Está en la página 1de 7

I.

MUNICIPALIDAD DE PROVIDENCIA
CORPORACIÓN DE DESARROLLO SOCIAL
LICEO POLIVALENTE ARTURO ALESSANDRI PALMA
DEPARTAMENTO DE BIOLOGÍA
PROFESORA DEL NIVEL: CAROLINA ARENAS CONTRERAS

GUIA DE ESTUDIO CUARTO MEDIO – BIOLOGÍA COMÚN

PREPARACIÓN PRUEBA COEFICIENTE DOS – PRIMER SEMESTRE.

Nombre del Alumno:……………..……………………………………Curso:…… Fecha……………….

UNIDAD: Expresión y manipulación del material genético


OBJETIVO (S) DE APRENDIZAJE(S):
- Analizar la adaptación del organismo a las variaciones del entorno, apoyándose en la capacidad de
informar de los órganos de los sentidos.
- Analizar la estructura del ADN y los mecanismos de su replicación que permiten su mantención de
generación en generación, considerando los aportes relevantes de científicos en su contexto histórico.
APRENDIZAJES A TRABAJAR:
1. Esquematizar el recorrido del sonido y las ondas sonoras, para provcar la audición.
2. Analizar principales casos de pacientes clinicos con problemas auditivos, determinando su deficiencia.
3. Determinar los aportes de los estudios cientificos en la importancia del ADN y el nucleo en general.
4. Comparar los experimentos, evidenciando en que aporta de manera sumativa al que lo precede.
5. Crear modelo de ADN según composicion química y aportes de la ciencia.
6. Deducir la importancia de cada estructura quimica del ADN, en estudios de caso.
HABILIDADES DEL PENSAMIENTO:
- Conocimiento
- Comprensión
- Aplicación
- Análisis
I. INSTRUCCIONES

Estimado estudiante considere las siguientes instrucciones para desarrollar la guía de estudio. En
este proceso su compromiso es fundamental para avanzar en la construcción del conocimiento. ¡A
trabajar!

1. Léela atentamente, compleméntala con la bibliografía sugerida y después realiza las actividades
propuestas.
2. Debes registrar tus respuestas en este documento (impreso) y archivarlo en una carpeta.
3. Administra tu tiempo de realización de la guía con intervalos de descanso, para que tu trabajo
sea efectivo.
4. Para revisar tus respuestas utiliza tu cuaderno y libro de biología verificand si están correctas. De
lo contrario revisa tus errores y corrígelos.

OIDO Y AUDICIÓN

Uno de nuestros sentidos sensoriales es la audición con la cual se efectúa gracias a nuestro hermano
sensitivo llamado oído. Específicamente el oído está compuesto por estructuras el desarrollo del
audición y la conducción De ondas sonoras. Dentro de estas estructuras se encuentran: el pabellón
auditivo, conducto auditivo, tímpano, huesecillos de oído, canales semicirculares, cóclea, trompa de
eustaquio y nervio auditivo.
La alteración a cualquier estructura auditiva pone juego la funcionalidad efectiva del oído, provocando
ciertas enfermedades, tales como: presbiacusia, otitis media, otitis interna, vértigo, entre otras.

ACTIVIDAD N°1: Rotule todas las estructuras anatomicas del oido, mencionando al menos una
función.
Nº Nombre Función

1
ACTIVIDAD N°2: Elabora un mapa conceptual, con la secuencia progresiva de sucesos que ocurren
para posibilitar la audición.

Fuente sonora externa

oir

ACTIVIDAD N°3: Imaine que Ud. Es un Médico reconocino de la Universidad de Oxford. En


base a las siguientes fichas médicas, diagnostique que enfermedad podria tener el paciente.
Ficha Médica Diagnóstico
Nombre: Jorge Muñoz
Edad: 89 años
• Sintomas:
el habla de los demás suena entre dientes, mal
articulada. Los sonidos de tono alto, tales como
la "s" o la "th" son difíciles de distinguir. Las
conversaciones son difíciles de entender, sobre
todo cuando hay ruido de fondo. Disminución
progresiva de la audición.

Nombre: Miguel Cares


Edad: 21 años
Sintomas: escucha silbidos zumbidos
constantes. Son a veces suaves y a veces
fuertes, sin embargo no hay fuente sonora
externa-

Nombre: Alejandro Del valle


Edad: 34 años
Sintomas: Suelo poseer irritacion e inflamacion al
oido externo, a veres sale un liquido purulento. El
fenomeno ha aumentado ahora útimo que
practico natacion.

Nombre: Jeremías Goicovich


Edad: 5 años
Sintomas: pasa resfriado con signos virales
presentes y sin curar. Se ve secreciones de pus
tanto en oido medio como en la trompa de
eustaqui.

2
EXPERIMENTOS QUE APORTAN AL ESTUDIO DEL ADN
Para poder determinar donde se encuentra la informacion genetica tanto Hammerling como
Gurdon realizaron experimetos que aportaron al estudio del nucleo y su herencia. Hammerling
trabaja con unicelulares (Acetabularia) y Gurdon con pluricelulares (Xenopus laevis), comprobando
que la informacion de todo ser vivo se encuentra al interior del nucleo. En base a esto, se determina
que la composición del núcleo está dada por las siguientes estructuras: carioteca, nucleoplasma,
nucleolo Y cromatina.
Posteriormente Griffith usó en su experimento dos cepas bacterianas de una enfermedad mortal
para descubrir qué estructura de la bacteria heredaba la patologia. Con esto logró descubrir la
transformación bacteriana. Sin embargo, esto no esclareció si las moléculas correspondían a
proteínas o al ADN, Por lo que posteriormente un grupo de científicos decidieron investigar cuál era
la molécula de la herencia. Para conseguirlo, se aislaron las proteínas y el ADN y analizaron el efecto
de cada uno sobre el fenotipo determinado. El resultado fue que solo el ADN produjo la
transformación batería, Lo que permitió identificar a esta molécula como la responsable de la
herencia


Observa y describe lo que ocurre en cada etapa del experimento.


¿Por qué en la etapa 3 el ratón sobrevive la inyección con cepa S?

3

¿Cuál era el resultado predecible en la etapa 4? fundamente su respuesta


¿Cómo explicas que, al extraer sangre del ratón muerto en la etapa 4, Se obtuvieran bacterias de la
cepa S vivas?

ACTIVIDAD N°5: Elabore un cuadro comparativo entre los experimentos realizados Hammerling
y Gurdon.

Criterios de comparacion: Hammerling Gurdon


semejanzas

Criterios de comparacion: Hammerling Gurdon


diferencias

MODELO DE WATSON Y CRICK


El patrimonio genético de toda célula está contenido en la molécula de ADN, constituida por tres
moléculas de naturaleza distinta, un azúcar con cinco átomos de carbono (desoxirribosa), un fosfato
y cuatro bases nitrogenadas diferentes: dos purinas, la adenina y la guanina, y dos Pirimidinas, la
citosina y la timina; la unidad fundamental de la molécula de ADN está constituida por un nucleótido
formado por una de las cuatro bases nitrogenadas enlazada a una molécula de azúcar y a una de

La estructura de doble hélice del ADN, con el


apareamiento de bases limitado (A-T; C-G), implica que
el orden o secuencia de bases de una de las cadenas
delimita automáticamente el orden de la otra, por eso
se dice que las cadenas son complementarias. Una vez
conocida la secuencia de las bases de una cadena, se
deduce inmediatamente la secuencia de bases de la
complementaria.
fosfato.

4
ACTIVIDAD N°6: Responde las siguientes preguntas.

Indica qué es el ADN y cuál es la diferencia entre ADN y el ARN en los organismos
eucariontes.


Según las evidencias de la historia acerca del ADN, por qué crees Ud. Que los investigadores Watson y
Crick lograron descifrar la estructura de este ácido nucleico.


Si tengo la siguiente hebra de ADN, cuál será la hebra complementaria, esquematiza cada base
con los puentes de hidrógeno.

ATTCCGGTACGTGTCACGTATCCTAAGCCGTAAAACGTCCGTAAGGTATGCGCGCGCTG

___ _________________________________________________________________________

ACTIVIDAD N°7: Siguiendo el modelo de Watson y Crick, dibuja la cadena de


nucleótidos complementaria a la de la figura y responde:

Menciones las
estructuras de los
nucleótidos y los
enlaces participantes.

Reaponde:

¿Por qué se define el ADN cómo una doble hebra antiparalela?

5

¿Por qué una molécula de ADN con mayor porcentaje de G+C es más difícil de separar
que otra con mayor proporción de A+T?

ACTIVIDAD N°8: Investigue sobre el experimento de Meselson y Stahl. En base a lo indagado y


escuchado en clases responder las siguientes preguntas. Finalmente complete el cuadro que
resume el experimento de estos científicos.

¿Cuál es el objetivo de la investigación de Meselson y Stahl?


¿Por qué utilizaron nitrógeno en el diseño experimental?


¿Cuál es la importancia experimental de obtener tubos control, con ADN
conocido?


¿Qué ventajas representa trabajar con bacterias, como E. coli?


Si este trabajo se hubiese realizado usando células eucariontes, ¿crees que se habrían
obtenido los mismos resultados? Fundamenta.

ACTIVIDAD N°9: Completa la interpretación parcial del experimento de Meselson y Stahl,


dibujando las moléculas de ADN de la segunda generación.

6
7