro, tanto de la función física social negativo.
como de la calidad de vida, en 92 pacientes españoles con
EA17 y Ward se ocupó de identificar los diferentes aspec-
Bibliografía
tos que influyen en la calidad de vida en 175 pacientes de
California18. Sin embargo, en ambos estudios se utilizaron 1. Gran JT, Skomsvoll JF. The outcome of ankylosing spondyli-
cuestionarios genéricos como el SF-36 y EuroQol. tis: a study of 100 patients. Br J Rheumatol 1997;24:908-11.
2. van der Linden S, van der Heijde D. Ankylosing spondylitis.
En nuestro trabajo, sin embargo, utilizando cuestiona-
Clinical features. Rheum Dis Clin North Am1998;24:663-73.
rios más específicos para EA, la actividad de la enferme- 3. Brophy S, Mackay K, Al-Saidi A, Taylor G, Calin A. The
dad fue la única responsable del deterioro de la capacidad natural history of ankylosing spondylitis as defined by radio-
funcional. logical progression. J Rheumatol 2002;29:1236-43.
Ward, en un estudio transversal con 326 pacientes, iden- 4. Ward MM. Quality of life in patients with ankylosing spon-
dylitis. Rheum Dis Clin North Am1998;24:815-26.
tificó que el trabajo con mayor demanda física, la presencia
5. Ward MM, Weisman M, Davis JC Jr, Reveille JD. Risk fac-
de comorbilidades, el tabaquismo y el menor nivel educati- tors for functional limitations in patients with long-standing
vo eran factores predictores de discapacidad funcional5. ankylosing spondylitis. Arthritis Rheum (Arthritis Care Res)
Guillemin y col. habían demostrado que los pacientes 2005;53:710-17.
expuestos a trabajos sedentarios preservaban su capacidad 6. Ward MM. Predictors of the progression of functional dis-
ability in patients with ankylosing spondylitis. Rheumatol;
funcional 20. En nuestro estudio, el 76,8% de nuestros pa-
2002;29:1420-5.
cientes se encontraba realizando actividad laboral con una 7. van der Linden S, Valkenburg HA, Cats A. Evaluation of
distribución uniforme entre los diferentes tipos de ocu- diagnostic criteria for ankylosing spondylitis. A proposal
paciones. Al analizar específicamente los distintos tipos for modification of the New York criteria. Arthritis Rheum
de trabajo y las demandas físicas relacionadas, no se halló 1984;27:361-8.
8. Citera G, Maldonado Cocco JA, Moroldo M, et al. Validación de
asociación. Previamente, nosotros estudiamos el status la-
la versión en español de los cuestionarios de capacidad funcional
boral de los pacientes con EA y llamativamente tampoco BASFI y actividad de la enfermedad BASDAI en pacientes con
hallamos asociación alguna entre la limitación funcional, Espondilitis Aquilosante en cuatro países Latinoamericanos.
el tipo de trabajo y la desocupación, siendo la edad más Rev Arg Reumatol (abstract- P 033). CONAR 1999.

24
9. Citera G, Arriola MS, Maldonado Cocco J, et al. Validation 16. Pujol J. Análisis Ocupacional. Manual de Aplicación para
and Cross Cultural Adaptation of an Argentine Spanish Ver- Instituciones de Forma Profesional. Publicación de Ofi-
sion of the Health Assessment Questionnaire Disability In- cina Internacional del Trabajo. Centro Interamericano de
dex. J Clin Rheumatol 2004;10(3):110-5. Investigación y Documentación sobre Formación Profe-
10. Daltroy L, Larson M, Roberts W, Liang M, et al. A modifica- sional 1987.
tion of the health assessment questionnaire for the spondy- 17. Ariza-Ariza R, Hernandez-Cruz B, Navarro-Saravia F. Phys-
loarthropathies. J Rheumatol 1990;17:946-950. ical Function and Health- related quality of life of spanish pa-
11. González V, Stewart A, Ritter P, et al. Traslation and Valida- tients with ankylosing spondylitis. Arthritis Rheum (Arthritis
tion of Arthritis Outcome Measures into Spanish. Arthritis Care Res) 2003; 49: 483-87.
Rheum 1995;38:1429-46. 18. Ward MM. Health-Related Quality of life in Ankylosing
12. Blalock S, De Vellis R, Brown G,Wallston K, et al. Validity of Spondylitis: A survey of 175 Patients. Arthritis Rheum (Ar-
the center for epidemiological studies depresion scale in ar- thritis Care Res) 1999; 4: 247- 55.
thritis populations. Arthritis Rheum 1989;32:991-7. 19. Taylor AL, Balakrishnan C, Calin A. Reference centile charts
13. Krupp L, LaRocca NG, Muir-Nash J, Steinberg A, et al. for measures of disease activity, functional impairement, and
The Fatigue Severity Scale: Application to Patients with metrology in ankylosing spondylitis. Arthritis Rheum 1998;
Multiple Sclerosis and Lupus Erythematosus. Arch Neurol 41: 1119-25.
1989;46:1121-24. 20. Guillemin F, Briancon S, Pourel J, Gaucher A. Long-term dis-
14. Doward L, Spoorerg A, Cook S, et al. Development of the ability and prolonged sick leaves as outcome measurements
ASQoL: a quality of life instrument specific to Ankylosing i.n ankylosing spondylitis. Possible predictor factors. Arthri-
Spondylitis. Ann Rheum Dis 2003;62:20-6. tis Rheum 1990; 33: 1001-5.
15. ILO. Clasificación Internacional Uniforme de Ocupaciones. 21. Marengo MF, Citera G, Schneeberger EE, Maldonado Cocco
Publicación de Oficina Internacional del Trabajo. CIUO JA. Work status among patients with ankylosing spondylitis
1988. Ginebra CHE 1990. in Argentina. J Clin Rheumatol 2008; 14: 273-77.

Revista Argentina de Reumatología • Año 20 • Nº 3 25


[ artículo original ]

Caracterización inmunogenética de pacientes


con espondilitis anquilosante en Argentina
Gustavo Citera1, Emilce E. Schneeberger1, José A. Maldonado Cocco1, Juan-Manuel Anaya2
Instituto de Rehabilitación Psicofísica, Buenos Aires, Argentina, 2Centro de Estudio de Enfermedades Autoinmunes (CREA) Universidad de
1

Rosario, Corporación para Investigaciones Biológicas, Bogotá, Colombia.

Resumen Summary
Objetivo: Evaluar la influencia del polimorfismo genético del HLA Objective: To determine the influence of the genetic polymorphism
clase I y II, TNFα e IL1β en pacientes argentinos con espondilitis of HLA class I and II, TNFα and IL1β in Argentinean patients with
anquilosante (EA). ankylosing spondylitis.
Material y métodos: Este fue un estudio de asociación en el que se Material and Methods: This was an association study where AS
incluyeron pacientes con EA clasificados de acuerdo a los criterios patients according to modified New York criteria were included. We
de New York modificados. Se registraron datos demográficos y clí- recorded demographic and clinical data of the disease. A non re-
nicos de la enfermedad. Un grupo no relacionado, pero pareado, de lated but age and sex matched group of 154 people was used as
154 personas fue utilizado como grupo control. La genotipificación controls. Genotyping was performed using polymerase chain reac-
fue realizada utilizando técnicas basadas en la reacción en cadena tion (PCR) techniques. We evaluated HLA class I (A and B) and class
de la polimerasa. Se evaluaron alelos HLA clase I (A y B) y II (DR), II (DR), single nucleotide polymorphism of the TNFα (-238 and 308)
polimorfismos de nucleótido simples del TNF (-238 y 308) y del gen and IL1β (-511 and +3954).
IL1β (-511 y +3954). Results: We included 52 patients with AS of whom 90.4% were
Resultados: Se incluyeron 52 pacientes con EA, de los cuales male with a median age of 44 years (IQR 34-53). We confirm the
90,4% fueron varones, con una edad mediana de 44 años rango association of HLA-B27 with disease (90.4% vs 5.2%. OR 171.5, p
intercuartilo (RIQ) 34-53. Confirmamos la asociación del HLA-B27 = 1x10-30). The most common subtype in both patients and controls
con la enfermedad (90,4% vs. 5,2%, con OR: 171,5, p = 1x10-30). El was B27*05 (85%). Comparison between class A and B alleles non
subtipo más frecuente tanto en pacientes como en controles fue el B27 between controls and patients did not show significant diffe-
B27*05 (85%). La comparación de alelos de clase A y B no B27 entre rences. Comparison between class II alleles showed a statistically
controles y pacientes no mostró diferencias significativas. La com- significant higher frequency of HLA-DR1 in AS patients (59.6% vs.
paración entre los alelos clase II evidenció una mayor frecuencia 20% OR 6.1, p = 1x10-5). TNF -308 GA genotype was a risk factor
del HLA-DR1 (59,6% vs. 20%, OR: 6,1, p = 1x10-5). El genotipo TNF for AS (94% vs. 81% OR 3.96 p = 0.02), while the -238 GA geno-
-308 GA fue un factor de riesgo (94% vs. 81%, OR: 3,96, p = 0,02), type had a protective effect and was more frequently observed in

Correspondencia
Gustavo Citera. IREP, Echeverría 955, Capital Federal.
gustavocitera@gmail.com

26
mientras que el genotipo -238 GA fue protector (53% vs. 76%, OR: controls (76% vs. 53%, OR 0.19, p >0.0001). IL1β -511 allele was
0,19, p >0,0001). El alelo IL1β-511C se asoció con la EA (66% vs. associated with a higher susceptibility to AS (66% vs. 53%, OR 1.74
53%, OR: 1,74, p = 0,03). p = 0.03).
Conclusión: En el presente estudio, hemos replicado por primera Conclusion: In the present study, we have replicated for the first
vez en la población argentina la influencia del HLA, TNF e IL1β en time in the Argentinean population, the influence of HLA, TNFα, and
la EA. Estos hallazgos permiten una comprensión homogénea de la IL1β in patients with AS. These findings allow a uniform understan-
fisiopatogenia de la enfermedad. ding of the physiopathology of the disease.

Palabras clave: HLA-B27, genética, espondilitis anquilosante. Key words: HLA-B27, genetics, ankylosing spondylitis.

Introducción caucásica de Canadá y china de Taiwan, se demostraron


asociaciones con genes del grupo de la IL119,20.
Las espondiloartropatías seronegativas (EASN) incluyen
Dado que la influencia que puede tener el polimor-
un grupo de enfermedades de etiología aún desconocida,
fismo genético sobre una enfermedad varía de acuerdo a
que comparten ciertas características clínicas, serológi-
la etnicidad y geografía, los estudios de replicación son
cas y genéticas1. La espondilitis anquilosante (EA) es el
importantes para la comprensión de la fisiopatología de
prototipo de estas enfermedades y es bien conocida la im-
enfermedades complejas como la EA. Por tal motivo, el
portante carga genética involucrada en el desarrollo de la
presente trabajo examinó la influencia del polimorfismo
misma, siendo los genes del sistema de histocompatibili-
de genes HLA clase I y II, TNF e IL1β en la presentación
dad (HLA) los más comúnmente asociados2,3. En el año
y curso de la EA en pacientes argentinos.
1972, Brewerton y col. descubrieron la asociación entre
el HLA-B27 y la espondilitis anquilosante, observando
este alelo en el 96% de los pacientes con EA versus 7% de Pacientes y métodos
la población general4. Si bien el HLA-B27 es el principal Estudiamos pacientes consecutivos con EA, según crite-
alelo asociado con la EA en más del 95% de los caucásicos, rios de New York modificados21.
solamente del 1 al 5% de los sujetos B27 positivos desarro- Todos los pacientes dieron su consentimiento para la
llan la enfermedad5-7. participación en el estudio y el mismo fue aprobado por
Existe evidencia en diferentes grupos étnicos, que otros el comité de docencia del Instituto de Rehabilitación Psi-
alelos del complejo mayor de histocompatibilidad clase I y cofísica (IREP). Consignamos datos demográficos (edad,
II pueden influir sobre la susceptibilidad a la enfermedad sexo) y clínicos de la enfermedad como edad de comienzo,
y sus manifestaciones clínicas. Así, entre los antígenos duración de la enfermedad, tipo de EASN, compromiso
clase I, es clásica la asociación con el complejo CREG (B7, articular periférico y/o de caderas, compromiso ocular,
B22, B40 y B42) descripto por Khan en 19833. También presencia y grado de sacroileítis.
se han publicado asociaciones con otros alelos como B60, Un grupo no relacionado de 154 personas pareadas
B40 y B15, DR1, DR8, así como con polimorfismos en por edad, sexo, geografía y etnicidad fue utilizado como
diferentes genes de citoquinas como el factor de necro- control en la comparación de los datos genéticos.
sis tumoral alfa (TNF) e interleuquina 1β (IL1β)8-16. En la En todos los individuos se extrajeron muestras de san-
actualidad, el amplio estudio del genoma humano en pa- gre venosa periférica, la cual fue conservada con EDTA
cientes con EA permitió detectar posibles áreas sugestivas a -20ºC hasta su análisis. Para la tipificación genética,
o significativamente ligadas, ubicadas en sitios diferentes se extrajo ADN de células mononucleares desde sangre
al complejo mayor de histocompatibilidad17. Los estudios total, luego del fraccionamiento con Ficoll Ipaque, los
de posibles genes candidatos en EA son escasos, pero en alelos clase I (A y B) y II (DR) fueron analizados por
2 cohortes caucásicas se observó asociación con el locus PCR y oligotificación como fue descripto en extenso
CYP2D6 ubicado en el cromosoma 218. Adicionalmente, previamente22. La tipificación de polimorfismos de nu-
en algunos estudios de casos y controles en población cleótidos simples (SNPs) del TNF en las posiciones -238

Revista Argentina de Reumatología • Año 20 • Nº 3 27


y -308 se realizó también por PCR, tal como fue señala- alguno de los alelos en la tabla de 2x2 fue menor a 5, en
do previamente23. Se utilizó un aparato i Cycler de Bio- cuyo caso se utilizó test exacto de Fisher. Se calcularon
Rad. La PCR fue seguida de una digestión con enzimas los razones de disparidad [odds ratio (OR)] y los inter-
de restricción. El polimorfismo del TNF -308 se analizó valos de confianza (IC) del 95%. El valor de significancia
utilizando el método de polimorfismo en el tamaño de p fue corregido por el número de alelos examinados para
los fragmentos de restricción (RFLP)… Brevemente: Un los de clase I y II. El equilibrio de Hardy Weinberg y el
fragmento de 107 bp se amplificó con un primer pionero desequilibrio de ligamiento fueron evaluados utilizando
5´AAGGCAATAGGTTTTGAGGGCCAT 3´ y reverti- el software Arlequin. Un valor de p menor a 0,05 fue con-
damente con un primer 5´TCCTCCCTGCTCCGATTC siderado significativo.
3´ (Invitrogen Life Technologies, Frederich MD). Las
condiciones de PCR fueron las siguientes: 5 minutos
Resultados
a 94ºC seguido de 3 a 5 ciclos de 30 segundos a 94ºC, 1
minuto a 60ºC y 1 minuto a 72ºC . Se realizó una exten- Incluimos 52 pacientes con EA, 47 eran varones (90,4%),
sión final a 72ºC por 10 minutos y los productos fueron con una edad mediana de 44 años rango intercuartilo
digeridos enzimáticamente por incubación con la enzima (RIQ: 34-53). La edad mediana de inicio de la enfermedad
Nco1 (Promega, Bogotá Colombia) a 37ºC por 12 horas. fue de 22 años (RIQ: 18-21) y el tiempo mediano de evolu-
El polimorfismo en la posición -238 del TNF fue definido ción de la enfermedad de 17 años (RIQ: 10-28).
usando PCR-RFLP según lo desarrollado por Gallager y Veinte (38,5%) pacientes habían tenido compromiso
col 24. Los primeros fueron desarrollados para amplificar periférico, 15 (29%) compromiso de caderas y 15 uveítis.
un producto de 192 bp de la siguiente manera: primer de El 77% de nuestros pacientes presentaban sacroileítis gra-
inicio 5´TTCCTGCATCCTGTCCTGTCTGGAAGT do IV. Cuatro de los pacientes tenían antecedentes de pso-
AAGAA 3´ y el primer reverso 5´AGCATACCCCTCA riasis cutánea y 1 de enfermedad inflamatoria intestinal
CACTCCCATCCTCCCCGCATC 3´ (Invitrogen Life (Tabla 1). Tal como lo esperado, el HLA-B27 se asoció
Technologies, Frederich MD); con condiciones de PCR con la EA (Figura 1). El subtipo más frecuente tanto en
similares a las utilizadas para el SNP -308. Los productos pacientes como en controles fue el B27*05 (85%).
obtenidos en este caso fueron sometidos a digestión enzi-
mática con la enzima Bam HI (Promega, Bogotá Colom-
bia), a 37ºC por 2 horas. Los fragmentos de restricción 87
bp, y 20 bp para -308 G y 107 bp para -308Aª; 164 bp y 28
Sexo: Masculino 47 (90,4%)
bp para -238G y 192 bp para -238Aª fueron analizados en
gel de agarosa con teñido de bromuro de ethidinium al 3% Femenino 5 (9,6%)
(Seakem LE Agarose Bio Whittaker, Rockland ME). Se Edad actual mediana (RIQ) 44 años (34-53)
incluyeron controles positivos y negativos en cada análisis
Edad inicio EA mediana (RIQ) 22 años (18-31)
de muestras.
La genotipificación de los SNPs de IL1β -511 y +3954. Tpo evolución mediana (RIQ) 17 años (10-28)
La tipificación de T-511 C SNP se realizó por PCR- Compromiso periférico 20 (38,5%)
RFLP, utilizando sebadores específicos y condiciones de
Compromiso de caderas 15 (29%)
PCR previamente establecidas y descriptas en detalle an-
teriormente25. Uveítis 15 (29%)
Sacroileítis Grado 4 40 (77%)
Análisis estadístico Tipo de EA: Pura 43 (82,7%)
El análisis estadístico fue realizado con el programa SPSS APs 4 (7,7%)
versión 10.0 (SPSS, Chicago Illinois).
EAJ 4 (7,7%)
La frecuencia de alelos y haplotipos fue calculada por
conteo directo. Las diferencias entre frecuencias de los EII 1 (1,9%)
diferentes alelos entre pacientes y controles se realizaron
Tabla 1. Características demográficas y clínicas en 52 pacientes con
por test de Chi cuadrado, excepto cuando el número de
espondilitis anquilosante.

28
5,2% La comparación de alelos HLA de clase A no mostró
diferencias significativas, pero el A11 y el A32 mostraron
B 27 POSITIVOS
una mayor frecuencia en pacientes y el A23 fue más fre-
B 27 NEGATIVOS cuente en controles (Tabla 2).
En la comparación de otros alelos de clase B no B-27,
de la misma manera que en la comparación anterior, hubo
una tendencia a mayor frecuencia del B40 en pacientes y
Controles
del B44 en controles, pero sin alcanzar significancia esta-
n = 154
90,4% dística (Tabla 3).
Por último, la comparación entre los alelos clase II,
evidenció una mayor frecuencia estadísticamente signifi-
cativa del HLA-DR1 en pacientes (59,6%) con respecto a
controles (19,5%) (Tabla 4).
También se observó que el DR15 fue más frecuente en
controles que en pacientes con una p corregida de 0,02 y
Pacientes
n = 52 un OR de 0,08 (IC 95% 0,01-0,6), comportándose como
un alelo protector. Dada la alta frecuencia de DR1 en
nuestra población, probamos el rol protector del DR15,
OR: 171,5
IC 95%: 53-549 excluyendo a los pacientes DR1 positivos; pero en estas
p = 1x10-30 circunstancias el DR15 no mantuvo su efecto protector.
Luego realizamos un análisis con la finalidad de detec-
tar asociaciones entre los alelos más frecuentes en nuestra
Figura 1. Frecuencia de HLA-B27 en pacientes con espondilitis anquilo-
población de espondilíticos, es decir el A11, B27, B40 y
sante y controles.

CONTROLES PACIENTES Pc OR (IC 95%)


HLA-A n = 154 n = 52
n (%) n (%)

A1 32 (20,8) 6 (11,5) NS
A2 70 (45,5) 26 (50) NS
A3 28 (18,2) 10 (19,2) NS
A11 24 (15,6) 12 (23,1) NS 1,61 (0,7-3,5)
A23 13 ( 8,4) 0 NS 0,73 (0,7-0,8)
A24 36 (23,4) 12 (23,1) NS
A25 5 (3,2) 1 (1,9) NS
A26 15 (9,7) 7 (13,5) NS
A29 17 (11) 2 (3,8) NS
A30 13 (8,4) 1 (1,9) NS
A31 6 (3,9) 4 (7,7) NS
A32 10 (6,5) 8 (15,4) NS 2,6 (0,9-7,0)
A33 2 (1,3) 1 (1,9) NS
A68 14 (9,1) 6 (11,5) NS
A74 1 (0,6) 0 NS
HOMOCIGOTAS 22 (14,3) 8 (15,4) NS

Tabla 2. Comparación de alelos de clase A entre controles y pacientes con EA.

Revista Argentina de Reumatología • Año 20 • Nº 3 29


CONTROLES PACIENTES Pc OR (IC 95%)
HLA-B n = 154 n = 52
n (%) n (%)

B7 17 (11) 2 (3,8) NS
B8 18 (11,7) 2 (3,8) NS
B13 8 (5,2) 2 (3,8) NS
B14 14 (9,1) 4 (7,7) NS
B15 2 (1,3) 1 (1,9) NS
B18 19 (12,3) 2 (3,8) NS
B27 8 (5,2) 47 (90,4) 1x10-30 171,5 (53-549)
B35 39 (25,3) 7 (13,5) NS
B37 4 (2,6) 1 (1,9) NS
B38 23 (14,9) 3 (5,8) NS
B39 13 (8,4) 3 (5,8) NS
B40 5 (3,2) 5 (9,6) NS 3,1 (0,8-11)
B41 8 (5,2) 0 NS
B42 1 (0,6) 0 NS
B44 33 (21,4) 2 (3,8) 0,06 0,4 (0,03-0,6)
B45 4 (2,6) 0 NS
B46 0 1 (1,9) NS

Tabla 3. Comparación de alelos de clase B entre controles y pacientes con EA.

CONTROLES PACIENTES Pc OR (IC 95%)


HLA-DR n = 154 n = 52
n (%) n (%)

DR1 30 (19,5) 31 (59,6) 1x10-5 6,1 (3-12)


DR3 19 (12,3) 5 (5,6) NS
DR4 39 (25,3) 10 (19,2) NS
DR7 35 (22,7) 11 (21,2) NS
DR8 10 (6,5) 8 (15,4) NS
DR9 9 (5,8) 2 (3,8) NS
DR10 7 (4,5) 1 (1,9) NS
DR11 50 (32,5) 12 (23,1) NS
DR12 3 (1,9) 3 (5,8) NS
DR13 25 (16,2) 7 (13,5) NS
DR14 20 (13) 2 (3,8) NS
DR15 28 (18,2) 1 (1,9) 0,02 0,08 (0,01-0,6)
DR16 12 (7,8) 4 (7,7) NS
DR17 3 (1,9) 0 NS
HOMOCIGOTAS 18 (11,6) 7 (13,5) NS

Tabla 4. Comparación de alelos de clase DR entre controles y pacientes con EA.

30
DR1 y ciertas características clínicas de la enfermedad -511C se asoció con la EA, observándose con una frecuen-
como edad de inicio, sexo, compromiso periférico, de cia del 66% en pacientes vs. 53% en controles [OR: 1,74
caderas y uveítis. Encontramos que en los pacientes B40 (IC 95% 1,1-2,82), p = 0,03], el genotipo CC mostró una
positivos, la edad de inicio es significativamente mayor en tendencia a mayor susceptibilidad pero sin alcanzar sig-
comparación a los B40 negativos (p = 0,03). En cuanto a nificancia estadística. El genotipo IL1β +3954 no mostró
los pacientes B27 positivos, al igual a lo referido en la lite- influencia significativa.
ratura, la edad de inicio es significativamente menor (p =
0,01). Para el resto de las características estudiadas, no se
Discusión
encontraron asociaciones significativas con los alelos ana-
lizados (Tablas 5 y 6). Tanto la prevalencia del HLA-B27 como la frecuencia de
En los pacientes y controles testeados para polimorfis- los distintos subtipos del mismo son comparables a los de
mo del TNF, se observó un claro desbalance en relación a otras poblaciones caucásicas. El HLA-B27 es el factor ge-
la susceptibilidad para la enfermedad. El genotipo GA del nético que contribuye con más fuerza para el desarrollo
SNP -308 fue significativamente más frecuente en pacien- de EA; sin embargo, otros estudios soportan el rol de ge-
tes (94%) que en controles (81%) [OR: 3,96 (IC 95% 1,14- nes adicionales3,9,15,17,19. Nuestros resultados sustentan que
13,70), p = 0,02], mientras que el genotipo GA del SNP otros genes además del HLA-B27, se relacionan con la sus-
-238 fue protector observándose con mayor frecuencia en ceptibilidad a EA en la población argentina. Hemos obser-
controles (76%) que en pacientes (53%) [OR: 0,19 (IC 95% vado que el HLA-DR1 confiere mayor susceptibilidad a
0,1-0,37), p >0,0001]. la enfermedad (OR: 6,1) y el hecho de encontrar este alelo
Con respecto al polimorfismo del gen IL1β, el alelo tanto en individuos B27 positivos como en negativos, per-

A 11 B 40
CARACTERÍSTICAS POSITIVO NEGATIVO POSITIVO NEGATIVO
CLÍNICAS n = 12 n = 40 n=5 n = 47
Edad de inicio mediana 20,5 a 23 a 30 a 21 a*
Sexo masculino 11 (92%) 36 (90%) 4 (80%) 43 (91%)
Compromiso periférico 3 (25%) 11 (27%) 2 (40%) 18 (38%)
Compromiso de caderas 6 (50%) 9 (23%) 1 (20% 14 (30%)
Uveítis 6 (50%) 9 (23%) 2 (40%) 13 (28%)

*p = 0,03
Tabla 5. Asociación entre alelos y características clínicas de la enfermedad.

B 27 DR 1
CARACTERÍSTICAS POSITIVO NEGATIVO POSITIVO NEGATIVO
CLÍNICAS n = 47 n = 5 n = 31 n = 21
Edad de inicio mediana 21 a 30 a* 23 a 19 a
Sexo masculino 43 (91%) 4 (80%) 28 (90%) 19 (90%)
Compromiso periférico 18 (38%) 2 (40%) 10 (32%) 10 (48%)
Compromiso de caderas 14 (30%) 1 (20%) 9 (30%) 6 (29%)
Uveítis 15 (32%) 0 11 (35%) 4 (19%)

*p = 0,01
Tabla 6. Asociación entre alelos y características clínicas de la enfermedad.

Revista Argentina de Reumatología • Año 20 • Nº 3 31


mite sugerir que este gen se hereda en forma independiente ofrecen una visión homogénea de la inmunogenética de
al B27, como ya fue descripto por otros autores26,27. la enfermedad con respecto a otras poblaciones y contri-
El HLA-DR1 ha sido reportado previamente en pa- buyen en un mejor entendimiento de la patogenia de esta
cientes con EA. Los gemelos dicigóticos llevando B27 y enfermedad.
DR1 son más concordantes para esta enfermedad que los
gemelos B27 positivos DR1 negativos (p = 0,039)12. En
Bibliografía
un estudio francés de familias con EA, se encontró que
el haplotipo HLA-DRB1*0101/ DQB*0501 era trans- 1. Citera G: Espondiloartropatías seronegativas. Conceptos
generales. En Reumatología2000, JA Maldonado Cocco: Edi-
mitido preferencialmente dentro de familias a chicos con
tor. 1era edición:331-335. Americana de Publicaciones, Bue-
EA, independientemente del HLA-B2726. Armstrong y nos Aires, Argentina.
col., en un estudio de pacientes británicos, encontraron 2. Calin A, Elswood J, Riggs S, Skevingtonn S: Ankylosing
que 48,5% de los pacientes con EA eran HLA-DR1 posi- Spondylitis. An analysis review of 1500 patients. The chang-
tivos vs. 14,9% de controles sin la enfermedad 27. Brown y ing pattern of disease. J. Rheumatol 1988;15:1234-1238.
col. encontraron que el HLA-DR1 puede tener un efecto 3. Khan MA: Update on Spondyloarthropathies. Ann Intern
Med. 2002;136:896-907.
débil sobre la susceptibilidad a EA, independientemente
4. Brewerton DA: Discovery: HLA and disease. Curr Opin
del HLA-B2717. Por último, un estudio reciente en Méxi- Rheumatol 2003;15:369-373.
co detectó una asociación significativa del HLA-DR1 y 5. López de Castro, et al: The pathogenic role of HLA-B27 in
HLA-B15 con EASN, la cual también fue independiente chronic arthritis. Curr Opin Immunol 1998;10:59-66.
del HLA-B27; además, la presencia del HLA-DR1 se re- 6. Gónzalez S, et al: Immunogenetics, HLA-B27 and spondy-
loarthropathies. Curr Opin Rheumatol 1999;11:257-264.
lacionó con un comienzo más tardío de la enfermedad11.
7. Alvarez I, et al: HLA-B27 and Immunogenetics of spondy-
Varios estudios previos demostraron la asociación de EA loarthropathies. Curr Opin Rheumatol 2000;12:248-253.
con polimorfismo de los genes TNF e IL1β27-31, lo cual 8. Laurence, et al: Investigating the genetic basis for ankylosing
también ha sido confirmado en pacientes argentinos. spondylitis. Arthritis Rheum 1994;37:1212-1220.
En nuestra población, el HLA-DR15 se comportó 9. López-Larrea C, Sujurachato K, Mehra NK, et al: HLA
como un alelo protector, al igual que el genotipo GA del B27 subtypes in Asian patients with ankylosing spon-
dylitis: evidence for a new association. Tissue Antigens
TNF -238.
1995;45:169-76.
Con respecto a las características clínicas de la enfer- 10. Brown MA, et al: Ankylosing spondylitis in West Africans-
medad, se ha observado que ciertos genes determinan su evidence for a non-HLA-B27 protective effect. Ann Rheum
severidad y patrón de expresión fenotípica. Es así como Dis 1997;56:68-70.
varios estudios han relacionado la presencia de HLA- 11. Vargas Alarcón G, et al: Effect of HLA-B and HLA-DR genes
on susceptibility to and severity of spondyloarthropathies in
B27 con mayor frecuencia de artritis periférica, entesitis,
Mexican patients. Ann Rheum Dis 2002; 61:714-717.
uveítis, enfermedad más severa, progresión más rápida 12. Brown MA: Susceptibility to ankylosing spondylitis in twins.
de la sacroileítis y edad de inicio de la enfermedad más Arthritis Rheum 1997;40:1823-1828.
temprano3,11,14. También, como referimos anteriormente, 13. Skomsoll JF: HLA-B27 negative spondylitis in a father and a
ha sido documentada la asociación del HLA-DR8 a la son. Scand J Rheumatol 1995;24: 321-322.
presencia de uveítis en pacientes con EA15. 14. Brown MA: The effect of HLA-DR genes on susceptibility
to and severity of ankylosing spondylitis. Arthritis Rheum
En conclusión, en nuestra población de la ciudad de
1998;41:460-465.
Buenos Aires, la prevalencia HLA-B27 en pacientes con 15. Monowarel Islam SM: HLA-DR8 and acute anterior uveitis
EA es alta (90,4%). Además, el HLA-DR1 confiere en in ankylosing spondylitis. Arthritis Rheum1995;38:547-550.
forma independiente seis veces más probabilidad de pa- 16. Said-Nahal R: The role of HLA genes in familial spondyloar-
decer la enfermedad, mientras que el HLA-DR15 podría thropathy a comprehensive study of 70 multiplex families.
Ann Rheum Dis 2002;61:201-206.
comportarse como un alelo protector. La edad de inicio
17. Brown MA, Pile KD, Gibson K, et al. A genoma wide screen
de la enfermedad es menor en los individuos HLA-B27 for susceptibility loci in ankylosing Spondylitis. Arthritis
positivos y mayor en los HLA-B40 positivos. Hemos re- Rheum 1998;41:588-595.
plicado también la influencia del TNF e IL1β sobre la en- 18. Beyeler C, Armstrong M, Bind HA, et al: Relationship be-
fermedad. tween genotype for the cytochrome P450 CY92D6 and sus-
Los hallazgos de este estudio inmunogenético en una ceptibility to ankylosing spondylitis and rheumatoid arthritis.
Ann Rheum Dis 1996;55:66-68.
población representativa de pacientes argentinos con EA,
19. Macksymowych WP, Rohman P, Reeve JP, Gladman DD,

32
Peddle L, Inman R: Association of the IL 1 gene cluster 25. Camargo JF, Correa PA, Castiblanco J, Anaya JM: Interleu-
with susceptibility ankylosing spondylits. An analysis of kin-1beta polymorphisms in Colombian patients with auto-
three Canadian populations. Arthritis Rheum 2005;54:974- immune rheumatic diseases. Genes Immun 2004;5:609-14.
985. 26. Nahal R: Genetic Investigation in familial spondyloarthropa-
20. Jin L, Zhang G, Akey JM, et al: Lack of linkage of IL 1 RN thy (Spa) with focus on HLA region using transmission dese-
genotypes with ankylosing spondylitis susceptibility. Arthri- quilibrium test. Arthritis Rheum 1996;13:S573 (Abst).
tis Rheum 2004;50:3047-48. 27. Armstrong RD: Histocompatibility antigens in psoriasis, pso-
21. van der Linden S, Valkenburg HA, Cats A: Evaluation of riatic arthropathy and ankylosing spondylitis. Ann Rheum
diagnostic criteria for ankylosing spondylitis: a proposal Dis 1983;442:142-146.
for modification of the New York criteria. Arthritis Rheum 28. Verjons G, Messer G, Weiss EH, et al: Polymorphism of the
1984;27:361-368. tumor necrosis factor region in relation to disease. An over-
22. Olerup O, Zetterquist H: HLA DR typing by PCR amplifi- view. Rheum Dis Clin North Am 1992;18:177-185.
cation with sequence specific primers (PCR-SSP) in 2 hours: 29. Höhler T, Schoper T, Schneider PM, et al: Association of
an alternative to serological DR typing in clinical practice different TNF α promotes allele frequencies with ankylos-
including donor-recipient matching in cadaveric transplan- ing spondylitis in HLA B27 individuals. Arthritis Rheum
tation. Tissue Antigens 1992;39:225-235. Laivoranta JI, et al: 1998;41:1489-92.
HLA frequencies in HLA-B27 negative patients with reactive 30. Mc Gary F, Neilly J, Anderson N, Surrock R, Field M: A
arthritis. Clin Expl Rheumatol 1995;13:637-640. polymorphism within the interleukin 1 receptor antagonist
23. Correa PA, Gómez LM, Cadena J, Anaya J: Autoimmunity (ILRA) gene is associated with ankylosing spondylitis. Rheu-
and tuberculosis. Opposite association with TNF polymor- matology (Oxford) 2001;40:1359-64.
phism. J Rheumatol 2005;32:219-24. 31. Vender Faard T, Crusius JB, García González, et al: Interleu-
24. Gallagher G, Eskade J, Oh HH, et al: Distribution of poly- kin 1β and interleukin 1-receptor antagonist gene polymor-
morphic elements within the tumor necrosis factor locus in a phism in the susceptibility to ankylosing spondylitis. Rheu-
Canadian population. Inmunogenetics 1997;45:188-194. matology (Oxford) 2002;41:1419-23.

Revista Argentina de Reumatología • Año 20 • Nº 3 33


Comité de Drogas de Alta Tecnología (CODAT)
Sociedad Argentina de Reumatología

Introducción
El Comité de Drogas de Alta Tecnología - Sociedad Argentina de Reumatología, creado
hace un año, tiene entre sus objetivos propiciar eventos como el Curso de Drogas Endo-
venosas y Agentes Biológicos para Enfermería que fuera un éxito en el 42° Congreso Ar-
gentino de Reumatología. Asimismo requiere informes legales para prescripciones fuera de
prospecto, consentimientos informados en niños y adolescentes que fueran oportunamen-
te publicados en esta revista. Por otro lado, bajo la designación de las autoridades que lo
integran, ya se concertaron reuniones en el Ministerio de Salud y en la Superintendencia de
Servicios de Salud a fin de solicitar la reconsideración de las enfermedades reumáticas como
cuadros nosológicos que requieren actualizaciones periódicas en el PMO y en el APE, en
cuanto a diagnóstico y terapéutica. Debido a que la ciencia avanza a pasos agigantados y
nuestros pacientes deben contar con la mejor calidad de atención. Estas gestiones se están
llevando a cabo en estos momentos en forma conjunta con los reumatólogos pediatras.
Una de las tareas a las cuales también se halla abocado este Comité es la de actualizar
permanentemente el listado de drogas en investigación para enfermedades reumáticas,
según los protocolos que se encuentran en desarrollo a nivel internacional. Por tal motivo,
en esta edición de la revista, hemos volcado el resultado de la última revisión realizada
sobre Esclerodermia y publicada por el Instituto Nacional de la Salud de Estados Unidos
(NIH) a través de la página web www.clinicaltrials.com. Este servicio cuenta además con
el apoyo de la Biblioteca Nacional de Medicina de Estados Unidos (NLM) y del Departa-
mento de Salud del mismo país (U.S. Department of Health & Human Services).
A continuación, se publica la revisión sobre las líneas de investigación en Escleroder-
mia que se encuentran actualmente en desarrollo.
Comité de Drogas de Alta Tecnología: Dres. Victor Caputo, Cecilia Viacava, Laura
Raiti, Dario Scublinsky, Daniel O. Messina, Julio Hofman y Horacio Venarotti.

Revista Argentina de Reumatología • Año 20 • Nº 3 37


Comité de drogas de alta tecnología
Esclerodermia tigación fármaco-clínica federal y privadamente finan-
(Actualización sobre drogas utilizadas en el tratamien- ciados, desarrollados en los Estados Unidos y en todo el
to de las complicaciones vasculares de la enfermedad y mundo, existiendo registrados actualmente 79.285 trials
otros usos) desarrollados en 171 países, de los cuales 81 corresponden
Clinicaltrials.gov es un registro de estudios de inves- a esta enfermedad y sus complicaciones.

Drogas aprobadas

Droga Indicación Dosis Administración Mecanismo de acción Efectos adversos

Epoprostenol Hipertensión 2 ng/kg/min Perfusión Antiagregante Rubor facial,


pulmonar primaria intravenosa plaquetario muy cefalea, náuseas,
potente, PGI2, vómito, sequedad
activación de la de boca, dolor
adenilato ciclasa, torácico, bradicardia,
aumento del AMP hipotensión,
cíclico y disminución bradicardia, dolor
de calcio intracelular abdominal

Bosentan 1. Hipertensión 150 a 250 Oral Inhibidor de los Mareo, flush,


(Tracleer R.) pulmonar primaria y mg/d receptores A y B para hipotensión, cefalea,
secundaria (CF II- III) la endotelina hepatotoxicidad 7,8%
2. Esclerosis
sistémica con
alteración digital
ulcerosa activa
Sitaxsentan Hipertensión pulmonar 100 mg/d Oral Inhibición selectiva Hepatotoxicidad 3%.
(Thelin R.) primaria (CF II-III) Receptores tipo A Potencia efectos de la
warfarina

Ambrisentan ÍDEM 5-10 mg/d Oral ÍDEM anterior


Sildenafil ÍDEM 75 a 200 Oral Inhibidor de la Mareo, hipotensión,
mg/d fosfodiesterasa cefalea, flush.
CI: Cardiopatía
isquémica.
Pacientes tratados con
nitritos
Imatinib Leucemia 400 mg/d Oral Inhibidor de la Síntomas
(Gleevec R.) Sme hipereosinofílico tirosinquinasa, inhibe gastrointestinales,
Tumores digestivos de la producción de PDGF elevación de
estirpe estromal y TFGB, potente efecto transaminasas hepáticas,
antifibrótico, inhibe esplenomegalia,
Uso compasivo: la producción de ruptura esplénica en
Hipertensión arterial fibroblastos dérmicos pacientes con neoplasias
pulmonar refractaria en cultivo hematológicas

38
Drogas en estudio

Droga Indicación Dosis Administración Mecanismo de acción Efectos adversos

NCT00555581 Hipertensión arterial 400 mg/d por Oral, actualmente Inhibidor de la


(experimental) pulmonar e isquemia 12 meses en período de tirosinquinasa, inhibe
Intervencional, digital reclutamiento la producción de PDGF
(fase IIA) y TFGB, potente efecto
Abierto, prospectivo, antifibrótico, inhibe
1 solo grupo de la producción de
tratamiento, evalúa fibroblastos dérmicos
eficacia y seguridad de en cultivo
la droga
NCT00506831 Fibrosis cutánea e ÍDEM anterior
Intervencional, no hipertensión arterial
randomizado, abierto, pulmonar refractaria,
no controlado, un solo por sus efectos sobre
brazo de tratamiento la remodelación
para evaluar seguridad vascular
y eficacia de la droga en
la esclerosis sistémica
refractaria.
(Imatinib en esclerosis
sistémica)
(Fase I/II)
NCT0072536 Úlceras digitales 1 año de Oral Bloqueante de Similares a bosentan y
(ambrisentan) en pacientes con duración, inicio endotelina congéneres
Estudio de fase 1, esclerodermia Junio de 2008,
abierto, no randomizado, pacientes de
no controlado, de ambos sexos,
un solo grupo de mayores de 18
tratamiento, para evaluar años de edad
eficacia y seguridad
de ambrisentan en el
tratamiento de úlceras
digitales en pacientes
con esclerodermia
(reclutamiento)
NCT00463125 Úlceras digitales 18-80 años Estudio fase II-III, Inhibidor de factores
Gel plaquetario para en pacientes con de edad, intervencional, de crecimiento PDGF,
úlceras digitales esclerodermia difusa ambos sexos, randomizado, doble TGF beta 1-2, IGF
en pacientes con duración un ciego, controlado
esclerodermia difusa: año con placebo, de
un estudio controlado grupos paralelos,
randomizado para valorar eficacia
(reclutamiento) del compuesto
NCT00622687 Úlceras digitales 18-80 años de Intravenosa, para Análogo de la
Estudio de eficacia, fase refractarias edad, ambos valorar el efecto de prostaciclina, efecto
II, abierto, randomizado, sexos. distintos regímenes vasodilatador, inhibidor
de comparación de dosis, Iloprost 0,5 a de dosis (21 días de de la proliferación de
de grupos paralelos 2,0 ng/kg x tratamiento) músculo liso
(finalizado) min

Revista Argentina de Reumatología • Año 20 • Nº 3 39


Droga Indicación Dosis Administración Mecanismo de acción Efectos adversos

NCT00077584 Úlceras digitales Bosentan vs. Oral Inhibidor de receptores


“Eficacia y seguridad en pacientes con placebo, A y B (endotelina)
de bosentan oral en la esclerodermia 24 sem de
prevención y curación tratamiento
de úlceras digitales
en pacientes con
esclerodermia”
Intervencional,
randomizado, doble
ciego, controlado con
placebo, un solo grupo
de tratamiento, fase
III, evalúa eficacia y
seguridad de la droga
(finalizado)
NCT00775463 “Lesiones 18 años Oral Análogo de la Cefalea, diarrea,
Intervencional. isquémicas digitales de edad o prostaciclina (PGI2), náusea, rash, prurito,
Estudio de eficacia, en Esclerodermia mayores, efecto vasodilatador hipotensión
fase II, de tratamiento, tratadas con ambos sexos,
randomizado, doble treprostinil dosis máxima
ciego, controlado con dietanolamina oral” 16 mg 2
placebo, de grupos veces/día
paralelos
(reclutamiento)
CAT-192 Fase 1/2, doble 0,5-10 mg/kg Perfusión Anticuerpo anti-TFGB Elevada tasa de efectos
(experimental) ciego, controlado con intravenosa adversos y 4 muertes,
placebo, randomizado, no prosperó
escalamiento
de dosis para
evaluar seguridad,
tolerabilidad y
farmacocinética
de CAT 192,
un anticuerpo
monoclonal anti TFG-
Beta 1 en pacientes
con estadio temprano
de esclerosis
sistémica difusa, en
pacientes de ambos
sexos entre 18 y 75
años de edad

40
Droga Indicación Dosis Administración Mecanismo de acción Efectos adversos

P-144 La administración Tópica Péptido inhibidor de Reacciones locales,


(experimental) tópica diaria TFGB dermatitis
(NCT00656825) disminuye la
“Tolerabilidad y fibrosis inducida
biodisponibilidad del por bleomicina.
péptido P 144 inhibidor La administración
de TGF B1 luego de la tópica de P-144
administración tópica en más inyecciones de
voluntarios sanos” bleomicina hacen que
el grado de fibrosis
cutánea sea menor
(estado: en curso)
PVAC Psoriasis cutánea. 15 a 50 Intradérmica Citostático Todavía no bien
(experimental) Sólo un estudio piloto Micro- Antifibrótico estandarizados
de 18 pacientes con gramos
esclerodermia en 24
semanas
CT00769028 Doble ciego, 1 ml albúmina Subcutánea Inhibición de células Todavía no bien
(experimental) controlado con caprina mononucleares, estandarizados
Título: Estudio piloto, placebo, randomizado. hiperinmune inhibición de LT
doble ciego, controlado Estudiar la seguridad (2 veces estimulados y de la
con placebo, para y tolerabilidad por semana síntesis de moléculas
evaluar eficacia y de suero caprino durante 6 proinflamatoria
seguridad de AIMSPRO hiperinmune meses)
en esclerosis sistémica (AIMSPRO) en el
cutánea difusa tratamiento de
establecida. esclerosis sistémica
Fase II durante un período de
26 semanas.
Actualmente en fase
de reclutamiento
NCT00333437 No randomizado, 2 g/d Oral Agente Diarrea, leucopenia,
(experimental) abierto, no controlado, inmunosupresor vómitos, sepsis,
Título: Compromiso 1 solo brazo de inhibidor de la incidencia elevada
pulmonar en tratamiento para inosina monofosfato de infecciones
esclerodermia, evaluar eficacia deshidrogenasa oportunistas.
seguridad y eficacia de y seguridad de (IMPDH) Casos reportados de
mofetil micofenolato mofetil micofenolato leucoencefalopatía
en pacientes con en el tratamiento multifocal progresiva
esclerodermia de pacientes con
esclerodermia.
Estudio actualmente
en curso, finalizado
período de
reclutamiento

Revista Argentina de Reumatología • Año 20 • Nº 3 41


Droga Indicación Dosis Administración Mecanismo de acción Efectos adversos

NCT00501995 Abierto, no Dosis inmuno- Intravenosa Inhibidor de la Alopecia, náusea,


(Fase III) randomizado, no supresoras proliferación y vómito, diarrea,
(experimental) controlado, 1 solo crecimiento celular, predisposición a
Titulo: brazo de tratamiento inhibidor de la síntesis infecciones
Altas dosis de para evaluar de proteína, depresión
ciclofosfamida para eficacia y seguridad inmunitaria
el tratamiento de la de altas dosis de
esclerosis sistémica ciclofosfamida en
el tratamiento de
esclerodermia
NCT00004786 Tratamiento Iloprost, VO Oral Inhibición de Rubefacción facial,
(Fase III) randomizado, doble o placebo la agregación, cefaleas, malestar
(experimental) ciego, controlado con durante 6 adherencia y liberación general, náuseas,
placebo. semanas, 2 plaquetaria, activación vómitos.
Evaluar la seguridad veces al día de la fibrinólisis, En algunos casos
y eficacia de disminución de la hipotensión arterial
Iloprost, un análogo permeabilidad vascular
de la prostaciclina aumentada en la
en pacientes con microcirculación
fenómeno de
Raynaud secundario
a esclerosis sistémica.
Se reclutaron 200
pacientes mayores de
18 años con úlceras
cutáneas digitales
NCT00626665 Doble ciego, Placebo o 20 Oral Inhibidor de la PDE-5 Disconfort abdominal,
(experimental) controlado con mg de tadalafil cefalea, mialgias,
Titulo: Estudio placebo, randomizado, 3 veces por congestión nasal,
randomizado, controlado dosis fijas. semana por 6 flushing
para evaluar eficacia de 25 pacientes de semanas
Tadalafil en fenómeno de ambos sexos entre 18
Raynaud en pacientes y 70 años de edad
con esclerodermia
NCT00764309 Fase I/II, experimental, Tabletas 100 Oral Dasatinib es un Mielosupresión,
Título: 1 solo grupo de mg, 1 vez/d, inhibidor de múltiples neutropenia,
Estudio abierto para tratamiento por 6 meses tirosinquinasas trombocitopenia,
evaluar seguridad insuficiencia hepática
de Dasatinib en el y/o renal.
tratamiento de la Eventos hemorrágicos.
fibrosis pulmonar por Prolongación del
esclerodermia segmento QT
NCT00498615 Fase III, randomizado, Oral Inhibición de la Cefalea, pirosis
Titulo: doble ciego, vasoconstricción
Eficacia y tolerabilidad controlado, un solo por inhibición de la
de un inhibidor de grupo de tratamiento, molécula de señal
Rho-Kinasa (Fasudil) estudio de eficacia y Rho-kinasa, proteína
en el tratamiento del seguridad involucrada en una
fenómeno de Raynaud variedad de procesos
de transducción celular

42
Droga Indicación Dosis Administración Mecanismo de acción Efectos adversos

NCT00725361 Fase I, no 1-10 mg/d Oral Bloqueante de Mareo, flushing,


Titulo: Un estudio randomizado, abierto, endotelina 1 cefalea, hipotensión
piloto para evaluar la no controlado, un solo
eficacia de Ambrisentan grupo de tratamiento,
en el tratamiento y la estudio de eficacia y
prevención de úlceras seguridad. Población:
digitales en pacientes pacientes mayores de
con esclerodermia 18 años, ambos sexos

Revista Argentina de Reumatología • Año 20 • Nº 3 43


[ información ]

La revista se encuentra indizada en LILACS


Base de datos de LILACS

La base de datos LILACS - Literatura Latinoamericana y del El acceso a la base de datos LILACS puede ser realizado en
Caribe en Ciencias de la Salud es un producto cooperativo del disco compacto (CD ROM) y también en la Biblioteca Virtual
Sistema Latinoamericano y del Caribe de Información en Cien- en Salud en el ítem Literatura Científica, con conexiones a
cias de la Salud, y comprende la literatura científico-técnica fuentes de información complementarias, particularmente con
en salud, producida por autores latinoamericanos y del Caribe bases de datos de textos completos y servicios de suministro
y publicada en los países de América latina y Caribe, a partir online de copias de documentos en papel.
de 1982. El disco LILACS/CD ROM tiene periodicidad cuatrimestral e
El principal propósito de la base de datos de LILACS es el incluye las bases de datos del sistema LILACS, bases de da-
control bibliográfico y la diseminación de la literatura científi- tos de Centros Especializados y de la Biblioteca de la Orga-
co-técnica latinoamericana y del Caribe en el área de la salud, nización Panamericana de la Salud, y la base de datos SECS
ausentes de las bases de datos internacionales. Publicaciones Periódicas en Ciencias de la Salud. Puede ser
En la base de datos LILACS son descriptos e indizados: libros, adquirido por suscripción por cualquier usuario o biblioteca.
capítulos de libros, tesis, anales de congresos o conferencias, La política de distribución de LILACS/CD ROM a los Centros
informes técnico-científicos, artículos de revistas, etc., relati- Cooperantes está basada en la contribución para la base de
vos al área de la salud. datos de LILACS.

Centros cooperantes

BIREME - Centro Latino Americano e do Biblioteca Central Biblioteca Central


Caribe de Informação em Ciências da Hospital Italiano de Buenos Aires Facultad de Ciencias Médicas
Saúde - Organização Panamericana da a/c: María del Rosario Revello Universidad Nacional de Rosario
Saúde - OPAS Gascón 450, 2º P. Ciudad de Buenos Aires a/c: Elsa M. Biese de Christen
Rua Botucatu 862 Vila Clementino Dirección: Santa Fe 3100
São Paulo, 04023-901 Biblioteca Rosario, Santa Fe
Facultad de Ciencias Médicas
Biblioteca Médica Nacional - Centro Universidad Nacional de Córdoba - UNC Biblioteca de la Escuela de Enfermería
Nacional de Información de Ciencias Mé- a/c: María Graciela Cañete Módulo de Farmacia y Bioquímica
dicas - INFOMED - MINSAP - Ministerio Dirección: Pabellón Argentina, 2º Piso, Universidad Nacional de Misiones
de Salud Pública. Ciudad Universitaria. Ciudad de Córdoba a/c: Rosa Elena López
a/c: Bárbara C. Lazo Rodríguez López Torres 3415. Posadas, Misiones
Calle 23 Nº 162 Esq. N - El Vedado Biblioteca A.A.O.T.
La Habana, CU Asociación Argentina de Ortopedia y Centro de Documentación
Traumatología Representación de la OPS/OMS
BINAME –Biblioteca Nacional de Medici- a/c: Silvina Dicranian Organización Panamericana de la Salud
na– Centro Nacional de Documentación e Vicente López 1878. Ciudad de Buenos Organización Mundial de la Salud
Información en Medicina y Ciencias de la Aires a/c: Susana Catalina Iannello
Salud - CENDIM - Facultad de Medicina Marcelo Torcuato de Alvear 684
Gral. Flores 2125. Montevideo, UY 1800 Biblioteca Ciudad de Buenos Aires
Centro de Investigaciones Endocrinológi-
Biblioteca Central. Facultad de cas –CEDIE–. Servicio de Endocrinología Biblioteca
Medicina. Universidad de Chile Hospital General de Niños Dr. Ricardo Hospital Británico de Buenos Aires
a/c: Carmen Lœwenstein Vega Gutiérrez a/c: Norma Mabel Nunez
Av. Independencia 1027. Santiago a/c: Sra. María Susana Mancini Perdriel 74. Ciudad de Buenos Aires
Gallo 1330. Ciudad de Buenos Aires
Argentina: Centro de Información Pediátrica
Centro de Documentación Médica de La Sociedad Argentina de Pediatría
Biblioteca. Academia Nacional de Plata a/c: Inés Amor de García Uranga
Medicina de Buenos Aires a/c: Oscar Américo Barbieri Av. Coronel Díaz 1971
a/c: Patricia Boan Calle 2 Nº 1519 (63 y 64) Ciudad de Buenos Aires
Andrés Pacheco de Melo 3081 - 1º Piso. Ciudad de La Plata
Ciudad de Buenos Aires Biblioteca
Biblioteca Facultad de Ciencias Médicas FCM
Centro de Información Biomédica del Facultad de Ciencias Médicas –UNCu– Universidad Nacional de Cuyo
Chaco –CIBCHACO– Ministerio de Salud Facultad de Odontología Parque Gral. San Martín - Centro Univer-
Pública y Acción Social Universidad Maimónides sitario. Mendoza
a/c: Alberto Carisimo Mendoza a/c: Inés Amor García Uranga
Marcelo T. de Alvear 20 - 2º P. Hidalgo 775 - 5º Piso
Resistencia, Chaco. Ciudad de Buenos de Aires

50
[ información ]

Biblioteca. Servicios ofrecidos


Consulta en Sala de Lectura: el servicio funciona de lunes a del Caribe de Información en Ciencias de la Salud, coordina-
viernes de 14 a 19 hs. Consultas en Internet y uso de equipos da por BIREME (Biblioteca Regional de Medicina).
de informática en sala. The Cochrane Library: es una colección actualizada de
Fotocopias: atención de consulta y pedido de artículos vía fuentes de información sobre medicina basada en eviden-
telefónica, fax o correo electrónico. cias, incluyendo la base de datos Cochrane de Revisiones
Búsqueda en Bases de Datos: servicio arancelado. Permite Sistemáticas.
obtener, en base a un tema determinado, un listado de citas bi-
bliográficas con sus respectivos resúmenes a través del acceso Conmutación Bibliográfica: copias de documentos en foto-
a las bases Medline, Lilacs, Cochrane Library. Las búsquedas copias y formato electrónico que se localizan en otras biblio-
se solicitan personalmente, por fax o correo electrónico. tecas o centros de información. Servicio arancelado.
Medline: versión electrónica del Index Medicus. Es la base Digitalización de Imágenes: servicio arancelado. La biblio-
de datos bibliográficos elaborada por la National Library of teca posee un scanner para diapositivas, negativos, opacos
Medicine; abarca las áreas de medicina, enfermería, odonto- y textos.
logía, veterinaria y ciencias biológicas. Pago de aranceles: se puede efectuar personalmente, por
Lilacs: versión electrónica del Index Medicus Latinoamerica- débito en tarjeta de crédito, cheque, giro postal o depósito
no (Literatura Latinoamericana de Información en Ciencias de bancario.
la Salud), producto cooperativo de la Red Latinoamericana y Consultas y pedidos: e-mail: sar-biblioteca@fibertel.com.ar

Catálogo de publicaciones periódicas

a. Acta Rheumatologica Portuguesa k. Clinical Orthopedics and Related u. Osteoarthritis and Cartilage
b. American Journal of Medicine Research v. Osteoporosis International
c. Annals of Internal Medicine l. Clinical Rheumatology w. Radiology
d. Annals of Rheumatic Diseases m. Clinics in Rheumatic Diseases of x. Revista Brasileira de Rheumatologia
e. Arthritis and Rheumatism North America y. Revue du Rhumatisme et des
f. Bailiere’s Best Practice & Research n. Connective Tissue Research Maladies Osteo-Articulaires
in Clinical Rheumatology o. Journal of Bone and Joint Surgery A z. Rheumatology International
g. Best Practice & Research Clinical p. Journal of Bone and Joint Surgery B aa. Scandinavian Journal of Rheumatology
Rheumatology q. Journal of Clinical Rheumatology ab. Seminars in Arthritis and Rheumatism
h. Bone r. Journal of Rheumatology ac. Skeletal Radiology
i. Bulletin on the Rheumatic Diseases s. Medicina (Buenos Aires) ad. Zeitschrift für Rheumatologie
j. Clinical and Experimental Immunology t. Medicine

Actualización de las publicaciones que se reciben

a. Annals of the Rheumatic Diseases d. Clínicas de Reumatología Norteamérica g. Lupus


b. Arthritis and Rheumatism e. Current Opinion in Rheumatology h. Seminars in Arthritis and Rheumatism
c. Clinical and Experimental Rheumatology f. Journal of Rheumatology

Libros adquiridos recientemente

a. Arturi AS, Marcos JC, Babini JC. Enfer- cía Carrasco M, Cervera R. Autoinmuni- Weisman MH, Winblatt ME, Louie JS. 2ª
medades autoinmunes. Buenos Aires: dad y enfermedad autoinmune. Mede- ed. española. Madrid: Marbán, 2003.
Abbott, 2005. llín, 2005. f. Taylor & Resnick: Aparato locomotor.
b. Manual SER de las enfermedades reu- d. Kelley’s: Reumatología. Ruddy S, Harris Diagnóstico radiológico. Taylor JAM,
máticas. Sociedad Española de Reu- Jr. Ed., Sledge CB. 6ª ed. española. Ma- Resnick D. ed. española de: Skeletal
matología. 4ª ed. Madrid: Panamerica- drid: Marbán, 2003. imaging atlas of the spine and extremi-
na, 2004. e. Complemento de Kelley’s Reumato- ties. Madrid: Marbán, 2003.
c. Anaya JM, Shœnfeld Y, Correo PA, Gar- logía: Tratamientos de reumatología.

Horario de atención

Lunes a viernes de 14 a 19 hs.


RevistaLILACS.doc

Revista Argentina de Reumatología • Año 20 • Nº 3 51


[ información ]

Reglamento de Publicaciones RAR

Los artículos deberán remitirse en forma- realizados para llegar al diagnóstico defi- drán igual sistema de numeración que
to electrónico (diskette de 3 1/2 o CD) y 2 nitivo. Se aceptarán hasta 6 figuras. los gráficos. Es muy importante que las
copias en papel a: Cartas de lectores: comentarios acerca copias fotográficas papel sean de calidad
Revista Argentina de Reumatología de los artículos publicados previamente. inmejorable para poder obtener así bue-
Austria 2469, (7º A), (1425) No deberán superar las 4 páginas, pu- nas reproducciones; se presentarán de
Ciudad de Buenos Aires, Argentina. diendo incluir una sola tabla o figura y modo que los cuerpos opacos (huesos,
hasta 6 citas bibliográficas. sustancias de contraste) aparezcan en
En la primera página de las distintas cola- blanco. Las fotografías irán numeradas al
boraciones deberá constar: título en cas- Material ilustrativo: dorso, con números arábigos, siguiendo
tellano y en inglés, apellidos y nombres • Tablas: debe presentarse una sola tabla la secuencia que tienen en el texto, me-
completos de los autores, centro donde por página. Se enviará en formato elec- diante una etiqueta adhesiva, indicando
se realizó el trabajo, dirección del mismo, trónico en archivo Excel o tabla inserta en además el nombre del primer autor, con
y para la correspondencia y petición de Word en archivo aparte del texto. Cada una flecha que señalará la parte superior.
separatas. tabla debe ir numerada con números ro- Debe procurarse no escribir en el dorso,
manos y encabezada por el enunciado o ya que se producen surcos en la foto-
Secciones de la revista: título. Las tablas deberán ir citadas en el grafía. Si las fotos se envían en formato
Editorial: contribución solicitada por texto por orden consecutivo. Todas las digital, éstas deberán encontrarse por lo
el Comité a un experto, quien desde el siglas y abreviaturas se acompañarán menos a 250 dpi al tamaño solicitado an-
punto de vista personal escribirá sobre siempre de una nota explicativa al pie teriormente y guardadas en los formatos
temas de interés actual. Su extensión de la tabla. Asimismo, se identificarán de tiff, eps o Adobe Photoshop. No utilizar
máxima será de 5 páginas. forma precisa las medidas estadísticas formatos bmp, pict, jpeg, pdf o swf, tam-
Artículos originales: presentación de una empleadas. Cuando se haya efectuado poco fotos o gráficos tomados de pági-
experiencia científica original, personal o un estudio estadístico se indicará a pie nas web o cds interactivos. No se acep-
grupal, que contribuya al progreso de la de tabla el nivel de significación, si no se tarán fotos ni gráficos incluidos dentro de
Especialidad. El texto tendrá una exten- hubiera incluido en el texto de la tabla. El Power Point o Word debiendo ser envia-
sión máxima de 20 páginas. Los distintos orden de los signos de llamada será el dos como archivos externos. El archivo
ítems figurarán en el siguiente orden: resu- siguiente:* si hay una única llamada; le- deberá estar nombrado con el número
men en castellano e inglés de hasta 200 tras minúsculas en orden alfabético (a, b, de foto (en números arábigos) seguido
palabras, palabras clave (3 a 10), intro- c…) si hay dos o más llamadas. Para su del nombre del primer autor, enviando un
ducción, material y métodos, resultados, envío deberán estar realizadas en Micro- archivo por foto.
discusión, conclusiones y bibliografía. Se soft Word o Excel no aceptándose tablas • Pies de figuras: deberán ir en el archi-
admitirán hasta 6 figuras y 6 tablas. escaneadas. vo aparte, numeradas según su secuen-
Actualizaciones: puesta al día sobre de- • Gráficos (figuras): podrán ser elabo- cia correspondiente y a doble espacio.
terminados temas de interés, expuestos rados con computadora únicamente en En ellas se explicará el contenido de la
en forma sintética. No deberá exceder las programa vectorial (Corel Draw, Free- ilustración, así como el significado de los
10 páginas, pudiendo incluir 2 tablas y 2 hand, Adobe Illustrator) o en programa signos, flechas, números y abreviaturas
figuras. Se deberán agregar “Lecturas re- de planilla de cálculos (Excel). El tamaño que pueda haber. En las reproducciones
comendadas” en número no mayor a 10 será de 9 x 12 cm o 12 x 18 cm. Se en- histológicas se especificará el aumento y
citas. viarán como archivos externos al archivo el método de tinción.
Casos clínicos: descripción de un caso principal de textos; deberán estar nom- • Citas bibliográficas: se redactarán se-
de rara observación que suponga un apor- brados con el número de figura, envian- gún normas del International Committee
te importante al conocimiento del tema. do un archivo por gráfico. Si se envían of Medical Journal Editor. Las mismas
Su extensión máxima será de 10 páginas. escaneados, modalidad poco conve- pueden consultarse en:
Constará de resumen en castellano y en niente, se deberán seguir las pautas in- http://www.nlm.nih.gov.bsd/uniform_re-
inglés, descripción y discusión del caso y dicadas para fotografías. Si se incluyen quirements.htlm
bibliografía (no más de 15 citas). Se admi- dibujos especiales a mano alzada en
tirán hasta 4 figuras y 4 tablas. papel, deberán estar dibujados en tinta El Comité de Redacción se reserva el
Diagnóstico por imágenes: presenta- negra sobre papel blanco que garantice derecho de rechazar aquellos artícu-
ción de un caso problema en base al diag- un buen contraste. los que juzgue inapropiados, así como
nóstico por imágenes, con datos clínicos • Fotografías: se seleccionarán procu- de proponer o realizar modificaciones
imprescindibles y secuencia de estudios rando que sean de buena calidad. Ten- cuando lo considere necesario.

52