Está en la página 1de 175

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/316754612

Mis casos clínicos en Odontología

Book · October 2015

CITATIONS READS
0 15,958

1 author:

Edith Lara-Carrillo
Universidad Autónoma del Estado de México (UAEM)
45 PUBLICATIONS   158 CITATIONS   

SEE PROFILE

All content following this page was uploaded by Edith Lara-Carrillo on 08 May 2017.

The user has requested enhancement of the downloaded file.


Mis casos clínicos en
Odontología
EDITORES

Carlo Eduardo Medina Solís


Juan Fernando Casanova Rosado
Edith Lara Carrillo

ISBN: 978-607-8444-10-6
Mis casos clínicos en Odontología

EDITORES
Carlo Eduardo Medina Solís
Juan Fernando Casanova Rosado
Edith Lara Carrillo

ISBN: 978-607-8444-10-6

San Francisco de Campeche, octubre de 2015.


Primera Edición:

Sobre la presente edición


Universidad Autónoma de Campeche
Facultad de Odontología
Av. Agustín Melgar s/n
Entre Juan de la Barrera y Calle 20
Colonia Buenavista
CP. 24039
1a. Edición
Octubre de 2015
ISBN: 978-607-8444-10-6

Los comentarios, interpretaciones y conclusiones de este libro son


responsabilidad exclusiva de los autores y no necesariamente reflejan el
punto de vista del editor.

Mis Casos Clínicos de Odontología by Universidad Autónoma de Campeche is licensed


under a Creative Commons Reconocimiento-NoComercial 4.0 Internacional License.
DIRECTORIO

Lic. Gerardo Montero Pérez


Rector

Lic. Manuel Sarmiento Morales


Secretario General

Dr. Benjamin Otto Ortega Morales


Director General de Estudios de Posgrado e Investigación

CDEE. José Manuel Pech Ramírez


Director de la Facultad de Odontología
Presentación

Escribir bien un trabajo científico no


es una cuestión de vida o muerte;
es algo mucho más serio.
(Robert A. Day, 2005)

Desde siempre, los casos clínicos han tenido un papel central en la actividad docente dentro del proceso enseñanza-
aprendizaje en el área de la Odontología, ya que tiene una particularidad que la hace diferente a otras carreras; es
inminentemente clínica. Por lo que en la era de la práctica basada en la evidencia, es necesaria la evidencia basada en la
práctica. La base de esta evidencia es la información detallada de los reportes de casos de personas individuales que
comunican tanto nuestra investigación clínica como nuestra atención clínica diaria.1 Los primeros informes de casos clínicos
aparecieron en las revistas médicas alrededor del mundo hace más de un siglo. Para muchos, el informe riguroso de casos
clínicos es el primer peldaño en la investigación clínica, seguido de la serie de casos, la encuesta transversal, el estudio de
casos y controles, y así sucesivamente. De esta forma, generalmente lo que se aprende en los libros no siempre es lo que
uno aprecia en la práctica. Compartir los casos clínicos también facilita el aprendizaje continuo del profesional. El objetivo
del reporte de un caso clínico es hacer una contribución al progreso de la odontología, presentando aspectos nuevos o
instructivos de una enfermedad o evento determinado. Pese a tener un nivel bajo de evidencia científica, la publicación de
un caso clínico favorece al estudiante la comprensión de una guía práctica clínica, la forma de razonamiento y el manejo de
la incertidumbre. Su lectura puede incrementar el abanico de diagnóstico diferencial y estimular el espíritu del clínico.2,3,4 En
este libro, se presentan una serie de casos clínicos que fueron desarrollados por profesores y estudiantes de licenciatura y
posgrado. Representa un esfuerzo conjunto de múltiples instituciones que tienen intereses comunes, cuerpos académicos
que buscan el desarrollo de la enseñanza en la Odontología, profesores y clínicos entusiastas en la academia para mejorar
la salud de los pacientes. En este libro estuvimos interesados en reportar casos clínicos comunes, así como en casos
clínicos poco comunes, ya que con la publicación de casos clínicos comunes manejados de acuerdo a los principios de
mejores prácticas consensuadas se ayuda a informar a un público más amplio, del que se lograría con la publicación de
informes clínicos más raros y complejos, que tal vez, nunca encontremos en la práctica clínica.

M en C. Carlo Eduardo Medina Solís - Universidad Autónoma del Estado de Hidalgo.


M en C. Juan Fernando Casanova Rosado - Universidad Autónoma de Campeche.
D en CS. Edith Lara Carrillo - Universidad Autónoma del Estado de México.
E D I T O R E S

1 Kidd M. Editor's profile. Editor-in-Chief of the Journal of Medical Case Reports. 2015.
2 Villanueva-López IS. Cómo redactar un caso clínico. Acta Ortopédica Mexicana 2009; 23(5):315-316.
3 Reyes-Ortiz CA, Llanos G. La alegría de publicar 5. El informe de un caso clínico. Revista Colombia Médica 2002;33(4):198-199.
4 Chiari K, Díaz R. Generalidades de casos clínicos. En: Ortega-Loubon C, Correa-Márquez R, editores. Casos clínicos. Semiología y

publicación. Panamá: iMedPub; 2010.


CONTENIDO
Pag.
Capítulo 1.
Manejo odontopediátrico de órgano dentario triple: reporte de un caso.
1
Gutiérrez-Romero L, Gasca-Argueta G, Robles-Bermeo NL, Lara-Carrillo E, Medina-Solís CE.

Capítulo 2.
Tratamiento de la caries de la infancia temprana severa: reporte de un caso.
8
Hernández-Martínez CT, Medina-Solís CE, Guadarrama-Quiroz LJ, Robles-Bermeo NL, Jiménez-Gayosso JG.

Capítulo 3.
Rehabilitación bucal de paciente con trastorno de espectro autista: reporte de un caso.
13
Baena-Santillán ES, Medina-Solís CE, Ortiz-Ruiz J, Varela-Ibáñez CE.

Capítulo 4.
Retención dental: reporte de caso en gemelas monocigóticas.
20
Manzur-Quiroga SC, Lara-Carrillo E, Jardón-Romero EA, Valdez-Vargas B, Medina-Solís CE.

Capítulo 5.
Uso del péndulo para la distalización de molares: serie de casos clínicos.
25
Esparza-Camacho M, Beltrán-Jiménez C, Valenzuela-Zamora YH, Verdugo-Barraza ML, Castro-Lara AL.

Capítulo 6.
Corrección de apiñamiento anteroinferior con extracción de un incisivo: reporte de un caso.
32
Moreno-Terrazas E, Verdugo-Barraza ML, García-Jau RA, Padilla-Suzuki B, Castro-Lara AL.

Capítulo 7.
Terapia miofuncional con lip bumper de un paciente clase II división 1: reporte de un caso.
36
Mendoza-Rodríguez M, Cores-Carballosa A, Minaya-Sánchez MI, Vallejos-Sáncehez AA.

Capítulo 8.
Prognatismo mandibular corrección quirúrgica ortodontica: reporte de un caso.
42
Moreno-Terrazas E, Verdugo-Barraza ML, García-Jau RA, Benítez-Pascual J, Villalobos-Rodelo JJ.

Capítulo 9.
Tratamiento de extrusión-intrusión dental en el tratamiento interdisciplinario. reporte de dos casos.
47
Herrera-Atoche JR, Escoffié-Ramírez M, Carrillo-Ávila BA, Novelo-Mendoza LE.

Capítulo 10.
Tratamiento ortodóncico-quirúrgico de una laterognasia: reporte de un caso.
54
Lara-Carrillo E, Kubodera-Ito T, Muñoz-Saracho AM, López-González S, Valdez-Vargas B.

Capítulo 11.
Tratamiento multidisciplinario periodontal y ortodóntico. reporte de un caso.
61
Minaya-Sánchez MI, Casanova-Rosado JF, Vallejos-Sánchez AA, Robles-Minaya JL, Mendoza-Rodríguez M.

Capítulo 12.
Quiste periapical: reporte de un caso. 65
Barajas-Pérez VH, González JL, Zambrano-Galván G, Ávila-Valdez R, Cuevas-González JC.
Capítulo 13.
Hiperplasia multifocal del epitelio en cavidad oral. reporte de un caso.
68
Lizárraga-Rodríguez D, Jiménez-Aguilar SM, Benítez-Pascual J, Padilla-Suzuki BE, Villalobos-Rodelo JJ.

Capítulo 14.
Leiomioma vascular oral: reporte de un caso.
74
Jardón-Romero EA, Manzur-Quiroga SC, Lara-Carrillo E, López-González S, Medina-Solís CE.

Capítulo 15.
Odontoma compuesto: reporte de un caso.
Casanova-Rosado JF, Vallejos-Sánchez AA, Casanova-Rosado AJ, Minaya-Sánchez MI, Casanova-Sarmiento 78
JA.

Capítulo 16.
Fibrosarcoma ameloblástico: reporte de un caso.
83
González-López BS, Escalona-Bermeo JR, Campos-Hernández R, Montes de Oca-Rodríguez M.

Capítulo 17.
Lipoma intraoral: reporte de un caso.
91
Valdez-Vargas BJ, Manzur-Quiroga SC, López-González S, Jadón-Romero EA, Contreras-Landgrave G.

Capítulo 18.
Odontectomía de mesiodens con extirpación de quiste dentígero: reporte de un caso.
96
López-González S, Manzur-Quiroga SC, Lara-Carrillo E, Valdez-Vargas BJ, Jardón-Romero EA.

Capítulo 19.
Tratamiento quirúrgico de pseudoquiste de extravasación en el labio inferior: reporte de un caso.
101
Hernández-Martínez CT, Reyes-García M, Pedraza-Contreras G, González-López BS, Robles-Bermeo NL.

Capítulo 20.
Odontoma compuesto, manejo del paciente con trastorno por déficit de atención e hiperactividad: reporte
de un caso. 108
Bravo-López LD, Robles-Bermeo NL, Villanueva-Jurado D.

Capítulo 21.
Fibromatosis gingival hereditaria: reporte de un caso.
114
Benítez-Pascual J, Lizárraga-Rodríguez D, Padilla-Suzuki B, García-Jau R, Verdugo-Barraza L.

Capítulo 22.
Reacción liquenoide por amalgama: reporte de un caso.
119
Lizárraga-Rodríguez D, Jiménez-Aguilar SM, Villalobos-Rodelo JJ, Benítez-Pascual J, Muñoz-Estrada VF.

Capítulo 23.
Uso de ultrasonido en la remoción de una fresa endo-safe fracturada en un conducto radicular: reporte de
un caso. 126
Ramírez-Salinas PA, Vázquez-Coria S, de la Rosa-Santillana R, Medina-Solís CE.

Capítulo 24.
Tratamiento alternativo para la fluorosis dental: reporte de un caso.
132
Yáñez-Acosta MF, Velázquez-Jiménez YC, Alonso-Sánchez CC, Nario-Venegas H, Núñez-Torres LJ.
Capítulo 25.
Rehabilitación bucal de un paciente adulto joven como competencia clínica de prótesis parcial fija en la
licenciatura: reporte de un caso. 137
Cervantes-Chávez FM, Fernández-Barrera MA, Asencio-Villagrán A, Márquez-Corona ML, Medina-Solís CE.

Capítulo 26.
Hallazgo radiológico: defecto de Stafne.
Casanova-Sarmiento JA, Casanova-Rosado JF, Minaya-Sánchez MI, Vallejos-Sánchez AA, Casanova-Rosado 144
AJ.

Capítulo 27.
Presencia de los polimorfismos rs411717 y rs810687 del gen de COL1A2 en caries severa: reporte de un
caso. 148
López-Rodríguez P, Guerrero-Cabral BV, Muñoz-Hernández MJ, Cuevas-González JC, Zambrano-Galván G.

Capítulo 28.
Planeación digital odontológica: reporte de un caso.
153
Nario-Venegas H, Yáñez-Acosta MF, Núñez-Torres LJ, Plascencia-Serrano IH.

Capítulo 29.
Tratamiento ortodóncico de maloclusión Clase I con extracciones de segundos premolares: reporte de un
caso. 157
Scougall-Vilchis RJ, Pérez-García IJ, Santillán-Reyes AM, Carrillo-Novia I, Medina-Solís CE.
Capítulo 1
MANEJO ODONTOPEDIÁTRICO DE ÓRGANO
DENTARIO TRIPLE: REPORTE DE UN CASO.
Liliana Gutiérrez-Romero,1 Resumen
Gabriela Gasca-Argueta,2 Introducción: La unión de tres dientes se ha reportado como “dientes triples”, son el
Norma Leticia Robles-Bermeo,3 resultado de un desequilibrio durante el complejo proceso de la odontogénesis, que
Edith Lara-Carrillo,4 conduce a una anormalidad en el número, tamaño, forma o estructura del diente, causando
problemas estéticos, caries, enfermedad periodontal, maloclusiones, retraso en la
Carlo Eduardo Medina-Solís.5
exfoliación, otros problemas de desarrollo y funcionales transitorios en la dentición primaria
y retraso o alteración del desarrollo y erupción de los sucesores permanentes.
(1) Alumna de la Especialidad en
Odontopediatría. Facultad de Odontología de Presentación del caso: En este trabajo se presenta el manejo odontopediátrico de una
la Universidad Autónoma del Estado de niña de 3 años de edad con una fusión inusual de tres dientes, que afecta a dos órganos
México. Toluca, México. dentarios de la fórmula y un supernumerario, asociado a un problema de mordida cruzada
(2) Profesor de la Especialidad en anterior, el cual fue rehabilitado con una corona estética en el diente trifusionado,
Odontopediatría. Facultad de Odontología de previamente habiendo mejorado la relación de mordida cruzada anterior, utilizando aparatos
la Universidad Autónoma del Estado de de ortopedia para este fin por un periodo aproximado de dos meses, mejorando las
México. Toluca, México. condiciones estéticas y funcionales del paciente. Conclusiones: A pesar de tener una
(3) Profesor-Investigador. Coordinadora del dentición temporal incompleta la intervención temprana ayudará a evitar el agravamiento del
Posgrado en Odontopediatría de la Facultad
de Odontología de la Universidad Autónoma
padecimiento, considerando la opción de modificar el tratamiento una vez que haya sido
del Estado de México. Toluca, México. completada la dentición temporal. Significancia clínica: Al ser el diente trifusionado una
(4) Profesor-Investigador. Coordinadora de la anomalía de baja prevalencia, en el presente manuscrito se ofrece al lector una opción para
Maestría en Ciencias Odontológicas de la el manejo clínico, mejorando las condiciones estéticas y funcionales.
Facultad de Odontología de la Universidad
Autónoma del Estado de México. Toluca, Cómo citar:
México. Gutiérrez-Romero L, Gasca-Argueta G, Robles-Bermeo NL, Lara-Carrillo E, Medina-Solís
(5) Profesor-Investigador. Área Académica de CE. Manejo odontopediátrico de órgano dentario triple: reporte de un caso. En: Medina-
Odontología del Instituto de Ciencias de la Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en
Salud de la Universidad Autónoma del
Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 1-7. ISBN: 978-
Estado de Hidalgo. Pachuca, México.
607-8444-10-6

Correspondencia a:
M. Ed. Norma Leticia Robles Bermeo.
Email: leticia.roblesbermeo@gmail.com

INTRODUCCIÓN Fusión y geminación implican una confluencia de dentina,


La Odontogénesis es un proceso complejo donde más de concrescencia la unión por cemento. La fusión dental se
200 genes juegan un papel significativo en el desarrollo define como la unión entre dentina y/o esmalte de dos o
del diente. Un desequilibrio durante esta fase conducirá a más dientes en desarrollo, causando la formación de uno
anormalidades de número, tamaño, forma o estructura. sólo con una corona clínica ampliada, puede ser parcial
La presencia de una lámina dental adicional formará un o total, dependiendo de la etapa de desarrollo en el
diente supernumerario. Los trastornos del desarrollo que momento de la unión.2,3
afectan a la forma de los dientes incluyen geminación, Los dientes triples son resultado de estos trastornos,
fusión y concrescencia.1 causando problemas estéticos y funcionales en la

1
dentición primaria, retraso o alteración del desarrollo y isocóricas, puente nasal alto, base de la nariz amplia,
erupción de los permanentes. La anomalía dental más implantación baja de la oreja, labios hidratados, en carpa,
común reportada en dientes primarios son “dientes competentes, sin lesiones en piel, tercio facial superior
dobles“, con prevalencia de 0.1% a 1.55%; sin embargo, ligeramente aumentado con respecto al medio e inferior
la aparición de unión de tres dientes “diente triple” es (Figura 1a y 1b).
raro. Ravn4 informó una prevalencia de 0.02% en
dentición primaria,4 los “dientes triples” sugieren una
anormalidad idiopática en la distribución del material
dental que se originó muy temprano en el desarrollo.3,4
Más frecuente en los varones (2:1), con una
preponderancia en el lado izquierdo sobre el derecho
(4:3).2
Los problemas relacionados con dientes triples incluyen:
estética, caries, enfermedad periodontal, maloclusión,
Figura 1. Fotografías extraorales. Fig. 1a Fotografía de frente. Fig. 1b
retraso en la exfoliación, impactación del órgano sucesor, Fotografía de perfil.

problemas de desarrollo y funcionales,5 razones que


El examen intraoral revela dentición temporal incompleta
motivan a reportar el manejo odontopediátrico del “diente
(falta de erupción del segundo molar superior derecho),
triple” en paciente femenino de 3 años, que afecta a dos
trifusión dental entre dos dientes de la serie normal
órganos dentarios de la fórmula (incisivo central y lateral
(incisivo central y lateral superior derechos) y un
superior derecho) y supernumerario.
supernumerario entre ellos, con lesiones cariosas
profundas en los dos surcos de unión que dividen a cada
PRESENTACIÓN DEL CASO
órgano dentario, extendiéndose en toda la estructura de
Paciente femenino de 3 años 1 mes de edad, originario
vestibular a palatino; presenta mordida cruzada anterior,
del Estado de México, ingresa a la clínica de Posgrado
que involucra en la arcada superior al diente trifusionado,
de la Especialidad en Odontopediatría de la Universidad
órgano dentario (OD) 53 y 61 cayendo detrás de los OD
Autónoma del Estado de México, por antecedente de
71, 72, 81, 82 y 83 (Figura 2a), higiene oral deficiente y
dolor agudo, espontáneo y difuso en la zona anterior
lesiones cariosas cavitadas en OD 64, 74 y 75, arcos de
superior derecha. La madre refiere “tiene el diente
Baum tipo I superior e inferior (Figura 2b y 2c), relación
picado”. En la anamnesis no se hallaron desórdenes
canina del lado derecho clase I e izquierdo clase III.
sistémicos o anomalías en su historia personal, ni
Mordida cruzada posterior del lado derecho con relación
antecedentes familiares de anomalías dentarias.
molar no identificable debido a la falta de erupción del
Examen clínico
segundo molar superior y escalón mesial del lado
A la exploración extraoral es mesofacial, simétrico y
izquierdo (Figura 2d y 2e). Overjet negativo de -2 mm
prognático. Perfil facial recto, implantación alta del
(Figura 2f).
cabello, cejas semipobladas, arqueadas, pupilas

2
Figura 2. Fotografías intraorales. Fig. 2a. Máxima intercuspidación. Figura 4. Plan de tratamiento. Fig. 4a. Conductometría para el
Fig. 2b. Oclusal superior. Fig. 2c. Oclusal inferior. Fig. 2d. Lateral tratamiento de pulpectomía. Fig. 4b. Obturación de pulpectomía con
derecha. Fig. 2e. Lateral izquierda. Fig. 2f. Resalte. Vitapex.

Estudio radiográfico: El plan de tratamiento buco-dento-maxilar consistió en


modificar el medio bucal, para reducir el riesgo a caries
con controles de placa dentobacteriana, técnica de
cepillado, profilaxis, aplicaciones de fluoruro y análisis de
dieta. Se realizan resinas preventivas en los OD 64, 74 y
75, sellador de fosas y fisuras (SFF) en 54, 65, 84 y 85
(citas desensibilizadoras de la conducta), en el diente
trifusionado se realizan pulpectomías, obturando con
pasta premezclada de hidróxido de calcio con yodoformo
(Vitapex, Neo-Dental/Japón) (Figura 4a y 4b), al término
Figura 3. Radiografía oclusal superior
del tratamiento pulpar se reconstruye con Ionómero de
vidrio de reconstrucción (Vitremer, 3M, EUA). Se coloca
Se observa trifusión de dos órganos de la fórmula y
arco palatino modificado con aditamento en “S”, en el
supernumerario, con cámaras y canales radiculares
arco superior, adaptando bandas prefabricadas (de
independientes, diagnosticando trifusión incompleta
premolares) en primeros molares (54 y 64) para
(Figura 3).
descruzar mordida (Fig. 5a). En el arco inferior se coloca
Plan de tratamiento

3
plano inclinado para el mismo propósito (Figura 5b). Tras 2. Lavar bajo el chorro de agua hasta remover por
concluir la colocación de SFF, la obturación de las completo el ácido fluorhídrico.
lesiones cavitadas y la colocación de aparatos, se 3. Secar con aire.
rehabilita el diente trifusionado con corona estética de 4. Aplicar con un micro cepillo 1 capa de silano (Silane,
resina (técnica indirecta), preparando el tallado Ultradent, España).
subgingival de la corona, toma de impresión con silicona 5. Adelgazar con aire.
y se elaborar provisional en acrílico, el cual es Acondicionamiento del órgano dentario
cementado con óxido de zinc sin eugenol (Temp Bond 1. Grabar con ácido fosfórico al 37% (Eco-Eatch, Ivoclar
NE, Kerr Hawe, EE.UU), mientras se fabricaba la corona Vivadent, Schaan Liechtenstein), 20 segundos.
definitiva. 2. Lavar con abundante agua hasta remover el ácido por
20 segundos.
3. Secar 5 segundos con aire.
4. Aplicar con un micro cepillo dental 1 capa de adhesivo
(Te-Econom Bond, Ivoclar Vivadent, Schaan
Liechtenstein).
5. Fotocurar por 20 segundos.
6. Preparar resina dual (Eco Link, Ivoclar Vivadent,
Schaan Liechtenstein) y llevarla a la restauración.
7. Ubicar en posición y cementar.
8. Retirar excedentes y fotocurar 20 segundos.
Posteriormente a la cementación de la corona estética,
trascurrido un mes de la colocación de aparatos, la
paciente acude a revisión, donde al retirar plano inclinado
se observa avance del diente trifusionado, con una
relación borde a borde, sin embargo, el OD 61 aún se
Figura 5. Aparatología. Fig. 5a. Arco palatino modificado con “s”. Fig.
5b. Plano inclinado encuentra en mordida cruzada, por lo que se modifica el
arco palatino (Fig. 6b). Tras 2 meses de activación del
Al obtener la restauración definitiva se revisó el sellado, arco palatino y el uso del plano inclinado, los resultados
anatomía, integridad de los tejidos blandos y la estética del tratamiento han sido favorables, sin embargo, se
para la cementación de la corona de resina (Figura 6a), requiere seguimiento para implementar nuevas
secuencia de cementación: estrategias, al tener una dentición temporal completa.
Acondicionamiento de la restauración El consentimiento informado se obtuvo de la madre de la
1. Grabar con ácido fluorhídrico (Porcelain Etch, paciente para la publicación del presente caso al igual
Ultradent, España) al 9.6 % durante dos minutos. que las imágenes que acompañan.

4
En este caso, se observó trifusión entre dos dientes de la
serie normal (incisivo central y lateral superior derechos)
y un supernumerario, con cámaras y canales radiculares
independientes, (la fusión se dio después de la
calcificación), dando lugar a una trifusión incompleta
implicando dentina en la porción coronal, y en la porción
media y apical conductos radiculares independientes,1
clínicamente podían observarse dos surcos que
separaban las coronas de los incisivos y supernumerario.
El tratamiento del diente dependerá de la situación
clínica. La fusión y geminación causan alteración
cosmética, apiñamiento, retención de placa, caries dental
y si el surco prominente que los divide en la superficie
labial y palatina se continúa hasta la superficie radicular,
posiblemente producirá patología periodontal.6,7
Figura 6. Fotografías finales. Fig. 6a. Restauración definitiva (corona El tratamiento de estos dientes, será interdisciplinario.
estética de resina). Fig. 6b. Arco palatino modificado.
Halil Kayalibay6 reportó un caso de fusión de incisivo
DISCUSIÓN central superior izquierdo a un supernumerario en su
Diferenciar la fusión, geminación y concrescencia es cara vestibular, intervenido con extracción quirúrgica,
esencial en la práctica odontológica. La ausencia de un hemisección y reimplantación y ortodoncia, presentando
diente primario en el caso de un diente triple, indica la reabsorción como secuela.6 Para Yadav Suresh5 la
fusión de dientes primarios generalmente con un estética suele ser el factor determinante para decidir
supernumerario, causado por la presión que generan las retener o extraer estos dientes en función de la etapa de
raíces adyacentes durante el desarrollo.1 Si la fusión se dentición en la que se encuentre el niño. En nuestro
inicia antes de la etapa de calcificación, la unión implicará paciente debido a su corta edad, y tener dentición
a todos los componentes del diente, incluyendo esmalte, temporal incompleta, pero sobre todo por los problemas
dentina, cemento y pulpa. Si se inicia en una fase estéticos y maloclusión que este diente trifusionado le
posterior, los dientes pueden tener coronas separadas y ocasionaba, decidimos mantenerlo, rehabilitándolo con
la fusión puede limitarse sólo a las raíces. El canal pulpar terapias pulpares (pulpectomías), reconstruir con
puede ser condensado o separado.5 La geminación se ionómero de vidrio, mejorar la maloclusión y estética del
observa como una corona bífida, con una cámara pulpar paciente con la corona de resina, logrando excelentes
y un canal radicular implicando una confluencia de resultados cosméticos.
dentina, mientras que la concrescencia implica la unión Entre los problemas clínicos asociados con las anomalías
solo por cemento.1 dentarias, está la maloclusión, en este caso estaban
asociadas anomalías de tamaño, forma y maloclusión ya

5
que la paciente presentaba mordida cruzada anterior Hasta este punto del tratamiento se han logrado avances
involucrando al diente trifusionado, 53 y 61 cayendo por favorables; dando cita de revisión 1 mes después;
detrás de los OD 71, 72, 81, 82 y 83 y mordida cruzada indicación que no pudo cumplirse, interrumpiendo el
posterior unilateral del lado derecho con relación molar tratamiento por 6 meses debido a que la paciente requirió
no identificable (falta de erupción del segundo molar de hospitalización debido a una infección en vías
superior). El tratamiento temprano puede restablecer el urinarias. Tras recuperación acudió a la clínica de
equilibrio muscular adecuado y un desarrollo oclusal. Odontopediatría, donde se evaluó su estado actual. Si
Prakash, Prashanth, Durgesh BH7 declaran que ambas bien el tratamiento fue suspendido, las condiciones no se
mordidas cruzadas requieren corrección temprana por agravaron gracias a la intervención temprana. Al realizar
razones funcionales, la anterior por razones estéticas. la exploración y encontrar una dentición temporal
Según Profitt8 la corrección de la mordida cruzada dental completa se explicó a la madre la necesidad de reiniciar
anterior requiere la apertura de espacio, y después el el tratamiento, para lo que se le solicitó estudio
desplazamiento del diente o dientes a través de la ortodóncico completo.
oclusión en la posición correcta. Ngan8 sugiere que el
plano inclinado es el método tradicional utilizado para la CONCLUSIÓN
corrección de uno o múltiples dientes anteriores en La trifusión es una anomalía poco común, pero su
mordida cruzada, produciendo el movimiento a partir de diagnóstico clínico y radiográfico es indispensable para
la fuerza resultante de músculo de cierre y la interacción facilitar su tratamiento, el cual debe ser multidisciplinario
plano inclinado. El tratamiento temprano se dirige hacia para satisfacer las necesidades estéticas y funcionales
la prevención de crecimiento displásico esquelético como del paciente. Idealmente esta anomalía debe ser
de los componentes dentoalveolares.8 En el caso de la diagnosticada tempranamente para realizar tratamientos
paciente a pesar de tener una dentición temporal preventivos evitando caries y complicación pulpar. De la
incompleta para la corrección de la mordida cruzada y misma forma la intervención ortopédica temprana en el
con el fin de prevenir complicaciones más severas paciente pediátrico, ayudará a evitar el agravamiento del
asociadas a este padecimiento se decidió colocar en la padecimiento, considerando la modificación del
arcada superior un arco palatino con aditamento en “s”, tratamiento una vez completada la dentición temporal.
apoyado únicamente sobre el diente trifusionado
complementando en el arco inferior con un plano REFERENCIAS

inclinado removible. 1. Sharma U, Gulati A, Grill NC. Concrescent triplets involving

Una vez lograda una relación borde a borde, previas citas primary anterior teeth. Contemp Clin Dent 2013;4:94-6.
2. Ozden B, Gunduz K, Ozer S, Oz A, Otan-Ozden F.
de desensibilización de la conducta, rehabilitando los
Multidisciplinary management of a fused maxillary central
órganos dentarios con caries, la modificación del medio
incisor with a talon cusp. Aust Dent J 2012;57:98-102.
bucal y análisis de dieta, se realizó el tallado, preparación
3. Schuurs AHB, Van-Loveren C. Double teeth: review of the
y cementación de la corona estética, mejorando la
literature. J Dent Child 2000;67:313-25.
estética, la maloclusión y salud dental de la paciente. 4. Shilpa G, Nuvvula S. Triple tooth in primary dentition: a

6
proposed classification. Contemp Clin Dent 2013;4:263-7. correction in early mixed dentition period using catlan´s
5. Yadav S, Tyagi S, Kumar P, Sharma D. Triplication of appliance: a case report. ISRN Dentistry, 2011 [citado 2 Mar
deciduous teeth: a rare dental anomaly. Niger J Surg 2015]. Disponible en: doi:10.5402/2011/298931
2013;19:85-7. 8. Yaseen S.M, Acharya R. Hexa Helix: Hexa helix: modified
6. Radi L. Gómez GL, Cortés CN. Dientes dobles: fusión y quad helix appliance to correct anterior and posterior crossbites
geminación. Reporte de dos casos. Rev Fac Odont Univ Ant in mixed dentition. Case Rep Dent 2012 [citado 2 Mar 2015].
2004;15:45-52. Disponible en: doi:10.1155/2012/860385
7. Prakash, Prashanth, Durgesh BH. Anterior crossbite

7
Capítulo 2
TRATAMIENTO DE LA CARIES DE LA
INFANCIA TEMPRANA SEVERA: REPORTE DE
UN CASO.
César Tadeo Hernández-Martínez,1 Resumen
Carlo Eduardo Medina-Solís,2 Introducción: La Academia Americana de Odontología Pediátrica define a la caries de la
Luis Javier Guadarrama-Quiroz,3 infancia temprana (CIT), como la presencia, en dientes primarios, de 1 o más superficies
Norma Leticia Robles-Bermeo,4 cariadas (cavitadas o no), perdidas (por caries) u obturadas en niños menores de 71 meses
de edad (5 años y 11 meses), por lo que en menores de 3 años, cualquier signo de caries
Sandra Isabel Jiménez-Gayosso.5
en superficies lisas, es indicativo de presencia de caries de la infancia temprana severa. De
los 3 a los 5 años, 1 o más superficies lisas cariadas, perdidas (debido a caries) u obturadas
(1) Estudiante de la Especialidad de
Odontopediatría. Facultad de Odontología de en los dientes anteriores maxilares primarios, o un ceo-s>4 (a los tres años), >5 (a los 4
la Universidad Autónoma del Estado de años), o >6 (a los 5 años) constituye CIT severa. Presentación del caso: Paciente
México. Toluca, México. femenino de 1 año 11 meses de edad originaria de Almoloya de Juárez, Estado de México,
(2) Profesor-Investigador. Área Académica de aparentemente sana, acude a la clínica de la especialidad de Odontopediatría de la
Odontología del Instituto de Ciencias de la Universidad Autónoma del Estado de México, su motivo de consulta fue: [sic] porque
Salud de la Universidad Autónoma del necesita coronitas. La madre no refiere datos patológicos relevantes para el problema
Estado de Hidalgo. Pachuca, México. actual. Por las múltiples lesiones cariosas en superficies lisas se diagnostica caries de la
(3) Profesor-Investigador. Especialidad de infancia temprana severa, se rehabilita mediante terapia pulpar, operatoria dental; se
Odontopediatría de la Universidad Autónoma
enfatiza en el tratamiento preventivo y posteriores citas de control. Conclusiones: La caries
del Estado de México. Toluca, México.
(4) Profesor-Investigador. Coordinadora del de la infancia temprana severa es una patología que tiene alta prevalencia en la población
Posgrado en Odontopediatría. Facultad de infantil, es importante su atención precoz para evitar que esta se extienda y cause un
Odontología de la Universidad Autónoma del desequilibrio mayor en los tejidos bucales. Significancia clínica: El tratamiento precoz de
Estado de México. Toluca, México. la caries de la infancia temprana previene el aumento en su severidad así como daños a la
(5) Estudiante de la Especialidad de dentición permanente en formación.
Ortodoncia. Facultad de Odontología de la
Universidad Autónoma del Estado de México. Cómo citar:
Toluca, México. Hernández-Martínez CT, Medina-Solís CE, Guadarrama-Quiroz LJ, Robles-Bermeo NL,
Jiménez-Gayosso SI. Tratamiento de la caries de la infancia temprana severa: reporte de un
Correspondencia a: caso. En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Campeche:
Dr. César Tadeo Hernández-Martínez Universidad Autónoma de Campeche; 2015. p. 8-12. ISBN: 978-607-8444-10-6
Email: cetahm@gmail.com

INTRODUCCIÓN indicativo de presencia de caries de la infancia temprana


La caries dental es un problema de salud pública en severa. De los 3 a los 5 años, 1 o más superficies lisas
México y el mundo. La Academia Americana de cariadas, perdidas (debido a caries) u obturadas en los
Odontología Pediátrica define a la caries de la infancia dientes anteriores maxilares primarios, o un ceo-s>4 (a
temprana (CIT), a la presencia, en dientes temporales, de los tres años), >5 (a los 4 años), o >6 (a los 5 años)
1 o más superficies cariadas (cavitadas o no), perdidas constituye CIT severa.1 Es la enfermedad de mayor
(por caries) u obturadas en niños menores de 71 meses frecuencia en infantes de todo el mundo, en México
de edad (5 años y 11 meses), por lo que en menores de involucra el 59% de este grupo.2,3,4 Su etiología es
3 años, cualquier signo de caries en superficies lisas, es multifactorial, entre los factores de riesgo está la

8
presencia de Streptococcus mutans, ingesta de alimentos y preservar los órganos dentales dañados,
y bebidas con alto contenido en carbohidratos, uso restableciendo su función y estética, sin embargo el
prolongado de biberón y falta de higiene; así como es punto más importante es desarrollar una actitud
estatus socioeconómico y cultural familiar, desnutrición, preventiva en los padres o tutores de los niños para de
enfermedades crónicas, bajas concentraciones de flúor esta manera actuar sobre los factores de riesgo y evitar
en el medio oral, alteraciones hipoplásicas, pacientes con la reincidencia.9,10
discapacidad física o mental y factores genéticos.5
Muchas han sido las formas en las que esta enfermedad PRESENTACIÓN DEL CASO
ha sido denominada, tales como: caries del lactante, Paciente femenino de 1 año 11 meses de edad originaria
caries circunferenciales, caries rampante específica del de Almoloya de Juárez, Edo. De México; la cual acude a
niño o caries de biberón. Sin embargo se ha optado por la Clínica de la Especialidad de Odontopediatría de la
el término caries de la infancia temprana severa ya que Universidad Autónoma del Estado de México con motivo
muchos nombres hacen alusión a su etiología, siendo de consulta: [sic] Me dijeron que necesitaba coronitas. Al
esta multifactorial y no siempre se presentan todos los interrogatorio la madre refiere que su hija fue número de
factores.6 gesta 2:2, cursó 9 meses de gestación, normoevolutivo a
La caries de la infancia temprana severa, es un término término y parto eutócico. La madre refiere que la paciente
que describe un proceso rápidamente destructivo el cual se alimentó 9 meses a seno materno, inició la ablactación
afecta a la dentición temporal en niños menores de 3 a los 6 meses, inició alimentación sólida a los 8 meses y
años. Se presenta sobre todo en niños con alimentación que aún continúa con consumo de lácteos y bebidas
por biberón o materna prolongada con falta de higiene endulzadas en biberón. Dentro de los antecedentes
bucal, así como dieta semisólida rica en carbohidratos. personales patológicos la madre sólo refiere tres cuadros
Sin embargo debemos recordar que es una afección faringoamigdalinos por año. Dentro del cuestionario por
multifactorial, lo cual hace aun más difícil el determinar su aparatos y sistemas la madre no refiere datos de interés
etiología precisa para evitar recidivas.5,6 para el padecimiento actual. Dentro del análisis de
Los pacientes afectados por caries de la infancia dienta, la madre refiere una alimentación rica en
temprana severa tienen riesgo de presentar procesos carbohidratos, bajo consumo de frutas y verduras y alto
infecciosos, con dolor dental agudo o crónico que llevan consumo de leche endulzada mediante biberón antes de
la incapacidad para alimentarse por lo que el niño se ve dormir sin realizar higiene posterior a esto.
afectado en su desarrollo, así mismo la pérdida de La madre nos refiere que la niña ha recibido atención
algunos órganos dentales da como resultado la dental previa, mostrándose poco cooperadora (Frankl I),
disminución de la función masticatoria, dificultando la le realizaron resinas en múltiples ocasiones en órganos
fonación y afectando la estética.7,8 dentales (OD) 52 y 62, pero que fracasaron tiempo
Es importante conocer el manejo clínico de estos después de ser colocadas (Figura 1).
pacientes, ya que al actuar en las primeras fases de la
enfermedad se puede restaurar, limitar el daño, proteger

9
En la primer sesión se enseñó la técnica de cepillado a la
madre para que la llevara a cabo en su hija, se realizó
profilaxis y aplicación tópica de fluoruro en barniz
(Duraphat de Colgate) se dieron indicaciones sobre
alimentación y medidas preventivas.
En las posteriores sesiones se realizaron selladores de
fosetas y fisuras en OD 54, 64 y 74; se realizo resina en
OD 84. Se optó por restaurar en la última sesión los OD
Figura 1. Fotografía de máxima intercuspidación, se observan
lesiones cariosas en superficies lisas así como destrucción parcial de anterosuperiores por ser una zona muy sensible y así
las coronas de los OD 52 y 62.
evitar generar una conducta indeseable.

Al examen clínico y radiográfico se observaron tejidos En la penúltima sesión se realizaron pulpotomías en OD


blandos aparentemente sanos, pulpitis incipiente en OD 51, 62 y pulpectomía en el OD 52; posteriormente a la
61 y 84, pulpitis parcial en OD 51, 62 y necrobiosis en semana se colocaron las coronas de níquel/cromo en OD
OD 52, OD 53 y 63 parcialmente erupcionados, los OD 52, 51, 61 y 62 (Figura 4, 5 y 6).
55, 65, 75 y 85 aún no erupcionaban, OD 54, 64, 74, 73,
72, 71, 81, 82 y 83 aparentemente sano (Figura 2 y 3).

Figura 4. Fotografía oclusal superior con las restauraciones


colocadas.

Figura 2. Fotografía oclusal superior donde se observan las lesiones


cariosas en los incisivos centrales y laterales.

Figura 5. Fotografía oclusal inferior con restauraciones colocadas.

En citas subsecuentes se realizaron aplicaciones de


Figura 3. Fotografía oclusal inferior, no se observan lesiones cariosas
severas. fluoruro en barniz (Duraphat de Colgate), controles de

10
placa dentobacteriana con disminución del índice de l. Se AGRADECIMIENTOS
dieron indicaciones para tener citas de seguimiento cada Agradecemos el apoyo de la EOP. Guadalupe Pedraza
mes y posteriormente cada 4 meses. Contreras durante el tratamiento ya que sin su apoyo
hubiera sido aún más complicado el manejo y tratamiento
de la paciente, gracias por su comprensión, apoyo y
concejos al momento de realizar la rehabilitación.
Agradecemos a la EOP. Patricia Valero Conzuelo por su
apoyo durante el desarrollo de la rehabilitación, sus
conocimientos favorecieron en buen término del
proyecto.
En especial agradecemos a la madre de la paciente, ya
Figura 6. Fotografía de máxima intercuspidación rehabilitada
que a pesar de múltiples dificultades siempre asistió
Se obtuvo el consentimiento informado de la madre para puntualmente a sus citas, mostrando gran interés por
la publicación del presente caso al igual que las mejorar la salud bucal de su hija.
imágenes que acompañan.
REFERENCIAS

CONCLUSIONES 1. American Academy of Pediatric Dentistry: Policy on early


childhood caries (ECC): Unique challenges and treatment
La caries de la infancia temprana es una enfermedad
options. Pediatr Dent 2004;25:27-28.
muy virulenta la cual representa un problema de salud
2. Montero-Canseco D, López-Morales P, Castrejón-Pérez RC.
pública, el manejo de esta entidad es un reto ya que son
Prevalencia de caries de la infancia temprana y nivel
múltiples los factores que intervienen en su desarrollo.
socioeconómico familiar. Revista Odontológica Mexicana
En el caso presentado, se contó con la ventaja del interés 2011;15:96-102.
de la madre, sin embargo los factores de riesgo que 3. Alonso-Noriega MJ, Karakowsky L. Caries de la infancia
presenta la paciente son muy importantes, por lo tanto es temprana. Perinatol Reprod Hum 2009;23:90-97.
necesario realizar controles periódicos para prevenir 4. Zaror-Sánchez C, Pineda-Toledo P, Orellana-Cáceres JJ.

recurrencias. Prevalencia de caries temprana de la infancia y sus factores

Es importante realizar los tratamientos correspondientes asociados en niños chilenos de 2 a 4 años. Int J Odontostomat
2011;5:171-177.
en el momento adecuado, en el caso reportado, la
5. Galeana-Villa R, Robles-Bermeo NL. Caries temprana de la
paciente ya había sido atendida por otro odontólogo sin
infancia severa: Reporte de un caso y su manejo clínico.
recibir la atención adecuada, esto pudo modificar su
Odontopediatría Actual 2011;1:16-19.
comportamiento ya que en la mayoría de las sesiones se 6. Amarilla M, Quintero-de Lucas G. Caries severa de aparición
mostro poco cooperadora (Frankl 1); por la corta edad de temprana: una nueva denominación para un antiguo problema.
la paciente el manejo de conducta es complejo, sin RAAO 2006;46:32-25.
embargo, se concluyó favorablemente su tratamiento.

11
7. Arango MC, Baena GP. Caries de la infancia temprana y 9. Guerrero-Castellón MP, Galeana-Ramírez MG, Corona-
factores de riesgo. Revisión de la literatura. Rev Estomat Zavala AA. Caries de la infancia temprana: medidas
2004;12:59-65. preventivas y rehabilitación. Rev Odontol Latinoam 2011;4:25-
8. Echeverría-López S, Henríquez-D’Aquino E, Sepúlveda- 28.
Ramírez R, Barra-Pérez M. Caries temprana de la infancia 10. Aguilar-Ayala FJ, Duarte-Escobedo CG, Rejón-Peraza ME,
severa: Impacto en la calidad de vida relacionada a la salud Serrano-Piña R, Pinzón-Te AL. Prevalencia de caries de la
oral de niños preescolares. Revista Dental de Chile infancia temprana y factores de riesgo asociados. Acta Pediatr
2010;101:15-21. Mex 2014;35:259-266.

12
Capítulo 3
REHABILITACIÓN BUCAL DE PACIENTE CON
TRASTORNO DE ESPECTRO AUTISTA:
REPORTE DE UN CASO.
Elena Saraí Baena-Santillán,1,2 Resumen
Carlo Eduardo Medina-Solís,3 Introducción: El autismo no es una entidad simple, sino más bien un trastorno complejo del
Jesús Ortiz-Ruiz,3 desarrollo de origen neurobiológico, con etiologías múltiples que todavía hoy no son bien
Carlos Eduardo Varela-Ibañez,4 conocidas y con manifestación clínica neuro-conductual. No es una enfermedad sino un
síndrome clínico, presente desde los primeros meses de vida y que incluye alteraciones en
(1) Profesora. Área Académica de conducta, comunicación verbal y no verbal e interacción social y emocional anómala. El niño
Odontología del Instituto de Ciencias de la autista muestra un retardo importante en la adquisición del lenguaje, usa las palabras
Salud de la Universidad Autónoma del inadecuadamente y sin un adecuado propósito comunicativo. El autismo no representa un
Estado de Hidalgo. Pachuca, México. solo proceso patológico, sino un cortejo sintomático que puede deberse a diferentes
(2) Odontopediatra. Hospital del Niño DIF. enfermedades. Presentación del caso: Se muestra un caso clínico de un paciente masculino
Pachuca, México. de 7 años con diagnóstico de autismo, el cual presenta múltiples lesiones cariosas y no es
(3) Profesor-Investigador. Área Académica posible rehabilitarse en el sillón dental, por lo que es manejado bajo anestesia general. Se
de Odontología del Instituto de Ciencias de hace énfasis en el manejo conductual con la desensibilización sistemática y control de dieta e
la Salud de la Universidad Autónoma del
higiene. Conclusiones: Para lograr un adecuado manejo y plan de tratamiento del paciente
Estado de Hidalgo. Pachuca, México.
(4) Jefe del Área de la Subdivisión de autista es importante conocer las características propias de este síndrome. Debido a la falta
Salud Bucal del Hospital del Niño DIF. de comunicación, la hiperactividad, un desarrollo desigual intelectual y los movimientos
Pachuca, México. repetitivos que presentan, hace que se dificulte el tratamiento, es por esto que debemos
lograr una adecuada comunicación e interacción para poder brindarles una atención integral y
tengan salud bucodental. Significancia clínica: La mayoría de las veces este tipo de
Correspondencia a: pacientes no son atendidos por los odontólogos de manera correcta debido a la nula
Dra. Elena Saraí Baena-Santillán cooperación y al desconocimiento del manejo del síndrome.
Email: baenasantillan@hotmail.com
Cómo citar:
Baena-Santillán ES, Medina-Solís CE, Ortiz-Ruiz J, Varela-Ibáñez CE. Rehabilitación bucal
de paciente con trastorno de espectro autista: reporte de un caso. En: Medina-Solís CE,
Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en Odontología.
Campeche: Universidad Autónoma de Campeche; 2015. p. 13-19. ISBN: 978-607-8444-10-6

INTRODUCCIÓN un escape de la realidad asociada con la fantasía,


El autismo, según el manual diagnóstico y estadístico de asociado a la esquizofrenia. Leo Kanner, tomó el término
los trastornos mentales, pertenece a los trastornos Autismo, mencionando que era un trastorno del
generalizados del desarrollo (TGD).1,2 Este síndrome es desarrollo de la infancia donde el individuo tenía
definido como un trastorno neuro-conductual y cognitivo, "incapacidad para relacionarse en forma ordinaria a otras
caracterizado por el retraso del desarrollo de habilidades personas" y por "insistencia en la igualdad", acuñando
interpersonales, de comunicación, intereses limitados y así un grupo de trastornos característicos de la
comportamientos repetitivos.3 El término fue acuñado por infancia.2,4 En los años 60, la prevalencia de autismo,
Eugen Bleuler para describir un trastorno donde existía según la descripción clínica de Kanner, era de 4 a 5 por

13
10.000 niños. En los trabajos epidemiológicos de los potencial genético y el entorno biológico a nivel pre y
años 80 esta cifra ascendió a 7 en 10.000 con una perinatal.6
proporción de 4 varones por 1 niña. Algunos autores Leo Kanner en 1943 describió las características
destacan que en la actualidad existe un importante comunes más importantes del trastorno en 3 áreas
aumento de este trastorno: 10/10.000 niños (referido aquí diferentes del funcionamiento psíquico, existiendo una
más ampliamente a los trastorno del espectro autista), apreciable perturbación en la reciprocidad de la
con una prevalencia de hasta 30/10.000 niños con TDG. interacción social, con tendencia al aislamiento,
Recientes publicaciones mencionan un aumento de la retraimiento o soledad, asimismo una alteración en las
prevalencia de hasta 17 autistas por 10.000 niños y de capacidades comunicativas, con profunda inhibición o
63/10.000 para los TDG. Otros autores desestiman estas ausencia de lenguaje, tanto expresivo como comprensivo
cifras advirtiendo que existe un sobrediagnóstico debido y un repertorio conductual patológico y disruptivo,
a criterios y métodos de diagnóstico poco fiables. En todo consistente en estereotipias motoras y afán por
caso, el acuerdo general es que sí existe cierto aumento conservar inmutable o inalterado el entorno.7 Según Soto
de la prevalencia de este trastorno a alrededor del Mundo en 1994, menciona que existen otros rasgos como la
5 de cada 10.000 niños presentan un cuadro de autismo. incapacidad intelectual, ecolalia retardada, actividad de
Algunos estudios recientes establecen que se ha juego repetitiva estereotipada, carencia de imaginación,
producido un gran incremento de la tasa de casos buena memoria, presentar un aspecto físico normal y es
identificados. No está claro si esto representa un diagnosticada en la primera infancia.8
incremento real de la incidencia, si es un efecto de las El objetivo de la evaluación diagnóstica de los trastornos
modificaciones en los criterios diagnósticos, el que los del espectro autista es, además de realizar un
profesionales tengan una mayor conciencia del autismo o diagnóstico acertado de forma temprana (mediante la
el que se efectúen diagnósticos poco estrictos.5-8 clínica y la utilización de instrumentos diagnósticos), el
La evidencia científica coincide en establecer que los realizar un despistaje orgánico, detectar enfermedades
síntomas de los trastornos del espectro del autismo son orgánicas o psiquiátricas asociadas, evaluar las
el resultado de alteraciones generalizadas del desarrollo necesidades de la familia y realizar las recomendaciones
de diversas funciones del sistema nervioso central. Está terapéuticas individualizadas. El fenotipo clínico
claro que no se trata de una causa biológica única, sino reconocido para los trastornos del espectro autista (TEA)
que hay que considerar una etiología multifactorial. En la en la actualidad incluye, además, del “fenotipo
mayoría de los casos hay que considerar el papel de tradicional”, a otros niños que poseen un déficit menos
factores hereditarios, con una contribución genética severo que el autismo típico pero que mantiene las
compleja y pluridimensional, que daría lugar a una gran mismas alteraciones cualitativas propias del autismo en
variabilidad en la expresión de las conductas. Sin lo social, la comunicación y la conducta.9
embargo, los genes por sí solos no pueden explicar todas Actualmente los instrumentos diagnósticos disponibles
las variaciones que se dan en las desviaciones muy son difíciles de aplicar a los niños más pequeños. Esto
precoces. Hay que tener en cuenta la interacción entre el podría tener su explicación en las diferencias

14
sintomáticas entre los casos y también a que las entrenamiento en habilidades sociales con el último fin de
carencias sociales, lingüísticas y ciertos retrasos no se alcanzar la independencia en actividades de la vida diaria
ponen de manifiesto hasta que el niño no tiene la y de autocuidados, como es el mantenimiento de la salud
oportunidad de interaccionar con sus compañeros en la oral. Namal et al., en un estudio reciente revela que el
guardería. Los síntomas primarios del autismo cambian nivel del tratamiento dental era menor en los niños con
con la edad y los niños menores de tres años raramente autismo. Esto debido a que los niños autistas son más
presentan las conductas perseverativas, preocupaciones difíciles de tratar a nivel odontológico.13
o resistencia a cambiar; pueden no tener la habilidad Es fundamental recordar que con el niño autista no hay
cognitiva necesaria para jugar de forma repetitiva. En lugar para la improvisación. De esto se deriva la
niños muy pequeños ciertos retrasos y alteraciones del necesidad de recurrir a un protocolo de desensibilización
patrón de la interacción social pueden ser confundidos sistemática que comenzará previamente a que el niño
con timidez, temperamento inhibido o con rasgos acuda a la consulta.14
evolutivos relacionados con características familiares.10
Los niños con retraso mental severo y profundo pueden PRESENTACIÓN DEL CASO
exhibir varias características que se asocian con el Paciente masculino de 7 años de edad, quién acude a la
autismo, como las dificultades para interaccionar y las clínica de la especialidad de Odontopediatría del Área
conductas estereotipadas.11 Académica de Odontología de la Universidad Autónoma
La literatura no reporta un rasgo único en la dentición y del Estado de Hidalgo con sede en el Hospital del Niño
las estructuras periodontales de los niños autistas. Sin DIF, Hidalgo. El motivo de la consulta es que "el paciente
embargo, debido a las complicaciones sistémicas que tiene caries”.
estos pacientes presentan, el sistema estomatognático Se realiza historia clínica completa. Como dato
muchas veces se ve afectado. En ocasiones el clínico heredofamiliar relevante tiene una hermana de 9 años de
desconoce la repercusión de los problemas médicos edad diagnosticada con Síndrome de Asperger. Como
sobre la cavidad bucal.12 antecedentes perinatales es producto de la segunda
La Academia Americana de Odontología Pediátrica gesta de la madre, la cual tenía 27 años de edad,
reconoce que, hoy en día, el manejo del comportamiento presenta amenaza de aborto en el primer trimestre,
en personas con necesidades especiales está asimismo, refiere que durante su embarazo no sintió los
cambiando. Estos pacientes pueden presentar un mayor movimientos de su hijo, por lo que acudía de manera
riesgo de patología oral debido a su capacidad recurrente a controles prenatales. Nació por cesárea con
disminuida de entender o participar en su higiene diaria y un peso de 3 kilos y 300 gramos y una talla de 47
cooperar con los programas preventivos. Una atención centímetros, no recuerda calificación APGAR. No fue
integral del paciente con autismo incluye el consejo a los necesario incubarlo por lo que fue entregado a su madre
padres, la educación especial (a veces con un mayor el mismo día. La madre nota que el bebé no toma el seno
énfasis en la modificación de conducta) en un entorno materno, no la observa, no reacciona ante ruidos fuertes
altamente estructurado, terapia del lenguaje y o estímulos externos; caminó a los 3 años de edad, tomó

15
seno materno 2 meses y biberón 1 año. Los de acero inoxidable, múltiples lesiones cariosas en
antecedentes alérgicos y sistémicos fueron negados y caninos y molares deciduos (Figuras 2, 3 y 4).
presenta esquema de vacunación completa. Actualmente
no articula palabras sólo monosílabos. Con antecedente
de experiencias dentales desagradables, donde se
realizó previo tratamiento dental en el "Norte del País",
bajo restricción física.
El paciente al entrar al servicio presenta gritos, se mete
debajo de las sillas, no sigue instrucciones orales, no
coopera en el sillón dental, no permite exploración
intraoral, presenta movimientos bruscos y violentos. A la Figura 2. Fotografía intraoral de la arcada superior inicial.
exploración extraoral se aprecia normocráneo,
dolicofacial, simetría facial, perfil recto (Figura 1).

Figura 3. Fotografía intraoral de la arcada inferior inicial

Figura 1. Fotografías extraorales..

Con ayuda de un abreboca tipo Molt se realiza


exploración intraoral donde se aprecia dentición mixta Figura 4. Fotografía intraoral de frente inicial.

temprana, higiene oral deficiente con acumulación de


Se solicita radiografía panorámica para completar el
biofilm dental, arcada superior forma oval, arcada inferior
diagnóstico, observando senos nasales hipertróficos,
forma cuadrada. Se observan restauraciones de coronas
espina nasal desviada a la derecha, fórmula dental
permanente completa, con ausencia por edad de

16
gérmenes de terceros molares (Figura 5a). Se toman realiza la rehabilitación oral completa con tratamientos a
radiografías de aleta de mordida donde se aprecian base de pulpotomías y coronas (Figuras 7, 8 y 9). Al
lesiones cariosas con compromiso pulpar en órganos finalizar el tratamiento dental se traslada al área de
dentales 85 y 75 (Figuras 5b y 5c) recuperación del Hospital del Niño DIF, brindando
indicaciones de cuidado a los padres.
a

Figura 6. Fotografía de la intubación nasotraqueal.


b c
Figura 5. a) Radiografía panorámica previo al tratamiento, b) y c)
radiografías de aleta de mordida.

Se inicia el tratamiento con sesiones cortas enseñando


técnica de cepillado de Fones, se brindan consejos
higiénico-dietéticos utilizando la técnica de modificación
de conducta “Decir-Mostrar-Hacer” y desensibilización
sistemática obteniendo adecuados resultados, logrando
que el paciente se suba al sillón dental, abra la boca y se
Figura 7. Fotografía intraoral de la arcada superior final.
realice profilaxis dental, sin embargo, por la falta de
cooperación del paciente así como por la severidad de
las lesiones y el número de piezas dentales con lesiones
cariosas, se decide realizar tratamiento bajo anestesia
general.
Se solicitan estudios preoperatorios, donde el paciente se
encuentra en valores normales, se realiza tratamiento
bajo anestesia general, utilizando atropina, fentanil,
rocuronio y propofol. Se realiza laringoscopía con tubo
endotraqueal del número 5.5 e intubación nasotraqueal Figura 8. Fotografía intraoral de la arcada inferior final.

(Figura 6); se mantiene monitoreado valorando en todo


momento signos vitales y saturación de oxígeno. Se

17
En la mayoría de los casos los rasgos autistas persisten
toda la vida, pero el pronóstico del trastorno varía desde
mínimo o nulo lenguaje y pobres capacidades para la
vida diaria, hasta el logro de grados universitarios y
funcionamiento totalmente independiente.6
La importancia de la detección temprana y los cambios
recientes en las cifras de prevalencia hacen que sea
esencial la realización de un diagnóstico temprano y
Figura 9. Fotografía Intraoral de Frente Final.
acertado.11
Se continúa el tratamiento con desensibilización Es indispensable que el profesional se informe sobre el

sistemática, logrando cooperación del paciente en síndrome, sus características, sus antecedentes etc.,
sesiones cortas, se mantiene control sobre la higiene y la para así poder tratar a cada individuo como único, ya que
dieta con citas cada 4 meses. Se solicita cada paciente es diferente uno de otro y deberemos
ortopantomografía control a los 6 meses posteriores a la adecuarnos a cada uno en particular, utilizando todos los
rehabilitación sin datos patológicos relevantes (Figura recursos de los que podamos valernos para lograr

10). resultados positivos.


El manejo Psicológico debe realizarse desde la primera
sesión y no dejar de hacerse hasta la última, debemos
tener en consideración los datos consignados en la
historia clínica, mantener contacto permanente con los
profesionales que tratan al paciente.
El paciente autista debe familiarizarse con el profesional
estomatológico, el consultorio, los colores, olores y ruidos

Figura 10. Radiografía panorámica control 6 meses después. .


propios del ambiente odontológico, debemos tener en
cuenta que este tipo de pacientes son muy susceptibles a
El consentimiento informado se obtuvo de la madre del cambios de cualquier tipo a pesar de que en muchos
paciente para la publicación del presente caso al igual casos pueden parecer abstraídos en su propio mundo.15
que las imágenes que lo acompañan. Debemos lograr la cooperación del paciente y diseñar
técnicas de modificación de conducta antes de valorar el
CONCLUSIONES uso de sedación o anestesia general para evitar riesgos a
El autismo es un síndrome no una enfermedad, en la su salud.
gran mayoría de los casos congénito, que afecta las Es por esto que nuestro abordaje debe ser realizado de
relaciones sociales y afectivas así como la capacidad de afuera hacia adentro, nunca acercarnos directamente a la
comunicación de los individuos.15 cavidad oral e ir avanzando de acuerdo a como el
paciente reaccione ante cada uno de los procedimientos.

18
8. Soto CR. El síndrome autista: un acercamiento a sus

AGRADECIMIENTOS: características y generalidades. Rev Educación 2002;26(1):47-

Al Hospital del Niño DIF, Hidalgo, por facilitar las 61.


9. Hervás A, Sánchez SL Autismo. Espectro autista.
instalaciones para la realización del caso clínico.
Disponible:
http://www.sepeap.org/imagenes/secciones/Image/_USER_/Ps
REFERENCIAS
_inf_autismo_espectro_autista.pdf Consultado:
1. DSM IV – Manual de diagnóstico y estadística de los
26/marzo/2015
trastornos mentales. Trastornos de inicio en la infancia, la niñez
10. Díaz AF, García PC, Martín RA. Diagnóstico precoz de los
o la adolescencia. Disponible en:
Trastornos Generalizados del Desarrollo Disponible:
http://www.inau.gub.uy/biblioteca/train.pdf. Consultado
http://www.paidopsiquiatria.com/rev/numero5/autismo.pdf
25/marzo/2015.
Consultado: 26/marzo/2015
2. Raja M, Azzoni A. Autistic spectrum disorders and
11. Javaloyes SM. Autismo: criterios diagnósticos y diagnóstico
schizophrenia in the adult psychiatric setting: diagnosis and
diferencial. Pediatr Integral 2004;VIII(8):655-62
comorbidity. Psychiatr Danub 2010;22(4):514-21.
12. Morales CM. El paciente autista en la clínica dental.
3. Muthu MS, Prathibha KM. Management of a child with autism
Disponible en http://www.icoev.es/oris/56-1/paciente.pdf
and severe bruxism: a case report. J Indian Soc Pedod Prev
Consultado 26/marzo/2012
Dent 2008;26(2):82-4.
13. Morales CM. Abordaje conductual del paciente autista en la
4. Adrián SJ, Bausá VE. Dificultades Diagnósticas en el
consulta estomatopediátrica. REDOE. 2006. Disponible en:
autismo. Presentación de un caso. Universitat Jaume. 1-8
http://www.redoe.com/indice.php?seccion=articulos
5. Asociación Internacional Autismo-Europa. Descripción del
14. Gómez LB, Badillo PV, Martínez PE, Planells PP.
Autismo. Consejo de Autismo-Europa. 2000. Disponible:
Intervención odontológica actual en niños con autismo. La
http://iier.isciii.es/autismo/pdf/aut_autis.pdf Consultado 26
desensibilización sistemática. Cient Dent 2009;3(6):51-9.
Marzo 2015
15. Horruitiner-Gutiérrez L. Manejo del paciente autista en el
6. Rogel OF. Autismo. Gac Med Mex 2005;2(141):143-7.
consultorio odontológico. Odontol Pediatr 2008;7(2):34-35.
7. Irarrázaval OM, Brokering AW, Murillo BG. Autismo: una
mirada desde la psiquiatría de adultos. Rev Chil Neuro-Psiquiat
2005;43(1):51-60

19
Capítulo 4
RETENCIÓN DENTAL: REPORTE DE CASO EN
GEMELAS MONOCIGÓTICAS.
Silvia Cristina Manzur-Quiroga,1,2 Resumen
Edith Lara-Carrillo,3 Introducción: Es inusual la presencia de anomalías en dentición permanente en gemelos
Erika Alejandra Jardón-Romero,4 monocigóticos; la herencia juega un papel importante en la presencia de características
Brenda Valdez-Vargas,5 similares entre gemelos, pero también determina la presencia de aberraciones en el
desarrollo; por lo que el propósito del presente trabajo fue exponer el caso de gemelas con
Carlo Eduardo Medina-Solís.6
retención de caninos superiores bilaterales y su tratamiento quirúrgico. Presentación del
caso: Se muestra la identificación y tratamiento en gemelas idénticas de 17 años de edad
(1) Profesora. Facultad de Odontología de la
Universidad Autónoma del Estado de México. que ignoraban la presencia de caninos retenidos, una de ellas se presenta a consulta por
Toluca, México. referir dolor en el maxilar desde hace tres meses, el hallazgo fue radiográfico y su
(2) Directora General del Consejo tratamiento quirúrgico para ambas pacientes; con la persistencia de los caninos temporales,
Mexiquense de Ciencia y Tecnología. Toluca, aún cuatro años después de las extracciones. Conclusiones: Es importante en un caso
México. como éste hacer un completo diagnóstico radiográfico y evaluar a su gemelo, en el caso
(3) Profesor-Investigador. Coordinadora de la que así sea; sospechando que la fuerte carga genética conlleva a la aparición de
Maestría en Ciencias Odontológicas. alteraciones idénticas, con la finalidad de dar el tratamiento oportuno a ambos, aunque la
Facultad de Odontología de la Universidad sintomatología solo se haya reportado en uno de ellos. Significancia clínica: Es necesario
Autónoma del Estado de México. Toluca,
México.
enfatizar el papel del odontólogo en el manejo de los casos de retención dental,
(4) Estudiante. Maestría en Ciencias principalmente debido a la pronta detección de anomalías que puedan llevar a un correcto
Odontológicas. Facultad de Odontología de la plan de tratamiento, dependiendo de la edad y condición del paciente, aunado a la carga
Universidad Autónoma del Estado de México. genética en el caso de gemelos monocigóticos.
Toluca, México.
(5) Profesora de la Especialidad en Cómo citar:
Ortodoncia. Facultad de Odontología de la Manzur-Quiroga SC, Lara-Carrillo E, Jardón-Romero EA, Valdez-Vargas B, Medina-Solís
Universidad Autónoma del Estado de México. CE. Retención dental: reporte de caso en gemelas monocigóticas. En: Medina-Solís CE,
Toluca, México. Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en Odontología.
(6) Profesor-Investigador. Área Académica de
Campeche: Universidad Autónoma de Campeche; 2015. p. 20-24. ISBN: 978-607-8444-10-
Odontología del Instituto de Ciencias de la
Salud de la Universidad Autónoma del 6
Estado de Hidalgo. Pachuca, México.

Correspondencia a:
Dra. Edith Lara-Carrillo
Email: laracaedith@hotmail.com

INTRODUCCIÓN molar clase Angle, tamaño dental, patrones de


Biológicamente los gemelos monocigóticos resultan de la apiñamiento, forma y tamaño de arcadas dentarias, pero
única fertilización del óvulo, así son idénticos rotaciones dentales individuales, así como overjet y
genéticamente; es razonable que ambos gemelos overbite.2
puedan expresar la misma rara anomalía, debida a una La ocurrencia de retención dental en gemelos
alteración programada en el fenotipo.1 monocigóticos es inusual, la presencia de estos
Se ha establecido que los gemelos monocigóticos fenómenos soportan la hipótesis de un origen
presentan idéntica oclusión, así como similar relación genético.2,3-6

20
El retraso de la erupción y la retención dentaria son porción derecha del maxilar superior, de manera
problemas que se observan frecuentemente en la espontáneo, nocturno, localizado y punzante.
práctica dental. La presencia de dientes Sistémicamente no reportó alteraciones relevantes al
supernumerarios, la herencia, anomalías endócrinas y interrogatorio, con signos vitales normales, aparatos y
deficiencia de vitamina D se han determinado como sistemas sin datos patológicos.
causantes de la retención dental.7 La gemela B ignoraba la presencia de sus caninos
La falta de erupción de caninos superiores es la segunda retenidos, no presentaba sintomatología y el diagnóstico
más común de las retenciones dentales, después de los fue por hallazgo radiográfico, cuando acompañaba a su
terceros molares.8 hermana a revisión. Ella tampoco mencionó alteraciones
Estos dientes también presentan un desplazamiento y relevantes al interrogatorio; signos vitales, aparatos y
posición inusuales. De 1 – 3% de la población presentan sistemas sin datos patológicos.
caninos con una vía de erupción ectópica palatina, y Diagnóstico dental
muchas veces son descubiertos inesperadamente debajo Clínicamente, en la gemela A se observaba la punta de la
de la delgada mucosa del paladar.1 cúspide del canino permanente del lado derecho
Por lo que el propósito del presente trabajo fue exponer erupcionado parcialmente en el paladar, a nivel del
el caso de gemelas con retención de caninos superiores espacio interdentario entre el incisivo lateral permanente
bilaterales y su tratamiento quirúrgico. y el canino temporal. La coloración de la mucosa en esa
zona era rosa coral sin aumento de volumen palpable ni
PRESENTACIÓN DEL CASO visible en la región, de consistencia firme y humectada.
Se presentan gemelas idénticas del sexo femenino de 17 A diferencia, en la gemela B por la región palatina no
años de edad (figura 1). existía aumento de volumen palpable, ni visible y la
coloración de mucosa también era rosa coral, de
consistencia firme y humectada.
Diagnóstico radiográfico
En la radiografía oclusal superior de la gemela A se
aprecian los caninos permanentes retenidos en el hueso
maxilar, ambos en posición mesioangular. El canino del
lado derecho abarcaba desde el incisivo lateral
permanente hasta el tercio medio de la raíz mesial de
primer molar superior; mientras que en lado izquierdo, la
Figura1. Gemelas A y B
cúspide del canino se encontraba aproximadamente a
La gemela A ingresó a la Clínica de Cirugía Bucal en la nivel del tercio apical de la raíz del incisivo central y su
Facultad de Odontología de la Universidad Autónoma del ápice a nivel del tercio medio de la raíz del segundo
Estado de México con un cuadro clínico de dolor desde premolar (figura2).
hace 3 meses previos a fecha de ingreso, referido en la

21
En este caso el manejo fue quirúrgico, ya que las
pacientes no consintieron otra opción de tratamiento y los
caninos temporales se encontraban en adecuada
posición con buen pronóstico para permanecer mayor
tiempo en cavidad bucal (figura 3).
Figura 2. a) Radiografía preoperatoria oclusal superior de la gemela
A. b) Radiografía preoperatoria oclusal superior de la gemela B. El examen histopatológico de los folículos de los caninos
retenidos no reveló la presencia de quistes o alguna otra
Radiográficamente en la gemela B se aprecian los alteración patológica.
caninos permanentes retenidos en el maxilar, El periodo postoperatorio para ambas gemelas fue
mesializados en posición parecida a la cogemela. Del favorable, recurriendo nuevamente a rayos X para control
lado derecho aparece la cúspide sobre el tercio apical de postquirúrgico (figura 4).
la raíz del incisivo central superior y ápice a nivel del
tercio medio de la raíz del segundo premolar. En el lado
izquierdo la cúspide a nivel del tercio apical de la raíz del
incisivo central superior y su ápice aproximado al tercio
medio de la raíz del segundo premolar del mismo lado
(figura 2). Figura 4. a) Radiografía postoperatoria oclusal superior de la gemela
A. b) Radiografía postoperatoria oclusal superior de la gemela B.

La cigocidad de ambas gemelas se comprobó por medio


de diagnóstico por analogía polisintomática y
demostración serológica tomada de los sistemas O-A-B
y Rh, el resultado para ambas gemelas fue O Rh positivo.
Se realizó comparación de las huellas de las palmas de
ambas manos, encontrándose similitudes en las huellas
dactilares (figura 5).

Figura 5. Comparación de huellas dactilares entre la gemela A y la


gemela B.
Figura 3. Dientes extraídos, en la parte superior los correspondientes
a la gemela A y en la parte inferior los de la gemela B.
Cuatro años después, se tomaron radiografías de ambas

Plan de tratamiento pacientes sin encontrarse rastro patológico


postoperatorio (figura 6).

22
han mencionado que los factores ambientales también
juegan un papel importante en la manifestación de
alteraciones dentales.1,3, 7,11
En los criterios de diagnóstico de dientes retenidos
juegan un papel importante la edad del paciente, las
Figura 6. Seguimiento postoperatorio a cuatro años a) gemela A, b)
gemela B.
condiciones oclusales, resorción radicular y nivel de
hueso alveolar, e incluso la economía familiar, entre
El consentimiento informado se obtuvo de las pacientes otros. Ya que de éstos dependerá el método de
para la publicación del presente caso, al igual que las tratamiento a seguir, su extracción quirúrgica o no.3
imágenes que lo acompañan. Estudios de la morfología dental en gemelos
monocigóticos han demostrado similitudes remarcadas
DISCUSIÓN en medidas y forma del diente por lo cual, bajo algunas
El reporte de anomalías dentarias en gemelos ha sido circunstancias se puede determinar la cigocidad siendo
documentado desde hace tiempo, en donde se han tan confiable como un examen serológico. Sin embargo,
expuesto similitudes en el desarrollo dental,9 alteraciones aquí se prefirió realizar la prueba serológica y la
de forma dental,10 presencia de dientes comparación dactilar para confirmar la referencia
supernumerarios,4,7,11,12 retención,2,5,8 agenesia,3,13,14 gemelar.
entre otros.
Es común el reporte de anomalías dentales en imagen de CONCLUSIONES
espejo entre ambos gemelos, el cual consiste en la Es importante en un caso como este hacer un completo
aparición de la anomalía que ocurre en el lado derecho diagnóstico radiográfico y evaluar a su gemelo, en el
de un gemelo y en el lado izquierdo del cogemelo; 6,8, 11
caso que así sea; sospechando que la fuerte carga
aunque este no fue el caso, ya que aquí la retención fue genética conlleva a la aparición de alteraciones idénticas,
bilateral, lo que todavía es menos común de encontrar en con la finalidad de dar el tratamiento oportuno a ambos,
la literatura. aunque la sintomatología solo se haya reportado en uno
El desplazamiento de los caninos hacia palatino es una de ellos.
anomalía que se presenta más frecuentemente en
mujeres que en hombres y es aproximadamente más REFERENCIAS
prevalente en europeos que en asiáticos.1 1. Leonardi R, Peck S, Caltabiano M, Barbato E. Palatally
Existen evidencias científicas de que este displaced canine anomaly in monozygotic twins. Angle Orthod

desplazamiento hacia palatino es de origen genético, son 2003;73:466-70.


2. Oikarinen V, Gûven O, Silaste H. Similary impacted second
reiterados los reportes familiares. 1
and third maxillary and mandibular molars in a pair of
A pesar de que ambas gemelas tenían los caninos
monozigotic twins. Dentomaxillofac Radiol 1990;19:133-4.
superiores retenidos, existió cierta variabilidad en cuanto
a posición y manifestaciones clínicas; estudios previos

23
3. Zenguin AZ, Sumer AP, Karaarslan E. Impacted primary treatment of impacted maxillary central incisosrs: a study of
tooth and tooth agenesis: a case report of monozygotic twins. twins. Am J Orthod Dentofacial Orthop 2000;117:68-74.
Eur J Dent 2008;2:299-302. 9. Gran SM, Lewis AB, Polachek DL. Sibling similarities in
4. Vecchione GC, Soares CAL, Yuriko KT, Bonifácio SSM, dental development. J Dent Res 1960;39:170-5.
Andrade MMA, Rios D, Gamba GD, Marchani OT. Bilateral 10. Miller WB, McLendon WJ, Hines FB. Two treatment
mediodens in monozygotic twins: 3D diagnostic and approaches for missing or peg-shaped maxillary lateral incisors:
manegement. Case reports Dent; 2013: 193614 a case study on identical twins. Am J Orthod Dentofac Orthop
doi:http://dx.doi.org/10.1155/2013/193614. 1987;92:249-56.
5. Babacan H, Ôztûrk F, Burak PH. Identical unerupted 11. Cassetta M, Altieri F, Giordano A. Mirror imaging of
maxillary incisors in monozygotic twins. Am J Ortho Dentofacial impacted and supernumerary teeth in dizygotic twins: a case
Orhop 2010;138:498-509. report. J Clin Exp Dent 2015;7:e167-9.
6. Townsend GC, Richards L, Hughes T, Pinkerton S, Schwerdt 12. Choi WKL, Chang RCH, Chuang STH. Bilateral
W. Epigenetic influences may explain dental differences in mesiodentes of identical twins-a case report. Chin Dent J
monozygotic twin pairs. Aust Dent J 2005;50:95-100. 1990;9:116-22.
7. Langowska-Adamczyk H, Karmanska B. Similar locations o 13. Nik-Hussein NN, Salcedo AH, Double teeth with hypodontia
fimpacted and supernumerary teeth in monozygotic twins: A in identical twins. ASDC J Dent Child 1987;54:179-81.
report of 2 cases. Am J Orthod Dentofacial Orthop 14. Ulrich SK. Isolierte eckzahnaplasie bei eineiigen zwillingen.
2001;119:67-70. Fortschr. Kieferorthop 1989;50:415-22.
8. Brand A, Akhavan M, Tong H, Kook YA, Zernik JH.
Orthodontic, genetic, and periodontal considerations in the

24
Capítulo 5
USO DEL PÉNDULO PARA LA DISTALIZACIÓN
DE MOLARES: SERIE DE CASOS CLÍNICOS.
Melisa Esparza-Camacho,1 Resumen
Cecilia Beltrán-Jiménez,1 Introducción: La distalización de los molares maxilares es una de las modalidades de
Yarenis Holanda Valenzuela-Zamora,1 tratamiento en las maloclusiones de clase II esqueléticas y dentales que pretende
María de Lourdes Verdugo-Barraza,2 convertir una relación de distoclusión en una neutroclusión y resolver el apiñamiento
anterosuperior mediante el desplazamiento de los molares hacia distal en las etapas
Alma Lucía Castro-Lara.2
iniciales del tratamiento. El aparato péndulo como distalizador ofrece a los ortodoncistas
la posibilidad de ganar espacio, siendo beneficioso y de gran utilidad para los fines del
(1) Estudiante de Maestría en Ortodoncia y
Ortopedia. Facultad de Odontología de la tratamiento temprano y tardío sobre todo cuando no ha erupcionado el segundo molar
Universidad Autónoma de Sinaloa. Culiacán, permanente y así contribuir a la organización de las piezas dentales. Presentación de los
México. casos: Se presentan tres casos clínicos de pacientes femeninas de edades entre 11-13
(2) Profesor-Investigador. Maestría en años que acuden a la clínica de Ortodoncia y Ortopedia de la Universidad Autónoma de
Ortodoncia y Ortopedia de la Facultad Sinaloa, las cuales no cuentan con espacio necesario para la erupción de caninos
Odontología. Universidad Autónoma de superiores. Como plan de tratamiento se decide colocar el Péndulo, para alcanzar la
Sinaloa. Culiacán, México. distalización molar y generar espacio para la erupción de caninos. Tomando en cuenta
que en dos de las pacientes aún no se encontraban erupcionados los segundos molares,
Correspondencia a:
favoreció una rápida distalización, logrando el espacio necesario. Seguido a éste
Dra. María de Lourdes Verdugo-Barraza tratamiento, se proseguirá a utilizar aparatología ortodóncica prescripción Alexander Slot
Email: lourdesverdugo@yahoo.com.mx 018. Conclusiones: El uso del Péndulo para distalar molares superiores, permite en
edades tempranas obtener espacio para la erupción de caninos retenidos, evitando
extracciones de piezas permanentes. Significancia clínica: Resolver problemas
funcionales y estéticos de pacientes Clase II con reducción de espacio para la erupción de
caninos maxilares, utilizando aparatos ortopédicos que evitan la pérdida de piezas
dentarias permanentes, es sin duda una excelente opción de tratamiento.

Cómo citar:
Esparza-Camacho M, Beltrán-Jiménez C, Valenzuela-Zamora YH, Verdugo-Barraza ML,
Castro-Lara AL. Uso del péndulo para la distalización de molares: serie de casos clínicos.
En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos
en Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 25-31. ISBN:
978-607-8444-10-6

INTRODUCCIÓN Las maloclusiones de clase II a menudo se presentan


Las maloclusiones son definidas como alteraciones de con características clínicas que incluyen aumento del
carácter genético, funcional, traumático o dentario que overjet y el overbite en los dientes anteriores, proyección
afectan a los tejidos blandos y duros de la cavidad oral. de incisivos, rotación de molares e inclinación axial de los
La maloclusión no es una variable discreta sino una molares alterada. La corrección exitosa de esas
suma más definida de variación genética y de los efectos maloclusiones radica en un diagnóstico correcto, que
intrínsecos y extrínsecos sobre el crecimiento de la cara, lleva a un plan de tratamiento secuenciado con precisión.
dientes y los maxilares.1 Un análisis clínico cuidadoso le permite al ortodoncista

25
diseñar el sistema de fuerzas adecuado para obtener los rotación de los molares con un mínimo desplazamiento
objetivos del tratamiento. El análisis biomecánico del mesial de los premolares de anclaje. Además, en un
sistema de fuerzas deseado es la mayor importancia amplio estudio realizado por McNamara, lo recomienda
durante el diseño de los aparatos para evitar efectos como un distalizador efectivo con un mínimo efecto sobre
colaterales indeseables.2 Para llegar a un plan de la dimensión vertical.5
tratamiento ideal, se debe hacer un análisis del desarrollo El aparato péndulo como aparato distalizador ofrece a los
de la oclusión. ortodoncistas la posibilidad de ganar espacio, siendo
La distalización de los molares maxilares es una de las beneficioso y de gran utilidad, para los fines del
modalidades de tratamiento en las maloclusiones de tratamiento temprano y tardío sobre todo cuando no ha
clase II esqueléticas y dentales que pretende convertir erupcionado el segundo y tercer molar permanente, y así
una relación de distoclusión en una neutroclusión y contribuir a la organización estética de las piezas
resolver el apiñamiento anterosuperior mediante el dentales, el cual, mejorara la oclusión de los pacientes.3
desplazamiento de los molares hacia distal en las etapas Hallazgos clínicos iniciales han sido alentadores. No es
iniciales del tratamiento.3 La distalización de los molares raro ver tanto como 5 mm de distalización molar en tres o
se puede llevar a cabo con aparatos como el CEOB-1, cuatro meses. Siempre y cuando el espacio se mantiene
Péndulo, Pendex, el arco facial, open coil, Distal jet, correctamente, la mayor parte de la necesaria corrección
placas Cetlin, etc.1 de la clase II, así como la expansión y mejora de la forma
La fuerza adecuada para el movimiento distal de los de arco se puede lograr con poca o ninguna necesidad
molares actúa en los límites de 150-250 g. El tipo de de que el cumplimiento del paciente.6
movimiento puede ser de traslación o inclinación
centrada seguida por verticalidad. El movimiento de PRESENTACIÓN DE LOS CASOS
traslación requiere que la fuerza pase a través del centro Caso 1
de resistencia. Paciente femenina de 11 años y 6 meses de edad, que
Las alternativas de tratamiento de las maloclusiones de acude al Posgrado de Ortodoncia y Ortopedia de la UAS
clase II esqueléticas y dentales incluyen las extracciones por falta de espacios para la erupción de caninos
de dientes permanentes o la distalización de los molares superiores. En el análisis facial se puede observar que la
maxilares con aparatos extraorales e intraorales.2 paciente presenta en la fotografía de frente un biotipo
El péndulo fue reportado originalmente por Hilgers y facial mesoprosopo y en la fotografía de perfil , este es
experimentado luego por Byloff y cols., con él se obtiene convexo con ángulo nasolabial agudo (Figura 1a y 1b).
un nivel óptimo de fuerzas continuas obteniendo un En el análisis intrabucal, las arcadas abiertas nos
movimiento distal de los molares hasta de 3.5 mm.4 muestra que se trata de una dentición mixta (Figura 2a y
En numerosos estudios se ha observado que este 2b), en la fotografía lateral derecha l la relación molar
aditamento produce una distalización con poca era de Clase II. En la del lado izquierdo fue clase molar
inclinación del molar, cuando se le compara con otros no clasificable y un overjet de 2.4 mm. En la fotografía de
métodos, al tiempo que permite el control sobre la frente encontramos líneas medias dentales no

26
coincidentes y un overbite de 2.1 mm (Figura 3a, 3b y nos ayudó a observar que, la pieza 45 se encuentra
3c). incluida, su erupción se encuentra obstaculizada por la
mesialización de la pieza 46, del lado izquierdo existen
ausencias de las piezas 35, 36 y 37. El diagnóstico
obtenido mediante la medición de modelos de estudio
determinó macrodoncia tanto superior como inferior, así
como una discrepancia hueso-diente de la arcada
superior de -2.2 mm según el análisis de Jenkins-Moyers,
se establece un plan de tratamiento en dos fases, una
a b
ortopédica y posteriormente una ortodóntica.
Figura 1. a) Fotografía de frente, b) Fotografía de perfil.

a b
Figura 2. a) Arcada Superior y b) Inferior. Dentición mixta

a b

Figura 4. Análisis radiográfico de Ricketts. Clase I esqueletal, con una


dirección de crecimiento vertical.

Figura 3. Análisis intrabucal: a) Lateral derecha, b) lateral izquierda y


c) vista frontal. Relación molar derecha Clase II, overbite y overjet en
norma, relación molar Izquierda no clasificable.

En el análisis radiográfico el diagnóstico cefalométrico


según Ricketts (Figura 4) mostró que la paciente se Figura 5. Radiografía panorámica. Pieza 45 incluida, mesialización de
la pieza 46, ausencia de las piezas 35, 36 y 37.
encuentra en Clase I esqueletal, con una dirección de
crecimiento vertical. La radiografía panorámica (Figura 5)

27
La etapa ortopédica se inicia con la utilización de un caninos que no han salido”. En el análisis facial, es la
Péndulo de Hilgers en arcada superior (Figura 6) para fotografía de frente se observa un biotipo facial
lograr la distalización de los molares, y así obtener la euriprosopo y en la fotografía de perfil un perfil convexo
relación molar Clase I y el espacio necesario para la y ángulo nasolabial obtuso (Figura 8a y 8b).
erupción de los caninos, el tiempo que llevó esta fase en
ser cumplida fue de 7 meses (Figura 7). Posterior a esta
etapa ortopédica iniciará la etapa ortodóntica con
aparatología prescripción Alexander Slot 018.

a b

Figura 8. a) Fotografía de frente y b) Fotografía de perfil.

En el análisis intraoral, las arcadas en oclusión del lado


derecho e izquierdo muestran Clase I molar y un overjet
de 3 mm. De frente las líneas medias no son
coincidentes, y presenta un overbite de 4mm (Figura 9a,

Figura 6. Etapa de tratamiento ortopédico, colocación de péndulo 9b y 9c).En las arcadas abiertas identificamos falta total
para distalizar molares de espacio para la erupción de caninos superiores, ya
que los laterales se encuentran en contacto interproximal
con los primeros premolares (Figura 10).

a b

Figura 7. Después de 7 meses de tratamiento y con la obtención de


espacio necesario se finaliza activación de péndulo. c

Caso 2 Figura 9. Arcadas en oclusión: Lateral derecha, frente y lateral


izquierda. Líneas medias no coincidentes, Clase I molar bilateral,
Paciente femenina de 11 años de edad, acude al overbite 4 mm, overjet 3 mm.

Posgrado de Ortodoncia y Ortopedia de la UAS con


motivo de consulta “quiero guardar el espacio de los

28
Con la medición de modelos de estudio se encontró que lograr la distalización de los molares, y así obtener la
existe micrognatismo transversal, al igual que relación molar Clase I y el espacio necesario para la
macrodoncia, lo que nos dio una discrepancia hueso- erupción de los caninos. La distalización deseada se
diente negativa. En la radiografía lateral de cráneo se logró después de 6 meses (Figura 14). Como tratamiento
observó una Clase I esqueletal (Figura 11). Mediante la continuo se usará ortodoncia, con aparatología
radiografía panorámica se valora la presencia de los prescripción Alexander Slot 018.
caninos maxilares retenidos. (Figura 12).

a b
Figura 10. Arcadas Superior e Inferior. Falta de espacio para erupción
de caninos superiores.

Figura 13. Etapa de tratamiento ortopédico con la colocación de


péndulo para la distalización de los molares

Figura 11. Radiografía lateral. Clase I esqueletal.

Figura 14. Después de 6 meses se logra el espacio necesario y se


termina activación de péndulo.

Caso 3
Paciente femenina de 13 años de edad, la cual acude a
la clínica del Posgrado de Ortodoncia y Ortopedia, su

Figura 12. Radiografía panorámica. Valoración de los caninos


motivo de consulta era “Porque tengo los dientes
maxilares retenidos. chuecos”. El biotipo facial obtenido del análisis facial en
su foto de frente es mesoprosopo, y en la fotografía de
La etapa ortopédica se inicia con la utilización de un
Péndulo de Hilgers en arcada superior (Figura 13) para

29
perfil es perfil convexo y ángulo nasolabial obtuso
(Figura 15a y 15b).

a b

c
Figura 17. Arcadas en oclusión: Frente, lado derecho, lado izquierdo.
Relación molar Clase II bilateral. Sobremordida vertical aumentada,
Figura 15. a) Fotografía de frente y b) Fotografía de perfil. overjet en norma.

Dentalmente en arcadas abiertas presenta dentición


permanente con falta de espacio para la erupción de
caninos (Figura 16a y 16b). En oclusión del lado derecho
e izquierdo la relación molar fue Clase II y el overjet
está en norma. En las arcadas de frente existe una
sobremordida vertical aumentada, (Figura 17a, 17b y
17c). La medición de modelos de estudio nos revela que
el ancho transverso se encuentra disminuido.

Figura 18. Análisis cefalométrico de Ricketts Clase II esqueletal con


dirección de crecimiento neutro.
a b
Figura 16. Arcadas a) Superior y b) Inferior. Dentición permanente
con falta de espacio para la erupción de caninos.

a b
En el análisis cefalométrico de Ricketts la paciente
presenta Clase II esqueletal con dirección de crecimiento
neutro (Figura 18).
Como plan de tratamiento se decide iniciar con la
utilización de un péndulo (Figura 19), el cual se mantuvo
con activaciones durante 9 meses (Figura 20), hasta
lograr la distalización deseada, para posteriormente
Figura 19. Etapa de tratamiento ortopédico con la colocación de
colocar ortodoncia y realizar la retracción de las piezas péndulo para la distalización de los molares
posteriores.

30
Algunas de las desventajas que presenta éste aparato es
que puede ocurrir proinclinación de las piezas
anterosuperiores o puede producir una mordida abierta
anterior, por la dirección distal en la que se mueven los
molares y el aumento de la dimensión vertical. Para
contrarrestar estos efectos en ocasiones se realizan
modificaciones en la confección del aparato.
Una vez realizado el correcto diagnóstico y decidido
emplear el péndulo es necesario llevar un control
Figura 20. Después de 9 meses de tratamiento, se logra el espacio
radiográfico posterior a la distalización, ya que al distalar
necesario y se suspende activación de péndulo.
el primer molar, cuando no ha erupcionado el segundo
El consentimiento informado se obtuvo de las pacientes molar, puede provocar el atrapamiento del mismo
para la publicación de los presentes casos al igual que de limitando su erupción normal.
las imágenes que los acompañan
Referencias
CONCLUSIONES 1. Rodríguez EE, White LO. Ortodoncia Contemporánea:

El péndulo de Hilgers es un aparato ortopédico con el Diagnóstico y Tratamiento. 2ª ed. Bogotá Amolca; 2008.

cual se puede lograr una efectiva distalización, sobre 2. Nanda R. Biomecánicas y Estética: Estrategias en
Ortodoncia Clínica. Connecticut: Amolca; 2007.
todo utilizado en edades tempranas en donde aún no han
3. Ciro P, Sandoval P, Rey D, Uribe G, Sierra A, Oberti G.
hecho erupción los segundos molares. Este aparato
Distalización de molares maxilares con aparatos intraorales de
produce una distalización de 1.5-2.5 mm/mes
nueva generación que no necesitan colaboración del paciente.
aproximadamente.
Int J Odontostomat 2011;5(1):39-47.
Es muy bien aceptado por el paciente ya que es estético, 4. De Saturno Luz D´Escriván. Ortodoncia en Dentición Mixta.
al ser intrabucal no se aprecia con facilidad, a pesar de Caracas: Amolca; 2007
reducir la capacidad de habla y de higiene del paciente 5. Rodriguez YE, Casasa R, Natera A.1001 Tips en Ortodoncia
por contener acrílico en la zona palatina, éste suele y Sus Secretos. Caracas: Amolca, 2007.

adaptarse de forma rápida. 6. Hilgers J. The Pendulum Appliance for Class II Non-

Uno de los principales motivos de efectividad del Péndulo Compliance Therapy. JCO 1992;26(1):706-14.

es que no es necesaria la cooperación del paciente. Las


activaciones del mismo serán realizadas de manera
sencilla y rápida en el sillón dental.

31
Capítulo 6
CORRECCIÓN DE APIÑAMIENTO
ANTEROINFERIOR CON EXTRACCIÓN DE UN
INCISIVO: REPORTE DE UN CASO.
Efigenia Moreno-Terrazas,1 Resumen
María de Lourdes Verdugo-Barraza,1 Introducción. El debate sobre la terapia de extracciones en el tratamiento de ortodoncia se
Rosa Alicia García-Jau,1 remonta hasta principios del siglo pasado. Al día de hoy la terapia de extracciones sigue en
Bertha Eugenia Padilla-Suzuki,1 uso en un gran número de pacientes; ya que, la estabilidad de los tratamientos a largo
plazo ha sido una de las razones más importantes para motivar su uso. La extracción de un
Alma Lucia Castro-Lara.1
incisivo inferior, no es común en ortodoncia, sin embargo, es una buena alternativa en los
casos de apiñamiento anteroinferior severo y moderado, siendo necesario realizar un
(1) Profesor-Investigador. Maestría en
Ortodoncia y Ortopedia de la Facultad estudio detallado para tomarlo como una solución. Presentación del caso: paciente
Odontología. Universidad Autónoma de femenina 13 años de edad, acude a la Clínica de Ortodoncia y Ortopedia de la Universidad
Sinaloa. Culiacán, México. Autónoma de Sinaloa. Biotipo facial leptoprosopo, asimétrica, tercios desproporcionados,
overjet de 1mm, Clase I molar, Clase I canina, apiñamiento anteroinferior moderado. Plan
de tratamiento: colocación de aparatología ortodóncica para lograr alineación y nivelación
Correspondencia a: de arcadas dentarias, eliminar el apiñamiento anteroinferior a través de la extracción de un
Dra. Efigenia Moreno-Terrazas incisivo inferior. Resultados: se logró una relación maxilomandibular ideal, los contactos
Email: effymoreno@hotmail.com interproximales ideales, overjet posibles, se colocaron los incisivos en sus basales, se
conservó Clase I canina, se eliminó el apiñamiento anteroinferior. Conclusiones: la
extracción de un incisivo inferior como posibilidad terapéutica es una opción válida ya que
se pueden obtener buenos resultados tanto funcionales como estéticos, además la gran
ventaja de proveer estabilidad prolongada. Significancia clínica: aunque el apiñamiento
anterior es muy frecuente, la decisión de la extracción de un incisivo no es muy común sin
embargo esta puede ser la solución adecuada.

Cómo citar:
Moreno-Terrazas E, Verdugo-Barraza ML, García-Jau RA, Padilla-Suzuki B, Castro-Lara
AL. Corrección de apiñamiento anteroinferior con extracción de un incisivo: reporte de caso.
En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en
Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 32-35. ISBN: 978-
607-8444-10-6

INTRODUCCIÓN abiertas. Por lo regular los ortodoncistas recurren a la


El debate sobre la terapia de extracciones en el extracción de premolares para la resolución de
tratamiento de ortodoncia se remonta hasta principios del apiñamientos severos. Sin embargo, en casos en los
siglo pasado. Canut y algunos autores recomiendan cuales el paciente presenta un perfil recto, es un riesgo
realizar extracciones en los siguientes casos: deficiencia de la terapia de extracciones la afectación negativa del
en la longitud de arco, protrusión dentoalveolar, perfil del paciente. El tratamiento de extracción de un
discrepancia de masa dentaria (apiñamiento), incisivo inferior en este tipo de casos puede ser una
compensación dentaria, e incluso para disminuir la buena opción, ya que resuelve el apiñamiento sin afectar
dimensión vertical en el caso de pacientes con mordidas el perfil del paciente.1,2

32
Para Proffit el apiñamiento dentario es la maloclusión maxilar, que pueda permitir la corrección con un pequeño
más común en la actualidad e indudablemente está desgaste interproximal, mientras que en el maxilar
relacionada a la reducción del tamaño mandibular en inferior debe existir un apiñamiento moderado en el
relación al tamaño de los dientes, el cual parece tener un sector anterior, perfil facial aceptable; debido a que
fuerte control genético y cuyas dimensiones ocurrirá un mínimo cambio en la arcada superior, no se
transversales afectan directamente la cantidad de puede esperar modificaciones en el perfil, la
espacio para el alineamiento dentario.3 sobremordida vertical y horizontal debe ser mínima a
Con relación a la extracción terapéutica de un incisivo moderada, de forma tal que pueda resolverse con la
mandibular, ésta puede ser realizada en casos de extracción de un incisivo, mínimo potencial de
discrepancia de tamaño dentario en la región anterior, crecimiento. En los pacientes en crecimiento debe
con una deficiencia en la longitud de la arcada entre 4 y 7 considerarse la terapia sin extracciones antes de la
mm. La decisión de extraer un incisivo va a depender, extracción de un incisivo.6
además, de la posición de los dientes, de las condiciones Es necesario verificar que exista espacio suficiente en el
periodontales y la integridad dental.4 arco, realizar las mediciones necesarias y determinar el
La extracción del incisivo lateral es generalmente incisivo a extraer y provocar con estos, una posición
preferida porque es menos notoria de frente, pero el optima de los dientes la cual nos brinda la función
incisivo que está más cercano al apiñamiento es requerida, estabilidad y estética para el paciente.7 El
usualmente el mejor candidato para extracción. Los análisis de Bolton es un elemento de diagnóstico que hay
triángulos negros no solo son comunes después de la que tener en cuenta sobre todo si se quiere cuantificar si

terapia de extracción del incisivo mandibular, sino que el problema es una discrepancia de tamaño de los

suele aparecer en 40% de los adultos, después de dientes superiores o de los incisivos (masa dental).5,8

cualquier tratamiento ortodóntico. Esto puede ser una


PRESENTACIÓN DEL CASO
consideración importante, especialmente en pacientes
Se presentó paciente femenina de 13 años de edad, al
mayores, ya que el desplazamiento del incisivo
Posgrado de Ortodoncia de la Universidad Autónoma de
mandibular se incrementa con la edad. Los pacientes
Sinaloa, la cual refiere en su interrogatorio, como dato
adultos deber ser informados del potencial de estos
interesante succión digital hasta los 6 años, al examen
efectos secundarios. La formación de los triángulos
extraoral se determinó un paciente leptroprosopo, tercios
negros ha sido atribuido a muchos factores, incluida la
medios desproporcionados, asimétrica (fotografía de
perdida de hueso por motivos periodontales, mayor
frente), perfil recto, ángulo nasolabial obtuso, nariz
contacto interproximal incisal, incisivos triangulares y
proporcional (fotografía de perfil) (Figura 1). Al examen
diferentes angulaciones de las raíces.5
intraoral se observa clase I canina y molar (fotografía
Owen señala algunas condiciones que debemos tomar
lateral derecha), en su arcada inferior se observa
en cuenta al decidir la extracción de un incisivo
apiñamiento anterior moderado, en las arcadas en
mandibular en casos de maloclusión Clase I tipo I:
oclusión se puede observar un overbite de 5.5 mm,
Presencia de apiñamiento leve o ninguna en el arco
overjet de 1 mm (Figura 2). En el análisis cefalométrico

33
realizado (Rickets) presenta una relación Una vez realizado el diagnostico se establecieron los
maxilomandibular Clase II, proinclinación de incisivos objetivos: 1) conservar el perfil, así como su clase I
superiores e inferiores (Figura 3). canina y molar, 2) eliminación del apiñamiento
anateroinferior, y 3)obtener la máxima intercuspidación
posible. Para logarlos se colocó aparatología fija
Alexander slot .018. Como lo indica la esta técnica se
colocó la aparatología superior hasta que se logró la
alineación en la arcada superior, para después se
colocar en la arcada inferior, donde se tomó la decisión
de eliminar el apiñamiento anateroinferior a través de la
extracción de un incisivo (pieza 31) debido a las
Figura 1. Fotografías de examen extraoral.
características del caso (perfil recto, clase I molar ), una
vez lograda la nivelación, cierre de espacios y
paralelización de raíces, después de 21 meses de
tratamiento el caso fue finalizado, colocándose sus
retenedores. (Figura 4).

Figura 4. a) y b) Fotografías al inicio del tratamiento.

Resultados
Se logró una relación maxilomandibular ideal, los
Figura 2. Fotografías examen intraoral.
contactos interproximales posibles, se colocaron los
incisivos en sus basales, se mantuvo la Clase I canina,
overbite, overjet funcionales, se eliminó el apiñamiento
anteroinferior (Figura 5).
El consentimiento informado se obtuvo de los padres de
la paciente para la publicación de los presentes casos al
igual que de las imágenes que los acompañan

CONCLUSIONES
Cuando se realiza un diagnóstico adecuado del paciente,
Figura 3. Radiografía lateral y análisis de Ricketts.
Plan de tratamiento podemos decidir la mecanoterapia que ayudará a
resolver los problemas de la mejor manera, obteniendo

34
así mejores resultados estéticos y funcionales. En este REFERENCIAS.

caso la extracción del incisivo inferior fue la mejor 1. Ruiz GE, Perez-Traconis LB, Gomez-Morayta A. Extracción

decisión para eliminar el apiñamiento y así lograr una atípica en Ortodoncia, Revista Odontológica Latinoamericana
2009, Vol.1,Num.2 pp 57-62
mayor estabilidad del tratamiento.
2. Canut J. Ortodoncia Clínica. 2da ed. Barcelona: Salvat
Editores, 2000.
3. Profit, W. Contemporary Orthodontics. 2nd ed. Missouri:
Mosby Year Book, 1993.
4. Pujol A, Bardinet E, Bazert, C. Extraction of a mandibular
incisor. A.J.O-D.O 2002; 121:432. 85 65.
5. Ittle RM, Riedel RA. Postretention, evaluation of stability and
relapse mandibular arches with generalized spacing. AJODO
1989;95:37-41
6. Owen A. Single lower incisor extractions. J.C.O. 1993 March:
153-160. 66.
7. Gavin J, Michael G. Incisal Changes and orthodontics
Stability. Journal angle orthodontics 1999; 69
8. Sheridan JJ, Hastings J. Air-rotor stripping and lower incisor
extraction treatment. JCO 1992; 18-22

Figura 5. Fotografías de resultados.

35
Capítulo 7
TERAPIA MIOFUNCIONAL CON LIP BUMPER
DE UN PACIENTE CLASE II DIVISIÓN 1:
REPORTE DE UN CASO.
Martha Mendoza-Rodríguez,1 Resumen
Adianis Cores-Carballosa,2 Introducción: La terapia miofuncional es muy efectiva cuando se realiza en el período de
Mirna Isabel Minaya-Sánchez,3 dentición mixta. La causa ambiental determinante en la aparición de maloclusiones son
Ana Alicia Vallejos-Sánchez.3 los hábitos no fisiológicos, que pueden modificar la posición de los dientes, la forma y
relación que guardan las arcadas dentarias en pacientes en desarrollo. Presentación del
(1) Profesor-Investigador. Área Académica de caso: Se presenta un paciente de 10 años, masculino, clase II de Angle división 1, con
odontología del Instituto de Ciencias de la hábito de succión labial inferior y sobremordida horizontal acentuada. Es tratado con un
Salud de la Universidad Autónoma del Estado aparato lip bumper removible para equilibrar las fuerzas musculares que están alteradas
de Hidalgo. Pachuca, México. y redirigirlas, eliminando el hábito de succión labial y corregir el overjet, utilizado durante
(2) Estudiante de la Licenciatura de Cirujano tres meses. Se obtuvo una disminución del resalte de 3 mm, cambios en la posición de
Dentista. Área Académica de odontología del incisivos y mejoría en la musculatura peribucal y la eliminación del hábito de succión
Instituto de Ciencias de la Salud de la digital. Para el éxito del tratamiento fue importante la cooperación y constancia del
Universidad Autónoma del Estado de Hidalgo.
paciente. Conclusiones: La detección temprana del hábito de succión labial es
Pachuca, México.
(3) Profesor-Investigador. Facultad de importante para prevenir cambios óseos y dentales en los pacientes. En la aparatología
Odontología de la Universidad Autónoma de ortopédica removible la cooperación del paciente es un factor importante para tener éxito
Campeche. Campeche, México. en el tratamiento. Significancia clínica: El uso del aparato ortodóntico con aplicaciones
ortopédicas Lip bumper removible disminuyó la sobremordida horizontal del paciente,
mejoro su perfil y elimino la succión labial.
Correspondencia a:
Dra. Martha Mendoza-Rodríguez Cómo citar:
Email: romen65@hotmail.com
Mendoza-Rodríguez M, Cores-Carballosa A, Minaya-Sánchez MI, Vallejos-Sáncehez
AA. Terapia miofuncional con lip bumper de un paciente clase II división 1: reporte de un
caso. En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos
clínicos en Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 36-
41. ISBN: 978-607-8444-10-6

INTRODUCCIÓN desarrollo de anomalías de tamaño, forma y número así


Actualmente se considera que las maloclusiones se como en alteraciones de la cronología y secuencia
producen por una discrepancia entre el tamaño de los eruptiva. Dentro de los factores locales contribuyentes se
dientes y el hueso asociado a un problema en el destacan la pérdida prematura de dientes, la retención
crecimiento y desarrollo de las bases óseas. prolongada de dientes temporales, ausencias congénitas,
La base de un tratamiento de ortodoncia es diagnosticar frenillos anormales y en los factores sistémicos se
el origen de la maloclusión para actuar sobre los factores pueden citar los trastornos metabólicos y otras
que la están produciendo. A esta se le atribuye un origen enfermedades con repercusión dental. La causa
multifactorial, destacándose fundamentalmente factores ambiental más determinante en la aparición de
genéticos y ambientales. La herencia puede influir en el maloclusiones son los hábitos.1-2

36
Un hábito se define como la costumbre o práctica  Asociada a hábitos.6
adquirida por la repetición frecuente del mismo acto, el En esta maloclusión los caninos y molares mandibulares
cual en un inicio se hace de forma consciente y están en una relación distal respecto a los superiores;
posteriormente de forma inconsciente. 2-4 hay una alteración del crecimiento y se afectan las
Los hábitos de acuerdo a su etiología se pueden relaciones esqueléticas y dentales. Estos pacientes
clasificar en: presentan un resalte aumentado, proinclinación de
 Instintivos: hábito de succión. incisivos superiores, arco superior triangular y perfil
 Placenteros: succión digital o del chupón. retrognático. Habitualmente durante la posición de
 Defensivos: respiración bucal. reposo, no contactan sus labios y el labio inferior se
 Hereditarios: inserciones cortas de frenillos linguales, interpone entre los incisivos superiores e inferiores.
lengua bífida. Debido a esto el labio superior está hipotónico, los
 Adquiridos: la fonación nasal en los pacientes de labio incisivos inferiores se inclinan hacia lingual, el labio
y paladar hendido. inferior y los músculos del mentón están hipertónicos.3,5-8

 Imitativos: gestos, muecas.2 La terapia miofuncional es la disciplina que se encarga

Además se clasifican en: de prevenir, valorar, diagnosticar y corregir las

 Fisiológicos: son los que nacen con el individuo. disfunciones que pueden interferir en el complejo

 No fisiológicos: son los que ejercen fuerzas dañinas orofacial.4,9

sobre los dientes, tejidos blandos y duros provocando Objetivos de la terapia miofuncional:

alteraciones en el desarrollo del sistema estomatognático  Lograr un equilibrio entre las estructuras orofaciales

y óseo.4-5 tanto óseas como musculares.

Dentro de los hábitos no fisiológicos ubicamos la succión  Crear una función muscular normal.

lingual o interposición lingual. Este se produce por  Mejorar la estética. 4


presión del labio inferior sobre los dientes El hábito de succión lingual ocurre con el labio inferior en
anteroinferiores e interfiere en el crecimiento normal y en la mayoría de los casos en el cual puede evidenciarse
la función de la musculatura orofacial. Con mucha resequedad, inflamación y grietas. Para su corrección es
frecuencia se asocia a maloclusiones clase II con una ampliamente usado el aparato con lip bumper o
sobremordida horizontal pronunciada.1 separador labial. Este es un aparato funcional que guía
Edward H. Angle en 1899 agrupó a las maloclusiones en las fuerzas producidas por la musculatura del individuo
tres grandes grupos de los cuales solo referenciaremos modificando los huesos y a su vez le transmite a los
la clase II o distoclusión.6 dientes las fuerzas funcionales. Por esto se puede decir
Etiología de la maloclusión clase II división 1: que es un aparato ortodóntico de acción ortopédica.4, 9-11

 Displasia ósea básica. Fauchard en el siglo XVIII introdujo el uso de aparatos

 Inclinación vestibular de arco superior y procesos reguladores. Thomes en el siglo XIX propuso una teoría

alveolares. que relacionaba la forma de los arcos dentales con la

 Influencia de factores esqueletales y dentales. actividad muscular. Renfroe en 1956 reporta el lip

37
bumper como un aparato de anclaje muscular o pronunciada se los dientes superiores". Fue atendido por
empujador labial. Su uso se basaba en controlar la fuerza una alumna de la licenciatura que cursa la clínica de
ejercida por el labio inferior hipertónico contra los dientes ortodoncia de 9° semestre. Al examen clínico se
anteriores superiores e inferiores. Subtenly y Sakuda determina que presenta una maloclusión clase II de
demostraron en un estudio que con el lip bumper Angle división 1, overjet de 10 mm, overbite de 3 mm,
aumentaba el perímetro del arco inferior. En un estudio diastemas entre incisivos superiores, arcada superior
realizado por Attarzaden y Adenwalla encontraron que, triangular y hábito de succión labial inferior (Figura 1). En
usando el lip bumper durante seis meses, el incisivo el examen físico se detectó un perfil convexo (Figura 2).
inferior se vestibularizó 1.2 mm y los molares se
distalizaron 0.50 mm.9
El lip bumper es más efectivo en tratamientos durante la
dentición mixta, en los picos del crecimiento óseo antes
de la erupción de los segundos molares permanentes. a b
Puede ser fijo, semi-fijo o removible. La pantalla
vestibular se coloca entre los incisivos inferiores y el labio
con un grosor de 2 a 4 mm. Sus funciones
fundamentales son:
 Separar el labio y carrillos de las estructuras dentarias
c
inferiores.
 Estimular la acción de la musculatura lingual lo cual
Figura 1 . Fotografías intraorales iniciales del paciente a), de perfil b)
permite el desplazamiento vestibular de los incisivos. superior y c) frontal.
 Aumentar el perímetro del arco mandibular en sentido
sagital.
 Impedir la interposición labial entre incisivos lo cual le
regresa su tonicidad normal al labio superior.
 Distalizar y rotar los molares inferiores.
 Permitir el desarrollo dentoalveolar lateral.9,12-14

PRESENTACIÓN DEL CASO


Se presenta el caso de un paciente de sexo masculino de
10 años de edad procedente de Pachuca. Acude con su
mamá a la clínica de ortodoncia del Área Académica de
Odontología del Instituto de Ciencias de la Salud de la
Universidad Autónoma del Estado de Hidalgo. El motivo
de consulta referido por la madre fue la "inclinación

38
Figura 2 . Fotografía de perfil del paciente disminuyó a 9 mm el cual se mantuvo con el mismo valor
Se realizaron estudios radiográficos y modelos de en la tercera activación.
estudio. El diagnóstico del paciente fue: Clase II En la cuarta visita del paciente se realizó otro desgaste
esqueletal, crecimiento vertical, Clase II molar derecha e de 1 mm en el acrílico palatino de los incisivos
izquierda, Clase II canino derecha e izquierda, superiores. Para la quinta y sexta semanas el overjet
proinclinación de incisivos centrales superiores e había disminuido a 8.5 mm y 8 mm en centrales
inferiores. En el análisis facial presentó perfil convexo, respectivamente y en los laterales de 8 a 7.5
incompetencia labial y mentón hipertónico. En el plan de respectivamente (Figura 4).
tratamiento se decide colocar aparatos removibles tipo
Hawley superior e inferior con lip bumper por el manejo
de la clínica y los costos.
Se le toman impresiones con alginato y se elaboran
modelos de estudio. Se construyen los aparatos con
acrílico con ganchos circunferenciales de bola de 0.28
mm como retenedores en los primeros molares
permanentes y arco vestibular con alambre de 0.36 mm.
El lip bumper se coloca sobre los 6 dientes
anteroinferiores con un grosor de 3 mm de acrílico
dejando libre los bordes incisales (Figura 3). Se realiza la
instalación de los aparatos, se dan indicaciones de uso y
Figura 4. Evolución del paciente a la sexta semana de tratamiento.
se le da cita cada semana al paciente.
Los cambios en los laterales se evidenciaron porque
comenzaron a rotarse. En la octava semana estos
valores se redujeron 0.5 mm y en la décima semana el
overjet mostró un valor de 7.5 mm en centrales y 7 mm
en laterales. Debido a que el semestre terminó en la
UAEH, este paciente fue remitido a ortodoncia para
Figura 3. Placa Hawley superior y placa Hawley inferior con lip continuar con su tratamiento en el Hospital del Niño DIF.
bumper.

En la primera cita se realizó un desgaste en el acrílico DISCUSIÓN

por detrás de los incisivos superiores para propiciar la El lip bumper es un aparato funcional que es muy

retroinclinación. Se midió con sonda North Carolina el efectivo para controlar el hábito de succión labial inferior

overjet el cual fue de 9.5 mm En la segunda semana se a través del empleo de las fuerzas musculares. Los

incrementaron 2 mm al grosor del lip bumper y el overjet cambios asociados a malposiciones dentales, longitud

39
de arco, sobremordida horizontal y tonicidad muscular asociados con hábitos anormales como la succión labial
son visibles en cortos períodos de tiempo.9,12-14 inferior. Es simple y bien tolerado por el paciente
El paciente del presente caso se encuentra en etapa de actuando sobre el equilibrio de las fuerzas musculares
dentición mixta por lo que se usó un lip bumper para extraorales que son causantes de maloclusiones.
controlar el hábito de succión labial y mejorar la actividad
muscular peribucal. Con este aparato se logró disminuir
el overjet de 10 mm hasta 7.5 mm en un período de 10
semanas debido a que se propició la actividad de los
músculos de la lengua y el labio dejó de interponerse
entre los incisivos. El perfil mejoró considerablemente, a
(Figura 5) la línea mentolabial se observó menos
marcada, mejoró la tonicidad del labio superior y
disminuyó la del inferior, los diastemas se cerraron, el
arco superior tomó una forma más ovoidea (Figura 6).
Resultados similares muestran Germer y Taner10 y Manoj b
et al.,12 en sus estudios. Figura 6. a) Inicio del tratamiento b) evolución del paciente a la
décima semana de tratamiento.

REFERENCIAS
1. Sakkal, R. Importancia de la interacción genética-ambiente
en la etiología de las maloclusiones. Revista Latinoamericana
de Ortodoncia y Odontopediatría 2004. Disponible en:
https://www.ortodoncia.ws/publicaciones/2004/art4.asp (último
acceso 3 de abril 2015).
2. Urrieta E, López I, Quirós O, Farias M, Rondón S, Lerner H.
Hábitos bucales y maloclusión presente en los pacientes
atendidos durante el diplomado de ortodoncia interceptiva
U.G.M.A año 2006-2007. Revista Latinoamericana de
Ortodoncia y Odontopediatría 2008. Disponible en:
http://www.ortodoncia.ws/publicaciones/2008/habitos_bucales_
maloclusion.asp (último acceso 3 de abril 2015).
3. Quirós Álvarez O, Quirós L, Quirós J. La orientación
Figura 5. Perfil del paciente. psicológica en el manejo de ciertos hábitos en odontología.
Revista Latinoamericana de Ortodoncia y Odontopediatría
CONCLUSIONES 2003. Disponible en:
El aparato con lip bumper es muy efectivo para la http://www.ortodoncia.ws/publicaciones/2003/orientacion_psicol
corrección de problemas dentales y musculares ogica_habitos_odontologia.asp (último acceso 3 de abril 2015).

40
4. Alvizua V, Quirós O. Efectividad de la terapia miofuncional Odontopediatría 2014. Disponible en:
en los hábitos más comunes capaces de producir http://www.ortodoncia.ws/publicaciones/2014/art26.asp (último
maloclusiones clase II. Revista Latinoamericana de Ortodoncia acceso 3 de abril 2015).
y Odontopediatría 2013. Disponible en: 9. Di Santi de Modano J. Fuerzas producidas por el lip bumper.
http://www.ortodoncia.ws/publicaciones/2013/art15.asp (último Acta Odontol Venez 2005; 43 (1). Disponible en:
acceso 3 de abril 2015). http://www.scielo.org.ve/scielo.php?pid=S0001-
5. Lugo C, Toyo I. hábitos orales no fisiológicos más comunes 63652005000100012&script=sci_arttext (último acceso 3 de
y cómo influyen en las maloclusiones. Revista Latinoamericana abril 2015).
de Ortodoncia y Odontopediatría 2011. Disponible en: 10. Germec D, Taner Tu¨ lin Ug˘ur. Lower Lip Sucking Habit
http://www.ortodoncia.ws/publicaciones/2011/art5.asp (último Treated with a Lip Bumper Appliance. Angle Orthodontist 2005;
acceso 3 de abril 2015). 75 (6): 1071-76.
6. Ortiz M, Lugo V. maloclusión clase II división 1; 11. Shahraki N, Yassaei S, Goldani Moghadam M. Abnormal
etiopatogenia, características clínicas y alternativa de oral habits: A review. J Dent Oral Hyg 2012;4(2):12-15.
tratamiento con un configurador reverso sostenido II (CRS II). 12. Manoj Kumar MG, Sai Sankar AJ, Ratnaditya. A Maxillary
Revista Latinoamericana de Ortodoncia y Odontopediatría Appliance for Correcting Lower Lip Sucking Habit. J Orofac Sci
2006. Disponible en: 2010;2(1):24-26.
http://www.ortodoncia.ws/publicaciones/2006/maloclusion_etiop 13. Ferro F, Funiciello G, Perillo L, Chiodini P. Mandibular lip
atogenia.asp (último acceso 3 de abril 2015). bumper treatment and second molar eruption disturbances. Am
7. Rojas García AR, Gutiérrez Rojo JF, Peña Montero CA, J Orthod Dentofacial Orthop 2011;139:622-7.
Aguilar Orozco NY. Revista Latinoamericana de Ortodoncia y 14. Gerety RG. Use of lip bumpers. Disponible en:
Odontopediatría 2013. Disponible en: http://orthodonticteaching.com/webroot/files/documents/use-lip-
http://www.ortodoncia.ws/publicaciones/2013/art6.asp (último bumpers/08-Use-of-Lip-Bumpers.pdf (último acceso 3 de abril
acceso 3 de abril 2015). 2015).
8. Arévalo Remache JP, Sigüencia Cruz V, Bravo Calderón
ME. Maloclusión clase II-1, tratamiento ortodóncico-Revisión de
la literatura. Revista Latinoamericana de Ortodoncia y

41
Capítulo 8
PROGNATISMO MANDIBULAR CORRECCIÓN
QUIRÚRGICA ORTODONTICA: REPORTE DE
UN CASO.
Efigenia Moreno-Terrazas,1 Resumen
María de Lourdes Verdugo-Barraza,1 Introducción: Las alteraciones del desarrollo de los maxilares comprenden exceso o falta
Rosa Alicia Garcia-Jau,1 de desarrollo de los huesos de la cara y con quien se relacionan, una de estas alteraciones
Julio Benítez Pascual,1 es el prognatismo mandibular, su presencia provoca problemas, tales como: inadecuada
posición dentaria, alteraciones de la función masticatoria y estética facial afectada. La
Juan José Villalobos Rodelo.2
etiopatogenia es multicausal; su tratamiento debe realizarse por equipos multidisciplinarios,
cirujano maxilofacial y el ortodoncista. Aun cuando en México la prevalencia no es muy alta
(1) Profesor-Investigador. Facultad de
Odontología de la Universidad Autónoma de la afectación a quienes la presentan tienen grandes repercusiones en su personalidad
Sinaloa. Culiacán, México. debido a la afectación estética que involucra. Presentación del caso. Paciente masculino
(2) Profesor. Facultad de Odontología de la de 18 años 10 meses de edad, que acude a la consulta a la clínica de Ortodoncia y
Universidad Autónoma de Sinaloa. Culiacán, Ortopedia de la Facultad de Odontología de la Universidad Autónoma de Sinaloa, con
México. antecedentes de corrección ortodóntica de aproximadamente 5 años, diagnosticado con:
Clase III esqueletal debido a prognatismo mandibular, Clase III molar, mordida cruzada
anterior y posterior, proinclinación de incisivos superiores e inferiores según análisis
Correspondencia a: cefalométrico de Ricketts, agenesia de segundos premolares inferiores. El objetivo
Dra. Efigenia Moreno-Terrazas
fundamental de tratamiento fue lograr una relación maxilo-mandibular ideal, descruzar
Email: effymoreno@hotmail.com
mordida anterior y posterior lograr overjet y overbite funcionales, mejorar la estética facial.
El tratamiento se llevó a cabo en tres fases; primera fase: preparación pre–quirúrgica,
segunda fase: intervención quirúrgica (osteotomía sagital de la mandíbula), logrando la
relación anteroposterior ideal de los maxilares, tercera fase: finalización del tratamiento de
ortodoncia para establecer la oclusión y la adecuada función. Conclusiones: la ortodoncia
tiene límites y necesita de otras disciplinas para lograr que los pacientes que presentan este
tipo de problemas sean resueltos exitosamente. Significancia clínica: resolver los
problemas funcionales y estéticos de un paciente Clase III por prognatismo mandibular de
manera multidisciplinaria; es sin duda la mejor opción para que los pacientes logren su
inserción a la vida cotidiana sin los problemas que esta anomalía dentomaxilofacial
conlleva.

Cómo citar:
Moreno-Terrazas E, Verdugo-Barraza ML, García-Jau RA, Benítez-Pascual J, Villalobos-
Rodelo JJ. Prognatismo mandibular corrección quirúrgica ortodontica: reporte de un caso.
En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en
Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 42-46. ISBN: 978-
607-8444-10-6

INTRODUCCIÓN mismo tiempo Rubbrecht también había estudiado cinco


El prognatismo ha sido un padecimiento conocido y familias prognatas, habiendo comprobado que padres
además estudiado desde hace años. Galipe lo había prognatas le trasmitían a sus hijos la característica facial
descrito como un estigma degenerativo. Knoche lo había y observó además que en algunos casos no se hacía
estudiado en la familia de Goethe en Alemania. Por este evidente esta enfermedad. Otros como Aguilar y

42
Korkhaus hicieron exhaustivas investigaciones en mediante trazos de osteotomía los fragmentos óseos
dinastías y en gemelos alemanes. El primero de ellos alterados para movilizarlos y fijarlos en la posición
estudió veinte generaciones y pudo comprobar la adecuada, planificada previamente: oclusión y
herencia del prognatismo, y así por medio de un estudio articulación correcta; estética y equilibrio facial y
en la iconografía genealógica pudo demostrar la estabilidad morfológica y funcional.4
trasmisión sucesiva del prognatismo sin interrupción en la La osteotomía sagital de rama mandibular es un
familia de Alfonso VIII en 1158 parientes con prognatismo procedimiento común usado para la corrección de las
que lo habían heredado de sus antecesores. Esta deformidades dentofaciales en un individuo, la cual
característica facial originaria de la casa de Castilla pasó permite realizar movimientos mandibulares en diferentes
a otras familias reinantes en Europa. El emperador planos. La rama mandibular tiene un segmento articular
Maximiliano I de Austria fue originario de Happsburg que (portador del cóndilo) y un segmento vasculonervioso
más tarde trasmitía el carácter a otras familias reinantes (nervios mentoniano y vasos alveolares inferiores), la
en Castilla (Borbón, Portugal, Palma, Medecis, Estuardo, osteotomía separa estos dos segmentos, dividiendo la
Veíais, Orleans y Sabo). Evidentemente se ha rama en forma sagital en sus dos corticales permitiendo
demostrado la existencia de un factor hereditario en el el avance o retroceso mandibular.5
desarrollo de prognatismo verdadero. Sin embargo,
existen también padecimientos durante una vida normal PRESENTACIÓN DEL CASO
que son capaces de desencadenar un prognatismo.1 Paciente masculino de 18 años 10 meses de edad,
Prognatismo mandibular es la más frecuente de las procedente y residente de la ciudad de Culiacán Sinaloa
malformaciones maxilofaciales. Se expresa por una que acude a la consulta a la clínica de Ortodoncia y
desarmonía facial caracterizada por una mandíbula Ortopedia de la Facultad de Odontología de la
prominente principalmente en sentido antero-posterior. Universidad Autónoma de Sinaloa. Con antecedentes de
Las piezas dentarias inferiores acompañan este corrección ortodóntica de aproximadamente 5 años. Al
crecimiento dando una oclusión de Clase III de Angle, interrogatorio refiere antecedentes de prognatismo
con overjet negativo. Es decir que los dientes antero- mandibular en sus parientes paternos (tíos). Al examen
inferiores, en relación céntrica, se encuentran por delante extraoral se determinó un paciente euriprosopo,
de los superiores.2 Esta deformación dentomaxilar de asimétrico con tercio inferior aumentado (Figura 1),
acuerdo a su severidad puede tratarse con una terapia perfil cóncavo, ángulo naso labial agudo (Figura 2). Al
ortodóncico corrigiendo el déficit oclusal y la mordida examen intraoral presentó: clase III molar, clase III
cruzada, en casos de gran severidad requieren conducta canina, mordida cruzada posterior derecha, agenesia de
quirúrgica la llamada cirugía ortognática.3 segundos premolares inferiores, apiñamiento anterior
La ortodoncia y la cirugía ortognática son las terapéuticas inferior (Figuras 3) según el análisis cefalométrico de
aplicables para corregir las disgnatias, los objetivos Ricketts se diagnosticó con: clase III esqueletal,
perseguidos en estos tratamientos son: el tratamiento proinclinación de incisivos superiores e inferiores,
quirúrgico en líneas generales consiste en separar braquifacial, macrognatismo mandibular (Figura 4).

43
Figura 3. Fotografías examen intraoral

Figura 1. Fotografía de examen extraoral.

Figura 4. Radiografía de análisis cefalométrico de Rickets.

El tratamiento se llevó a cabo en tres fases. Primera


fase: preparación prequirúrgica, cuyo objetivo fue alinear
las piezas dentarias inferiores, colocándolos
adecuadamente en hueso basal, con el correcto torque
corono-radicular (Figura 5).

Figura 2. Fotografía de perfil.

44
oclusal. Los resultados obtenidos fueron los siguientes:
se corrigieron las inclinaciones axiales de las piezas
dentarias. Se logró la armonía de las partes óseas, con
un overjet y overbite funcional, alineación correcta de la
arcada dentaria y una buena interdigitación cúspide,
adecuada función oclusal, un perfil recto con un rostro
armónico y bien proporcionado (Figura 7 y 8).

Figura 5. Fotografía de primera fase prequirúrgica.

Segunda fase: conjuntamente con el Cirujano


Maxilofacial se llevó a cabo el análisis clínico y
cefalométrico del caso y se decidió realizar una
intervención quirúrgica para acortar el tamaño
desproporcionado de la mandíbula (prognatismo
mandibular) y eliminar la asimetría maxilo mandibular. La
corrección quirúrgica de las partes óseas se realizó con
la técnica quirúrgica de osteotomía sagital de la rama
mandibular (Figura 6).

Figura 7. Fotografía de perfil después realizar de la intervención


quirúrgica.

Figura 6. Radiografía después de realizar corrección quirúrgica.

Tercera fase: tratamiento ortodóncico complementario.


Dirigido a completar el alineamiento dentario superior e Figura 8. Fotografía intraoral 6 meses después de la intervención
inferior y a conseguir una interdigitación cuspídea quirúrgica.

funcional sin interferencias dentarias y adecuada función

45
El consentimiento informado se obtuvo del paciente para en la integración curativa de las especialidades
la publicación del presente caso al igual que las estomatológicas.
imágenes que lo acompañan.
REFERENCIAS
CONCLUSIONES 1. Henríquez C, Romero S, Reyes R, Morales M, Cividanes M.

La combinación del tratamiento quirúrgico y ortodóncico Prognatismo. Rev Medica Honduras 1979;47:94-95.
2. Galluzzo M. Prognatismo Mandibular Severo. Salud Militar
ha hecho posible afrontar los problemas que presentan
2000;22:8-12.
una intensa deformidad facial imposibles de mejorar por
3. López-Davis A, Martin-Granizo R. Cirugía Oral y
medio de la terapéutica mecánica y el desplazamiento
Maxilofacial. España. Editorial Panamericana 2012;795-807.
dentario. La cirugía de las deformidades maxilofaciales
4. Munro Ir, Jackson Ii, Salyer K, Whitaker l. Atlas of
ha experimentado un desarrollo importante en las últimas Craniomaxillofacial surgery. Edit. Mosby Company. USA. 1982
décadas y el número de pacientes que se someten a este 5. Trauner R, Obwegeser H. Zur Operationstechnik Bei der
tipo de tratamientos ha sufrido un incremento Progenie und anderen Unterkieferanomalien. DtschZahnMund-
considerable. Los beneficios para ambas especialidades Kieferheilk 23 (1955-56) 1.
han sido notables e indican el camino que hay que seguir

46
Capítulo 9
TRATAMIENTO DE EXTRUSIÓN-INTRUSIÓN
DENTAL EN EL TRATAMIENTO
INTERDISCIPLINARIO: REPORTE DE DOS
CASOS.
José Rubén Herrera-Atoche,1 Resumen
Mauricio Escoffié-Ramírez,1 Introducción. A través de los movimientos de extrusión e intrusión, el ortodoncista posee la
Bertha Arelly Carrillo-Ávila,2 capacidad de erupcionar raíces de manera artificial y de corregir márgenes gingivales. En
Ludy Evangelina Novelo-Mendoza.3 un contexto interdisciplinario esta habilidad abre la posibilidad para el tratamiento de
problemas complejos como son fracturas dentales y la presencia de sonrisa gingival.
(1) Profesor-Investigador de la Presentación de los casos. El primer caso, describe el tratamiento de la fractura de un
Especialización en Ortodoncia y Ortopedia incisivo central superior. Para su resolución la paciente se sometió a tratamiento de
Dentomaxilofacial. Facultad de Odontología erupción forzada, con el cual se pudieron extruír 3 mm de raíz para su posterior
de la Universidad Autónoma de Yucatán. restauración. En el caso participaron cuatro disciplinas distintas y se explica de manera
Mérida, México. detallada su participación en el tratamiento. En el segundo caso se presenta una paciente
(2) Profesor-Investigador de la con desgaste y sobre-erupción severa de los incisivos centrales superiores. A consecuencia
Especialización en Periodoncia. Facultad de de lo anterior se exponía una sonrisa gingival de aproximadamente 4 mm. Para resolver el
Odontología de la Universidad Autónoma de caso se conjuntó la intrusión de los incisivos afectados, gingivoplastía y restauración con
Yucatán. Mérida, México.
carillas para devolver las proporciones adecuadas, así como la solución de la sonrisa
(3) Práctica privada. Egresada de la
Especialización en Ortodoncia y Ortopedia gingival. Conclusiones. La posibilidad de extruír o intruír ortodónticamente los dientes fue
Dentomaxilofacial. Facultad de Odontología clave para la resolución de manera exitosa en los casos. Es importante que cada
de la Universidad Autónoma de Yucatán. especialista conozca tratamientos diferentes al de su propia especialidad y el potencial de
Mérida, México. los mismos para aportar un beneficio mayor a los pacientes, ya que estos casos solo
pueden ser resueltos en un contexto interdisciplinario. Significancia clínica. Radica en la
comparación de dos movimientos verticales ortodónticos (extruír e intruír), abordando las
Correspondencia a: consideraciones clínicas para cada uno, y en un contexto interdisciplinario (hasta 4
Dr. Mauricio Escoffié-Ramírez especialidades para resolver un caso).
Email: escoffiemauricio@gmail.com
Cómo citar:
Herrera-Atoche JR, Escoffié-Ramírez M, Carrillo-Ávila BA, Novelo-Mendoza LE. Tratamiento
de extrusión-intrusión dental en el tratamiento interdisciplinario. reporte de dos casos. En:
Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en
Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 47-53. ISBN: 978-
607-8444-10-6

INTRODUCCIÓN realizarán la reabsorción del hueso alveolar adyacente, al


El movimiento dental ortodóntico es posible debido a mismo tiempo que, en los sitios de tensión de las fibras
complejos mecanismos celulares en el ligamento del ligamento periodontal, los osteoblastos inician
periodontal. La teoría de tensión-presión explica cómo, a procesos de aposición ósea como resultado de esta
través de estímulos provocados por las fuerzas estimulación.1 Este mecanismo permite la formación de
ortodónticas, en los sitios de presión del ligamento hueso nuevo y es el fundamento teórico de algunos
periodontal se induce la llegada de osteoclastos que tratamientos como la erupción forzada que se vale de

47
este principio para la solución de problemas dentales nivel de la cresta ósea y que el diente había sido
complejos tales como la corrección de defectos óseos y sometido en el pasado a tratamiento de conductos
fracturas dentales,2 al igual que la preparación de sitios (Figura 1).
para la colocación de implantes dentales.3
Así como los tejidos periodontales responden formando
hueso al ser extruidos, cuando son sometidos a fuerzas
intrusivas también sufren procesos de adaptación. Se ha
demostrado que al intruír un diente, los tejidos
periodontales se desplazan junto con el diente en su
misma dirección.4 Bellamy (2008) sugiere utilizar la
terapia de intrusión particularmente en dientes anteriores,
en casos en los que debido a sobre-erupción se deben
re-nivelar los márgenes gingivales para un resultado
estético.5 Figura 1. Registros iniciales. A) Fotografía frontal. B) Fotografía
oclusal. C) Radiografía periapical.
A continuación se presentan dos casos clínicos que
demuestran la aplicación clínica de ambos procesos y
Con la finalidad de tratar la fístula, así como de descartar
como la intervención de diversos especialistas es
defectos óseos o bolsas periodontales la paciente fue
importante en la resolución de los mismos.
referida al periodoncista para valoración y tratamiento.
Afortunadamente la fístula era de origen gingival y sin
PRESENTACIÓN DEL CASO
compromiso óseo, la paciente fue tratada
Caso clínico 1. Erupción forzada.
periodontalmente y de nuevo fue referida al ortodoncista.
Diagnóstico y plan de tratamiento.
Una vez analizadas las radiografías, modelos, e historia
El primer caso es la descripción de una paciente de 67
clínica se llegó a las siguientes opciones de tratamiento
años de edad que es referida al ortodoncista por parte
para el caso:
del odontólogo restaurador para realizar tratamiento de
1. Extracción de la raíz del central superior izquierdo y
erupción forzada. La paciente presentaba el incisivo
rehabilitar con un puente de coronas de porcelana.
central superior izquierdo con una fractura sub-gingival
2. Realizar un alargamiento de corona y rehabilitar el
que impedía la preparación protésica. Durante la
diente con una prótesis fija individual.
valoración clínica se observó la presencia de una fístula
3. Erupción forzada ortodóntica de la raíz,
en el diente afectado. Como parte de los estudios
gingivectomía, y rehabilitación con corona individual.
ortodónticos, se tomaron fotografías clínicas, radiografía
La primera opción suponía la pérdida de la raíz del
panorámica y lateral de cráneo, así como modelos de
central y la necesidad de cambiar las prótesis de los
estudio. Adicionalmente, se tomó una radiografía
dientes vecinos para poder usarlos como pilares de
periapical del diente fracturado donde se observó que la
puentes. En la segunda opción el alargamiento de corona
fractura se encontraba aproximadamente a 1 mm del
implicaría dejar los márgenes gingivales de los 2

48
centrales no coincidentes por varios milímetros, así como sonreír, el alargamiento de corona comprometería la
una relación corona-raíz comprometida. En la tercera relación corona-raíz debido a la cantidad de hueso a
opción la paciente conservaba la raíz del central, no remover en el procedimiento quirúrgico.
tendría que perder sus prótesis y estéticamente tendría 6. Pronóstico periodóntico y endodóntico: se sugiere
mejor resultado, sin embargo debería de cumplir con los que en caso de estar comprometida la salud de los
6 criterios que establece Kokich (2002) para que un tejidos de soporte o del tejido pulpar, es preferible no
diente sea candidato a erupción forzada,2 estos criterios realizar la erupción forzada. En este caso, no había
son: compromiso periodontal y desde el punto de vista
1. Longitud radicular: se debe calcular que al final de endodóntico, el central ya había pasado por tratamiento
la extrusión la relación corona-raíz sea uno a uno, si la de conductos. Sin embargo, debido a que había estado el
fractura está a nivel de la cresta ósea, lo mínimo conducto radicular durante un tiempo, se refirió al
necesario a extraer es de 4mm. En el presente caso la endodoncista para realizar de nuevo el tratamiento de
fractura estaba 1 mm por encima de la cresta ósea, por lo conductos. Con todo esto el diente cumplió con este
que 3 mm de extrusión serían suficientes y no criterio.
comprometería la relación corona-raíz. Se le explicó a la paciente los riesgos, limitaciones y
2. Forma radicular: la raíz debe ser ancha y su beneficios de cada plan de tratamiento. La paciente optó
conducto radicular no debe ser mayor a 1/3 del ancho por la tercera opción.
radicular. Una raíz delgada podría producir un resultado Descripción del tratamiento.
no estético. Un conducto muy ancho le restara Kokich (2002) recomienda que si la fractura se localiza a
resistencia a la restauración. En este caso, debido a la nivel de la cresta alveolar, se deben extruír mínimo 4 mm
edad de la paciente, el conducto radicular se encontraba 2.5 para el espesor biológico y 1.5 para la férula de la
dentro del parámetro establecido. restauración.2 Ya que la fractura se localizaba 1 mm
3. El nivel de la fractura: por regla general, si la coronal al nivel de la cresta alveolar, el rehabilitador
fractura se localiza a 3 mm o más por debajo del nivel de solicitó extruír únicamente 3 mm. El rehabilitador logró
la cresta ósea será muy difícil la colocación de un cementar un provisional de acrílico al cual se le adhirió
aparato para tracción. De nuevo, el central fracturado un bracket para realizar la tracción ortodóntica.
cumplía con este criterio. Se utilizó aparatología de Alexander en slot 0.018” Para
4. Importancia relativa del diente: en el caso de ser un cementar la aparatología fija en las coronas de porcelana
diente importante por función o estética. Dado que se que presentaba la paciente, se utilizó el Kit de la marca
trataba de un central superior su importancia en estética Realiance para cementado en porcelana. No se tomaron
y función justifican realizar el tratamiento. en cuenta las alturas convencionales sugeridas por el Dr.
5. Línea de sonrisa del paciente: si el paciente no Alexander del cementado de bracktes ya que no se
muestra el tejido gingival tal vez sea mejor realizar un requería ningún movimiento en los dientes vecinos, solo
alargamiento de corona o la extracción de la pieza. A servirían como anclaje. Los brackets se colocaron de tal
pesar de que la paciente no mostraba tejido gingival al manera que las ranuras coincidieran, de esta manera al

49
colocar el alambre ortodóntico no se producirían fuerzas extruido este sobrepasaba el de los dientes vecinos y
entre dientes. Se tomó de referencia el lateral izquierdo presentaba trauma de oclusión (Figura 4).
que fue colocado a 2.5mm del borde incisal. El bracket
de diente a extruír se colocó a una altura de 5 mm del
borde incisal, de esta manera, cuando el bracket del
diente a extruír se alineara con los vecinos, se tendría la
certeza de haber extruido 2.5 mm quedando solo 0.5 mm
por extruír (Figura 2).

Figura 3. Inicio de la tracción ortodóntica utilizando arcos 0.016 SS


como arco de anclaje y 0.012 NiTi sobrepuesto como arco activo.

Figura 2. Cementación de aparatología fija. A) Colocación de los Figura 4. Fotografías del proceso de tracción ortodóntica. A)
brackets de los dientes de anclaje a 2.5 mm. B) Colocación del Fotografía a 1 mes de iniciada la extrusión, se observa el sistema de
bracket en el incisivo a traccionar a 5 mm. C) Vista frontal con el arco arcos sobrepuestos. B) Arco 0.016 SS con un doblez incorporado para
0.014 SS incorporado en los brackets de anclaje. estabilizar el diente traccionado, se puede ver el desgaste del borde
incisal para nivelarlo con los vecinos así como evitar trauma de
oclusión.
Se inició con un arco 0.014” de acero inoxidable (SS) y al
mes siguiente se colocó un arco 0.016” de SS que En la siguiente cita se retomó el tratamiento de extrusión.
ejercería como anclaje para la tracción del central Para ello se colocó un arco 0.016 de SS con un doblez
fracturado. Se le dio cita un mes después y se dio inicio orientado hacia el borde incisal con el objetivo de evitar
al procedimiento de erupción forzada del central superior que dicho alambre interfiriera con la tracción del central.
izquierdo. Se colocó un arco 0.012” de níquel titanio (NT) De nuevo se utilizó un arco sobrepuesto de 0.012” de
sobrepuesto al alambre 0.016” de SS para iniciar la NiTi. En la cita subsecuente se llegó a la marca de
extrusión (Figura 3). 2.5mm, se desgasto una vez más el borde incisal para
Treinta días después de la primera activación, el diente evitar el trauma oclusal, y con el uso de un arco 0.014 SS
presentaba movilidad por lo que se colocó un arco 0.016” se buscó estabilizar el resultado durante un mes.
de SS con un doblez de intrusión que serviría como Posteriormente, y con el objetivo de conseguir los 3 mm
retención para mantener los resultados obtenidos a la que solicitados por el rehabilitador, se colocó un arco
vez de hacer funciones de férula. En esa misma cita, se 0.016” SS con un doblez de extrusión de 0.5 mm (Figura
desgasto el borde incisal del central ya que al haber sido 5).

50
Figura 5. Arco 0.016 SS con un doblez de extrusión de 0.5 mm Figura 6. Comparativo desde el inicio hasta la etapa de retención. A)
incorporado para obtener los 3 mm requeridos. Fotografía frontal inicial. B) Fotografía de la cita de cementación de
aparatología fija. C) Fotografía una vez obtenidos los 3 mm de extrusión,
se observa la discrepancia entre los márgenes gingivales de ambos
centrales. D) Fotografía posterior a la fibrotomía, gingivoplastía y
Kokich (2002) menciona que, según la velocidad de colocación del nuevo provisional, se inicia la etapa de retención.
extrusión, la terapia de erupción forzada puede ser
clasificada como rápida o lenta. En la erupción forzada
rápida el hueso alveolar es dejado atrás ya que no se
espera el tiempo suficiente para que las fibras del
ligamento periodontal estimulen la formación de tejido
óseo. Dada esta situación, el periodoncista debe realizar
una fibrotomía circunferencial para evitar que se forme
hueso nuevo y requerir un alargamiento de corona en el
futuro.2 En el presente caso, se realizó la fibrotomía
acompañada de una gingivoplastía para eliminar el tejido Figura 7. Comparativo de radiografías periapicales. A) Inicial. B) Final.

excedente y poder adaptar un nuevo provisional. Una vez


Finalmente, en la figura 7 se presenta un comparativo
cementado el provisional, al cual le fue adherido un
radiográfico del inicio y final del tratamiento, en donde se
bracket cuya ranura estuviera alineada con la de los
puede comprobar el desplazamiento de la raíz del diente
vecinos, todo esto con el fin de poder colocar un arco
fracturado.
0.016” SS e iniciar los 6 meses de retención que son
recomendables para evitar la recidiva.
Caso clínico 2. Intrusión de incisivos.
En la figura 6 se puede observar la secuencia de
Diagnóstico y plan de tratamiento.
extrusión, así mismo, se puede ver como el tejido gingival
En el segundo caso, se presentó a consulta con el
fue siguiendo la erupción forzada de la raíz y finalmente
ortodoncista una paciente de 32 años de edad cuya
como se iguala la longitud de coronal de ambos centrales
queja principal era su preocupación por el desgaste
una vez realizados los procedimientos periodontal y
excesivo de sus dientes anteriores. La paciente comentó
restaurativo antes descritos.
que había sido sometida a tratamiento de ortodoncia con

51
extracciones de premolares en el pasado. Al examen Con este análisis se presentó a la paciente el siguiente
clínico se observó un desgate importante de los centrales plan de tratamiento: realizar la intrusión de los incisivos
superiores así como de todos los incisivos y ambos centrales superiores así como de todos los inferiores con
caninos inferiores. El desgaste había dejado como el objetivo de abrir la mordida, corregir la forma de los
consecuencia que los centrales superiores presentaran dientes y la sonrisa gingival. Frecuentemente, cuando
forma cuadrada, los cuatro incisivos inferiores habían son muchos milímetros los requeridos para el tratamiento
perdido al menos un tercio de su longitud y los caninos de intrusión, este se acompaña de un procedimiento de
no tenían cúspides. La paciente presentaba también gingivoplastía adicional. Esto es debido a que durante el
mordida profunda y sonrisa gingival (figura 8). la intrusión el tejido gingival se desplaza un 20% menos
que el diente tratado,4 a pesar de esto, se le comentó a la
paciente que la necesidad de realizar la gingivoplastía se
definiría posteriormente. Una vez concluido lo anterior, la
paciente tendría que someterse a un tratamiento
restaurativo para devolverle la proporción adecuada a
todos los dientes intruídos. Dado que por cuestiones
económicas la paciente optó por realizar solo la intrusión
de los 2 centrales superiores, la mordida profunda no
podría ser resuelta. La paciente aceptó los términos del
Figura 8. Fotografías iniciales. A) Sonrisa. B) Vista frontal intraoral. C)
Vista oclusal inferior. tratamiento y se dio inicio al mismo.
Descripción del tratamiento.
Al ser cuestionada sobre sus hábitos de bruxismo, la El tratamiento inició con la cementación de aparatología
paciente explicó que su esposo había referido escucharla fija Alexander de ranura 0.018. Durante 8 meses se
rechinar sus dientes durante la noche. Se solicitaron realizó la etapa de alineación y nivelación de las ranuras
radiografías panorámica y lateral de cráneo, y se tomaron hasta llegar a un alambre 0.016 por 0.016 de SS. En este
fotografías clínicas así como modelos de estudio. alambre se inició la intrusión de los 2 centrales
El análisis cefalométrico arrojó un biotipo braquifacial, superiores a través de la incorporación paulatina de
con incisivos retroinclinados, lo que es consistente con la dobleces al arco. Durante un período de 5 meses se
presencia de la mordida profunda. En el análisis de los realizó la intrusión hasta lograr llevar la unión cemento-
registros se determinó que los incisivos desgastados se esmalte de los centrales al mismo nivel que el de los
habían sobre-erupcionado, lo que en consecuencia caninos. Una vez alcanzado el objetivo la paciente fue
provocó que en la arcada superior el tejido gingival referida al rehabilitador para su valoración. Ya que la
migrara hacia oclusal exponiendo una sonrisa gingival paciente presentaba bolsas falsas a consecuencia del
muy marcada; por otro lado, en la arcada inferior, la tratamiento de intrusión y con el fin de obtener una mejor
sobre-erupción de los dientes contribuyó a la proporción de anchura-longitud de sus coronas clínicas,
profundización de la mordida. el rehabilitador le explicó a la paciente que sí requeriría el

52
procedimiento de gingivoplastía. En la figura 9 se problemas complejos como son las fracturas dentales y
presenta una fotografía posterior a la gingivoplastía y se los dientes sobre-erupcionados. La capacidad de
puede observar la cantidad de intrusión lograda. formación ósea y de nivelación de márgenes gingivales
amplían las posibilidades de tratamiento en un contexto
interdisciplinario en el que cada especialista puede
aportar una habilidad diferente para el beneficio de los
pacientes.

REFERENCIAS
1. Krishnan V, Davidovitch Z. Cellular, molecular, and tissue-
level reactions to orthodontic force. Am J Orthod Dentofacial

Figura 9. Fotografía tomada posterior a la intrusión de los centrales Orthop 2006;129(4):469.e1-469.32.


superiores y al procedimiento de gingivoplastía. Se observa también la 2. Kokich V. The role of orthodontics as an adjunct to
cantidad de desgaste de los incisivos y caninos inferiores.
periodontal therapy. J Clin Periodontol 2002;9:704-718.

Después de un período de 6 meses de retención los 3. Korayem M, Flores-Mir C, Nassar U, Olfert K. Implant site
development by orthodontic extrusion. A systematic review.
brackets fueron eliminados y se realizó la restauración de
Angle Orthod 2008;78(4):752-760.
los centrales con carillas. En la figura 10 se puede ver
4. Erkan M, Pikdoken L, Usumez S. Gingival response to
como se eliminó la sonrisa gingival y el resultado final.
mandibular incisor intrusion. Am J Orthod Dentofacial Orthop
2007;132(2):143.e9-143.13.
5. Bellamy LJ, Kokich VG, Weissman JA. Using orthodontic
intrusion of abraded incisors to facilitate restoration: the
technique's effects on alveolar bone level and root length. J Am
Dent Assoc 2008;139(6):725-733.
Figura 10. Fotografías de comparación de sonrisa. A) Inicial. B) Final.

CONCLUSIONES
Los procedimientos de extrusión e intrusión ortodóntica
son un auxiliar importante para el tratamiento de

53
Capítulo 10
TRATAMIENTO ORTODÓNCICO-QUIRÚRGICO
DE UNA LATEROGNASIA: REPORTE DE UN
CASO.
Edith Lara-Carrillo,1 Resumen
Toshio Kubodera-Ito,2 Introducción: en el tratamiento correctivo de las deformidades dentofaciales como es el
Ana María Muñoz-Saracho,3 caso de la laterognasia, generalmente es necesario un manejo multidisciplinario. Una pobre
Saraí López-González,4 estética facial es la principal queja en estos pacientes, que a menudo se acompaña de
problemas funcionales, desórdenes temporomandibulares y desventajas psicosociales por
Brenda Valdez-Vargas.4
la asimetría facial que presenta. Presentación del caso: paciente de sexo femenino de 15
años de edad, que acude a tratamiento de ortodoncia por anquilosis mandibular ocasionada
(1) Profesor-Investigador. Coordinadora de la
Maestría en Ciencias Odontológicas. por una caída desde una tabla en la pared a los 3 años de edad. Se presenta la preparación
Facultad de Odontología de la Universidad ortodóncica prequirúrgica, el proceso quirúrgico a través una fractura LeFort I, mentoplastía
Autónoma del Estado de México. Toluca, y avance mandibular y por último el detallado ortodóncico postquirúrgico. Conclusiones:
México. existen diversos métodos quirúrgicos para corregir una laterognasia, el mejor tratamiento
(2) Profesor-Investigador. Coordinador de la dependerá de cada paciente. Ya que influyen factores como la edad, situación económica y
Especialidad en Ortodoncia. Facultad de la severidad de ésta. Es importante establecer un adecuado tratamiento ortodóntico, a
Odontología de la Universidad Autónoma del edades tempranas con la finalidad de tener un mejor pronóstico. Significancia clínica:
Estado de México. Toluca, México. proporcionar información sobre el manejo ortodóncico-quirúrgico de una laterognasia
(3) Estudiante de la Especialidad en
mandibular.
Ortodoncia. Facultad de Odontología de la
Universidad Autónoma del Estado de México.
Toluca, México. Cómo citar:
(4) Profesor-Investigador de la Especialidad Lara-Carrillo E, Kubodera-Ito T, Muñoz-Saracho AM, López-González S, Valdez-Vargas B.
en Ortodoncia. Facultad de Odontología de la Tratamiento ortodóncico-quirúrgico de una laterognasia: reporte de un caso. En: Medina-
Universidad Autónoma del Estado de México. Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en
Toluca, México. Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 54-60. ISBN: 978-
607-8444-10-6
Correspondencia a:
Dra. Edith Lara-Carrillo
Email: laracaedith@hotmail.com

INTRODUCCIÓN dientes posteriores; que también desarrolla asimetría en


Sabemos que el ser humano desde su formación la actividad muscular masticatoria, generalmente con
embrionaria es propenso a sufrir alteraciones mayor actividad postural de los músculos temporal
craneofaciales por causas internas o externas. Una de posterior, sugiriendo una asimetría postural.1-3
estas alteraciones es la laterognasia. El objetivo del tratamiento es la mejora de la función
Se entiende por laterognasia al desplazamiento del masticatoria, estética y del habla, lo que produce muchas
centro del maxilar inferior que ocasiona una desviación de las veces en estos pacientes deterioro en su
permanente de la mandíbula, cuya morfología se halla autoestima debido a su apariencia. El tratamiento de la
alterada tanto en cóndilo, rama, cuerpo y región laterognasia va a depender de la edad del paciente y de
dentoalveolar, con mordida cruzada de uno o varios la severidad del problema.2

54
La técnica de distracción o elongación ósea progresiva Paciente femenino de 15 años de edad que solicita
permite hoy día la creación de hueso nuevo en el área consulta para tratamiento de ortodoncia por falta de
maxilofacial en edades muy tempranas. La distracción crecimiento mandibular (anquilosis), ocasionada por una
osteogénica se ha convertido en un acierto del caída desde una tabla en la pared a los 3 años de edad.
procedimiento en la ortopedia y se ha aplicado para tratar Fue intervenida quirúrgicamente a los 8 años,
deformidades óseas y graves defectos en el complejo colocándole un injerto condrocostal; a los 12 años, volvió
craneofacial. Con este procedimiento el volumen de a presentar desviación mandibular, tres años después
hueso puede aumentarse por tracción gradual de un callo acude con su odontólogo quien la canaliza para
de fractura formado entre los segmentos óseos tratamiento ortodóntico-quirúrgico.
osteotomizados.4 A la inspección física se observa desviación mandibular
La osteotomía sagital bilateral de rama mandibular hacia el lado izquierdo, lo que conlleva a una asimetría
(OSBRM) representa la técnica más utilizada en cirugía sobre todo de los tercios inferior y medio facial, con
ortognática, que consiste en un abordaje subperióstico incompetencia labial al cierre, mostrando la comisura
del borde anterior de la rama y del trígono retromolar labial izquierda por arriba de la derecha e hipertonicidad
posteriormente, para restringir a lo estrictamente del mentón.
necesario el despegamiento de la cara interna de la rama Al sonreír se puede notar la desviación de la línea media
mandibular. La fijación interna rígida ha sido un aporte dental hacia la derecha con respecto a su línea media
extraordinario para la OSBRM, cada vez más la literatura facial, con el plano oclusal inclinado mostrando su parte
y autores de la técnica abandonan el uso de alambres a más baja en el lado derecho.
favor de fijación interna rígida con la utilización de placas Su perfil facial es completamente convexo por falta de
y tornillos mono corticales o el uso de tornillos desarrollo del mentón y un mayor desarrollo anterior del
bicorticales.5 maxilar superior (Figura1).
Sin embargo, la alteración mandibular también afecta el
crecimiento del maxilar superior por lo que el tratamiento
quirúrgico puede incluir una reposición del plano oclusal,
generalmente inclinado por el desarrollo mandibular
unilateral, y la intrusión del mismo.
El presente caso clínico muestra la preparación
Figura1. Fotografías extraorales: a) Plano frontal de la cara, b) Plano
ortodóncica prequirúrgica, el proceso quirúrgico a través frontal de la cara con sonrisa, c) Perfil facial.
una fractura LeFort I, mentoplastía y avance mandibular,
y por último el detallado ortodóncico postquirúrgico, de Diagnóstico dental

una paciente con laterognasia mandibular. Intraoralmente demuestra un overbite de 3mm y overjet
de 10mm (Figura 2 a y b). La forma de los arcos dentales

PRESENTACIÓN DEL CASO es oval, con dentición permanente hasta los segundos
molares; los incisivos superiores en mesioversión,

55
espacios interdentarios en la arcada superior del lado 26, la formación de los gérmenes de los terceros molares
derecho; mientras que en la arcada inferior se observa el superiores con una posición vertical y los inferiores
primer molar izquierdo en posición lingualizada y ligero mesioangulares (Figura 3).
apiñamiento del mismo lado (Figura 2 c y d), mordida
cruzada posterior de los órganos 25,26 con el 35, con
relación molar clase II de Angle (Figura 2 e y f).

Figura 3. Ortopantomografía de diagnóstico.

Diagnóstico Cefalométrico
El análisis cefalométrico se basó en los parámetros
establecidos para población mexicana propuestos por el
Dr. Kubodera.6 Se determinó una longitud de base del
cráneo disminuida; longitud posterior del maxilar de
menor tamaño; y la altura anterior y posterior del arco
dentario superior indicó extrusión. Mientras que la
longitud total de la mandibula con menor tamaño y la
Figura 2. Fotografías intraorales: a) Máxima intercuspidación, b) Perfil
dental, c) Arcada superior, d) Arcada inferior, e) Lateral derecha, f) altura anterior del arco dental inferior con extrusión
Lateral izquierda.
(Figura 4).

Fue importante hacerle notar a la paciente la presencia


de gingivitis y placa dentobacteriana, así como lesiones
cariosas en algunas piezas; por lo que tuvo que cuidarse
su adecuada higiene bucal antes del inicio del
tratamiento ortodóntico.
Diagnóstico radiográfico
En la radiografía panorámica destaca la falta de Figura 4. a) Cefalometría lateral de cráneo, b) Análisis cefalométrico
lineal.
formación del cóndilo mandibular del lado izquierdo, así
como dos tornillos a nivel del ángulo gonial como fijación En el diagnóstico cefalométrico angular se encontraron
del injerto condrocostal, precisamente ese borde los siguientes resultados: un perfil facial convexo, por la
mandibular se denota muy delgado cercano a los ápices mandibula y mentón retruidos; relación esqueletal clase
radiculares del segundo molar inferior. Dentalmente, se II, con aumento en la altura facial anterior de la cara en
marca una amplia cavidad cariosa en el órgano dentario

56
sentido vertical (high mandibular). Dentalmente se técnica Edgewise estándar slot 0.018 y arcos NiTi calibre
muestra rotación descendente del plano oclusal y 0.014 in. para la alineación y nivelación (Figura 6).
proinclinación tanto de los dientes anteriores superiores Una vez terminada la nivelación se utilizaron arcos de
como inferiores, lo que disminuye el ángulo interincisal. calibre 0.016 x 0.022 in. para la retracción de caninos con
(Figura 5). cadena elástica (Figura 7).

Figura 7. Fotografías intraorales durante la retracción de caninos con


cadena elástica, a) Lateral derecha, b) Oclusal superior c) Lateral
Figura 5. Análisis cefalométrico angular. izquierda.

Plan de tratamiento Después de la retracción de caninos se colocaron bull


1era fase: tratamiento ortodóncico-prequirúrgico, como loops de cierre para el segmento anterior en calibre 0.017
primer paso se realizó la extracción del primer molar x 0.025 in. (Figura 8).
superior izquierdo por la gran destrucción oclusal que
presentaba, y las extracciones de primeros premolares
superiores y segundos premolares inferiores, para
mejorar el perfil estético de la paciente.
Figura 8. Retracción del segmento anterior, a) En arcada inferior, b)
En arcada superior

Figura 9. Fotografías intraorales con el arco pre-quirúrgico y ganchos


Figura 6. a) High pull con soporte cervical, b, c, d) Fotografías crimpables a) Frontal intraoral, b) Lateral derecha, c) Lateral izquierda.
intraorales de las extracciones y nivelación.

Una vez concluido el cierre de espacios, se preparó a la


Se colocaron bandas con tubo triple en los órganos
paciente para ser intervenida quirúrgicamente, mediante
dentarios 17, 16, 27, 36, 37, 46, 47 para colocar un high
la colocación de un arco calibre 0.017 x 0.025 in. con
pull con soporte cervical como sistema de anclaje y
rotación mandibular; además de colocar brackets para

57
ganchos crimpables (Ribbed Crimpable Hook 226-040. Como tercer paso se realizó una osteotomía sagital de
TP Ortodontics, La Porte Indiana US) (Figura 9). avance mandibular (Figura 11 e), utilizándose
Para la predicción quirúrgica y la realización de una guía minitornillos para fijar el hueso, ferulizando con ligadura
oclusal, se articularon los modelos de estudio para que de alambre sobre los ganchos crimpables posicionados
el cirujano maxilofacial pudiera evaluar las necesidades en el arco (Figura 11 f).
de la paciente (Figura 10). Minutos después de la cirugía se le colocó una
mentonera de yeso con el fin de proteger y mantener la
nueva posición del mentón.
3ª fase: Tratamiento ortodóncico postquirúrgico, un poco
más de tres meses posteriores a la cirugía, la paciente
acudió para continuar con el detallado del tratamiento
ortodóntico. Dos meses después, se concluyó éste y se
Figura 10. a) Articulado prequirúrgico, b) Guía oclusal.
procedió al retiro de la aparatología fija, colocándole
2da fase: Tratamiento quirúrgico, se realizó una cirugía retenedores fijos, es importante mencionar que no se
LeFort I bajo intubación nasotraqueal, y anestesia pudieron tomar radiografías postratamiento pues la
general inducida, con una incisión circunvestibular, de paciente se encontraba embarazada (Figura 12 y 13).
primer molar superior a primer molar de lado opuesto.
(Figura 11a).
Un vez efectuada la disyunción pterigoidea maxilar, se
colocó la guía oclusal con el fin de llevar el maxilar a la
posición deseada (Figura 11b), fijándolo con miniplacas y
minitornillos, ferulizándose con ligadura metálica sobre
Figura 12. Fotografías extraorales después del tratamiento
los ganchos crimpables (Figura 11c) ortodóncico quirúrgico.

Posteriormente se procedió a la exposición del mentón


(Figura 11d) para mejorar la proyección del mismo,
fijándose con mini placas de titanio.

Figura 11. a) Incisión circunvestibular y colocación de la guía oclusal,


b) Fijación del maxilar con miniplacas y minitornillos, c) Ferulizado y
Figura 13. Fotografías intraorales al retiro de la aparatología fija
sutura del maxilar, d) Exposición y fijación del mentón, e) Incisión y
ortodóntica.
exposición del hueso mandibular, f) Fijación del hueso con
minitornillos de titanio.

58
Acudió a su cita mensual de revisión y mostró el convencionales aplicables únicamente al finalizar el
retenedor fijo inferior parcialmente despegado, se le tomó crecimiento. 4
impresión y se elaboró un retenedor removible inferior. El tratamiento durante la infancia también consigue una
Citas después la paciente acudió refiriendo haber perdido buena integración del paciente con su entorno escolar y
el retenedor inferior, por lo que se le colocó otro social. Si a esta paciente se le hubiera realizado una
nuevamente con striping anteroinferior. La última revisión distracción ósea en lugar de un implante costal
fue 19 meses al término del tratamiento ortodóntico posiblemente se podrían haber evitado las demás
mostrando estabilidad dental. intervenciones quirúrgicas, desafortunadamente este
El consentimiento informado se obtuvo de la paciente procedimiento es relativamente nuevo y en el momento
para la publicación del presente caso al igual que las del implante costal, éste era la mejor opción, ya que en
imágenes que acompañan. teoría los injertos óseos son los únicos que tienen la
peculiaridad de inducir de manera natural el proceso de
DISCUSIÓN regeneración mediante osteogénesis, osteoinducción y
La asimetría facial secundaria a la hiperplasia condilar no osteoconducción.4
sólo es un problema estético ya que puede tener La mentoplastía de aumento es un procedimiento
alteraciones funcionales tales como dolor y limitación a la importante en cirugía plástica facial, a través de la
apertura oral, el crecimiento de la cabeza condilar causa historia se han usado materiales tanto autógenos como
desplazamiento hacia abajo y hacia adelante del cuerpo aloplásticos para alcanzar su armonía El mentón
mandibular provocando discrepancia vertical maxilar del proporciona un balance y equilibrio facial con una forma y
plano oclusal, mordida cruzada y además interferencias tamaño adecuados, e incluso llega a determinar aspectos
en los movimientos de la ATM, en ocasiones dolor por la emocionales y psicosociales del sujeto por su forma
compresión y desplazamiento de estructuras periféricas. “fuerte” o “débil”.8
Desde el punto de vista psicológico, las deformidades Sin embargo, los implantes aloplásticos llevan consigo el
dentofaciales tienen mucho que ver con la aceptabilidad riesgo de resorción ósea, infección, extrusión y
social del individuo que se ve afectado por los siguientes desplazamiento. Debido a las particularidades de este
factores: características raciales, nivel sociocultural y caso la combinación del tratamiento ortodóncico y
ocupación; por lo que, dos terceras partes de los quirúrgico fue la mejor opción.
pacientes con este tipo de problema admiten querer Kiyak y cols. 9 evaluaron los cambios psicológicos en un
cambiar su apariencia facial por razones estéticas y el grupo de 74 pacientes, 24 meses después de ser
resto alude a dolor y disfunción de la articulación intervenidos quirúrgicamente, es necesario resaltar que
temporomandibular como la única razón para hacerlo.7 al igual que otros estudios los pacientes obtienen un
La creación de hueso nuevo en el área maxilofacial es elevado grado de satisfacción y mejora psicológica a
actualmente posible gracias a la técnica de distracción o pesar de cursar con problemas postoperatorios.
elongación ósea progresiva, es posible aplicarla durante Cabe mencionar que la paciente del caso presentado
la infancia, al contrario de los tratamientos obtuvo un alto grado de satisfacción al ver su nueva

59
apariencia física facial, lo que notablemente mejoró su 3. Pinto AS, Buschang PH, Throckmorton GS, Chen P.

desenvolvimiento psicosocial. Morphological and positional asymmetries of young children


with functional unilateral posterior crossbite. Am J Orthod
Dentofacial Orthop 2001;120:513- 20.
CONCLUSIONES
4. Dolanmaz D, Ihya KA, Gurcan GH, Kalayci A, Kucukkolbasi
Existen diversos métodos quirúrgicos para corregir una
H, Usumez S. Correction of mandibular retrognathia and
laterognasia, el mejor tratamiento dependerá de cada
laterognathia by distraction osteogenesis: follow up of 5 cases.
paciente. Ya que influyen factores como la edad,
Eur J Dent 2009;3;335-42.
situación económica y la severidad de ésta. 5. Quevedo RLA. Osteotomía sagital de rama mandibular en
Es importante establecer un adecuado tratamiento cirugía ortognática. Rev Esp Cirug Oral y Maxilofac
ortodóntico, a edades tempranas con la finalidad de 2004;26:14-21.
tener un mejor pronóstico. 6. Kubodera IT. Morphometric study on craniofacial structures
La laterognasia produce asimetría facial que conlleva a of central Mexican adolescents by using cephalometric

una serie de problemas como estéticos, funcionales, analysis. Meikai Univ Dent J 1992;21:125-44.
7. Khadka A, Hu J. Autogenous grafts for condylar
sociales y emocionales, entre otros. Al realizar el plan de
reconstruction in treatment of TMJ ankylosis: current concepts
tratamiento es necesario contemplar la resolución de la
and considerations for the future. Int J Oral Maxillofac Surg
mayoría de éstos.
2012;41:94-102.
8. Lee EI. Aesthetic alteration of the chin. Semin Plast Surg
REFERENCIAS
2013; 27:155-60.
1. Juri J. Conceptos de Belleza. En: Coiffman F. (ed) Texto de
9. Kiyak HA, Hohl T, West RA, McNeill RW. Psychologic
Cirugía plástica, reconstructiva y estética. España: Salvat;
changes in orthognathic surgery patients: a 24-month follow up.
1986:28-29.
J OralMaxillofac Surg 1984;42:506-12.
2. Costales LLM, Guzmán VI. Prognatismo y laterognasia
severos, hiperplasia condilar con marcada asimetría facial. Rev
Mex Ortod 2014; 2:136-42.

60
Capítulo 11
TRATAMIENTO MULTIDISCIPLINARIO
PERIODONTAL Y ORTODÓNTICO: REPORTE
DE UN CASO.
Mirna Isabel Minaya-Sánchez,1 Resumen
Juan Fernando Casanova-Rosado,1 Introducción: El propósito de este reporte es describir el tratamiento interdisciplinario
Ana Alicia Vallejos Sánchez,1 realizado en una paciente con periodontitis crónica del adulto con tratamiento ortodóntico.
José Luis Robles Minaya,2 La enfermedad periodontal se caracteriza por una alteración de color, forma, consistencia y
volumen de margen gingival, adaptación al cuello del diente, presentando hemorragia y
Martha Mendoza-Rodríguez.3
exudado. La periodontitis es la progresión de la inflamación gingival a la cresta ósea
alveolar y pérdida ósea que lleva a bolsas periodontales y movilidad dentaria. Un
(1) Profesor-Investigador. Facultad de
tratamiento ortodóntico mal ejecutado en pacientes con problemas periodontales puede
Odontología de la Universidad Autónoma de
Campeche. Campeche, México. contribuir a una mayor destrucción del tejido periodontal y la pérdida del diente. En
(2) Estudiante de la Especialidad en particular, la combinación de inflamación, fuerzas ortodónticas y trauma por oclusión puede
Rehabilitación Bucal. Universidad del Mayab. producir una destrucción más rápida que la que puede ocurrir únicamente con la
Mérida, México. inflamación. Presentación del caso: Se reporta caso clínico de una paciente femenina de
(3) Profesor-Investigador. Área Académica de 54 años de edad sin antecedentes patológicos de importancia, al diagnóstico cínico
odontología del Instituto de Ciencias de la presenta vestibularización y movilidad de los incisivos central y lateral y canino superiores
Salud de la Universidad Autónoma del derechos, inflamación, sangrado y supuración; al radiográfico y sondeo periodontal se
Estado de Hidalgo. Pachuca, México. observó pérdida ósea. El tratamiento consistió en realizar Fase I o higiénica, ejecución del
tratamiento de ortodoncia y posteriormente se llevó a cabo la cirugía periodontal.
Conclusión: Es importante la cooperación interdisciplinaria entre especialistas en
Correspondencia a: periodoncia y ortodoncia, siendo necesario realizar un diagnóstico certero sobre los factores
Dra. Mirna I. Minaya-Sánchez. etiológicos involucrados, estableciendo una plan de tratamiento adecuado y manejo clínico
Email: miminaya@hotmail.com según el caso, para garantizar la salud bucal del paciente. Significancia Clínica: El
abordaje multidisciplinario en casos ortodónticos con periodonto reducido permite devolver
de manera correcta la estética y función de todos los dientes a tratar.

Cómo citar:
Minaya-Sánchez MI, Casanova-Rosado JF, Vallejos-Sánchez AA, Robles-Minaya JL,
Mendoza-Rodríguez M. Tratamiento multidisciplinario periodontal y ortodóntico. reporte de
un caso. En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos
clínicos en Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 61-64.
ISBN: 978-607-8444-10-6

INTRODUCCIÓN o con migración, en personas con sonrisas y dentaduras


Actualmente, el tratamiento ortodóntico en adultos con estéticas aceptables.1
problemas periodontales se realiza en conjunto por La única contraindicación para el tratamiento ortodóntico
equipos de periodoncistas y ortodoncistas. La en pacientes con enfermedad periodontal, es la
cooperación interdisciplinaria cuidadosa de ambas persistencia de una enfermedad activa a pesar de los
disciplinas puede transformar a pacientes con procedimientos adecuados. Los movimientos dentales en
denticiones en mal estado de salud , dientes espaciados una encía inflamada, exacerban el problema periodontal.2

61
PRESENTACIÓN DEL CASO sobre la patología presente, aplicar técnica de cepillado,
Se reporta el caso clínico de una paciente adulta, de 54 uso de enjuague bucal e hilo dental, raspado y alisado
años de edad, sexo femenino, quién asiste a consulta, radicular, profilaxis y Pulido. Medicación de Amoxicilina
sin diagnóstico presuntivo, con motivo de consulta: 500 mg y Metronidazol 500 mg. Se inició con la terapia
"sangrado provocado al cepillado, dolor al comer y periodontal utilizando técnicas no quirúrgicas. Una vez
movilidad dentaria". En su historial clínico presentó controlada la inflamación, se continuo con el tratamiento
valores normales en los exámenes de laboratorio. ortodóntico utilizando aparatología fija empleando la
Antecedentes médicos-odontológicos: paciente técnica de Roth (arco recto), alineando el incisivo
sistémicamente aparentemente sano, ha recibido lateral. En todo momento se utilizaron fuerzas
tratamiento odontológico de operatoria, exodoncias, extremadamente ligeras (Figura 2).
tartrectomía. Visita al odontólogo en caso de urgencia. Al
examen físico: sin lesión aparente. Al examen intrabucal:
encía color rojo violácea marginal y papilar generalizada,
consistencia blanda y desprendimiento marginal y papilar
generalizada, disminución del puntillado generalizado,
migración hacia apical marginal y papilar generalizada;
exudado hemorrágico generalizado provocado al sondeo,
exudado purulento a nivel de 11, 12 y 13, cálculo dental
supragingival y subgingival moderado, presencia de
materia alba. Mostraba pérdida de soporte con Figura 2.Tratamiento ortodóntico con Técnica de Roth, con empleo de
fuerzas muy ligeras.
inflamación gingival y el migración del órgano dentario
12. Presentaba bolsas mayores de 6 mm, Una vez completado el tratamiento ortodóntico se logró la
vestibularizado y movilidad de grado dos en los dientes posición adecuado del diente. El tratamiento se completó
11,12 y 13 (Figura 1). con cirugía periodontal con el objeto de corregir la
pérdida ósea (Figura 3).

Figura 1. Foto inicial del paciente

Diagnóstico: Periodontis crónica generalizada severa.


Plan de Tratamiento: Educación y motivación al paciente Figura 3. Pérdida ósea y los dientes ya en posición.

62
El tratamiento combinado permitió corregir los problemas condición periodontal empeore sin corrección
que tenía la paciente, mejorando el estado de salud ortodóntica.2
bucal. El tiempo total de tratamiento fue de dos años con Es prioritario que el paciente se involucre en el
controles y soporte periodontal cada tres meses (Figura tratamiento ya que va a influir de forma crítica en la
4). evolución de su enfermedad y en el planteamiento,
aunque su grado de colaboración y capacidad en el
control de la higiene oral por el paciente sólo se podrá
valorar a lo largo del tratamiento, en este caso la
paciente fue motivada y se mantuvo un alto grado de
colaboración en el control de placa ya que la enfermedad
periodontal era avanzada. Uno de los requisitos más
importantes para iniciar el tratamiento ortodóncico en un
Figura 4. Final del tratamiento interdisciplinario, imagen posterior a la
cirugía periodontal. Dientes posicionados, periodonto sano y paciente, periodontalmente tratado son: motivación del
recuperación de papila dentaria
paciente, enfermedad periodontal controlada y buena
comunicación entre especialistas, en este caso se
El consentimiento informado se obtuvo de la paciente
cumplió con estos requisitos.
para la publicación del presente caso al igual que las
Se debe esperar aproximadamente de 4 a 6 meses, para
imágenes que acompañan.
iniciar los movimientos ortodónticos en pacientes que han
recibido terapia periodontal extensa; que implica un
DISCUSIÓN
tiempo prudencial para los procedimientos de
La Periodontitis Crónica está caracterizada por: mayor
regeneración y recuperación de las estructuras
prevalencia en adultos a comparación con niños y
periodontales. De manera periódica, durante el
adolescentes, el progreso de la enfermedad es lenta con
tratamiento de ortodoncia, el periodoncista debe observar
periodos de exacerbación y remisión de la destrucción de
la condición de los tejidos, eliminar todos los irritantes y
los tejidos periodontales relacionada con la presencia de
reforzar la higiene bucal del paciente según sea
factores locales, el cálculo subgingival es un hallazgo
necesario, estos exámenes por lo regular se conducen
frecuente, puede ser clasificada en base a la extensión y
cada 8 a 12 semanas.2
la severidad, que en este caso es una periodontitis
La toma de decisión del momento adecuado para optar
crónica generalizada severa.3
por una solución quirúrgica de los problemas
En ocasiones, se requieren procedimientos ortodónticos
periodontales no debe ser apresurada. Es importante
durante el tratamiento periodontal para cambiar la
tener en cuenta, además que el diagnóstico correcto de
posición de los dientes. La recomendación de seguir una
la enfermedad periodontal, la aplicabilidad de un
corrección ortodóntica depende de la gravedad del
tratamiento no quirúrgico como es el raspado y alisado
problema periodontal, Es posible mejorar con ortodoncia
radicular, donde podemos obtener buen control de la
el nivel del hueso remanente, y también es posible que la

63
enfermedad y advertir al paciente la posibilidad de usar 1. Lindhe J, Lang N, Karring T. Periodontología Clínica e

algunos métodos quirúrgicos al finalizar la ortodoncia.7 Implantología Odontológica. Buenos Aires: Médica

Desde el inicio del tratamiento ortodóntico, la relación Panamericana 2005.


2. Carranza F, Newman M, Cervera Pacheco C, Ramos
estrecha con el periodoncista es necesaria para
Tercero J. Periodontología Clínica. México: McGraw-Hill
establecer un programa de mantenimiento periodontal
interamericana; 1998. 8ª. Edición. Pag. 600
eficaz que se ajuste a las necesidades individuales de
3. [No authors listed]. The American Academy of
cada caso, y asegurar un mínimo daño a los tejidos
Periodontology . Annais Vol. 4 International Workshop for A
durante la terapéutica ortodóncica.10 Estas dos entidades, Classification of Periodontal Disease and condition. 1999;4(1).
tienen en común el manejo integral del paciente, 4. Axelsson P, Lindhe J. The significance of maintenance care
relacionando problemas oclusales y gingivales. Con in the Treatment of periodontal Disease. J Clin Periodontol
mucha frecuencia es indispensable realizar correcciones 1981;8:281.
ortodónticas en pacientes adolescentes y adultos que 5. Bishara SE. Book of Orthodontics. Capítulo 24. Periodontal

han recibido tratamiento periodontal, con el propósito de considerations during orthodontic treatment. Iowa; Saunders
Company: 2000. 442-451.
colocar las estructuras periodontales de los dientes en
6. Romero AI. Condiciones gingivales y mucogingivales
mejores condiciones de salud.6,11
relacionados con el tratamiento ortodoncico. Maracaibo -
Después de terminada la terapia ortodóncica, el paciente
Venezuela. Universidad del Zulia. Facultad de Odontología.
debería permanecer en un programa de mantenimiento
División de Estudios para Graduados. 2003.
periodontal cada 3 meses.8,9 Pero pueden incrementar su 7. Mathews DP, Kokich VG. Manejo del tratamiento del
frecuencia cada 1 o 2 meses, si persiste una pobre paciente ortodóncico con problemas periodontales. Semen
remoción de placa bacteriana o bolsas periodontales Orthos 1997;3:21-38.
profundas.9 8. Alàndez F, Herrera JI, Zabalegui I, Carasal M. Importancia
de la relación entre periodoncia y ortodoncia. Parte I. Prof

CONCLUSIONES Dental 1998;1:35-42.


9. Melsen B, Agerbaek N. Orthodontics as an adjunct to
El tratamiento ortodóntico no está limitado a niños y
rehabilitation. Periodontology 2000 1994;4:148-59.
jóvenes. El uso de aparatos ortodónticos apropiados,
10. Keim Robert G. Importancia de la estética en las
fuerzas ligeras, continuas, y mantenidas dentro de los
Relaciones entre ortodoncia y periodoncia. Periodontology
límites biológicos, así como la prevención de los
2000 2002;2:59-71.
problemas periodontales, permite hoy en día incorporar 11. Quiroz MD, Gurrola MB, Casasa AA. Tratamiento de
la ortodoncia al tratamiento de pacientes adultos. Ortodoncia en Paciente Adulto. Revista Latinoamericana de
ortodoncia y Odontopediatría. 2014. disponible en:
Referencias https://www.ortodoncia.ws/publicaciones/2014/art25.asp

64
Capítulo 12
QUISTE PERIAPICAL: REPORTE DE UN CASO.
Víctor Hiram Barajas-Pérez,1 Resumen
José Luis González,2 Introducción: Los quistes periapicales son lesiones asociadas a órganos dentarios con
Graciela Zambrano-Galván,3 daño pulpar irreversible, en su fase inicial son asintomáticos, pueden pasar desapercibidos
Roberto Ávila-Valdez,4 y presentar sintomatología clínica hasta que alcanzan un tamaño significativo y se requiere
de tratamientos más complejos, el estudio de tales lesiones adquiere una importancia
Juan Carlos Cuevas-González.4
particular en la práctica odontológica debido a su alta frecuencia clínica. Presentación del
caso: Paciente masculino de 26 años de edad que presentaba aumento de volumen de 1
(1) Estudiante de la Maestría en Ciencias
Estomatológicas. Facultad de Odontología de año de evolución en cuerpo mandibular izquierdo, con ligera movilidad de premolares y
la Universidad Juárez del Estado de molares ipsilaterales, con datos de parestesia mandibular, se realizó prueba de vitalidad
Durango. Durango, México. pulpar del primer y segundo premolar así como de primer y segundo molar la cual resulto
(2) Práctica Privada. Durango, México. negativa. Radiográficamente se observó lesión radiolúcida con bordes regulares de
(3) Profesora-Investigadora. Facultad de aproximadamente 3.5cm x 2cm, se decidió realizar biopsia por aspiración con aguja fina en
Odontología de la Universidad Juárez del donde el diagnóstico fue de exudado inflamatorio agudo, posterior a esto se realizó biopsia
Estado de Durango. Durango, México. escisional y se obtuvo espécimen de 2 cm x 1 cm aproximadamente de consistencia blanda
(4) Profesor-Investigador. Facultad de y superficie lisa, fue enviado a estudio histopatológico y se nos reportó “Quiste periapical.”
Odontología de la Universidad Juárez del
El paciente fue remitido a tratamiento endodóntico de los órganos dentarios involucrados, a
Estado de Durango. Durango, México.
los dos meses del procedimiento quirúrgico se obtuvo una adecuada evolución y remisión
del aumento de volumen con recuperación de la sensibilidad mandibular y sin datos de
Correspondencia a: dolor. Conclusiones: En este caso el tiempo de evolución era mayor a un año debido a
Dr. Juan Carlos Cuevas González esto las opciones de tratamiento disminuyeron y el tratamiento fue más complejo.
Email: cuevas_gonzalez@hotmail.com Significancia Clínica: Es prioritario concientizar al paciente que presente lesiones cariosas
amplias sobre la importancia de tratarse en ese momento y evitar el daño pulpar
irreversible; así como evitar el desarrollo de patologías periapicales en los que ya lo
presentan.

Cómo citar:
Barajas-Pérez VH, González JL, Zambrano-Galván G, Ávila-Valdez R, Cuevas-González
JC. Quiste periapical: reporte de un caso. En: Medina-Solís CE, Casanova-Rosado JF,
Lara-Carrillo E, editores. Mis casos clínicos en Odontología. Campeche: Universidad
Autónoma de Campeche; 2015. p. 65-67. ISBN: 978-607-8444-10-6

INTRODUCCIÓN La respuesta inflamatoria en el periápice comienza


El quiste periapical es una lesión de origen inflamatorio incluso antes de que la pulpa esté totalmente necrótica,
que se desarrolla a partir de un granuloma periapical pre dentro de los agentes patógenos causantes de la lesión
existente,1 invariablemente se encuentra asociado a se encuentran endotoxinas bacterianas, mediadores de
órganos dentarios desvitalizados por secuelas de la inflamación y tejido pulpar necrótico, que pasan a
lesiones cariosas; en general todos los quistes través del foramen apical favoreciendo el proceso
odontogénicos suelen ser asintomáticos en sus etapas inflamatorio haciéndolo crónico siendo mediado por el
iniciales, a menos que se infecten secundariamente o tejido vascular de la zona.3
alcancen un tamaño significativo que produzca El quiste periapical es frecuente en maxilar y en
deformidad del hueso afectado.2 mandíbula sin preferencia por algún sexo,4 debido a su
etiología suelen presentarse con mayor frecuencia entre

65
la tercera y sexta décadas de la vida.1 La disparidad que A la exploración física dirigida, presentaba ligero
se encuentra en la literatura acerca de su prevalencia se aumento de volumen a nivel de cuerpo mandibular
debe a los criterios diagnósticos utilizados, cuando estos izquierdo, firme a la palpación, con moderado dolor a la
criterios son rigurosos la prevalencia que se ha reportado manipulación, sin datos de adenomegalias o
es del 15%, es indispensable el estudio histopatológico linfadenopatías cervicales. En la exploración bucal se
para el correcto diagnóstico y para hacer la distinción encontró aumento de volumen vestibular en región de
entre granuloma o quiste periapical.5 cuerpo mandibular izquierdo desde el primer premolar
Radiográficamente se observa ensanchamiento del hasta el segundo molar, sin dolor a la percusión, con
ligamento periodontal, así como una zona radiolúcida que ligera movilidad y fuera de oclusión por intrusión de los
en etapa inicial es redondeada u oval asociada a la raíz órganos dentarios, sin datos de secreción de ningún tipo,
de un órgano dentario con lesión pulpar.6 con adecuado color e hidratación de la mucosa. Se
En las características histopatológicas se encuentra una realizó prueba de vitalidad pulpar del primer y segundo
cavidad cubierta por un epitelio plano estratificado no premolar así como de primer y segundo molar la cual fue
queratinizado de grosor variable, es frecuente también la negativa.
espongiosis y exocitosis, así como la presencia de una
capsula de tejido conjuntivo fibroso, de
polimorfonucleares, células plasmáticas, linfocitos y de
cuerpos esféricos birrefringentes (cuerpos de Russell).1,7
Distintos tratamientos se han propuesto para el quiste
periapical, entre los que destacan apicectomía,
tratamiento endodóntico, extracción del órgano dentario
afectado entre otros,8 el estudio de tales lesiones
adquiere una importancia particular en la práctica
Figura 1. Radiografía periapical. Lesión periapical que se desarrolla a
odontológica debido a su alta frecuencia clínica.9 expensas de la raíz del primer molar inferior izquierdo, en el cual es
evidente el proceso carioso que involucra la pulpa dental.

PRESENTACIÓN DEL CASO


En la radiografía periapical (Figura 1) se evidenciaba que
Paciente masculino de 26 años de edad que acudió al
la lesión era radiolúcida con bordes regulares de
servicio de Cirugía Oral y Maxilofacial por presentar
aproximadamente 3.5cm x 2cm, se decidió realizar
aumento de volumen de forma paulatina de región de
biopsia por aspiración con aguja fina en donde el reporte
cuerpo mandibular izquierdo de un año de evolución
fue exudado inflamatorio agudo. Se realizó enucleación
aproximadamente, al interrogatorio directo no refirió
quirúrgica (Figura 2) completa del quiste, previa
antecedentes sistémicos o alérgicos, negó datos de
infiltración de lidocaína 2% con epinefrina 1:100,000 con
traumatismos y refirió ligera movilidad de premolares y
fines hemostáticos.
molares ipsilaterales, con datos de parestesia
mandibular.

66
de volumen de manera paulatina desde hacía un año, lo
cual indica que el tiempo de evolución de la lesión era
aún mayor, por lo que es prioritario concientizar al
paciente que presente lesiones cariosas de la
importancia de tratarse en ese momento y evitar el daño
pulpar irreversible; así como el desarrollo de patologías
periapicales en los que ya lo presentan.

Referencias
1. Regezy JA, Sciubba JJ, Jordan RC: Oral pathology clinical
pathologic correlations. St Louis: Saunders Elsevier; 2008.
2. Mosqueda A, Irigoyen ME, Díaz MA, Torres MA. Quistes
Figura 2. Enucleación quirúrgica. Cavidad quística observada al odontogénicos. Análisis de 856 casos. Medicina Oral
momento de hacer el abordaje quirúrgico.
2002;7:89-96.

Se obtuvo espécimen de 2cm x 1cm aproximadamente 3. Leyva ER, Tapia JL, Quezada D, Ortiz E. Factores

de consistencia blanda y superficie lisa, fue enviado a involucrados en el desarrollo y expansión del quiste periapical.

estudio histopatológico en donde se reportó cavidad Rev Odont Mex 2006;10:36-41.

quística cubierta por epitelio plano estratificado no 4. Silva M, Palacios E, Sáenz L. Quiste periapical: Reporte de

queratinizado y capsula de tejido conjuntivo fibroso, así caso clínico. Odontol Sanmarq 2004;8:46-48.
5. Neville BW, Damm D, Allen CM, Bouquot JE. Oral &
como la presencia de infiltrado inflamatorio de predominio
Maxillofacial Pathology. Philadelphia: Saunders Elsevier; 2002.
crónico y cuerpos de Russell, por lo que el diagnóstico
6. Vázquez D, Balsamo MF, Gandini P, Valdez A, Carbajal E.
correspondió a “Quiste periapical”
Quiste periapical inflamatorio, diagnóstico radiográfico, solución
En base al diagnóstico el paciente fue remitido a
de un caso y revisión de la literatura. Rev ADM 2009;65:24-27.
tratamiento endodóntico de los órganos dentarios
7. Silva LC, Vilas DS, Vásconcelos GQ, Gonçalves EA, Silva
involucrados, a los dos meses del procedimiento
CA, Nunes J. Histopathological Study of Radicular Cysts
quirúrgico se obtuvo una adecuada evolución y remisión
Diagnosed in a Brazilian Population. Braz Dent J 2011;22:449-
del aumento de volumen con recuperación de la
54.
sensibilidad mandibular y sin datos de dolor.
8. Bava FA, Umar D, Bahseer B, Baroudi K. Bilateral radicular
El consentimiento informado se obtuvo del paciente para
cyst in mandible: an unusual case report. J Int Oral Health
la publicación del presente caso al igual que las
2015;7:61-3.
imágenes que acompañan.
9. Pires DA, Alves KM, Gordon MA, Andrade R, Cavalcanti H,
Lopes Al. Formación de los granulomas y quistes periapicales:
CONCLUSIONES
Una revisión de los aspectos inmunopatológicos. Rev ADM
El quiste periapical en etapa inicial es asintomático, en 2007;64:91-96.
este caso el paciente nos refirió haber notado aumento

67
Capítulo 13
HIPERPLASIA MULTIFOCAL DEL EPITELIO EN
CAVIDAD ORAL: REPORTE DE UN CASO.
Daniel Lizárraga-Rodríguez,1 Resumen
Sandra Margarita Jiménez-Aguilar,2 Introducción: La hiperplasia epitelial multifocal, causada por el virus papiloma humano 13 y
Julio Benítez-Pascual,1 32, presentándose en la primera década de vida, pero puede ocurrir en adultos hasta de 20
Bertha Eugenia Padilla-Suzuki,1 años de edad. Generalmente son lesiones papulonodulares asintomáticas, de crecimiento
lento en mucosa labial como sitio de predilección, de diámetro variable El diagnóstico
Juan José Villalobos-Rodelo.3
usualmente se basa en hallazgos clínicos, donde el diagnóstico clínico diferencial incluye:
Nevo esponjoso blanco oral, papilomatosis oral florida, síndrome de Cowden, verrugas
(1) Profesor-Investigador. Facultad de
Odontología de la Universidad Autónoma de vulgares, condiloma acuminado, papiloma escamoso múltiple. El tratamiento es
Sinaloa. Culiacán, México. controversial, puesto que tiene tendencia a la regresión espontánea; escisión quirúrgica,
(2) Pasante en Servicio Social. Facultad de criocirugía y electrofulguración son opciones viables. Presentación del caso: Se describe
Odontología de la Universidad Autónoma de paciente masculino de 8 años de edad, con lesiones papilomatosas regulares bien
Sinaloa. Culiacán, México. definidas, de base sésil, color rosa intenso y superficie verrugosa, diámetros variables,
(3) Profesor. Facultad de Odontología de la localizadas en mucosa de labio inferior y superior, mucosa yugal, lengua y paladar. Para
Universidad Autónoma de Sinaloa. Culiacán, corroborar diagnóstico clínico presuntivo de hiperplasia epitelial multifocal, se realizó biopsia
México. por Punch de una de las lesiones, se procedió con tratamiento por electrofulguración, por
electrocauterio en una de las zonas más afectadas manteniendo al paciente en observación
Correspondencia a: 5 días posteriores al tratamiento. Conclusiones: Una correcta exploración intra y extra oral
Dr. Daniel Lizárraga-Rodríguez permite discernir entre los diagnósticos diferenciales para determinar el padecimiento
Email: dlizarraga65@hotmail.com actual. Significancia Clínica: En pacientes con hiperplasia epitelial multifocal, es
importante prestar una atención multidisciplinaria desde el aspecto odontológico, médico y
nutricional, con la finalidad de proporcionar el tratamiento adecuado acorde al cuadro clínico
que presenta cada paciente.

Cómo citar:
Lizárraga-Rodríguez D, Jiménez-Aguilar SM, Benítez-Pascual J, Padilla-Suzuki BE,
Villalobos-Rodelo JJ. Hiperplasia multifocal del epitelio en cavidad oral. reporte de un caso.
En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en
Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 68-73. ISBN: 978-
607-8444-10-6

Introducción de ésta. Parece que no hay potencial de transformación


La hiperplasia epitelial multifocal (HEM), también maligna.1-6
conocida como enfermedad de Heck es una patología Definición
papulonodular, poco frecuente en el campo odontológico, La hiperplasia epitelial multifocal o enfermedad de Heck
que predomina en niños y de poca frecuencia en adultos, es una rara y benigna alteración de la mucosa oral, que
la cual está asociada al virus papiloma humano (VPH) 13 predomina en niños, de cualquier sexo y grupo étnico.7
y 32. Otro nombre que ha recibido es papilomatosis Fue descrita inicialmente por Archard y cols., en 1965, en
múltiple focal. No todos presentan regresión espontánea, un grupo de niños indios navajos de Nuevo México. El
pueden persistir durante meses o años. Poco se ha epónimo “enfermedad de Heck” fue acuñado por la
escrito sobre la conducta clínica y el manejo terapéutico incuestionable participación del Dr. John Heck.2,8

68
Se trata de pápulas, nódulos o placas en la mucosa bucal Centroamérica y Brasil, pueblos nativos nórdicos y otros
o labial, parecida a verrugas planas, asintomáticas, grupos de Europa y África.17
sésiles ó pediculares, forma ovoide o regular, color igual En cuanto a la raza, la enfermedad disminuye en
a la mucosa adyacente y de superficie irregular; de mestizos y es aún más rara en caucásicos y en
crecimiento lento y de 3 a 10 mm de diámetro. Pueden individuos de raza negra; se muestra incidencia
confundirse con bastante facilidad con los papilomas o principalmente en indios mexicanos.15,18
condilomas, y por lo tanto tal vez dar lugar a la sospecha Diagnóstico
de abuso sexual en niños.1,8-10 El diagnóstico de estas lesiones se hace básicamente
En algunos casos se diagnostican erróneamente como por el aspecto clínico, las cuales deben ser procesadas
papilomas. La diferencia, es la presentación múltiple y la mediante el estudio histopatológico para confirmar el
resiliencia, es decir que al tensar la mucosa afectada diagnóstico definitivo; sin embargo, la única prueba que
desaparecen, y al regresar a la mucosa a su posición puede detectar el VPH con certeza es la prueba de la
original, las lesiones reaparecen.2 reacción en cadena de la polimerasa (PCR) por
Etiología secuenciación que deberá estar a cargo de personal
Resultados de diferentes estudios determinan, que el especializado, con experiencia en biología molecular.2,19
factor etiológico de la HEM está íntimamente relacionado Características clínicas
con el VPH tipo 13 y 32, los cuales son encontrados Son lesiones benignas de la mucosa bucal, elevadas tipo
específicamente en estas lesiones y pueden ser pápula nodular, múltiples o aisladas, asintomáticas,
detectados en un alto porcentaje de casos, utilizando el sésiles o pediculadas de forma ovoide, blanda a la
análisis de hibridación “In Situ” y la reacción en cadena palpación, de color similar a la mucosa circundante, con
de la polimerasa (RCP). El Serotipo 13 fue el primero en presentación de fino patrón de aspecto verrugoso o de
ser descrito y es más frecuente encontrarlo en ésta empedrado, de crecimiento lento y con diámetro de 0.1 a
entidad. Aunque se han descrito reacciones cruzadas 0.5 cm, hasta varios centímetros por la coalescencia de
con HPV 10, 11, 12.2,11,13,14 las lesiones pequeñas.1,2,5
Otras investigaciones sustentan que las posibles causas Las lesiones se presentan principalmente en mucosa
etiológicas de la enfermedad están relacionadas con un labial (inferior y/o superior), mucosa yugal, lengua y rara
componente genético asociado a rasgos étnicos, estados vez en el paladar (duro y/o blando) y encía. De igual
de inmunosupresión del hospedero, así como mal modo se ha encontrado que las lesiones en su mayoría
nutrición y condiciones de vida de hacinamiento.12,15,16 aparecen en áreas con trauma oclusal.2,20
Epidemiología Características histológicas
La incidencia en cuanto al sexo se encuentra relacionada El epitelio superficial se caracteriza por acantosis e
con mayor predominio en el género femenino, pero hiperparaqueratosis extensa, las células epiteliales del
puede encontrarse en ambos sexos.1 estrato espinoso superior presentan núcleos aumentado
Esta afección se encuentra principalmente en grupos de tamaño y citoplasma vacuolado claro (coilocitos) que
aislados de indios nativos de América del Norte, indican infección por VPH. Se muestra hiperplasia basal,

69
el tejido conjuntivo subyacente suele ser laxo y bien aproximadamente; asintomáticas, aparentemente sin
vascularizado, presentando infiltrado inflamatorio crónico interferencia en la masticación (Figura 1 y 2).
de predominio linfocitario variable.17
Diagnósticos diferenciales
Los diagnósticos diferenciales de la HEM deben
realizarse con las otras lesiones benignas producidas por
el VPH como es el nevo esponjoso blanco bucal, verruga
vulgar, papilomas escamosos múltiples, papiloma oral
florida, condiloma acuminado, enfermedades de Darier,
de Crohn, Síndrome de Cowden y otros crecimientos
exofíticos de variada etiología.1,2,8,17
Tratamiento
En caso de persistencia de las lesiones, puede ser
Figura 1. Se observan lesiones papilomatosas con las características
indicada su eliminación, aunque es importante destacar ya descritas en la mucosa del labio inferior del paciente.
que esta enfermedad tiene tendencia a la regresión
espontánea. La escisión quirúrgica, criocirugía, ablación
con láser y aplicación de ácido tricloroacético (ATA) son
algunas de las diferentes alternativas de tratamiento
empleadas. Es prudente la explicación médica al
paciente y sus familiares respecto a la naturaleza y curso
del padecimiento, por lo que es determinante enfatiza en
las medidas de higiene en objetos de uso personal para
evitar el contagio.3,8, 20

Presentación del caso


Se reporta un caso clínico de un paciente escolar, de Figura 2. Imagen de la mucosa labial inferior del paciente, claramente
se observa la zona de donde fue obtenida la muestra). Se dieron
sexo masculino de 8 años de edad natural, procedente indicaciones preventivas post-operatorias sin necesidad de
medicamento.
de Guerrero pero residente en el Campo San Armando
de la Cofradía de San Pedro Sinaloa.
Estudio histopatológico
Presentaba múltiples lesiones papilomatosas en mucosa
Lesión papilomatosa, base sésil de 4 mm
labial (superior e inferior), mucosa yugal, superficie
aproximadamente, a nivel de mucosa del labio inferior.
dorsal, ventral y lateral de lengua, de igual color que la
Informe macroscópico
mucosa aparentemente sana, de forma circular, base
Fragmento nodular pardo claro midiendo 0.2x0.2x0.1 cm
sésil, bien delimitado, con textura suave, de superficie
se incluye en su totalidad (1T).
verrugosa, de tamaño variable desde 2 a 10 mm
Informe microscópico

70
Fracción de mucosa de labio inferior que exhibe Diagnóstico: hallazgos histopatológicos compatibles con
hiperplasia pseudoepiteliomatosa con vasos congestivos, VPH.
fragmentos de glándulas salivales con inflamación Tratamiento: se decide realizar electrofulguración con
crónica reactiva inespecífica leve y hemorragia reciente, electrocauterio en una de las lesiones más grandes.
negativo a malignidad (Figura 3 y 4).

Figura 3. Micrografía de un corte histológico teñido con Hematoxilina-


Eosina a 400x.
Figura 5. Se observa el momento en que se realiza el tratamiento de
electrofulguración en la lesión más importante, ubicada en la mucosa
En el corte histológico teñido con hematoxilina eosina a labial inferior del lado derecho.

400 aumentos, se observa un epitelio escamoso


Se proporcionan medidas preventivas pos-operatorias y
estratificado paraqueratinizado con células compatibles
se indicó Ibuprofeno 400 mg, 1 tableta cada 12 h por 3
con coilocitos, ubicadas en los estratos superiores del
días. Se observó la evolución del paciente durante 5 días
epitelio y estrato espinoso básicamente.
posteriores al tratamiento, percibiendo adecuada
cicatrización.

Figura 4. Se observa epitelio escamoso estratificado Figura 6. Cicatriz de la zona sometida a tratamiento después de 5
paraqueratinizado mostrando células que son compatibles con
coilocitos. días.

71
Es importante señalar que obtuvimos el consentimiento Ws edición electrónica mayo 2006. Obtenible en:

informado por parte de los padres del paciente para la www.ortodoncia.ws

publicación del presente caso al igual que las imágenes 2. De la Teja AE, Martínez SB, Téllez RJ, Ramírez PLF, Durán
GA, Cadena GA. Hiperplasia epitelial multifocal.
que lo acompañan.
Manifestaciones bucales en niños. Revisión de la literatura.
Acta Pediatr Mex 2008;29:31-35.
Conclusiones
3. Harris RJ, Vasquez SK, Fortich MN. Hiperplasia epitelial
Una correcta exploración intra y extra oral permite
focal. Tratamiento conservador con ácido tricloroacético. Rev
discernir entre los diagnósticos diferenciales para CES Odont 2011; 24:367-370.
determinar el padecimiento actual. 4. Godoy MC, Villamil UJL, González LM, Lama GEM.
Se recomienda realizar promoción de la salud sobre Hiperplasia epitelial focal (multifocal)/Enfermedad de Heck. Rev
medidas higiénicas y nutrición para tratar de prevenir la Mex Odontología Clínica 2008;11:18-19.
aparición de nuevos casos. 5. Villanueva AS, Hernández-Núñez A, Castaño A, Miñano MR,

Además, que se tomen la medidas necesarias por parte Córdoba GS, Borbujo MJ. Hiperplasia epitelial multifocal: un
caso familiar. An Pediatr (Barc). 2010;73:357-360.
de las instituciones de salud de los diferentes estados del
6. Hashemipour M, Shoryabi A, Adhami S, Honarmand H.
país, para llevar un control de los diferentes casos que
Extensive Focal Epithelial Hyperplasia. Arch Iran Med
se han presentado y poder evitar contagios, ya que la
2010,13:48-52.
mayoría de ellos son niños hijos de jornaleros agrícolas
7. Salloum SS, Fernández H, Orta J. Hiperplasia Epitelial
que se trasladan de un estado a otro en diferentes Focal. Dermatología Venezolana 2008; 46:36-37.
temporadas del año. Los estados donde se han 8. Pérez EAD, del Pino GT, López SML. Hiperplasia epitelial
presentado más casos son Guerrero, Oaxaca y Yucatán, focal: Actualidades y tratamiento. Rev Mex Cir Bucal Max
como lo refieren diferentes estudios realizados. 2010;6:111-115
9. Hall C, McCullough M, Angel C, Manton D. Multifocal epitelial

Agradecimientos hiperplasia: a case report of a family of Somalian descent living


in Australia. Oral Surg Oral Med Oral Pathol Oral Radiol Endod
Gracias al Dr. Víctor Fernando Muñoz Estrada y a su
2010;109:20-24.
magnífico equipo de profesionales por colaborar con
10. Schwenger JU, von Buchwald C, Lindeberg H. Oral focal
nosotros para realizar tanto el estudio histopatológico
epithelial hyperplasia. Any risk of confusion with oral
como el tratamiento y poder así concluir nuestro
condylomas?. Ugeskr Laeger 2002;164:4287-4290.
proyecto. 11. Obalek S, Janniger C, Jablonska S, Favre M, Orth G.
A la Dra. Cynthia Marina Urías Barreras por su gran Sporadic cases of Heck disease in two Polish girls: association
ayuda al interpretar las microfotografías, with human papillomavirus type 13. Pediatr Dermatol
1993;10:240-244.
Referencias 12. Flatiz C. Focal epitelial: A Multifocal oral human
1. Córdova L, Jiménez C. Hiperplasia epitelial multifocal, papillomavirus infection. Pediatric Dentistry 2000;220:153-154.
reporte familiar, revisión de la literatura. Revista 13. Jimenez C, Correnti M, Salma N, Cavazza ME, Perrone M.
Latinoamericana de Ortodoncia y Odontopediatría. Ortodoncia. Detection of human papilomavirus DNA in benign oral

72
squamous epithelial lesions in Venezuela. J Oral Pathol Med 17. Sapp PJ, Eversole LR, Wysocki, GP; Patología Oral y
2001;30:385-388. Maxilar Contemporánea; 1.ª Edición; Barcelona: Elsevier; 1998.
14. González LMR, Suarez ARE, Canul CJ, Conde FL, Eljure 18. Binder B, Wicland U, Smolle J. Focal Epithelial Hyperplasia
LN. Multifocal epithelial hyperplasia in a community in the (Heck Disease) in a Black Child. Pediatr Dermatol 2007;24:31-
Mayan area of Mexico. Int J Dermatol 2011;50:304-309. 32.
15. González LBS. Hiperplasia Epitelial Focal en la cavidad 19.- Kumaraswamy KL, Vidhya M. Human papilloma virus and
bucal. Reporte de casos en dos comunidades del Estado de oral infections: An uptade. J Can Res Ther 2011;7:120-127.
México. Ciencia Ergo Sum 1999;6:253-256. 20. Lu YG, Wu JJ, Lei X, Zhu TY, He Y, Chen L, Cheng QH.
16. Praetorious CF, Emmertsen M. Ocurrente of focal epitelial Treatment of oral floridpapillomatosis with systemic
hyperplasia among Americans in Ecuador. Int J Oral Surgery administration of photocarcinorin: an effective photodynamic
1973;2:45-53. therapy. Photomed Laser Surg 2010;28:831-833.

73
Capítulo 14
LEIOMIOMA VASCULAR ORAL: REPORTE DE
UN CASO.
Erika Alejandra Jardon-Romero,1 Resumen
Silvia Cristina Manzur-Quiroga,2,3 Introducción: El leiomioma oral es un tumor benigno del músculo liso que aparece
Edith Lara-Carrillo,2 frecuentemente en el útero, aparato gastrointestinal y piel, siendo poco frecuente en la
Saraí López-González,2 cavidad oral debido a la escasez de músculo liso en esta localización. Este tipo de tumores
puede aparecer a cualquier edad, presentándose generalmente como una masa de
Carlo Eduardo Medina-Solís.4
crecimiento lento y asintomático, aunque en ocasiones pueden ser dolorosos. Los lugares
más frecuentes de asentamiento dentro de la cavidad oral son: labios, paladar y lengua. El
(1) Estudiante de la Maestría en Ciencias
Odontológicas. Facultad de Odontología de la diagnóstico de leiomioma se basa fundamentalmente en la histología. El tratamiento de
Universidad Autónoma del Estado de México. elección es la escisión quirúrgica, presentando una tasa muy baja de recurrencia y
Toluca, México. pronóstico excelente. Presentación del caso: Paciente masculino de 38 años con una
(2) Profesor-Investigador. Facultad de lesión en la mejilla derecha, refirió haber notado un ligero aumento de volumen en el carrillo
Odontología de la Universidad Autónoma del derecho, de aparición espontánea, sin antecedentes traumáticos, el cual aumentó
Estado de México. Toluca, México. lentamente de tamaño y se mantuvo asintomático; la cual fue diagnosticada
(3) Directora General del Consejo histológicamente como leiomioma vascular, con una evolución favorable a tres meses de
Mexiquense de Ciencia y Tecnología. Toluca, seguimiento. Conclusiones: Es importante realizar los estudios pertinentes para diferenciar
México.
(4) Profesor-Investigador. Área Académica
esta lesión de su contraparte maligna, se recomienda en todos los casos un seguimiento
de Odontología del Instituto de Ciencias de la estricto y a largo plazo. Significancia clínica: Aunque si bien es cierto que la aparición del
Salud de la Universidad Autónoma del leiomioma vascular oral es rara, se debe tener el conocimiento básico para su adecuado
Estado de Hidalgo. Pachuca, México. diagnóstico y tratamiento.

Cómo citar:
Correspondencia a: Jardon-Romero EA, Manzur-Quiroga SC, Lara-Carrillo E, López-González S, Medina-Solís
Dra. Edith Lara-Carrillo CE. Leiomioma vascular oral: reporte de un caso. En: Medina-Solís CE, Casanova-Rosado
Email: laracaedith@hotmail.com JF, Lara-Carrillo E, editores. Mis casos clínicos en Odontología. Campeche: Universidad
Autónoma de Campeche; 2015. p. 74-77. ISBN: 978-607-8444-10-6

INTRODUCCIÓN Los leiomiomas pueden presentarse en un amplio rango


El leiomioma es un tumor benigno del músculo liso que de edad, teniendo una mayor incidencia en la 5ta y 6ta
puede aparecer en cualquier lugar, siendo la localización décadas de vida. No hay predilección por género o raza.
más frecuente el útero (95%), seguido de la piel (3%),y Clínicamente se presentan como masas superficiales,
tracto gastrointestinal (1.5%). Menos de 1% ocurren en asintomáticas, de crecimiento lento, consistencia firme y
cabeza y cuello estructura. Sólo el 0.065% de los en ocasiones elástica. Con frecuencia es asintomática,
leiomiomas tienen una ubicación intraoral, debido a la pero puede presentarse dolor, movilidad dental o
falta de músculo liso en este sitio, por lo que se supone dificultad en la masticación; se localiza principalmente en
que la formación de leiomioma resultante de la capa la lengua, labios, paladar y mucosa bucal.3-5
media de los vasos sanguíneos y músculo liso del Radiográficamente no hay cambios significativos cuando
conducto excretor de las glándulas salivales.1-3 se presenta en tejidos blandos, sin embargo en su
presentación intraósea se manifiesta como una

74
radiolucidez uni o multilocular, pudiendo presentar proximal de la lesión, disección roma, separando la
expansión cortical y resorción radicular. El diagnóstico patología del tejido de recubrimiento (Figura 2).
diferencial clínico debe realizarse con otras neoplasias
benignas mesenquimatosas como hemangioma,
linfangioma, y granuloma piógeno, y lesiones malignas
como leiomiosarcoma.4,6
El tratamiento de elección de los leiomiomas bucales es
la escisión. A pesar de la naturaleza vascular del
leiomioma, es raro observar sangrado profuso durante el
acto quirúrgico. La recurrencia es notablemente rara y en
general el pronóstico es excelente.5-7

Figura 1. Aspecto intrabucal de la lesión: Aumento de volumen en


PRESENTACIÓN DEL CASO mucosa de la mejilla derecha, de aproximadamente 1.5 cm de
diámetro color rojo-azul-violáceo.
Paciente masculino de 39 años de edad, el cual acude al
Servicio de Cirugía Bucal de la Facultad de Odontología Se limpió el lecho quirúrgico y realizó hemostasia con
de la UAEM por presentar una lesión asintomática en la electrobisturí (Figura 3), por último se suturó con Vicryl
mucosa de la mejilla derecha. El paciente manifestó 0000, colocándose 5 puntos simples, retrayendo los
antecedentes de alcoholismo y tabaquismo; refirió haber bordes de la herida. Se envía el tejido a estudio
notado un ligero aumento de volumen en el carrillo histopatológico (Figura 4).
derecho, de aparición espontánea, sin antecedentes
traumáticos, el cual aumentó lentamente de tamaño y se
mantuvo asintomático. A la exploración física se observa
lesión elevada localizada en la mucosa vestibular
derecha, solitaria de contorno ovalado e irregular,
superficie nodular, color rojo-azul-violáceo, consistencia
blanda, base sésil, de 1.5 cm de diámetro, fija a tejidos
(Figura 1). Se solicita estudio de imagen
(ortopantomografía) donde no se aprecian alteraciones
óseas, y estudios de laboratorio (biometría hemática,
química sanguínea, tiempo de sangrado y tiempo de
Figura 2. Biopsia escisional observando una lesión firme y sólida, de
coagulación) con valores normales. color rojizo.
Se procede a realizar biopsia escisional de la lesión
mediante abordaje intrabucal utilizando electro bisturí. Se Histopatología

realizó incisión de 1 cm de longitud en la base más Se observa tejido blando cubierto por una capa de tejido
conectivo subyacente. Que sostiene numerosos vasos

75
capilares y cavernosos, congestionados. Se observan
numerosas fibras de tejido nervioso y músculo estriado,
evidencia de hemorragia y hemosiderina. Se observan
glándulas mixtas propias de la región de aspecto normal.
No se observaron elementos neoplásicos malignos.

Figura 5. Control posoperatorio a 3 meses del tratamiento quirúrgico.

DISCUSIÓN
Los leiomiomas son raros en cavidad bucal. Brooks y
cols.,8 reportaron únicamente 12 casos entre 76,412
biopsias analizadas entre 1963 y 2001 en un servicio de
Figura 3. Lecho quirúrgico controlando la hemostasia con patología bucal. Esto se explica por la poca cantidad de
electrobisturí y puntos de sutura.
tejido muscular liso que existe en esta zona.3-5 Varios
autores han postulado diferentes teorías en relación con
el origen de los leiomiomas en la cavidad bucal; Stout9
propone que el origen es el músculo liso de la pared de
los vasos sanguíneos, específicamente de la túnica
media. Gaytan y cols.,6 sugieren que los leiomiomas
vasculares solo representan una etapa en el proceso de
proliferación continua del músculo liso y que un gran
número de estos pueden ser malformaciones vasculares.
La secuencia de progresión que ellos sugieren es
hemangioma, angioma, leiomioma vascular, leiomioma y
Figura 4. Aspecto macroscópico de la lesión: Masa de consistencia leiomioma sólido. En otro estudio realizado por Baden y
firme, color rojizo, forma ovalada y superficie rugosa, de
aproximadamente 1.5 x 1.3 x 0.9 cm. cols.,10 de un total de 142 leiomiomas bucales 94 casos
correspondieron a la variante vascular.
El paciente acude a controles periódicos, con adecuada Por la baja incidencia de estas lesiones, cuando llegan a
cicatrización de la herida quirúrgica y tres meses presentarse, los diagnósticos clínicos generalmente van
después se encuentra asintomático y libre de lesión orientados a otro tipo de patologías, como lo son,
(Figura 5).

76
lesiones de tejido conectivo, lesiones de glándulas 2. Anastassov G, van Damme P. Angioleiomyoma of the upper

salivales o malformaciones vasculares.3-6 El leiomioma es lip: report of a case. Int J Oral Maxillofac Surg 1995;24:301-

una entidad totalmente benigna, sin embargo debe 302.


3. Orsini G, Fiorini M, Rubini C, Piatelli, A. Leiomyoma of the
diferenciarse cuidadosamente de su contraparte maligna
Lip: Report of a case. J Oral Maxillofac Surg 2001;59:80-83.
el leiomiosarcoma, aunque las características
4. Gianluca S, Marini R, Tonoli F, Cristalli MP. Leiomyoma of
histológicas como atipa celular y necrosis pueden
oral cavity: case report and literature review. Ann Stomatol
proveer indicadores de malignidad, la actividad mitótica
2011;2:9-12.
representa el criterio más confiable de un 5. Koutlas IG, Manivel JC. Epithelioid leiomyoma of the oral
comportamiento maligno junto con estudios de mucosa. Oral Surg Oral Med Oral Pathol Oral Radiol Endod
inmunohistoquímica y marcadores moleculares.6,8,10 1996;82:670-3.
El consentimiento informado se obtuvo del paciente para 6. Gaitan Cepeda LA, Quezada Rivera D, Tenorio Rocha F,
la publicación del presente caso al igual que las Leyva Huerta ER, Mendez Sánchez ER. Vascular leiomyoma of

imágenes que lo acompañan. the oral cavity. Clinical, histopathological and


immunohistochemical characteristics. Presentation of five
cases and review of the literature. Med Oral Patol Oral Cir
CONCLUSIONES
Bucal 2008;13:E483-8.
Aunque si bien es cierto que la aparición del leiomioma
7. Alvarez E, Laberry MP, Ardila CM. Multiple oral leiomyomas
vascular oral es rara, se debe tener el conocimiento
in an infant: a rare case. Case Rep Dent. 2012;804305.
básico para su adecuado diagnóstico y tratamiento, así 8. Brooks J, Nikitakis N, Goodman, N Levy B. Clinicopathologic
como considerar un diagnóstico diferencial en casos que characterization of oral angioleiomyomas. Oral Surg Oral Med
compartan características clínicas. Es importante realizar Oral Pathol Oral Radiol Endod 2002; 94:221-7.
los estudios pertinentes para diferenciar esta lesión de su 9. Nikitakis NG, Lopes MA, Bailey JS, Blanchaert RH, Ord RA,

contraparte maligna, se recomienda en todos los casos Sauk JJ. Oral Leiomyosarcoma; review of the literature and

un seguimiento estricto y a largo plazo. report of two cases with assessment of the prognostic and
diagnostic significance of immunohistochemical and molecular
markers. Oral Oncol 2001;38:201-8.
Referencias
10. Baden E, Doyle JL, Lederman DA: Leiomyoma of the oral
1. Campelo VE, Neves MC, Nakanishi M, Voegels RL. Nasal
cavity: A Light microscopic and inmmunohistochemical study
cavity vascular leiomyoma: case report and literature review.
with review of the literatureform 1884 to 1992. Oral Oncol Eur J
Braz J Otorhinolaryngol 2008;74:147-50.
Cancer 1994; 30:1.

77
Capítulo 15
ODONTOMA COMPUESTO: REPORTE DE UN
CASO.
Juan Fernando Casanova-Rosado,1 Resumen
Ana Alicia Vallejos-Sánchez,1 Introducción. Los odontomas son tumores de origen odontogénico más frecuentes.
Alejandro José Casanova-Rosado,1 Generalmente son asintomaticos y se diagnostican en estudios radiograficos de rutina o
Mirna Isabel Minaya-Sánchez,1 cuando involucran alteraciones en la salida de dientes o posición de los mismos.
Presentación de los casos. Se presenta el caso clínico de una niña de 10 años de edad,
Juan Alejandro Casanova-Sarmiento.2
la cual acude a consulta por la falta de erupción de un incisivo central superior izquierdo.
Se realiza estudios radiologicos de rutina, evidenciandose la presencia de un probable
(1) Profesor-Investigador. Facultad de
Odontología de la Universidad Autónoma de odontoma que impide la erupcion del incisivo superior. Se indica la enucleación del
Campeche. Campeche. México. odontoma y su biopsia correspodiente para determinar el tipo; se inicia un tratamiento de
(2) Pasante de la carrera de Cirujano Dentista. ortodoncia para la alineacion y la erución controlada del incisivo involucrado.
Facultad de Odontología de la Universidad Conclusiones. El diagnóstico oportuno, así como la terapia efectuada, han podido lograr
Autónoma de Campeche. Campeche. México. la erupción del incisivo central, y se continua con el tratamiento ortodóntico, para lograr la
funcionalidad oclusal del caso. Significancia clínica: La identificación oportuna de las
patologías a través de un auxiliar radiográfico podrá disminuir los riesgos y futuras
Correspondencia a: complicaciones en los pacientes.
Dr. Juan Fernando Casanova-Rosado
Email: juanf_casanova@hotmail.com
Cómo citar:
Casanova-Rosado JF, Vallejos-Sánchez AA, Casanova-Rosado AJ, Minaya-Sánchez MI,
Casanova-Sarmiento JA. Odontoma compuesto: reporte de un caso. En: Medina-Solís
CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en Odontología.
Campeche: Universidad Autónoma de Campeche; 2015. p. 78-82. ISBN: 978-607-8444-
10-6

INTRODUCCIÓN La última clasificación de la OMS del 2005 reconoce dos


El término "odontoma" fue introducido en 1867 por Broca tipos de odontomas: el complejo, cuando estos
los cuales son uno de los tumores odontogénicos más elementos se encuentran de forma desordenada; y el
frecuentes; su etiología es desconocida, aunque se han compuesto, si se hallan en relación organizada y
implicado numerosos factores como traumatismos, preservando la arquitectura normal de los tejidos que lo
infecciones y mutaciones genéticas entre otros; ya que componen. Ambos tipos de tumores poseen una cápsula
están compuestos por tejidos de origen epitelial y de tejido conectivo a su alrededor, que es similar a la del
mesenquimatoso bien diferenciado. folículo que rodea a un diente normal.
La mayoría de los odontomas presentan un curso En general, son tumores más frecuentes en el maxilar
asintomático, aunque pueden aparecer signos y síntomas superior que en mandíbula. Los odontomas compuestos
relacionados con su presencia, como es el caso de normalmente se localizan en el sector superior del
supernumerarios, impactaciones dentarias o en su caso maxilar, mientras que los complejos son más frecuentes
puede existir procesos inflamatorios e infecciosos en el sector posterior de la mandíbula.
presentes en el área de la presencia del odontoma.

78
Existe mayor predominio en niños y adolescentes,
observándose poca diferencia en su incidencia entre
mujeres y varones. Estas lesiones normalmente se
descubren mediante exámenes radiográficos de rutina
durante la segunda y tercera década de la vida.
El tratamiento para los odontomas es quirúrgico, realizar
la enucleación de todos los componentes y enviarlo a
patología para la confirmación histopatológica.
El defecto óseo puede ser rellenado con hueso autólogo,
u otro tipo de sustituto óseo para evitar el espacio
muerto.
Figura 2. Radiografía periapical, mostrando el incisivo retenido y el
probable odontoma.
PRESENTACIÓN DEL CASO
Paciente femenina de 10 años 10 meses de edad,
originaria del estado de Campeche, sin antecedentes
patológicos de relevancia para el diagnóstico. El motivo
de la consulta se debe a la falta de erupción de incisivo
central superior izquierdo. Tiempo de evolución 3 años
aproximadamente (Figura 1).

Figura 3. Radiografía panorámica de la paciente.

Con respecto al estudio de las radiografías se refiere a la


paciente al servicio de cirugía maxilofacial para
tratamiento convencional; el tratamiento quirúrgico
Figura 1. Fotografía extraoral de la paciente. (ENUCLEACIÓN) se llevó a cabo con materiales de
antisepsia descartable y para la confección de los
Se recomienda análisis radiográficos para determinar la
campos.
posible causa de la falta de erupción; la radiografía
La intervención fue llevada a cabo bajo anestesia local: 3
panorámica muestra un probable odontoma, se sugiere
cartuchos, aguja de anestesia corta, mango de bisturí n⁰
una radiografía periapical para confirmar. El diagnostico
3, hoja n⁰ 15; separadores de farabeuf, perióstomo,
radiográfico presuntivo es de un odontoma, por lo que se
sidesmótomo, fresas quirúrgicas redondas n ⁰ 4, 6 y 8.
le sugiere la enucleación y biopsia para determinar el
Instrumental rotatorio, pinzas Pean, Kocher, gubia.
tipo. Se refiere al servicio maxilofacial para su valoración
Cucharas y limas para hueso, hilo de sutura 000, porta
y tratamiento (Figura 2 y 3).

79
aguja, tijera, gasa estéril, solución fisiológica y solución Evolución del caso clínico
desinfectante. El tratamiento ortodóntico permitió la erupción del incisivo
Descripción microscópica central superior izquierdo, al proveer el espacio
En los cortes de tejido examinados se observaron requerido, así mismo colocar en una mejor posición al
estructuras semejantes a dientes contenidos dentro de lateral erupcionado hacia palatino (Figura 6 y 7).
una matriz fibrosa.
La mayoría de esmalte fue perdido durante la
descalcificación, sin embargo se observó una capa de
esmalte inmaduro asociado a dentina; con numerosos
fragmentos de dentina.
Así mismo, se encontró tejido conectivo denso con áreas
semejantes a tejido pulpar bien vascularizado. No se
observaron áreas semejantes a tejido embrionario de Figura 6. Fotografía intraoral, después de la cirugía para enuclear la
lesión.
lámina dental (Figura 4 y 5).

Figura 7. Fotografía intraoral, después de la colocación de la


aparatología fija.

Actualmente se continúa con el tratamiento ortodóntico


hasta conseguir establecer las características ideales de
Figura 4. Fragmentos extraídos de la lesión. la dentición (Figuras 8).
Se pudo establecer que la técnica panorámica es el
estudio radiográfico aconsejable para complementar la
clínica y contribuir al diagnóstico presuntivo ya que tiene
la ventaja de observar en una sola imagen la visión
completa de ambas arcadas dentarias y estructuras
vecinas.
Se establece que el padre de la paciente ha dado su
consentimiento informado para que el caso clínico
incluyendo las imágenes puedan ser publicadas, en
Figura 5. Corte histológico.

80
medios impresos o digitales, así mismo para la Opine sobre las ventajas y desventajas del tratamiento
presentación en carteles o exposiciones orales. elegido, y describa las contraindicaciones para ello.
Incluya una conclusión clara sobre lo que el lector debe
aprender del informe del caso(s) y del impacto clínico que
tiene. Esta sección debe indicar claramente las
principales conclusiones del informe del caso y dar una
explicación clara de su importancia y relevancia. Evite
a que el texto sea repetitivo de las secciones anteriores.

AGRADECIMIENTOS
Un agradecimiento especial a la M en C. Ixchel Maya
García, patóloga bucal por sus aportaciones especiales
para la realización de la biopsia, así como de la
descripción microscópica del caso.
b
REFERENCIAS
1. Lopez- arealL, Silvestre Donat F, Gil Lozano J. Compound
Figura 7. Fotografías intraoral mostrando el progreso del tratamiento
ortodóntico. odontoma eruptiing in the mouth:4- year follow up of a clinic
case. J Oral Pathol Med. 1992;21(6):285.
CONCLUSIONES 2. Cataldo E, Santis HR, A clinico-pathologic presentation.
El oportuno diagnóstico de patologías tal y como son los Ameloblastic fibrous odontoma. J Mass Dent Soc

tumores odontogénicos (odontomas), puede llevar a 1992;41(2):43.


c 3. Piatelli A, Trisi P. Ghost cells in compoun odontoma: a study
evitar futuras complicaciones de dientes retenidos o
of undemineralized material. Bull Groyp Int Rech Sci Stomatol
desviaciones en la erupción de los dientes involucrados a
Odontol 1991;34(3-4):145.
la patología; un estudio radiográfico rutinario como
4. Delgado WA, Arrasque M, Calderón V, Paniura D. Tumor
auxiliar en las consultas odontológicas, pudiera lograr
Odontogénico Híbrido: tumor odontogénico quístico calcificante
prevenir alteraciones mayores en el establecimiento de la con odontoma complejo y focos de ameloblastoma Rev
oclusión. En caso clínico expuesto muestra que aunque Estomatol Herediana 2006;16(2):120-5.
la paciente fue diagnosticada a los 10 años y el 5. Dinatale E. Neuralgia sintomática de la tercera rama del
tratamiento fue favorable, un diagnóstico temprano pudo trigémino asociada a un odontoma compuesto. Presentación
haber evitado mucho de las complicaciones y acortar el de un caso. Acta Odontol Venez 2003;41(3):50-3.

tiempo de tratamiento. Se sugiere el uso de radiografías 6. Amado S, Gargallo J, Berini L, Gay C. Revisión de 61 casos
de odontoma. Presentación de un odontoma complejo
panorámicas como auxiliares del diagnóstico para todos
erupcionado. Med Oral 2003;8:366-73
los pacientes que acuden a una consulta dental.
7. NelsonP,Silva A, Farias G, Freitas AC. Odontoma-hice
malformation on a in permanent maxillary central incisor

81
subsegment to trauma to the incisor predecesor. Dent 12. Kulkarni V, Vanka A, Shashikiran N. Compound adontoma
Traumatol 2005;21(5):309-12. associated with an unerpted rotated dilacerates maxillary
8. Tomizawa M, Otsuka Y, Nods T. Ti: Clinical observations of central incisor. Contemp Clin Dent 2011;2(3):218-21.
odontomas children: 39 cases inculuding one recurrent case. 13. Shafer W, Levy B. Tratado de patología bucal. México, D.F:
Int J Paedia Dent 2005;15:37-43. Interamericana; 1986.
9. De Alesio D. Creosinin ML. Odontoma compuesto complejo: 14. Mursulí M. Pestana O, Carmona S, Cruz M. Odontoma
un caso clínico. Rev Asoc Odontol Argent 2003;91(5):433-6. compuesto. Presentación de un caso. Gaceta Médica
10. Rushton VE, Horner K. The use of panoramic radiology in Espirituana 2005;7(2):3.
dental practice. J Dent 1996;24:185-205. 15. Da Costa C, Torriani D, Torriani M, Da Silva R. Central
11. Vázquez D. Gandini P. Carbajal E. Odontoma compuesto: incisor impatcted by an odontoma. J Contemp Dent Pract.
diagnostico radiográfico y tratamiento quirúrgico de un caso 2008;9(6):122-8.
clínico. Odontoestomatol 2008;24(5):307-12.

82
Capítulo 16
FIBROSARCOMA AMELOBLÁSTICO: REPORTE
DE UN CASO.
Blanca Silvia González-López,1 Resumen
Josué Roberto Bermeo-Escalona,2 Introducción: El fibrosarcoma ameloblástico es un tumor odontogénico raro constituido por
Raúl Campos-Hernández.2,3 elementos epiteliales y ectomesenquimales. La causa del fibrosarcoma ameloblástico se
Miriam Montes de Oca-Rodríguez.4 desconoce, se ha sugerido que puede surgir a partir de la transformación maligna de un
fibroma ameloblástico. Presentación del caso: Paciente masculino de 28 años de edad,
(1) Profesor-Investigador. Centro de originario del municipio de Temascaltepec, Estado de México, que presenta un aumento de
Investigación y Estudios Avanzados en volumen de aproximadamente 10 centímetros de diámetro, localizado en mandíbula, con
Odontología. Facultad de Odontología de la imagen radiolúcida multilocular, con 20 años de evolución. El paciente acudió a solicitar
Universidad Autónoma del Estado de México. atención por la imposibilidad para comer y presencia de dolor. Se tomó una biopsia
Toluca, México. incisional en el servicio de cirugía maxilofacial del Hospital General Adolfo López Mateos de
(2) Profesor. Facultad de Odontología de la Ciudad de Toluca. El diagnóstico de fibrosarcoma ameloblástico se estableció mediante
Universidad Autónoma del Estado de México. tinciones de Hematoxilina-Eosina y de inmunohistoquímica mediante Ki67 y p53. El paciente
Toluca, México. fue remitido al servicio de oncología de cabeza y cuello del Instituto Nacional de
(3) Servicio de Cirugía Maxilofacial. Hospital
Cancerología. Se desconoce el estado actual del paciente. Conclusiones: Se presenta un
General Adolfo López Mateos, SSA Estado
de México. Toluca, México. caso de fibrosarcoma ameloblástico que presumiblemente surge de la transformación
(4) Egresada de la Licenciatura de Cirujano maligna de fibroma ameloblástico considerando su evolución. La carencia de servicios de
Dentista. Facultad de Odontología de la atención médico-odontológicos, en comunidades distantes y en extrema pobreza son
Universidad Autónoma del Estado de México. condiciones que favorecen el retraso en el diagnóstico y tratamiento de lesiones que en su
Toluca, México. origen son benignas. Significancia clínica: El odontólogo debe estar familiarizados con los
signos y síntomas de los las lesiones intraóseas potencialmente malignas o localmente
agresivas, particularmente de los tumores poco frecuentes o de localización inusual.
Correspondencia a:
Dra. Blanca Silvia González-López
Cómo citar:
Email: effymoreno@hotmail.com
González-López BS, Escalona-Bermeo JR, Campos-Hernández R, Montes de Oca-
Rodríguez M. Fibrosarcoma ameloblástico: reporte de un caso. En: Medina-Solís CE,
Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en Odontología.
Campeche: Universidad Autónoma de Campeche; 2015. p. 83-90. ISBN: 978-607-8444-10-
6

INTRODUCCIÓN
El fibrosarcoma ameloblástico (FSA) es una neoplasia Patogenia.
maligna de origen odontogénico infrecuente que se La mayoría de los FSA se originan de novo5,6 y un tercio
desarrolla principalmente en la región premolar-molar de se desarrollan a partir de tumores odontogénicos
la mandíbula.1 Se considera que es la contraparte benignos pre-existentes.7,8 Sin embargo según la edad
maligna del fibroma ameloblástico, mientras que el de aparición de fibroma-ameloblástico (FA) y la del FSA,
componente epitelial permanece benigno, el la posibilidad de progresión de una neoplasia benigna a
mesenquimal muestra características de malignidad.2 Se una neoplasia maligna es más factible que su origen de
ha reportado en el componente mesenquimal positividad novo.5,6 El mecanismo de la transformación maligna no
de Ki67, PCNA, Bcl-2 y p53.3.4 se conoce, los casos reportados indican que los

83
procedimientos quirúrgicos múltiples y las recurrencias, fácilmente,6 a la palpación se puede apreciar un tejido
son un factor que influye en la transformación maligna del firme-óseo.2,8,14
FA.9,10 Los síntomas descritos en la literatura incluyen dolor de
Williams,11 reportó en el componente sarcomatoso una reciente aparición, inflamación, tumefacción, ulceración,
expresión alta restringida del gen c-KIT. El gen c-KIT, se sangrado, parestesia, anestesia del nervio dentario
localiza en el cromosoma 4, se trata de un protooncogén inferior, trismus, dientes retenidos, desplazamiento y/o
que transcribe un receptor transmembrana con actividad movilidad dental.2,3,9 Las lesiones situadas en el maxilar
tirosina quinasa del factor de células madre. Las pueden presentar alteraciones visuales.8
mutaciones en las regiones reguladoras y el dominio Imagen Radiográfica.
quinasa conducen a la sobreexpresión y activación de Las radiografías muestran lesiones con una imagen
este oncogén. No obstante que el autor no detectó radiolúcida unilocular o multilocular, con márgenes
mutaciones en los "hot spots" en su caso, postula que la irregulares, indefinidos y difusos, con expansión,
sobreexpresión de c-KIT se debe a la acción de otros adelgazamiento y perforación de corticales, asociadas a
mecanismos incluidos el aumento de número de copias. un diente retenido.8,12 En mandíbula se extienden hacia
Epidemiología. la rama mandibular,2 los dientes involucrados pueden
El FSA es una neoplasia maligna de origen odontogénico mostrar reabsorción de raíces.14
de muy baja frecuencia.9,12 Los hallazgos clínicos y La radiografía oclusal revela destrucción del hueso
demográficos de series de casos, de revisiones de la cortical lingual con espículas óseas finas en la misma
literatura3,9,10,13 y el análisis de los casos reportados región.2 Según el reporte de Zabolinejad y cols,15 de un
sugieren una ligera predilección por los varones, aunque FSA en el maxilar, la radiografía panorámica mostró una
afecta a ambos géneros.14-16 El rango de edad de los lesión radiolúcida mal definida que involucró el seno
pacientes fluctúa entre 3 y 83 años, la edad promedio al maxilar el cual se encontró completamente ocupado, la
inicio de los síntomas varía entre 18 y 27 años.13 tomografía computarizada reveló extensión medial y
Hallazgos clínicos. vertical al septum nasal y al borde inferior de la órbita,
Clínicamente, los pacientes presentan asimetría facial,8 la que posteriormente desarrollo metástasis al cerebro.6
mayoría de los casos involucran la mandíbula Histología.
particularmente la región molar, con una relación de 2:1 El examen histológico, manifiesta un tumor bifásico
con respecto al a maxilar superior,2,3,9,13 en el maxilar se compuesto de epitelio y tejido mesenquimal, el epitelio
puede observar expansión del proceso alveolar tanto en constituido por cordones y nidos de células basaloides
su porción palatina y bucal.16 con núcleos hipercromáticos con polaridad inversa y
En cavidad bucal se manifiestan como lesiones citoplasma vacuolado, en ocasiones presenta un área
exofíticas que pueden obliterar el surco vestibular, de central con aspecto de retículo estrellado, el epitelio es
superficie lisa, nodular, eritematosa, cuando se ha similar al observado en el FA.6,14,17 El tejido
realizado una extracción en la zona se puede apreciar mesenquimatoso está representado por una proliferación
una masa irregular exofítica ulcerada, que sangra sarcomatosa de células ovoides, redondas, y fibroblastos

84
fusiformes en un arreglo fasicular o en espiral, con control de los pacientes debe realizarse hasta por lo
marcado pleomorfismo, hipercromatismo y un incremento menos 10 años.5
de figuras mitóticas normales y anormales. También, se La duración de la enfermedad desde la aparición de los
ha observado células gigantes.6,2,8 En algunos casos se síntomas hasta la muerte está en el rango de 1.9 años a
puede encontrar dentina displásica.13,14 19 años, usualmente el paciente fallece debido al
Las áreas con mayor celularidad y anaplasia usualmente crecimiento incontrolable del tumor e invasión local.2,4,5
están desprovistas de epitelio odontogénico.2 La Se han referido adenopatías cervicales, no obstante los
desaparición gradual de epitelio puede deberse a casos en los que se ha realizado la extirpación de los
cambios degenerativos por la gran proliferación de las ganglios, el estudio histopatológico ha demostrado solo
células mesenquimatosas malignas.2 En esos casos el procesos reactivos, inflamatorios.8
diagnóstico puede confundirse con fibrosarcoma El FSA se caracteriza por ser un tumor localmente
intraóseo. No obstante, el FSA tiene un comportamiento agresivo, aun cuando se han reportados lesiones
diferente al fibrosarcoma de cabeza y cuello en el que se encapsuladas,14 ocasionalmente pueden observarse
reportan metástasis a ganglios linfáticos regionales y a metástasis regionales o metástasis a distancia
distancia. Se ha sugerido que en el FSA el componente especialmente a pulmones, hígado, mediastino y
epitelial exhibe un efecto organizacional sobre el huesos. Los casos reportados como fatales se han
mesénquima y reduce la habilidad de las células para asociado con infiltración incontrolable de las células
generar metástasis.8 tumorales después de numerosas recurrencias.1, 2,17
Se ha encontrado intensa positividad a Ki67 (marcador En vista de la tasa de recurrencias y la posibilidad de
tumoral de proliferación celular), p53 (gen supresor, transformación maligna del FA algunos autores sugieren
moléculas de adhesión celular), Bcl-2 (B-cell lymphoma en su tratamiento procedimientos conservadores como
2) y PCNA (antígeno de proliferación celular nuclear)3,4 enucleación y curetaje y en caso de recurrencia, cirugías
en el componente mesenquimatoso, lo que confirma su radicales que aseguren la completa remoción de la
carácter agresivo. neoplasia.20
Tratamiento.
El tratamiento recomendado es resección quirúrgica PRESENTACIÓN DEL CASO CLÍNICO.
radical con amplios márgenes de seguridad, Paciente masculino de 28 años de edad referido al
complementado con radioterapia y quimioterapia,5,14,15 la Laboratorio de Patología Bucal del Centro de
respuesta al tratamiento varía de paciente a paciente.6,13 Investigación y Estudios Avanzados en Odontología
La tasa de recidiva es mayor cuando se lleva a cabo un (C.I.E.A.O.) de la Facultad de Odontología, originario del
tratamiento conservador con recesión marginal y municipio de Temascaltepec Estado de México, con
curetaje.9,10 diagnóstico presuntivo de ameloblastoma.
Debido a la baja frecuencia del FSA, es muy difícil El examen extraoral evidenció un aumento de volumen
estimar el pronóstico de la enfermedad a largo plazo, el que causaba asimetría facial izquierda y limitación de la
abertura bucal, a la evaluación intraoral se observó una

85
lesión elevada localizada en mandíbula izquierda de
contorno irregular, de superficie lisa-ulcerada, de bordes
indefinidos, de color similar a la mucosa adyacente, con
área de ulceración de color rojo-blanco, de consistencia
firme, de aproximadamente 10 cm., de diámetro, según el
paciente el aumento de volumen estaba presente desde
los 8 años de edad, con historia de un crecimiento lento,
gradual y asintomático, manifestaciones sugestivas de
una lesión benigna, que estuvo presente por largo tiempo
antes de mostrar rápido crecimiento, dolor constante,
limitación a la apertura y parestesia (Figura 1).

Figura 2. Radiografía anteroposterior que muestra adelgazamiento y


destrucción de corticales, se observa un molar retenido desplazado.

El paciente fue referido al Hospital General Adolfo López


Mateos de la Ciudad de Toluca, para la toma de una
biopsia incisional.
El examen histopatológico reveló un componente bifásico
constituido por células pequeñas, ovoides redondeadas
y fusiformes con pleomorfismo, hipercromatismo en un
Figura 1. Asimetría a expensas de un crecimiento tumoral en el lado
izquierdo de la mandíbula. patrón fasciculado y en espiral, y hasta 3 mitosis atípicas
por campo (Figura 3), el grado de diferenciación de las
La radiografía anteroposterior demostró una lesión
células mesenquimatosas vario de un área a otra (Figura
intraósea, solitaria, en región de cuerpo y rama, con
4) y de cordones y nidos de epitelio odontogénico,
expansión y destrucción de cortical externa. Con imagen
algunos con degeneración quística y presencia de un
radiográfica radiolúcida multilocular asociada a un diente
tejido similar al retículo estrellado en el centro (Figura 5),
retenido. No se detectó linfadenopatía en ganglios
en algunas áreas se observó dentina displásica (Figura
cervicales (Figura 2).
6).

86
Los bloques de tejido del tumor incluidos en parafina se
cortaron en secciones de 3 micras y se procesaron para
la inmunolocalización de las proteínas Ki67 y p53. Los
núcleos de las células en el elemento sarcomatoso
mostraron tinción positiva intensa con Ki67, con
disposición focal en varios sectores de los cortes (Figura
7), mientras que la tinción de los núcleos con p53 fue
moderada, en la mayoría de las células mostrando
disposición difusa (Figura 8).
Figura 3. Área densamente celular, células fusiformes organizadas
en fascículos, que muestran pleomorfismo e hipercromatismo,
ausencia de epitelio odontogénico. Tinción con Hematoxilina- Eosina
20x.

Figura 6. Aspecto bifásico del tumor, presencia de epitelio


odontogénico con esbozos de formación de dentina displásica, células
mesenquimatosas fusiformes, con pleomorfismo e hipercromatismo.
Tinción con Hematoxilina- Eosina 20x.
Figura 4. Marcado pleomorfismo, se observan células ovoides,
irregulares, hipercromáicas y mitosis atípicas. Tinción con
Hematoxilina- Eosina 20x.

Figura 5. Nido de epitelio odontogénico con degeneración central Figura 7. Expresión positiva de ki67 en el componente estromal,
similar al retículo estrellado. Tinción con Hematoxilina-Eosina 40x. mostrando un patrón difuso y moderado.

87
Kousar y cols,17 reportan hallazgos similares en FSA El consentimiento informado se obtuvo del paciente para
agresivos. Los marcadores Ki67 y p53 en asociación con el uso de la información del caso al igual que las
los hallazgos histopatológicos son útiles para identificar imágenes que lo acompañan, con fines académicos y de
malignidad en casos cuya imagen histopatológica no investigación en 1997.
revele la naturaleza de la lesión y en los casos en los que
se sospeche malignidad, el grado del tumor. CONCLUSIONES
Una vez analizadas las laminillas se estableció el El paciente refirió la presencia de un aumento de
diagnóstico de fibrosarcoma ameloblástico. volumen en la mandíbula izquierda a la edad de 8 años,
que nunca recibió tratamiento, debido al tiempo de
evolución se presume la pre-existencia de un FA. Se
considera que el FSA es un tumor de bajo grado de
malignidad,14 sin embargo, se ha reportado que después
de múltiples recurrencias presentan un comportamiento
agresivo,2,11,16,19 en el paciente la transformación maligna
del tumor pudo presentarse en algún momento de su
evolución, manteniendo un crecimiento silencioso, hasta
que manifestó un rápido crecimiento, los síntomas de
dolor, parestesia y dificultad para comer fueron el motivo
que llevó al paciente a solicitar atención, las
Figura 8. Expresión positiva de p53 en el componente estromal,
mostrando un patrón difuso e intenso. manifestaciones clínico-radiográficas fueron similares a
las reportadas previamente.10,12,13,16 Los hallazgos
El paciente fue remitido por el servicio de cirugía
histopatológicos corresponden a los descritos en la
maxilofacial del Hospital General Adolfo López Mateos al
literatura,6,12-14 notándose en las áreas sin epitelio mayor
servicio de oncología de cabeza y cuello del Instituto
atipia2,11 y afinidad de las células por los marcadores Ki67
Nacional de Cancerología de la Ciudad de México, aun
y p533,4,9 que explican el comportamiento agresivo del
cuando la descripción del caso del reporte de Bregni13 no
tumor.17
corresponde a la información recabada durante el
El odontólogo de práctica general es el primer contacto
examen del paciente, la imagen radiográfica de su
de los pacientes con dolor en los maxilares, que
reporte y el antecedente de remisión del paciente al
usualmente interpreta como de origen dental, si el dolor
Instituto Nacional de Cancerología, así como la fecha de
persiste después de una extracción dentaria y el sitio de
la publicación de su reporte, es factible que se trate del
la herida no sana, es necesario la toma de una biopsia
mismo paciente, se presenta el caso destacando la
incisional.9,10,13
importancia del diagnóstico y tratamiento temprano de
En las radiografías, la identificación de: retención de
lesiones en los maxilares de naturaleza maligna.
dientes, movilidad dental y/o expansión y destrucción de

88
corticales sugiere la presencia de una tumoración 7. Kousar A, Hosein MM, Ahmed Z, Minhas K. Rapid

intraósea que debe ser investigada.3,7,9,10 sarcomatous transformation of an ameloblastic fibroma of the

El FSA de bajo grado de malignidad debe distinguirse del mandible: Case report and literature review. Oral Surg Oral
Med Oral Pathol Oral Radiol Endod 2009;108:e80-e5.
FA, la identificación de marcadores como Ki67, Bcl-2,
8. Basavaraj VK, Yanduri Sarita. Ameloblastic fibrosarcoma of
PCNA, c-Kit vimentin y p53 pueden ser utilizados para
the mandible – a possible sarcomatous transformation of an
identificar la naturaleza del tumor.3,4,14,19,20 La detección
ameloblastic fibroma. JPFA 2012;26:12-6.
temprana de neoplasias malignas tiene un gran impacto
9. Hu YY, Deng MH, Yuan LL, Niu YM. Ameloblastic
en el pronóstico y en los resultados del tratamiento.6,9 fibrosarcoma of the mandible: A case report and mini review.
Exp Ther Med 2014;8(5):1463-6.
AGRADECIMIENTOS 10. Kobayashi K, Murakami R, Fujii T, Hirano A. Malignant
Se agradece al paciente su autorización para que su transformation of ameloblastic fibroma to ameloblastic
caso fuera presentado con fines académicos y fibrosarcoma: case report and review of the literature. J

científicos. Craniomaxillofac Surg 2005;33(5):352-5.


11. Williams MD, Hanna EY, El-Naggar AK. Anaplastic
Se agradece al Dr. en CS. Ulises Velázquez Enríquez su
ameloblastic fibrosarcoma arising from recurrent ameloblastic
apoyo en la edición del material fotográfico.
fibroma: restricted molecular abnormalities of certain genes to
the malignant transformation. Oral Surg Oral Med Oral Pathol
Referencias
Oral Radiol Endod 2007;104(1):72-5
1. Wood R, Markle T, Barker B, Hiatt W. Ameloblastic
12. Loya-Solis A, González-Colunga KJ, Pérez-Rodríguez CM,
Fibrosarcoma. Oral Surg 1988;66(1):74-7.
Ramírez-Ochoa NS, Ceceñas-Falcón L, Barboza-Quintana O.
2. Park HR, Shin KB, Sol MY, Suh KS, Lee SK. A highly
Ameloblastic Fibrosarcoma of the Mandible: A Case Report and
malignant ameloblastic fibrosarcoma: Report of a case. Oral
Brief Review of the Literature. Case Rep Pathol 2015; 2015:
Surg Oral Med Oral Pathol Oral Radiol Endod 1995;79:478-8
245026.
3. Huguet P, Castellví J, Avila M, Alejo M, Autonell F, Basas C,
13. Bregni RC, Taylor AM, García AM. Ameloblastic
Bescos MS. Ameloblastic fibrosarcoma: report of a case.
fibrosarcoma of the mandible: report of two cases and review of
Immunohistochemical study and review of the literature. Med
the literature. J Oral Pathol Med 2001;30(5):316-20.
Oral 2001;6(3):173-9.
14. Delgado-Azañero W, Funes-Rumiche I, Torres-Vega F,
4. Pontes HA, Pontes FS, Silva BS, Cury SE, Fonseca FP,
Calderón-Ubaqui V. Fibrosarcoma ameloblástico encapsulado.
Salim RA, Pinto Júnior Ddos S. Immunoexpression of Ki67,
Rev Estomatol Herediana 2008;18(2):128-35.
proliferative cell nuclear antigen, and Bcl-2 proteins in a case of
15. Zabolinejad N, Hiradfar M, Anvari K, Razavi AS.
ameloblastic fibrosarcoma. Ann Diagn Pathol 2010;14(6):447-
Ameloblastic fibrosarcoma of the maxillary sinus in an infant: a
52.
case report with long-term follow-up. J Pediatr Surg
5. Kapila R, Dhaliwal A, Singh N, Kaur D. Ameloblastic
2008;43(2):e5-8.
Fibrosarcoma arising denovo in mandible: A Case Report. ADR
16. Galindo-Obando U, Delgado-Azañero W, Calderón-Ubaqui
2014;3(2):47-51.
V, Beltrán-Silva J, Huamaní-Parra J, Paniura-Rodriguez D,
6. Khalili M, Shakib PA. Ameloblastic fibrosarcoma of the upper
Anchayhua-Espinoza M. Seguimiento de un fibroma
jaw: Report of a rare case with long‑term follow‑up. Dent Res J
ameloblástico con transformación maligna a fibrosarcoma
(Isfahan) 2013;10(1):112-5.
ameloblástico. Rev Estomatol Herediana 2012; 22(1):26-30.

89
17. Kousar A, Hosein MM, Ahmed Z, Minhas K. Rapid 19. Takeda Y, Kaneko Ri, and Suzuki A. Ameloblastic
sarcomatous transformation of an ameloblastic fibroma of the fibrosarcoma in the maxilla, malignant transformation of
mandible: Case report and literature review Oral Surg Oral Med ameloblastic fibroma. Arch Pathol Anat 1984;404:253-263
Oral Pathol Oral Radiol Endod 2009;108(3):e80-5. 20. Gilani SM, Raza A, Al-Khafagi BM. Ameloblastic
18. Chen Y, Wang JM, Li TJ. Ameloblastic fibroma: A review of fibrosarcoma: a rare malignant odontogenic tumor. European
published studies with special reference to its nature and Annals of Otorhinolaringology. Eur Ann Otorhinolaryngol Head
biological behavior. Oral Oncol 2007;43(10):960-9. Neck Dis 2014;131:53-6.

90
Capítulo 17
LIPOMA INTRAORAL: REPORTE DE UN CASO.
Brenda Jazmín Valdez-Vargas,1 Resumen
Silvia Cristina Manzur-Quiroga,2 Introducción: Los lipomas son neoplasias benignas de células adiposas, que aparecen con
Saraí López-González,3 más frecuencia entre los 30 y 40 años de edad, siendo el género masculino el que muestra
Erika Alejandra Jadón-Romero,4 mayor predilección que el femenino. La presentación clínica típica es la de una lesión
tumoral, de crecimiento lento asintomática, de consistencia blanda, aislada o lobulada de
Georgina Contreras-Landgrave.5
base sésil o pediculada, con un tamaño que varía de 1 a 2 cm, de color amarillento y
superficie lisa. Microscópicamente el tumor consiste en células adiposas maduras incluidas
(1) Profesor de posgrado. Facultad de
Odontología de la Universidad Autónoma del dentro de un tejido alveolar fino y rodeado por una cápsula fibrosa. La eliminación quirúrgica
Estado de México. Toluca, México. es el tratamiento de elección, rara vez se observan recurrencia. Presentación del caso:
(2) Profesor-Investigador. Facultad de Paciente de sexo femenino de 31 años de edad. Se presenta a la clínica por aumento de
Odontología de la Universidad Autónoma del volumen en mucosa del labio inferior, de forma redondeada, pequeña y circunscrita, que
Estado de México. Directora General del comenzó a crecer, asintomática sin embargo refiere molestia al hablar, comer y
Consejo Mexiquense de Ciencia y ocasionalmente la muerde, con evolución de 3 años. Se presenta al tratamiento quirúrgico
Tecnología. Toluca, México. de posible lipoma. Conclusiones: Es de suma importancia la identificación del lipoma
(3) Profesor-Investigador. Facultad de intraoral basándose en las características clínicas descritas en la literatura. Significancia
Odontología de la Universidad Autónoma del
clínica: Se considera este caso de interés por tratarse de dos lesiones con una localización
Estado de México. Toluca, México.
(4) Estudiante de Maestría en Ciencias excepcional para este tipo de tumor, presentándose en una paciente del sexo femenino, lo
Odontológicas. Facultad de Odontología de la cual es de menor frecuencia para este tipo de neoplasias.
Universidad Autónoma del Estado de México.
Toluca, México. Cómo citar:
(5) Profesor-Investigador y coordinadora de Valdez-Vargas BJ, Manzur-Quiroga SC, López-González S, Jadón-Romero EA, Contreras-
la Licenciatura de Educación para la Salud. Landgrave G. Lipoma intraoral: reporte de un caso. En: Medina-Solís CE, Casanova-
Unidad Académica Profesional Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en Odontología. Campeche:
Nezahualcóyotl. Universidad Autónoma del Universidad Autónoma de Campeche; 2015. p. 91-95. ISBN: 978-607-8444-10-6
Estado de México. Nezahualcóyotl, México.

Correspondencia a:
Dr. Brenda Jazmín Valdez-Vargas
Email: bvaldezvargas@yahoo.com.mx

INTRODUCCIÓN La presentación clínica típica es la de una lesión tumoral,


Aunque es relativamente común encontrar lipomas en de crecimiento lento, asintomática, de consistencia
cualquier parte del cuerpo, particularmente en los tejidos blanda, aislada o lobulada, de base sésil o pediculada,
de cuello, este tumor es sumamente raro en la cavidad con un tamaño que varía de 1 a 2 cm, de color
bucal. Comprende entre el 2% y el 4% de todos los amarillento y superficie lisa, los vasos sanguíneos suelen
tumores de cabeza y cuello. Los lipomas son neoplasias ser evidentes sobre el tumor.1,5,6
benignas de células adiposas.1,2 Aparecen con mayor Los lipomas que se presentan en la cavidad oral pueden
frecuencia entre los 30 y 40 años de edad, teniendo aparecer en diversos sitios anatómicos tales como; las
mayor predilección por el sexo masculino que por el glándulas salivales mayores, mucosa bucal, labios,
femenino en una relación 2:5.3,4 lengua, paladar vestíbulo y piso de boca, se han descrito
lipomas y variantes del mismo en diversas localizaciones,

91
demostrando que el sitio más predominante es la a crecer, asintomáticas; sin embargo, refiere molestia al
lengua.5,7 hablar, comer y ocasionalmente las muerde, con
A pesar de que su etiología es desconocida, se sugiere evolución de 3 años, pero que han crecido últimamente.
factores como: traumatismo, infección, irritación crónica y (Figura 1b)
alteraciones hormonales, como posibles causas.8 A la exploración física se presenta, paciente de edad
Desde el punto de vista histológico, los lipomas están cronológica similar a la aparente normocefálica,
subdivididos en un número de entidades que pueden ser: implantación de cabello normal propia de su edad y sexo,
lipoma simple, angiolipoma, fibrolipoma, lipoma de tez morena, cabello castaño oscuro, conductos auditivos
células estrelladas o pleomórfico, miolipoma, permeables y simétricos, movimiento ocular normal,
mielolipoma, lipoma condroide, lipoma mixoide, pupilas, narinas permeables, labios simétricos, comisuras
lipoblastomatosis, lipomatosis, hibernoma y lipoma alineadas y simétricas, cuello delgado y cilíndrico,
atípico.7,9 ganglios no palpables, tráquea movible, no presenta
Microscópicamente el tumor consiste en células adiposas dolor (Figura 1a).
maduras, incluidas dentro de un tejido alveolar fino y A la inspección intraoral presenta, dentición permanente
rodeado por una cápsula fibrosa. Hay un estroma fibroso completa, arcos ovales, higiene oral regular, mucosa bien
que divide la grasa en lóbulos y contiene pequeños vasos humectada de color rosa coral, la lengua se presenta de
sanguíneos.3 tamaño mediano con movilidad adecuada, se observan
Dentro del diagnostico diferencial pueden incluirse otras dos tumoraciones menores a un centímetro de diámetro,
lesiones benignas de tejido conectivo, por ejemplo; el cada una ubicadas en la mucosa del labio inferior de lado
tumor de células granulares, neurofibroma, fibroma derecho (Figura 1b).
traumático y malformaciones de las glándulas salivares
(mucocele y tumor mixto).2,9
La eliminación quirúrgica de la lesión es el tratamiento de
elección. Rara vez se observan recurrencias y si
existieran se asocia a una extirpación incompleta de la
neoplasia.10,11
Figura 1. a) Aspecto extraoral de la paciente b) Aspecto de las
lesiones en labio inferior.

PRESENTACIÓN CASO CLÍNICO


Dentro de los exámenes complementarios se solicitaron
Paciente de sexo femenino de 31 años de edad, vive en
BH, QS, TP, TPT, que se reportaron dentro de los niveles
unión libre, originaria de Zitácuaro Michoacán, sin
normales.
antecedentes patológicos personales relevantes, refiere
En base a los hallazgos clínicos, se planteo como
madre con hipertensión arterial (Figura 1a).
diagnóstico posible lipoma intraoral, por lo que se decide
Se presenta a la clínica por aumento de volumen en dos
realizar la eliminación quirúrgica de la lesión.
zonas de la mucosa del labio inferior, de forma
Procedimiento
redondeadas, pequeñas y circunscritas, que comenzaron

92
Se realizó la asepsia y antisepsia de la zona utilizando (ketorolaco 10 mg, una tableta cada 8 horas por 3 días) y
pinzas de anillos y gasas estériles embebidas en se le dan indicaciones postoperatorias (Figura 5b).
antiséptico. Se inicia con la técnica de bloqueo
introduciendo solo el bisel de la aguja en la base de la
lesión (Figura 2)

Figura 4. Incisión en la base de la lesión.

Figura 2. Técnica de anestesia en la base de la lesión.

Con pinzas adson se sujetaron cada una de las lesiones


(Figura 3a) y con hilo de sutura seda tres ceros se
amarró desde la base a cada una de ellas (Figura 3b).

Figura 5. a) Sutura b) Cirugía de extirpación de lipoma concluida.

La paciente se presenta al control postquirúrgico para el


retiro de puntos presentando una evolución normal.
Se realiza seguimiento a seis meses donde se observa
evolución favorable y ausencia de recidiva.
Figura 3. a) Proceso de sujeción de la lesión, b) Lesión amarrada con
hilo de sutura. El consentimiento informado se obtuvo de la paciente
para la publicación del presente caso, al igual que las
La incisión se realiza con hoja de bisturí del número 15, imágenes que lo acompañan.
en forma de ojal desde la base de la lesión, eliminando el
tejido que está sujetado por el hilo de sutura (Figura 4). DISCUSIÓN
Posteriormente se lavó con solución fisiológica y se Los lipomas son tumores benignos del tejido adiposo
suturó con seda tres ceros (Figura 5a). mesenquimal maduro, raros en la cavidad oral. 1,12, 13

El procedimiento fue bien tolerado y sin complicaciones, Aún así deben de ser considerados dentro de los
por parte de la paciente, se prescribe analgésico posibles diagnósticos diferenciales que se planteen.

93
Fregnani et al, 3 Chikui et al,4 mencionan que la edad de tratamiento de elección de lipoma es la extirpación
aparición de las lesiones es entre los 30 y 40 años de quirúrgica. A menudo el pronóstico es bastante bueno,
edad, sin embargo Matheus et al,13 Romero & Orozco14 pero se considera necesaria la escisión amplia para
reportan pacientes de 50 y 55 años respectivamente que evitar recidivas.
presentaban los tumores, sin embargo, Salazar ST. et Se concluye considerando este caso de interés por
al,15 menciona en su estudio a paciente de 71 años con la tratarse de dos lesiones con una localización excepcional
lesión de lipoma presente en el labio inferior. Furlong et para este tipo de tumor, presentándose en una paciente
al,7 y Salazar et al,15 señala que los lipomas de la femenina, lo cual es de menor frecuencia para este tipo
cavidad oral pueden aparecer en diversos sitios tales de lesiones según la literatura, sin embargo coincide la
como glándulas salivales mayores, mucosa bucal, labios, edad de aparición.
paladar, sin embargo el sitio más predominante de
aparición es la lengua al igual que Salazar et al,15 Referencias

menciona que la localización más común es la lengua 1. Shafer W, Hine M, Levy B. Tratado de Patología Bucal.

seguido de piso de boca y mucosa yugal, contrario a lo Tercera Edición. Editorial Interamericana, México, 1977.
2. Regezi W, Sciubba JJ. Patología bucal. McGraw-Hill
que reporta Matheus et al,13 en su estudio donde el sitio
Interamericana. México 2000.
predominante es la mucosa bucal seguido de lengua,
3. Fregnani ER, Pires FR, Falzoni RM, Lopes MA, Vargas PA.
labios y piso de boca. El tratamiento de elección para los
Lipomas of the oral cavity: Clinical findings, Histological
lipomas incluyendo todas las variantes histológicas de la
classifications and proliferative activity of 46 cases. Int J Oral
neoplasia es la extirpación quirúrgica, como señalan Maxillofac Surg 2003;32:49-53.
Fregnani et al3, Lai-Ping et al10, y Mighell11 indicando su 4. Chikui T, Yonetsu K, Yoshiura K, Miwa K, Oseki S
baja tasa de recidiva. A pesar de esto, Orozco et al 5,
Shinohara M. Imaging findings of lipomas in the orofacial region
reportan que si bien el pronóstico es bastante bueno, se whit CT, US, and MRI. Oral Surg Oral Med Oral Pathol Oral
informa recidiva en pacientes menores de 18 años y el Radiol Endod 1997;84:88-95.

desarrollo de liposarcomas después de varias 5. Orozco S.M, Romero F.J, Lipoma de la cavidad bucal.
Reporte de un caso. Rev Esp Cir Oral Maxilofac 2009;31:329-
recurrencias, por lo tanto recomienda necesaria la
332.
escisión amplia con un margen de tejido sano, para
6. Trandafir D, Gog Iniceanu D,Trandafir V, C Runtu ID.
prevenir la recurrencia local.
Lipomas of the oral cavity a retrospective study. Rev Med Chir
Soc Med Nat lasi 2007;111:754-8.
CONCLUSIONES 7. Furlong MA, Fanburg-Smith JC, Childers EL. Lipoma of the
Es de suma importancia a pesar de su escasa oral and maxilofacial región: Site and subclassification or 125
frecuencia, la identificación del lipoma intraoral cases. Oral Surg Oral Med Oral Pathol Oral Radiol Endod
basándose en las características clínicas descritas 2004;98:441-50.
anteriormente, así como realizar el diagnóstico diferencial 8. Del Castillo JL, Cebrián JL, Gómez E. Chronic lingual

de otras lesiones benignas de tejido conjuntivo con ulceration caused by lipoma of the oral cavity. case report. Med
Oral 2004;9:163-6.
características similares presentes en boca. El

94
9. Sapp JP, Eversole LR, Wysocki GP, Patología Oral y 13. Matheus CB, Joubert M de P, Michele RN, Jose VO, and
Maxilofacial contemporánea. Harcourt. Madrid, 1998. Oral Soft Tissue Lipomas: A Case Series. JCDA 2007;73:431-
10. Lai-Ping Z, Shi-Fang Z, Chen GF, DDS, Fei-Yun P, Hang- 4.
zhou. Ultrasonographic appearance of lipoma in the oral and 14. Romero JF, Orozco MS, Lipoma de cavidad bucal. Reporte
maxillofacial region. Oral Surg Oral Med Oral Pathol Oral de un caso, Asc Mex de Cirugía Oral y Maxilofacial 2010;6:47-
Radiol Endod 2004;98:738-40. 50.
11. Mighell AJ. Lipoma, an unusual alveolar swelling. Br Dent J 15. Salazar ST. Reynaga L. Fourcans ML, Lipoma Intraoral.
1994;176: 225-6. Presentación de un caso y revisión de la literatura. Arch Argent
12. Ghandour K, Issa M. Lipoma of the floor of the mouth. Oral Dermatol 2006;56:115-118.
Surg Med Oral Pathol 1992;73:59-60.

95
Capítulo 18
ODONTECTOMÍA DE MESIODENS CON
EXTIRPACIÓN DE QUISTE DENTÍGERO:
REPORTE DE UN CASO.
Saraí López-González,1 Resumen
Silvia Cristina Manzur-Quiroga,2,3 Introducción: La presencia de dientes supernumerarios en la línea media maxilar,
Edith Lara-Carrillo,1 conocidos bajo el término de mesiodens, puede causar diferentes alteraciones tales como:
Brenda Jazmín Valdez-Vargas,1 malposición de dientes vecinos, erupción anómala o retraso de erupción de los incisivos
centrales superiores permanentes, diastema interincisal y formación de quistes, entre otros.
Erika Alejandra Jardón-Romero.4
El quiste dentígero es uno de los quistes odontogénicos más frecuentes y están asociados
con la corona de un diente no erupcionado o en desarrollo. En la región maxilar, el 90% de
(1) Profesor-Investigador. Facultad de
Odontología de la Universidad Autónoma del los casos se asocian a mesiodens. Presentación del caso: Se presenta el caso de un
Estado de México. Toluca, México. quiste dentígero asociado a un diente supernumerario (mesiodens) impactado en la región
(2) Profesor-Investigador. Facultad de maxilar de un paciente de sexo masculino, de 70 años de edad. Radiográficamente, el
Odontología de la Universidad Autónoma del quiste aparece como una imagen radiolúcida, unilocular, ovoide, bien delimitada, con un
Estado de México. Toluca, México. borde esclerótico. El presente informe de caso describe el manejo quirúrgico exitoso de un
(3) Directora General. Consejo Mexiquense quiste dentígero y revisión de la literatura. Conclusiones: La evaluación cuidadosa de la
de Ciencia y Tecnología. Toluca, México. historia clínica, así como los hallazgos clínicos y radiográficos, ayudan al clínico a
(4) Estudiante de Maestría en Ciencias diagnosticar la condición con precisión, identificar los factores etiológicos y administrar el
Odontológicas. Facultad de Odontología de la
tratamiento apropiado. Significancia clínica: Es importante realizar un diagnóstico
Universidad Autónoma del Estado de México.
Toluca, México. temprano de este tipo de quistes debido a la posibilidad de presentar complicaciones como
reabsorción de las piezas adyacentes, maloclusiones y su posible transformación maligna.

Correspondencia a: Cómo citar:


Dra. Edith Lara-Carrillo López-González S, Manzur-Quiroga SC, Lara-Carrillo E, Valdez-Vargas BJ, Jardón-Romero
Email: laracaedith@hotmail.com EA. Odontectomía de mesiodens con extirpación de quiste dentígero: reporte de un caso.
En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en
Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 96-100. ISBN:
978-607-8444-10-6

INTRODUCCIÓN 3.5%; son más frecuentes en hombres que en mujeres


Los dientes supernumerarios son aquellos que exceden en una proporción de 2:1, aunque algunos autores
la fórmula dental normal. Este fenómeno también se informan que esta proporción va desde 1.7:1 a 3.1:1. El
conoce como hiperodoncia y puede ocurrir en forma 80-90% aparece en el maxilar superior. La situación más
solitaria o múltiple, ser unilateral o bilateral, y afectar a habitual es que se encuentre incluido completamente y
uno o ambos maxilares. Un mesiodens es un diente sólo esté erupcionado en un 25% de los casos.3,4
supernumerario localizado en la región de los incisivos La etiología de dientes supernumerarios es multifactorial,
centrales superiores. Es el diente supernumerario más una combinación de medio ambiente y factores
común.1-4 genéticos.3-5
La prevalencia de dientes supernumerarios en dentición Algunos casos de dientes supernumerarios son
temporal es 0.3-0.8%, y en dentición permanente 1.5 a asintomáticos y se detectan casualmente en el curso de

96
un examen radiográfico. El examen clínico y radiográfico permanecen sin ninguna complicación clínica. La
es esencial para la detección de dientes supernumerarios mayoría predisponen el área a una subsiguiente
y la tomografía computarizada se ha introducido pericoronaritis, gingivitis, formación de abscesos y un
recientemente como método diagnóstico gran número de tumores y quistes odontogénicos. El
complementario. La radiografía periapical u oclusal es 95% de los quistes dentígeros están relacionados con
importante para el diagnóstico de dientes dientes permanentes y alrededor del 5% con dientes
supernumerarios en la región de los incisivos.1 supernumerarios.7
La complicación más frecuentemente asociada con el Los quistes dentígeros se desarrollan en el órgano
mesiodens es la sobreretención de la dentición primaria, adamantino de un diente no erupcionado. Son, por lo
impactación o erupción retardada de los incisivos tanto, quistes odontogénicos epiteliales consecutivos a
centrales superiores permanentes, puesto que al estar alteraciones del desarrollo. Aproximadamente el 95%, se
situado en la línea media impide la erupción de los relacionan con dientes permanentes y solo el 5-6% se
incisivos permanentes, los cuales no pueden entonces asocian con dientes supernumerarios. La mayoría se
realizar la normal exfoliación de los incisivos temporales, desarrolla en maxilar superior, alrededor de un
los cuales permanecerán más tiempo del normal en mesiodens. Los quistes dentígeros son más comunes en
boca.6 hombres y se observan más frecuentemente entre la
Otras complicaciones importantes son la impactación y/o segunda y tercera décadas de vida. La incidencia actual
erupción retardada de dientes vecinos; el de asociación con dientes impactados aumenta con la
desplazamiento, rotación o apiñamiento de los dientes edad.7-9 Una radiografía del quiste dentígero muestra una
anteriores; lesiones periodontales; dilaceración de las lesión unilocular radiolúcida bien definida, a menudo con
raíces en desarrollo o reabsorción radicular de los un borde esclerótico, que rodea la corona de un diente no
dientes vecinos como resultado de la compresión sobre erupcionado. La escisión quirúrgica y el análisis
las raíces de los mismos; formación de diastemas en la patológico de la lesión son esenciales para un
línea media del maxilar superior entre ambos incisivos diagnóstico definitivo.10
centrales; complicaciones quísticas, ya que el folículo El presente caso describe el manejo quirúrgico de un
que rodea al diente supernumerario puede dar lugar a la quiste dentígero junto con el diente retenido.
formación de un quiste folicular o dentígero.1,2,4,6
El tratamiento depende del tipo, posición y las posibles PRESENTACIÓN DEL CASO
complicaciones, identificadas tanto clínica como Paciente de sexo masculino de 70 años de edad, viudo,
radiológicamente. Aunque la extracción quirúrgica es el comerciante, que acude a consulta a la Clínica de Cirugía
tratamiento más común, otra opción es cambiar la de la Facultad de Odontología de la Universidad
posición de los dientes supernumerarios en el arco Autónoma del Estado de México, y refiere como motivo
dental.1 de consulta un aumento de volumen en la región de
Alrededor del 75% de los supernumerarios de la región premaxila, sin precisar fecha de aparición (Figura 1).
anterior no pueden erupcionar. Sólo del 7 al 20%

97
Figura 2. Radiografía oclusal superior. Se observa un diente
supernumerario en la línea media rodeado de una lesión radiolúcida
delimitada.

El tratamiento elegido fue la remoción quirúrgica del


quiste y el diente retenido. El procedimiento se realizó
dentro de la Clínica de Cirugía Bucal de la Facultad de
Odontología de la UAEM. Bajo anestesia local se realizó
Figura 1. Fotografía frontal preoperatoria del paciente.
incisión, levantamiento de colgajo y osteotomía por

En el examen clínico intraoral se observa proceso de vestibular de maxilar superior, se removió el diente

cicatrización postextracción en región de órgano dentario supernumerario y la lesión quística a su alrededor. Una

No. 13, sin salida de material patológico y crecimiento en vez extraído el mesiodens, se realizó el tratamiento de la

región vestibular. Radiográficamente, en una radiografía cavidad mediante legrado del alveolo residual con el fin

oclusal, se observa un diente supernumerario en línea de eliminar los restos de tejido dentario y tejido quístico.

media del maxilar rodeado de una lesión radiolúcida, de Posteriormente, se reposicionó el colgajo y suturó la

aproximadamente 0.4 mm de diámetro, bien delimitada, herida. Se colocaron puntos de sutura, hasta cerrar

que sugiere una lesión quística (Figura 2). totalmente la herida operatoria (Figuras 3 y 4).

Después del examen clínico y radiológico, y teniendo en


cuenta su relación con un diente retenido, se hizo un
diagnóstico presuntivo de quiste dentígero, y dada su
semejanza, con otras lesiones de apariencia quística, se
hizo diagnóstico diferencial con queratoquiste
odontogénico.

Figura 3. Remoción quirúrgica del quiste. A) Incisión; B)


Levantamiento de colgajo; C) Osteotomía; D) Irrigación y lavado.

98
adyacentes. La eliminación del diente supernumerario es
recomendable cuando existan pruebas de una patología
asociada, alteraciones de la erupción, el desplazamiento
de los incisivos o cuando ocurra una erupción
espontánea del diente supernumerario.9,10
Cuando la presencia de un diente supernumerario es
evidente, la dirección de la corona, ubicación, influencia
en los dientes adyacentes, reabsorción de raíces
adyacentes y la formación de quistes dentígeros deben
Figura 4. Extracción del mesiodens. A) Eliminación del tejido quístico;
B) Extracción propiamente dicha; C) Vista del mesiodens; D) ser cuidadosamente evaluados. El examen radiográfico
Reposición del colgajo y sutura.
convencional, incluye radiografías panorámica, oclusal y

El diente supernumerario (mesiodens) relacionado con el vistas periapicales, las cuales se utilizan para determinar

quiste, presentaba una corona de morfología su posición exacta, elaborar el plan de tratamiento

rudimentaria (morfología dismórfico o conoide), con raíz adecuado y la extirpación quirúrgica.10

corta y dirección invertida. El paciente recibió cobertura


antibiótica. CONCLUSIONES

El diagnóstico histopatológico se realizó en el laboratorio Los quistes dentígeros se asocian generalmente con

de patología del Centro de Investigación y Estudios dientes no erupcionados. Por lo tanto, es importante

Avanzados en Odontología de la UAEM, con el cual se llevar a cabo un examen radiográfico de todos los dientes

confirmó el diagnóstico de Quiste dentígero asociado a no erupcionados. La detección temprana requiere de un

un diente supernumerario (mesiodens). El paciente minucioso examen clínico y radiográfico para conseguir

acudió a citas de revisión durante los siguientes dos un diagnóstico preciso y evitar, en lo posible, las

meses sin desarrollar alguna complicación relacionada complicaciones asociadas a estos.

con el procedimiento quirúrgico. El consentimiento informado se obtuvo del paciente para


la publicación del presente caso al igual que las

DISCUSIÓN imágenes que lo acompañan.

La presencia de un diente supernumerario representa un


REFERENCIAS
gran potencial para interrumpir el desarrollo oclusal
1. Ata-Ali F, Ata-Ali J, Peñarrocha-Oltra D, Peñarrocha-Diago
normal, por lo cual se requiere una intervención temprana
M. Prevalence, etiology, diagnosis, treatment and complications
para obtener una alineación razonable y relación oclusal
of supernumerary teeth. J Clin Exp Dent 2014;6(4):e414-8.
adecuada. La remoción debe ser realizada tan pronto
2. Russell KA, Folwarczna MA. Mesiodens-Diagnosis and
como sea posible para evitar algún daño en el desarrollo Management of a Common Supernumerary Tooth. Can Dent
normal de los dientes.3 Assoc 2003;69(6):362–6.
El manejo de un diente supernumerario depende del tipo
y la posición del diente y su efecto sobre los dientes

99
3. Mittal M, Sultan A. Clinical management of supernumerary Presentación de casos. Ciencia Odontológica 2011868-78.
teeth: A report of two cases. J Indian Soc Pedod Prev Dent. Disponible en:
2010;3(28):219-222. http://www.redalyc.org/articulo.oa?id=205222068007.4.
4. Díaz-Ortiz ML, Vicente-Rodríguez M. Mesiodens: 8. Rodríguez Romero FJ, Cerviño Ferradanes S, Muriel Cueto
presentación de tres casos. Rev Pediatr Aten Primaria. P. Quiste dentígero asociado con mesiodens: Exposición de un
2010;12:79-87. caso, revisión de la literatura y diagnóstico diferencial. Av.
5. Qian J, Guang-Zhou X, Chi Y, Chuang-Qi Y, Dong-Mei H, Odontoestomatol 2011;27(6):289-299.
Zhi-Yuan Z. Dentigerous cysts associated with impacted 9. Baranwal HC, Verma PK, Dwivedi CD, Srivastava R.
supernumerary teeth in the anterior maxilla. Exp Ther Med Dentigerous cyst associated with an impacted maxillary
2011;2:805-9. mesiodens. Eur J Gen Dent 2012;1:50-3.
6. Naveen Kumar. M, Rama Devi. S, Shreenivas Vanaki. S, 10. John T, Guna-Shekhar M, Koshy M. Dentigerous Cyst
Puranik. R.S Dentigerous Cyst Occurring in Maxilla Associated Associated with supernumerary Teeth: A Report Of Three
with Supernumerary Tooth Showing Cholesterol Clefts-A Case Cases. Journal of Clinical and Diagnostic Research [serial
Report. Int J Dent Clin 2010:2(2): 39-42. online] 2010 June [cited: 2010 June 17]; 4:2601-2606.
7. Erdody M. G, López N. JC, Quezada R. D, Malanche A. G.
Quiste dentígero asociado a diente supernumerario.

100
Capítulo 19
TRATAMIENTO QUIRURGICO DE
PSEUDOQUISTE DE EXTRAVASACION EN EL
LABIO INFERIOR: REPORTE DE UN CASO.
César Tadeo Hernández-Martínez,1 Resumen
Marcela Reyes-García,1 Introducción: El mucocele es una lesión frecuente en la cavidad oral. La lesión se
Guadalupe Pedraza-Contreras,2 caracteriza por la acumulación de saliva como consecuencia de la ruptura de un conducto
Blanca Silvia González-López,2 salival, por un trauma. El mucocele según sus características histológicas puede ser por
extravasación o por retención de saliva, se presenta en cualquier grupo de edad y género,
Norma Leticia Robles-Bermeo.3
siendo más frecuente en niños y adultos jóvenes. Su pronóstico es favorable. Presentación
del caso: Paciente masculino de 8 años 3 meses de edad originario de Toluca de Lerdo,
(1) Estudiante de la Especialidad de
Estado de México, que acude a consulta en la clínica de la Especialidad de Odontopediatría
Odontopediatría. Facultad de Odontología de
la Universidad Autónoma del Estado de de la Universidad Autónoma del Estado de México, por presentar un aumento de volumen
México. Toluca de Lerdo, Estado de México., en mucosa labial inferior izquierda. A la anamnesis, la madre no refiere datos patológicos de
México. interés para el problema actual. Se decide extirpar la lesión, el diagnóstico reportado de
(2) Profesor. Especialidad de Odontopediatría acuerdo al estudio histopatológico fue de Mucocele “Fenómeno de extravasación”.
de la Universidad Autónoma del Estado de Conclusiones: El estudio histopatológico de las lesiones de los tejidos blandos es
México. Toluca de Lerdo, Estado de México., importante para descartar la presencia de neoplasias benignas o malignas de glándulas
México. salivales accesorias, el tratamiento oportuno de la lesión evita el crecimiento gradual y la
(3) Profesor-Investigador. Coordinadora del necesidad de cirugías más traumáticas para los pacientes jóvenes, asegurando un
Posgrado en Odontopediatría. Facultad de
Odontología de la Universidad Autónoma del
pronóstico favorable. Significancia clínica: El odontólogo de práctica general y el
Estado de México. Toluca, Estado de especialista en odontopediatría deben estar familiarizados con la identificación, estudio
México., México. morfológico y semiológico de las lesiones bucales. Además, tienen la responsabilidad de
enviar los tejidos obtenidos durante el proceso quirúrgico para su estudio histopatológico.

Correspondencia a: Cómo citar:


Dr. César Tadeo Hernández-Martínez Hernández-Martínez CT, Reyes-García M, Pedraza-Contreras G, González-López BS,
Email: cetahm@gmail.com Robles-Bermeo NL. Tratamiento quirúrgico de pseudoquiste de extravasación en el labio
inferior: reporte de un caso. En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E,
editores. Campeche: Universidad Autónoma de Campeche; 2015. p. 101-107. ISBN: 978-
607-8444-10-6

INTRODUCCIÓN anterior de lengua involucrando las glándulas de Blandin


El mucocele es una lesión común de la mucosa bucal, se Nunh,4 en mejilla,5,6 y en piso de boca.7
origina en glándulas salivales menores, por lo que puede En los pacientes jóvenes cuando el mucocele se ubica
aparecer en cualquier sitio de la mucosa bucal donde se en labio, se relaciona con un trauma menor que
asientan estas glándulas.1 El término mucocele es ocasiona la ruptura del conducto excretor de la glándula
utilizado para describir lesiones por extravasación y por salival causando extravasación de saliva al tejido
retención de saliva,2 el mucocele por extravasación se conectivo adyacente,2,5 también se ha descrito que el
encuentra principalmente en el labio inferior, lateralmente hábito de succión y mordisqueo pueden contribuir a la
a la línea media,3 se han reportado casos en vientre formación de la lesión.1 Mientras que el mucocele por

101
retención se origina por la obstrucción parcial o total del El mucocele consiste en una cavidad revestida por tejido
conducto excretor debido a la proliferación epitelial del de granulación,6 la pared está constituida por una
conducto o por la presencia de un sialolito que provoca proliferación de tejido conjuntivo en la que se puede
la retención de la secreción glandular y dilatación del observar un infiltrado inflamatorio representado por
conducto.8 Usualmente la obstrucción es parcial, en polimorfonucleares y en las lesiones de evolución crónica
ocasiones la obstrucción total, la persistencia de la lesión por linfocitos, células plasmáticas y macrófagos. Los
por años o las recurrencias provocan fibrosis y atrofia acinos glandulares pueden mostrar sialoadenitis y
de los acinos glandulares alterando la estructura y dilatación e hiperplasia de conductos salivales.6,2,13
fisiología glandular de forma irreversible.8 Se localiza Chunawalla14 refiere tres fases en el aspecto
usualmente en glándulas salivales mayores histopatológico del mucocele, en la primera se observa la
principalmente en la glándula submandibular, en esos presencia de polimorfonucleares y macrófagos,
casos la lesión se diagnostica como Ránula,9,10 aunque, particularmente en las áreas donde hay extravasación de
Pérez y cols.,11 reportaron un caso de mucocele por saliva. En tanto que en la segunda fase, etapa de
retención por la presencia de un sialolito en mucosa resorción, se puede observar un tejido de granulación
labial superior. con la presencia de macrófagos, células epitelioides y en
Una variante es el mucocele superficial, que se presenta ocasiones pueden identificarse células gigantes de tipo
como una vesícula tensa y clara de unos pocos cuerpo extraño. En la tercera fase es evidente la
milímetros de diámetro, de carácter asintomático, formación de una pseudocápsula, caracterizada por la
autorresolutivo y recidivante. Se localiza en la grasa proliferación de fibroblastos y capilares, aparición de
retromolar, en la mucosa oral posterior y en el paladar escasos linfocitos y células plasmáticas.
blando. Debe diferenciarse clínicamente de otros Para realizar el diagnóstico clínico, es necesario
procesos ampollosos, ya sean virales o inmunológicos.12 considerar las características clínicas de la lesión, la
El mucocele se observa principalmente en niños y información obtenida durante el interrogatorio, el
adultos jóvenes, no tienen predilección por género.3 antecedente de trauma, el vaciamiento de la lesión al
La lesión superficial aparece como un aumento de morderla o pincharla y su reaparición, el estudio
volumen, con un color azulado, superficie lisa, base histopatológico confirma el diagnóstico.1 El diagnóstico
sésil, fluctuante a la palpación, de varios milímetros a 1 ó diferencial incluye: al hemangioma, debido a que el
2 cm. de diámetro y asintomático.2 En tanto que la lesión mucocele superficial tiende a presentar una coloración
profunda se manifiesta como un aumento de volumen azul violácea similar a la observada en los
fluctuante, de superficie lisa y su coloración es similar a hemangiomas,6 no obstante que los hemangiomas
la de los tejidos adyacentes, debido al espesor de los generalmente se presentan hacia la línea media de la
tejidos que las cubren. Algunas lesiones pequeñas mucosa labial. 2
desaparecen sin necesidad de tratamiento.1 También debe descartarse la presencia de hiperplasia
fibrosa, 2 cuando los mucoceles son de implantación

102
profunda la forma clásica de lesión con contenido líquido glándulas marginales y sus conductos,1 así mismo se
se pierde y su superficie no es traslúcida. La frecuencia debe tener cuidado al momento de suturar de no lesionar
de neoplasias benignas y malignas en glándulas salivales las glándulas salivales adyacentes, lo que ocasionaría la
menores es baja, estos tumores pueden afectar reaparición de la lesión.3
pacientes en las primeras décadas de la vida, incluso se Las lesiones tratadas mediante marsupialización
han reportado casos de neoplasias malignas en lesiones recurren, no obstante se ha indicado que en las lesiones
que clínicamente fueron diagnosticadas como muy grandes es un procedimiento que puede ser
mucoceles.15,16 utilizado, con el propósito de evitar pérdida de tejido
En la literatura se describen diferentes opciones de disminuyendo el riesgo de dañar la rama labial del nervio
tratamiento como: cirugía convencional y ablación por mentoniano. Las lesiones de tamaño mediano y con
láser14, micromarzupialización,17 marzupialización,7 la pared gruesa pueden ser tratadas mediante excisión.5 En
criocirugía en combinación con la aplicación de ese caso el tejido debe ser enviado para su estudio
corticosteroides vía intralesional18 o en ungüentos.8 histopatológico para confirmar el diagnóstico.
Sin embargo, el número de fracasos asociados con
estas últimas técnicas es muy alto y la mayoría de los PRESENTACIÓN DEL CASO
pacientes requieren re-intervención para la completa Se reporta el caso de un paciente varón de 8 años y 3
remoción de la lesión, situación similar a la detectada en meses de edad originario de Toluca de Lerdo, Estado de
mucoceles que son tratados con incisión simple para México; que acude a la Clínica de la Especialidad de
drenar el contenido del mismo. Odontopediatría de la Universidad Autónoma del Estado
El tratamiento convencional es la extirpación quirúrgica de México, el motivo de consulta fue (sic) “tiene una
de la lesión y las glándulas adyacentes. Delbem,17 bolita en el labio” con un año de evolución. La historia
recomienda en pacientes pediátricos como tratamiento clínica no aporta datos de interés para el padecimiento
ideal la micromarzupialización, ya que es un actual. La inspección intrabucal reveló una lesión
procedimiento rápido y simple del que se obtienen elevada localizada en mucosa labial inferior izquierda.
buenos resultados, si se trata de un mucocele grande la Solitaria, de contorno redondo, de superficie lisa, de
marsupialización es la mejor opción para evitar el daño a bordes definidos, no reducible, de color azulado, de
tejidos cercanos. consistencia firme, de base sésil, de aproximadamente 3
El láser de CO2 tiene una tasa de absorción de agua alto mm3 de diámetro, fija a tejidos, que cursó con evolución
por lo que se absorbe bien en los tejidos con alto lenta, asintomática. Con historia de trauma y mordisqueo
contenido de agua, el daño a tejidos circundantes es en la región (Figura 1). Bajo anestesia local con
mínimo. Estas propiedades hacen del láser una de las lidocaína al 2% y epinefrina 1:100000 se procedió a
mejores opciones para tratar los mucoceles.14 realizar la escisión quirúrgica de la lesión; con una hoja
Las glándulas menores adyacentes a la lesión deben ser de bisturí número 15, se realizó una incisión en forma
removidas cuidadosamente para evitar el daño a las elíptica (Figura 2), posteriormente se cortó la base de la

103
lesión cuidadosamente para evitar perforar el mucocele Se procedió a eliminar las glándulas circundantes para
(Figura 3). prevenir recidivas y se suturó con seda 3-0 con puntos
aislados (Figura 4).

Figura 1. Se observa el aumento de volumen localizado en mucosa


del labio inferior izquierda.
Figura 4. Sutura mediante puntos aislados con seda 3-0.

El tejido fue fijado en formol buferado al 10% y remitido


para su estudio histopatológico al Laboratorio de
Patología del CIEAO de la Facultad de Odontología de la
Universidad Autónoma del Estado de México obteniendo
el siguiente resultado.
Descripción microscópica
Tejido blando cubierto por una capa de epitelio escamoso
estratificado paraqueratinizado hiperplásico que alterna
Figura 2. Incisión con hoja de bisturí número 15 en forma elíptica con áreas de atrofia. Límites basales definidos. El tejido
abarcando la totalidad de la extensión de la lesión.
conectivo colagenizado subyacente, presentó una
cavidad revestida por tejido de granulación que en su luz
presentó polimorfonucleares. La pared de la lesión
constituida por fibroblastos proliferantes, mostró un
infiltrado inflamatorio constituido por escasos linfocitos,
células plasmáticas, macrófagos y capilares proliferantes,
algunos con datos de congestión y presencia de
hemosiderina (Figura 5). Se observaron escasos acinos
glandulares de tipo mucoso, con cambios degenerativos
y un conducto salival fragmentado hiperplásico que en su
Figura 3. Aspecto macroscópico de la lesión.
luz contenía polimorfonucleares. Diagnóstico

104
histopatológico: Mucocele, fenómeno de extravasación recidiva ni aparición de nuevas lesiones en el área
en mucosa labial inferior izquierda. (Figura 7).
El consentimiento informado se obtuvo de los padres del
paciente para la publicación del presente caso al igual
que las imágenes que acompañan.

CONCLUSIONES
La causa de la lesión, las manifestaciones clínicas y los
A B hallazgos histopatológicos del caso que se reporta fueron
Figura 5. A) Cavidad revestida por tejido de granulación (Flecha) B) similares a los referidos en la literatura.
Epitelio escamoso estratificado, límites básales definidos, tejido
fibroconectivo proliferante y ligero infiltrado linfocitario. La frecuencia del mucocele en niños y adolescentes es
alta, es de suma importancia que el odontólogo de
práctica general y el odontopediatra identifiquen esta
lesión, su etiopatogenia y manifestaciones clínicas, para
sugerir el tratamiento más adecuado, tienen además la
responsabilidad de enviar la lesión a su estudio
histopatológico,1 para descartar la presencia de
neoplasias benignas, malignas u otro tipo de patologías.19
Durante el interrogatorio es factible identificar las posibles
causas del mucocele que incluyen: Hábitos orales como:
Figura 6. Se retiran puntos a los 10 días. mordisqueo de los labios, chupar los labios, proyección
de la lengua hacia los dientes, mordisqueo de la mejilla,
incluso se ha mencionado que la irritación crónica del
tejido por el calor extremo del cigarrillo pueden contribuir
al desarrollo de la lesión. La colocación de piercings en
los labios, antecedente de lesión deportiva, lesión
mecánica durante el proceso de la masticación cuando el
tejido del labio inferior queda atrapado entre los dientes
anteriores o por malposición de los dientes adyacentes
que además, pueden provocar irritación crónica. El uso

Figura 7. Cita de control 15 días después de la cirugía. de chupetes durante la erupción de los dientes, en esa
etapa los tejidos bucales se vuelven muy sensibles y los
Se citó al paciente para retirar los puntos a los diez días niños tratan de aliviar los síntomas al morder el chupete
(Figura 6) y a los 15 días no se observan signos de con fuerzas excesivas que conducen al daño de los

105
tejidos del labio. Así como, los procedimientos 5. Senthilkumar B, Nazargui-Mahabob M. Mucocele: An
quirúrgicos en la cavidad bucal que causan trauma a la unusual presentation of the minor salivary gland lesion. Pharm

glándula. Bioallied Sci 2012;4:180-182.


6. Pérez C, Jiménez C. Mucoceles con localizaciones
En los recién nacidos se pueden observar mucoceles
inusuales. Reporte de casos. Acta odontol venez 2002;40.
debido a la succión de los dedos durante la gestación, o
disponible en:
si el bebe se encuentra succionando los dedos durante el
http://www.actaodontologica.com/ediciones/2002/2/mucoceles_
paso por el canal del parto, por el uso de fórceps o por
localizaciones_inusuales.asp Fecha de consulta 15 Mayo
los procedimientos de aspiración de la boca del bebé 2015.
después del nacimiento. 7. Boneu-Bonet F, Vidal-Homs E, Maizcurrana-Tornil A,
González-Lagunas J. Submaxillary gland mucocele:
AGRADECIMIENTOS presentation of a case. Med Oral Patol Oral Cir Bucal
Agradecemos al CDMF. David Villanueva Jurado por su 2005;10:180-184.

apoyo durante el procedimiento quirúrgico. 8. Costa H. Tratamiento tópico del mucocele oral. Folia
Dermatol 2003;14:9-14.
Al EEP. Luis Javier Guadarrama Quiroz por su
9. Leyva-Pérez M, Lahera-Valdés JA, Díaz-Díaz D, Pérez-
colaboración durante el manejo y rehabilitación del
Pérez O. Ránula del suelo de la boca. A propósito de un caso.
paciente.
Revista Habanera de Ciencias Médicas 2005;4:1-8.
Agradecemos al paciente y a su madre, por su
10. Baharvand M, Sabounchi S, Mortazavi H. Treatment of
autorización para reportar el caso. Labial mucocele by injection of dexamethasone: Case series. J
Dent Mater Tech 2014;3:128-133.
REFERENCIAS 11. Pérez-Castro L, Yoris-Pérez O, Molina-Delgado C, Pérez-
1. Danelon M, Lodi CS, Favretto CO, Crivelini MM, Cunha RF, Pernalete C. Quiste de retención mucoso por sialolitiasis en
Delbem ACB. Diagnóstico e Tratamento de Mucocele em labio superior. Reporte de un caso. Ciencia odontológica
Odontopediatria: Relato de caso. Arch Health Invest 2013;2:47- 2007;4:1-9.
53. 12. Valdivielso-Ramos M, Mauleón C, Balvín E, de la Cueva P,
2. Bhargava N, Agarwal P, Sharma N, Agrawal M, Sidiq M, Hernanz JM. Mucocele en la mucosa labial. Acta Pediatr Esp
Narain P. An Unusual Presentation of Oral Mucocele in Infant 2008;66:502-503.
and its Review. Case Reports in Dentistry 2014; Article ID 13. Gupta B, Anegundi R, Sudha P, Gupta M. Mucocele: Two
723130, localizable en case reports. J Oral Health Comm Dent 2007;1:56-58.
http://www.hindawi.com/journals/crid/2014/723130/ Fecha de 14. Chunawalla Y, Morawala A, Talathi R, Nandam A. Oral
consulta 15 Mayo 2015. mucocele: A neoteric aproach in children using CO2 laser. J
3. Ata-Ali J, Carrillo C, Bonet C, Balaguer J, Peñarrocha M, Dent Lasers 2015;9:44-47.
Peñarrocha M. Oral mucocele: review of the literatura. J Clin 15. Hernández-Granados R, Mérida-Méndez C, Guarneros-
Exp Dent 2010;2:18-21. López P, Aldape-Barrios B. Carcinoma mucoepidermoide.
4. González J, Moret Y, Calzadilla D, Márquez J, Restuccia G. Revista ADM 2010;67:181-184.
Mucocele en glándulas de Blandin-Nuhn o glándulas linguales
anteriores – Reporte de un caso. Acta Odontol Venez;49:1-7.

106
16. Ávila RE, Samar ME, Camps D, Fernández R, Fernández 18. Twetman S, Isaksson S. Cryosurgical treatment of
JE. Tumores de glándulas salivales menores. Estudio mucocele in children. Am J Dent 1990;3:175-6.
retrospectivo de 46 casos. Rev Esp Patol 2008;41:23-29. 19. Pires FR, Pringle GA, de Almeida OP, Chen SY. Intra-oral
17. Delbem AC, Cunha RF, Vieira AE, Ribeiro LL. Treatment of minor salivary gland tumors: a clinicopathological study of 546
mucus retention phenomena in children by the micro- cases. Oral Oncol 2007;43:463-470.
marsupialization technique: Case reports. Pediatr Dent
2000;22:155-8.

107
Capítulo 20
ODONTOMA COMPUESTO, MANEJO DEL
PACIENTE CON TRASTORNO POR DÉFICIT DE
ATENCIÓN E HIPERACTIVIDAD: REPORTE DE
UN CASO.
Leliette Deyanira Bravo-López,1 Resumen
Norma Leticia Robles-Bermeo,2 Introducción: El trastorno por déficit de atención e hiperactividad se caracteriza por la falta
David Villanueva-Jurado.3 de atención generalizada, hiperactividad e impulsividad lo que resulta en un desafío para el
profesional en la atención odontológica y requiere de una atención especializada basado en
1) Estudiante de la Especialidad en un protocolo de atención. Se presenta un reporte sobre el abordaje quirúrgico de un
Odontopediatría. Facultad de Odontología de odontoma en un paciente diagnosticado con trastorno por déficit de atención. Presentación
la Universidad Autónoma del Estado de del caso: Paciente de sexo masculino de 11 años 8 meses de edad, con diagnóstico de
México. Toluca, México. base desde hace 3 años de trastorno por déficit de atención e hiperactividad y trastorno
(2) Coordinadora de la Especialidad en negativista desafiante controlado con atomoxetina 50 mg cada 24 horas y risperidona 2 g
Odontopediatría de la Facultad de cada 24 horas, que acude a la Clínica de la Especialidad en Odontopediatría de la Facultad
Odontología de la Universidad Autónoma del de Odontología de la Universidad Autónoma del Estado de México. A la exploración clínica
Estado de México. Toluca, México.
se observa persistencia del canino temporal y el canino permanente retenido con dos
(3) Profesor de la Especialidad en
Odontopediatría. Facultad de Odontología de tercios de raíz formados, se dio un diagnóstico presuntivo de Odontoma compuesto. Se hizo
la Universidad Autónoma del Estado de el abordaje quirúrgico considerando el manejo estomatológico de los pacientes con
México. Toluca, México. trastorno de conducta. Conclusión: La atención integral del paciente pediátrico en los
casos de trastornos neuronales que se acompañan de alteraciones dentomaxilares es de
gran importancia ya que esto permite el mejor desarrollo y rehabilitación de estos casos.
Correspondencia a: Significancia clínica: Es primer reporte de abordaje quirúrgico de un odontoma compuesto
Dra. Leliette Deyanira Bravo-López siguiendo un protocolo de atención en el paciente con trastorno por déficit de atención e
Email: lel_iet11@hotmail.com hiperactividad con comorbilidad.

Cómo citar:
Bravo-López LD, Robles-Bermeo NL, Villanueva-Jurado D. Odontoma compuesto, manejo
del paciente con trastorno por déficit de atención e hiperactividad: reporte de caso. En:
Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en
Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 108-113. ISBN:
978-607-8444-10-6

INTRODUCCIÓN presentan trastorno comórbido como el trastorno


El trastorno de hiperactividad y déficit de atención negativista desafiante (TND), se describe como un patrón
(TDAH) es un trastorno neuroconductual que se recurrente de conductas no cooperativas, desafiantes,
caracteriza por la falta de atención generalizada, negativas, irritables y hostiles hacía cualquier figura que
hiperactividad e impulsividad.1 Es el trastorno represente la autoridad.3 Las principales características
neuropsiquiátrico más común a nivel mundial en la que tienen los pacientes con ambos trastornos
población pediátrica con una prevalencia de 3-7%.2 diagnosticados se reflejan en un bajo rendimiento
Hasta dos terceras partes de los pacientes con TDAH escolar, problemas sociales y familiares de manera

108
general.4 Se han observado que los niños con TDAH por tanto, hay poca semejanza con la forma del diente
tiene mayor índice de dientes cariados, obturados y normal. Está formado por múltiples dentículos
perdidos (CPOD), acúmulo de placa dentobacteriana, malformados. El 50% se localiza en la región posterior
gingivitis y cálculo dental que se asocian a la pobre mandibular.
habilidad, motivación, falta de atención para seguir 2) Odontoma compuesto: es un conglomerado de
indicaciones a la hora de realizar la higiene bucal. El esmalte, dentina, cemento y pulpa. La mayoría se
equilibrio y la estabilidad tienden a verse afectada en los localiza en la región incisivo-canina del maxilar superior.
niños con TDAH, haciéndolos susceptibles a lesiones Para el odontopediatra resulta un reto el manejo de un
dentales traumáticas. Los medicamentos estimulantes niño con TDAH por las características propias del
pueden producir efectos secundarios como boca seca, trastorno; no prestan atención a la indicaciones, no
sensación de alteración del gusto, además, estos niños siguen instrucciones, son impulsivos, no saben esperar
pueden estar tomando medicamentos en forma de su turno, hablan y se mueven en exceso y puede resultar
jarabe, que puede contener altas concentraciones de en el fracaso del tratamiento dental en la consulta y a la
azúcar, haciéndolas susceptibles a la caries dental, y hora de dar instrucciones tan simples como la higiene
pueden tener bruxismo debido a la ansiedad.5 dental. Si el profesional no está preparado se verá
No se tiene reportes de que haya tumores benignos reflejado aumentando la tensión, ansiedad y temores del
asociados al trastorno por déficit de atención e paciente, por eso se debe estar familiarizado con las
hiperactividad, un odontoma es una neoplasia benigna características comunes del niño de acuerdo a la edad.9
mixta de origen odontógeno, es decir, es una lesión de Es importante conocer el manejo del paciente
células odontogénicas epiteliales y mesenquimatosas, diagnosticado con TDAH que presenta odontoma; este
completamente diferenciadas y que forman esmalte, tumor odontogénico requiere de un tratamiento quirúrgico
dentina y cemento.6 Son los tumores odontogénicos más con técnica especializada y cuidados postoperatorios que
frecuentes. La etiología es desconocida pero se relaciona pueden resultar complicados en pacientes con trastornos
con factores traumáticos, infecciosos, factores de conducta, en este reporte de caso se explicará el
hereditarios, alteraciones durante la embriogénesis, manejo odontológico que se da para la escisión
hiperactividad odontoblástica y mutaciones genéticas.7 quirúrgica de un odontoma compuesto en paciente con
Representa más del 50% de los tumores odontogénicos; trastorno por déficit de atención y trastorno negativista
con lesiones hamartomatosas frecuentes; habitualmente desafiante.
son asintomáticos, diagnosticándose de forma casual
mediante exámenes radiográficos de rutina, o bien a PRESENTACIÓN DEL CASO
partir de algún signo, como retraso de la erupción Paciente de sexo masculino de 11 años 8 meses de
dentaria.8 edad, con diagnóstico de base desde hace 3 años de
Se distinguen dos tipos histológicos: trastorno por déficit de atención e hiperactividad y
1) Odontoma complejo: que corresponde a una alteración trastorno negativo desafiante controlado con atomoxetina
de la odontogénesis. La morfodiferenciación es escasa y, 50 mg cada 24 horas y risperidona 2 g cada 24 horas,

109
que acude a la Clínica de la Especialidad en hallazgo de la lesión, explicar el tratamiento.
Odontopediatría de la Facultad de Odontología de la La exploración clínica se apoyó por refuerzo positivo y
Universidad Autónoma del Estado de México. A la tiempos fuera donde se dejaba al paciente realizar una
exploración clínica se observa dentición mixta y actividad de su agrado (Figura 3).
persistencia del canino temporal derecho superior (Figura
1), como parte del auxiliar de diagnóstico se tomó una
radiografía periapical y una radiografía panorámica, se
observó una imagen mixta, radiolúcida y radiopaca, con
borde radiolúcido definido y múltiples zonas radiopacas
en su interior, también se ve la persistencia del canino
temporal y el canino permanente retenido con dos tercios
de raíz formados (Figura 2), se dio un diagnóstico
presuntivo de Odontoma compuesto. La conducta fue
cooperadora la primera cita pero no se logró la
comunicación y atención deseada en la exploración.

Figura 3. Manejo de conducta permitiendo con juguete que capta el


interés del paciente.

Figura 1. a) Imagen clínica del maxilar superior, b) Persistencia del


canino temporal.
Se hizo un breve paseo por la clínica dental para que se
familiarizara con el diseño, mobiliario y personal.
En las próximas citas se habló de manera clara, con
términos sencillos, asegurándonos de tener su atención y
viéndolo a los ojos.
Se progresó gradualmente con el tratamiento partiendo
de lo más fácil como profilaxis y aplicaciones de fluoruro
hasta la programación de la cirugía.
La cita fue matutina porque el paciente está menos
Figura 2. a) Radiografía dentoalveolar, b) Ortopantomografía se fatigado. Se ignoraban comportamientos no adecuados
observa lesión mixta asociado a canino retenido.
para que no trascendieran pero siempre se reforzaba los
Consideraciones del manejo estomatológico en el comportamientos adecuados.
paciente con TDAH: Tratamiento quirúrgico:
La primera cita suele ser la más importante, se le dio el Previo consentimiento informado de los padres del
tiempo suficiente a los padres para poder explicar el paciente, se realizó asepsia y antisepsia de la región. Se

110
aplicó anestesia local (lidocaína y epinefrina al 2%), se Se reposicionó colgajo y se fija con puntos simples en la
extrajo el órgano dentario temporal (Figura 4), se realizó liberatriz y colchonero horizontal de forma interpapilar
incisión semi-newmann con una liberatriz distal y se con sutura no reabsorbible (vicryl 4-0) (Figura 6). Los
procedió al levantamiento de colgajo mucoperióstico. Se tejidos extraídos fueron colocados en formol al 10% para
hizo osteotomía, lo que permitió observar una lesión bien su estudio histopatológico. La prescripción médica fue a
delimitada por una cubierta fibrosa, procediéndose a la base de Amoxicilina con ácido clavulánico y paracetamol,
enucleación de la misma por medio de disección roma; vía oral. Las indicaciones postoperatorias se extienden
de su interior se extrajeron cinco dentículos (Figura 5). de forma verbal y por escrito.
En el control postoperatorio, siete días después del
procedimiento quirúrgico se observaron los tejidos
blandos en buen estado y en proceso de cicatrización, a
pesar de tratarse de material absorbible retiramos las
suturas.
El reporte histopatológico refiere que se trata de un
odontoma compuesto por lo que se confirmó el
diagnóstico presuntivo.

Figura 6. Reposición de tejidos y puntos simples de sutura.

Figura 4. a) Odontectomía del canino persistente, b) Levantamiento El consentimiento informado se obtuvo de la madre del
de colgajo semi-newman.
paciente para la publicación del presente caso al igual
que las imágenes que lo acompañan.

DISCUSIÓN
La atención en la Clínica de Odontopediatría de la
Universidad Autónoma del Estado de México es brindada
Figura 5. a) Enucleación del odontoma, b) Cinco dentículos a pacientes sanos, pacientes con compromiso sistémico,
enucleados.

111
trastornos neuronales o del desarrollo que cursan con reportes anteriores y por las consecuencias descritas en
una patología craneodentofacial. El paciente reportado la literatura que consisten en interferir con la erupción de
en el caso clínico está diagnosticado con trastorno por algún órgano dentario permanente como el caso de
déficit de atención y trastorno negativista desafiante que paciente reportado, otras consecuencias pueden resultar
según estudios en la literatura científica se ha reportado en desplazamiento de dientes adyacentes y origen a
al TND como la enfermedad comórbida más frecuente quistes dentígeros.
asociada al TDAH.10 En Latinoamérica el trastorno por
déficit de atención se considera un problema de salud CONCLUSIONES
social porque afecta a más de 36 millones de personas2 y El reporte de este caso sirve como referencia
en la consulta dental es un reto para el profesional el bibliográfica del manejo de pacientes con trastorno de
manejo debido a la conducta del paciente, basado en déficit de atención y trastorno negativista desafiante en la
sugiere que la conducta que presentan suele verse consulta dental, se demuestra la importancia de realizar
reforzada cuanta más atención se le presta; por lo tanto un diagnóstico adecuado sobre tumores odontogénicos
las conductas normales quedan desatendidas en estadios tempranos, el abordaje quirúrgico sin olvidar
completamente, una técnica muy aceptada es cambiar que son pacientes con falta de atención, hiperactividad e
estas preferencias, ignorar la mala conducta y reforzar impulsividad así como la evolución del caso y la
los comportamientos adecuados,5 en el caso clínico se corroboración a través de estudio histopatológico para la
hacía refuerzo positivo y modelaje. En las características resolución final y el seguimiento.
clínicas bucales del paciente se observa signos de
bruxismo, que según estudios se ha encontrado en un REFERENCIAS

4.7% de los pacientes con TDAH,11 el odontoma 1. Diagnostic and statistical manual of mental disordes (DSM-

reportado en el paciente del presente caso no es V). Washington, D.C. American Psychiatric Association;2013.
2. Barragán PE, de la Peña OF, Ortiz LS, Ruiz GM, Hernández
característico del trastorno, de hecho no existen reportes
AJ, Palacios CL, Suárez RA. Primer consenso latinoamericano
de que exista una relación entre ambas patologías; pero
de trastorno por déficit de atención e hiperactividad. Bol Med
si existen reportes como el de Bucher y cols. en 200612
Hosp Infant Mex 2007;64:326-343.
que examinó muestras de 1 8000 tumores odontogénicos
3. Barkley RA: Defiant Children: a clinician´s manual for parent
teniendo como resultado que más del 75% training. New York; Guilford Press. 1987.
representaban los odontomas y según Hisatomi y cols. 4. Bimstein Enrique, Wilson Jonh, Guelmann Marcio, Primosch
en el 200213 demostró que el odontoma compuesto se Robert. Oral characteristics of children with attention déficit
detecta a más temprana edad que el complejo, el hyperactivity disorder. Spec Care Dentist 2008;28:107-110.
odontoma se encontró localizado en el maxilar 5. Quijano-Villavicencio GM, Valdivieso-Vargas Machuca M.

asintomático; la mayoría de los estudios realizados Déficit de atención e hiperactividad: un reto para el
odontopediatra. Rev Estomatol Herediana 2007;17:40-43.
reportan un claro predominio por el maxilar, el 57% de los
6. Vázquez Diego J, Gandini Pablo C, Carbajal Eduardo E.
odontomas no generan síntomas. El tratamiento de
Odontoma compuesto: diagnóstico radiográfico y tratamiento
elección es la enucleación del tumor basada en los
quirúrgico de un caso clínico. Av Odontoestomatol

112
2008;24:307-312. 11. Blomqvist M, Holmberg k, Fernell E, Ek U, Danllo G. Oral
7. Owens BM, Schulman NJ, Mincer HH, Turner IE, Oliver FM. health dental anxiety and behavior management problems in
Dental odontomas: a restrospective study of 104 cases. J Clin children with ADHD. Eur J Oral Sci 2006;114:385-390.
Ped Dent 1997;21:261-264. 12. Buchner A, Merrell PW, Carpenter WM. Relative frequency
8. Orellana Centeno Mauricio y col. Odontoma compuesto caso of central odontogenic tumors: a study of 1,088 cases from
clínico. Rev ADM 2013;70(5):258-262. Northern California and comparison to studies from other parts
9. Sapp JP, Eversole LR, Wysocki GP. Patología oral y of the world. J Oral Maxillofac Surg 2006;64:1343-1352.
maxilofacial contemporánea. Harcourt; Madrid; 2004:147-149. 13. Hisatomi M, Asaumi JI, Konouchi H, Honda Y, Wakasa T,
10. Biederman J, Spencer TJ, Newcorn JH, Gao H, Milton DR, Kishi K. A case of complex odontoma associated with an
Feldman PD, et al. Effect of comorbid symptoms of oppositional impacted lower deciduous second molar and analysis of the
defiant disorder on responses to atomoxetine in children with 107 odontomas. Oral Dis 2002;8:100-105.
ADHD: a metaanalysis of controlled clinical trial.
Psychopharmacology 2007;190:31-41.

113
Capítulo 21
FIBROMATOSIS GINGIVAL HEREDITARIO:
REPORTE DE UN CASO.
Julio Benítez-Pascual,1 Resumen
Daniel Lizárraga-Rodríguez,1 Introducción: La Fibromatosis Gingival Hereditaria, es una enfermedad poco frecuente,
Berta Padilla-Suzuki,1 asociada a factores genéticos y se presenta como un crecimiento descontrolado de la
Rosa García-Jau,1 encía en pacientes con dentición mixta. La fibromatosis gingival hereditaria (FGH), es una
enfermedad genéticamente heterogénea, proliferativa, de carácter benigno, con una
Lourdes Verdugo-Barraza.1
incidencia de 1 en 750.000. Se puede presentar como caso aislado o con características
que manifiesten que esté acompañado de un síndrome como el de Zimmerman-Laband.
(1) Profesor-Investigador. Facultad
Odontología. Universidad Autónoma de Puede provocar desplazamiento dental, de la dentición primaria, secundaria, maloclusión,
Sinaloa. Culiacán, México. retraso en la erupción dentaria, problemas de fonación y estética, de ahí la importancia de
su detección temprana. En Sinaloa es el segundo caso que se reporta. Presentación del
caso: Paciente femenina de 12 años de edad, originaria de Culiacán, Sinaloa, con
Correspondencia a: dentición mixta, aumento de volumen en la encía de tipo fibroso, que cubre el 90% de la
Dr. Julio Benítez-Pascual corona clínica, color rosa intenso, con problemas de maloclusión, masticación y estética,
Email: bpj10@hotmail.com diagnosticada como fibromatosis gingival hereditaria. Tratamiento: se realizó
gingivoplastía y gingivectomía, para eliminar el tejido fibroso, se dio seguimiento durante
3 meses. Conclusiones: Al realizar gingivoplastía y gingivectomía como tratamiento de
elección la paciente redujo notablemente su deficiencia de fonación, masticación y
estética; además de prepararla para su remisión al ortodoncista para resolver su problema
de maloclusión. Significancia clínica: realizar un diagnóstico diferencial temprano en
estos casos, permite brindar al paciente un tratamiento adecuado, restableciendo la
realización de las funciones del aparato estomatognático y por ende mejor la calidad de
vida de estos pacientes.

Cómo citar:
Benítez-Pascual J, Lizárraga-Rodríguez D, Padilla-Suzuki B, García-Jau R, Verdugo-
Barraza L. Fibromatosis gingival hereditaria: reporte de un caso. En: Medina-Solís CE,
Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en Odontología.
Campeche: Universidad Autónoma de Campeche; 2015. p. 114-118. ISBN: 978-607-
8444-10-6

INTRODUCCIÓN dos familias, la mayoría con un coeficiente intelectual


La fibromatosis gingival hereditaria, fue descrita por normal.1 Las hiperplasias gingivales (HG) son causa
primera vez por Laband y cols., en 1964, en una familia común de atención odontológica, asociándose a
hindú, con una madre y 5 de 7 hijos presentaron enfermedad periodontal, uso prolongado de
fibromatosis gingival y ausencia o displasia de uñas. En medicamentos así como enfermedades hereditarias.2,3 La
1965 Alavandar realizó una descripción similar en un fibromatosis gingival hereditaria (FGH) es una
paciente del Caribe. Chodirker en 1968 describe por enfermedad genéticamente heterogénea, proliferativa, de
primera vez la asociación al retraso mental. Van carácter benigno, con una incidencia 1 en 750.000 se
Buggenhout en 1995 reporta una serie de 11 casos de manifiesta como aumento de volumen de la encía de

114
forma generalizada, provocando dificultad para hablar tratamiento con fármacos como los anticonvulsivantes y
masticar y retraso en la erupción dental, puede originarse al síndrome de Zimmerman-Laband.
por el uso de medicamentos, como los TRATAMIENTO
anticonvulsivantes, o puede ser hereditaria y ser parte de La resección quirúrgica como la gingivectomía y
un síndrome genético, también puede ser un caso gingivoplastía son sin duda el tratamiento de elección y
aislado con antecedentes familiares, se reportan formas tienen como objetivo disminuir el grosor y la altura de los
de herencia recesiva, estudios del ligamento periodontal tejidos gingivales, la selección de la técnica depende de
han localizado lugares de herencia autosómica las características del paciente y de la severidad del
dominante no sindromática en los cromosomas 2p21- caso.11 Kelekis y cols., reportan que la recurrencia es
p22,2p.3-p23.3 y 5q13-q22, identificando también una común.12
mutación del gen SOS1 en el locus GINGF1 como el gen
causante de la enfermedad, la base molecular sigue PRESENTACION DEL CASO
siendo desconocida y poco estudiada.4 Por lo general Paciente femenina de 12 años de edad originaria y
coincide con la erupción de los dientes permanentes sin residente de la ciudad de Culiacán Sinaloa México,
tener predilección por algún genero sexual, y la acude a la Facultad de Odontología de la Universidad
manifestación de la enfermedad puede estar dada por la Autónoma de Sinaloa, “por problemas para masticar”, al
penetración del gen mutado.5,6 interrogatorio la madre refiere que fue producto del
CARACTERISTICAS CLÍNICAS DE LA FGH primer embarazo de una familia de tres hermanos, al
La encía se observa de aspecto nodular con bordes examen físico presenta desarrollo psicomotor normal, al
ondulados y romos, a la palpación, la consistencia es examen extraoral presenta facies alargada, pabellones
firme y densa con textura lisa, su color es rosa intenso, la auriculares prominentes, perfil cóncavo, cabello
superficie irregular o de forma nodular y asintomática, el abundante bien implantado, labios gruesos con
crecimiento excesivo gingival genera problemas incompetencia labial y nevos (Figura 1).
funcionales y estéticos.7,8
CARACTERISTICAS HISTOLOGICAS DE LA FGH
Histológicamente presenta un epitelio denso con papilas
epiteliales largas que se extienden profundamente en el
tejido conectivo subyacente, en el tejido conectivo es
común encontrar abundantes fibras de colágeno y
fibroblastos.9.10
DIAGNÓSTICO DIFERENCIAL
Es importante realizar diagnóstico diferencial con la
fibromatosis gingival idiopática, causas iatrogénicas,
presencia de hiperplasia gingival asociada a leucemias,
Figura1. Fotografía lateral de la paciente.

115
Al examen intraoral se observa agrandamiento gingival displasia de falanges pulgares-hallux y defectos
generalizado, tanto en maxilar superior como en vertebrales). Se realizaron además estudios de
mandíbula, de consistencia firme sin dolor ni sangrado, laboratorio de rutina y se tomó una biopsia incisional.
con placa dentobacteriana el cual cubre al 90% de la
corona clínica (Figura 2), revelando áreas de irritación
mucosa, lo cual provoca problemas a la masticación y
fonación; así como, problemas estéticos y psicosociales.

Figura 4. Radiografía de huesos largos.

El diagnóstico clínico fue fibrosis gingival hereditaria


corroborada por el diagnóstico histopatológico el cual
reportó: fibrosis de estroma gingival con aumento de
bandas de colágeno, epitelio con áreas de acantosis y
Figura 2. Fotografía intraoral.
prolongación de procesos interpapilares con pérdida

El estudio radiográfico, (ortopantomografía) revela significativa de la arquitectura epitelial. Cariotipo 46, XX

dentición mixta observándose en la arcada superior e en 30 metafase, sin evidencia de alteraciones.

inferior 14 piezas permanentes y 6 piezas temporales, Tratamiento: se realizó un sondeo periodontal de cada

todas ellas en mal posición (Figura 3). diente con una sonda de Williams encontrando bolsas de
entre 4 mm hasta 6 mm de profundidad. Posteriormente
se realizó una cirugía ambulatoria que consistió en
gingivoplastía y gingivectomía, dividida en dos fases una
superior y otra inferior, ambas bajo anestesia local. El
procedimiento fue: con un mango de bisturí número 3 y
una hoja de bisturí número 15, se efectuó una incisión
contorneando el cuello de los dientes creando un collar
Figura 3. Radiografía panorámica.
del tejido gingival, el cual se retiró con curetas gracey
específicas, posteriormente se practicó un refinado del
Se realizó toma de radiografía de huesos largos (Figura
tejido con un bisturí de Kirklan y Orban para las áreas
4), la intención fue checar la presencia de defectos en
interproximales y se realizaron las exodoncias de los
ellos, ya que se quería descartar la relación con el
dientes primarios superiores 54, 55 y 64, finalmente se
síndrome de Zimmerman-Laband (este síndrome
efectuó la hemostasia, se suturo, se indicó
presenta, anormalidades esqueléticas tales como,

116
farmacoterapia, con antibióticos, analgésicos y probando (I) es nuestro caso clínico. El consentimiento
antiinflamatorios. Para el posoperatorio se indicaron informado se obtuvo de la paciente para publicación del
técnicas de cepillado y colutorios sin alcohol. El mismo presente caso al igual que las imágenes que acompañan.
procedimiento se realizó a los 30 días para la mandíbula.
Se realiza cita de control a los treinta días después de la
cirugía observando buenos resultados tanto en la arcada
superior como en la inferior (Figura 5, 6 y 7).

Figura 7. Gingivoplastía después de 30 días.

Figura 5. Gingivoplastía de 10 días.

Figura 6. Gingivoplastía de 20 días. Figura 8. Árbol genealógico la madre, es la 3 de 5 hermanos y caso


probando es la primera de 3 hermanos.

ARBOL GENEALÓGICO
CONCLUSIONES
Se presenta el árbol genealógico de la paciente en donde
La elección de la cirugía como tratamiento para este caso
se aprecia los afectados observándose: abuela materna,
clínico, permitió disminuir el volumen del tejido gingival,
la hija mayor de esta y nuestro caso III.I (Figura 8). De un
lo cual fue benéfico desde todos los puntos de vista para
matrimonio es la tercera (III), de ésta la primera hija
la paciente ya que se recuperaron sus funciones

117
esenciales mejorando su calidad de vida. En este caso 6. Odessey EA, Cohn AB, Casper F, Schechter LS. Hereditary

particular no se evidenció relación con el síndrome de gingival fibromatosis: aggressive 2-stage surgical resection in

Zimmerman-Laband. lieu of traditional therapy. Ann Plast Surg 2006;57:557-60.


7. Sengün D, Hatipoğlu H, Hatipoğlu MG. Long-term
uncontrolled hereditary gingival fibromatosis: a case report J
REFERENCIAS:
Contemp Dent Pract 2007;8:90-96.
1. Dumic M, Wford C. Zimmerman Laband syndrome: an
8. Coletta RD, Graner E. Hereditary gingival fibromatosis: A
unusually early presentation in a newborn girl. Croat Med J
systematic review. J Periodontol 2006;77(5):753-64.
1999;40(1):102-06.
9. Regezy-Scrubba. Patologia Oral. 3ra ed. McGraw-Hill-
2. Avelar RL, de Luna Campos GJ, de Carvalho Bezerra Falcão
Interamericana; México, DF: 2000.
PG, da Costa Araújo FA, de Carvalho RW, de Souza Andrade
10. Laskaris G. Atlas de enfermedades orales. Elsevier;
ES. Hereditary gingival fibromatosis: A report of four cases in
Barcelona: 2005.
the same family. Quintessence Int 2010;41(2):99-102.
11. Wood NK, Goaz PW. Diagnóstico diferencial de las
3. Vishnoi SL. Hereditary gingival fibromatosis:Report of four
lesiones orales y maxilofaciales. Elsevier; Barcelona: 1998.
generation pedigree. IJCRI 2011;2(6):1-5.
12. Kelekis-Cholakis A, Wiltshire WA, Birek C. Treatment and
4. Pampe Ml, Maier S, Kreczy A, Weirich-Schwaiger H,
long-term follow-up of a patient with hereditary gingival
Utermann G, Janecke A. Refinement of the GINGF3 locus for
fibromatosis: a case report. J Can Dent Assoc 2002;68:290-4.
hereditary gingival fibromatosis. Eur J Pediatr 2010;169:327-32.
5. Breen GH, Addante R, Black Early C. Onset of hereditary
gingival fibromatosis in a 28-month-old. Pediatr Dent
2009;31:286–88.

118
Capítulo 22
REACCIÓN LIQUENOIDE POR AMALGAMA:
REPORTE DE UN CASO.
Daniel Lizárraga-Rodríguez,1 Resumen
Sandra Margarita Jiménez-Aguilar,2 Introducción. Las alteraciones de liquen plano oral (LPO) en pacientes que tienen
Juan José Villalobos-Rodelo,3 contacto con determinados materiales dentales o fármacos, se les conoce como
Julio Benítez-Pascual,1 reacciones liquenoides orales (RLO). Clínicamente se puede llegar a confundir LPO por
sus características similares. El diagnóstico y la relación causa-efecto, en muchas
Víctor Fernando Muñoz-Estrada.4
ocasiones resulta difícil de establecer; aunque se puede facilitar con una historia clínica
detallada y correlación de los hallazgos clínicos e histológicos. El tratamiento será la
(1) Profesor-Investigador. Facultad de
Odontología de la Universidad Autónoma de eliminación del agente causal teniendo como resultado la recuperación total del paciente.
Sinaloa. Culiacán, México. Presentación del caso: Se describe paciente femenino de 48 años de edad, con lesiones
(2) Pasante de servicio social de la Licenciatura erosivas de 3x2 cm y 5x3 cm en la mucosa yugal de ambos carrillos, de color rojo intenso,
de Cirujano Dentista. Facultad de Odontología rodeadas de un halo blanquecino con evolución de 8 meses. Para corroborar diagnóstico
de la Universidad Autónoma de Sinaloa. clínico presuntivo de liquen plano oral, se realizó biopsia por Punch de una de las
Culiacán, México. lesiones. Al observar que las lesiones se encontraban próximas a órganos dentales con
(3) Profesor. Facultad de Odontología de la amalgamas de 25 años de antigüedad, realizamos nuevo diagnóstico presuntivo:
Universidad Autónoma de Sinaloa. Culiacán, Reacción liquenoide por amalgama; por lo que decidimos a retirar todas las amalgamas
México.
(4) Médico Cirujano Especialista en
de la cavidad oral, sustituyéndolas con material restaurativo temporal; 7 días después, la
Dermatología. Hospital Civil. Culiacán, México. paciente reporta significativa evolución, confirmando así la causa de la RLO.
Conclusiones. El trabajo multidisciplinario e interconsulta, resulta necesario para
establecer el diagnóstico y tratamiento adecuado. Significancia Clínica: El liquen plano y
Correspondencia a: la reacción liquenoide por amalgama son clínica e histológicamente similares, el
Dr. Juan José Villalobos-Rodelo diagnóstico diferencial y resolución de las lesiones se establece cuando se elimina el
Email: villarodelo@gmail.com factor causal (obturaciones con amalgama).

Cómo citar:
Lizárraga-Rodríguez D, Jiménez-Aguilar SM, Villalobos-Rodelo JJ, Benítez-Pascual J,
Muñoz-Estrada VF. Reacción liquenoide por amalgama: reporte de un caso. En: Medina-
Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en
Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 119-125. ISBN:
978-607-8444-10-6

INTRODUCCIÓN Definición
El término de lesión liquenoide oral (OLL), es utilizada Fue en 1982 que el término Reacción liquenoide oral
para describir erupciones de la cavidad oral que tienen (RLO), fue propuesto por Finne, para nombrar a lesiones
una etiología identificable pero que son clínica e clínicamente indistinguibles del LPO pero con un factor
histológicamente similares al liquen plano oral (LPO).1 etiológico específico.
La OMS, recomienda el desarrollo de criterios En la literatura, diferentes términos se utilizan para
diagnósticos que permitan diferenciar el LPO de las OLL, referirse a estas lesiones. Las OLLs, también se han
pero se menciona que ambas entidades deben descrito como alergias de contacto, lesiones liquenoides
considerarse susceptibles de sufrir una degeneración orales, lesiones de contacto o reacciones liquenoides
maligna hasta que dichos criterios estén disponibles.2 orales.1

119
En ocasiones, encontramos lesiones muy parecidas a las farmacológico que reciben estos pacientes el causante
del LPO en pacientes en contacto con determinados de OLLs.2
materiales dentales o fármacos; a estas lesiones se les Epidemiología
llama reacciones liquenoides (RLO), ya que tienen una En un análisis reciente de la prevalencia de lesiones de
causa conocida y desaparecen cuando el factor asociado la mucosa oral llevado a cabo en Turín (Italia), se estudió
es eliminado.3-5 la frecuencia de gran cantidad de entidades clínicas,
Etiología entre las que se encontraban las reacciones liquenoides.2
A pesar de que la relación patogénica entre las De estos datos, se extrae que las RLO aparecen más
reacciones liquenoides orales (OLR) y amalgamas frecuentemente en hombres que tienden a fumar más de
dentales es aún materia de controversia;6,7 resultados de 10 cigarros al día, o en mujeres que consumen alcohol; y
diferentes estudios determinan, que está íntimamente que generalmente en un rango de edad entre 40-60
relacionado a una alergia al mercurio en los empastes de años.
amalgama de plata.3-13 Diagnóstico
De igual manera, fármacos como los antimaláricos, El método más eficaz de diagnosticar la RLO sería la
antihipertensivos, antiinflamatorios no esteroideos, entre constatación de que la patología remite cuando se retira
otros más; también pueden ser motivo de OLLs.3 el fármaco o la sustancia responsable, y vuelve a
Aún no es posible decir con seguridad que las OLLs aparecer si se repite la situación. La realidad no es así,
puedan tener alguna sinergia con las drogas. puesto que en muchas ocasiones no remiten las lesiones
En ciertos informes de casos, han mencionado la hasta meses después de la retirada del fármaco y, de la
existencia de OLLs en pacientes sin evidencia de misma forma la aparición de la RLO no aparece hasta un
asociación con cualquiera de los factores mencionados tiempo después del comienzo de la ingesta. Por todo ello,
anteriormente. En estos individuos se han citado factores el diagnóstico y la relación causa-efecto, en muchas
como el sarro dental y la acumulación de placa. Hay un ocasiones resulta difícil de establecer.15
informe de un caso interesante de OLL en un paciente El diagnóstico se puede facilitar con una historia clínica
con una tríada de sarro dental, hiposialia y respiración detallada, los hallazgos clínicos e histológicos.16 Si se
bucal sin otros factores asociados. Por lo que los autores sospecha de asociación a material dental, entonces la
opinaron que la acumulación de patógenos en el sarro y prueba epicutánea de Patch es buena opción.14
la falta de protección de anticuerpos salivales debido a Características clínicas y diagnósticos diferenciales
hiposialia, probablemente resultaron en la OLL. Mientras que algunos autores no hacen diferenciación
Informes similares han apoyado la aparición de este clínica, otros creen que las dos condiciones son distintas.
fenómeno, y por lo tanto, el reconocimiento de esta El LPO es una afección más generalizada que implica
característica como un factor probable en la etiología de muchos sitios anatómicos dentro de la cavidad oral (o en
OLLs.14 otros lugares, incluyendo la piel y genitales) y distinta de
En cuanto al VIH, no se sabe si es el propio virus el que las RLO.
induce la enfermedad, o si más bien es el tratamiento

120
Normalmente, la presentación clínica en ambas Pinkus en 1973 acuñó el término " Reacción liquenoide
condiciones pueden ser manchas reticulares blancas, tisular" para describir el patrón histológico con daños a
pápulas o placas con o sin erosiones y/o áreas los queratinocitos, que se refiere ahora como apoptosis,
ulceradas. de células inflamatorias infiltradas en el tejido conectivo y
Las RLO causadas por hipersensibilidad a la amalgama o que se puede extender al epitelio.5
sus constituyentes suelen tener una relación anatómica Las características histológicas de OLLs difieren a las
clara a las amalgamas dentales, por lo que suelen ser del LPO en varios aspectos. Mientras que el infiltrado
unilaterales y no simétricas. Son más frecuentes en la subepitelial en LPO se limita a la lámina propia, es más
mucosa bucal y la lengua, donde el revestimiento de difusa y penetrante en OLLs.
cobertura mucosa entra en contacto con las La naturaleza del infiltrado también es linfohistiocitario en
restauraciones. comparación con la variedad mixta de LPO. Existe una
La encía, el paladar, o el piso de la boca, siendo los sitios tendencia a la distribución perivascular de células
más alejados de restauraciones, rara vez se ven inflamatorias, como se observa en muchas reacciones
afectados y los pacientes casi nunca han asociado alérgicas, en OLLs.
síntomas cutáneos. Los cambios epiteliales que incluyen paraqueratosis
Manifestaciones clínicas de hipersensibilidad al contacto focal, interrupción focal de la capa granular, y la
con la boca pueden variar, así como ardor, dolor y presencia de cuerpos semejantes a células en las capas
sequedad de la mucosa oral (síndrome de la boca granulares queratinizadas son comunes en LPO.
ardiente).16-18 Los mastocitos constituyen una característica integral de
Pueden presentar una reacción de hipersensibilidad tipo la presentación histológica y etiopatogenia de la OLP. La
IV (hipersensibilidad retardada), pues generalmente la presencia de mastocitos en OLL es más tenue.
reacción tarda en desarrollarse desde varios meses Varias otras características menores, como aumento de
hasta años;15,16,19 también suelen presentarse casos de la vascularización y el aumento de la positividad de
hipersensibilidad inmediata, pero suelen ser poco material ácido periódico de Schiff (PAS) en la membrana
frecuentes.20 basal de la OLP no se encuentran generalmente en
El diagnóstico clínico se complica aún más debido a las OLLs.14,16
lesiones orales similares que pueden resultar de Tratamiento
reacciones relacionadas con las drogas o enfermedades El reemplazo de las amalgamas por materiales de
como EICH, lupus eritematoso discoide (LED), y lupus restauración estéticos en la cavidad oral del paciente
eritematoso sistémico (LES).16,17 será la única y mejor solución, siempre y cuando la causa
Tanto LPO como RLO pueden ser consideradas sea la amalgama dental.
potencialmente malignas. Es importante mantener un La eliminación del agente causal, resultará en la
seguimiento para poder diagnosticar con precisión cada recuperación total del paciente.1,20
condición.15,16
Características histopatológicas PRESENTACIÓN DEL CASO

121
Describimos un caso clínico de una paciente adulta de evidenciaron lesiones erosivas de 3x2 cm y 5x3 cm
sexo femenino de 48 años de edad, procedente de aproximadamente en la mucosa yugal de ambos carrillos,
Navolato, Sinaloa. eritematosas, de color rojo intenso, rodeadas de un halo
blanquecino de aspecto piloso, con evolución aproximada
de 8 meses (Figuras 1 y 2).
Clínicamente se planteó un diagnóstico presuntivo de
liquen plano oral; realizamos biopsia, iniciando con
anestesia local con 0.90 ml de lidocaína con epinefrina
(Figura 3), una vez insensibilizada el área se realizó la
incisión con “punch” de 5 mm de diámetro enviándose al
departamento de histopatología (Figura 4).

Figura 1. Mucosa yugal izquierda con aparente lesión liquenoide oral.

Figura 3. Paciente siendo anestesiada localmente para posterior


intervención.

Figura 2. Mucosa yugal derecha con lesión de características


compatibles a liquen plano oral.

La paciente llegó a consulta dental refiriendo dolor severo


Figura 4. A) Punch dermatológico utilizado para obtener la muestra de
en la cara interna de ambas mejillas que dificultaban la tejido (B).
alimentación. Al momento de realizar la historia clínica, la
paciente mencionó que previamente le fue indicado Se inició tratamiento farmacológico con Talidomida

realizarse un examen de detección de VIH/SIDA con 100mg, (una tableta diaria por tres meses).

resultado negativo; aparte de esto, no se encontraron Al mes, la paciente acude a cita reportando ausencia de

datos de significancia relevante. menstruación, por lo que indicamos la suspensión del

En el examen extraoral se pudo observar el rostro de la tratamiento y se solicitó a la paciente someterse una

paciente sin aparentes anomalías. El examen intraoral prueba de embarazo (GCH); el resultado fue negativo.

122
Procedimos a una nueva revisión intraoral para ver si
notábamos alguna evolución favorable; solo notamos una
ligera disminución del halo blanquecino, pero las
molestias y la zona erosiva seguían sin cambios.
Al observar que las lesiones se encontraban próximas a
órganos dentales con amalgamas de 25 años de
antigüedad (Figura 5), realizamos nuevo diagnóstico
presuntivo: Reacción liquenoide por amalgama,
corroborado con el resultado histopatológico que arrojaba
que en la muestra había hallazgos histopatológicos
compatibles con Liquen plano oral.

Figura 6. Arcada superior e inferior después de haber removido las


restauraciones de amalgama.

Figura 5. Lesiones en la mucosa yugal derecha (A) e izquierda (B) en


aparente contacto con restauraciones de amalgama.

Tratamiento
Se procedió a retirar todas las amalgamas que se
encontraban en la cavidad oral; sustituyéndolas por
material restaurativo temporal (Figura 6).
Figura 7. Evolución de las OLL a 7 días del tratamiento.
Siete días después la paciente reporta significativa
mejoría e inclusive señala ausencia total de una de las
El consentimiento informado se obtuvo de la paciente
lesiones y disminución considerable de todos los
para la publicación del presente caso al igual que las
síntomas; confirmando así la causa de la RLO (Figura 7).
imágenes que acompañan.

CONCLUSIONES

123
El examen clínico minucioso de la mucosa oral así como with amalgam: improvement after amalgam removal. Br J

la identificación de alteraciones liquenoides contiguas a Dermatol 2003;148:70-6.

restauraciones con amalgama, son importantes para el 7. Koch P, Bahmer FA. Oral lesions and symptoms related to
metals used in dental restorations: a clinical, allergological, and
diagnóstico diferencial de LRO y liquen plano oral. La
histologic study. J Am Acad Dermatol 1999;41:422-30.
sustitución de este material por otro, como las resinas
8., Widman L, Bergdahl J. Regression of oral lichenoid lesions
compuestas, ayuda considerablemente a la resolución
after replacement of dental restorations. J Oral Rehabil
del cuadro.
2014;41:381-91.
Se requiere de un trabajo de equipo multidisciplinario e 9. Bratel J, M, Jontell M. Effect of replacement of dental
interconsulta entre patólogo, dermatólogo y odontólogo, amalgam on oral lichenoid reactions. J Dent 1996;24:41-5.
para evitar confundir el diagnostico con LPO 10. Issa Y, Brunton PA, Glenny AM, Duxbury AJ. Healing of
(enfermedad autoinmune) y, de esta manera, evitar oral lichenoid lesions after replacing amalgam restorations: a
terapéuticas agresivas y elevadas dosis medicamentosas systematic review. Oral Surg Oral Med Oral Pathol Oral Radiol

con sus reacciones adversas implícitas en estos Endod 2004;98:553-65.


11. Laeijendecker R, Deker KS, Burger PM, Mulder PGH, Van
tratamientos.
JT, Neumann HAM. Oral lichen planus and allergy to dental
amalgam restorations. Arch Dermatol 2004;140:1434-8.
REFERENCIAS
12. Thornill MH, Pemberton MN, Simmons RK, Theaker ED.
1. Cobos MJ, Sahuquillo MAM, Gallardo CI, Armas PJR,
Amalgam-contact hypersensitivity lesions and oral lichen
Moreno FA, Bullón FP. Oral lichenoid lesions related to dental
planus. Oral Surg Oral Med Oral Pathol Oral Radiol Endod
materials: A literature review. Med Oral Patol Oral Cir Bucal
2003;95:291-9.
2009;14:514-20.
13. Pang BK, Freeman S. Oral lichenoid lesions caused by
2. Matesanz-Pérez P, Bascones-Martínez A. Liquen plano:
allergy to mercury in amalgam fillings. Contact Dermatitis
Revisión de la literatura actual. Av Odontoestomatol
1995;33:423-7.
2009;25:99-114.
14. Kamath VV, Setlur K, Yerlagudda K. Oral lichenoid lesions -
3. Bermejo-Fenoll A, López-Jornet P. Liquen plano oral:
A review and update. Indian J Dermatol 2015;60:102.
Naturaleza, aspectos clínicos y tratamiento. RCOE [revista en
15. Cerero-Lapiedra R. Malignización del liquen plano oral. Av
la Internet]. 2004 Ago [citado 2015 Jun 16]; 9: 395-408.
Odontoestomatol 2008;24:97-103.
Disponible en:
16. McParland H, Warnakulasuriya S. Oral lichenoid contact
http://scielo.isciii.es/scielo.php?script=sci_arttext&pid=S1138-
lesions to mercury and dental amalgam—A Review. J Biomed
123X2004000400003&lng=es.
Biotechnol 2012;1:1-8.
4. Jayanthi K, Kavyashree L. Mysterious metal reaction-a
17. Aggarwal V, Jain A, Kabi D. Oral lichenoid reaction
report of contact mucosal reaction to amalgam. Int J Dent Case
associated with tin component of amalgam restorations: a case
Reports 2013;3:12-15.
report. Am J Dermatopathol 2010;32:46-48.
5. Kharangate N, Figueiredo NR, de Ataide IN, Fernandes M.
18. D. Ditrichova, et al. Oral lichenoid lesions and allergy to
Amalgam Associated Oral Lichenoid Reaction – A Case
dental materials. Biomed Pap Med Fac Univ Palacky Olomouc
Report. IJRD 2013; 2:134-38.
Czech Repub. 2007;151:333-339.
6. Dunsche A, Kästel I, Terheyden H, Springer ING,
19. Dahiwal P, Kaur SS, Patil S, Kadam V, Ambulgekar J,
Christiphers E, Brasch J. Oral lichenoid reactions associated
Balkunde A. Oral lichenoid lesions associated with amalgam

124
restorations: two case reports. Int J Curr Microbiol App Sci
2014;4:54-58.
20. Kal BI, Evcin O, Dundar N, Tezel H, Unal I. An unusual
case of immediate hypersensitivity reaction associated with an
amalgam restoration. Br Dent J 2008;205:547-550.

125
Capítulo 23
USO DE ULTRASONIDO EN LA REMOCIÓN DE
UNA FRESA ENDO-SAFE FRACTURADA EN UN
CONDUCTO RADICULAR: REPORTE DE UN CASO.
Paola de los Ángeles Ramírez-Salinas,1 Resumen
Sandra Vázquez-Coria,2 Introducción: Al realizar la terapia endodóntica, específicamente durante la apertura
Rubén de la Rosa-Santillana,2 coronal (acceso), la preparación biomecánica y la obturación del sistema de conductos,
Carlo Eduardo Medina-Solís.3 pueden ocurrir accidentes que deben ser prevenidos, tomando en cuenta ciertos factores
como las consideraciones anatómicas del diente a tratar, las condiciones del instrumental
(1) Estudiante de la Licenciatura de Cirujano y la habilidad del operador, entre otros. Cuando éstos accidentes ocurren deben ser
Dentista. Área Académica de Odontología del evaluados y relacionados al pronóstico del diente, para establecer un plan de tratamiento
Instituto de Ciencias de la Salud de la adecuado. Presentación del caso: Paciente masculino de 52 años, presenta necrosis
Universidad Autónoma del Estado de Hidalgo. pulpar en el órgano dental 45, al momento de abrir y conformar el acceso se presenta
Pachuca, Hidalgo, México. fractura de fresa Endo-safe la cual se queda alojada a nivel de tercio medio del conducto
(2) Profesor. Área Académica de Odontología radicular. En este documento se describe un caso clínico exitoso de remoción de
del Instituto de Ciencias de la Salud de la instrumento fracturado utilizando ultrasonido para endodoncia. Conclusiones: Una
Universidad Autónoma del Estado de Hidalgo.
complicación indeseable del tratamiento endodóntico es la separación de un instrumento
Pachuca, Hidalgo, México.
(3) Profesor-Investigador. Área Académica de en el conducto, si un instrumento se fractura en el conducto radicular durante alguna fase
Odontología del Instituto de Ciencias de la del tratamiento de conductos, debe extraerse siempre que sea posible, con la finalidad de
Salud de la Universidad Autónoma del Estado lograr una buena conformación y una obturación tridimensional garantizando así el éxito
de Hidalgo. Pachuca, Hidalgo, México. del tratamiento. Significancia clínica: El odontólogo general y particularmente el
especialista, deben tener un alto nivel de conocimientos y de experiencia clínica para
poder manejar de manera exitosa todos los accidentes que se puedan presentar durante
Correspondencia a: la terapia endodóntica y que previsiblemente pueden solventarse cuando se toman en
Dra. Sandra Vázquez-Coria cuenta los conceptos básicos para la terapéutica endodóntica y posteriormente integrar
Email: vcoriasandra@hotmail.com
los auxiliares de la tecnología en el tratamiento endodóntico convencional.

Cómo citar:
Ramírez-Salinas PA, Vázquez-Coria S, de la Rosa-Santillana R, Medina-Solís CE. Uso de
ultrasonido en la remoción de una de fresa endo-safe fracturada en un conducto radicular:
reporte de caso. En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores.
Mis casos clínicos en Odontología. Campeche: Universidad Autónoma de Campeche;
2015. p. 126-131. ISBN: 978-607-8444-10-6

INTRODUCCIÓN geométrico del diente. La desviación de este eje y la


El objetivo principal de una cavidad de acceso es proveer falta de atención en el grado de inclinación axial de un
al operador una ruta directa y sin obstáculos hacia la diente, en relación con los dientes vecinos y al hueso
constricción apical facilitando así la preparación alveolar, provoca la eliminación excesiva de estructura
biomecánica y la obturación del sistema de conductos.1,2 dental originando socavados o perforaciones de la
A pesar de las variaciones anatómicas presentes en las corona o raíz en varios niveles e incluso la fractura de las
configuraciones de las cámaras pulpares, la cavidad fresas utilizadas para la conformación del acceso
pulpar se encuentra generalmente en el centro endodóntico.2

126
Lasala3 refiere que en el momento de rectificar la potencia mínima y se utiliza en seco, para obtener una
apertura de cámara y el acceso a los conductos, se visión constante de la punta funcionando y del
puede producir la fractura de las fresas; esto ocurre instrumento roto. El instrumento seleccionado se mueve
posiblemente debido a la profundidad del tejido, la forma ligeramente alrededor del instrumento en sentido
de la fresa y a la activación de la misma cuando ya está contrario de las agujas del reloj. Esta acción ultrasónica
colocada en posición, en lugar de llevarla activada al expulsa el polvo de dentina y trepana unos pocos
punto de trabajo. En cuanto al pronóstico, refiere que milímetros coronales alrededor del instrumento. Por lo
este accidente no influye negativamente, ya que el general durante el uso del ultrasonido el fragmento
fragmento puede ser removido sin dejar consecuencias. comienza a aflojarse, desenroscarse y girar. Si se ejerce
Walvekar et al.4 reportaron un caso donde se fracturó una una suave acción de palanca con la punta entre el
fresa al momento de realizar la apertura de cámara instrumento fracturado y la pared del conducto, en
quedando atrapada en el conducto, posterior al intento de ocasiones el instrumento "salta" del interior del mismo.7, 8
su remoción la misma bloqueó totalmente el conducto. Es importante subrayar que en la mayoría de las
Como refiere Lasala3 la eliminación del fragmento fracturas de un instrumento, el fragmento rara vez
fracturado depende de ciertos factores como la gravedad permanece en el centro del conducto radicular; para
en los dientes superiores y la presencia de pulpa vital, la localizarlo, es necesario explorar con claridad las
cual actúa como un obstáculo al progreso del fragmento paredes laterales.9
hacia el interior del conducto.
En cuanto al tratamiento Walvekar et al.,4 recomiendan PRESENTACIÓN DEL CASO
sobrepasar el fragmento con una lima #8 y continuar con Se presenta el caso de un paciente masculino de 52
limas #10 y #15 hasta poder colocar una lima Hedström años de edad, el cual acude a las Clínicas del Área
para poder enganchar el fragmento. Lasala 48 prefiere en Académica de Odontología del Instituto de Ciencias de la
primer lugar intentar la remoción del fragmento con el Salud de la Universidad Autónoma del Estado de Hidalgo
explorador, si no fuese posible recomienda utilizar para rehabilitación del órgano dental 45 por presentar
ensanchadores para desprenderlo de las paredes y tratar una lesión cariosa extensa, con destrucción de la pared
de arrastrarlo con una o varias sondas barbadas. distal y una ligera lesión periapical. A las pruebas de
Lovdahl et al.,5 y Hulsmann6 señalan que el uso de los vitalidad pulpar no se presenta ninguna respuesta, por lo
aparatos ultrasónicos facilita la remoción de objetos e que se diagnostica como: necrosis pulpar. El paciente
instrumentos fracturados dentro del conducto radicular. refirió haber tenido un dolor intenso hace 2 meses que
De acuerdo a los protocolos actuales propuestos entre cedió y ahora se encuentra asintomático. A la exploración
otros por el Ruddle,7 la primera opción para remover un física no se observa aumento de volumen ni fístula. Se
instrumento fracturado es el empleo de instrumental procede a tomar radiografía inicial (Figura 1).
ultrasónico. Se selecciona el instrumento ultrasónico, Después de hacer el aislamiento absoluto del órgano
según la profundidad a la que se encuentra el fragmento dental 45, se procede a realizar el acceso endodóntico
y el espacio disponible. Este instrumento se activa a la con una fresa de bola No. 4 y posteriormente al estar

127
conformando la porción cervical, sucede la fractura de la protocolo a seguir será la utilización de un dispositivo
fresa. La inexperiencia y angustia de la alumna, en su ultrasónico para su remoción. El ultrasonido utilizado fue
intento de remover el fragmento, la llevan a empujar la Varios 350 NSK América (Figura 4) con una punta
fresa al tercio medio de la raíz (Figura 2). Spartan CPR4S (Figura 5).

Figura 4. Varios 350 NSK América.

Figura 1. Radiografía Inicial.

Figura 5. Punta Spartan CPR4S.

Figura 2. Radiografía que muestra el fragmento fracturado de la fresa


Endo-Safe a nivel del tercio medio.

Figura 3. Vista del conducto.

Se procede entonces a tratar de ubicar la porción más Figura 6. Ampliación del conducto con fresa Endo-Safe.
coronal del instrumento (Figura 3), y se decide que el

128
Se limpió el acceso y se amplió la porción coronal y Después de varios intentos, se logra con éxito el desalojo
media con otra fresa Endo-safe nueva (Figura 6). Una de la porción fracturada de la fresa (Figura 8). Se
vez ampliada se introdujo la punta de ultrasonido procede a iniciar el tratamiento de conductos, en la
haciendo un desgaste circunferencial alrededor de la radiografía de conductometría podemos observar que la
fresa fracturada para tratar de desalojarla (Figura 7). lima ya no tiene ningún obstáculo para pasar y llegar al
tercio apical (Figura 9).

Figura 9. Radiografía de conductometría.

Figura 7. Aplicación del ultrasonido para desalojar el instrumento Se muestra radiografía final, donde se puede observar el
fracturado.
ensanchamiento del conducto provocado por el
ultrasonido, en su porción cervical y media (Figura 10).

Figura 10. Radiografía final, diente con remisión para endoposte.

El consentimiento informado se obtuvo del paciente para


la publicación del presente caso al igual que las
imágenes que lo acompañan.

Figura 8. Fresa Endo-Safe fuera del conducto. DISCUSIÓN

129
Ruddle8 señala que el potencial de remover de forma transcurrido ese tiempo sean consideradas otras
segura un instrumento fracturado va a estar guiado por opciones de tratamiento.
factores anatómicos, entre ellos el diámetro, longitud y
curvatura del conducto, y a su vez este potencial va a CONCLUSIONES
estar limitado por la morfología radicular, incluyendo Un accidente muy común es la fractura de instrumentos
dimensiones circunferenciales, grosor de dentina y dentro del sistema de conductos, ya sea durante el la
profundidad de la concavidad externa. Quizás el factor apertura, la preparación biomecánica o la obturación;
más importante para la exitosa remoción de instrumentos para la remoción de los mismos la literatura refiere
fracturados es el conocimiento, entrenamiento y muchas técnicas. La técnica a emplear dependerá del
competencia en la selección de las mejores técnicas y tipo de instrumental fracturado, su tamaño, su ubicación,
tecnologías desarrolladas y probadas actualmente.8 Es su accesibilidad y como punto importante la experiencia
importante saber que ningún método de remoción de operador en el manejo de cada una de ellas. El
producirá el resultado deseado en todas las manejo adecuado de cada accidente determina el
ocasiones.8,10 y que la remoción exitosa con frecuencia pronóstico del caso.
requiere paciencia, perseverancia y creatividad.8 Los instrumentos fracturados en el conducto radicular,
Hülsman y Schinkel11 consideraron como éxito el retiro pueden ser eficazmente eliminados en la mayoría de los
del instrumento o sobrepasar el mismo, y obtuvieron un casos al uso de ultrasonido y puntas especiales para
índice de éxito general de 68%. Suter et al.12 evaluaron el Endodoncia, sin embargo la prevención siempre será el
índice de éxito para la remoción de instrumentos factor más importante a determinar para evitar los
fracturados usando ultrasonido, microscopio y en accidentes durante la terapia endodóntica.
ocasiones empleando técnicas de retiro por microtubos,
logrando la remoción del 87% (n= 84) de los fragmentos REFERENCIAS
en un total de 97 casos. Estos autores registraron el 1. Gutmann JL, Lovdahl PE. Problems encountered in tooth

tiempo requerido para el retiro del instrumento y isolation and access to the pulp chamber space. En: Gutmann
JL, Dumsha TC, Lovdahl PE, Hovland EJ, editors. Problem
consiguieron que el índice de éxito disminuye a medida
solving in endodontics. Missouri: Mosby; 1997:47-67.
que aumenta el tiempo del tratamiento. Esto puede estar
2. Torabinejad M. Accidentes de procedimiento. En: Walton
relacionado con fatiga del operador o al sobre-
RE, Torabinejad M, editores. Endodoncia. Principios y práctica
ensanchamiento del conducto debido a la abrasión
clínica. Philadelphia: Pennsylvania; 1991:317-33.
ultrasónica, lo cual puede corresponder a un mayor 3. Lasala A. Complicaciones y accidentes en el tratamiento y la
riesgo de perforación. La dificultad del caso también obturación de conductos. En: Endodoncia. Cuarta edición.
puede explicar la reducción del índice de éxito. Por lo Barcelona: Ediciones Científicas y Técnicas, S.A; 1992.
expuesto anteriormente concluyen que los intentos de 4. Walton RE, Torabinejad. Limpieza y preparación. En: Walton
remover instrumentos fracturados de los conductos no RE, Torabinejad M, editores. Endodoncia. Principios y práctica

deben tomar más de 45-60 min; y recomiendan que clínica. Philadelphia: Pennsylvania; 1991:223-28.
5. Lovdahl PE, Wade CK. Problems in tooth isolation and
periodontal support for the endodontically compromised tooth.

130
En: Gutmann JL, Dumsha TC, Lovdahl PE, Hovland EJ, 10. Ward JR, Parashos P, Messer HH. Evaluation of an
editors. Problem solving in endodontics. Missouri: Mosby; ultrasonic technique to remove fractured rotary nickel-titanium
1997:203-27. endodontic instruments from root canals: an experimental
6. Hülsmann M. The removal of silver cones and fractured study. J Endod 2003;29(11):756-63
instruments using the canal finder system. J Endodon 1990; 11. Hulsmann M, Schinkel I. Influence of several factors on the
16(12)596-600. success or failure of removal of fractured instruments from the
7. Ruddle C. Retratamiento endodóncico no quirúrgico. En: root canal. Endod Dent Traumatol 1999;15(6):252-8
Vías de la Pulpa. Cohen S, Burns R. editores. 8va. edición. 12. Suter B, Lussi A, Sequeira P. Probability of removing
Barcelona: Editorial Mosby; 2002. fractured instruments from root canals. Int Endod J
8. Ruddle CJ. Nonsurgical retreatment. J Endod 2005;38(2):112-23.
2004;30(12):827-45.
9. Carr G. Retratamiento. En: Vías de la Pulpa. Cohen S, Burns
R. editores. 7ma. edición. Madrid: Editorial Harcourt S.A; 1999.

131
Capítulo 24
TRATAMIENTO ALTERNATIVO PARA LA
FLUOROSIS DENTAL: REPORTE DE UN CASO.
María Fernanda Yáñez-Acosta,1 Resumen
Yannette C. Velázquez-Jiménez,1 Introducción: La fluorosis dental es un problema endémico de salud pública que afecta a la
Carmen Celina Alonso-Sánchez,2 población infantil y adolescente de varias regiones del mundo, incluyendo México. Es una
Horacio Nario-Venegas,3 patología presente en la mayor parte de la población de Lagos de Moreno, Jalisco, ya que
en esta región el agua de consumo proviene de los pozos con una concentración del
Luis Javier Núñez-Torres.4
mineral flúor muy elevada. Presentación del caso: Paciente masculino, 22 años,
procedente de Lagos de Moreno, al examen clínico se observan manchas parduzcas con
(1) Técnico Académico y Profesor de
Asignatura. Universidad de Guadalajara. pigmentos cafés en todas las caras vestibulares y palatinas de los dientes superior.
Centro Universitario de los Altos. Tepatitlán Diagnóstico: Fluorosis Dental grado 5 según el índice Thylstrup y Fejerskov (TF); el
de Morelos, México. tratamiento realizado fue un blanqueamiento con el producto Antivet®, el cual limpia la
(2) Profesor de Tiempo Completo. estructura del esmalte de los dientes sin afectarla, ya que solamente extrae los iones de
Coordinadora de la Especialidad en substancias orgánicas e inorgánicas que se encuentran ocupando los espacios que existen
Odontopediatría. Universidad de entre los cristales poco calcificados de fluorapatita. Conclusiones: En el paciente hubo
Guadalajara. Centro Universitario de los una reducción significativa de las manchas en el esmalte en dos sesiones con un intervalo
Altos. Tepatitlán de Morelos, México de 22 días y respecto a la textura el cambio fue muy notorio, quedando una superficie
(3) Profesor de Asignatura. Universidad de
Guadalajara. Centro Universitario de los Altos
prácticamente lisa sin rugosidades en el esmalte. Además el autoestima del paciente se
(4) Estudiante de la Licenciatura de Cirujano elevó considerablemente. Significancia Clínica: Este tratamiento químico estético es una
Dentista. Universidad de Guadalajara. Centro alternativa mínimamente invasiva, no afecta el esmalte, ofrece una limpieza permanente del
Universitario de los Altos. Tepatitlán de diente y no produce sensibilidad.
Morelos, México.
Cómo citar:
Yáñez-Acosta MF, Velázquez-Jiménez YC, Alonso-Sánchez CC, Nario-Venegas H, Núñez-
Correspondencia a: Torres LJ. Tratamiento alternativo para la fluorosis dental: reporte de un caso. En: Medina-
Dra. María Fernanda Yáñez-Acosta Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Campeche: Universidad
Email: fernanda_yanez@hotmail.com
Autónoma de Campeche; 2015. p. 132-136. ISBN: 978-607-8444-10-6

INTRODUCCIÓN flúor (F–) en el agua potable, que permite la normatividad


La fluorosis dental es el efecto endémico patológico del mexicana, es de 0.7 mg/l.2
exceso en la ingesta del ión flúor. El término de "esmalte La fluorosis dental es un problema endémico de salud
moteado" es un calificativo que ha sido utilizado desde la pública que afecta a la población infantil y adolescente de
antigüedad para describir algunos de los efectos de esta varias regiones del mundo. En ésta alteración del
ingesta. Esta patología está caracterizada por una mayor esmalte de los órganos dentarios, se pueden observar
porosidad de la superficie que en el esmalte dental desde manchas de color blanquecino hasta manchas de
normal, esto se produce principalmente en la etapa color café oscuro y en los casos más severos, pérdida
formativa de la dentición permanente.1 El grado de del tejido adamantino. En países como México,3 Chile,
fluorosis está relacionado con la cantidad de flúor Argentina, Colombia, Venezuela4 y Paraguay existen
ingerido y su efecto es acumulativo. La concentración de localidades cuyas aguas de consumo presentan en forma

132
natural, concentraciones de flúor superiores a las PRESENTACIÓN DEL CASO
recomendadas para la prevención de la caries dental.5 Paciente de sexo masculino de 22 años de edad,
Actualmente la fluorosis es una alteración dental procedente de Lagos de Moreno, ciudad ubicada en el
abundante en la ciudad de Lagos de Moreno (ciudad en estado de Jalisco, México. Acude al Centro de Atención
la cual radica el paciente), se mantiene un nivel de flúor Médica Integral del Centro Universitario de los Altos por
muy elevado en el agua, según una investigación presentar manchas cafés en los dientes permanentes.
realizada en el 2002 por Hurtado y Gardea,6 se No reporta ningún antecedente sistémico. Al examen
investigaron 105 pozos, 13 de ellos abastecedores de clínico se observan manchas parduzcas con pigmentos
Lagos de Moreno, en donde se demostró que el 45% de cafés en todas las caras vestibulares y palatinas de los
las muestras excedieron los límites permitidos por la dientes superiores.
normatividad, el estudio señaló que hay hasta el doble de Al realizar la evaluación para determinar el grado de
flúor permitido en el agua de los Altos de Jalisco: de 1.5 fluorosis dental se definió el siguiente diagnóstico:
miligramos por litro a 3.2.7 El nivel óptimo de flúor ha sido Arcada superior
determinado entre 0.7 y 1 partes por millón (ppm) que Según el índice de Thylstrup y Fejerskov se clasifica
previene la caries dental con un riesgo mínimo de como una fluorosis grado 5, presentando un esmalte con
fluorosis dental de acuerdo a la Secretaria de Salud. áreas irregulares de menos de la mitad de la superficie y
En 1978, Thylstrup y Fejerskov, desarrollaron una remanente de tejido opaco intacto (Figura 1 y 2).
clasificación para el diagnóstico de la fluorosis dental, en
la cual nos apoyamos para determinar el grado de
fluorosis dental del paciente.7
Actualmente se conocen varios métodos para el
tratamiento de la fluorosis dental: técnicas invasivas,
tales como restauraciones directas y carillas con resinas,
Figura 1. Fotografía inicial, en la cual se observa un esmalte con
carillas de porcelana entre otros; además de tratamientos áreas irregulares de menos de la mitad de la superficie y remanente
de tejido opaco intacto.
mínimamente invasivos, como la micro abrasión y la
macro abrasión, así como el tratamiento químico
(Antivet), el cual se aplicó en este caso.
Este tratamiento químico estético es una alternativa
mínimamente invasiva, no afecta el esmalte, ofrece una
limpieza permanente de la pieza dentaria y no produce
sensibilidad.6 El objetivo de este trabajo es presentar un
caso clínico de un paciente con fluorosis, en el que se
usó una técnica de remoción química para corregir el
Figura 2. Acercamiento de Incisivos Centrales superiores el cual se
problema estético. observan más a detalle las manchas cafés sobre las caras
vestibulares.

133
Se decide realizar un tratamiento estético con una 10. En una cita posterior se aplicó una técnica de
sustancia base acida (Antivet), el sistema y el producto, blanqueamiento dental para potenciar el resultado
está debidamente patentado en México y varios países estético (Figura 4).
del mundo, además de estar recomendado por la OMS.
Procedimiento
1. Anestesia tópica a nivel de la encía vestibular y
palatina
2. Se realizó aislado absoluto a distancia con un dique
de hule de la pieza 17 a la 27. Se dosifico la solución
acida (Figura 3). Figura 4. Aislamiento absoluto del campo operatorio con dique de
hule, exponiendo la totalidad de las caras vestibulares de todos los
3. Se aplicó la solución sobre las superficies dientes a tratar.
vestibulares de los órganos dentarios a tratar mediante
una torunda de algodón sujetándose con unas pinzas de 11. Tratamiento terminado después de las dos citas de
presión. blanqueamiento (Figura 5 y 6).
4. Se frotó firmemente en forma circular, cada que la
torunda se manchaba se cambiaba y se saturaba de la
solución base acida.
5. Se repitió la operación hasta que desapareciera la
mancha (Figura 3).

Figura 5. En una cita posterior se aplicó una técnica de


blanqueamiento dental para potenciar el resultado estético.

Figura 3. Se aplicó la solución y se repitió la operación hasta que


desapareciera la mancha.

6. Se llevó a cabo lavado profuso con agua.


7. Se secó con la jeringa triple.
8. Se repite el proceso en cada pieza hasta obtener
resultados en cada una.
9. Por último se aplicó flúor tópico por 5 minutos.
Figura 6. Aplicación del blanqueamiento.

134
12. Resultado inmediatamente después de la primera dental, distribución de los dientes afectados y en la
sesión del blanqueamiento (Figura 7). historia familiar.9
En este caso, el defecto en el esmalte se presentó con
una distribución generalizada en ambas arcadas, todas
las piezas estaban marcadamente afectadas, existen
antecedentes familiares del padecimiento de esta
patología, un dato importante es el hecho de que
siempre vivieron en la misma zona demográfica, y por lo
tanto es un factor que predispone al padecimiento de la
Figura 7. Resultado inmediatamente después de la primera sesión del
tratamiento. fluorosis. El paciente no presenta enfermedades
sistémicas que puedan causar hipoplasia en el esmalte.
13. Resultado final (Figura 8).
Por lo que indiscutiblemente, este análisis llevó al
diagnóstico de una fluorosis dental, que debido a la alta
cantidad de flúor en el agua no es una sorpresa la
prevalencia de esta enfermedad en la población de
Lagos de Moreno.
Tomando en cuenta el tratamiento propuesto, se
Figura 8. Resultado final. considera que su mecanismo de acción basado en su
naturaleza acida actúan en los enlaces iónicos, y de esta
DISCUSIÓN
manera limpia la estructura del esmalte de los dientes sin
Durante la etapa de maduración del desarrollo del diente,
afectarla, ya que solamente extrae los iones de
el agua y las proteínas son removidas de la matriz
substancias orgánicas e inorgánicas que se encuentran
extracelular del esmalte, lo que permite el incremento de
ocupando espacios que existen entre los cristales poco
cristales de hidroxiapatita. Los efectos de la
calcificados de fluorapatita, esto ayuda para que se
hipomineralización están asociados con la retención del
disuelva el material orgánico residual, incluida la
2% al 5% de proteínas de la matriz del esmalte, mientras
pigmentación y posteriormente el flúor y los minerales
que en un esmalte normal, la retención es, solamente,
salivales intensifiquen su remineralización.10
del 0.01% al 1%.8
Otra posible explicación para el éxito del tratamiento, es
La hipomineralización, puede ser la consecuencia de
el hecho de que la superficie tratada, refleja y refracta la
muchos desórdenes caracterizados por alteraciones en la
luz en los dientes, de tal forma que las imperfecciones
estructura del esmalte. Estas condiciones incluyen
leves del esmalte son borradas.11
defectos hereditarios, como la amelogénesis imperfecta o
En el paciente hubo una reducción significativa de las
alteraciones sistémicas como en el caso de la fluorosis.
manchas en el esmalte en dos sesiones con un intervalo
La etiología de estas lesiones se basa en la historia
de 22 días y respecto a la textura el cambio fue muy

135
notorio, quedando una superficie prácticamente lisa sin Department of Health and Human Services, Public Health

rugosidades en el esmalte. Service, CDC; 1995.


4. Loyola J, Pozos A, Hernández J, Hernández J. Fluorosis en
dentición temporal en un área con hidrofluorosis endémica.
CONCLUSIÓN
Salud Publica Mex 2000;42(3):194-200.
Se aplicó una técnica de blanqueamiento dental para
5. Trejo R, Bonilla A. Exposición a fluoruros del agua potable
potenciar el resultado estético. La técnica presentada es
en la ciudad de Aguascalientes, México. Rev Panam Salud
capaz de manejar adecuadamente aquellas manchas
Pública 2005;10(2):108-12.
confinadas a las capas superficiales del esmalte 6. Hurtado-Jiménez R, Gardea-Torresdey J. Estimación de la
afectado; combinada con una técnica de blanqueamiento exposición a fluoruros en Los Altos de Jalisco, México. Salud
dental proporciona un efecto estético satisfactorio, y Publica Mex 2007;49(4):312-315.
altamente conservador. La combinación de técnicas 7. Sapp JP, Eversole LR & Wysocki GP: Patología Oral y
micro abrasivas con blanqueamiento dental, representa Maxilofacial Contemporanea. España. Elvesier Mosby; 2004.

una alternativa eficaz de tratamiento para la fluorosis 8. Ramirez DR. http://scienti.colciencias.gov.co. Recuperado el
17 de Febrero de 2014, de
dental moderada con un resultado estético superior al
http://scienti.colciencias.gov.co:8084/publindex/docs/articulos/1
que pudiera esperarse de la aplicación separada de una
692-5106/3/25.pdf (Octubre de 2013).
sola de dichas técnicas y a un costo biológico y
9. Espinosa-Fernández R, Valencia-Hitte R, Ceja-Andrade I.
económico inferior al logrado con tratamientos
Fluorosis dental. Etiología, diagnóstico y tratamiento.
restauradores invasivos. Clasificación de la Fluorosis Dental. Santiago; Ripano: 2011.
10. Ashkenazi M, Sarnat H. Microabrasion of teeth with
REFERENCIAS discoloration resembling hypomaduration enamel defects: four-
1. Hidalgo-Gato I, Estrada-Riverón J, Mayor-Hernández F, year follow up. J Clin Pediatric Dent 2000;2 -33.
Zamora-Díaz J. Fluorosis dental: no solo un problema estético. 11. Matos A, Turbino M, Lacalle ME. Efeito das técnicas de
Rev Cubana Estomatol 2007;44(4):1-12. microabrasao no esmalte: estudo em microscopia eletronicas
2. Norma Oficial Mexicana NOM-000-SSA1-2010. Agua para de varredura. Universidad de Sao Paulo: Odontología,
uso y consumo Humano. 1998;105.
3. Reeves T. Engineering and Administrative
Recommendations for Water Fluoridation. Atlanta: US

136
Capítulo 25
REHABILITACIÓN BUCAL DE UN PACIENTE
ADULTO JOVEN COMO COMPETENCIA
CLÍNICA DE PRÓTESIS PARCIAL FIJA EN LA
LICENCIATURA: REPORTE DE UN CASO.
Fernando Manuel Cervantes-Chávez,1 Resumen
Miguel Ángel Fernández-Barrera,2,3 Introducción: La prótesis parcial fija es uno de los tratamientos más comúnmente
Arturo Asencio-Villagrán,4 utilizados en odontología restauradora. Los objetivos de la prótesis parcial fija son
María de Lourdes Márquez-Corona,4 regresar la función del sistema masticatorio, así como mejorar la estética, generando una
mayor confianza en el paciente. La educación universitaria tiene una gran
Carlo Eduardo Medina-Solís.4
responsabilidad, pues es la formadora de los cuadros científicos, técnicos y políticos
responsables del liderazgo futuro. La competencia clínica constituye un eje integrador en
(1) Estudiante de la Licenciatura de Cirujano-
Dentista. Área Académica de Odontología del la profesión odontológica. Presentación del caso: Paciente femenino de 36 años de
Instituto de Ciencias de la Salud de la edad acude a las clínicas de Licenciatura del Área Académica de Odontología del Instituto
Universidad Autónoma del Estado de Hidalgo. de Ciencias de la Salud de la UAEH. El motivo de la visita fue inconformidad con sus
Pachuca, México. prótesis colocadas en la zona anterior. Después de ser valorado el paciente con los
(2) Alumno de la Maestría de Ciencias elementos diagnósticos necesarios, se decidió, rehabilitarla con prótesis parcial fija. Las
Biomédicas y de la Salud. Instituto de Ciencias restauraciones colocadas fueron metal-porcelana, con lo que se mejoró la estética y se
de la Salud de la Universidad Autónoma del regresó la función al paciente. Conclusiones: La competencia clínica en odontología es
Estado de Hidalgo. Pachuca, México. el conjunto de conocimientos, habilidades, destrezas, actitudes y valores necesarios para
(3) Profesor. Área Académica de Odontología
la ejecución de acciones relacionadas con la prevención, diagnóstico y tratamiento. Con la
del Instituto de Ciencias de la Salud de la
Universidad Autónoma del Estado de Hidalgo. adecuada rehabilitación del paciente ayudamos a mejorar su calidad de vida, al satisfacer
Pachuca, México. sus necesidades estéticas y funcionales. Significancia clínica: Este trabajo muestra un
(4) Profesor-Investigador. Área Académica de ejemplo del impacto de la rehabilitación bucal en las clínicas de licenciatura sobre la
Odontología del Instituto de Ciencias de la calidad de vida de las personas.
Salud de la Universidad Autónoma del Estado
de Hidalgo. Pachuca, México. Cómo citar:
Cervantes-Chávez FM, Fernández-Barrera MA, Asencio-Villagrán A, Márquez-Corona ML,
Medina-Solís CE. Rehabilitación bucal de un paciente adulto joven como competencia
Correspondencia a:
clínica de prótesis parcial fija en la licenciatura: reporte de un caso. En: Medina-Solís CE,
Dr. Miguel Ángel Fernández-Barrera.
Email: mafba.mafb@gmail.com Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos en Odontología.
Campeche: Universidad Autónoma de Campeche; 2015. p. 137-143. ISBN: 978-607-
8444-10-6

INTRODUCCIÓN personas, teniendo un impacto negativo en la calidad de


La pérdida de dientes, casi siempre es el resultado de las vida de las personas que la padecen.1,2
dos principales enfermedades bucodentales; la caries y Durante años, la odontología ha enfocado sus esfuerzos
la enfermedad periodontal. Es un problema de salud en tratamientos restaurativos que mejoren la calidad de
pública que limita la gama de alimentos consumibles, vida, así como lograr restauraciones más duraderas y
ocasionando un deterioro nutricional, genera problemas con un mayor grado de estética. Uno de los tratamientos
estéticos e inseguridad al relacionarse con otras protésicos más usados es la prótesis parcial fija. Si bien,

137
los implantes dentales, son un tratamiento novedoso, con integral, que involucre aspectos clínicos y sociales,
muy buenos resultados, el costo de estos, los vuelve capaces de resolver los problemas de salud bucal de la
inaccesibles para la población en general. El objetivo de población en general. Las necesidades de tratamiento de
la prótesis parcial fija es regresar al paciente la función y la población cambian dependiendo de variables
la estética, para así mejorar su calidad de vida. La socioeconómicas y sociodemográficas, por lo cual es
prótesis fija puede abarcar desde la rehabilitación de un necesario generar recursos humanos en materia de
diente, hasta la rehabilitación de todos los órganos odontología, capaces de atender a la sociedad en
dentales. Están indicados para reemplazar espacios general.
edéntulos cortos, restaurar dientes muy destruidos a La educación universitaria tiene una gran
causa de caries, dientes anteriores con problemas de responsabilidad, pues es la formadora de los cuadros
color, diastemas y preparación de un pilar para una científicos, técnicos y políticos responsables del liderazgo
prótesis parcial removible.3 futuro, de la producción de bienes y servicios y del
Los tipos de restauraciones metal-porcelana son muy ejercicio de la sociedad civil educada, alerta y
utilizadas, ya que combinan la resistencia del metal con participante. Ante la constante transformación, la
la estética de la porcelana. El avance tecnológico en vertiginosa innovación tecnológica y la voraz
materiales dentales ha permitido realizar restauraciones competencia, la necesidad de relacionar de una manera
más duraderas y con un mayor grado de estética. La más efectiva la educación con el mundo del trabajo es
principal desventaja de una corona metal-porcelana una demanda que no deben desoír las instituciones
cuando se compara con una total cerámica, es la educativas que pretendan mantener la excelencia en su
estética, aunque su durabilidad (en términos de calidad de formadores. El objetivo primordial de la
supervivencia de la restauración) es mayor4 y el costo es formación odontológica, debe ser formar individuos
más bajo, lo que las vuelve más accesible para la capaces, con pensamiento crítico y que posean la
población en general. Estudios sugieren un menor habilidad de continuar aprendiendo durante toda la vida.
número de fracasos o fallas en las restauraciones metal- Es importante resaltar que es elemental mantener la
porcelana, que en las total-cerámicas. Un fracaso puede competencia específica de cada profesión y en nuestro
ser definido como una razón o motivo para reemplazar la caso primordialmente la competencia clínica de alguna
prótesis. Las condiciones que llevan a reemplazar una manera se constituye en un eje integrador.7 En una
prótesis frecuentemente son: caries secundaria y pérdida declaración de la Federación Internacional, aprobada en
de retención de la prótesis, además de fallas estéticas, Asamblea General, Sídney septiembre 2003, el
pulpitis irreversible, entre otras.5,6 término competencia clínica se refiere a una combinación
Si bien, existen diferentes opciones de tratamiento para de habilidades, actitudes, conocimientos que provee al
un mismo caso, es importante que el odontólogo sea clínico de suficiente idoneidad para emprender una tarea
capaz de reconocer y ofrecer un plan de tratamiento de clínica específica. El conocimiento requerido comprende
acuerdo a las necesidades de cada paciente. La mejor el entendimiento apropiado de los principios biológicos
forma de poder lograrlo, es por medio de una educación moleculares, a través de características anatómicas y

138
fisiológicas, hasta la patogénesis de los procesos de la
enfermedad (FDI; 2003). Una de las materias que se
imparten en el Área Académica de Odontología del
Instituto de Ciencias de la Salud de la Universidad
Autónoma del Estado de Hidalgo es la clínica de prótesis
parcial fija, donde se reciben pacientes remitidos de otras
clínicas, tales como clínica de diagnóstico, clínica de
Figura 1. Fotografía frontal inicial. Se aprecia el estado de las
endodoncia y clínica de prótesis parcial removible. El tipo prótesis con las que llego el paciente nótese los problemas con el
color de las prótesis.
de población que recibe es de un estrato socioeconómico
que va de medio a bajo. Una de las razones por las
cuales acuden los pacientes a las clínicas de la UAEH,
es el bajo costo con el que se pueden rehabilitar. A pesar
de que hoy en día la odontología está cambiando su
enfoque de tratamientos restaurativos a preventivos, la
mayor demanda de tratamientos sigue siendo para
tratamientos restaurativos. Por lo cual es necesario
capacitar al estudiante en esta área de la odontología.

REPORTE DEL CASO


Paciente de sexo femenino, 36 años de edad, acude a la Figura 2. Fotografía oclusal inicial. Se ve diferencia de color entre la
prótesis inicial y los órganos dentales naturales.
clínica de prótesis parcial fija de la licenciatura del Área
Académica de Odontología del Instituto de Ciencias de la
Para establecer el diagnóstico y plan de tratamiento se
Salud de la Universidad Autónoma del Estado de
solicitaron estudios de gabinete, tales como radiografías
Hidalgo, México. Es remitido de la clínica de diagnóstico,
periapicales, radiografía panorámica, fotografías
ya que el paciente porta restauraciones mal ajustadas, y
intraorales y extra orales y modelos de estudio. Los
el paciente refiere que además de incomodidad para
modelos fueron montados en un articulador
comer, le causa inseguridad. Al examen clínico se
semiajustable, y se solicitó un encerado diagnóstico. En
observa un provisional de 2 unidades (órganos dentales
el análisis radiográfico se observó tratamiento de
11 y 12) mal ajustado y decolorado como se muestra en
conductos en las piezas 11 y 21, el estado de la
las figuras 1 y 2. La paciente refiere que lo tiene desde
endodoncia fue valorado por un endodoncista, ya que la
hace 2 años aproximadamente. También se observaba
paciente refiere que tiene 12 años de tratamiento.
un puente de 3 unidades que abarca los órganos
Finalmente se decidió no realizar retratamiento de
dentales 21, 22 y 23, siendo ausente el órgano dental 22.
conductos, ya que el órgano dental con tratamiento de
La prótesis se veía clínicamente desajustada y con un
conductos se mostraba asintomático.
color diferente a las necesidades del paciente.

139
Preparación humedecer el hilo retractor UltraPak Ultradent® en
Para la preparación de los órganos dentales pilares se solución de cloruro de aluminio al 25% ViscoStat Clear
respetaron los principios de tallado básicos. La línea de Ultradent®. Después se coloca el hilo retractor dentro del
terminación fue chaflán largo con una fresa troncocónica surco, con ayuda de un empacador de Fisher (Figura 3).
de extremo redondeado, la cual se ubicó Toma de impresión
subgingivalmente. Para posicionar la línea de terminación Antes de tomar una impresión definitiva, es necesario
sin dañar el margen gingival se colocó hilo retractor “000” realizar una primera impresión con alginato, lo que ayuda
UltraPak Ultradent®. El hilo retractor colocado para a valorar el paralelismo de los muñones. La toma de
proteger el margen gingival también ayudó al ajuste del impresión definitiva se realizó con polivinilsiloxano
provisional.8 Una vez terminado el desgaste de los Hidroxtreme Swiss TEc ® Coltene, la técnica realizada
órganos dentales, se ajustaron los provisionales, fue por técnica de impresión a doble hilo.10 Se utilizaron
dejándolos perfectamente bien adaptados y pulidos. hilos de calibre “000” y “0” UltraPak Ultradent® y
Colocación del endoposte hemostático de cloruro de aluminio al 25% ViscoStat
Al retirar las restauraciones con las que llego el paciente, Clear Ultradent®. El procedimiento fue el siguiente:
se observó severamente destruida la corona del órgano 1. Se aplicó el cloruro de aluminio en el surco gingival
dental 11, por lo cual, después de realizar el desgaste se según las recomendaciones del fabricante, para control
decidió necesaria la colocación de un endoposte de fibra de los fluidos gingivales.
de vidrio. Para la colocación del endoposte se desobturó 2. Después de valorar el biotipo gingival del paciente, se
2/3 partes de gutapercha de la raíz con las fresas peeso. empacó el hilo retractor de calibre “000”.
Antes de cementar el endoposte se tomó una radiografía 3. El segundo hilo que se colocó fue de calibre “0”, y se
periapical para ver que el endoposte estuviera bien colocó con la finalidad de producir retracción gingival
ajustado. La reconstrucción del muñón fue con resina horizontal y vertical.
compuesta.9 4. Posteriormente se esperó 15 minutos,10 y se comenzó
a mezclar el material pesado con su activador. Se colocó
el material de impresión en la cucharilla de plástico
previamente probada, y a la cual se le colocó adhesivo a
base de un copolimero de polidimetisolano de la casa
comercial Coltene®. Para la impresión del material
pesado se mezcló la pasta con su material activador. Se
Figura 3. Fotografía de los órganos dentales desgastados con el hilo
retractor. Se observan los órganos dentales desgastados previos a la siguieron las recomendaciones del fabricante para
impresión. También se puede ver la retracción gingival provocada por
el empacamiento del hilo retractor. obtener las condiciones ideales del material de
impresión.
Manejo de tejidos
5. Para la toma de impresión del material ligero, se retiró
El manejo de tejidos se realizó por medio de la técnica
el hilo de mayor calibre y se secó la superficie. Se colocó
quimico-mécnica.9 El procedimiento consiste en
el material ligero tanto en cucharilla, como en órganos

140
dentales desgastados y se tomó la impresión dejando el 2. Toma de color: Para la toma de color se utilizó el
tiempo que recomienda el fabricante. colorímetro Vita®, las piezas adyacentes y dientes
6. Para obtener el positivo se utilizó yeso tipo IV, antagonistas, fueron la referencia para la selección de
mezclado según las recomendaciones del fabricante en color. El tipo de luz utilizada fue la luz natural y el color
la relación agua-polvo. El modelo fue segueteado, elegido según la escala Vita® “c2” para todas las coronas
delimitado y articulado, previo a enviarlo a laboratorio. a realizar.
Pruebas de la Prótesis. 3. Prueba de porcelana: Durante la prueba de cerámica
1. Prueba de metal: Se verifico que el metal ajustara de se valoraron puntos de contacto prematuros, que el color
forma adecuada en el modelo de trabajo, así como el fuera el adecuado y se le observó que hacía falta más
espacio suficiente en los espacios proximales. Después cerámica en los pónticos para un terminado más estético,
de revisar los metales en el modelo de trabajo, lo por lo cual se solicitó al técnico dental que le agregara un
siguiente fue la evaluación clínica de los mismos. poco más de porcelana, y se realizó una segunda prueba
previo al glaseado (Figura 6).

Figura 4. Fotografía de prueba de metales en boca. Se observa el


ajuste de los metales en los órganos dentales desgastados.

Figura 6. Fotografía de prueba de porcelana. Se observa la prueba de


porcelana en el modelo de yeso, nótese una muy buena anatomía.

4. Cementado provisional: Una vez glaseado el trabajo, lo


siguiente fue cementar el puente de manera temporal,
para evaluar la función de la restauración y respuesta del
Figura 5. Fotografía de prueba de metales en el modelo. Se aprecia paciente hacia la prótesis.
el ajuste de los metales en el modelo de yeso.
5. Cementado definitivo: Lo primero es retirar la prótesis
Se valoró el sellado clínicamente con ayuda de un provisional con mucho cuidado, después se eliminan los
explorador, y se verifico radiográficamente con una excedentes del cemento provisional, se enjuaga con
radiografía de aleta de mordida (Figuras 4 y 5). También chorro de agua, y se seca con mucha precaución, se
se verificó el espacio interoclusal, para garantizar un aisló de forma relativa, y se usó eyector para mantener el
espacio suficiente para el montaje de porcelana. campo operatorio seco. Se utilizó ácido fosfórico

141
grabador en gel 3M ESPE® sobre los metales del La principal desventaja de la prótesis parcial fija, es el
puente, para eliminar impurezas del metal y lograr una tener que desgastar tejido sano para poder reemplazar
adhesión mecánica y química entre la restauración y el un diente faltante, sin embargo, en este caso, como ya
muñón. Se cementó con cemento de resina modificado tenía prótesis fija previa, los desgastes ya se habían
con ionómero de vidrio (RelyX™ Luting®) de la casa realizado. Con la adecuada rehabilitación del paciente
comercial 3M ESPE®. Ya cementado se retiraron ayudamos a mejorar su calidad de vida, al satisfacer sus
excedentes (Figura 7). necesidades estéticas y funcionales.

REFERENCIAS
1. Sánchez-García S, Juárez-Cedillo T, Reyes-Morales H, De
la Fuente-Hernández J, Solórzano- Santos F, García-Peña C.
Estado de la dentición y sus efectos en la capacidad de los
ancianos para desempeñar sus actividades habituales. Salud
Publica Mex 2007;49:173-181.
Figura 7. Fotografía final del paciente. Se observa la prótesis fija
cementada en la boca del paciente. 2. Batista MJ, Lawrence HP, de Sousa MLR. Impact of tooth
loss related to number and position on oral health quality of life
El consentimiento informado se obtuvo del paciente para among adults. Health and Quality of Life Outcomes
la publicación del presente caso al igual que las 2014;12:165.
imágenes que acompañan. 3. Rosenstiel SF, Land MF, Fujimoto J. Prótesis Fija
Contemporánea. Elsevier España 2008.
CONCLUSIONES 4. Anusavice KJ. Standardizing failure, success, and survival

La competencia clínica en odontología de alguna manera decisions in clinical studies of ceramic and metal–ceramic fixed
dental prostheses. Dental Materials 2012; 28:102-111.
constituye un eje integrador. Es decir es el conjunto de
5. Libby G, Arcuri MR, LaVelle WE, Hebl L. Longevity of fixed
conocimientos, habilidades, destrezas, actitudes y
partial dentures. J Prosthet Dent 1997;78:127-131.
valores necesarios para la ejecución de acciones
6. Pjetursson BA, Sailer I, Makarov NA, Zwahlen M, Thoma
relacionadas con la prevención, diagnóstico y
DS. All-ceramic or metal-ceramic tooth-supported fixed dental
tratamiento; para la interacción de los miembros del prostheses (FDPs)? A systematic review of the survival and
equipo de salud individual o comunidades, en la complication rates. Part II: Multiple-unit FDPs. Dental Materials
búsqueda de solución a los graves problemas de salud 2015;31:624-639.
que afrontamos; para lo cual se requiere del dominio de 7. Calatrava-Oramas LA. Educación por competencias en
conocimientos específicos, de habilidades de odontología. Acta Odontol Venez 2010; disponible en:

comunicación y organización; de destrezas para trabajar http://www.actaodontologica.com/ediciones/2010/1/art16.asp.


8. Kina S, Bruguera A. Invisible: Restauraciones estéticas
en equipo y solucionar problemas; de pericias para el
cerámicas / Aesthetic Ceramic Restorations. Editorial Médica
razonamiento en función de evidencias, englobando
Panamericana. 2011.
valores como vocación de servicio, sensibilidad social,
9. Shillinburg HT. Fundamentos esenciales en prótesis fija. 3ra
responsabilidad, compromiso, empatía, honestidad, etc7.
Ed. Quintessence, 2000.

142
10. Salazar JR. Métodos de separación gingival en prótesis fija. 11. Declaración de la FDI. Resultados recomendados
Acta Odontol Venez 2007;45:1-8. (competencias) en el entrenamiento de estudiantes de
pregrado. Sydney. Asamblea General FDI 18 sept, 2003.

143
Capítulo 26
HALLAZGO RADIOLÓGICO: DEFECTO DE
STAFNE. REPORTE DE UN CASO.
Juan Alejandro Casanova-Sarmiento,1 Resumen
Juan Fernando Casanova-Rosado,2 Introducción: La cavidad ósea idiopática de Stafne fue descrita en 1942, a través de 35
Mirna Isabel Minaya-Sánchez,2 pacientes, por primera vez se hizo referencia a este defecto óseo y se describió como una
Ana Alicia Vallejos-Sánchez,2 cavidad asintomática radiolúcida unilateral y localizada en la parte posterior de la
mandíbula. Se cree que se presenta con una incidencia de entre 0.1 y un 1.3% y es más
Alejandro José Casanova-Rosado.2
frecuente en pacientes varones (80%). La edad promedio donde se observan con mayor
frecuencia es entre los 50 y 60 años; aunque alguno autores afirman que puede ser
(1) Pasante de la Licenciatura de Cirujano
Dentista. Facultad de Odontología de la detectado en edades tempranas. Su localización es entre el ángulo de la mandíbula y la
Universidad Autónoma de Campeche, México. parte posterior del primer molar. Se cree que puede asociarse con la presencia de tejido
Campeche, México. glandular salival en su interior. Presentación del Caso: Paciente masculino de 30 años
(2) Profesores-Investigadores. Facultad de de edad, se presenta a consulta odontológica por motivos de rehabilitación con implantes
Odontología de la Universidad Autónoma de dentales en la región del 12 y 22, asintomático durante la exploración física, no se
Campeche, México. Campeche, México. observó algún hallazgo de interés clínico. La exploración intraoral no muestra expansión
cortical mandibular, no hay movilidad ni dolor a la percusión dental y a la palpación no se
encuentra ningún cambio, durante el estudio radiográfico rutinario se denota la presencia
Correspondencia a:
Dr. Juan Alejandro Casanova-Sarmiento
de esta cavidad con un aspecto radiolúcido en la zona antegonial mandibular cerca del
Email: juancoliz@hotmail.com borde basal, la cual está bien delimitada y corticalizada, se localiza por debajo del
conducto dentario inferior, sin relación aparente con las piezas dentales. Conclusiones:
en casos atípicos o cuando existen dudas diagnósticas, una intervención quirúrgica y el
análisis del tejido extirpado puede estar indicado, ya que esta es la única forma de
descartar una patología neoplásica. Significancia clínica: El diagnóstico oportuno
radiográfico puede llegar a hallazgos importantes y es deber del profesional de la salud
emitir un correcto diagnóstico presuntivo, diagnósticos diferenciales y manejo clínico de
acuerdo a cada patología.

Cómo citar:
Casanova-Sarmiento JA, Casanova-Rosado JF, Minaya-Sánchez MI, Vallejos-Sánchez
AA, Casanova-Rosado AJ. Hallazgo radiológico: defecto de Stafne. Reporte de un caso.
En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores. Mis casos clínicos
en Odontología. Campeche: Universidad Autónoma de Campeche; 2015. p. 144-147.
ISBN: 978-607-8444-10-6

INTRODUCCIÓN ya que el defecto se forma durante la osificación


La patogenia del defecto de Stafne no es muy clara hoy mandibular por presión crónica glandular.1,2
en día. Han sido descritos en la literatura como defectos Durante el examen histopatológico el hallazgo más
congénitos, por atrapamiento de tejido glandular importante ha sido tejido glandular salival, también se ha
submaxilar en caso de defectos posteriores y de la encontrado tejido conectivo, linfático, muscular e incluso
glándula sublingual en localizaciones anteriores. Algunos en algunos paciente se ha descrito como una cavidad
autores afirman que el hallazgo en los adultos sólo se vacía. Esto hace que su nombre correcto sea como
debe al tiempo en que se realiza el examen radiográfico, cavidad ósea, ya que no muestra epitelio de

144
revestimiento, lo que por lo tanto no puede ser clasificado Esta lesión no requiere tratamiento quirúrgico y su
como quiste. tratamiento se basa únicamente en un seguimiento con
Podemos mencionar que existen distintos subtipos, y radiografías periódicas.
esto se denominan según su relación con la cortical
vestibular y la densidad ósea de su contenido. La PRESENTACION DEL CASO
clasificación según su relación con la cortical sería Tipo I Paciente masculino de 30 años de edad, se presenta a
(no alcanza la cortical bucal), tipo II (Se extiende hasta la consulta odontológica por motivos de rehabilitación con
cortical bucal), y Tipo III (expande la cortical bucal). Por implantes dentales en la región del 12 y 22, asintomático
su contenido se clasificaría en tipo G (contiene tejido durante la exploración física, no se observó algún
glandular), tipo F (densidad grasa); y tipo S (contiene hallazgo de interés clínico. La exploración intraoral no
partes blandas).1-3 muestra expansión cortical mandibular, no hay movilidad
El examen radiológico muestra una lesión unilocular, bien ni dolor a la percusión dental y a la palpación no se
definida, algunos pocos casos se han descritos como encuentra ningún cambio, durante el estudio radiográfico
uniloculares, le cavidad presenta bordes nítidos y rutinario se denota la presencia de esta cavidad con un
ligeramente escleróticos, con un contenido hipodenso y aspecto radiolúcido en la zona antegonial mandibular
homogéneo, siendo descrita en su contenido una cerca del borde basal, la cual está bien delimitada y
densidad grasa propia de tejidos blandos. Generalmente corticalizada, se localiza por debajo del conducto dentario
se encuentra en una relación caudal al nervio dentario inferior, sin relación aparente con las piezas dentales
inferior, con relativa cercanía a los ápices, a veces puede (Figura 1).
superponerse la imagen a estos ápices. Por lo general es
una única lesión, aunque se han descrito casos múltiples
y bilaterales.3
Clínicamente suele ser diagnosticada de forma accidental
en exámenes rutinarios radiológicos, y su curso es
generalmente asintomático. Por lo general no el palpable
y en el examen clínico intra y extraoral no manifiesta
signos ni síntomas.
Para poder establecer un diagnóstico la radiografía Figura 1. Fotografía intraoral del paciente.
panorámica puede ser suficiente, aunque en algunos
casos se requerirá de exámenes complementarios como Una vez realizado del diagnostico presuntivo de cavidad

la imagen de resonancia magnética, la sialografía y el de Stafne se pidió una tomografía axial computarizada

cone bean.2,4,5 (cone beam) en la cual se comprobó que no se

Para el diagnóstico diferencial se deben descartar encontraba ningún contenido dentro de la cavidad

lesiones de tipo tumorales benignas o malignas descartando diagnósticos diferenciales, mediante la TAC

(ameloblastoma, queratoquiste, quistes radiculares, etc).

145
se pudieron realizar mediciones exactas de la periferia de
la lesión (Figura 2).

Figura 2. Corte tomográfico en el cual se observa una zona


radiolúcida en la zona antegonial mandibular izquierda.
Figura 4. Acercamiento en corte tomográfico, obsérvese los bordes
bien definidos y corticalizados.
Está clasificado como un pseudoquiste ya que no hay
epitelio o fluido en el interior. Generalmente es El consentimiento informado se obtuvo del paciente para
confundido con otros quistes mandibulares. la publicación del presente caso al igual que las
La cavidad de Stafne, es una cavidad asintomática imágenes que acompañan.
radiolúcida unilateral y localizada en la parte posterior de
la mandíbula, la mayoría de estos defectos se presentan DISCUSIÓN
en el sexo masculino, El defecto de Stafne es raro y se reporta en formarse
Se conoce que este sea causado por una porción entre los 11 a los 30 años de edad, aunque el defeco es
ectópica de la glándula salival submandibular la cual de desarrollo, pareciera no estar presente en el momento
causa que la cortical lingual a remodelarse. Raras veces del nacimiento implicando que la lesión se desarrolla mas
este defecto puede estar completamente rodeado de tarde. Usualmente el efecto es unilateral y se presenta
hueso (Figuras 3 y 4). con mayor frecuencia en hombres.

CONCLUSIONES
En la mayoría de los casos de cavidad de Stafne no se
requiere ningún tratamiento, puesto que la cavidad no
aumenta o disminuye según se le apliquen diferentes
terapias puesto que es una deformación ósea formada
durante crecimiento; en casos atípicos o cuando existen
dudas diagnosticas, una intervención quirúrgica y el
análisis del tejido extirpado puede estar indicado, ya que
esta es la única forma de descartar una patología
Figura 3. Reconstrucción tridimensional vista lateral izquierda
mandibular. neoplásica.

Generalmente es descubierto durante una revisión


radiográfica rutinaria. No se requiere ningún tratamiento

146
REFERENCIAS: 3. Burket's oral medicine diagnosis & treatment (10th ed.).
1. Stafne, EC. Bone cavities situated near the angle of the Hamilton, Ont.: BC Decker. 2003. p. 155.
mandible. JADA 1942;29:1969-1972 4. White SC, Pharoah MJ. Oral radiology principles and
2. Sánchez-Burgos R, Navarro-Cuellar I, del Castillo JL, interpretation. 5th edition. St. Louis; Mosby: 2004. pp. 651–2.
Moran-Soto MJ, Burgueño-García M. Cavidad ósea idiopática 5. Seward, GR. Salivary gland inclusions in the mandible. Br
de Stafne. Diagnóstico y manejo. Rev Esp Cirug Oral y Dent J 1960;108:321-325
Maxilofac 2011;33(2):96-99.

147
Capítulo 27
PRESENCIA DE LOS POLIMORFISMOS
rs411717 Y rs810687 DEL GEN DE COL1A2
EN CARIES SEVERA: REPORTE DE UN CASO.
Pamela López-Rodríguez,1 Resumen
Brenda Vianeth Guerrero-Cabral,1 Introducción: La caries dental es hoy reconocida como una enfermedad
Manuel de Jesús Muñoz-Hernández,2 infectocontagiosa que provoca perdida localizada de mineralización en los dientes
Juan Carlos Cuevas-González,2 afectados. En cavidad bucal, el colágeno participa en la formación de dentina, la
presencia de polimorfismos de un solo nucleótido en esta proteína dan origen a una
Graciela Zambrano-Galván.3
proteína deficiente. Presentación del caso: Se presenta un paciente de sexo femenino
de 22 años de edad, clínicamente sana, sin antecedente de consumo de tabaco, alcohol y
(1) Estudiante de la Licenciatura de Cirujano
Dentista. Facultad de Odontología. Universidad drogas, refiriendo molestia y dolor en cavidad bucal. Se realizó exploración de cavidad
Juárez del Estado de Durango. Durango, bucal, encontrando una oclusión clase I con mordida y articulación temporomandibular
México. normal, sin patologías aparentes en tejidos blandos, con diagnóstico presuntivo de caries
(2) Profesor-Investigador. Facultad de severa. El tratamiento consistió en obturaciones con amalgama y resina. Para las piezas
Odontología. Universidad Juárez del Estado de 11,13, 21 y 22 se indicó tratamiento endodóntico para su rehabilitación con carillas. Se
Durango. Durango, México. realizó un análisis molecular de los polimorfismos rs411717 y rs810687 del gen COL1A2,
(3) Profesora-Investigadora. Laboratorio de por PCR- HRM. Encontrando que se presentan los homocigotos mutados GG y TT de
Estomatología Molecular, Facultad de los polimorfismos rs411717(A>G) y rs810687(C>T) del gen COL1A2 respectivamente.
Odontología. Universidad Juárez del Estado de
Conclusiones: La presencia de los alelos mutados GG y TT de los polimorfismos
Durango. Durango, México.
rs411717y rs810687del gen COL1A2 en caries severa, coadyuvara en la implementación
del uso técnicas moleculares para le detección temprana de individuos con mayor
Correspondencia a: susceptibilidad al desarrollo de enfermedades bucodentales. Significancia Clínica: El
Dra. en C. Graciela Zambrano Galván. uso de técnicas moleculares para la detección temprana de riesgo en el desarrollo de
Email: gzambrano@ujed.mx diferentes patologías bucodentales, permitirá realizar un abordaje desde una perspectiva
de la medicina personalizada.

Cómo citar:
López-Rodríguez P, Guerrero-Cabral BV, Muñoz-Hernández MJ, Cuevas-González JC,
Zambrano-Galván G. Presencia de los polimorfismos rs411717 y rs810687 del gen de
COL1A2 en caries severa: reporte de un caso. En: Medina-Solís CE, Casanova-Rosado
JF, Lara-Carrillo E, editores. Mis casos clínicos en Odontología. Campeche: Universidad
Autónoma de Campeche; 2015. p. 148-152. ISBN: 978-607-8444-10-6

INTRODUCCIÓN esmalte atacando la dentina, alcanzando la pulpa dental


La caries dental es una condición bucal adversa cuya con la consecuente inflamación (pulpitis) y
etiología es multifactorial la cuan involucra aspectos posteriormente necrosis de la pieza dental afectada.2
genéticos, de comportamiento y ambientales.1 La caries Esta afección inicia con un cambio en la microbiota bucal,
dental es hoy reconocida como una enfermedad la cual es afectada por la composición del flujo salivar,
infectocontagiosa que provoca perdida localizada de exposición al flúor, consumo elevado de azucares en la
mineralización en los dientes afectados, los cuales de dieta, así como los malos hábitos de limpieza bucal. Es
no ser tratados se puede llegar a la destrucción del considerada una enfermedad irreversible y puede ser

148
detenida en cualquier estado excepto cuando la dentina o como la presencia de caries (11, 13, 15, 21, 22, 23, 25,
el esmalte son destruidos.3 En cavidad bucal, el colágeno 35 y 45) (Figuras 1a y 1b), por lo que el diagnóstico fue
participa en la formación de la dentina. Se presenta en de caries severa múltiple.
fibrillas de 20-100nm de diámetro estriadas agrupadas
para formar fibras de colágeno mayores; es una proteína
tricatenaria formada por cadenas alfa de 2 tipos cuyas
subunidades mayores difieren en su composición de
aminoácidos y secuencia, las cuales se encuentran
constituidas por una cadena tipo 1 alfa 1, y dos cadenas
tipo 1 alfa 2;4 por lo que, la presencia de polimorfismos
de un solo nucleótido en la secuencia del gen que
codifica para la formación de esta proteína son de alta
relevancia clínica; ya que podrían dar origen a una
proteína deficiente, que en el caso de la formación de la
dentina, puede ocasionar mayor susceptibilidad al
desarrollo de caries dental.5

PRESENTACIÓN DEL CASO Figuras 1a y 1b. Lesiones de caries severa múltiple.

Se presenta paciente de sexo femenino de 22 años de


edad, clínicamente sana, sin antecedentes de consumo El tratamiento consistió en la obturación con amalgama

de tabaco, alcohol y drogas; de ocupación estudiante, en 15, 35 y 45, y la obturación con resina en 23. Para las

residente en la ciudad de Durango, Durango. Acude a piezas 11,13, 21 y 22 se indicó tratamiento endodóntico

consulta a la Clínica de Integral de la Facultad de para su posterior rehabilitación con carillas dentales.

Odontología de la Universidad Juárez del Estado de Debido a la severidad por caries presentada por la

Durango, refiriendo molestia y dolor en cavidad bucal. paciente se procedió a realizar un análisis molecular de

Previa firma de carta de consentimiento informado para los polimorfismos rs411717 y rs810687 del gen COL1A2,

la realización del diagnóstico, tratamiento, presentación por análisis de fundido de alta resolución de productos de

y/o publicación de su caso, se procedió a realizar PCR conteniendo el sito polimórfico (PCR- HRM); la cual

exploración inicial de cavidad bucal así como la toma de consistió, en la toma de 10 µL sangre capilar la cual fue

radiografías periapicales, encontrando una oclusión clase recolectada en un tubo con 100 µL de solución de lisis de

I con mordida y articulación temporomandibular normal, NaOH (obteniendo una concentración final de 9.1% V/V),

sin patologías aparentes en tejidos blandos. Además se la solución fue incubada a 37°C por 15 min, el lisado

encontraron obturaciones con amalgamas (16, 17, 26, obtenido se utilizó para la realización de la técnica

27, 36, 37, 46, 47) y resinas (11, 12, 13, 21, 22, 23); molecular. A continuación se procedió a realizar el PCR-

piezas extraídas (14, 18, 24, 28, 34, 38, 44 y 48), así HRM, en el cual se utilizaron un rango de temperatura de

149
55- 95°C para cubrir todos los puntos de fusión de los alelos mutados GG y TT de los polimorfismos
acuerdo al tipo de cambio de la base utilizando el rs411717(A>G) (Figura 2) y rs810687(C>T) (Figura 3) del
reactivo Precision Melt Supermix (Bio-Rad Laboratories. gen COL1A2 respectivamente. El resultado obtenido
Hercules, CA.) de acuerdo a las recomendaciones del permite realizar inferencias con respecto a la deficiencia
proveedor. Las condiciones del PCR-HRM y las de la síntesis de la dentina, lo cual conlleva a que la
secuencias de los polimorfismos se muestran en el paciente presente una mayor susceptibilidad para el
Cuadro I. desarrollo de caries severa.

Cuadro I.- Condiciones de amplificación de los polimorfismos rs411717 y rs810687 del gen COL1A2.
Polimorfismo Secuencia de Oligonucleótidos* Temperatura de Temperatura de Tamaño del
Alineación (0C) Fundido amplicon
(0C) (pb)
rs411717 F’GTAAGGTAGGTTTGACTGCAGAG 58 55 - 90 105
R’CCGTACCCTCTGTTCCTCATA

rs810687 F’GGAATATCCCTGACAGCAAGCATACC 53.7 55 - 90 132


R’GAACCAAAGTCTAGTATACCTCTAAGC

pb= pares de bases.


*Los oligonucleótidos fueron diseñados con el programa PrimerQuest Disign Tool de la compañía Integrated DNA Technologies y refSNP de
NCBI.

Para el análisis de las curvas de fundido se utilizó un


termiciclador ECO (Illumina Inc. San Diego, CA.) con
canal para HRM. El tamaño de los amplicones fue de de
105 y 132 pb para rs411717(A>G) y rs810687(C>T) del
gen COL1A2 respectivamente.

Figuras 3. Curva de fundido de alta resolución del


polimorfismos rs810687 del gen COL1A2.

El consentimiento informado se obtuvo de la paciente


para la publicación del presente caso al igual que las
imágenes que acompañan.
Figuras 2. Curva de fundido de alta resolución del
polimorfismos rs411717 del gen COL1A2.
DISCUSIÓN
Como resultado de dicho análisis molecular se encontró Aunque la caries dental no es considerada como una
que la paciente presenta genotipificación homocigota de enfermedad fatal, el deterioro dental puede impactar de

150
forma negativa en las actividades de la vida diaria, y proporcionan una mejor comprensión de las redes de
consecuentemente en la calidad de vida provocando regulación y de las moléculas de la matriz extracelular
dolor, lo cual ocasiona alteraciones en el consumo de que intervienen en el desarrollo del diente, así como los
alimentos, el sueño, socialización y así como en la diferentes tipos de defectos heredados que se producen
autoestima.1 cuando los genes que codifican estas moléculas están
Es importante mencionar que el proceso de la funcionalmente alterados por mutación.7
enfermedad cariosa inicia con un desequilibrio en la
placa dentobanteriana que recubre la superficie dental, CONCLUSIÓN
observándose el proceso de desmineralización en los La presencia de los alelos mutados GG y TT de los
tejidos duros del diente; sin embargo, los cambios en el polimorfismos rs411717y rs810687del gen COL1A2 en
esmalte dental no son detectados con métodos clínicos o caries severa, coadyuvara en la implementación del uso
radiográficos tradicionales3 haciendo de esta manera que técnicas moleculares para le detección temprana de
la severidad de las lesiones cariosas aumenten en gran individuos con mayor susceptibilidad al desarrollo de
medida como es el caso de la paciente. enfermedades bucodentales.
En los resultados moleculares obtenidos sobre la
presencia de los alelos mutados para los polimorfismos AGRADECIMIENTOS
en estudio del gen COL1A2 , son un claro ejemplo de la Agradecemos a la C. Ana Cecilia Gómez Briseño y al
utilidad del uso de técnicas moleculares para la detección C.D. Francisco Márquez Quiñonez por su importante
temprana de riesgo en el desarrollo de diferentes colaboración para la realización de este trabajo.
patologías bucodentales, permitiendo de esta manera
realizar un abordaje desde una perspectiva de la REFERENCIAS

medicina personalizada; ya que hasta el momento 1. Ramos-Jorge J, Ramos-Jorge ML, de Paiva SM, Marques

únicamente se habían reportado afecciones graves LS, Pordeus IA: Dental Caries and Quality of Life Among
Preschool Children, Emerging Trends in Oral Health Sciences
ocasionadas por diferentes tipos de mutaciones de este
and Dentistry. Prof. Mandeep Virdi; 2015.
gen en enfermedades como la dentinogénesis
2. Oral Health Surveys Basic Methods. 5th ed. Geneva: WHO;
imperfecta,6 osteogénesis imperfecta I-IV, Ehlers-Danlos
2013.
tipo VII B, recesiva de Ehlers-Danlos tipo clásico, la
3. Selwitz RH, Ismail AI, Pitts NB. Dental caries. The Lancet
osteoporosis idiopática así como el síndrome de Marfán 2007;369:51-59.
atípico,5 siendo este reporte de caso el primero en su 4. Kuivaniemi H, Tromp G, Prockop DJ. Mutations in collagen
tipo. genes: causes of rare and some common diseases in humans.
Las alteraciones de las matrices de dentina y esmalte FASEB J 1991; 5:2052-60.
que dan lugar a defectos en la mineralización hereditarios 5. Dalgleish R. The human type I collagen mutation database.

forman parte de la pérdida de función en la formación de Nucleic Acids Res 1997; 25:181-7.
6. Lopez- Franco GE, Huang A, Pleshko- Camacho N, Blank
la corona, que son ocasionadas por la presencia de
RD. Dental phenotype of the col1a2(oim) mutation: DI is
diferentes mutaciones. Los avances recientes

151
present in both homozygotes and heterozygotes. Bone 7. Hu JC, Simmer JP. Developmental biology and genetics of
2005;36:1039-46. dental malformations. Orthod Craniofac Res 2007;10:45-52.

152
Capítulo 28
PLANEACIÓN DIGITAL ODONTOLÓGICA:
REPORTE DE UN CASO.
Horacio Nario-Venegas,1 Resumen
María Fernanda Yáñez-Acosta,2 Introducción: En la actualidad uno de los motivos de consulta más frecuente es mejorar la
Luis Javier Nuñez-Torres,3 estética dental. Normalmente un análisis estético requería de una serie de fotografías en las
Ileana Haidee Plascencia-Serrano.3 que se montaba un acetato y sobre él se diseñaban las modificaciones que se creían
pertinentes para lograr una sonrisa bella. Actualmente se ha logrado incorporar tecnología
(1) Profesor de Asignatura. Departamento de por medio de cámaras digitales y software al análisis estético de cada paciente. Es
Clínicas. Centro Universitario de los Altos, importante que se dé a conocer este sistema de trabajo debido al bajo índice de errores que
Universidad de Guadalajara. Tepatitlán de se cometen al implementarlo en cuanto al diseño del plan de tratamiento, comunicación con
Morelos, México. el equipo de trabajo y expectativas del paciente. Presentación del caso: Acude paciente
(2) Técnico Académico y Profesor de masculino de 26 años de edad, por motivo de unas restauraciones filtradas con
Asignatura. Departamento de Clínicas. repercusiones pulpares y periapicales en los órganos dentarios 11 y 21, primeramente se
Centro Universitario de los Altos, Universidad realizó la terapia pulpar y posteriormente se realizó la planeación digital del caso,
de Guadalajara. Tepatitlán de Morelos, decidiendo restaurar ambos órganos dentarios con dos restauraciones completamente
México.
cerámicas y la debida colocación de postes de fibra de vidrio debido a la ventaja estética y
(3) Estudiante de la Licenciatura de Cirujano
Dentista. Centro Universitario de los Altos de funcional que tienen. Conclusiones: Se logró cumplir con las expectativas del paciente
la Universidad de Guadalajara. Tepatitlán de logrando los resultados esperados tanto estética como funcionalmente con un sistema
Morelos, México. digital de fácil uso y acceso para cualquier profesionista. Significancia Clínica: Aquí reside
la importancia de esto, ya que nos permite dejar a nuestros pacientes conformes y
satisfechos con el tratamiento realizado.
Correspondencia a:
Dra. María Fernanda Yáñez-Acosta Cómo citar:
Email: fernanda_yanez@hotmail.com Nario-Venegas H, Yáñez-Acosta MF, Núñez-Torres LJ, Plascencia-Serrano IH. Planeación
digital odontológica: reporte de un caso. En: Medina-Solís CE, Casanova-Rosado JF, Lara-
Carrillo E, editores. Campeche: Universidad Autónoma de Campeche; 2015. p. 153-156.
ISBN: 978-607-8444-10-6

INTRODUCCIÓN conveniente proporción y correspondencia de unas cosas


Actualmente sabemos que muchos de los pacientes que con otras.1 Esta armonía es evaluada mediante las
reciben atención médica odontológica buscan resolver proporciones faciales, dentofaciales y dentales. Autores
sus problemas de manera rápida y eficiente, sin contemporáneos como Magne y Belser, nos explican la
embargo, en las últimas décadas se ha logrado existencia de dos criterios que conforman los elementos
desarrollar una necesidad inherente al ser humano, la de una sonrisa agradable, el subjetivo y el objetivo.2 Esto
estética o la belleza. nos facilita el análisis estético de cada paciente, sin
Durante mucho tiempo se han hecho estudios para embargo, los únicos medios disponibles para realizar
determinar qué características debe tener una sonrisa este estudio eran fotografías o de manera empírica con
visualmente agradable, y para que esto se logre se modelos de estudio. Es aquí donde la necesidad del ser
necesita hablar de un término muy utilizado en el ámbito humano estimula el empleo de herramientas que faciliten
de la odontología estética, la armonía, que se refiere a la más esta labor. Christian Coachman, en su necesidad

153
crea una herramienta digital en la cual integra todas las obteniendo resultados predecibles tratando de cumplir las
herramientas para que obteniendo fotografías digitales, expectativas del paciente respecto a sus restauraciones.
un computador y su software se logre un análisis
cuidadoso de las características dentales y faciales del PRESENTACIÓN DEL CASO
paciente para ayudar a los equipos de restauración a Paciente de 26 años se presenta a la Clínica de Atención
evaluar los factores de riesgo y las limitaciones de cada Medica Integral con motivo de consulta, “Necesito que
caso, permitiendo hacer las modificaciones pertinentes me hagan unas endodoncias porque hace 9 años me las
para lograr un resultado que agrade. Todo esto con la realizaron y me dijeron que tendría que ajustármelas a
finalidad de lograr resultados más predecibles mediante los 6 años”, por lo cual se le realizaron los medios de
una buena comunicación con el paciente y el equipo diagnóstico pertinentes para determinar un plan de
interdisciplinario de trabajo, motivar al paciente para tratamiento específico (Figura 1).
llevar a cabo su tratamiento y marketing.3
Lamentablemente este sistema de análisis y diseño tiene
un costo elevado que aspira a los 987 USD,4 requiere de
una capacitación especial que no está al alcance de
todos los profesionales del área odontológica y es una
Figura 1. Fotografía de la situación inicial del paciente del sextante
tarea que requiere de invertirle mucho tiempo. antero-superior.
Debido a esto, surge la necesidad tener este excelente
Radiográficamente se presentaron zonas radiolúcidas a
instrumento al alcance de nuestras manos, autores como
nivel periapical en los órganos dentarios número 11 y 21,
Edward McLaren y Johan Figueira de la Universidad de
acompañados de percusión vertical positiva y pruebas de
California Campus Los Ángeles (UCLA) ingeniaron la
vitalidad negativas se procede a realizar terapia
manera de incorporar el diseño y la planificación digital
endodóntica en ambos órganos para su posterior
mediante un concepto similar pero esencialmente
rehabilitación. Se decide restaurar ambos órganos
diferente. Lograron emplear esta herramienta con un
dentarios con postes de fibra de vidrio bajo la necesidad
software de diseño gráfico muy conocido, Photoshop®,
de obtener la retención y resistencia de la preparación
llamándolo Photoshop Smile Design. Este método de
que se perdió al retirar el tejido infectado sin sacrificar el
hacer diseño digital de sonrisa es una forma más fácil,
factor estético, se complementa el tratamiento con dos
accesible y rápida de llevar a cabo este trabajo
restauraciones libres de metal (disilicato de litio
obteniendo los beneficios de un diseño digital de sonrisa
prensado) debido a las ventajas estéticas que nos ofrece
obteniendo además el beneficio de la toma de color
este sistema sin dejar por un lado el factor funcional. Se
digital.5-7 Con base a esto se ha logrado sugerir el uso de
toman modelos de estudio y fotografías para realizar el
otros software como PowerPoint® y Keynote® para
encerado diagnóstico modificando la morfología de los
realizar bocetos de diseños digitales de sonrisa.3
órganos dentarios 11 y 21, que presentaban patología
En este caso clínico se pretende mostrar las ventajas que
pulpar y periapical debido a la filtración de restauraciones
ofrece la técnica de Photoshop® Smile Design,

154
con resina y un tratamiento endodóntico deficiente. Se le Se dejó que el paciente usara este prototipo estético y
presenta al paciente un boceto digital de los resultados funcional a base de bis-acril por 15 días para que
que se pueden obtener al final del tratamiento para que aprobara el diseño, el paciente acepta el prototipo y se
apruebe la forma y tamaño de los órganos dentarios a procede a tomar la impresión final para enviar a realizar
restaurar, se realizan algunas modificaciones a petición las restauraciones al laboratorio. Se realiza la toma de
del paciente transmitiendo esa información obtenida de color mediante una imagen para hacer un análisis por
manera digital al encerado diagnostico que será el diseño medio de Photoshop® eligiendo de esta manera el color y
de las restauraciones provisionales (Figura 2 y 3). capturar los detalles de los dientes por medio de
imágenes que proporcionen la información necesaria
para la estratificación correcta de los colores y
caracterizaciones de los dientes a tratar, además, se
tomó una fotografía de la preparación para determinar el
grado de opacidad de la pastilla del material restaurador
Figura 2. Captura de pantalla del diseño de las restauraciones en
Photoshop® transportando dientes de una galería de otros casos. debido a un sustrato desfavorable (Figuras 5 y 6).

Figura 5. Captura de pantalla de la selección de color por medio de


Figura 3. Fotografía del encerado diagnóstico de acuerdo al diseño Photoshop® mediante una fotografía calibrada, tomando como
digital acordado entre el paciente y clínico. referencia el colorímetro Clásico de la casa comercial Vita.

Posteriormente se realiza el tallado y colocación del


poste en ambos órganos dentarios y colocación de los
dientes provisionales, que nos servirán como medio de
comunicación con el paciente (Figura 4).

Figura 6. Fotografía de las preparaciones donde se aprecia el color


desfavorable del sustrato, misma que se envió al laboratorio para
determinar el grado de opacidad de la pastilla a utilizar.

Figura 4. Fotografía post-operatoria inmediata de los provisionales Se hace el análisis de color en el laboratorio
obtenidos del encerado por medio de una llave de acetato.
determinando el color y la forma en que se estratificaran

155
los polvos cerámicos, posteriormente se hace la prueba demostrando su gratitud al final del tratamiento, además
de la restauración en boca y por último el paciente de que es una herramienta que nos ayudó a elegir el
aprueba la cementación de las restauraciones (Figuras 7 color de las restauraciones y el tipo de material que el
y 8). técnico utilizó para bloquear el sustrato desfavorable,
haciendo de este, un método más preciso en todo
sentido. En conclusión la planeación digital de nuestros
casos es una herramienta muy buena que permite lograr
los resultados esperados cumpliendo las expectativas del
paciente en cuanto al color, forma y tamaño.
Figura 7. Fotografía post-operatoria inmediata.

REFERENCIAS
1. Diccionario de la Lengua Española (en Línea). [página en
Internet] http://lema.rae.es/drae/?val=armonia
2. Magne P, Belser U. Bonded porcelain restorations in the
anterior dentition: a biomimetic aproach. Chicago:
Quintessence; 2002.
3. Coachman C, Calamita M. Digital smile design: a tool for
treatment planning and communication in esthetic dentistry.
Quintessence Dent Technol 2012;35:1-9.
Figura 8. Fotografía post-operatoria 24 horas después.
4. Digital Smile Design [homepage on the Internet]
http://www.digitalsmiledesign.com/doctors/us/products/dsd-
El paciente rechazó el tratamiento de ortodoncia, sin
connect-software.
embargo, se obtuvo el consentimiento informado del
5. McLaren EA, Garber DA, Figueira J. The photoshop smile
paciente para la publicación del presente caso al igual design technique (part 1): digital dental photography. Compend
que las imágenes que lo acompañan. Contin Educ Dent 2013;34(10):772-779.
6. McLaren EA, Culp L. Smile analysis: the photoshop® smile
CONCLUSIONES design technique: part 1. Journal of Cosmetic Dentistry AACD.
Se logró una integración natural de las restauraciones en 2013;29(1):94-108.

el paciente logrando resultados predecibles en el 7. McLaren EA, Culp L, Swann LC. Converting digital designs
to the final smile (part 2): smile analysis. Journal of Cosmetic
tratamiento propuesto, hubo motivación y participación
Dentistry AACD. 2013;29(2):98-108.
por parte del mismo en todas las etapas de su
tratamiento lo que se reflejó en el resultado final,

156
Capítulo 29
TRATAMIENTO ORTODÓNCICO DE
MALOCLUSIÓN CLASE I CON EXTRACCIONES
DE SEGUNDOS PREMOLARES: REPORTE DE
UN CASO.
Rogelio José Scougall-Vilchis,1 Resumen
Isabel J. Pérez-García,2 Introducción: La maloclusión Clase I es la más frecuentemente encontrada entre los
Ana Miriam Santillán-Reyes,3 pacientes que solicitan tratamiento ortodóncico correctivo. Cuando el apiñamiento es
Iris Carrillo-Novia,2 severo, la extracción de premolares es la opción ideal. Los primeros premolares son
comúnmente eliminados para corregir la maloclusión; sin embargo, la extracción de
Carlo Eduardo Medina-Solís.4
segundos premolares es la indicación en algunos casos de apiñamiento moderado.
Presentación del caso: Paciente femenino de 15 años 10 meses de edad que presenta
(1) Profesor-Investigador. Coordinador del
Centro de Investigación y Estudios apiñamiento moderado y fue tratada con aparatología fija ortodóncica y la extracción de los
Avanzados en Odontología. Facultad de 4 segundos premolares. El tratamiento fue exitosamente terminado y los cambios
Odontología de la Universidad Autónoma del dentofaciales fueron impactantes para la paciente y son estables hasta 3 años post-
Estado de México. Toluca, México. retención. Conclusiones: La decisión fundamentada en un análisis diagnóstico preciso y
(2) Estudiante de Posgrado. Centro de adecuado para la extracción de los segundos premolares, es una alternativa importante de
Investigación y Estudios Avanzados en tratamiento en casos con apiñamiento moderado y su indicación favorece la estética
Odontología. Facultad de Odontología de la dentofacial. Significancia clínica: La extracción adecuada de los órganos dentales es clave
Universidad Autónoma del Estado de México. en la estética dentofacial y en la función de los pacientes tratados ortodónticamente. Existen
Toluca, México.
puntos claves para decidir cuándo es indicado eliminar los segundos premolares.
(3) Profesor de Posgrado. Centro de
Investigación y Estudios Avanzados en
Odontología. Facultad de Odontología de la Cómo citar:
Universidad Autónoma del Estado de México. Scougall-Vilchis RJ, Pérez-García IJ, Santillán-Reyes AM, Carrillo-Novia I, Medina-Solís CE.
Toluca, México. Tratamiento ortodóncico de maloclusión Clase I con extracciones de segundos premolares:
(4) Profesor-Investigador. Área Académica de reporte de un caso. En: Medina-Solís CE, Casanova-Rosado JF, Lara-Carrillo E, editores.
Odontología del Instituto de Ciencias de la Campeche: Universidad Autónoma de Campeche; 2015. p. 157-163. ISBN: 978-607-8444-
Salud de la Universidad Autónoma del 10-6
Estado de Hidalgo. Pachuca, México.

Correspondencia a:
Dr. Rogelio José Scougall-Vilchis
Email: rogelio_scougall@hotmail.com

INTRODUCCIÓN terapéutica internacionalmente realizada, por tal motivo la


Considerando la legendaria clasificación propuesta por el extracción de los primeros premolares es la primera
Dr. Edward H. Angle, la maloclusión Clase I es la más opción en casos de maloclusión Clase I con biprotusión
frecuentemente presentada por los pacientes que maxilar.1,2 En casos complejos se puede combinar la
solicitan tratamiento ortodóncico correctivo.1 extracción de los primeros premolares con algún otro
Comúnmente la extracción de los primeros premolares órgano dentario como los molares destruidos por caries.3
tiene un efecto benéfico en la corrección dental y en la En este contexto algunas maloclusiones de Clase I tienen
apariencia estética de los casos tratados bajo esta que tratarse con la extracción inusual de otros órganos

157
dentarios como los incisivos inferiores, por presentar una congénita de premolares.13 Existe la evidencia científica y
discrepancia de Bolton en las anchuras mesio-distales.4-6 se ha publicado una revisión sistemática de casos con
Existen casos en la literatura internacional relevante que extracciones de segundos premolares.14 Algunos autores
describen la terapéutica para tratar dichas maloclusiones han reportado un ligero cambio, o efecto facial con la
con dientes congénitamente ausentes como es el caso extracción de segundos premolares en el aspecto facial
de los incisivos inferiores; en dichos casos, si la de los pacientes. Sin embargo, en el presente caso
protrusión es muy marcada la ausencia del incisivo es clínico se muestra los efectos estéticos en ambos
compensada con la extracción de tres primeros aspectos, el dental y por supuesto en el efecto facial.
premolares para solucionar la protrusión dentomaxilar.7
Es importante mencionar que en otros casos de ausencia PRESENTACIÓN DEL CASO
congénita de órganos dentarios que no requieren Diagnóstico
extracción tendrán que ser tratados de diferente manera Paciente femenino de 15 años 10 meses de edad que
para recuperar los dientes ausentes, utilizando acude a valoración manifestando como motivo principal
alternativas como los implantes protésicos.8 En algunos de consulta “no me gusta la posición de mis caninos”.
casos las exigencias de la retracción dento-alveolar Dentro de la historia clínica no se detectó ningún aspecto
indican la extracción de los cuatro primeros premolares y que requiriera la revisión de algún especialista médico y
usar dispositivos de anclaje temporal (TADs);3,9 mientras se determinó que la paciente presentaba una salud
que otros autores prefieren utilizar aparatología lingual aparentemente sana para someterse a tratamiento
accesoria.10 ortodóncico sin limitaciones.
Si bien la extracción de órganos dentarios es una
alternativa indispensable para la corrección de algunas
maloclusiones, es importante saber que dientes y en qué
condiciones deberán ser eliminados. A pesar de que la
extracción de los primeros premolares ha sido la primera
opción, puesto que se encuentran entre el segmento
anterior y el segmento posterior, algunos estudios han
demostrado que su efecto no es positivo en todos los
casos. Como variante, la eliminación de los segundos
premolares se ha recomendado en casos de apiñamiento
moderado que no requiere grandes modificaciones para
el perfil de los pacientes.11 Por lo anterior, la extracción Figura 1. Imágenes faciales e intraorales pretratamiento.
de los segundos premolares se ha considerado
importante y se le ha dado mayor importancia para el La inspección clínica (Figura 1) reveló que la paciente

tratamiento de algunos casos.12 Dichos hallazgos clínicos presentaba simetría facial pero el perfil era ligeramente

se han ratificado en aquellos casos de ausencia convexo. Dentalmente, se observó una maloclusión

158
Clase I con apiñamiento moderado (Figuras 1 y 2).
Radiográficamente se encontraron condiciones
favorables y la presencia de todos los órganos dentales
permanentes incluyendo a los 3ros molares (Figura 3).

Figura 4. Imagen de la radiografía lateral de cráneo pretratamiento.

Figura 2. Imágenes fotográficas de los modelos de estudio


pretratamiento.

Figura 3. Ortopantomografía pretratamiento.


Figura 5. Imagen del trazado cefalométrico pretratamiento.

Esqueléticamente (Figuras 4 & 5), el patrón analizado


Alternativas de tratamiento
arrojó valores de clase I (ANB -1°) con tendencia a clase
Tratamiento con alineadores o tratamiento de ortodoncia
III esquelética, con un plano mandibular bajo (FMA 13°);
convencional sin extracciones, sin embargo hubiera
consulte el Cuadro I.
requerido reducción interproximal considerable en ambas
Objetivos del tratamiento
alternativas y el perfil final quedaría con el reflejo de la bi-
Mejorar el perfil facial, liberar el apiñamiento dental
protrusión dentomaxilar.
manteniendo la Clase I molar y mejorar la relación dental
El tratamiento de ortodoncia con aparatología fija
anterior a nivel de los caninos y la línea media.
convencional y en combinación con las extracciones de
premolares es una opción adecuada para lograr cambios
faciales y ajustar la oclusión ideal. En este contexto la

159
opción entre realizar la exodoncia de los primeros o de
los segundos premolares fue la clave en la decisión final,
puesto que eliminar los primeros premolares significaría
comprometer la apariencia final del perfil facial.
Por lo anterior, se eliminaron los segundos premolares y
se realizó tratamiento ortodóncico correctivo con
aparatología fija convencional.
Plan de tratamiento Figura 6. Imágenes faciales post-tratamiento.
Se programaron las extracciones de los cuatro segundos
premolares para liberar el apiñamiento dental y no
comprometer la estética del perfil facial.
Tratamiento ortodóncico correctivo con aparatología fija,
prescripción Roth en slot 0.018”.
Control de anclaje con elásticos intermaxilares.
Progreso del tratamiento
Figura 7. Imágenes intraorales post-tratamiento.
La paciente fue tratada en la práctica privada del primer
autor. Inicialmente, se realizaron sin complicaciones las
extracciones de los segundos premolares (15, 25, 35 &
45). Inmediatamente después, la aparatología fija de
prescripción Roth (slot 0.018”), fue colocada en todos los
dientes excluyendo los terceros molares. Se cementaron
bandas en los primeros molares, mientras que los tubos
de los segundos molares fueron adheridos directamente. Figura 8. Ortopantomografía post-tratamiento.
Los brackets fueron adheridos con sistema de
autograbado y resina compuesta de prescripción
ortodóncica en primeros premolares, caninos e incisivos
tanto superiores; como inferiores.
La secuencia de arcos fue 0.016NiTi, 0.016”ss,
0.016x022”ss (cadena elástica para retraer caninos).
0.017x0.025ss con ansas de cierre para retraer el
segmento anterior en combinación con elásticos
intermaxilares Clase II para mantener el anclaje.
Finalmente se colocaron arcos ideales en alambre de
acero calibre 0.017x0.025”. Figura 9. Lateral de cráneo post-tratamiento.

160
Clase I cuando la cúspide distobucal del primer molar
superior ocluye con el segundo molar inferior. Además, la
relación canina I, la línea media, el overjet y el overbite
lucen funcionalmente y estéticamente dentro de los
parámetros ideales.
El tiempo activo de tratamiento fue de 2 años y los
registros post-retención se tomaron en Septiembre de
2014 como se muestran en las Figuras 11, 12, 13, 14, 15
y 16; obsérvese la estabilidad post-retención en el
Cuadro I. El periodo de retención para la arcada superior
fue de 3 años 1 mes; mientras que en la arcada inferior
fue de 3 años y 8 meses.
Figura 10. Trazado cefalométrico post-tratamiento.

Cuadro I. Evaluación cefalométrica


Medición A1 B *Diferencia
Entre A1 – B C
Maxilla to SNA 89° 83° 6° 84°
Cranial Base
Mandible to SNB 90° 84° 6° 83.5°
Cranial Base SN-Go-Gn 20° 20° 0° 20°
FMA 13° 13° 0° 13°
Maxillo- ANB -1° -1° 0° -0.5°
Mandibular
Maxillary 1 to NA (mm) 7.5mm 7mm .5mm 6mm
Dentition 1 to SN 115° 111° 4° 110°
6-6 (mm)(casts) 37 mm 33 mm 4 mm mm
Mandibular 1 to NB (mm) 3mm 4mm 1mm 2mm
Dentition 1 to Go-Gn 102.5° 100° 2.5° 101°
6-6 (mm)(casts) 34mm 29mm 5mm mm
3-3 (mm)(casts) 30mm 29mm 1mm mm
Soft Tissue Esthetic Plane 0mm -2mm 2mm -2mm
A1 Registrospre-tratamiento
B Registros post-tratamiento
C Registros post-retención

Se tomaron registros finales en Agosto de 2011 como se


muestran en las Figuras 6, 7, 8, 9 y 10; así como también
en el Cuadro I.
Posteriormente, retenedores fijos fueron adheridos en las
caras linguales (arcada inferior) y en las caras palatinas
(arcada superior) de canino a canino.
El la figura 7 se puede observar claramente la relación
molar Clase I, específicamente descrita como súper Figura 11. Imágenes extraorales post-retención.

161
para poder resolver los problemas de maloclusión y
alcanzar la oclusión final como se muestra en las
imágenes. El plan de tratamiento adecuado y la selección
de extracciones fueron factores determinantes para crear
una oclusión funcional e ideal con tratamiento
ortodóncico correctivo. Estéticamente, la oclusión luce de
Figura 12. Imágenes intraorales post-retención.
maravilla después de más de 3 años post-retención, la
sonrisa y el perfil facial son muy atractivos.

Figura 13. Imágenes de los modelos de estudio post-retención.

Figura 15. Lateral de cráneo post-retención.

Figura 14. Ortopantomografía post-retención.

El consentimiento informado se obtuvo del paciente para


la publicación del presente caso al igual que las
imágenes que acompañan.

CONCLUSIONES
El tratamiento de este caso fue realizado exitosamente y
los objetivos fueron alcanzados como originalmente se Figura 16. Trazado cefalométrico post-retención.

plantearon. La cooperación de la paciente fue importante

162
El patrón esquelético muestra una excelente estabilidad, 7. Barros S, Janson G, Torres F, De Freitas MR, Rodrigues

de igual manera el componente dental se encuentra R. Class I malocclusion treatment: Influence of a missing

estable post-tratamiento y post-retención, únicamente se mandibular incisor on anterior guidance. Am J of Orthod


Dentofacial Orthop 2010;138(1):109–17.
aprecia una ligera tendencia de los segundos molares
8. Bizetto MS, Tessarollo FR, Jimenez EE, Guariza-Filho O,
para inclinarse en sentido vestibular.
Camargo ES, Tanaka OM. Implant rehabilitation of canines in
case of bilaterally missing maxillary lateral incisors. Am J
Referencias
Orthod Dentofacial Orthop 2013;144(1):110-8.
1. Griffies JM, Meyers CE. Treatment of a Class I bimaxillary
9. Aljhani A, Zawawi KH. The use of mini-implants in en masse
protrusive malocclusion with a high mandibular plane angle: An
retraction for the treatment of bimaxillary dentoalveolar
American Board of Orthodontics case report. Am J Orthod
protrusion. Saudi Dent J. 2010; 22(1):35-9.
Dentofacial Orthop 2000;117(1):60-7.
10. Kurz C, Del Rey M, The use of lingual appliances for
2. Decker JD, Chen C. Adaptive response of the human dental
correction of bimaxillary protrusion (four premolars extraction).
alveolar process: Correction of a Class I protrusive and
Am J Orthod Dentofacial Orthop 1997;112(4):357-63.
mutilated dentition, with 32-year follow-up. Am J Orthod
11. Sakai N, Nakahara Y, Ichikawa H. The second premolar
Dentofacial Orthop 2009; 135(4):S113–22.
extraction case in the Begg technic. Nihon Kyosei Shika Gakkai
3. Chae JM. Unusual extraction treatment of Class I bialveolar
Zasshi 1984;43(1):89-100.
protrusion using microimplant anchorage. Angle Orthodontist
12. Mascarenhas R, Majithia P, Parveen S. Second premolar
2007;77(2):367-76.
extraction: Not always a second choice. Contemporary Clinical
4. Grob DJ. Extraction of a mandibular incisor in a Class I
Dentistry 2015;6(1):119-23.
malocclusion. Am J Orthod Dentofacial Orthop
13. Postema RS. Case report: orthodontic management of
1995;108(5):533-41.
congenitally absent mandibular second premolars. J Gen
5. Leal V, Barbosa T. Angle Class I malocclusion treated with
Orthod 1994;5(4):21-3.
lower incisor extraction. Dental Press J. Orthod 2013;18(3):150-
14. McNamara CM, Field D, Leonard T, Shue J. Second
8.
premolars: a review and case report of two impaction cases.
6. Mehmet B, Mete O. Mandibular incisor extraction treatment
Singapore Dent J 2000;23(1):33-6.
of a Class I malocclusion with bolton discrepancy: a case
report. Eur J Dent 2007;1(1): 54–9.

163
EDITORES

M en C. Carlo Eduardo Medina Solís


Actualmente es Profesor-Investigador Titular “B” en la Universidad Autónoma del Estado de
Hidalgo (UAEH). Cuenta con reconocimiento al perfil PRODEP. Pertenece al Sistema Nacional de
Investigadores desde el 2007, actualmente es Investigador Nacional Nivel II (SNI-CONACyT).
Estudiante del Doctorado en Ciencias Médicas y Biológicas en la Facultad de Medicina de la
Universidad Autónoma “Benito Juárez” de Oaxaca (UABJO). Es Maestro en Ciencias de la Salud con
área de concentración en Sistemas de Salud por el Instituto Nacional de Salud Pública/Escuela de
Salud Pública de México (2001-2003). Estudió la Licenciatura de Cirujano Dentista en la Facultad de
Odontología de la Universidad Autónoma de Campeche (1993-1998) donde realizó también un
Diplomado en Investigación Epidemiológica (2000). Como investigador, ha sido autor o coautor de
más de 250 presentaciones en congresos nacionales e internacionales donde ha obtenido diversos
premios y reconocimientos. Es autor o coautor en más de 115 artículos científicos que han sido
publicados en revistas nacionales e internacionales. Ha participado como investigador o co-
investigador en diversos proyectos de investigación. Es revisor (peer-reviewer) de revistas Nacionales
e Internacionales. Es Evaluador Externo para obtener financiamiento en proyectos de investigación
así como consultor en diversas Universidades de México. Ha participado en comités científicos de
congresos nacionales e internacionales. Es tutor de la Academia Mexicana de Ciencias para el
Verano de la Ciencia y del Programa DELFIN. Es evaluador acreditado del Programa Nacional de
Posgrados de Calidad (PNPC) y de fondos mixtos para financiamiento del CONACyT. Ha sido
profesor invitado a nivel Maestría en las unidades didácticas: Métodos de Investigación en Sistemas
de Salud II (INSP/ESPM), Bioestadística (UAC-IMSS, UAEH), Epidemiología (UAEM), así como
profesor adjunto en la unidades didácticas: Bioestadística aplicada a los Sistemas de Salud
(INSP/ESPM) y Métodos de Investigación I (UAEH). Actualmente, a nivel Licenciatura en Métodos de
Investigación III y Clínica de Exodoncia (UAEH). Ha sido Director o asesor de tesis de Maestría y
Especialidad en el INSP/ESPM, la UAEH, la UABJO, la UAEM y de Licenciatura en la BUAP, UAC y
UAEH.

M en C. Juan Fernando Casanova Rosado


Actualmente es Profesor-Investigador Titular “A” en la Universidad Autónoma de Campeche
(UAC). Cuenta con reconocimiento al perfil PRODEP. Pertenece al Sistema Nacional de
Investigadores desde el 2007, actualmente es Investigador Nacional Nivel II (SNI-CONACyT). Es
Coordinador de Posgrado de la Facultad de Odontología de la Universidad Autónoma de
Campeche (desde el 2006-). Estudió la Licenciatura de Cirujano Dentista en la Facultad de
Odontología de la Universidad Autónoma de Campeche (1981-1985) donde recibió la medalla
“Enrique Hernández Carvajal” por haber obtenido el promedio más alto de su generación. Estudio la
especialidad de Ortodoncia en la Universidad Nacional Autónoma de México (1886-1987). Estudió la
Maestría en Ciencias Odontológicas en la UAC (1997-1999). Como investigador, ha sido autor o
coautor de más de 180 presentaciones en congresos nacionales e internacionales donde ha obtenido
diversos premios y reconocimientos. Es autor o coautor en más de 40 artículos científicos que han
sido publicados en revistas nacionales e internacionales. Ha participado como investigador o co-
investigador en diversos proyectos de investigación. Es revisor (peer-reviewer) de revistas Nacionales
e Internacionales. Es Evaluador Externo para obtener financiamiento en proyectos de investigación.
Ha participado en comités científicos de congresos nacionales e internacionales. Es tutor de la
Academia Mexicana de Ciencias para el Verano de la Ciencia y del Programa JAGUAR. Es evaluador
acreditado del Programa Nacional de Posgrados de Calidad (PNPC) y de fondos mixtos para
financiamiento del CONACyT. Tiene registro como evaluador acreditado en el CONACyT.
Actualmente es el líder del cuerpo académico “Investigaciones Odontológicas” que se encuentra en el

164
nivel de “en Consolidación” de acuerdo al PRODEP. En Conjunto con su cuerpo académico ha
publicado el libro “Publicaciones en Odontología, Nacionales e Internacionales” (2009). Como
profesor imparte las asignaturas Ortodoncia, oclusión, seminario de investigación, estadística,
patología bucal, farmacología I, a nivel licenciatura. A nivel maestría es profesor invitado en la
Maestría en Ciencias de la Salud y Epidemiología en la Facultad de Medicina de la Universidad
Autónoma de Campeche.

Dra. en CS. Edith Lara Carrillo


Actualmente es Profesora de Tiempo Completo en la Universidad Autónoma del Estado de México.
Cuenta con reconocimiento al perfil PRODEP. Pertenece al Sistema Nacional de Investigadores
desde el 2014, actualmente es Investigador Nacional Nivel I (SNI-CONACyT). Es Coordinadora de
la Maesría en Ciencias Odontológicas de la Facultad de Odontología de la Universidad Autónoma del
Estado de México (2014 a la fecha). Estudió la licenciatura de Cirujano Dentista en la Facultad de
Odontología, la Maestría en Administración en Sistemas de Salud en la Facultad de Contaduría y
Administración, la Maestría en Ciencias Odontológicas con Especialidad en Ortodoncia, en la
Facultad de Odontología y el Doctorado en Ciencias de la Salud, en la Facultad de Odontología,
todos en la Universidad Autónoma del Estado de México, recibiendo en los dos últimos la presea
“Ignacio Manuel Altamirano Basilio” por haber obtenido el promedio más alto de su generación.
Obtuvo el Primer lugar Nacional en la segunda promoción del Examen General de Calidad
Profesional de Odontología, organizado por el CENEVAL (1997) y la Nota Laudatoria por el desarrollo
sobresaliente de actividades académicas en la Facultad de Odontología (2010). Autor o coautor en
diversas presentaciones de trabajos de investigación en donde ha obtenido varios premios a nivel
nacional e internacional. Es Miembro de la International Association for Dental Research (IADR),
revisora externa de revistas internacionales como The Angle Orthodontist e International Journal of
Paediatric Dentistry. Es coautora o autora de más de 30 artículos científicos publicados en revistas
nacionales e internacionales. Ha participado en diversos proyectos de investigación como
responsable o co-responsable de los mismos. Tutora del Programa Verano de la Investigación
Científica y Tecnológica del Pacífico DELFIN. Ha publicado el libro “Cambios en el ambiente bucal
durante el tratamiento de ortodoncia. Seguimiento a 30 meses” y participado con un capítulo en el
libro “Contemporary approach to Dental Caries”. Como docente imparte asignaturas en la licenciatura
de Cirujano Dentista, en la Maestría en Ciencias Odontológicas, en la Especialidad de
Odontopediatría y en la Especialidad de Ortodoncia desde 1996 a la fecha, en la Facultad de
Odontología de la Universidad Autónoma del Estado de México.

165

View publication stats

También podría gustarte