Está en la página 1de 5

EJERCICIOS Y PREGUNTAS DE TRANSCRIPCIÓN Y TRADUCCIÓN

1. De una cadena de ADN representa el inicio de un gen:

3’ TACCCGAGATGT…5’

a) Determine la secuencia de bases de su ARN mensajero e indique su
dirección.
b) Determine la secuencia de bases de la cadena complementaria de ADN
e indique su dirección.
c) ¿En qué componentes se diferencian el ADN y el ARN?

2. La transcripción y la traducción son procesos fundamentales en la célula
eucariota.
a) Define y distingue entre ambos procesos e indica en qué parte de la
célula se produce cada uno de ellos.
b) Nombra los tipos de ARN que intervienen en la traducción y explica la
función de cada uno de ellos.

3. En relación con la expresión de la información genética:
a) Cita y define los dos procesos que tienen lugar en la expresión de la
información genética
b) ¿Dónde tienen lugar los procesos anteriores en células procariotas y
eucariotas?

4. Referente a la expresión en eucariotas:
a) El esquema adjunto representa los procesos de transcripción,
procesamiento o maduración y traducción. Identifica los distintos
elementos de la figura representados por letras
b) Explica qué es un exón e identifica la función de los ARNt y de las
enzimas aminoacil-ARNt sintetasas

a
b
3’
c
5’
5’ 3’
d
3’
5’
e

La transcripción y la traducción son procesos fundamentales en la célula eucariota. 5´ Exón Intrón Exón Intrón 3´ Explique brevemente el proceso de maduración de este ARN transcrito primario hasta obtener su ARNm maduro. b) Cite cada uno de los procesos a y b indicados con las flechas. a) Define y distingue entre ambos procesos e indica en qué parte de la célula se produce cada uno de ellos. b) Explique brevemente las tres etapas del proceso de la transcripción en procariontes . 8. A 1 2 3 T 4 5 C 6 7 A T a A 9 U C 10 11 b Polipéptido Copie el esquema y responda a las siguientes cuestiones: a) Complete estas secuencias sustituyendo los números por las bases nitrogenadas correspondientes. Referente a la expresión del material hereditario en eucariotas: En el siguiente esquema se representan las secuencias incompletas de dos ácidos nucleicos. 6. b) Nombra los tipos de ARN que intervienen en la traducción y explica la función de cada uno de ellos. c) El siguiente esquema representa un ARN transcrito primario procedente de un fragmento de un gen. . indique su dirección de cada una de las cadenas y escriba el nombre del ácido nucleico al lado de sus secuencias correspondientes. La molécula de ADN es portadora de información: a) Indica el nombre de los autores que propusieron el modelo de la doble hélice y cita tres características de dicho modelo. indica razonadamente la molécula de ADN de la que procede y cita dos diferencias entre ambos ácidos nucleicos. Referente a la expresión del material hereditario: a) Represente mediante un esquema rotulado “El Dogma Central de la Biología Molecular” actualizado. b) Dado el siguiente fragmento de ARNm: 5’ AUGCUAGCGAAA 3’.5. correspondiente a una célula eucariota. 7. así como dos procesos biológicos muy importantes indicados con flechas. Defínalos e indique en qué parte de la célula se realiza cada uno de ellos.

9. La siguiente secuencia polinucleotídica corresponde a un fragmento del inicio de un gen de una cepa bacteriana: 3’ TACAATTCCCGGGCAACACAC 5’ a) Escribe la secuencia de bases del ARNm que se puede sintetizar e indica su dirección. indicando los extremos amino y carboxilo. . b) Para la síntesis del péptido Tyr-Leu-Met-Phe se han utilizado los siguientes ARNt: 3’UAC5’ 3’AAU5’ 3’AAA5’ y 3’AUA5’ Escribe la secuencia de nucleótidos del ARNm cuya traducción da lugar al péptido indicado y la secuencia de la cadena molde del ADN del gen correspondiente. indicando su dirección. Referente al código genético y las mutaciones: A partir de la siguiente secuencia de un fragmento de un gen: 5’ … TAT ATA CAA TTT …3’ 3’… ATA TAT GTT AAA …5’ a) Indica cuál será la secuencia del ARNm correspondiente a la cadena inferior de este fragmento. b) Indica el nombre de la molécula que lleva el codón y el nombre de la molécula que lleva el anticodón. b) ¿Cuál es el número máximo de aminoácidos que puede codificar este fragmento? c) ¿Qué características del código genético has utilizado para determinar el número de aminoácidos? d) Si se detectara una variante de la cepa que produjera un polipéptido de cinco aminoácidos ¿cómo pudo producirse esta variante? 10. c) Indica la función del ARNt en este proceso y explica la relación entre su estructura y su función. 12. b) Con la tabla del código genético escribe la secuencia de aminoácidos del polipéptido codificado por ese fragmento de gen. Con relación a la biosíntesis de proteínas en células eucariotas: a) Menciona el nombre del proceso e indica su localización celular. En relación con el código genético adjunto: a) Cita cuatro características del código genético para todos los tipos celulares y explica qué quiere decir que el código genético es degenerado. 13. En relación con la expresión de la información genética: a) Cita y define los dos procesos que tienen lugar en la expresión de la información genética) b) ¿Dónde tienen lugar los procesos anteriores en células procariotas y eucariotas? 11.

En relación con la expresión y cambios en el material hereditario: a) Indique dos diferencias entre la transcripción de procariotas y eucariotas. un virus de ARN monocatenario (similar al del VIH) debe integrarse en el genoma de la célula huésped. que es ADN bicatenario. c) Si en el ADN se produjese una sustitución del par C-G por el par T-A. Utilice para la respuesta la tabla del Código Genético. indique qué mutación se ha producido en cada caso. ¿sería posible que existiera un mecanismo de traducción igual al de la Tierra? Razone la respuesta. usted obtiene una serie de mutantes. citando las moléculas y estructuras nucleares que intervienen en el mismo. Razone las respuestas. Con referencia a distintos procesos biológicos: a) Para replicarse en células eucarióticas. 14. d) Explica qué significa que el código genético es degenerado. b) Suponga que está estudiando un gen de E. c) W gen indicado en el apartado anterior. 15. Parte de su secuencia es: -Ala-Pro-Trp-Met-Ser-Glu-Lys- ¿Cuáles son la secuencia y polaridad de la cadena de ADN. 16. . se encuentran las siguientes secuencias: Mutante 1: -Ala-Pro-Trp-lle-Ser-Glu-Lys- Mutante 2: -Ala-Pro Con la ayuda del Código Genético. existieran 216 aminoácidos esenciales y el código genético estuviera constituido por tripletes. Explique las distintas etapas del proceso de replicación. d) Las palabras del código genético (codones) están formadas por tres letras (bases) ¿Por qué no podrían estar formadas por una o por dos letras? Razone la respuesta para cada caso. cofi que determina cierta proteína. indica cómo se altera el ARNm y la cadena polipeptídica. a)Explique la parte del proceso que se efectúa en el núcleo. Para que una célula eucariota lleve a cabo la síntesis de proteínas exportables y su secreción al medio extracelular deben intervenir numerosas moléculas y estructuras celulares. Explique la parte del proceso que tiene lugar en el citoplasma indicando las moléculas y estructuras citoplásmicas que lo llevan a cabo. Al aislar las proteínas de estos mutantes. que determina esa parte de la proteína? Indique solamente una de entre las posibles secuencias. b) Si en otro Planeta hubiera un ADN constituido por 6 nucleótidos distintos.

Señala la secuencia de aminoácidos del polipéptido codificado por el siguiente fragmento de ADN: 5’-CCGAATATGCGTAAACGTATGCTTTAATT-3’ 18. Escribe la secuencia de aminoácidos que se puede originar a partir del ARNm siguiente (considera el primer codón de dicha secuencia de ARNm como el triplete que codifica al primer aminoácido de la cadena). -Identifica cuáles de las secuencias de ARN mostradas codifican para la siguiente secuencia peptídica: NH2-Arg-Gli-Asp-COOH A) 5’AGA-GGA-GAU3’ B) 5’ACA-CCC-ACU3’ C) 5’GGG-AAA-UUU3’ D) 5’CGG-GGU-GAC3’ E) 5’AGG-GGG-GAC3’ .17. ¿Cómo se habrá establecido? 19. 5’GAGCGUGGGAGUAGCUUUUAUGUC3’ b) Si el U que señala la flecha se cambiara por una C: -¿Cómo se llamaría ese proceso? ¿Tendría consecuencias para la célula? Explícalo. d) Esta secuencia deARNm tendrá una pauta de lectura (para producir esa secuencia de aminoácidos). Un fragmento de ADN presenta la siguiente secuencia de bases: 3’-AAGCAATGTGGGCGGAGACCACGT5’ Esta secuencia. se corresponde a un fragmento de proteína con esta secuencia de aminoácidos: …Phe-Val-Thr-Pro-Ala-Ser-Gly-Ala… a)¿Cuál sería el fragmento de ARNm corespondiente? b)¿Qué es un codón? ¿Por qué no podrían estar los aminoácidos codificados por dos bases? c) ¿Cuál sería el codón de la prolina? ¿Y el de la alanina? Explica a qué se debe. empleada como molde. tras su expresión. -¿Qué ocurriría si desapareciese la base señalada? ¿Cómo se llamaría a ese proceso? 20.