Está en la página 1de 96

ISSN - 0034 - 9313

REVISTA ECUATORIANA DE
MEDICINA Y
CIENCIAS BIOLÓGICAS
(REMCB)

VOLUMEN XXXVI - Nº 2 - NOVIEMBRE 2015


Revista Ecuatoriana de Medicina y Ciencias Biológicas
Volumen XXXVI - Nº 2, noviembre 2015
ISSN - 0034 - 9313

Pontificia Universidad Católica del Ecuador


Av. 12 de Octubre 1076 y Roca, Quito, Ecuador

Corrección de estilo y ortografía: Alfonso Sánchez

Asistente de edición: Lic. Maria Jose Salazar Nicholls

Impresión, diseño y diagramación:

QualityPrint Cía. Ltda., Quito, Ecuador

Fotografía portada: Jorge A. Castillo-Castro.

“La biodiversidad en los bosques tropicales, sobre todo en el Yasuní, es sorprendente. La vida se abre campo aprovechando todos los sustratos
posibles. Un brote de helecho crece de entre una cama de musgos y hepáticas que cubren las ramas de las plantas. Las briofitas (musgos y
hepáticas y antocerotes) son considerados como los reservorios más importantes de agua así como también los sustratos más importantes para
la colonización de nuevos sustratos”
REVISTA ECUATORIANA
DE MEDICINA Y CIENCIAS BIOLÓGICAS
Pontificia Universidad Católica del Ecuador
Rector: Dr. Fernando Ponce León S.J.

Casa de la Cultura Ecuatoriana Benjamín Carrión


Presidente: Sr. Raúl Pérez Torres

Sociedad Ecuatoriana de Ciencias Biológicas, Núcleo de Pichincha


Presidente: Dr. Jaime Costales Cordero

Editores:

Dra. Doris Vela Peralta1 (Ciencias Biológicas)

Dr. Tjitte de Vries1 (Ciencias Biológicas)

1
Pontificia Universidad Católica del Ecuador

Freddy G. Carrión Suárez MD. Psq. 1,2 (Medicina)

1
Pontificia Universidad Católica del Ecuador

2
Asociación Ecuatoriana de Psiquiatría

Coeditores:

Dr. Carlos A. Soria Proaño1

Dr. Rommel Montufar Galárraga1

1
Pontificia Universidad Católica del Ecuador

La Revista Ecuatoriana de Medicina y Ciencias Biológicas (REMCB) (ISSN 0034-9313)


es un órgano de difusión científica auspiciada por la Casa de la Cultura Ecuatoriana
Benjamín Carrión, la Pontificia Universidad Católica del Ecuador y la Sociedad
Ecuatoriana de Biología, Núcleo de Pichincha. La REMCB se encuentra incluida en
el Latin Index, se publica semestralmente y está dirigida a los científicos nacionales e
internacionales así como a estudiantes de Ciencias de la Vida.

El contenido de los artículos científicos y de las publicaciones que aparecen en la revista


son responsabilidad exclusiva de sus autores o de los auspiciantes y no representan
necesariamente el sentir de los editores de la REMCB, quienes no se responsabilizan por
errores o por las consecuencias surgidas por el uso del material que aparece publicado
en la misma.
ÍNDICE
EDITORIAL 7

MEDICINA

Relación entre la Cardiopatía Isquémica y la Proteína C Reactiva 9


Rosa Colina, Rommel Espinoza de los Monteros, James Franco, Bolívar Saenz, Luis Alejandro Cárdenas

QUÍMICA

Determinación computacional de la afinidad y eficiencia de enlace de antinflamatorios no 17


esteroideos inhibidores de la ciclooxigenasa-2
Lorena Meneses y Sebastián Cuesta

CIENCIAS BIOLÓGICAS

Rasgos morfológicos de frutos, semillas y embriones de Cinchona officinalis L. (RUBIACEAE) 27


en el Sur del Ecuador
José Miguel Romero-Saritama

Celulasas presentes en el tracto digestivo del camarón Litopenaeus vannamei 37


Claudia Segovia-Salcedo, Alexandra Narváez-Trujillo, Fernando Espinoza-Fuentes

Tratamiento de un efluente derivado de una planta procesadora de pieles para extracción de 47


gelatina mediante la tecnología de ficorremediación
Diana Ontaneda Andrade, Mabel Cadena Zumárraga, Ana González, Ever Morales Avendaño

Caracterización molecular de péptidos antimicrobianos a partir de muestras de piel de Agalychnis 57


spurrelli (Anura: Hylidae)
Andrea P. Vargas, Oscar Pérez, David Ortega, Myrian Rivera

Sensibilidad antimicrobiana y detección de genes de virulencia en aislados clínicos de Shigella spp. 67


Irina Villacrés, Iliana Alcocer, Jeannete Zurita y Mercedes Rodríguez-Riglos

NOTA CIENTÍFICA

Redescubrimiento de Sigmodon inopinatus (Rodentia: Cricetidae) en los Andes occidentales de la 77


provincia de Tungurahua, Ecuador
Diego G. Tirira y Andrea Vallejo-Vargas

COLECCIONES DE MUSEO

Las colecciones biológicas: Los tesoros escondidos de un país mega-diverso 83


Claudia Segovia-Salcedo, Luis Carrasco y Néstor Acosta Buenaño

INSTRUCTIVO PARA AUTORES 89

FE DE ERRATAS 95

Aislamiento, cultivo, viabilidad y evaluación de un consorcio cianobacteria-miroalga como


acondicionador de suelos
Raquel Martínez Pérez, Gianina Suárez Rodríguez y Ever Morales Avedaño
EDITORIAL
Contestar preguntas como ¿Cuán importante es la forma, el color, el tamaño o la textura de una semilla
para permitir su dispersión y germinación?, ¿Cuál es la estructura que debe tener una molécula para
incrementar su eficiencia? ó ¿Cuáles son los factores que determinan que una persona desarrolle o no una
enfermedad? Son verdaderos retos científicos que pueden llevar toda una vida de investigación.

Llegar a una respuesta –que la mayoría de las veces nos llevará a otra pregunta– requiere de tiempo y
mucho trabajo riguroso, es por ello que cada resultado que es reportado, a través de un artículo científico,
se convierte en un peldaño fundamental en la construcción del conocimiento.

Los artículos científicos que se publican en este número de la REMCB son una muestra de este proceso de
construcción del conocimiento, y de cómo la investigación en el Ecuador se está diversificando y abarcando
nuevas áreas en las cuales la diversidad biológica es la materia prima inagotable para la investigación y una
vertiente de conocimiento para las generaciones del futuro.

Por ejemplo, caracterizar nuevas sustancias producidas naturalmente por animales o plantas es una labor
compleja, ejemplo de ello es el trabajo realizado con los péptidos provenientes de la piel de los sapos, al
igual que la detección de celulasas en el camarón. También se evidencia preocupación por el estado de
nuestro entorno y las posibles soluciones a través de la recuperación del recurso natural más importante,
el agua. Para ello la misma naturaleza provee de microorganismos que, utilizados adecuadamente, pueden
permitir el tratamiento y la recuperación de este recurso.

Mejorar la calidad de vida de las personas también es un tema central para la investigación científica y
este proceso puede iniciarse, por ejemplo, a partir de la descripción de estructuras químicas que mejoren
la eficiencia de las moléculas, la implementación de nuevos procedimientos médicos para el diagnóstico
de enfermedades, la detección de cepas virulentas y sus cualidades de resistencia a antibióticos o la
caracterización genética y molecular de proteínas, como se muestra en algunos de los artículos incluidos.

Además, en este número de la REMCB se presenta un reporte sobre las colecciones biológicas en nuestro
país; con este artículo queremos dar relevancia a la diversidad biológica que ha sido preservada en dichas
colecciones y que además se convierten en una fuente de investigación. En la actualidad, los museos, los
herbarios, los bancos de germoplasma o bancos de tejidos, son reservorios de material invaluable y su
importancia radica en la información que guardan para las siguientes generaciones. Este material, que en
algunos casos se creía perdido, ha permitido desarrollar estudios tanto de carácter taxonómico y sistemático,
así como generar inferencias respecto al cambio climático o a eventos epidemiológicos, y en algunos casos
ha resuelto problemas de salud pública; por tanto es importante mirarlos como una fuente de información
y un patrimonio natural.

Es así que cada resultado generado en un estudio científico se convierte en una herramienta que permitirá la
continuidad de la investigación científica y la construcción del conocimiento científico. Por tanto la REMCB
les invita a ser partícipes en la construcción de este conocimiento y a dejarse cautivar por el contenido de
este volumen.

Dra. Doris Vela Peralta


Editora Científica
Revista Ecuatoriana de Medicina y Ciencias Biológicas
9

MEDICINA

Relación entre cardiopatía isquémica


y la proteína C reactiva
Rosa Colina Cifuentes¹, Rommel Espinoza de los Monteros², James Franco2, Bolívar
Saenz3, Luis Alejandro Cárdenas4

¹Laboratorio de Investigación en Biología Molecular, Facultad de Medicina,


Pontificia Universidad Católica del Ecuador. Quito, Ecuador.

²Servicio de Cirugía Cardiotorácica, hospital de Especialidades de las FF.AA. N°1 Quito,


Pontificia Universidad Católica del Ecuador. espinozarommel@hotmail.com

3
Servicio de Cardiología, hospital de Especialidades de las FF.AA. N°1 Quito.

4
Pontificia Universidad Católica del Ecuador, Facultad de Medicina. Quito, Ecuador.

Recibido: 2015-06-08; aceptado: 2015-09-29

RESUMEN.- Las enfermedades cardiovasculares están relacionadas con procesos inflamatorios


prolongados o persistentes que causan el aumento de los niveles de reactantes de fase aguda como la
proteína C reactiva (PCR), el fibrinógeno y las interleucinas IL-1 e IL-6. Desde este punto es importante
saber si existen en los ecuatorianos polimorfismos genéticos ya establecidos para otras poblaciones, en
especial en las citosinas IL-1 e IL-6. El objetivo del estudio fue relacionar la proteína C reactiva ultrasensible
(PCR-us) en pacientes con cardiopatía isquémica. Se analizaron un total de 91 personas: 50 pacientes con
criterios de inclusión para el diagnóstico de cardiopatía isquémica y 41 pacientes sin criterios de inclusión
o síntomas de cardiopatía isquémica, escogidos en el área de consulta externa y hospitalización de los
Servicios de Cardiología del hospital de Especialidades de las FF.AA. N° 1- Quito y del hospital Carlos
Andrade Marín (hospital IESS - Quito).
Entre los hábitos, en el grupo de casos prevaleció el tabaquismo 11 pacientes (22 %) seguidos por el
alcoholismo y tabaquismo juntos 9 (18 %). 25 individuos (50 %) de este grupo manifestó no tener hábito
alguno, debemos mencionar que muchos de estos pacientes acudían a consulta externa de cardiología
donde recibían educación médica.

El nivel de glicemia en ayunas mayor a 100 mg/dl encontró asociación de padecer cardiopatía isquémica
(OR = 4.13, IC 95 %: 1.54 – 11.0), (p = 0.03).

Los niveles de LDL, colesterol, triglicéridos y de glicemia en el grupo de los casos fueron superiores en
relación con el grupo control.

La lectura inmediata de la PCR-us no tuvo una diferencia significativa: p = 0.20 IC del 95 % entre los dos
grupos de estudio. Igualmente la lectura de la PCR-us a los 30 minutos: p = 0.21 IC del 95 %.

Existe gran interés clínico y fisiopatológico en el desarrollo de nuevos marcadores que nos permitan un
diagnóstico rápido y preciso en personas con mayor riesgo de desarrollar futuros eventos cardiovasculares.

PALABRAS CLAVES: cardiopatía isquémica, inflamación, interleucinas, proteínas de fase aguda,


proteína C reactiva.

ABSTRACT.- The cardiovascular diseases are associated with prolonged or persistent inflammatory
processes causing the increased levels of C-reactive protein (CRP) as acute phase reactants. The objective of
the study was to relate the Hscrp in patients with ischemic heart disease. We analysed a total of 91 people, 50
patients with inclusion criteria for the diagnosis of ischemic heart disease and 41 patients with no inclusion

Cardiopatía Isquémica y PCR


Colina et al.
10

criteria, chosen in the area of outpatient and hospitalization of the services of Cardiology of the Hospital of
specialties of the armed forces. N ° 1 - Quito and Carlos Andrade Marin Hospital (Hospital IESS - Quito).

Among the habits in the Group of cases prevailed 11 smoking (22 %) followed by alcoholism and smoking
together 9 (18 %). 25 (50 %) of this group said have any habit.

Level of glycemic in fasting more than 100 mg/dl found Association of ischemic heart disease (OR = 4.13,
95 % CI: 1.54-11.0), (p = 0.03).

The immediate reading of the PCR-us had no significant difference, p = 0.20 CI 95 % between the two study
groups, the reading of the PCR-us 30 minutes p = 0.21 CI of 95 %.

KEYWORDS: ischemic heart disease, inflammation, interleukins, proteins of acute phase, C-reactive protein.

INTRODUCCIÓN porque reacciona en cualquier proceso infeccioso


e inflamatorio, sin embargo, en algunos estudios
Según reporte 2013 de la OMS las enfermedades se le menciona como un marcador pronóstico de
cardiovasculares (ECV) son la causa del 30 % de infarto al miocardio (IM) en personas sanas y con
muertes en el mundo, afectan tanto a hombres angina inestable, cuando sus valores están sobre los
como a mujeres. Como parte de ECV está la 3 mg/L hasta 10 mg/L o más (García J y Kaski JC,
cardiopatía isquémica (CI), definida como el 1999). Según varios ensayos y determinando PCR
conjunto de trastornos relacionados íntimamente con alta sensibilidad en personas sanas, valores
donde existe un desequilibrio entre el suministro menores a 1 mg/L no tienen riesgo de eventos
de oxígeno y los sustratos frente a la demanda cardiovasculares. Entre 1 mg/L y 3 mg/L, la
cardíaca acompañada. Generalmente se debe a una posibilidad que ocurra un evento cardiovascular es
disminución en el calibre de las arterias coronarias. moderada y la probabilidad alta para un evento se
A estas cardiopatías se las ha relacionado observa cuando la concentración de PCR supera los
directamente con el proceso ateroesclerótico en 3 mg/L (Barba, 2007).
donde suceden dos procesos principales: a) la
aterosis, que no es más que el proceso inflamatorio En los estudios actuales se ha logrado establecer
de la íntima y b) la esclerosis conocida como el que la proteína C reactiva no solo es un marcador
endurecimiento y taponamiento de la luz del vaso. de la inflamación, sino que también juega un papel
Entre las manifestaciones clínicas de la cardiopatía activo en la inflamación porque reacciona con
isquémica están: la angina estable, angina inestable receptores de la superficie celular, facilitando la
y el infarto al miocardio (Braunwald’s, 2011). opsonización y fagocitosis (Braunwald’s, 2011).

Los procesos inflamatorios de la ateroesclerosis son MATERIALES Y MÉTODOS


procesos prolongados o persistentes (inflamaciones
crónicas), que causan el aumento de los niveles Población de estudio.- Este estudio se realizó en dos
de reactantes de fase aguda (marcadores de grupos de personas adultas; un grupo con criterios de
inflamación) como la proteína C reactiva, el inclusión para el diagnóstico de cardiopatía isquémica
fibrinógeno y las citosinas como la interleucina IL-1 (casos) y otro grupo de individuos (controles),
e IL-6 (Andrade et al., 2011). sin los criterios de inclusión para el diagnóstico
de cardiopatía isquémica, escogidos en el área de
La PCR es una proteína sintetizada por los consulta externa y hospitalización de los Servicios
hepatocitos (células del hígado), descubierta en 1930 de Cardiología del hospital de Especialidades de las
y llamada así por la reacción con el polisacárido C FF.AA. N° 1- Quito y del hospital Carlos Andrade
Pneumococico, es parte de la familia de las proteínas Marín (hospital IESS - Quito).
pentraxina y está formada por cinco subunidades,
es bastante estable y posee una vida media en el En los casos, se analizaron hombres y mujeres entre
plasma de 18-20 horas (Barba, 2007). los 37 a 91 años que presentaron tres o más factores
de riesgo cardiovascular (Tabla 1), con dolor
La proteína C reactiva al ser un reactante de fase precordial como la angina de pecho, definida a
aguda es un marcador de inflamación activa sensible través de dolor torácico agudo típico, y alteraciones
pero inespecífico (García et al., 1999). Es inespecífico de los registros electrocardiográficos (ECG) como

REMCB 36 (2), 2015


11

el descenso del ST, la inversión de la onda T. Se Grupo de controles


revisaron las coronariografías de los pacientes a
quienes se les había realizado este tipo de estudio. - Personas masculinas y femeninas sin Factores
de Riesgo Cardiovascular
- Personas de ambos sexos mayores de 35 años
Tabla 1. Factores de riesgo presentes en el grupo de estudio
de edad
Factores Parámetros - Personas que voluntariamente desearon
Edad
participar en el estudio
Sexo
Criterios de Exclusión:
Hipertensión arterial Presión arterial L ≥ 140/90
mmHg
- Pacientes menores de 35 años
Diabetes mellitus tipo II Glicemia en ayunas ≥ 100 - Antecedentes de infarto agudo de miocardio
mg/dl
- Enfermedades infecciosas menores de 6 meses
Tabaquismo SI / NO de evolución
Colesterol total ≥ 100 mg/dl - Embarazo
LDL ambos sexos ≥ 100 mg/dl - Neoplasias
- Cardiopatías valvulares o portadores de
Triglicéridos ≥ 150 mg/dl
marcapasos
Cambios en el EKG Cambios para cardiopatía - Antecedentes de enfermedad cerebral o
isquemica
hemorragia
Cambios en la Cambios para coronariopatía
corionariografía atersoclerótica
Para el análisis estadístico descriptivo se emplearon:
Troponinas elevadas Compatibles con cardiopatía porcentajes, tablas de frecuencia, medidas de
isquémica
tendencia central y dispersión en función de las
distintas variables en estudio. Para la comparación
El grupo control incluyó personas de ambos de los grupos en estudio se empleó el OR como
sexos, entre los 37 y 91 años sin los síntomas medida de asociación ajustado a un intervalo de
mencionados anteriormente o sin el diagnóstico confianza (IC del 95 %) y valor de P < 0.005 como
de cardiopatía isquémica. medida de significancia.

Muestra.- Se analizaron un total de 91 individuos: MATERIALES Y MÉTODOS


50 casos y 41 controles. El tamaño de la muestra se
calculó a base de nivel de confianza 95 %, poder del Una vez determinada la muestra, para los análisis
estudio 80 %. La frecuencia esperada de exposición de laboratorio se obtuvo sangre venosa por medio
en los no enfermos 20 %, frecuencia esperada de de venopunción directa para cuantificar niveles de
exposición en los enfermos 60 % y se le añadió un glicemia, colesterol total, LDL y Triglicéridos.
20 % más considerando pérdida o error.
En tubos de EDTA se tomó un mínimo de 3 ml
Análisis Estadístico.- Se desarrolló un estudio de sangre venosa, la cual se centrifugó dentro de
observacional analítico longitudinal de casos y las dos horas posteriores a la extracción. Una vez
controles. El análisis estadístico se realizó en el centrifugada se separó el plasma para analizar la
programa SPSS V21. PCR-us, mediante la técnica de ELISA (Araque, 2009).

Criterios de Inclusión: Para cuantificar Proteína C reactiva humana


ultrasensible se usó ELISA Kit marca INVITROGEN
Grupo de casos catálogo KHA0031. Este ensayo utiliza un
anticuerpo específico para PCR en un plato de 96
- Hombres y mujeres mayores de 35 años con 3 muestras con Ac anti PCR (Assay Kits, 2014).
o más factores de riesgo cardiovascular para la
cardiopatía isquémica Se utilizó el Equipo Molecular Devices 2001. Kinetic
- Pacientes con diagnóstico de cardiopatía Microplate Reader. Versión: Sofware, SOFT may
isquémica PRO 4.0 EXE.
- Pacientes que voluntariamente desearon
participar en el estudio y que reunían los La extracción y el transporte de las muestras
criterios de inclusión se realizaron de acuerdo con los protocolos
establecidos y usados para el estudio.

Cardiopatía Isquémica y PCR


Colina et al.
12

RESULTADOS LDL mayor a 100 mg/dl (p = 0.00) (OR = 57.7 IC 95


%: 14.5 – 229.1), triglicéridos superiores a 150 mg/
Se receptaron la información de 91 pacientes, y sus dl (p = 0,00) (OR = 22.1 IC 95 %: 6.6 – 74.2), y de
historias clínicas, los cuales cumplían con todos colesterol sobre los 100 mg/dl (p = 0,00) (OR = 11
los criterios de inclusión y exclusión anteriormente IC 95 %: 4.1 – 29), respectivamente.
descritos. El estudio se realizó en el hospital de
Especialidades de las FF. AA. de Quito N° 1 y en el La presencia de HTA con cifras mayores a 140/90
hospital del IESS, Carlos Andrade Marín, en el período mmHg (p = 0,00) (OR = 12.4 IC 95 %: 4.5 – 33.5)
comprendido entre febrero a noviembre del año 2013. estadísticamente significativa como factor de riesgo
El sexo prevalente fue el masculino en el grupo de para cardiopatía isquémica (Tabla 3).
casos 44 (88 %) y controles 33 (80.5 %), comparado
con un 6 (12 %) del femenino en los casos y 8 (19.5 En cuanto se refiere al registro electrocardiográfico
%) en los controles. La edad de los 91 integrantes en 16 (32 %) pacientes del grupo de los
del estudio tuvo una media de 61.34 ± 13 años y un casos presentaron cambios en el registro
rango de edad entre los 37 a 92 años (Tabla 1). electrocardiográfico, positivos para enfermedad
Entre los antecedentes patológicos en el grupo de coronaria. En 37 (90 %) no se evidenciaron cambios
casos se reportaron 32 (64 %) hipertensos, 10 (20 %) en el trazo del electrocardiograma sugestivos de
diabéticos, y 2 (4 %) casos de dislipidemia. cardiopatía isquémica aguda o crónica. (OR = 0.051
- IC 95 % 0.015 – 0.16).
Dentro de los hábitos estudiados en el grupo de
casos se encontró: alcoholismo 5 (10 %), tabaquismo Únicamente en 9 (18 %) pacientes con diagnóstico
11 (22 %), alcoholismo y tabaquismo juntos 9 (18 de cardiopatía isquémica se evidenció elevación de
%), ningún hábito 25 (50 %). Grupo control 41 (100 troponinas (OR = 0.11 IC 95 % 0.014 – 0.94) y en los
%) no reportaron tener malos hábitos (Tabla 2). pacientes a quienes se les practicó coronariografía
como método de diagnóstico para descartar
Para el nivel de glicemia en ayunas mayor a coronariopatía, 13 (26 %) individuos mostraron
100 mg/dl se encontró asociación de padecer cambios significativos en la anatomía de las arterias
cardiopatía isquémica (p = 0.03) (OR = 4.13 IC 95 coronarias (OR = 6.85 IC 95 % 1.44 – 32.4) (Tabla 4).
%: 1.54 – 11.0), así como también para los niveles de

Tabla 2. Características generales de los casos y controles

Variables Casos n = 50 Controles n = 41


Edad 61.34 ± 13 61.34 ± 13
Masculino 44 (88 %) 33 (80.5 %)
Femenino 6 (12 %) 8 (19.5 %)
Hipertensos 32 (64 %) 0
Diabéticos 10 (20 %) 0
Dislipidemia 2 (4 %) 0
Hábitos
Alcoholismo 5 (10 %) 0
Tabaquismo 11 (22 %) 0
Alcoholismo y tabaquismo 9 (18 %) 0
Ningún hábito 25 (50 %) 41 (100 %)
Química sanguínea
Glicemia menor a 100 mg/dl 9 (18 %) 35 (85.4 %)
Glicemia mayor a 100 mg/dl 41 (82 %) 6 (14.6 %)
Colesterol menor a 100 mg/dl 10 (20 %) 37 (90.2 %)
Colesterol mayor a 100 mg/dl 40 (80 %) 4 (9.8 %)
Trigliceridos menor a 150 mg/dl 4 (8 %) 27 (65.9 %)
Trigliceridos mayor a 150 mg/dl 46 (92 %) 14 (34.1 %)
LDL menor a 100 mg/dl 9 (18 %) 38 (92.7 %)
LDL mayor a 100 mg/dl 41 (82 %) 3 (7.3 %)

REMCB 36 (2), 2015


13

Tabla 3. Valores medios observados para las variables medidas infarto cardíaco. Si se aplicara la variabilidad
Variables n = 91
intraindividual muchos valores significativos entre
los casos y los controles se solaparían entre sí.
Casos n = 50 Controles n = 41
Colesterol 139.72 ± 20.2 100.4 ± 19.9 En el estudio MRFIT (Multiple Risk Factor
Triglicéridos 141.28 ± 25.55 138.26 ± 23.37 Intervention Trial) (Jeremiah et al., 2008) y en
Colesterol LDL 176.06 ± 29.6 118.41 ± 17.68 el estudio MONICA (Monitoring Trends and
determinants in Cardiovascular Disease) en 1999,
Glicemia 106.9 ± 25.59 92.87 ± 8.88
revelaron una relación significativa entre los
PCR inmediato 2.99 ± 0.35 2.87 ± 0.52 niveles altos de PCR-us y la mortalidad por eventos
PCR a los 30 3.02 ± 0.36 2.30 ± 0.49 coronarios y cardiovasculares.
minutos
En nuestro estudio, en el grupo de casos el sexo
masculino fue mayor 44 (88 %) frente a 6 (12 %)
Tabla 4. Evaluación de la enfermedad coronaria
femenino, lo que se explica por la mayor presencia
Examen Casos n = 50 Controles n = 41 de la cardiopatía isquémica en los hombres como
Cambios 16 (32%) 37 (90%) se viene reportado en la literatura médica con
ctrocardiográficos respecto a la cardiopatía isquémica (Garziano et al.,
Presencia de 9 (18%) 1 (2.4%) 2011; Malacrida et al., 1999).
troponinas
elevadas La hipertensión arterial 32 (64 %) siempre presente
Coronariografía 13 (26%) 2 (4%) en este tipo de estudios, también prevaleció
positiva notablemente seguida de la diabetes 10 (20 %) y la
dislipidemia 2 (4 %) o en su defecto juntas.

La medición de la PCR-us inmediato en el grupo Con respecto a los hábitos, en el grupo de casos
control tuvo una media de 2.99 mg/L, una desviación prevaleció el tabaquismo 11 (22 %) seguida por
típica de 0.35 un rango de 2.04 mg/L (1.21 – 3.25 el alcoholismo y tabaquismo juntas 9 (18 %).
mg/L). Mientras que la lectura de la PCR-us en el Debemos mencionar que muchos de los pacientes
grupo de los casos tuvo una media de 2.87 mg/L, del grupo de los casos, acudían a consulta externa
una desviación típica 0.52 un rango de 2.21 mg/L de cardiología por lo que una buena parte de ellos
(1.29 – 3.50 mg/L). Mediante cruce de variables manifestó haber dejado algún hábito 25 (50 %).
con la prueba de t de student no se encontró una
diferencia estadísticamente significativa entre los Los niveles de LDL, colesterol, triglicéridos y de
dos grupos p = 0.20 IC del 95 %. glicemia en el grupo de los casos fueron superiores
en relación con el grupo control. La lectura inmediata
La lectura de la PCR-us a los 30 minutos en el de la PCR-us no tuvo una diferencia significativa, p
grupo control, tuvo una media de 3.02 mg/L, una = 0.20 IC del 95 % entre los dos grupos de estudio,
desviación típica de 0.36 un rango de 2.21 mg/L igualmente la lectura de la PCR-us a los 30 minutos
(1.29 – 3.50 mg/L). En el grupo de casos la PCR-us p = 0.21 IC del 95 %. Sin embargo, nuestros datos
tuvo una media de 2.30 mg/L, una desviación típica son muy parecidos sino iguales a los encontrados
de 0.49 un rango de 2.25 mg/L (1.30 – 3.55 mg/L). por otros investigadores al respecto.
Mediante la prueba de t de student no se encontró
una diferencia estadísticamente significativa entre En pacientes sin enfermedad arterial coronaria
los dos grupos p = 0.21 IC del 95 %. las concentraciones medias de PCR son < 1
mg/L, mientras que en pacientes con tres arterias
DISCUSIÓN coronarias afectadas son: > 1.4 mg/L. A base de los
niveles plasmáticos de PCR, las Guías publicadas
En este estudio preliminar, presentamos los por el Centro de Control/Asociación Cardiaca
resultados obtenidos de un pequeño grupo de Americana (AHA) han determinado las cifras de
estudio. La información obtenida en los diferentes corte para determinar un riesgo cardiovascular bajo
trabajos que se han publicado hasta el momento (< 1.0 mg/L), medio (1-3 mg/L) y alto (> 3.0 mg/L)
no es homogénea, debido seguramente a una en pacientes con un riesgo de cardiopatía isquémica
falta de puntos de corte aceptados para definir los a diez años del 10-20 % según la escala de riesgo
valores entre normales o patológicos. Los datos de del estudio Framingham Risk Score. Si se alcanzan
referencia en la literatura médica se encuentran niveles ≥ 10 mg/L se debe repetir la determinación
entre 2 a 10 veces superiores a los de los varones y descartar la posible existencia de una inflamación
aparentemente normales que desarrollan un o infección (García y Kaski, 1999).

Cardiopatía Isquémica y PCR


Colina et al.
14

El estudio Multiple Risk Factor Intervention significativa, el grupo de casos siempre presentó
Trial (MRFIT) es un gran estudio con diseño más elevada (3.02 mg/L) la presencia de la PCR,
anidado en el cual se seleccionaron 12 866 varones frente a los controles (2.30 mg/L), y confirmó
aparentemente sanos, con un seguimiento de 17 como marcador inflamatorio en presencia de
años. La concentración de PCR no fue diferente cardiopatía isquémica.
en los varones sin eventos (2.0 mg/L), con infarto
de miocardio durante el seguimiento (2.7 mg/L) o •La PCR es un marcador sensible de la
que fallecieron por causa cardíaca (3.4 mg/L), no inflamación, pero inespecífico según nuestros
obstante, se observó una asociación significativa resultados y la bibliografía.
entre PCR y la mortalidad por cardiopatía
isquémica. La razón de riesgo (odds ratio) de •Creemos que el tiempo utilizado para el
los varones en el cuartil más elevado de PCR desarrollo de este tipo de investigación, fue
comparado con los del cuartil más bajo fue de 2.8 muy corto y el tamaño de la muestra debe
(1.4-5.4) (Jeremiah et al., 2008). ser ampliado significativamente para obtener
mejores resultados.
Un segundo estudio sobre el valor pronóstico de
la PCR en varones aparentemente sanos, fue el •Se recomienda realizar estudios con otros
Physicians Health Study (PHS). Se trata de un marcadores o predictores en este tipo de
estudio con diseño anidado, con una población patología cardíaca.
original de 22 071 varones, de los cuales 543
tuvieron eventos cardiovasculares (accidente REFERENCIAS BIBLIOGRÁFICAS
cerebrovascular isquémico o hemorrágico,
trombosis venosa profunda, infarto agudo de Andrade E, Waras R, Couto F, Couto R. 2011.
miocardio o muerte de origen cardíaco) y 543 Triglycerides/HDL-C ratio and high sensible
controles ajustados por edad y tabaquismo. C-reactive protein to the evaluation of
Ambos grupos habían sido aleatorizados cardiovascular risk. Jornal Brasileiro de Patologia
previamente a recibir aspirina o placebo. Los e Medicina Laboratorial, 47 (2): 113-118.
varones aparentemente sanos que no tuvieron
eventos (controles) tenían una PCR basal de 1.13 Arqué M. 2009. Obtención, procesado y
mg/L comparado con 1.40 mg/L en los varones almacenaje de muestras de plasma sanguíneo.
aparentemente sanos, que tuvieron eventos Centro de investigación biomédica en red
cardiovasculares (p < 0,001) (Ridker et al., 1997). enfermedades respiratorias.

Sabemos que la edad, la presencia de hipertensión, Assay Max human C reactive Protein ELISA Kit,
la diabetes y otros procesos inflamatorios presentes ASSAYPRO, Catalog No. EC1001-1. 2014.
en los dos grupos estudiados y al ser la PCR
utilizada la ultrasensible, no nos permitió encontrar Barba JR. 2007. Síndrome coronario agudo. Revista
una diferencia estadísticamente significativa entre Mexicana de Patología Clínica, 54 (3): 116-135.
los dos grupos, pero sí podemos afirmar que
obtuvimos mediciones de PRC-us muy parecidos a Braunwald’s 2011. Heart Disease: A Textbook of
los reportados por la literatura médica y recalcamos Cardiovascular Medicine. Novena Edición.
que nuestro estudio es un estudio piloto. Philadelphia. Pa: Saunders Elsevie: 49 pp.

Existe un gran interés clínico y fisiopatológico en el Danesh J, Collins R, Appleby P, Peto R. 1998.
desarrollo de nuevos marcadores que nos permitan Association of fibrinogen, C-reactive protein,
un diagnóstico más rápido y preciso de aquellos albumin, or leukocyte with coronary heart
individuos con un mayor riesgo de desarrollar disease. The Journal of the American Medical
futuros eventos cardiovasculares. Association, 279: 1477-1482.

CONCLUSIONES García J y Kaski JC. 1999. Cardiopatía Isquémica:


marcadores de inflamación y riesgo
•En nuestro estudio piloto, no se encontró cardiovascular. Revista Española de Cardiología,
diferencia significativa entre los dos grupos 52: 990-1003
analizados (casos y controles) con respecto a la
medición de la PCR-us. Graciani A, Zuluaga M. 2008. Mortalidad
cardiovascular atribuible a la presión arterial
•Si bien la medición del PCR-us en los dos elevada en la población española de 50 años o
grupos investigados no fue estadísticamente más. Medicina Clínica, 131: 125-129.

REMCB 36 (2), 2015


15

Jeremiah S, James D y Neaton. 2008. The Multiple Ridker PM, Cushman M, Stampfer MJ, Tracy
Risk Factor Intervention Trial (MRFIT) RP, Hennekens CH. 1997. For systemic
Importance Then and Now. The Journal of the inflammation, in 543 apparently healthy men
American Medical Association, 300(11):1343-1345. participating in the Physicians’ Health Study.
The New England Journal of Medicine, 337(5):356.

Cardiopatía Isquémica y PCR


Colina et al.
16

REMCB 36 (2), 2015


17

QUÍMICA

Determinación Computacional de la Afinidad y Eficiencia


de Enlace de Antinflamatorios No Esteroideos Inhibidores
de la Ciclooxigenasa-2
Lorena Meneses1 y Sebastián Cuesta1

1Laboratorio de Química Computacional, Facultad de Ciencias Exactas y Naturales,


Pontificia Universidad Católica del Ecuador, Quito, Ecuador. lmmeneses@puce.edu.ec

Recibido: 2015-06-16; aceptado: 2015-08-07

RESUMEN.- El presente es un estudio computacional de la interacción de diferentes antinflamatorios


no esteroideos con la enzima Ciclooxigenasa 2 (COX-2). El objetivo fue determinar la afinidad con
la cual los inhibidores estudiados se enlazan con el sitio activo de la enzima y calcular la eficiencia de
enlace de los mismos. Además, comprobar la aplicabilidad de los métodos de acoplamiento molecular,
en la determinación de moléculas prometedoras, que aceleren los estudios de descubrimiento de nuevos
fármacos. Se utilizaron métodos de dinámica molecular, para modelar las interacciones entre la enzima
COX-2 y los sustratos celecoxib, diclofenaco, etoricoxib, indometacina, ibuprofeno, meloxicam y naproxeno,
por medio del programa Autodock VINA. Los resultados muestran que la molécula que posee una mayor
afinidad con la COX-2 es el celecoxib, con una energía de enlace de -10.8 kcal/mol y una constante de
equilibrio Ki de 1.21x10-8 M. El ibuprofeno y el naproxeno son las moléculas con mayor eficiencia de enlace,
con un valor mayor a -0.48 kcal/mol/átomos (no hidrógeno). Esto demuestra que una molécula que tiene
una buena afinidad, no necesariamente debe tener una buena eficiencia de enlace. Estos valores dan una
pauta para poder elegir la mejor molécula para inhibir la enzima COX-2 y en casos de descubrimiento
de fármacos, la molécula idónea para invertir en su mejoramiento y optimización, para convertirla en un
fármaco aprobado.

PALABRAS CLAVES: Afinidad, antinflamatorios no esteroideos, Autodock VINA, COX-2, eficiencia de enlace.

ABSTRACT.- A computational study of the interaction of nonsteroidal antiinflammatory drugs with


Cyclooxygenase 2 (COX-2) enzyme is shown. The objective was to determine the affinity of the inhibitors
studied with the active site of the enzyme and calculate their binding efficiency. Furthermore, it is intended
to check the applicability of the methods of molecular docking in determining promising molecules in order
to accelerate drug discovery research. Molecular dynamics methods, using Autodock VINA, were used to
model the interactions between the COX-2 enzyme with celecoxib, diclofenac, etoricoxib, indomethacin,
ibuprofen, naproxen, and meloxicam. Results show that the molecule with higher affinity for COX-2 is
celecoxib with a binding energy of -10.8 kcal/mol and an equilibrium constant Ki of 1.21x10-8 M. Ibuprofen
and naproxen are the molecules with higher binding efficiency with a values greater than -0.48 kcal/mol/
atoms (other than hydrogen). This shows that a molecule having a good affinity, not necessarily will have
a good binding efficiency. These values give researchers a guideline to choose the best molecule to inhibit
COX-2 enzyme and in cases of drug discovery processes, the ideal molecule to invest in their improvement
and optimization to make it an approved drug.

KEYWORDS: Affinity, Autodock VINA, binding efficiency, COX-2, NSAIDs.

INTRODUCCIÓN lugar de considerar el dolor como un síntoma de


un traumatismo, una infección, una inflamación, o
En la última década, hemos sido testigos de cambios una cirugía, ahora lo tomamos como una entidad
dramáticos en la forma de entender el dolor. En patológica discreta que altera fundamentalmente

Afinidad y Eficiencia de enlace


Meneses y Cuesta
18

todo el sistema nervioso. Avances en tecnologías en el rango de nanomolar (nM). Los valores de
de neuroimagen, han permitido localizar zonas Ki y la concentración inhibitoria media (IC50),
del cerebro donde se percibe el dolor y por están relacionados con la potencia de un inhibidor
ende, proponer formas más efectivas de tratarlo (Stevens, 2014). El IC50 representa la concentración
(Standford Medicine, 2005). de un medicamento requerida para una inhibición
del objetivo biológico del 50 % en pruebas in vitro.
Entre los medicamentos más comunes en el mundo Además, la afinidad está relacionada con la energía
se encuentran los AINEs (Anti Inflamatorios No de enlace, que puede ser determinada a partir de la
Esteroideos). Cada día, más de 30 millones de constante de equilibrio. El valor de esta constante
estadounidenses los usan para tratar dolores de permite además, calcular la energía libre de Gibbs
cabeza, esguinces, síntomas de la artritis y cualquier para la unión del complejo medicamento-sitio
otro tipo de molestia (McMurry, 2004). activo (ecuación 1) (Stevens, 2012).

A un nivel básico, el dolor no es más que el


resultado de una señal eléctrica enviada por los E-I E+I
nervios al cerebro. Este proceso va acompañado
de una liberación de prostaglandinas que ante
una lesión, hacen que el tejido se hinche. Estos Ki=
mediadores químicos amplifican la señal eléctrica (1)
procedente de los nervios, causando el dolor
(Griffin, 2015). La función de los AINEs es bloquear En los últimos años, se ha vuelto común expresar
las enzimas Prostaglandina H2 sintasas, que son la energías de unión en términos de eficiencia de
las causantes de producir prostaglandinas en el enlace (LE). La eficiencia de enlace y propiedades
proceso inflamatorio (Hall et al., 2001). termodinámicas constitutivas del ΔG (ΔH y ΔS),
pueden proporcionar información sobre la unión
Los mamíferos tienen dos isoformas de la de una molécula con su ligando, que van más allá
prostaglandina H2 sintasa, la Ciclooxigenasa 1 de simples comparaciones de potencia inhibitoria
(COX1) y la Ciclooxigenasa 2 (COX-2). Ambas poseen (Reynolds y Holloway, 2011).
en su estructura más de 600 aminoácidos y, aunque
tienen similar secuencia de aminoácidos (60 a 65 %), La energía libre estándar (ΔG°) de unión del
poseen diferentes funciones (Nelson y Cox, 2008). complejo enzima-sustrato, puede ser calculada
utilizando la ecuación 2. La temperatura usada
La COX-2 es la enzima que produce prostaglandinas normalmente es 298 K (25° C). Valores más
adicionales que intervienen y causan los efectos en negativos indican mayores energías de unión
un proceso inflamatorio. Su función es mediar en (Stevens, 2014).
los procesos de inflamación. Es parte fundamental
en el sistema nervioso central (SNC) y el riñón (Hall ΔG° = -2.3RT log (1/Ki) = 2.3RT log (Ki)
et al., 2001). No es constitutiva en todos los tejidos, (2)
pero puede ser inducida en el sitio de inflamación,
manteniendo los mecanismos inflamatorios y Los cambios de entalpía (ΔH) y de entropía (ΔS),
amplificando las señales dolorosas (Hall et al., 2001). deben ser considerados en la evaluación de la
energía de unión (ecuación 3). Interacciones que
En el mercado, existe una gran variedad de son controladas por la entalpía, son los puentes
medicamentos AINEs. La elección depende de hidrógeno formados entre el medicamento
entre otros aspectos, del nivel del dolor y y la enzima, mientras que efectos hidrofóbicos
la farmacocinética de cada uno (Brunton y controlan los cambios en entropía (Stevens, 2014).
Parker, 2008). Dentro del estudio de nuevos Cuando un compuesto no polar se encuentra en
medicamentos, se busca que sean eficaces a bajas solución acuosa, las moléculas de agua forman una
concentraciones, con alta selectividad y alivio al capa altamente ordenada alrededor de las porciones
dolor (Davies y Skjodt, 2000). no polares del compuesto (efecto hidrofóbico)
(Stevens, 2012). Una vez que el compuesto entra y
El objetivo de un programa de descubrimiento de se une al sitio activo, algunas moléculas de agua
medicamentos es, generalmente, encontrar una de solvatación pasarán nuevamente a la solución.
molécula que se una a la proteína deseada, a bajas Las moléculas de agua que están libres en solución
concentraciones. Cuando un medicamento tiene tienen más libertad de movimiento que las que
el valor de la constante de disociación (Ki) muy están solvatadas. Por lo tanto, la unión de una
pequeño, indica que éste y su objetivo biológico molécula no polar en un bolsillo lipofílico aumenta
se unen fuertemente. Valores ideales de Ki están el desorden del sistema global (Stevens, 2012).

REMCB 36 (2), 2015


19

ΔG = ΔH – TΔS Al realizar el cálculo del acoplamiento, el software


(3) muestra diez resultados diferentes. Cada resultado
representa al ligando en una posición espacial
En el diseño de fármacos, el valor de ΔG permite distinta. En cada posición se obtiene la afinidad
evaluar si la modificación de un medicamento entre la macromolécula y el ligando. El programa
aumenta o disminuye la afinidad con su objetivo muestra las posibles conformaciones del ligando
biológico, estimando la estabilidad relativa de los ordenadas según su estabilidad. Para este trabajo, se
diferentes compuestos. En síntesis, se puede utilizar tomó para cada molécula la conformación de menor
para determinar si el sistema está en equilibrio, o qué energía, que se corresponde con mayor afinidad
tan rápido y en qué medida es probable que se dé la y por ende, la que tiene mayor probabilidad que
reacción de asociación (Stevens, 2012). La importancia suceda en la realidad.
descriptiva de ΔG, hace que sea interesante determinar
su valor mediante métodos computacionales. MATERIALES Y MÉTODOS

Otro enfoque es analizar el valor de la eficiencia Se realizó el modelamiento computacional de la


de enlace (LE). LE es una medida que relaciona la interacción de la enzima COX-2 con moléculas
energía libre de unión con el tamaño de la molécula. pertenecientes a la misma familia de AINEs
Es importante examinar cómo cambian los valores (ibuprofeno, naproxeno), diferentes familias
de LE a medida que se realizan cambios en diferentes (indometacina, diclofenaco, meloxicam) e
partes de la molécula (Murray et al., 2014). La LE inhibidores selectivos de la COX-2 (celecoxib,
se obtiene de dividir la energía libre de unión de etoricoxib). Se utilizó el programa Autodock VINA.
cada molécula por el número de átomos (n) no Los AINEs ejercen su acción antinflamatoria,
hidrógenos presentes en la estructura (ecuación 4). uniéndose al sitio activo ciclooxigenasa, ubicado
en la parte inferior de la enzima COX-2. En la
Figura 1 se muestra la estructura tridimensional
de la COX-2 unida al celecoxib en su sitio activo.
LE = La estructura tridimensional (estructura ternaria)
(4) de esta enzima, fue obtenida experimentalmente
mediante la técnica de rayos X por otros autores,
A medida que aumenta la eficiencia de enlace, y sus parámetros estructurales colocados en un
disminuye el peso molecular del medicamento
final (Graham, 2001). La eficiencia de enlace es
uno de los índices más usados en la actualidad
y se expresa en kcal/mol/átomos que no son
hidrógeno (Stevens, 2014). Proporciona una idea de
la cantidad de energía de enlace por átomo distinto
al de hidrógeno. Hay que tener en cuenta que el
valor para la eficiencia de enlace debe ser negativo,
ya que la energía libre de unión es negativa.
Fundamentalmente, LE ayuda a controlar el tamaño
molecular de una serie durante la optimización, y
da una pauta para decidir entre dos series, cuál es
la más prometedora (Murray et al., 2014).

En esta investigación se trabajó con el “software”


Autodock VINA. Autodock está diseñado como
una herramienta de acoplamiento molecular en la
que, mediante modelos matemáticos, se predice
la estructura o estructuras de los complejos
intermoleculares formados entre dos o más
estructuras. Docking, como también se lo llama, es
ampliamente usado para sugerir enlaces e inhibir
proteínas (Atkinson y Abernethy, 2007). Esta
herramienta permite predecir mediante cálculos
teóricos, cómo moléculas pequeñas, cómo sustratos
y candidatos de fármacos, pueden actuar como
ligandos, y se unen a estructuras tridimensionales
conocidas, biológicamente importantes (The Figura 1. Estructura experimental de la unión de celecoxib con
Scripps Research Institute, 2013). la enzima Ciclooxigenasa-2.

Afinidad y Eficiencia de enlace


Meneses y Cuesta
20

banco de proteínas (Protein Data Banks), de donde - Los resultados se visualizaron utilizando el
se descargó (Berman et al., 2000), (Figura 1). Para programa Autodock Tools.
obtener la energía de enlace, se hizo interactuar
al ligando con el sitio activo de la macromolécula RESULTADOS
(COX-2). El programa calcula la energía y produce
como resultado varias conformaciones posibles. En la Figura 2 se muestran las estructuras de todos los
Los criterios usados para determinar si una ligandos que fueron sometidos al estudio.
conformación es aceptada, o para comparar dos
conformaciones, son la energía libre y la distancia
media cuadrática (RMSD por sus siglas en inglés)
(Kitchen et al., 2004). Dos conformaciones son
consideradas idénticas, cuando la diferencia de
energía entre ellas está por debajo de las 3kcal/mol
y su RMSD es menor o igual al RMSD promedio
menos la desviación estándar. Para conformaciones
iguales, las de energías más altas son eliminadas
(Ermondi et al., 2004). Con este criterio, se escogió
la conformación con la menor energía libre para
cada molécula en estudio.

El programa Autodock permite seleccionar, para


el cálculo de acoplamiento molecular, cualquier
zona de la enzima. En este estudio, se seleccionó
el sitio activo ciclooxigenasa de la enzima. El
procedimiento que se siguió para cada principio
activo fue el siguiente:

- Se obtuvieron las coordenadas de posición de


la enzima, del banco de datos de proteínas en
formato PDB.

- Mediante el programa Chimera 1.7, se


identificaron todos los residuos que no
pertenecían a la proteína para poder eliminarlos
y que no afecten en los cálculos de docking Figura 2. Representación estructural en modelo de bolas de los
(Pettersen et al., 2004). antinflamatorios no esteroideos estudiados.

- En Autodock, se abrió Autodock Tools, se Las conformaciones calculadas de cada principio


escogió la enzima como macromolécula y se activo, fueron comparadas con un modelo
la preparó para los estudios, en donde los experimental de la interacción entre la COX-2 del
ligandos, moléculas de solvente y otros residuos ratón común con el medicamento celecoxib, por
fueron removidos del sitio activo de la enzima superposición de las estructuras. El resultado de la
(Abdel-Azeem et al., 2009). Los átomos de comparación se presenta en la Figura 3, donde se
hidrógeno fueron agregados a la estructura con
pueden observar las conformaciones calculadas de
la opción Hydrogen Polar only. Posteriormente,
menor energía en color verde para el celecoxib, celeste
se escogió cada principio activo como ligando y
para el etoricoxib, amarillo para el ibuprofeno, azul
se estableció el área de acoplamiento.
para el naproxeno, rojo para el diclofenaco, celeste
para el meloxicam y morado para la indometacina.
- Finalmente, con los datos obtenidos en
Autodock Tools, se creó un archivo de entrada La molécula obtenida de la interacción experimental
para Autodock VINA (Atkinson y Abernethy, se muestra de color gris para los átomos de carbono,
2007) y se realizó el cálculo. Autodock usa tres amarillo para los de azufre, azul para los de
métodos para la determinación del sitio activo: un nitrógeno y rojo para los de oxígeno.
algoritmo genético, un método de búsqueda local
y un método global-local adaptado basado en el Con estas conformaciones se obtuvo la energía
algoritmo genético de Lamarck en conjunto con libre de Gibbs para la unión entre el medicamento
campos de fuerza empíricos que permiten obtener y la enzima, que es calculada por el programa
las energías libres de unión. (Pouplana et al., 2002). y presentada en forma de afinidad. Mediante la

REMCB 36 (2), 2015


21

Como se puede observar en la Figura 3, todas las


conformaciones calculadas de mínima energía,
se encuentran superpuestas con la estructura
obtenida experimentalmente. En el caso del
celecoxib, la molécula se encuentra exactamente
en la misma posición que la experimental, lo que
nos demuestra la buena correlación de los cálculos
computacionales con los experimentales, ya que
no solo se encontró el sitio activo, sino también la
posición espacial en que la molécula va a entrar e
interaccionar con este sitio activo.

En la Tabla 1 se muestra la energía libre de Gibbs


para el complejo enzima-sustrato. La afinidad de
enlace, representada en la energía libre de Gibbs de
un ligando con un receptor, depende de la fuerza
de atracción entre los ligandos y sus sitios de unión
al receptor. La afinidad de enlace es la fuerza de
la interacción entre dos moléculas que se unen
de forma reversible (Stevens, 2012). En la Tabla
1 se puede observar que el principio activo que
posee mayor afinidad con la enzima COX-2 es el
celecoxib, con una energía de enlace de -10.8 kcal/
mol. Luego se encuentra el etoricoxib, seguido del
naproxeno, el diclofenaco, el ibuprofeno y al final
Figura 3. Comparación de la conformación de celecoxib obtenida el meloxicam y la indometacina. El celecoxib tiene
experimentalmente (gris), con las obtenidas computacionalmente
también la menor constante de disociación, que se
para diferentes antinflamatorios no esteroideos.
encuentra en el rango nanomolar.
utilización de la ecuación 2 se obtuvo la constante
de equilibrio para cada una de las interacciones. Con Algunos estudios similares se han realizado
la ecuación 4 se obtuvieron los valores teóricos para utilizando el mismo “software”, versiones
la eficiencia de enlace. Los valores para estos dos anteriores de “Autodock” e inclusive diferente
indicadores de afinidad se muestran en la Tabla 1. “software”, obteniendo resultados equivalentes.

Tabla 1. Energía libre de Gibbs y constantes de disociación y eficiencia de enlace para diferentes antiinflamatorios no esteroideos estudiados

Principio activo Fórmula ΔG (kcal/mol) Ki (M) LE kcal/mol/átomos


(no hidrógeno)
Celecoxib C17H14N3F3O2S -10.8 1.21*10-8 -0.415
Etoricoxib C18H15N2ClO2S -9.2 1.80*10 -7
-0.383
Ibuprofeno C13H18O2 -7.7 2.26*10-6 -0.513
Naproxeno C14H14O3 -8.4 6.94*10 -7
-0.494
Diclofenaco C14H11NCl2O2 -8.1 1.15*10 -6
-0.426
Meloxicam C14H13N3O4S2 -6.2 2.85*10-5 -0.270
Indometacina C19H16NClO4 -5.3 1.30*10 -4
-0.212

DISCUSIÓN Al comparar el resultado obtenido con el ibuprofeno


(-7.7 kcal/mol) con el resultado obtenido en otro estudio
Estudios previos demuestran que las enzimas con la utilización del programa “Autodock 4” (-6.21
Ciclooxigenasa poseen dos sitios activos kcal/mo) (Savic et al., 2011), se puede observar que la
ciclooxigenasa y dos peroxidasa en su estructura diferencia de energía entre ambas estructuras es de tan
(DeWitt, 1999). Los AINEs inhiben los sitios solo 1.49 kcal/mol. Tal como se explicó, estructuras se
activos ciclooxigenasa que se encuentran en la consideran homólogas cuando sus energías difieren en
parte inferior de la enzima. Por este motivo, el menos de 3 kcal/mol. Aunque no se puede obtener el
modelamiento molecular se enfocó únicamente en RMSD, este pequeño cambio en la energía nos da una
la zona del sitio activo ciclooxigenasa. pauta de la reproducibilidad en los datos.

Afinidad y Eficiencia de enlace


Meneses y Cuesta
22

En un estudio diferente (Pouplana et al., 2002), Los datos de afinidad y constante solas, no
utilizando Autodock 3, los autores obtuvieron determinan la potencia global de un medicamento.
energías de -11.04 kcal/mol para naproxeno, La potencia es el resultado de la compleja interacción
-11.09kcal/mol para diclofenaco y -10.19 kcal/mol tanto de la afinidad de unión como de la eficiencia
para indometacina. Aunque los valores difieren en de enlace. La eficiencia de enlace es la capacidad
mayor proporción a los obtenidos en este estudio, del ligando para producir una respuesta biológica
con excepción de la indometacina, ninguno de los a la unión al receptor de destino y la magnitud
valores sobrepasa la diferencia de 3 kcal/mol. La cuantitativa de esta respuesta (Abad-Zapatero y
diferencia en los resultados es comprensible ya que Metz, 2005). Es una medida de la energía de enlace
el “software” utilizado es una versión anterior por por átomo de un ligando a su pareja de unión,
lo cual algoritmos y cálculos matemáticos pueden tal como un receptor o enzima. Al observar estos
ser diferentes. A pesar de esto, se observa buena valores para las moléculas analizadas, podemos
relación entre resultados con el mismo programa, ver que el ibuprofeno es la molécula que posee un
ya que el naproxeno y el diclofenaco tienen energías mayor valor para la eficiencia de enlace, aunque su
similares y la indometacina posee una energía afinidad no sea la más alta. Esto también sucede
menor en los dos estudios. con el naproxeno y el diclofenaco. Los inhibidores
de COX-2, diclofenaco y naproxeno, aunque tienen
Con el programa Merck Molecular Force Field LE menores en relación con el ibuprofeno, también
MMFF94x, se obtuvieron energías de -11.20 kcal/ son valores que entran dentro de los aceptables,
mol para el ibuprofeno y -12.65 kcal/mol para para considerar a una molécula con propiedades
el naproxeno (Abdel-Azeem et al., 2009). Las farmacológicas interesantes (llamada hit) para
diferencias se dan ya que entre diferentes marcas estudios posteriores. Con esto se puede normalizar
de “software”, se utilizan diferentes algoritmos las afinidades de los “hits” para identificar los
matemáticos en el cálculo de las conformaciones. mejores puntos de partida para la optimización.
Aunque las energías son diferentes, estas no
pasan de los 5 kcal/mol. De la misma manera, Normalizar se refiere a identificar aquellos con
los resultados son equivalentes entre “softwares” los más altos valores de LE, en igualdad de
mostrando que el naproxeno tiene una menor condiciones. A pesar de sus bajas afinidades,
energía de enlace que el ibuprofeno en ambos casos. fragmentos de los hits seleccionados a menudo
tienen LE relativamente buenas (> 0,4) a excelentes.
La afinidad tiene repercusiones en la potencia Estudios en medicamentos que ya están a la venta
inhibitoria de la molécula en la enzima (Graham, (Hopkins et al., 2014), determinaron un LE para los
2001). Esto es vital en los estudios farmacológicos medicamentos orales de -0.52 kcal/mol/átomos
para determinar la dosis ideal para el medicamento. (no hidrógeno) lo cual está dentro del rango de los
En las pruebas preliminares para medicamentos, resultados obtenidos en este estudio. Además, se
existe un rango muy pequeño donde se alcanza muestra como va cambiando la LE a medida que
el efecto deseado. Concentraciones elevadas avanza el proceso de descubrimiento siendo para
producen toxicidad por sobredosificación, hits -0,41, compuestos líderes -0.39 y compuestos
mientras que concentraciones por debajo del rango en Fase 2 -0.42 kcal/mol/átomos (no hidrógeno).
terapéutico, no llegan a tener ningún efecto en el Transformar estos “hits” en compuestos líderes es
paciente. Datos de afinidad, sumados a pruebas un desafío que a menudo requiere la adición de
clínicas, ayudan a determinar la cantidad y el 15-20 átomos pesados para aumentar la afinidad.
intervalo entre dosificaciones, consiguiendo así, un Esto presenta una oportunidad para utilizar
tratamiento efectivo y seguro. diferentes ligandos y la eficiencia de grupos
para controlar cuidadosamente las propiedades
En la creación de nuevos medicamentos, estos químicas (Hopkins et al., 2014). La eficiencia de
datos son de gran importancia, ya que la mayoría ligando es bastante dependiente del tamaño
de inhibiciones se dan por competencia entre de la molécula donde ligandos de menor peso
el sustrato y el medicamento (Murray et al., molecular van a tener mejores eficiencias en
2003). En este tipo de competencia, la constante promedio que ligandos más grandes. La principal
de disociación determina la concentración del causa para esto es que a medida que el ligando
medicamento necesaria para lograr una inhibición crece en tamaño se reduce la calidad de la unión
exitosa de la enzima y el beneficio terapéutico para entre este y el receptor, ya que ligandos más
el paciente. Estos valores ayudan a escoger un grandes y complejos complican la entrada hasta
compuesto líder, entre un conjunto de potenciales el sitio activo del receptor (Reynolds et al., 2008).
moléculas, para invertir en el desarrollo de nuevos
fármacos (Stevens, 2014).

REMCB 36 (2), 2015


23

Existen varias limitaciones en el uso de estos en el cálculo, así como de otras propiedades
descriptores de afinidad. En primer lugar, todos los farmacocinéticas como biodisponibilidad, unión
átomos que no son hidrógeno tienen el mismo peso, proteica, vida media y de la interacción del fármaco
por lo que la introducción de un CH3, NH2, OH, F, Cl, con otros sistemas biológicos del cuerpo. Tomando
Br creará el mismo cambio en valores de LE, sin tomar en cuenta los datos obtenidos, se puede determinar
en cuenta las ventajas y desventajas de introducir que los inhibidores selectivos de la COX-2, debido
moléculas polares o especies cargadas en la molécula. a sus energías más bajas, van a ser más útiles para
Esto supone un riesgo en la utilización de LE, sin tratar dolores más agudos, en comparación al resto
considerar otras propiedades tales como la potencia, de AINEs estudiados. Así, mientras se necesitan 120
eficiencia de enlace lipofílico (LLE), solubilidad, mg (3x10-4 moles) de etoricoxib al día, para tratar
farmacocinética, entre otros (Murray et al., 2014). dolores como artritis gotosa aguda, tratamientos
con ibuprofeno pueden llegar a los 800 mg (4x10-3
Algunos autores sugieren que existen mejores moles) al día (American Society of Health-System
indicadores de eficiencia ligando, como son el Pharmacists, 2015).
índice porcentual o eficiencia-potencia (PEI,
por sus siglas en inglés), el índice de eficiencia Al comparar el ibuprofeno con el meloxicam,
de unión (BEI, por sus siglas en inglés), porque podemos observar que aunque el ibuprofeno posee
son más fáciles de calcular y tienen en cuenta las valores más favorables de energía libre de Gibbs y
diferencias entre los elementos en diferentes filas de eficiencia de enlace, la dosis diaria de meloxicam
de la tabla periódica (Abad-Zapatero, 2005). La es de tan solo 15 mg, mientras la del ibuprofeno es de
eficiencia de enlace lipofílico (LLE), por otro lado, 400 a 600 mg. Esto se debe a la influencia que tienen
es un parámetro extremadamente importante que otras propiedades farmacocinéticas, en este caso la
se debe tomar en cuenta durante la optimización vida media del medicamento, que mientras en el
de compuestos. LLE considera explícitamente el ibuprofeno es de tan solo 1.8 horas, en el meloxicam
equilibrio entre la lipofilia y la potencia inhibitoria. puede llegar a las 20 horas, siendo necesario menor
Sin embargo, a pesar de sus puntos fuertes, LLE no cantidad del medicamento para lograr mantener la
es tan idóneo cuando se quiere comparar moléculas dosis terapéutica en el cuerpo (American Society of
de diferentes tamaños. También, LLE no es útil Health-System Pharmacists, 2015).
cuando el objetivo biológico requiere moléculas
muy polares (Murray et al., 2014). Las comparaciones analizadas son útiles para
determinar la aplicabilidad y exactitud de los
No existe un descriptor de afinidad que sea la solución resultados obtenidos mediante programas
a todos los problemas y que lleven al éxito. Sin embargo, computacionales, en la búsqueda de sitios activos,
el concepto de LE es importante en investigaciones, compuestos con propiedades farmacológicas
para guiar las estrategias basadas en los fragmentos, interesantes y enlaces enzima-sustrato de objetivos
para acelerar el descubrimiento de fármacos y en la biológicos y enzimas de interés.
toma de decisiones (Murray et al., 2014). También se ha
utilizado para diseccionar el fragmento más eficiente CONCLUSIONES
en moléculas grandes obtenidas de productos
naturales (Abad-Zapatero et al., 2010). •El principio activo que posee mayor afinidad
con la enzima COX-2 es el celecoxib, con una
La diversidad de mecanismos de enlace de la energía de enlace de -10.8 kcal/mol y una
COX-2 demostrados para diferentes compuestos constante de equilibrio Ki de 1.21x10-8 M.
es impresionante. La habilidad de la enzima
de acomodarse estructuralmente a diferentes •El ibuprofeno y el naproxeno son las moléculas con
inhibidores es notable, ya que no existe evidencia mayor valor de eficiencia de enlace que sobrepasa
de cambios considerables en la conformación de los -0.48 kcal/mol/átomos (no hidrógeno).
las proteínas en la interacción con AINEs (Blobaum
y Marnet, 2007). Los AINEs estudiados, como •Aunque los datos de ΔG, Ki y LE son
mostraron los resultados, bloquean la unión entre el fundamentales para iniciar un estudio en una
ácido araquidónico con el sitio activo ciclooxigenasa molécula determinada, otras propiedades
de la enzima (impidiendo la formación de como biodisponibilidad, tiempo de vida
la prostaglandina). Esta inhibición se da por media y unión proteica, son importantes en el
competencia, por lo que esta puede ser revertida momento de definir la dosis del medicamento
al diluir el inhibidor, o aumentando la cantidad para el paciente, por lo cual este estudio debería
de sustrato (Nelson y Cox, 2008). La cantidad de complementarse con pruebas clínicas en el
antinflamatorio necesaria para lograr la inhibición laboratorio, para poder determinar seguridad y
depende de los valores de afinidad obtenidos dosis terapéutica.

Afinidad y Eficiencia de enlace


Meneses y Cuesta
24

AGRADECIMIENTOS Ermondi G, Caron G, Lawrence R y Longo D. 2004.


Docking studies on NSAID/COX-2 isozyme
A la DGA-PUCE, a través del proyecto “Estudio complexes using Contact Statistics analysis.
téorico y experimental en síntesis orgánica Journal of Computer-Aided Molecular Design, 18:
(Ibuprofeno)”, con código J13075. 683–696.

REFERENCIAS BIBLIOGRÁFICAS Graham P. 2001. An Introduction to Medicinal


Chemistry. Quinta edición. Oxford. Reino
Abad-Zapatero C y Metz J. 2005. Ligand efficiency Unido. 116, 211 pp.
indices as guideposts for drug discovery. Drug
Discovery Today, 10 (7): 464–469. Griffin M. 2015. Pain Relief: How NSAIDs Work.
Página de Internet: http://www.webmd.com/
Abad-Zapatero C, Perišić O, Wass J, Bento P, arthritis/features/pain-relief-how-nsaids-
Overington J, Al-Lazikani B y Johnson M. work Consultada 03-Junio-2015.
2010. Ligand efficiency indices for an effective
mapping of chemico-biological space: the Hall V, Murillo N, Rocha M y Rodríguez E. 2001.
concept of an atlas-like representation, Drug Antinflamatorios No Esteroidales. Centro
Discovery Today, 15: 804-811. Nacional de Información de Medicamentos,
Instituto de Investigaciones Farmacéuticas.
Abdel-Azeem A, Abdel-Hafez A, El-Karamany Universidad de Costa Rica, Costa Rica. 7:
G y Farag H. 2009. Chlorzoxazone esters of 13,14 pp.
some non-steroidal anti-inflammatory (NSAI)
carboxylic acids as mutual prodrugs: Design, Hopkins A, Keserű G, Leeson P, Rees P y Reynolds
synthesis, pharmacological investigations C. 2014. The Role of Ligand Efficiency
and docking studies. Bioorganic & Medicinal Measures in Drug Discovery, Nature reviews
Chemistry, 17: 3665–3670. drug discovery, 13 (2): 105-121.

American Society of Health-System Pharmacists. Kitchen D, Decornez H, Furr J y Bajorath J. 2004.


2015. Consumer Medication Information. Docking and scoring in virtual screening for
Página de Internet: http://www.nlm.nih. drug discovery: methods and applications.
gov/medlineplus/spanish/druginfo/meds/ Nature reviews: Drug discovery, 3: 935-949.
a689002-es.html Consultada 06-junio-2015.
McMurry, J. 2004. Organic Chemistry, sexta edición.
Atkinson A y Abernethy D. 2007. Principles of Thomson, USA. 305, 519, 1034, 1035 pp.
Clinical Pharmacology. Segunda edición.
Elsevier Inc. UK. 146-149 pp. Murray C, Erlanson D, Hopkins A, Keseru G,
Leeson P, Rees D, Reynolds C y Richmond N.
Berman H, Westbrook J, Feng Z, Gilliland G, Bath 2014. Validity of Ligand Efficiency Metrics,
T, Weissig H, Shindyalov I and Bournel P. 2000. ACS Medicinal Chemistry Letters, 5: 616-618.
The Protein Data Bank, Oxford Journals Nucleic
Acids Research, 28 (1): 235-242.
Murray R, Granner D, Mayes P y Rodwell V. 2003.
Harper’s Illustrated Biochemistry. Vigésima
Blobaum A y Marnett L. 2007. Structural and
sexta edición. McGraw-Hill. USA. 49, 50, 190-
Functional Basis of Cyclooxygenase Inhibition,
194 pp.
Journal of Medicinal Chemistry, 50 (7): 1425-1441.

Brunton L y Parker K. 2008. Goodman & Gilman’s Nelson D y Cox M. 2008. Lehninger Principles of
Manual of Pharmacology and Therapeutics. Biochemistry. Quinta edición. W.H Freeman
Décimo primera edición. McGraw-Hill. USA. and Company. USA. 184, 358, 817, 1184 pp.
421, 428, 429, 436, 451 pp.
Pettersen E, Goddard T, Huang C, Couch G,
Davies NM y Skjodt NM. 2000. Choosing the right Greenblatt D, Meng E y Ferrin T. 2004.
nonsteroidal anti-inflammatory drug for the UCSF Quimera - a visualization system for
right patient: a pharmacokinetic approach, exploratory research and analysis. Journal of
Clinical Pharmacokinetics, 38 (5): 377-392. Computational Chemistry, 25 (13): 1605-1612.

DeWitt D. 1999. Cox-2-Selective Inhibitors: The Pouplana R, Lozano J y Ruiz J. 2002. Molecular
New Super Aspirins, Molecular Pharmacology, modelling of the differential interaction between
55: 625–631. several non-steroidal anti-inflammatory drugs

REMCB 36 (2), 2015


25

and human prostaglandin endoperoxide H Stevens E. 2012. Medicinal Chemistry: The Modern
synthase-2 (h-PGHS-2). Journal of Molecular Drug Discovery Process. Primera edición.
Graphics and Modelling, 20: 329–343. Pearson. USA. 106, 254 pp.

Reynolds C, Tounge B y Bembenek S. 2008. Ligand Stevens E. 2014. 001 x: Medicinal Chemistry: The
Binding Efficiency: Trends, Physical Basis, and molecular basis of drug discovery, a course of
Implications J. Med. Chem, 51: 2432–2438. study offered by Davidson College through edX
platform, disponible en www.edx.org, chapters
Reynolds C y Holloway M. 2011. Thermodynamics 4,1; 4,3; 9,1; 10,2. Consultada 11-febrero-2015.
of Ligand Binding and Efficiency, ACS Medicinal
Chemistry Letters, 2: 433-437. The Scripps Research Institute. 2013. Autodock.
Página de Internet: http://autodock.scripps.
Savic J, Dilber S, Markovic B, Milenkovic M, edu/, 24/09/2013 Consultada 03-junio-2015.
Vladimirov S y Juranic I. 2011. Docking
Studies and a-Substitution Effects on the
Anti-Inflammatory Activity of ß-Hydroxy-ß-
arylpropanoic Acids. Molecules, 16: 6645-6655.

Standford Medicine. 2005. Pain Research at


Stanford. Página de Internet: http://med.
stanford.edu/paincenter/research.html
Consultada 03-junio-2015.

Afinidad y Eficiencia de enlace


Meneses y Cuesta
26

REMCB 36 (2), 2015


27

CIENCIAS BIOLÓGICAS

Rasgos morfológicos de frutos, semillas y embriones de


Cinchona officinalis L. (RUBIACEAE) en el sur del Ecuador
José Miguel Romero-Saritama

Departamento de Ciencias Naturales, Banco de Germoplasma


Universidad Técnica Particular de Loja jmromero@utpl.edu.ec

Recibido: 2015-06-11; aceptado: 2015-08-25

RESUMEN.- El estudio de rasgos morfológicos funcionales es importante para comprender el rol


de las especies en las comunidades vegetales. El objetivo del trabajo fue generar información de rasgos
morfológicos cuantitativos y cualitativos de frutos, semillas y embriones de Cinchona officinalis, L. que nos
permita mejorar el conocimiento, manejo, germinación y conservación ex situ de la especie. Colectamos
200 frutos maduros de cinco individuos presentes en un remanente de bosque montano en la provincia de
Loja– Ecuador. Se seleccionaron 50 cápsulas y evaluamos 13 rasgos morfológicos. Los resultados mostraron
que la especie posee cápsulas polispérmicas de 29 mm de largo x 9.5 mm de ancho con alta variación en
el número de semillas por fruto, pericarpio de consistencia leñoso con superficie fisurada. Las semillas
de C. officinalis están entre las más pequeñas del género Cinchona en Ecuador, son aladas de superficie
membranosa que terminan en pequeñas y finas puntas microscópicas semejantes a tricomas simples de
color café amarillento, miden un promedio de 5.1 mm de largo x 2.47 mm de ancho con un peso promedio de
3.30e-04 gramos por semilla. Embriones diminutos de color crema, foliados y espatulados con cotiledones
redondeados rodeados de endospermo. El largo del embrión mostró asociación significativa con el ancho
de las semillas y de los cotiledones.

PALABRAS CLAVES: Asociaciones morfológicas, Cinchona officinalis, conservación, especies


medicinales, morfología de semillas.

ABSTRACT.- Understanding the functional role of plant seed, fruits and embryos morphological traits is
essential in order to devise the ecological relevance of single species for the assembly of plant communities.
In the present study we generated information concerning qualitative and quantitative traits of Cinchona
officinalis L. seeds, fruits and embryo. A total of 200 mature fruits were collected from five individuals of
this species in a mountain forest of Loja province, southern Ecuador. Thirteen morphological traits were
evaluated in 50 capsules. Or results revealed that the species possesses polyspermic capsules with an
averaged length of 29 mm and an averaged width of 9.5 mm. There was a high variability in the number of
seeds per fruit. The fruits of the species have a pericarp of woody consistency and a fissured surface. The
C. officinalis seeds are within the smallest ones of the Chinchona genus in Ecuador. Seeds are winged with
a membranous surface and sharp endings that resemble trichomes. Seeds have an averaged length of 5.1
mm, an averaged width of 2.47 mm their average weight is of 3.30e-04 grams. The C. officinalis embryos are
tiny, foliated and spatulate with rounded cotyledons surrounded by endosperm. Embryos length showed
a significant association with seed and cotyledon width.

KEYWORDS: Cinchona officinalis, conservation, medicinal species, morphological associations,


morphology seeds.

INTRODUCCIÓN y fisiológicos hasta alcanzar su maduración y


dispersión (Hay y Robert, 1995). Durante ese
Las semillas empiezan su desarrollo después de período las semillas varían enormemente en su
que ha ocurrido la fertilización, momento en que se tamaño, forma, estructura, morfología interna
iniciarán un sinnúmero de cambios morfológicos y presencia de tejidos de almacenamiento

Frutos, semillas y embriones de Cinchona officinalis


Romero-Saritama
28

(Hartmann et al., 1997). El estudio de rasgos componentes y rasgos de las especies. Con respecto
funcionales y cambios morfológicos en especies a investigaciones sobre rasgos morfológicos de
individuales es importante porque nos permiten cápsulas de Cinchona officinalis L. no se conocen
determinar la respuesta de las plantas a factores estudios a detalle o al menos no se evidencian
ambientales (Lavorel et al., 2007), en cambio los reportes de ello. En Ecuador el género Cinchona
rasgos morfológicos en cápsulas podrían ayudar conocido como cascarilla y considerado “árbol y
a establecer su calidad (Romero-Saritama y la flor nacional del Ecuador” (Buitrón, 1999), está
Pérez, en prensa), reconocer las especies en el compuesto por 12 especies, cuatro endémicas y
campo (Amorim, 1996), y proveer de información 8 nativas (Jørgensen y León-Yánez, 1999) de las
importante para la germinación y conservación cuales C. capulí está casi amenazada, C. rugosa y C.
de las semillas. Por ejemplo estudios realizados lucumifolia vulnerable, C. mutisii en peligro crítico
en Trema micrantha concluyeron que los rasgos (Cornejo y Jaramillo, 2011), y aunque C. officinalis
morfológicos son una importante herramienta todavía no consta dentro del libro rojo de plantas
para comprender los procesos germinativos de endémicas del Ecuador, su distribución es bastante
esa especie (Amorim et al., 1997). El conocimiento baja y restringida lo cual ha puesto a la especie al
de rasgos morfológicos también contribuye a la límite de su desaparición (Madsen, 2002).
comprensión de la dinámica a nivel de poblaciones
vegetales (Donadio y Demattê, 2000), predecir el Las especies de Cinchona identificadas como
ritmo de los procesos de las especies dentro de plantas medicinales distribuidas en la región andina
los ecosistemas (Garnier et al., 2004; Laughli et al., sudamericana (Valverde, 1998) han sido utilizadas
2012) y en estudios taxonómicos de las especies. mundialmente como remedio contra la malaria y
En este sentido algunos autores como Gunn desórdenes infecciosos por más de 300 años (Stell,
(1981, 1984), Lima (1985, 1989), Oliveira (1999), 1982), lo que ha llevado a considerarlas como
Kirkbride et al. (2003) y Tozzi y Meireles (2008) en plantas “salvadoras de la humanidad” (Buitrón,
sus trabajos muestran la importancia de los rasgos 1999). El uso de estas especies ha implicado que
morfológicos en la taxonomía de leguminosas. En sus poblaciones naturales bajen drásticamente
cambio Martin (1946) utilizó rasgos morfológicos y en algunos de los casos estén amenazadas; por
para clasificar a las semillas, de acuerdo con el ello es fundamental realizar trabajos que apoyen
tamaño y disposición del embrión dentro de la su conservación in situ y ex situ. C. officinalis fue
semilla, clasificación que hasta la actualidad se la primera especie de cascarilla descrita por la
sigue utilizando como una referencia en estudios ciencia (Acosta-Solis, 1989), es un árbol o arbusto
de evolución, morfología y dormancia de semillas que puede alcanzar unos 16 metros de altura
(Forbis et al., 2002; Baskin y Baskin, 2004; Finch- (Anderson y Taylor, 1994) perteneciente a la familia
Savage and Leubner-Metzger, 2006). Rubiaceae, descubierto y revelado por un indígena
de Loja a los virreyes españoles de Lima (Buitrón,
Dentro de los rasgos morfológicos, el tamaño de 1999), considerándola endémica de la región sur
las semillas ha sido uno de los más estudiados y del Ecuador específicamente del valle de Loja
su importancia radica en que ocupa una posición (Madsen, 2002; Garmendia, 2005), de donde se
pivotante en la ecología de las plantas al estar reconoce proviene el producto de mejor calidad
asociado tanto con la capacidad de las especies (Buitrón, 1999). Sin embargo, también se la puede
de dispersarse como al de establecerse en un encontrar distribuida en las provincias de Bolívar,
determinado sitio (Leishman et al., 1995; Alexander Chimborazo, Cañar, Azuay, Morona Santiago y
et al., 2001). El tamaño de las semillas en algunas Zamora Chinchipe (Jørgensen y León-Yáñez, 1999).
especies ha significado que semillas grandes Lamentablemente y a pesar de la gran importancia
produzcan plántulas más vigorosas en el sotobosque, comercial y medicinal que ha tenido el género
mientras que especies con semillas pequeñas Cinchona, la sobreexplotación (Madsen, 2002) y
con rápida germinación, estarían adaptadas a la los graves problemas de deforestación, sin duda
colonización de nuevos espacios (Thompson, 2000). han hecho que poblaciones de C. officinalis en
La variación del tamaño de las semillas ha sido bien la provincia de Loja estén en riesgo y pongan en
estudiada en otras latitudes; sin embargo, en las peligro su sobrevivencia natural en el tiempo, por
zonas tropicales son escasos estos estudios, más aún esta razón el presente estudio tuvo como objetivo
para especies nativas o endémicas. generar información sobre rasgos morfológicos
cuantitativos y cualitativos del fruto, semillas y
En países tropicales como Ecuador que posee una embrión de C. officinalis que nos permitan identificar
alta biodiversidad, todavía una gran proporción parámetros y herramientas para mejorar el manejo,
de especies vegetales aún no se describen germinación y conservación ex situ de la especie.
taxonómicamente, lo cual implica un esfuerzo
en generar información referente a los diferentes

REMCB 36 (2), 2015


29

MATERIALES Y MÉTODOS variables que no se ajustan a una distribución


normal (Kent y Coker, 1992). Utilizamos el “Test de
Recolección del material.- Se recolectaron 200 Wilcoxon” para comparar el tamaño de las semillas
frutos maduros de cinco individuos de C. officinalis de C. Officinalis con otras especies del mismo
en un remanente de bosque montano (Sierra, 1999) género distribuidas en Ecuador según información
ubicado a una altitud de 2 250 msnm en el sector bibliográfica generada por Andersson y Taylor
Zamora Huayco (4°01´51.8”S 79°10´30.8”W) de la (1994), realizamos cluster utilizando distancia
provincia de Loja al sur del Ecuador que corresponde euclidiana para identificar grupos de especies
a la zona de amortiguamiento del parque Nacional con características similares según el tamaño de
Podocarpus. La temperatura media anual es de las semillas. Todos los análisis estadísticos fueron
15.3º C; y un promedio de lluvia anual de 900 realizados en el entorno R (R Core Team, 2013).
mm (Cañadas, 1983). El bosque montano del sur,
es un ecosistema en peligro de desaparecer, los RESULTADOS
pocos remanentes se encuentran en lugares poco
accesibles por la pendiente fuerte y con un suelo Morfología de frutos.- El fruto de C. officinalis es
menos útil para la agricultura (MAE, 2012). una cápsula septicida seca dehiscente polispérmica,
ovoide alargada que puede contener de 12 a 90
Análisis morfológicos.- Se seleccionó y midió una semillas, se separa longitudinalmente a través de
muestra de 50 frutos en buen estado fitosanitario las ranuras carpelares desde la base al ápice del
y se determinó el número de semillas por fruto. fruto, originando dos valvas o lóculos (Figura 1). El
Los diferentes rasgos morfológicos cuantitativos pericarpio es delgado pero leñoso de consistencia
y cualitativos evaluados para frutos, semillas dura, la superficie de forma fisurada color café a
y embriones se muestran en la tabla 1. Las marrón oscuro con presencia de diminutos tricomas
dimensiones del fruto y el grosor de las semillas se color blanco.
midió mediante un calibrador electrónico Stainless
hardened de tres dígitos. Utilizamos el “software” Como podemos observar en la figura 2, el largo de
de acceso libre Imagen J (http://imagej.nih.gov/ los frutos puede variar entre 16 a 29 x 4.5 a 9.4 mm de
ij/) para determinar el largo y ancho de 50 semillas. ancho. Encontramos que el 50 % de las mediciones
Se realizaron cortes longitudinales y transversales del largo se encuentran por debajo de la media (22.07
después de colocar las semillas en agua, durante ± Desviación estándar (DE) 3.04), mientras que solo
15 minutos, para identificar la presencia o ausencia el 25 % de las mediciones del ancho estuvieron por
de endospermo, forma y tipo de embrión. La debajo de la media (7.37 ± DE 1.19 mm), presentando
longitud del embrión se determinó mediante el uso así una asimetría negativa.
de una rejilla milimetrada en un estereoscopio. La
nomenclatura usada para los diferentes caracteres Caracterización de semillas y embrión.- Las
cualitativos se basó en Moreno (1984), Mauseth (1986) semillas presentan una forma fusiforme de testa
y Vozzo (2005). El tipo de embrión fue de acuerdo blanda con superficie membranosa con presencia
con la clasificación de Martin (1946) (Tabla 1). de alas muy frágiles que se rompen fácilmente
(Figura 3A) y terminan en pequeños tricomas
Tabla 1. Rasgos cuantitativos y cualitativos medidos para simples de color café amarillento. Semillas con
Cinchona officinalis endospermo y embrión pequeño espatulado con
Rasgo Cuantitativos Rasgo Cualitativos desarrollo rudimentario, tipo espatulado de color
blanco (Figura 3B).
Largo de frutos (mm) Color de frutos
Ancho de frutos (mm) Color de semillas El tamaño de las semillas de C. officinalis se
Ancho de semillas (mm) Forma de semillas diferencia significativamente de las otras especies
Largo de semillas (mm) Color de embrión de Cinchona distribuidas en Ecuador, sin embargo
Peso de semillas (g) Tipo de embrión
posee afinidad con dos especies (Figura 4).
C. officinalis es una de las especies con semillas de
Largo de embrión (mm) Presencia de endospermo
menor tamaño, que presenta un largo promedio
Ancho del cotiledón de 5.01 (± DE 0.60) x 2.46 (± DE 0.33) mm de ancho
(Figura 5) y grosor máximo de 1 mm. Las semillas
Análisis de datos.- Se obtuvieron valores son livianas con un peso promedio de 3.30e-04 g
estadísticos descriptivos para cada uno de los (DE: 0.0001). El embrión es bastante pequeño con
rasgos cuantitativos y los resultados se graficaron un promedio de 1.51 mm (± DE: 0.24) y puede
mediante “box plot”. Se establecieron asociaciones llegar hasta 1.85 mm de largo (Tabla 2).
entre rasgos cuantitativos con la prueba de
correlación Spearman (p < 005), adecuado para

Frutos, semillas y embriones de Cinchona officinalis


Romero-Saritama
30

Figura 2. Variación del tamaño de los frutos de C. officinalis. F= fruto

B
A

Figura 1. Frutos de C. officinalis en diferentes estados de


desarrollo. A.- Sección longitudinal del fruto inmaduro donde
se puede evidenciar las ranuras carpelares y los dos lóculos
(Lc) donde se forman las semillas. B.- Fruto seco en proceso de Figura 3. Características de las semillas de Cinchona officinalis. A
dehiscencia separándose por las ranuras carpelares desde la Parte exterior de las semillas. B Parte interna de las semillas. tes=
base al ápice del fruto. C.- Vista de un lóculo en un fruto abierto. testa, end= endospermo, emb= embrión, sam= samara.

REMCB 36 (2), 2015


31

Figura 4. Dendograma y agrupación jerárquica de acuerdo con Figura 5. Boxplot del tamaño promedio y distribución de
el tamaño de las semillas del género Cinchona. El asterisco(*) medidas de semillas de C. officinalis (n=50). Emb= embrión.
significa semillas de C. officinalis mediada en este estudio

Tabla 2. Resultados comparativos (p< 0.05) del tamaño de las semillas de C. officinalis con el promedio de otros géneros
distribuidos en el Ecuador.
Especie Largo (mm) p valor Ancho (mm) p valor
C.officinalis 5.2 0.025 2.6 0.002
C.lancifolia 9.0 0.001 3.2 0.001
C.lucumifolia 5.3 0.025 2.4 ns
C.macrocalys 9.0 0.001 2.9 0.001
C.mutisii 6.7 0.001 3.3 0.001
C.parabolica 6.9 0.001 2.0 0.001
C.pubescens 7.7 0.001 2.5 ns
C.pitayensis 6.0 0.001 3.6 0.001
C.rugosa 8.5 0.001 3.3 0.001
C.villosa 5.2 0.025 1.9 0.001
ns = no significativo.

Los resultados de las correlaciones entre rasgos ancho de los cotiledones (S = 137, p-valor = 0.003).
cuantitativos (Figura 6) mostraron que existe una No se encontraron asociaciones significativas entre
asociación entre el largo del embrión (S = 145, los demás rasgos estudiados.
p-valor = 0.033) con el ancho de las semillas y con
Ancho cotiledones (mm)

Figura 6. Correlación spearman (p= <0.05) entre rasgos en las semillas de Cinchona officinalis.

Frutos, semillas y embriones de Cinchona officinalis


Romero-Saritama
32

DISCUSIÓN Por otro lado, el tipo y tamaño pequeño del embrión


en las semillas de C. officinalis podría influir en el
En la naturaleza podemos observar una diversidad tiempo y tasa de germinación. En estudios con
de adaptaciones de las plantas que les permiten plantas del Mediterráneo y en algunas Apiaceas
asegurar su dispersión y adaptación a diversos mostraron una relación positiva entre la velocidad
lugares. En el caso de C. officinalis, la forma, el y tasa de germinación con el tamaño del embrión
tamaño y el peso de las semillas son rasgos que (Vivrette, 1995; Vandelook et al., 2012). Semillas con
están íntimamente relacionados con el tipo de embriones pequeños requiere un extenso período
dispersión, permitiéndoles ser llevadas por el de crecimiento del embrión antes de la germinación
viento. Las ventajas asociadas a este tipo de (Baskin y Baskin, 1988; Vandelook, 2012). Por lo
dispersión y al tamaño pequeño de las semillas, han tanto, una de las consecuencias que tendrían los
sido relacionadas con la habilidad de alcanzar más y embriones pequeños que presentan las semillas
mejores sitios de germinación (Peco et al., 2003). Sin de C. officinalis sería el retraso en la germinación,
embargo, al ser las semillas pequeñas, estas aportan no solo porque el embrión deberá primeramente
poco al crecimiento de la nueva planta y dependen crecer, sino que al estar rodeado por endospermo,
muy pronto de los recursos disponibles en su este también puede convertirse en una barrera para
medio, por lo cual su riesgo de morir es muy alto el desarrollo de la radícula. En estudios con otras
(Vásquez et al., 1997). Ante esta situación una de las especies se ha demostrado que el endospermos
estrategias que poseen las plantas para sobrevivir genera cierta resistencia mecánica al crecimiento
es producir muchas semillas (Parker, 1989). La del embrión (Baskin y Baskin, 2014; Yan et al., 2014),
variación encontrada en el número de semillas por por lo cual las semillas necesitan mayor tiempo
fruto de C. officinalis también podría ser una ventaja para germinar. La presencia de endospermo en las
al momento de establecerse en un determinado semillas se considera un caracter primitivo en las
sitio, ya que los frutos que tienen varias semillas especies (Lee et al., 2012) con respecto a las semillas
muestran mayor probabilidad de contener por sin endospermo.
lo menos una semilla madura, viable y que logre
sobrevivir (Dalling, 2002). Además, la variación CONCLUSIONES
de semillas por fruto aparte de ser estrategia de
los sistemas de reproducción y establecimiento de •Los rasgos morfológicos determinados en
las diferentes especies (Parker, 1989), en algunos las cápsulas de C. officinalis podrían actuar
taxones se presenta como una respuesta a la en forma complementaria generando en las
asignación de recursos de la planta a las semillas, semillas ventajas y desventajas al momento de
las fluctuaciones en la disponibilidad de recursos, dispersarse y germinar.
hace que las plantas opten por modificar el número
de semillas antes que su peso (Haig y Westoby, 1988; •Los rasgos como tamaño, peso y forma de
Garrido et al., 2005), y en C. officinalis la variación en las semillas, podrían favorecer a C. officinalis
el número de semillas es alta. a encontrar nuevos y mejores sitios para
germinar y establecerse durante su dispersión,
Contrario a las ventajas de dispersión que sin embargo, rasgos internos en las semillas
puede tener una semilla pequeña, el tamaño podrían influir negativamente en el proceso
que presentan las semillas de C. officinalis podría normal germinativo y podrían también requerir
significar una desventaja ecológica con respecto tratamientos pregerminativos.
a semillas grandes que dan a las plántulas más
recursos de cara a la germinación, establecimiento •Los rasgos morfológicos evaluados son
y supervivencia de las plántulas (Jakobsson y factores a tomar en cuenta al momento de
Eriksson, 2000; Susko y Lovett-Doust, 2000; Paz generar y ejecutar programas de conservación,
y Martínez-Ramos, 2003; Alcántara y Rey, 2003), propagación y recuperación de esta especie por
esta podría ser una de las razones por las cuales medio de semillas.
no se observa con frecuencia la germinación y
regeneración natural de C. Officinalis. Sin embargo, AGRADECIMIENTOS
una posible ventaja que presentan las semillas para
ayudar a su germinación es su tipo de testa, que Este trabajo contó con el apoyo financiero por parte
al ser blanda y membranosa puede absorber mejor del programa de becas SENESCYT 2008-2 y por
y mayor cantidad de agua para iniciar su proceso proyectos internos de la UTPL. A Javier Loayza
germinativo, a diferencia de las especies con por el apoyo en la colección de semillas; a Janneth
semillas de testa dura que generan latencia física Simaluiza por la revisión del manuscrito.
impidiendo el paso del agua desde afuera hacia el
interior de las semillas (Baskin y Baskin, 2015).

REMCB 36 (2), 2015


33

REFERENCIAS BIBLIOGRÁFICAS Cornejo X y Jaramillo T. 2011. Rubiaceae en: León-


Yánez, S., R. Valencia, N. Pitman, L. Endara, C.
Acosta-Solís M. 1989. La cinchona o quina plata Ulloa et H. Navarrete (eds). Libro rojo de las
nacional del Ecuador. Revista de la Academia plantas endémicas del Ecuador, 751- 766. 2a.
colombiana de Ciencias, 17(65):306–311. ed., Publicaciones del Herbario QCA. Pontificia
Universidad Católica del Ecuador, Quito.
Alexander HM, Cummings CL, Kahn L y Snow
AA. 2001. Seed size variation and predation Dalling JW. 2002. Ecología de semillas. En: M.
of seeds produced by wild and crop-wild Guariguata y G. Catan, (eds). Ecología y
sunflowers. American Journal of Botany, 88(4): Conservación de Bosques Neotropicales, 345-
623- 627. 375. Libro Universitario Regional, Cartago,
Costa Rica.
Alcántara JM y Rey PJ. 2003. Conflicting selection
pressures on seed size: evolutionary ecology of Donadio MM y Demattê ME. 2000. Morfologia de
fruit size in a bird-dispersed tree, Olea europaea. frutos, sementes, e plântulas de canafístula
Journal of Evolutionary Biology, 16(6): 1168-1176. (Peltophorum dubium (Spreng.) Taub.) e
jacarandá-da-Bahia (Dalbergia Nigra (Vell.) Fr.
Amorim IL. 1996. Morfologia de frutos, sementes, All. ex Benth.) - Fabaceae. Revista Brasileira de
germinação, plântulas e mudas de espécies Sementes, 22(1):64-73.
florestais da região de Lavras - MG. 1996. 127f.
Tesis de Mestrado em Engenharia Florestal - Finch-Savage WE y Leubner-Metzger G. 2006. Seed
Departamento de Silvicultura, Universidade dormancy and the control of germination. New
Federal de Lavras. Lavras. Phytologist, 171:501-523.

Amorim IL, Davide AC, Chaves MM. 1997. Forbis TA, Floyd SK y De Queiroz A. 2002. The
Morfologia do fruto e da semente, e germinação evolution of embryo size in angiosperms and
da semente de Trema micrantha (L.) Blum. other seed plants: implications for the evolution
Revista Cerne, 3(1):129-142. of seed dormancy. Evolution, 56:2112–2125.

Andersson L y Taylor CM. 1994. Rubiaceae: Garnier E, Cortez J, Billès G, Navas M-L, Roumet C,
Cinchonea - Coptosapeltea flora of Ecuador. Debussche, Toussaint JP. 2004. Plant functional
En Harling G y Andersson (eds). Flora of markers capture ecosystem properties during
Ecuador. 62:1- 319. University of Gothenburg; secondary succession. Ecology, 85:2630–2637
Riks museum; Pontificia Universidad Católica
del Ecuador. Quito. Garmendia AF. 2005. El árbol de la Quina (Cinchona
spp): Distribución, caracterización de su hábitat
Baskin CC y Baskin JM. 1998. Seed: Ecology, y arquitectura. Universidad Técnica Particular
biogeography, and evolution of dormancy and de Loja. Ecuador. 187 pp.
germination. Academic Press, San Diego, USA.
666 pp. Garrido JL, Rey JP y Herrera CM. 2005. Fuentes
de variación en el tamaño de la semilla de
Baskin JM y Baskin CC. 2004. A classification system la herbácea perenne Hellebous foetidus L.
for seed dormancy. Seed Science Research, 14:1-16. (Ranunculaceae). Anales del Jardín Botánico de
Madrid, 62(2):115-125.
Baskin CC y Baskin JM. 2014. Seeds: Ecology,
biogeography and evolution of Dormancy and Gunn C. 1981. Seeds of Leguminosae. En: Polhill
Germination. 2a. ed. Kentucky, USA: Elsevier. R y Raven H. (eds). Advances in legume
systematics. Part 2: 913-925. Royal Botanic
Buitrón X. 1999. Ecuador: uso y comercio de plantas Gardens, Kew, London.
medicinales, situación actual y aspectos
importantes para su conservación. TRAFFIC Gunn C. 1984. Fruits and seeds of genera in the
Internacional. Ecuador. 101 pp. subfamily Mimosoideae (Fabaceae). Technical
bulletin nº 1681. A gricultural Research Service.
Cañadas L. 1983. El Mapa Bioclimáticoy Ecológico United States Departament of Agriculture,
del Ecuador. MAG-PRONAREG. Quito. Washington DC. 190 pp.

Frutos, semillas y embriones de Cinchona officinalis


Romero-Saritama
34

Haig D y Westoby M. 1988. Inclusive fitness, seed Lima HC. 1989. Tribo Dalbergieae (Leguminosae-
resources, and maternal care. En: Lovett-Doust Papilionoideae) –morfología dos frutos,
J. y Lovett-Doust L. (eds) Plant Reproductive sementes e plántulas e sua aplicação na
Ecology: Patterns and strategies: 60- 79. Oxford sistemática. Arquivos do Jardim Botânico do Rio
University Press. Oxford. de Janeiro, 30:1–42.

Hay FR y Probert RJ. 1995. Seed maturity and Madsen JE. 2002. Historia cultural de la cascarilla
the effects of different drying conditions on de Loja. En: Aguirre Z, Madsen JE, Cotton E,
desiccation tolerance and seed longevity y Balslev H (eds) Botánica Austroecuatoriana:
in foxglove (Digitalis purpurea L.). Annals of estudios sobre los recursos naturales en las
Botany, 76(6):639-647. provincias de El Oro, Loja y Zamora Chinchipe:
385–399. Ediciones Abya-Yala, Quito.
Hartmann HT, Kester DE, Davies FT, y Geneve RL.
1997. Plant propagation, principles and practices. Mauseth JD. 1986. Plant anatomy. Cumminigig
Prentice Hall International, INC. 869 pp. Series in the life Science. Unversity of Texas.
676 pp.
Jakobsson A y Eriksson O. 2000. A comparative
study of seed number, seed size, seedling size Martin AC. 1946. The comparative internal
and recruitment in grassland plants. Oikos, morphology of seeds. The American Midland
88(3):494-502. Naturalist, 36(3):513–660.

Jørgensen PM y León-Yánez S (eds). 1999. Catalogue Ministerio del Ambiente del Ecuador (MAE).
of the vascular plants of Ecuador. Monogr. Syst. 2012. Sistema de clasificación de los ecosistemas
Bot. Missouri Bot. Gard. 75: i–viii, 1182 pp. del Ecuador continental. Subsecretaría de
Patrimonio Natural. Quito. 136 pp.
Kent M y Coker P. 1992. Vegetation: description
and analysis, a practical approach. Belhaven Moreno NP. 1993. Glosario botánico ilustrado.
Press, Londres, 112-161 pp. Instituto Nacional de Investigaciones sobre
Recursos Bióticos. Xalapa, México. 300 pp.
Kirkbride JH, Gunn CR, Weitzman AL. 2003. Fruits
and seeds of genera in the subfamily Faboideae Oliveira DM. 1999. Morfo-anatomia do embrião de
(Fabaceae). U.S. Department Agriculture leguminosas arbóreas nativas. Revista Brasileira
Technical Bulletin 1890:212 pp. de Botânica, 22:413–427.

Lavorel S, Díaz S, Cornelissen J, Garnier E, Harrison Parker KC.1989. Height structure and reproductive
SP, McIntyre S, Urcelay C. 2007. En: Canadell characteristic of senita Lophocereus schottii
JG, Pataki D, y Pitelka L (eds). Terrestrial (Cactaceae) in southern Arizona. The
Ecosystems in a Changing World. The IGBP Southwestern Naturalist, 34:392–401.
Series, Springer-Verlag, Berlin Heidelberg.
Paz H y Martínez-Ramos M. 2003. Seed mass and
Lee KJ, Dekkers BJW, Steinbrecher T, Walsh CT, seedling performance within eight species of
Bacic A, Leónie-Bentsink L, et al. 2012. Distinct Psychotria (Rubiaceae). Ecology, 84:439-450.
cell wall architectures in seed endosperms
in representatives of the Brassicaceae and Peco B, Traba J, Levassor C, Sánchez M y Azcárate
Solanaceae. Plant Physiology, 160(3):1551–1566. FM. 2003. Seed size, shape and persistence in
dry Mediterranean grass and scrublands. Seed
Leishman MR, Westoby M y Jurado E. 1995. Science Research, 13(1): 87–95.
Correlates of seed size variation a comparison
among 5 temperate floras. Journal of Ecology, R Core Team. 2013. R: A language and environment
83(3):517–529. for statistical computing. Vienna, Austria, R
Foundation for Statistical Computing.
Lima MP. 1985. Morfologia dos frutos e sementes
dos gêneros da tribo Mimoseae (Leguminosae Sierra R. 1999. Propuesta Preliminar de un Sistema
– Mimosoideae), aplicada à sistemática. de Clasificación de Vegetación para el Ecuador
Rodriguésia, 37:53–78. Continental. Proyecto INEFAN, GEFBIRG y
EcoCiencia, Quito, Ecuador.

REMCB 36 (2), 2015


35

Susko DJ y Lovett-Doust L. 2000. Patterns of seed Vasquez C, Orozco A, Rojas M, Sánchez M y


mass variation and their effects on seedling Cervantes V. 1997. La reproducción de las
traits in Alliaria petiolata (Brassicaceae). plantas: semillas y meristemos. Primera
American Journal of Botany, 87(1):56-66. edición. México DF. 90 pp

Stell G. 1982. Flores para el Rey. Editorial del Serbal. Vivrette NJ. 1995. Distribution and ecological
Barcelona-España. 347 pp. significance of seed-embryo types in
Meditteranean climates in California, Chile,
Thompson K. 2000. The functional ecology of soil and Australia. En: Arroyo MKT, Zedler PH,
seed banks. In: Fenner M. (eds), Seeds: the y Fox MD (eds) Ecology and biogeography
ecology of regeneration in plant communities. of Mediterranean ecosystems in Chile,
pp. 215–236. CABI Publishing. California and Australia. 274–288: Springer
Verlag. New York.
Tozzi A y Meireles J. 2008. Seed and embryo
morphology of Poecilanthes (Fabaceae, Vozzo JA. 2002. Tropical Tree seed manual. United
Papilionoidadae, Brongniartieae). Botanical States Departament of Agriculture, Forest
Journal of the Linnean Society, 158:249–256. Service. EEUU. 899 pp.

Valverde F. 1998. Plantas útiles del litoral ecuatoriano. Yan D, Duermeyer L, Leoveanu C, y Nambara E.
Fundación Ecuatoriana de estudios Ecológicos 2014. The Functions of the Endosperm During
– EcoCiencia. Ministerio de Medio Ambiente. Seed Germination. Plant & Cell Physiology,
Instituto para el Ecodesarrollo de la Amazonía 55(9):1521–1533.
Ecuatoriana – ECORADE. Guayaquil-Ecuador.

Vandelook F, Janssens SB y Probert RJ. 2012.


Relative embryo length as an adaptation to
habitat and life cycle in Apiaceae. The New
Phytologist, 195(2):479–87.

Frutos, semillas y embriones de Cinchona officinalis


Romero-Saritama
36

REMCB 36 (2), 2015


37

Celulasas presentes en el tracto digestivo del


camarón Litopenaeus vannamei
Claudia Segovia-Salcedo1, Alexandra Narváez-Trujillo 2, Fernando Espinoza-Fuentes3
1
Departamento de Ciencias de la Vida. Escuela Politécnica del Ejército.
Sangolquí, Ecuador. mcsegovia@espe.edu.ec

2
Laboratorio de Biotecnología Vegetal, Escuela de Ciencias Biológicas,
Pontificia Universidad Católica del Ecuador. Quito, Ecuador. anarvaez@puce.edu.ec

3
Universidad Espíritu Santo. Guayaquil, Ecuador.

Recibido: 2015-08-07; aceptado: 2015-10-12

RESUMEN.- Las celulasas han sido clasificadas como endoglucanasas responsables de degradar celulosa,
lo que le proporciona gran importancia en los procesos de la cadena alimentaria. Las celulasas y enzimas
relacionadas son utilizadas ampliamente en varios procesos industriales. La celulosa es utilizada como
una fuente nutricional por varios organismos, inicialmente se pensaba que únicamente microorganismos
podrían degradarla, pero en la actualidad se ha encontrado celulasas en varios grupos de animales. En este
trabajo, presentamos la detección de celulasas en extractos obtenidos del camarón Litopenaeus vannamei.
En los ensayos se utilizaron individuos adultos y de los diferentes subestadios de L. vannamei colectados
en los estanques de cría de las camaroneras de la Península de Santa Elena y Muisne, en las provincias
de Santa Elena y Esmeraldas, respectivamente. Los hepatopáncreas, los estadios larvarios y los intestinos
fueron homogeneizados en un homogeneizador Braun-Melsungen. Para la identificación de la celulasa,
se utilizó como sustrato carboximetil celulosa (CMC) de mediana viscosidad. Para medir su actividad se
añadió ácido 3,5 dinitrosalicílico (DNS). La actividad de la celulasa se determinó en base en la cantidad
de los grupos reductores liberados. Para intentar determinar el origen sea endógeno o microbiano de las
celulasas identificadas, se sometieron las muestras de adultos a antibióticos.

En el subestadio zoea 3, se identificó una celulasa con un rango de pH óptimo entre pH 6.5 y pH 9.5. En las
muestras de hepatopáncreas del camarón adulto se determinaron dos pH óptimos: uno en el rango ácido (pH
4-6) y otro en el rango básico (pH 10-11) lo cual sugiere la presencia de dos celulasas diferentes. En el intestino
se observó actividad únicamente en el pH ácido (pH 4-6). La actividad celulolítica detectada en el desarrollo
ontogénetico del camarón fue baja e inestable, una condición reportada también en el análisis comparativo
de enzimas digestivas en otras cuatro especies de crustáceos. La actividad relativa de las dos enzimas del
hepatopáncreas es similar y cada una de estas tienen una actividad cuatro veces mayor a la encontrada en el
intestino. Estos resultados indican la presencia de dos celulasas presentes en el hepatopáncreas y se sugiere
que una de ellas (con pH óptimo ácido) podría ser transportada desde el hepatopáncreas al intestino, aunque
los datos no son concluyentes. En el caso de la celulasa con actividad a pH básico (10.5) puede tratarse de
una celulasa producida de manera endógena por el camarón. Los datos reportados en este estudio sobre las
capacidades de producción enzimática del camarón puede ser la base para futuros proyectos de investigación
cuyo objetivo sea optimizar los procedimientos de cultivo del camarón.

PALABRAS CLAVES: Celulasas, crustáceos, digestión, Ecuador, Litopenaeus vannamei.

ABSTRACT.- Cellulases have been classified as endoglucanases. This is the only enzyme capable of
degrading cellulose, which gives an immense importance in the processes of the food chain, being cellulose
the most abundant source of carbon on earth. Cellulases and related enzymes are widely used in various
industrial processes. Cellulose is used as a nutritional source for several organisms, initially it was thought
that only microorganisms may degrade this polymer however cellulases have been reported in many animal
groups. In this paper, we present the preliminary identification and characterization of cellulases in the shrimp
Litopenaeus vannameiduring its larval and adult stages. In adults and f different sub-stages of L. vannamei
were collected in culture tanks in comercial shrimp farms in the Santa Elena Peninsula and Muisne, in the
provinces of Esmeraldas and Santa Elena, respectively. The hepatopancreas, larval stages and intestines were

Celulasas en el camarón Litopenaeus vannamei


Segovia et al.
38

homogenized in a Braun-Melsungen homogenizer. Carboxymethyl cellulose (CMC) of medium viscosity was


used as a substrate. To measure enzymatic activity 3,5 dinitrosalicylic acid (DNS) was added. The cellulase
activity was determined based on the amount of reducing groups released. To try to determine the presence of
endogenous cellulases, that is produced by shrimp, samples were submitted to antibiotics and later assayed.
In sub-stage zoeal 3, a cellulase with an optimal pH range between pH 6.5 and pH 9.5 was determined.
In samples of adult shrimp hepatopancreas two optimum pH were determined: one in the acid range (pH
4-6) and one in the basic range (pH 10-11), while in the intestine only one in an acidic pH range (pH 4-6)
was determined. The cellulase activity detected in the ontogenetic development of the shrimp was low and
unstable, a condition also reported in the comparative analysis of digestive enzymes in four other species
of crustaceans. The relative activity of the two enzymes is similar in the hepatopancreas and each of these
have an activity four times greater than that found in the intestine. These results suggest the presence of two
possible cellulases, one could be transported from the hepatopancreas into the intestine but more tests are
needed to get more conclusive results. The cellulase activity at basic pH (10.5) may be a cellulase produced
endogenously by the shrimp. The data reported in this study of enzyme production capabilities shrimp can
be the basis for future research projects aimed at optimizing procedures shrimp farming.

KEYWORDS: Celullases, crustacean digestión, Ecuador, Litopenaeus vannamei

INTRODUCCIÓN anaeróbicos, producen complejos multienzimáticos


extracelulares que se encargan de la hidrólisis de la
En los últimos 20 años el progreso en la ingeniería celulosa (Ohara et al., 2000; Calderón-Cortés et al.,
genética de las enzimas y la tecnología de 2012; Tanimura et al., 2012; Tuyub-Tzuc et al., 2014).
fermentación, han permitido el desarrollo de
aplicaciones enzimáticas en las áreas industriales Para intentar consensuar esta difícil actividad
que van desde la fabricación de detergentes más la Internacional Union of Biochemistry and
eficientes y amigables con el ambiente, hasta Molecular Biology (1992) sugiere que la hidrólisis
aplicaciones en la industria textil, del cuero, de de los complejos celulósicos empiezan a degradarse
alimentos, cosméticos, productos médicos y por acción de las endoglucanasas que rompen
también como herramientas para proyectos de los enlaces 1,4-β-glucosídicos lo cual reduce
investigación (Galante y Formantici, 2003). Esto ha significativamente el grado de polimerización de
llevado a que el gasto en la utilización de enzimas la celulosa permitiendo que nuevos extremos de
se cotice en varios millones de dólares a nivel cadenas queden expuestos y faciliten el acceso para
mundial y que los proyectos de investigación en las exo-celobiasas que dan origen a unidades del
busca de nuevas enzimas aptas para ser utilizadas disacárido celobiosa, el cual será hidrolizado por la
en la industria se multipliquen (Beilen y Li, 2002). enzima celobiasa originando moléculas unitarias
de glucosa (Hui et al., 2002).
Las celulasas han sido clasificadas en:
endoglucanasas, que se encargan de la destrucción La celulosa es utilizada como una fuente
de los enlaces 1,4-β –glucosídicos actuando en la nutricional por varios organismos, inicialmente
hidrólisis en el interior de la cadena; luego están las se pensaba que únicamente microorganismos
exo-celobiosas que son exoglucanasas, encargadas podrían degradarla pero en la actualidad se
de hidrolizar los enlaces 1,4- β- glucosidicos, ha encontrado celulasas en varios grupos de
liberando celobiosa desde los extremos no animales. La tasa de absorción de nutrientes se
reducidos de la cadena de la celulosa; y celobiosas basa en la tasa del contacto de los nutrientes con
conocidas también como β-glucosidasas, que el epitelio intestinal. La inclusión de fibra en la
catalizan la hidrólisis del disacárido celobiosa dieta, como en el caso de celulosa, está asociada
liberando a las glucosas (Henrissat, 1991; Lo Leggio con mayor tiempo de permanencia del alimento
y Larsen, 2001; Byrne et al.,1999). en el estómago lo que contribuye a la utilización
eficiente de proteína (Velurtas et al., 2011). De ahí,
La hidrólisis de la celulosa se lleva a cabo de que la formulación de cualquier dieta requiere de
diferente manera según la especie. En el caso de una información detallada de los requerimientos
algunos microorganismos aeróbicos se produce nutricionales y capacidades digestivas de las
una combinación de endo y exo- glucanasas, especies. Los perfiles de actividad de las enzimas
que si bien atacan al sustrato individualmente digestivas han sido utilizados para determinar las
poseen una acción de sinergia entre ellas. Al necesidades nutricionales de los crustáceos.
mismo tiempo se ha visto que algunos organismos

REMCB 36 (2), 2015


39

Las enzimas celulasas se encuentran en una amplia intestinos y hepatopáncreas mediante una incisión
gama de invertebrados como anélidos, moluscos, en la parte dorsal del animal. Dichas muestras
equinodermos y artrópodos (Crawford et al., 2004). fueron transportadas a 4° C hasta el Laboratorio
Se ha demostrado que algunos invertebrados de Biotecnología de la PUCE-Quito para los
son capaces de degradar celulosa, celulasas análisis respectivos.
microbianas pueden estar contribuyendo a los
niveles de actividad enzimática observados en el En el caso de los subestadios larvarios, estos fueron
sistema digestivo (Nakashima et al., 2002). En la recolectados en laboratorios de cría de camarón
última década se ha generado información sobre en la provincia de Santa Elena. Los subestadios
la presencia de celulasas en invertebrados, aunque colectados fueron: Zoea 1, 2 y 3; Mysis 1, 2 y 3; y pos-
en su mayoría atribuida a microorganismos larva 1, 2 y 6. Los subestadios se clasifican según los
simbiontes presentes en los tractos digestivos. días desde la eclosión del nauplio (Fao, 2006), y con
Fueron Watanabe et al. (1998) quienes reportaron esta base fueron clasificados por los laboratorios de
por primera vez la producción de una celulasa cría de camarón que proveyeron las muestras.
endógeno en Reticulitermes speratus Kolbe
(Isoptera: Rhinotermitidae) y posteriormente Preparación de los homogeneizados de
ha habido otras investigaciones que han hepatopáncreas e intestinos.- El hepatopáncreas
reportado celulasas endógenas en los órdenes fue homogeneizado con agua destilada a 4
Blattaria, Coleoptera, Hymenoptera, Hemiptera, grados centígrados en el laboratorio, se utilizó un
Phthiraptera, and Orthoptera (Watanabe y homogeneizador Braun-Melsungen de 5 mL de
Tokuda, 2010). Una distinción importante es que capacidad con punta de teflón. Para extraer la grasa
las celulasas endógenas de insectos se clasifican del hepatopáncreas se procedió a dos procesos
como endoglucanasas, la mayoría de la familia de sucesivos de centrifugación (el primero a 12 000 rpm
la glicosil hidrolasas 9 (GHF9), mientras que las por 20 min, seguido por 3 000 rpm durante 20 min)
celulasas de origen microbiano reportadas son endo mediante una centrífuga refrigerada Sorvall RC-5b
y exo- glucanasas y corresponden a otras familias (Lee et al., 1990). La grasa fue desechada y se extrajo
de GHF (Watanabe y Tokuda, 2010). Actividad de el sobrenadante, llevándola a una concentración de
celulosas ha sido detectada en langostas, cangrejos 4 animales/mL. De igual manera, los intestinos
y cangrejos de río (Pavasovic et al., 2004). Directa fueron homogeneizados (Ultra-Turvax T25) y
evidencia de una secreción endógena de celulasa filtrados por una malla de nylon con un poro de 250
en un crustáceo ha sido demostrada gracias a micras. La solución fue diluida hasta llegar a una
estudios moleculares en el cangrejo rojo (Cherax concentración final de 6 animales/mL.
quadricarinatus) y la presencia de una secuencia
de cDNA de endo-1-4-β-glucanasa que se reporta Preparación de los homogeneizados de los
en el hepatopáncreas de este artrópodo (Byrne et subestadios.- Las muestras de los diferentes
al.,1999; Tanimura et al., 2012). subestadios de Litopenaeus vannamei se
homogeneizaron sobre hielo, en 16 mL de agua
En este trabajo, presentamos la identificación y destilada enfriada a 4° C, en un homogeneizador
caracterización preliminar de las celulasas del Braun-Melsungen. Debido al reducido tamaño
camarón Litopenaeus vannameien sus estadios de los animales en los diferentes subestadios
larvario y adulto. se homogenizó el animal completo (aprox. 400-
3 500 μm) (Rodgers et al., 2013). Los diferentes
MATERIALES Y MÉTODOS homogeneizados se filtraron a través de una malla
de nailon con un poro de 250 micras. De esta
Obtención de la muestra.- En los ensayos se manera se obtuvo un preparado inicial, para cada
utilizaron camarones adultos y de los diferentes estadio, con una concentración de 40 a 50 animales/
subestadios de L. vannamei colectados en los mL, que se congeló a -20° C en alícuotas de 6 mL. El
estanques de cría de las camaroneras de la Península homogeneizado inicial se diluyó hasta 5 veces según
de Santa Elena y Muisne, en las provincias de Santa la actividad enzimática en los diferentes estadios.
Elena y Esmeraldas respectivamente.
Cuantificación de proteína total.- La cuantificación
En el caso de los adultos, se seleccionaron de proteína total en las muestras analizadas se la
especímenes con un promedio de 8.0 a 10.0 gramos realizó siguiendo el método de Bradford (1976), que
de peso corporal, con una curva de crecimiento utiliza albúmina de huevo como muestra estándar
de 1.0 g/semana, que fueron alimentados con un y métodos colorimétricos. Para preparar la proteína
balanceado compuesto de 36 % de proteína. patrón se disolvieron 6 mg de ovoalbúmina en 3
mL de agua destilada; esta solución de proteína
En el lugar de recolección se extrajeron los se diluyó diez veces. El colorante se preparó

Celulasas en el camarón Litopenaeus vannamei


Segovia et al.
40

disolviendo completamente 10 mg de azul de 30 g de tartarato de sodio y se aforó a 100 mL. La


Coomassie G en 5 mL de metanol, se añadieron 10 actividad de la celulasa se determina en función de
mL de ácido ortofosfórico (H3PO4) 85 % y se aforó a la cantidad de los grupos reductores liberados, la
100 mL con agua destilada. A cada tubo se le añadió coloración será más intensa mientras mayor sea la
1 mL de colorante y después de 5 minutos se midió actividad hidrolítica, y por lo tanto la absorbancia
la absorbancia contra un blanco de agua (100 μL) detectada por espectrofotometría será mayor
sometido al mismo procedimiento anterior con (Espinoza - Fuentes et al., 1984).
la utilización de un espectofotómetro Milton-Roy
Spectronic 301 (Absorbancia 595 nm). Una vez determinados los valores de pH en los
cuales la absorbancia era mayor y por lo tanto el pH
Determinación del ph óptimo de celulasas y óptimo para la actividad hidrolítica de la enzima,
cuantificación de la actividad enzimática.- En se procedió a cuantificar la actividad enzimática
el caso de los adultos y los subestadios previo relativa expresada en términos de mUnidades
a la determinación de la actividad enzimática (mU/animal). Una unidad de enzima es la
se determinó el pH óptimo al cual la actividad cantidad de enzima que hidroliza una nanomol de
hidrolítica de la celulasa fue más evidente. Cada sustrato por minuto.
ensayo se realizó en triplicado en un rango de pH
de 4.0 a 10.0, tomando intervalos de 0.5 unidades en La concentración de enzima presente en las
el caso de los subestadios y adultos, en este último muestras ensayadas se obtuvo relacionando la
se amplió el rango básico hasta 11.0. Los valores de pendiente de cada ensayo con el factor de absorción
pH en el rango de pH se lograron usando diferentes del sustrato, la cantidad de enzima utilizada en mL
tampones comunmente utilizados: citrato-fosfato y el factor de dilución de la muestra para obtener
(pH 4.0-6.5), fosfato (pH 7.0-8.5) y glicina-NaOH la actividad enzimática relativa en mU/mL. Una
(pH 10.5-11). La concentración final de los tampones vez cuantificada la cantidad de proteína para cada
fue de 0.05 M (Espinoza-Fuentes et al., 1984). muestra de extracto, la actividad específica (mU/
mg) se obtiene del cociente entre la actividad
Se utilizó como sustrato carboximetil-celulosa relativa (mU/animal) y la concentración de proteína
(CMC) de mediana viscosidad con una concentración total (mg/animal). Los ensayos de actividad
final de 0.5 %. Los tubos de reacción constaban, en enzimática se realizaron en el pH determinando
el caso de los adultos, de 0.2 mL de sustrato, 0.2 para cada muestra y se utilizó CMC como sustrato,
mL de tampón (0.2 M) a diferente pH (4.0-11.0) y tampón al pH óptimo y el extracto enzimático de
0.4 mL de extracto enzimático (hepatopáncreas hepatopáncreas, intestino o del subestadio larvario.
e intestino). En el caso de los subestadios, las Se utilizaron blancos de sustratos (sin extracto
mezclas de reacción fueron de 0.5 ml de sustrato, enzimático) y de enzima (sin sustrato) a los cuales
0.5 mL de tampón 0.2 M a diferente pH y 0.2 mL de se sometió al mismo tratamiento. Cada ensayo se
extracto enzimático (homogeneizado de camarón). realizó por triplicado.
Los tubos fueron incubados en un baño maría a 30
grados centígrados por 30, 60, 90 y 120 minutos. Actividad enzimática en camarones vivos adultos
Para detener la reacción enzimática se adicionaron en presencia de antibióticos.- Únicamente para
0.4 ml de ácido 3.5 dinitrosalicílico (DNS), se agitó la los camarones vivos adultos se realizaron ensayos
solución y se lo llevó inmediatamente a ebullición. con (67) camarones vivos con un peso entre 8 y 10
Los tubos fueron enfriados hasta temperatura g para eliminar la presencia de microorganismos
ambiente, se añadieron 0.4 mL de agua destilada en productores de celulasa. Los especímenes fueron
el caso de los subestadios larvarios y 0.4 mL en el colectados y posteriormente transportados en
caso de los adultos y se procedió a la cuantificación agua de mar para su cultivo en el Laboratorio de
por espectrofotometría. Para los ensayos se Biotecnología de la Pontificia Universidad Católica
establecieron muestras blancos en las cuales el del Ecuador. Los camarones se mantuvieron en
volumen correspondiente al extracto enzimático se peceras de 40 litros de agua con salinidad del 3 %,
remplazó por el mismo volumen de agua destilada. a una temperatura de 22° C y aireación constante.
La absorbancia de las muestras se midió mediante La alimentación usada fue balanceado comercial
espectrofotometría a 540 nm contra una muestra con 36 % de proteína. En el tiempo cero del ensayo
blanco de agua destilada sometida al mismo se sacrificaron dos especímenes y se cuantificó
tratamiento (Espinoza - Fuentes et al., 1984). la presencia de celulasa en el hepatopáncreas.
Para descartar o evidenciar la presencia de
En la preparación del ácido 3-5 dinitro-salicílico crecimiento microbiano se sembraron muestras de
se disolvió 1 g de ácido 3-5 dinitro-salicílico en hepatopáncreas en agar nutriente, medio selectivo
20 mL de hidróxido de sodio (NaOH) 2 N; se para Pseudomonas, TCBS (medio selectivo para
añadieron 50 mL de agua destilada para lograr una Vibrio), Cetrimide (selectivo para Pseudomonas),
buena disolución. Inmediatamente se añadieron Caseina Peptina y Sauboraud 2 % de glucosa

REMCB 36 (2), 2015


41

(hongos) y se los evaluó. A todos los medios se les celulasa en los homogeneizados debido a un
adicionó 3 % de sal (NaCl). comportamiento irregular de la enzima en los
ensayos en todos los estadios larvarios ensayados.
Determinación de dosis de antimicrobianos.- Para establecer la actividad en función del pH, se
Para eliminar en lo posible a los microorganismos eligió el estadio en el cual su actividad fue estable
presentes en el cultivo del camarón y que podrían y regular para la realización de los ensayos, en este
estar contribuyendo a la actividad de celulasa caso el subestadio zoea 3. En este subestadio se
identificada, se realizaron pruebas de sensibilidad determinó que el tiempo total de incubación óptimo
con las bacterias aisladas del hepatopáncreas. Los para cuantificar la actividad fue de 240 minutos en
antimicrobianos ensayados fueron: eritromicina (30 cuatro intervalos de 60 minutos y se determinó un
mg), ácido oxalínico (10 mg) nitrofurantoína (50 rango amplio de pH - entre pH 6.5 y pH 9.5 - en
mg), cloranfenicol (50 mg), tetraciclina (30 mg) y el cual se evidenció actividad celulásica (Figura 1).
sulfatrimetroprim (25 mg). El nivel de sensibilidad
se basó en la medición de halos de inhibición de
crecimiento bacteriano alrededor del disco de
antibiograma bajo el método de Bauer-Kirby (1966).

A partir de los resultados de las pruebas de


sensibilidad, se realizó un control de supervivencia
con un individuo, al cual se le colocó en una pecera
con 50 ppm del antimicrobiano de mayor sensibilidad
y 1 mL/L de albendanzol (antiprotozoo). Se repitió
la dosis cada seis horas en el caso de los antibióticos
y una vez al día con el albendazol. Se sacrificó
al individuo y se extrajo el hepatopáncreas para
comprobar el efecto de los antimicrobianos. Figura 1. Curva de pH óptimo de la enzima celulasa en el
subestadio Zoea 3 del camarón Litopenaeus vannamei. La
Posteriormente se realizó el mismo proceso con 20 actividad de la celulasa se presenta en un rango de pH de 6 a 9.5
camarones en un período de cinco días con la misma
frecuencia la frecuencia de administración de pH óptimo de celulasas en hepatopáncreas e intestino.-
antimicrobianos y albendazol para el control. Los En las muestras de hepatopáncreas de camarón
especímenes fueron sacrificados, su hepatopáncreas adulto se determinaron dos pH óptimos: uno en
fue extraído y se llevó a una concentración final el rango ácido (pH 4-6) y otro en el rango básico
de 1.2 hepatopáncreas/mL (sin antibiótico) y 2.5 (pH 10-11), mientras que en el intestino se observó
hepatopáncreas /mL (con antibiótico). únicamente el pH ácido (pH 4-6). (Figura 2).

Este experimento se lo realizó nuevamente en


el laboratorio comercial AQUALAB S.A en la
península de Santa Elena con camarones adultos con
un promedio de 5 g con la finalidad de ensayar con
especímenes tratados previamente con probióticos
en las piscinas de crecimiento. Se utilizaron las
mismas concentraciones de antibióticos aplicadas
a los camarones en el Laboratorio de la PUCE. La
única diferencia fue el uso del quimioterapeútico
líquido Trifluralin con dosis de 10 ppm, dos veces
al día en lugar de albendazol. Los hepatopáncreas
fueron extraídos y homogeneizados según los
procedimientos anteriores con una concentración
final de 2.6 hepatopáncreas/mL (sin antibiótico) y Figura 2. Curva de pH óptimo de la enzima celulasa en el
3.1 hepatopáncreas/mL (con antibiótico). hepatopáncreas e intestino del camarón adulto Litopenaeus
vannamei
RESULTADOS
Cuantificación de la actividad enzimática.- El
pH óptimo de celulasas en homogenizado de registro de absorbancia después de los intervalos
subestadios larvarios.- Se tuvo dificultad en de incubación con las mezclas de reacción fue
determinar el pH óptimo de la actividad de irregular por lo cual, a pesar de tener evidencia de

Celulasas en el camarón Litopenaeus vannamei


Segovia et al.
42

actividad de celulasa no se cuantificó la actividad DISCUSIÓN


relativa de la celulasa en los estadios larvarios. El
subestadio en el cual se evidenció mayor estabilidad La nutrición de los organismos marinos es esencial
de la actividad fue el subestadio zoea 3. En todos para una acuacultura rentable, por lo cual los
los ensayos la actividad de la enzima fue baja. tipos y las propiedades de las enzimas digestivas
del camarón definen las capacidades digestivas
Los datos de cuantificación de actividad enzimática y por tanto sugieren los ingredientes que deben
de las muestras en sus pH óptimos se reportan ser incluidos en las dietas para reproducir las
en la tabla 1. La actividad relativa (mU/animal) condiciones de la alimentación de los crustáceos en
nos indica que la actividad de las dos especies condiciones naturales. Sin embargo, el proceso de
enzimáticas (pH 5 y pH 10)) en el hepatopáncreas elaboración de dietas, en la mayoría de los casos,
es similar, indicando que las dos podrían ser no ha incluido información sobre las condiciones
producidas en este órgano; la actividad de la fisiológicas y bioquímicas del camarón (Narváez-
especie enzimática del intestino es tres veces menor Trujillo, 1990). Las especies de camarones son
a las del hepatopáncreas. Al determinar la actividad omnívoros con amplias capacidades bioquímicas
en función de la cantidad de proteína presente para poder degradar las fuentes de energía de su
en la muestra (actividad específica) se observa ambiente natural. El principal recurso energético
una mayor actividad de la enzima en el intestino de este crustáceo es la proteína seguido por
que las dos presentes en el hepatopáncreas. Esto los carbohidratos como energía metabólica.
sugiere que en el intestino la actividad detectada Adicionalmente necesita lípidos como elementos
podría ser la suma de la actividad de la enzima del fundamentales en la función y estructura celular
hepatopáncreas (pH 5) que viaja al intestino y la (Gaxiola et al., 2006).
actividad celulásica del aporte de microorganismos
asociados al intestino. Esta observación se respalda Los metazoos son capaces de digerir la celulosa
por los ensayos realizados con el camarón cultivado gracias a la presencia de microorganismos
en el Laboratorio de Biotecnología de la PUCE simbiontes (bacterias, hongos y protozoos) que
como en el laboratorio comercial en la Península proporcionan a sus hospederos habilidades
de Santa Elena, en los cuales la actividad específica digestivas adicionales (Hood, 1971; Cutter y
de la celulasa es mayor en las muestras tratadas Rosenberg, 1971; Mangrove, 1988; Byrne et al.,
con antimicrobianos con relación a las muestras 1999). El modelo enzimático más conocido se
no tratadas, lo cual indica que sí hay un aporte de basa en el sistema de hongos donde se demuestra
parte de microorganismos asociados en cuanto a la su complejidad basada en acciones poligénicas,
actividad de celulasa en el camarón. conjuntos multienzimáticos y estructuras mixtas
formadas entre celulasas y proteínas, glicoproteínas
Análisis microbianos.- Después de 24 horas o polisacáridos (Eveleigh, 1987).
de cultivo se observó crecimiento bacteriano en
Agar nutriente, cetrimide, TCBS agar, y en el agar En el caso de crustáceos, el proceso digestivo se lleva
selectivo para Pseudomonas. En los antibiogramas, a cabo en el hepatopáncreas y en el intestino medio
los antibióticos de mayor sensibilidad fueron con funciones y actividades diferentes en dichos
nitrofurantoína y ácido oxalínico. órganos. La celulasa actúa en la digestión primaria

Tabla 1. Actividad relativa (mU/animal) y específica (mU/mg) de celulasas en las muestras de adulto analizadas*

MUESTRAS mU/Animal mU/mg


Muestras sin tratamiento
Hepatopáncreas (pH 5) 30.5±2.8 5.9
Hepatopáncreas (pH 10.5) 33.3±5.0 6.4
Intestino (pH 5) 8.3±0.6 8.9
Muestras tratadas en el Laboratorio de Biotecnología
Hepatopáncreas con tratamiento antimicrobiano 88.8±13.4 12.5
Hepatopáncreas sin tratamiento antimicrobiano 140.9±6.0 34.9
Muestras tratadas en las Camaroneras de Sta. Elena
Hepatopáncreas con tratamiento antimicrobiano 11.0±2.0 1.9
Hepatopáncreas sin tratamiento antimicrobiano 25.2±0.5 2.8
*Se reporta la media de tres determinaciones.

REMCB 36 (2), 2015


43

iniciando su actividad en el hepatopáncreas para tratados con antimicrobianos, antifúngicos y


posteriormente volver a activarse en el intestino antiprotozoarios disminuyó en relación a las
medio. En insectos se ha propuesto una recirculación muestras no tratadas (Tabla 1) apoyando la
de enzimas que puede ser aplicado también a los hipótesis que la celulasa activa a pH ácidos (pH 4-6)
crustáceos (Espinoza-Fuentes et al., 1984) puede tener un origen fúngico o microbiano. Estos
resultados concuerdan con los datos de bacterias
La actividad celulolítica detectada en el desarrollo aisladas del tracto digestivo de Penaeus aztecus que
ontogénetico del camarón fue baja e inestable, describen a una o más celulasas junto con lipasas,
una condición reportada también en el análisis amilasas y quitinasas (Dempsey y Kitting, 1987).
comparativo de enzimas digestivas en cuatro Esta capacidad multienzimática sugiere un alto
especies de crustáceos incluyendo dos especies de potencial de degradación por parte de estas colonias
Penaeus realizada por Luqing (1997). A pesar de microbianas. Pero su funcionalidad va a estar
evidenciar actividad celulolítica, la inestabilidad en restringida a las condiciones ambientales del tracto
la actividad a lo largo del tiempo de desarrollo de los digestivo (pH, niveles de oxígeno, disponibilidad
ensayos y la baja actividad observada no permitió de nutrientes (Tuyub-Tzuc et al., 2014).
cuantificar la actividad relativa. El pH óptimo
determinado en el rango de 6.5 a 9.5 sugiere que En el caso de la celulasa con actividad a pH básico
puede haber una mezcla heterogénea de enzimas (10.5) puede tratarse de una celulasa producida de
por un origen múltiple de los extractos obtenidos manera endógena por el camarón. Estos datos son
considerando que en los tanques de cultivo hay apoyados por lo encontrado por Byrne et al. (1999)
larvas provenientes de nauplios desovados a partir que identificó el cDNA de una endo-1,4-beta-
de diferentes hembras ovadas; por otro lado, este glucanasa de 469 aminoácidos, denominada CqEG,
amplio rango de pH observado puede indicar la generada en el hepatopáncreas del crustáceo Cherax
presencia de enzimas producidas por la larva y/o quadricarinatus. Este gen es similar en estructura a
por microorganismos asociados, a pesar del uso los encontrados en los genes de endoglucanasas
y aplicación de antibióticos en los tanques de cría funcionales de cucarachas y termitas (Watanabe y
(Narváez-Trujillo, 1990). Tokuda, 2001). Estudios de comparación genética
han identificado a estos genes pertenecientes a la
En el caso del adulto, se encontró actividad familia de glicosil hidrolasas (GFH) 9 celulasas
enzimática para celulasas a dos pHs: 5.0 y 10.5 en el (Byrne et al., 1999) similares a los encontrados en
hepatopáncreas y de pH 5.0 en el intestino (Segovia- termitas lo cual sugiere un origen común entre las
Salcedo, 1996). La actividad relativa (mU/animal) células de insecto con la de crustáceos. Es posible
de las dos enzimas del hepatopáncreas es similar que las enzimas de celulasas hayan evolucionado
y cada una de estas tienen una actividad tres en diferentes linajes de los crustáceos en relación
veces mayor a la encontrada en el intestino. Estos con sus preferencias alimenticias principalmente
resultados sugieren la presencia de dos posibles en los herbívoros (Crawford et al., 2004).
celulasas, una de ellas podría ser transportada
desde el hepatopáncreas al intestino. Los datos Las evidencias observadas en este estudio favorecen
de actividad de celulasa con un rango ácido la combinación de enzimas celulósicas endógenas
concuerdan con lo observado en estadio larvario y simbióticas para la digestión de la pared celular
(Narváez-Trujillo, 1990). Una alternativa a esta vegetal en L. vannamei. La participación cooperativa
interpretación es que hay la producción de una de celulasas de diferentes fuentes (simbiontes
celulasa en el hepatopáncreas que tiene dos rangos y hospederos) con diferentes características
de pH para su actividad, en este caso aún se sostiene enzimáticas proveen de un mecanismo exitoso de
la posibilidad que la enzima del hepatopáncreas se digestión de dietas ricas en celulosa (Tanimura et al.,
movilice al intestino y actúe a un pH más ácido que 2012). De igual manera debemos tomar en cuenta
la del hepatopáncreas. En ninguno de los dos casos que la composición de la flora bacteriana varía con
se invalida la participación de actividad celulásica la dieta ya que un porcentaje de microorganismos
por parte de microorganismos asociados como ingresan al tracto digestivo con la comida. De ahí,
sucede en otros crustáceos (Zimmer et al., 2002). la importancia de estudios más profundos sobre la
comunidad microbiana permanente y la itinerante
Celulasas de origen fúngico y microbiano presentan asociada al camarón y las capacidades enzimáticas
actividad enzimática dentro de los rangos de cada una de ellas. Este estudio no descarta la
encontrados en el intestino (pH 5) (Wang et al., 1994; posibilidad que las fuentes de celulasas no sean
Guillén et al., 1987; Kaya et al., 1994; Copa-Patiño et efectivamente de microorganismos resistentes a los
al., 1987; Espinoza-Fuentes et al., 1984; Tuyub-Tzuc antimicrobianos utilizados.
et al., 2014). Adicionalmente, la actividad enzimática
de los extractos provenientes de los organismos

Celulasas en el camarón Litopenaeus vannamei


Segovia et al.
44

Los datos reportados en este estudio sobre Dempsey A y Kitting C. 1987. Characteristics
las capacidades de producción enzimática del of bacteria isolated from penaid shrimp.
camarón pueden ser la base para futuros proyectos Crustaceana, 52:90-94.
de investigación cuyo objetivo sea optimizar
los procedimientos de cultivo de camarón. La Espinoza-Fuentes F, Ferreira C y Terra W. 1984.
identificación de altos niveles de actividades Spatial organization of digestion in the larval
de carbohidrasas como las celulasas sugiere la and imaginal stages of the Sciarid fly, Trichosia
presencia de materiales vegetales en la dieta pubescens. Insect Biochemistry, 14(6):631-638.
de L. vannamei, lo cual está relacionado con la
presencia de algas como fuente alimenticia en estos Espinoza-Fuentes F y Terra W. 1986. Properties of
invertebrados filtradores. Estudios específicos larval and imaginal membrane-bound digestive
son necesarios para definir formulación de dietas enzymes from Trichosia pubescens. Archives of
específicas para el camarón considerando tanto Insect Biochemistry and Physiology, 3:181-192.
la microbiota como las enzimas endógenas del
sistema digestivo. Futuras investigaciones en estas Fao. 2006. Cultured Aquatic Species Information
áreas pueden reducir los costos de producción y Programme. Penaeus vannamei. Cultured
mejorar los niveles de digestión de las dietas. Aquatic Species Information Programme. Text
by Briggs, M. In: FAO Fisheries and Aquaculture
REFERENCIAS BIBLIOGRÁFICAS Department [online]. Rome. Updated 7 April
2006. [Cited 29 July 2015]. http://www.
Bauer AW, Kirby WMM, Sherris JC y Turck M.  fao.org/fishery/culturedspecies/Penaeus_
1966. Antibiotic susceptibility testing by a vannamei/en
standardized single disk method. American
Journal of Clinical Pathology,  36:493-496. Galante YM y Formantici C. 2003. Enzyme
Application in Detergency and in
Beilen JB y Li Z. 2002. Enzyme Technology: an Manufacturing Industries. Current Organic
overview. Current Opinion in Biotechnology, 13, Chemistry, 7:1399-1422.
338-344.
Gaxiola G, Rosas C, Arena L y Cuzón G. 2006.
Bradford M. 1976. A Rapid and sensitive method Requerimiento de carbohidratos. En: Rosas
for the quantification of microgram quantitites C. Carrillo O. Wilson R. Andreatta ER (eds)
of protein utilizing the principle of protein-dye Estado actual y perspectivas de la nutrición
binding. Analytic Biochemistry, 72:248-254. de los camarones peneidos en Iberoamèrica.
Mèxico DF, pp 143-153.
Byrne KA, Lehnert SA, Johnson SE y Moore SS.
1999. Isolation of a cDNA encoding a putative Guillén F, Reyes F, Rodríguez J y Vásquez C. 1987.
cellulose in the red claw crayfish Cherax Induction of an extracelular cellulase system
quadricarinatus. Gene, 239: 317-324. during autolysis of Alternaria alternata. Transaction
of British Mycology Society, 89(1):35-39.
Copa-Patiño JL, Monistrol Y, Laborada F y Pérez-Lebic.
1987. Characterization of 1,3 Beta-Glucanasas Henrissat B. 1991. A classification of glycosyl
poroduced during autolisis of Penicilllium hydrolases based on amino acid sequence
oxalicum in different culture media. Transaction of similarities. Biochemistry Journal, 280:309-316.
British Mycology Society, 88(3):317-321.
Hood M, Meyer P y Colmer A. 1971. Bacteria of
Crawford AC, Kricker JA, Anderson AJ, Richardson the digestive tract of the white shrimp Penaus
NR y Mather PB. 2004. Structure and function setferusi. Bacteriology Proceedings, 71:48.
of a cellulose gene in redclaw crayfish Cherax
quadricarinatus. Gene, 340: 267-274. Hui JPM, White TC y Thibault P. 2002. Identification
of glycan structure and glycosylation sites in
Cutter MF y Rosenber F. 191. The role of cellulolytic cellobiohydrolase II and endoglucanase I and II
bacteria in the digestive process of the from Trichoderma ressei. Glycobiology, 12:837-849.
shipworm. II. Isolation and some properties of
marine bacterial cellulose. Marine Organisms, Kaya F, Heitmann J y Joyce T. 1994. Cellulase
7:225-229. binding to cellulose fibers in high shear fields.
Journal of Biotechnology, 36:1-10.

REMCB 36 (2), 2015


45

Lo Leggio L y Larsen S. 2002. The 1.62 A structure Segovia-Salcedo MC. 1996. Celulasas presentes
of Thermoascus aurantiacus endoglucanase: en el Intestino Medio y el Hepatopáncreas
completing the structural picture of subfamilies de Penaeus vannamei cultivado en la Costa
in glycoside hydrolase family 5. FEBS Letters, Ecuatoriana. Tesis de Licenciatura en Ciencias
523:103-108. Biológicas, Pontificia Universidad Católica del
Ecuador. Quito, Ecuador.
Luqing P. 1997. Comparative studies on digestive
enzyme activities during larval development Tanimura A, Liu W, Yamada K, Kishida T y Toyohara
of four species of shrimps and crabs. Journal of H. 2012. Animal Cellulases with a focus on
Ocean University of Qingdao, 3. aquatic invertebrates. Fisheries Sciences, 79:1-13.

Mangrove R. 1998. Digestive ability of freshwater Tuyub-Tzuc J, Rendìz-Escalante D, Rojas-


crayfish Paranephrops zealandicus (White) Herrera R, Gaxiola Cortés G y Arena-Ortiz
(parastacidae) and the role of microbial MA. 2014. Microbiata from Litopenaeus
enzymes. Freshwater Biology, 20:305-314. vannmaei:digestive tract microbial community
of Pacific White shrimp (Litopenaeus vannamei).
Marín Alvarado RM. 2007. Caracterización y Springer Plus, 3:280.
Expresión Recombinante de una Celulasa
de Origen Antártico. Universidad de Chile. Velurtas SM, Díaz AC, Fernández-Giménez AN y
Facultad de Ciencias Físicas y Matemáticas. Fenucci JL. 2011. Influence of dietary starch
and cellulose levels on the metabolic profile
Nakashima K, Watanabe H, Saitoh H, Tokuda G and apparent digestibility in penaeoid shrimp.
y Azuma JI. 2002. Dual cellulose-digestive Latin American Journal of Aquatic Research, 39(2)
systemof the wood-feeding termite Coptotermes 214-222.
formosanus Shikari. Insect Biochemistry and
Molecular Biology, 32:777-784. Wang YL, Cracker L y Zhongyuan M. 1994.
Purification and characterization of cellulose
Narváez-Trujillo A. 1990. Identificación y from leaf absicion zones of coleus. Plant
cuantificación de la enzima tripsina, Physiology Biochemistry, 32(4): 467-472.
aminopeptidasa y amilasa responsables de
la digestión primaria en el camarón (Penaeus Watanabe H y Tokuda G. 2010. Cellulolytic systems in
vannamei), cultivado en los laboratorios de insects. Annual Review of Entomology, 55:609–632.
producción de lava en la provincia de Guayas,
Ecuador. Tesis de Licenciatura en Ciencias Watanabe H, Noda H, Tokuda G y Lo N. 1998.
Biológicas, Pontificia Universidad Católica del A cellulase gene of termite origin. Nature,
Ecuador. Quito, Ecuador. 394:330–331.

Ohara H, Noguchi J, Karita S, Kimura T, Sakka K y Zimmer M, Danko JP, Pennings SC, Danford AR,
Ohmiya K. 2000.Sequence of eg Vand Properties Carefoot TH, Ziegler A y Uglow RF. 2002.
of Eg V, a Ruminococcus albus Endoglucanase Cellulose digestion and phenol oxidation in
Containing a Dockering Domain. Bioscience, coastal isopods (Crustacea:Isopoda). Marine
Biotechnology and Biochemisty, 64:80-88. Biology, 140:1207-1213.

Pvasovic M, Richardson NA, Anderson AJ, Mann


D y Mather PB. 2004. Effect of pH, temperature
and diet on digestive profiles in the mud crab,
Scylla serrata. Aquacultura, 242:641-654.

Rodgers GC, Roberts SD y Dixon CD. 2013. The


effects of temperature on larval size in the
western king prawn, Peaneus (Melicertus)
latisulcatus Kishinouye, from Spencer Gulf,
South Australia: implications for fishery
management. Marine and Freshwater Research,
64:976-985.

Celulasas en el camarón Litopenaeus vannamei


Segovia et al.
46

REMCB 36 (2), 2015


47

Tratamiento de un efluente derivado de una planta


procesadora de pieles para extracción de gelatina
mediante la tecnología de ficorremediación
Diana Ontaneda Andrade1, Mabel Cadena Zumárraga2, Ana González 2,
Ever Morales Avendaño3*
1
Facultad de Ciencias Médicas, Universidad Central del Ecuador.

2
Departamento de Ciencias de la Vida y Agricultura, Universidad de las Fuerzas Armadas-ESPE.

3
Proyecto Becas Prometeo-SENESCYT. evermster@gmail.com

Recibido: 2015-08-02; aceptado: 2015-09-03

RESUMEN.- Entre las alternativas de tratamiento biológico de aguas residuales de curtiembres, se


propone la ficorremediación para la reducción de la carga contaminante del efluente y producción de
biomasa microalgal. Se evaluó la eficiencia de remoción de N, P, DQO, DBO5, SO4-2 y sólidos en un efluente
de curtiembre derivado del procesamiento de pieles para extracción de gelatina, mediante un consorcio
con las microalgas Desmodesmus sp. y Chlorella sp. Para dicho estudio se aplicó un diseño experimental de
bloques al azar. Dicho experimento se realizó en contenedores con 15.0 L del efluente (50 %) inoculado con
dicho consorcio a una densidad celular de 0.70 x106 cel.ml-1. Mientras que, en el control solo contuvo el
efluente. Ambos tratamientos, con 5 repeticiones fueron mantenidos en condiciones externas de laboratorio
en cuanto a iluminación solar y temperatura durante 25 días. El efluente inicial presentó una concentración
de sulfatos, DBO5, DQO, P y N de 570 mg.l-1, 6 200 mg.l-1, 11 825 mg.l-1, 4.9 y 612 mg.l-1; respectivamente.
En el tratamiento con el consorcio se alcanzó el crecimiento más elevado de 14.0 x106 cel.mL-1 a los 18 días.
No hubo diferencia significativa entre el control y el efluente con el consorcio en cuanto a la remoción
de sulfatos, DQO, P y N, cuyos máximos se produjeron entre 78 % y 89 % a los 15 días de realizado el
experimento. La biomasa microalgal obtenida al final del experimento, reportó un 8.45 %; 21.0 %; 6.68 %;
32.23 %; 7.75 % y 23.89 % de humedad, proteína, grasa, cenizas, fibra y carbohidratos, respectivamente.
Ambos tratamientos fueron efectivos para la remoción de contaminantes del efluente. No obstante, con la
aplicación de la tecnología de la ficorremediación se genera adicionalmente biomasa microalgal con una
excelente calidad nutricional para ser utilizada como complemento alimenticio animal.

PALABRAS CLAVES: biomasa, consorcio microalgal, curtiembre, DBO5, ficorremediación.


ABSTRACT.- Among the alternatives for biological treatment of tannery wastewater, the
phycoremediation for reducing the pollution load of the effluent and microalgal biomass production it is
proposed. The removal efficiency of N, P, COD, BOD 5, SO4-2 and solids in tannery effluent derived from
fur processing to extract jelly, through a consortium with Desmodesmus sp. and Chlorella sp. microalgae
was evaluated. The study was applied to an experimental randomized block design. This experiment was
carried out in containers with effluent 15.0 L (50 %) inoculated with the consortium to a cell density of 0.70
x106 cel.ml-1. While in control only contained the effluent. Both treatments, with 5 replicates were kept in
conditions outside laboratory for solar lighting and temperature for 25 days. The initial effluent presented
a concentration of sulfates, BOD 5, COD, P and N of 570 mg l-1, 6 200 mg.l-1, 11 825 mg l-1, 4.9 and 612 mg l-1;
respectively. In the treatment with the highest growth consortium of 14.0 x106 cel.mL-1 was reached after
18 days. There was no significant difference between the control and the effluent with the consortium
regarding the removal of sulphates, COD, P and N, whose maximum occurred between 78 % and 89 % at
15 days carried out the experiment. The microalgal biomass obtained at the end of the experiment, reported
a 8.45 %; 21.0 %; 6.68 %; 32.23 %; 7.75 % and 23.89 % moisture, protein, fat, ash, fiber and carbohydrates,
respectively. Both treatments were effective in removing contaminants from the effluent. However, the
application of technology phycoremediation microalgal biomass is also generated with excellent nutritional
quality to be used as an animal feed supplement.
 
KEYWORDS: biomass, BOD5, microalgal consortium, phycoremediation, tannery.

Ficorremediación de un efluente de curtiembre


Ontaneda et al.
48

INTRODUCCIÓN ningún tratamiento previo, lo cual ha provocado


una gran cadena de contaminación (Muñoz,
Entre las tecnologías aplicadas en los procesos de 2011), caracterizada por la presencia de sustancias
depuración de efluentes se utilizan los tratamientos químicas orgánicas e inorgánicas provocando así,
físicos, químicos y biológicos, según de la carga una acelerada eutrofización debido al exceso de
orgánica, compuestos recalcitrantes y de la fosfatos y nitratos, incrementando la demanda
capacidad de remoción del tratamiento al cual se de oxígeno (DO) y la demanda biológica de
somete al agua (Lofrano, 2013). La ficorremediación oxígeno (DBO), causando consecuencias graves
constituye un tipo de tratamiento biológico en el en los sistemas acuáticos y en la salud humana
cual se utilizan microalgas y/o cianobacterias para (Tayupanda, 2010; Cerón, 2011). En tal sentido, se
la remoción, biotransformación y reutilización de proponen alternativas como la ficorremediación
contaminantes dentro del agua (Rawat et al., 2011; a fin de recuperar la calidad de aguas residuales
Kotteswari et al., 2012; Bhatnagar y Kumari, 2013). afectadas por el tratamiento con pieles de bovinos.
Asimismo, se caracteriza por presentar ventajas En el presente trabajo, se utiliza un consorcio de
sobre métodos físico-químicos convencionales; tales las microalgas Desmodesmus sp. y Chlorella sp.,
como intercambio iónico, ósmosis inversa, diálisis y para el tratamiento de aguas residuales de una
electro-diálisis, adsorción con carbón activado, y la planta procesadora de pieles para extracción de
reducción química o la oxidación, debido a su eficacia gelatina, con la finalidad de remover el exceso
de eliminación, aprovechamiento de nutrientes de N, P, DQO, DBO y sulfatos, y a la vez obtener
y el bajo costo de su aplicación y mantenimiento biomasa microalgal con factibilidad de ser
(Hanumntha et al., 2011; Olguín et al., 2013). utilizada como complemento alimenticio animal o
como fertilizante.
Las microalgas Chlamydomonas, Chlorella, Chlorococcum,
Desmodesmus, Oocystis, Oedogonium y Scenedesmus, MATERIALES Y MÉTODOS
conjuntamente con la flora bacteriana asociada
han sido utilizadas en estudios de biorremediación Área de estudio.- Los muestreos de efluentes se
de aguas residuales por su capacidad de asimilar realizaron en una curtidora ubicada en el barrio
una elevada concentración de nitrógeno, fósforo y Totoras, parroquia de Cevallos, provincia de
reducir la DQO y DBO5, a partir de efluentes urbanos, Tungurahua, Ecuador y comprendida entre las
porcinos, de plantas procesadoras de alimentos, coordenadas 1°21´16,52” S y 78° 36´56,84” E y a una
textileras, extractoras de aceite de palma, curtiembres altura de 2 984 msnm. Las muestras del efluente
(Sivasubramanian et al., 2014; Chacón et al., 2004). fueron colectadas de forma manual en 10 envases
plásticos con volumen de seis litros procedentes
En Ecuador la mayor parte de las empresas del tambor donde se descarga el agua de las caretas
procesadoras de pieles para extracción de gelatina del ganado vacuno, con alto contenido de sulfatos
y de curtiembres para calzados y accesorios, y del sedimentador que son las aguas residuales
generan sus efluentes a cuerpos de agua, sin resultado de toda la producción de la planta

Figura 1. Esquema del diseño experimental aleatorizado de la fase de tratabilidad del efluente al 50 % (v/v) con un consorcio de las
microalgas Desmodesmus sp. y Chlorella sp. y con el control, cada uno con cinco réplicas.

REMCB 36 (2), 2015


49

procesadora de cuero para la extracción de gelatina. realizado con una mezcla de acetona: metanol (2:1)
Las muestras de 50 litros del efluente fueron y cuantificados mediante las ecuaciones propuestas
mantenidas en envases de plástico medianamente por Jeffrey y Humphrey (1980) y Strikland y Parsons
tapadas hasta su uso para el ensayo de tratabilidad. (1972) respectivamente.

Producción del consorcio microalgal.- El consorcio Análisis físico-químico de efluente.- A partir del
conformado por las microalgas Desmodesmus sp. y efluente tratado se tomaron muestras al día 0, 5,
Chlorella sp., fue previamente evaluado en la fase 10, 15, 20 y 25 de iniciada la fase de tratabilidad.
de factibilidad, destinada a evaluar la capacidad Para ello se tomaron submuestras de 250 ml
de crecimiento a las concentraciones del efluente a partir de cada uno de los cinco tratamientos
al 10, 25 y 50 % (v/v). Este experimento con un correspondientes al efluente+consorcio y al control.
volumen de tres litros fue realizado mediante un Estas fueron mezcladas para obtener 2.0 L de cada
diseño completamente al azar (DBCA) con tres tratamiento y luego centrifugadas para obtener el
tratamientos y tres repeticiones por tratamiento. sobrenadante como producto real para análisis de
Estos cultivos discontinuos fueron enriquecidos sulfatos, DBO5, DQO, Fósforo total y Nitrógeno total
con el fertilizante comercial Nitrofoska (1.0 mL-l), y y según los métodos: Hach 8025-PEE/ANNCY 28,
mantenidos con agitación manual periódicamente APHA 4500 SO4 E-PEE/ANNCY 20, APHA 5210
y sin aireación. De acuerdo con los resultados D- PEE/ANNCY23, APHA 5220 D- PEE/ANNCY
obtenidos, el consorcio logró el mayor crecimiento 03, APHA4500-P B-E- PEE/ANNCY/55, HACH
con el efluente al 50 % (v/v), por lo tanto se seleccionó 8075-PEE/ANNCY/56.
dicha concentración para el estudio de tratabilidad.
En cuanto al consorcio, este fue escalado hasta un El porcentaje de remoción fue determinado a partir
volumen de cinco litros a fin de ser utilizado como del valor inicial obtenido de cada variable con
inóculo en la prueba de tratabilidad. respecto al detectado cada cinco días hasta finalizar
con el día 25 (Romero et al., 2009).
Fase de tratabilidad.- Para la fase de tratabilidad
se utilizaron cinco tinas de plástico de 40x30x20 Análisis proximal de la biomasa microalgal.- La
cm con 15 L del efluente al 50 % (v/v), tanto para el biomasa obtenida al final de la fase de tratabilidad
tratamiento con el consorcio como para el control, fue sometida a sedimentación mediante la
no inoculado (Figura 1). aplicación de un floculante comercial a base de
Este bioensayo fue iniciado con la adición del quitosano, luego esta fue concentrada, lavada
consorcio con una densidad celular equivalente varias veces para retirar el efluente remanente y
a 0.7x6 cel.mL-1. Ambos tratamientos fueron secada en una estufa a 70° C (Andrade et al., 2009).
mantenidos durante 23 días en época de verano en El análisis proximal fue realizado a la biomasa
la terraza del edificio de cuatro niveles de la Unidad seca y se determinó el contenido porcentual
de Biología de la Universidad Central del Ecuador, (%, p/p) de humedad, proteína, grasa, ceniza y
a temperatura ambiente (entre 20±5° C durante fibra de acuerdo con el método INEN (Instituto
el día y de unos 12±2° C durante la noche. Las Ecuatoriano de Normalización) 518, 519, 523, 520,
unidades de experimentales fueron aleatorizadas 522. Mientras que, el contenido de carbohidratos o
de acuerdo con el programa Microsoft Excel (Lara, extracto libre de nitrógeno, se determinó al restar
2001) y agitadas manualmente unas 12 veces al 100 % menos los resultados de proteína, extracto
día. El volumen perdido por evaporación era etéreo, fibra y ceniza. El contenido de calorías
restituido con agua potable y para lo cual, también (Kcal/100g) se obtuvo a partir de multiplicar el
se colocó una tina de 15.0 L con agua potable, a fin porcentaje de carbohidratos y proteínas por 4 Kcal
de determinar el volumen de evaporación de los y el porcentaje de grasa por 9 Kcal (Livesey, 1995;
tratamientos durante el día. Benítez et al., 2008).

El crecimiento del consorcio en el efluente fue RESULTADOS Y DISCUSIÓN


monitoreado cada tres días, mediante recuento celular
con una cámara de Neubauer (Guillard y Sieracki, Crecimiento del consorcio.- El crecimiento de las
2005). Para la comparación de crecimiento del microalgas Desmodesmus sp. y Chlorella sp., fue
consorcio Chlorella sp., y Desmodesmus sp., se aplicó evidente desde el primer día del ensayo, por lo
como diseño experimental un análisis de varianza cual se observó en ambas un incremento constante
Anova (Di Rienzo et al., 2012). Mientras que, para de la densidad celular. Chlorella sp. alcanzó el
la determinación de clorofila y carotenoides fueron mayor crecimiento al final de la fase exponencial
colectados de cada tina con el efluente inoculado unos con 7.8x106 cel.ml-1, mientras que, Desmodesmus sp.
2 ml por dos repeticiones. El método de extracción fue presentó una fase exponencial más prolongada,

Ficorremediación de un efluente de curtiembre


Ontaneda et al.
50

hasta el día 21 con 9.48x106 cel.mL-1, y hasta decaer inferiores a un 70 %, se presentan condiciones
conjuntamente con Chlorella sp. a los 23 días con aptas para ser utilizadas como medio de cultivo. En
valores similares de densidad celular, de 3.76 y cambio, a elevadas cargas orgánicas del efluente se
3.5x106 cel.mL-1 respectivamente (Figura. 2). induce un efecto inhibitorio e incluso tóxico para
el crecimiento de microorganismos, incluyendo
a los fotosintéticos. Además, al ser mantenidos
estos efluentes diluidos en condiciones externas
de laboratorio, son susceptibles de ser colonizadas
por estos microorganismos. Se ha descrito que,
en estanques pocos profundos entre 30 y 60 cm
con efluentes y a cielo abierto en presencia de la
luz natural, se favorece el crecimiento microalgal,
generándose una interacción exitosa entre las
microalgas y las bacterias presentes, de tal forma
Figura 2. Crecimiento (x106 cel.ml-1) del consorcio conformado
por las microalgas Desmodesmus sp. y Chlorella sp. en el
que se inicia el consumo de nutrientes de estos
efluente al 50 % (v/v), en relación al tiempo de desarrollo del reservorios (Malgas, 2013).
experimento de tratabilidad.
Tanto las microalgas Chlorella como Desmodesmus
ó Scenedesmus han sido utilizadas en diversos
Siendo estos valores no significativamente estudios dada su facilidad de crecimiento y
diferentes (p>0.005). Estos resultados también adaptación a diferentes tipos de efluente. (De Godos
reflejan que en la fase de tratabilidad del et al., 2010) evaluaron diferentes consorcios con
efluente, el mayor aporte en cuanto al proceso Scenedesmus, Chlamydomonas, Microspora, Oocystis,
de biorremediación lo expresa Chlorella sp. entre Chlorella y Nitzschia; otro con Chlorella sorokiniana
los días 6 y 12. En cambio, Desmodesmus sp. y Scenedesmus obliquus y por último un consorcio
sustituye a Chlorella sp. entre los días 15 y 21 de solo con varias cepas de Chlorella. Otros trabajos
iniciado el bioensayo. Además, cuando se analiza han descrito con la aplicación de un consorcio
el crecimiento conjunto del consorcio Chlorella- conformado por Chlorella vulgaris, Scenedesmus
Desmodesmus, durante los 23 días de la fase de quadricauda, Scenedesmus dimorphus y Arthrospira
tratabilidad (Figura 3). platensis con la finalidad de evaluar el efecto de
la iluminación, temperatura, filtrado del efluente
porcino, profundidad del biorreactor, aireación,
CO2 y duración del período de estudio.

De acuerdo con estos resultados, se observó que el


consorcio siempre se mantuvo tanto en el efluente
inoculado como en los controles, y sin la presencia
de otro tipo de microalgas. Adicionalmente, se
Figura 3. Crecimiento (x106 cel.ml-1) conjunto del consorcio destaca que la flora bacteriana inherente al efluente
microalgal: Desmodesmus sp. – Chlorella sp. en el efluente al 50 % (v/v)
permaneció también en ambos tratamientos. En un
en relación al tiempo de desarrollo del experimento de tratabilidad.
estudio de tratabilidad de efluentes de pescadería
con Scenesdemus sp., en condiciones externas de
Se evidencia una fase exponencial entre los días 3 laboratorio, también se ha descrito su capacidad de
y 12 y una tendencia estacionaria a partir del día competencia ante otro tipo de microalgas; aun cuando
12 hasta el día 21, en la cual se exhibió la mayor también se reportó presencia de flora bacteriana propia
densidad celular de 14.0x106 cel.mL-1. del efluente (Andrade et al., 2009). Está demostrado
que el aporte de las bacterias son eficaces para la
En relación con el control, se observó a los 9 días de biodegradación de la materia orgánica presente en
iniciado el ensayo de tratabilidad un crecimiento los efluentes; de tal forma que contribuye al aporte de
reducido del consorcio microalgal, con el valor nutrientes a las microalgas en condiciones aeróbicas
más elevado para Desmodesmus sp. de 2.56x106 cel. (Sriram y Senivasan, 2012).
mL-1 en el día 9 y estabilizándose a partir del día
21, con 1.14 x106 cel.ml-1. En cambio, el crecimiento Entre otros bioindicadores del crecimiento microalgal en
Chlorella sp. apenas obtuvo una densidad celular de un proceso de ficorremediación se incluyeron también
0.58x106 cel.mL-1 en el día 9 y de 0.75x106 cel.mL-1, a los pigmentos clorofila y carotenoides producidos
también a partir del día 21. Esto significa que el por las microalgas; ya que reflejan las condiciones
consorcio logra crecer en el efluente no inoculado, adecuadas de iluminación, pH y disponibilidad de
en virtud que a concentraciones del efluente nutrientes en el efluente para su crecimiento.

REMCB 36 (2), 2015


51

Estos ensayos realizados en condiciones externas Tabla 1. Valores iniciales (t0días) y finales (t25días) de
parámetros físico-químicos del efluente de una planta
de laboratorio, presentan una ventaja para la
procesadora de pieles para extracción de gelatina, inoculado con
remediación de aguas residuales, debido a la el consorcio microalgal.
disponibilidad de aprovechamiento de la luz
solar; lo cual permite la actividad fotosintética y Parámetro Unidades Valor inicial Valor final
metabolismo de contaminantes en efluentes y con Color Unid. Pt-Co 5040 895
participación de bacterias (Salazar, 2005). En este Aparente
sentido, cuando se analizó la biomasa cosechada del Sulfatos mg.l-1 570 169
efluente los días 10, 15, 20 y 25, se obtuvo la mayor DBO5 mg.l-1
6200 167
producción de clorofila total y de carotenoides a
DQO mg.l-1 11825 840
los 20 días, con un contenido de 32.67 (p>0.05) y
Fósforo total mg.l-1
4,9 0,5
6.47µg/ml-1, respectivamente (Figura 4).
Nitrógeno mg.l-1
612 54
total (NKT)

En cuanto a la remoción de sulfatos, se obtuvieron


valores similares en ambos tratamientos. A los
5 días se logró una reducción del 72.19 % y
de 71.93 % en el control y efluente inoculado
respectivamente. Mientras que, a los 20 días fue
de 78.29 % para el control y de 79.25 % para el
efluente inoculado (Figura 5).

Figura 4. Contenido de clorofila y de carotenoides (µg.ml-1) en


el consorcio microalgal en la fase de tratabilidad del efluente.

Estos máximos valores coinciden con la densidad


celular más elevada obtenida por el consorcio en
el día 21. Además se, observó una tendencia al
incremento de carotenoides desde el día 10 hasta el
25, con diferencia significativa (p>0.05).
Figura 5. Porcentaje de remoción de Sulfato (%) en el control y
Así mismo, la relación manifiesta entre el contenido en presencia del consorcio microalgal.
de clorofila y de densidad celular o peso seco,
también ha sido descrita en cultivos discontinuos
en diferentes microalgas. Tal es el caso de cultivos En virtud de haberse observado presencia del
de Scenedesmus obliquus en efluente de una planta consorcio microalgal en todos los controles, podría
productora de caramelos y en el cual se logró un sugerirse que además de la presencia de la flora
rango de la tasa de crecimiento en cuanto a peso bacteriana contribuyeron a la reducción de sulfatos
seco y de clorofila, entre 0.32-0.42 y 0.33-0.41 y de los otros contaminantes del efluente. El uso de
respectivamente (Toyub et al., 2008). Es decir, la sulfatos en presencia de compuestos orgánicos por
aplicación de una correlación entre el contenido de parte de las bacterias sulfato reductoras está descrito
clorofila y crecimiento mediante densidad celular en diversos estudios en tratamiento anaeróbico de
efluentes y lodos (Percheron et al., 1997; Sarti et al.,
o peso seco es proporcional en fase exponencial
2010; Zhao et al., 2010). Es posible que, el hecho
(Morales et al., 2002).
de no haber obtenido remociones más elevadas,
podría ser debido a la carencia de este grupo de
Los resultados obtenidos del estudio de tratabilidad
microorganismos capaces de utilizar el sulfato en
del efluente con la finalidad de evaluar la eficiencia
condiciones aeróbicas. Sin embargo, se ha descrito
de remoción de sulfatos, DBO5, DQO, Fósforo y
la aplicación de un consorcio conformado por
Nitrógeno total, ante la aplicación del consorcio
bacterias reductoras de sulfatos y Spirulina platensis
Desmodesmus-Chlorella se presentan de acuerdo para el tratamiento de un efluente de curtiembre y
con los análisis realizados al inicio, y a los 5, 10, 15 en el cual obtuvieron una remoción del 80 % (Rose
y 20 días de experimento. Al inicio, se determinó et al., 1998); este valor fue similar al determinado
una concentración de sulfatos, DBO5, DQO, fósforo en este estudio de tratabilidad con el efluente
y nitrógeno de 570, 6 200, 11 825, 4.9 y 612 mg.l-1 procedente de una planta procesadora de piel de
(Tabla 1), al momento de desarrollar el experimento vacuno, para luego ser utilizada en la extracción de
de tratabilidad del efluente. gelatina y sin la adición de cromo.

Ficorremediación de un efluente de curtiembre


Ontaneda et al.
52

El efecto del pH sobre la eficiencia de eliminación cianobacterias (Spirulina platensis y Oscillatoria


de sulfatos de las aguas residuales también ha sido princeps) y la microalga, Chlorella vulgaris en un
descrito. Así, se ha reportado un óptimo de pH efluente de una planta extractora de gelatina a partir
4.5 en un estudio realizado a pH entre 2.5 y 10.5, de piel de vacuno en la India. Entre los resultados
tomando en consideración factores como la DQO y logrados se obtuvo una remoción de DQO y DBO
las condiciones bioelectroquímicas del tratamiento de 90.08±0.176 % y 89.24±0.544 % respectivamente
aplicado (Liang et al., 2013). Al respecto, se observó (Ghatnekar et al., 2011), estos fueron similares a
durante el estudio de tratabilidad un pH de 8 los obtenidos en la presente investigación. Con
al inicio y de 9 al final del monitoreo realizado. la bacteria fotosintética Rhodocyclus gelatinosus,
De tal manera que, el pH elevado podría ser cultivada en un efluente de un matadero avícola
otro factor limitante para el caso de la remoción en condiciones de laboratorio, también se han
biológica del sulfato en presencia de las bacterias reportado valores similares para la remoción de la
sulfatorreductoras (Al Zuhair et al., 2008). DQO con un 90 % (Giglio et al., 2003).

La remoción de DBO5 al quinto día, tanto en el control La microalga Chlorella vulgaris, también ha sido
como en el efluente con microalgas inoculadas fue utilizada para el tratamiento de efluentes y lodos
de 76.29 % y de 78.06 %; respectivamente. Para procedentes de una planta procesadora de pieles de
luego, alcanzar un incremento hasta 92.81 % en el vacunos en la India, pero con remociones inferiores
control y de 93.69 % con el consorcio inoculado en a las obtenidas en el presente estudio. En dicha
el día 25 (Figura 6). investigación se obtuvo una remoción de solo un
22.0 % y de 38 % de DBO y DQO respectivamente
(Hanumantha et al., 2011). La cianobacteria Nostoc
sp., también ha sido utilizada en el tratamiento de
efluentes de curtiembres y los resultados reportan
una remoción del DBO y DQO del 37.0 % y 48.6
% respectivamente, al término de cuatro semanas
(Nanda et al., 2010). Sin embargo, tales resultados
no superan la eficiencia de remoción de estos dos
parámetros en relación con los obtenidos en la
Figura 6. Porcentaje de remoción de la DBO5 (%) en el control y presente investigación.
en presencia del consorcio microalgal.

Al analizar la remoción del nitrógeno, entre 5 y 25


Mientras que, para la DQO también se logró días se encontró que tanto el control como en los
una remoción al quinto día de 76.5 % y de 84.20 tratamientos con el consorcio, se obtuvo la misma
% en el control y con el consorcio microalgal; eficiencia en la reducción del nitrógeno total. Al
respectivamente. Luego, a los 25 días se obtuvo final del experimento, se alcanzó un valor de
la misma eficiencia de remoción en ambos 87.99% en el control y de 88.73 % con la tecnología
tratamientos, con 88.54 % y 88.44 % en el control y de ficorremediación (Figura. 8).
con el consorcio respectivamente (Figura 7).

Figura 8. Porcentaje de remoción del Nitrógeno (%) en el control


Figura 7. Porcentaje de remoción de la DQO (%) en el control y y en presencia del consorcio microalgal
en presencia del consorcio microalgal.

Para el caso del fosfato, también se detectaron


Estos resultados pueden compararse con los valores similares con una máxima a los 20 días,
obtenidos en un estudio sobre aplicación de tanto en el control como con el consorcio inoculado,
un consorcio microbiano integrado por hongos con un 89.80 % y 91.84 %; respectivamente. En
(Aspergillus flavus y Aspergillus niger), bacterias muestras de efluentes procedente de un planta
(Bacillus subtilis y Nitrobacter winogradskyi),

REMCB 36 (2), 2015


53

de tratamiento de aguas residuales de la ciudad estudio de tratabilidad, a fin de verificar su calidad


de Pune Bopodi, India, se realizó un estudio para nutricional (Vasco, 2008), indicaron un 8.45 % de
evaluar el efecto del consorcio con Chlorella vulgaris humedad, 32.23 % de cenizas, 21 % de proteína, 6.68
y Scenedesmus quadricauda sobre la reducción de % de grasa, 23.89 % de carbohidratos, 7.75 % de fibra y
fosfato y nitrato, cada 5 días hasta los 30 días y un valor calórico de 239.68 Kcal/100g (Tabla 2).
entre los resultados se destacó que C. vulgaris
mostró mejor capacidad de eliminación de nitrato Tabla 2. Contenido de humedad, proteína, grasa, cenizas, fibras,
con 78 % y S. quadricauda la de fosfato con 81 % carbohidratos y energía de la biomasa microalgal, determinado
(Kshirsagar, 2011). Otras cepas de Chlorella vulgaris, mediante análisis proximal.
Scenedesmus obliquus y de Ourococcus multisporus Ensayo Método Unidades Resultado
han sido objeto de un estudio para la producción Humedad INEN 518 %(p/p) 8.45
de biomasa microalgal como fuente de biodiesel, Proteína INEN 519 %(p/p) 21.00
previamente cultivadas en aguas residuales
Grasa INEN 523 %(p/p) 6.68
municipales en Corea del Sur y entre los resultados
obtenidos evidenciaron una eliminación casi Ceniza INEN 520 %(p/p) 32.23
completa de nitrógeno y fósforo (> 99%) al término Fibra INEN 522 %(p/p) 7.75
de 4 días (Min-Kyu, 2013). Estos resultados Carbohidratos Cálculo %(p/p) 23.89
obtenidos en otros países corresponden a estudios Energía Cálculo K cal/100g 239.68
sobre el uso de consorcios de microalgas, que en
nuestro caso con las microalgas Desmodesmus sp.-
Chlorella sp., también se aplica la ficorremediación Es decir, esta biomasa consistió mayormente de
para la remoción de estos parámetros y producción materia orgánica con un 51.57 % y con un contenido
de biomasa microalgal, como una tecnología dual de cenizas de un 32.23 %, menor al control. Es
y más efectiva para el tratamiento de efluentes.     posible que, este elevado porcentaje sea debido
a sulfatos, carbonatos y cloruros adicionados al
La elevada eficiencia de remoción de DQO, DBO5, N y sistema de procesamiento de pieles. Se destaca
P reportada en el control, es probablemente debida a la igualmente, que el contenido de cenizas es superior
actividad de la flora bacteriana asociada al efluente no a lo reportado por Ghatnekar et al. (2011); lo cual
inoculado y a la colonización de las microalgas Chlorella significa que las microalgas Desmodesmus sp.
sp. y Desmodesmus sp. durante el período del estudio. y Chlorella sp., estuvieron expuestas a un gran
De tal manera que, el bioproceso de remoción tanto contenido de minerales presentes en el efluente.
en el control como en el tratamiento con el consorcio
microalgal ha sido debida a la actividad microbiana En relación con el contenido de proteínas en un
heterotrófica y fotosintética. Esta evidencia también 21%, se estima que este fue similar al registrado con
ha sido descrita con un consorcio de Chlorella vulgaris la microalga Scenedesmus sp. a partir de un efluente
y bacterias asociadas a un efluente de una fábrica de de pesquería con 24.41 % (Andrade et al., 2009).
cerveza, a partir del cual se determinó que las bacterias Sin embargo, Ghatnekar et al. (2011) determinaron
asociadas participan de una manera significativa en la valores superiores de un 56.84 % a partir de un
biorremoción de la DQO y DBO5 (Raposo et al., 2010). efluente de una planta extractora de gelatina. Es
posible, que el consorcio integrado por microalgas,
La aplicación de consorcios con microalgas también bacterias y hongos, contribuyeron a incrementar la
ha sido aplicada para el tratamiento de efluentes de producción de proteínas.
curtiembres mediante el uso de Chlorella vulgaris LS120
y Scenedesmus obliquus LS121, pero tomando en cuenta El contenido de fibra cruda y considerado como
proporciones diferentes de volúmenes de cultivo de el componente de carbohidratos no digeribles de
dicho consorcio y del efluente, tales como 100:400, 7.75 %, estuvo en el rango estimado para las algas
200:300, 250:250, 300:200 y 400:100. De esta manera, marinas, entre 3.9 % y 13.5 % (Quevedo, 2008). No
Elumalai et al. (2014), reportaron las mayores eficiencias obstante, fue menor al reportado por ingredientes
de remoción de TDS, DBO y DQO a la relación empleados frecuentemente en la alimentación
de 250:250 (consorcio:efluente) y en comparación a animal y considerados altamente fibrosos, como
cultivos monoalgales de estas microalgas. el heno de alfalfa y de avena, con un contenido
entre 25 % y 35 % (Bondi, 1987). Por su parte, el
Los resultados del análisis proximal realizados a la extracto etéreo con un contenido del 6.68 % fue
biomasa microalgal de 155 g obtenida al final del superior al reportado por Andrade et al. (2009)

Ficorremediación de un efluente de curtiembre


Ontaneda et al.
54

y Ghatnekar et al. (2011). Así como, el reportado REFERENCIAS BIBLIOGRÁFCAS


para cereales (arroz y centeno) y leguminosas el
cual se encuentra por debajo del 2.0 % (Chávez Al-Zuhair S, El-Naas M y Al-Hassani H. 2008.
et al., 1996). Este elevado contenido de lípidos Sulfate inhibition effect on sulfate reducing
puede ser debido a la concentración de grasas y bacteria. Journal Biochemistry Technology,
aceites presentes en las pieles procesadas para la 1(2):39-44.
posterior extracción de gelatina. Además, esta
biomasa microalgal cosechada a partir de este Andrade C, Vera A, Cárdenas C y Morales E.
tipo de efluente podría ser evaluada en cuanto 2009. Producción de biomasa de la microalga
al contenido de triacilglicéridos como fuente de Scenedesmus sp. utilizando aguas residuales de
ácidos grasos para la producción de biodiesel. pescadería. Revista Técnica de Ingeniería, 32(2):
126-134.
Estos resultados confirman estudios realizados
donde se comprueba que mediante la tecnología Bai A, Stündl L, Bársony P, Fehér M, Jobbágy
de ficorremediación de aguas residuales (Renuka P, Herpergel Z y Vaszkó G. 2012. Algae
et al., 2015) se genera, además de una depuración production on pig sludge. Agronomy for
de contaminantes, una producción de biomasa Sustainable Development, 32: 611–618.
microalgal para ser utilizada como complemento
alimenticio o para biocombustible. Benítez B, Archile A, Rangel L, Ferrer K, Barboza
Y y Márquez E. 2008. Composición proximal,
CONCLUSIONES evaluación microbiológica y sensorial de una
galleta formulada a base de harina de yuca y
•Se demuestra la efectividad del uso de un plasma de bovino. Interciencia, 33(1): 61-65.
consorcio microalgal como catalizador del
Bhatnagar S y Kumari R. 2013. Bioremediation:
proceso de remoción de cada uno de los
A Sustainable Tool for Environmental
parámetros evaluados.
Management – A Review. Annual Review &
Research in Biology, 3(4): 974-993.
•Con el ensayo de tratabilidad realizado a un
volumen de 15 L del efluente al 50 %, se confirmó
Bondi A. 1987. Animal Nutrition. John Wiley and
una elevada eficiencia de remoción de sulfatos,
Sons Eds. Great Britain. 562pp.
DBO5, N, DQO y P, a partir del quinto día.
Cerón P. 2011. Estudio de un sistema físico-químico
•El uso de sedimentadores con agitación, permite
a escala prototipo de tratamiento de aguas
remociones superiores entre el 78 y 89 % de
residuales provenientes de una curtiembre.
los parámetros analizados; pero con un valor
Tesis de grado de Ingeniería Ambiental,
agregado cuando se aplica la ficorremediación
Universidad San Francisco de Quito, Ecuador.
debido a la producción de biomasa microalgal
con una calidad nutricional adecuada, por el
Chacón C, Andrade C, Cárdenas C, Araujo I
contenido de proteínas y minerales.
y Morales E. 2004. Uso de Chlorella sp. y
Scenedesmus sp. en la remoción de nitrógeno,
AGRADECIMIENTOS fósforo y DQO de aguas residuales urbanas
de Maracaibo, Venezuela. Boletín del Centro de
Este trabajo ha sido financiado por el Programa Investigaciones Biológicas, 38(2): 94-108.
Becas Prometeo de la Secretaría Nacional de
Educación Superior y Ciencia, Tecnología e Chávez M, Chávez V, Roldán A, Ledesma S,
Innovación de la República del Ecuador. Al Centro Mendoza M, Pérez F, Hernández C y Chaparro F.
de Biología de la Universidad Central del Ecuador, 1996. Tablas de valor nutritivo de los alimentos
por su apoyo permanente en la realización del de mayor consumo en Latinoamérica. Editorial
estudio experimental. Pax, México. 330pp.

De-Godos I, Vargas S, Blanco M, García-González C,


Soto R, García- Encina P, Becares E y Muñoz R.
2010. A comparative evaluation of microalgae
for the degradation of piggery wastewater
under photosynthetic oxygenation. Bioresource
Technology, 101:5150–5158.

REMCB 36 (2), 2015


55

Di Rienzo J, Casanoves F, Balzarini M, González L, Australian Current. I. Summer populations,


Tablada M y Robledo C. 2012. InfoStat versión. Marine Ecology Progress Series, 3: 285–294.
Grupo InfoStat, FCA, Universidad Nacional
de Córdoba, Argentina. Página de Internet: Kotteswari M, Murugesan S y Ranjith R. 2012.
http://www.infostat.com.ar. Phycoremediation of dairy effluent by using
the Microalgae Nostoc sp. International Journal of
Elumalai S, Anuvarshini S, Sangeetha T y Environmental Research and Development, 2 (1): 35-43.
Roopsingh D. 2014. Phycoremediation for
Leather Industrial Effluent - Treatment and Kshirsagar, AD. 2013. Bioremediation of wastewater
Recycling Using Green Microalgae and its by using microalgae: an experimental study.
Consortia International. Journal of Current International Journal Life Sciences Biotechnology
Biotechnology, 2(10): 1-9. & Pharma Researh, 2 (3): 339-346.

Ghatnekar S, Sharma S, Ghatnekar S y Dighe D. Lara A. 2001. Diseño estadístico de experimentos,


2011. Integrated microbial and algal effluent análisis de la varianza y tema relacionados:
treatment biotechnology for biomanagement tratamiento informático mediante SPSS. Ed.
of liquid effluent. 5th European Water & Proyecto Sur. Granada, España. http://www.
Wastewater Management Conference. Página ugr.es/~bioestad/guiaspss/index.html.
de Internet: www.suvash.com/algal_effluent_
treatment.pdf Liang F, Xiao Y y Zhao F. 2013. Effect of pH on
sulfate removal from wastewater using
Giglio P, Magalhães L y Franke M. 2003. Chemical a bioelectrochemical system. Chemical
Composition of Rhodocyclus gelatinosus Engineering Journal, 218: 147–153.
biomass produced in poultry slaughterhouse
wastewater. Brazilian archives of Biology and Livesey G. 1995. Metabolizable energy of
Technology, 46(2): 143-147. macronutrients. American Journal Clinic
Nutritional, 62:1135-1142.
González A. 2014. Remoción de contaminantes
en un efluente de una explotación porcina, a Lofrano G, Meriç S, Zengin G y Orhon D. 2013.
nivel de laboratorio, mediante la selección de Chemical and biological treatment technologies
un consorcio microalgal y evaluación del valor for leather tannery chemicals and wastewaters:
nutricional de la biomasa. Tesis de grado de A review. Science of the Total Environment, 461–
Ingeniería en Biotecnología. Universidad de 462:265–281.
las Fuerzas Armadas-ESPE, Ecuador.
Malgas. 2013. Oportunidades empresariales
Guillard R y Sieracki M. 2005. Counting cells in alrededor de las microalgas en el litoral
cultures with the light microscope.En: Algal Cantábrico. Aplicaciones de las microalgas:
Culturing Techniques. Andersen, R.A. (ed.). Estado de la técnica. Edición AST Ingeniería
Elsevier Academic Press, 239-252 pp. S.L. Asturias, España, 68 pp.

Hanumantha P, Kumar R, Raghavan B, Subramanian Min-Kyu J, Abou-Shanaba R, Seong-Heon K, El-


V y Sivasubramanianet V. 2011. Application of Sayed S, Sang-Hun L, Akhil N, Youn-Suk L,
phycoremediation technology in the treatment Sungwoo H y Byong-Hun J. 2013. Cultivation
of wasterwater from a leather- processing of microalgae species in tertiary municipal
chemical manufacturing facility. Tamil Nadu, wastewater supplemented with CO2 for
India: Department of Plant Biology and Plant nutrient removal and biomass production.
Biotechnology, R.K.M. Vivekananda College, Ecological Engineering, 58:142–148.
Chennai 600 004.
Morales E, Rodríguez M, García D, Loreto C y Marco
Hanumantha P, Ranjith R, Raghavan BG, E. 2002. Crecimiento, producción de pigmentos
Subramanian VV. y Sivasubramanian V. 2011. y exopolisacáridos de la cianobacteria Anabaena
Application of phycoremediation technology PCC 7120 en función del pH y CO2. Interciencia,
in the treatment of wastewater from a leather- 27(7): 373-378.
processing chemical manufacturing facility.
Water SA, 37(1): 7-14. Muñoz M. 2011. Removal of suspended solids from
wastewater of an Ecuadorian leather tannery.
Jeffrey SW y Hallegraeff GM. 1980. Studies of Quito, Ecuador: Universidad Politécnica
phytoplankton species and photosynthetic Nacional.
pigments in a warm core eddy of the East

Ficorremediación de un efluente de curtiembre


Ontaneda et al.
56

Nanda S, Kumar P y Abraham J. 2010. Cyanobacterial Salazar M. 2005. Aplicación e importancia de las
remediation of industrial effluents I. Tannery microalgas en el tratamiento de aguas residuales.
effluents. New York Science Journal, 3(12): 32-36. Laboratorio de Microbiología Ambiental y
Tratamiento de Aguas Residuales. Departamento
Olguín E,   Galicia S,  Mercado G  y Pérez T. 2003. de Biotecnología. ContactoS, 59: 64-70.
Annual productivity of Spirulina (Arthrospira) and
nutrient removal in a pig wastewater recycling Sarti A, Pozzi E, Chinalia F, Ono O y Foresti F. 2010.
process under tropical conditions. Journal of Microbial processes and bacterial populations
Applied Phycology, 15(2-3): 249-257. associated to anaerobic treatment of sulfate-rich
wastewater. Process Biochemistry, 45:164–170.
Percheron G, Bernet N y Moletta R. 1997. Start-up
of anaerobic digestion of sulfate wastewater. Sivasubramanian V, Muthukumaran M
Bioresource Technology, 61:21–27. y Subramanian V. 2014. Large–scale
phycoremediation of petrochemical effluent
Quevedo C, Morales S y Acosta A. 2008. using micro algae.  Journal of Algal Biomass
Crecimiento de Scenedesmus sp., en diferentes Utilization, 5(1): 47–66.
medios de cultivo para la producción de
proteína microalgal. Vitae, Revista de la Facultad Sriram S y Seenivasan R. 2012. Microalgae
de Química Farmacéutica, 15(1): 25-31. Cultivation in Wastewater for Nutrient
Removal. Journal of Algal Biomass Utilization, 3
Raposo MF, Oliveira SE, Castro PM, Bandarra (2): 9- 13.
NM y Morais RM. 2010. On the Utilization of
Microalgae for Brewery Effluent Treatment Strickland J. y Parsons T. 1972. A practical
and Possible Applications of the Produced handbook of seawater analysis. Journal of the
Biomass. Journal of the  Institute  of  Brewing,  Fisheries Research Board of Canada Bulletin
116(3): 285–292. 167, 2nd ed. 310pp.
Rawat I, Ranjith R, Mutanda T y Bux F. 2011.
Tayupanda S. 2010. Diseño del tratamiento del
Dual role of microalgae: Phycoremediation of
agua residual del proceso del pelambre para
domestic wastewater and biomass production
su reutilización, Curtiembres Pieles Puma.
for sustainable biofuels production. Applied
Tesis Ingeniería Química. Escuela Superior
Energy, 88(34): 11–3424.
Politécnica del Chimborazo, Ecuador.
Renuka N, Sood A, Prasanna R y Ahluwalia A.
Toyub M, Miah M, Habib M y Rahman M. 2008.
2015. Phycoremediation of wastewaters: a
Growth performance and nutritional value
synergistic approach using microalgae for
bioremediation and biomass generation. of Scenedesmusobliquus cultured in different
International Journal of Environmental Science concentrations of sweetmeat factory waste
and Technology, 12(4): 1443-1460. media. Bangladesh Journal Animal Science, 37(1):
86 – 93.
Rodríguez S. 2010. Evaluación de microalgas y de
bacterias asociadas productoras de exoenzimas Vasco VC. 2008. Determinación de parámetros
para tratamiento de aguas residuales de una fisicoquímico de la zanahoria (Daucus carota)
extractora de aceite de palma. Tesis de grado como base para el establecimiento de la norma
en Maestría en Microbiología. Universidad del de requisitos”. Tesis de Grado para la obtención
Zulia,Venezuela. del título Bioquímico Farmacéutico, Escuela
de Bioquímica y Farmacia, Escuela Superior
Romero-Aguilar M, Colín-Cruz A, Sánchez-Salina, E y Politécnica del Chimborazo-Ecuador.
Ortiz-Hernández M. 2009. Tratamiento de aguas
residuales por un sistema piloto de humedales Zhao YG, Wang AJ y Ren NQ. 2010. Effect of carbon
artificiales: evaluación de la remoción de la carga sources on sulfidogenic bacterial communities
orgánica. Revista Internacional de Contaminación during the starting-up of acidogenic sulfate-
Ambiental, 25 (3): 157-167. reducing bioreactors. Bioresource Technology,
101: 2952–2959.
Rose PD, Boshoff GA, Van Hille RP, Wallace LC,
Dunn KM y Duncan JR. 1998. An integrated
algal sulphate reducing high rate ponding
process for the treatment of acid mine drainage
wastewaters. Biodegradation, 9:247-257.

REMCB 36 (2), 2015


57

Caracterización molecular de péptidos antimicrobianos a partir


de muestras de piel de Agalychnis spurrelli (Anura: Hylidae)
Andrea P. Vargas1, Óscar Pérez2, David Ortega - Paredes2, Myrian Rivera1

Laboratorio de Investigaciones de Citogenética y Biomoléculas de Anfibios (LICBA) ,


1

Pontificia Universidad Católica del Ecuador, Quito, Ecuador.

Laboratorio de Biología del Desarrollo, Escuela de Ciencias Biológicas,


2

Pontificia Universidad Católica del Ecuador,, Quito, Ecuador. ap.vargash@gmail.com

Recibido: 2015-08-03; aceptado: 2015-08-27

RESUMEN.- Las secreciones de la piel de Agalychnis spurrelli han probado tener una marcada actividad
antimicrobiana sobre diferentes microrganismos patógenos por la presencia de biomoléculas en ellas. Se
realizaron análisis moleculares del ARN mensajero de la piel de A. spurrelli para determinar el tipo de
péptido antimicrobiano presente en las secreciones cutáneas de esta especie. Para amplificar las secuencias
precursoras de los péptidos maduros, se utilizaron iniciadores específicos que contienen secuencias
altamente conservadas. Como resultado se obtuvo una secuencia de ADN complementario de 357 pb,
la cual fue comparada con sus ortólogos de otras especies de la misma subfamilia Phyllomedusinae, se
lograron índices de identidad muy altos para precursores de dermaseptinas. Finalmente, para el análisis de
la secuencia de ADN complementario, se tradujo la secuencia nucleotídica por codones, con lo que se obtuvo
una secuencia aminoacídica. Dicha secuencia posee las características particulares de péptidos de la familia
de las dermaseptinas: una secuencia altamente conservada, una propieza acídica con los aminoácidos
Lisina y Arginina y el extremo C-terminal variable. En conclusión, la secreción total de Agalychnis spurrelli
contiene un péptido de la familia de las dermaseptinas o un péptido relacionado con ellas.

PALABRAS CLAVES: ADN complementario, Dermaseptinas, Phyllomedusinae, secuencias precursoras


ABSTRACT.- The skin secretions of Agalychnis spurrelli have proven to have a strong antimicrobial
activity on different pathogens because they contain certain biomolecules that have antimicrobial action.
In the Phyllomedusinae family antimicrobial peptides are commonly present. Molecular analysis where
performed in mRNA from the skin of A. spurrelli to determine the type of antimicrobial peptide present in
the skin secretions of this species. The precursor that amplifies the sequences of mature peptides, where
amplified by using specific primers that contained the highly conserved sequence, characteristic in this
family. The result was a sequence of DNA complementary of 357 pb. This sequence was compared with their
orthologs from other species of the same subfamily Phyllomedusinae, obtaining very high levels of identity
for dermaseptin precursors. Finally, for the analysis of complementary DNA sequence, this was translated
into an amino acid sequence. This sequence has the characteristics of peptides of the dermaseptin family: a
highly conserved sequence, an acidic propiece with Lysine and Arginine and the variable the C-terminus.
In conclusion, the total secretions of Agalychnis spurrelli contain a peptide of the family of dermaseptin or a
dermaseptin like peptide.

KEYWORDS: complementary DNA, Dermaseptins, Phyllomedusinae, precursor sequences,.

INTRODUCCIÓN fines medicinales y terapéuticos. Las biomoléculas


secretadas en la piel de los anfibios constituyen
Por la cantidad de especies descritas a nivel una fuente biológica de compuestos con varias
mundial, Ecuador está catalogado como el tercer funciones fisiológicas, especialmente de defensa
país en diversidad de anfibios, y el primero en (Barra y Simmaco, 1995), dirigida hacia patógenos
el mundo por el número de especies por área externos. Estas moléculas forman parte de la
(Coloma et al., 2011). En el pasado, las comunidades inmunidad innata de estos organismos y pueden
locales han utilizado muchas de estas especies con ser aminas biogénicas, alcaloides complejos y

Caracterización de péptidos antimicrobianos en anuros


Vargas et al.
58

péptidos antimicrobianos (Simmaco et al., 1998). MATERIALES Y MÉTODOS


Para que la inmunidad innata, pueda actuar sobre
patógenos que evolucionan rápidamente, los genes Para la caracterización con métodos moleculares
del sistema inmune de los anfibios poseen niveles de péptidos antimicrobianos se siguió el protocolo
muy altos de polimorfismos, dados por la presión determinado por Vanhoye y colaboradores (2003).
selectiva. Este polimorfismo está asociado con Tres especímenes (SC26539, SC26542 y SC26543)
la actividad antimicrobiana dada por los genes fueron sacrificados colocándoles Lidocaina en el
implicados. Ranas que pertenecen al mismo género área bucal para evitar dañar la piel. Posteriormente
pero de diferentes especies o subfamilias, pueden se procedió a removerla para obtener varias
tener diferentes tipos de péptidos con diferente muestras de aproximadamente 180 mg que fueron
tamaño, carga, hidrofobicidad, conformación y conservadas y almacenadas en RNAlater (QIAGEN
espectro de acción (Duda et al., 2002). Cat.No. 76106) a -20º C según lo especifica el
protocolo de clonación de Vanhoye et al. (2003).
En los anfibios ecuatorianos la familia Hylidae es Consecutivamente se extrajo el ARN total. Se utilizó
una de las más extensas por contener alrededor de el reactivo Tri Reagent (MOLECULAR RESEARCH
51 géneros incluidos en tres subfamilias: Hylinae, CENTER INC. Cat. No. TR-118), el protocolo se
Pelodryadinae y Phyllomedusinae. De la subfamilia siguió según las especificaciones del fabricante
Phyllomedusinae han podido ser aislados
mediante la centrífuga Refrigerated Centrifuge
aproximadamente 80 péptidos antimicrobianos
SIGMA 1-15K. El ARN resultante se disolvió en 25
que, agrupados por alineamiento múltiple de sus
μl de agua DEPC. Para comprobar la presencia de
secuencias, forman 7 familias de péptidos: las
ácidos nucleicos se corrió el ARN extraído en geles
phylloseptinas (PLS), las dermatoxinas (DRT),
de agarosa al 1 % y TBE 0.5X.
las plasticinas (PTC), las phyllotoxinas (PLX), las
hyposinas (HPS), los péptidos huérfanos y las
Después, el ADN complementario (ADNc) fue
dermaseptinas (DRS) (Amiche et al., 2008).
sintetizado a partir del ARN total extraído de las
muestras de piel. Para esto se utilizó la transcriptasa
Las Dermaseptinas están representadas por 50
péptidos provenientes de los géneros Pachymedusa, reversa M-MulV (ROCHE Cat .No.11062603001) así
Phyllomedusa y Agalychnis (Amiche et al., 2008). Son como el protocolo especificado por el fabricante con
lineares, catiónicos y generalmente no hemolíticos los siguientes reactivos: 5 μl de buffer de incubación
(De Lucca et al., 1998). La naturaleza anfipática de 5X, 1.25 μl de M-MulV transcriptasa reversa, 2.5 μl
las dermaseptinas les permite una interacción con la de PolyA oligodT (ROCHE Cat. No. 10108677001),
membrana del patógeno causando un colapso total de 1 μl de Inhibidor de RNAsas (ROCHE Cat. No.
la integridad de la misma, dando como resultado la 03335399001), 1.25 μl de deoxinucleotidos trifosfato
pérdida de la permeabilidad (Charpentier et al., 1998). (dNTPs) (INVITROGEN Cat. No. 1842701), 5 μl de
templado de ARN total (2-5 μg) y 9 μl de agua libre
Para la mayoría de las dermaseptinas los de nucleasas (DEPC).
precursores codifican una sola copia del péptido
antimicrobiano maduro al extremo C-terminal de Al producto de la reacción se lo colocó en un tubo
la secuencia. Una comparación de las secuencias de microcentrífuga de 1.5 ml con un volumen final
precursoras de los péptidos revela que poseen de 25 μl y posteriormente fue incubado en un baño
una preproregión N-terminal común, altamente María Reciprocal Shaking “Bath PRECISION”,
conservada inter e intraespecíficamente y una por una hora a una temperatura de 37º C. A partir
región C-terminal diferente que corresponde del ADNc sintetizado se realizó un protocolo de
a los péptidos antimicrobianos maduros. La reacción en cadena de la polimerasa (PCR), con el
preprorregión conservada comprende una señal objetivo de amplificar una porción de la secuencia
peptídica hidrofóbica de 22 residuos seguidos del precursor del péptido de A. spurrelli del ADN
por una propieza acídica que termina en una complementario total obtenido.
prohormona que procesa la señal Lisina Arginina
(Lys-Arg) (Duda et al., 2002). Para realizar la amplificación se diseñaron
iniciadores específicos basándose en secuencias
Por lo antes expuesto, en la presente investigación se conocidas de precursores de dermaseptinas
realizaron análisis moleculares del ARN mensajero encontrados en especies cercanas a A. spurrelli
de la piel de Agalychnis spurrelli para determinar como Agalychnis callidryas y Agalychnis annae.
la presencia de un péptido antimicrobiano en las Para esto, dos secuencias de precursores de A.
secreciones cutáneas de esta especie, las mismas callidryas y una de A. annae fueron alineadas entre
que han probado tener una amplia actividad sí. Dichas secuencias fueron alineadas mediante el
antimicrobiana (Cilveti et al., 2013), antifúngica programa ClustalW de European Bioinformatics
(Vargas, 2012) y anticancerígena (Chuang, 2012). Institute EMBL. Una vez encontradas las porciones

REMCB 36 (2), 2015


59

más alineadas se utilizó el programa BCM de poliA presente en el ARN como sitio de inicio
Searchlauncher de Baylor Collage of Medicine para PCR. Para este procedimiento se utilizó el
HGSC para diseñar los iniciadores corriente abajo ARN total extraído de la piel de la rana empleando
A.spuR1 y A.spuR2, los cuales fueron iniciadores como iniciadores específicos al iniciador corriente
degenerados. (Tabla 1) arriba A.spuF1 basado en el dominio altamente
conservado del extremo N-terminal de los péptidos
El iniciador corriente arriba A.spuF1 pertenece antimicrobianos de la familia Hylidae. Los
a la secuencia nucleotídica que codifica para iniciadores específicos corriente abajo AP y AUAP
el extremo N-terminal de la preprorregión de fueron obtenidos del Kit de reacción del 3’RACE
los precursores de dermaseptina diseñado por (System for Rapid Amplification of cDNA Ends
Vanhoye et al. (2003). La síntesis de los iniciadores INIVTROGEN Cat. No. 18373-019).
fue realizada bajo pedido por INVITROGEN.
Una vez obtenidos los iniciadores A.spuF1, Para la síntesis de ADN complementario se procedió
A.spuR1 y A.spuR2 se realizó un PCR anidado. según las especificaciones del fabricante utilizando
Este procedimiento utilizó una ADN polimerasa de 1 a 5 μl del ARN total extraído de la piel de A.
GoTaq (PROMEGA Cat. No. M3005) siguiendo el spurrelli y un ARN control incluido, en el Kit.
protocolo recomendado por el fabricante.
Para la amplificación del ADNc de interés se
Para la elaboración de estas amplificaciones siguieron las especificaciones del Kit (3’RACE
se utilizó una termocicladora PTC-100 MJ System for Rapid Amplification of cDNA Ends
RESEARCH. La reacción se colocó en la INVITROGEN Cat. No. 18373-019).
termocicladora, la cual se programó con los
siguientes ciclos: desnaturalización inicial a 94° C La termocicladora fue programada con los siguientes
por 2 minutos, acoplamiento a 56° C (temperatura ciclos: Desnaturalización inicial a 94º C por 3
dependiente de la secuencia de los iniciadores minutos, desnaturalización a 94º C por un minuto,
empleados) por un minuto, extensión a 72° C por 3 acoplamiento a 56º C por un minuto, extensión a
minutos con 30 segundos y extensión final a 72° C 72º C por 3 minutos con 30 segundos y extensión
por 5 minutos. Los ciclos 2, 3 y 4 se repitieron por final a 72º C por 5 minutos. Los ciclos 2, 3 y 4 se
33 veces según las recomendaciones del fabricante repitieron por 35 veces según las recomendaciones
de la polimerasa. La temperatura de acoplamiento del fabricante de la GoTaq polimerasa y el protocolo
se obtuvo mediante la ecuación de Wallace. Al de 3’RACE. Luego de la amplificación se extrajo la
término del PCR todas las muestras resultantes muestra con 50 μl de cloroformo y se transfirió la
fueron corridas en geles de agarosa y visualizadas. fase acuosa en un tubo nuevo.
Las bandas del tamaño adecuado fueron extraídas
del gel de agarosa para realizar la Amplificación Al término del PCR, todas las muestras resultantes
Rápida De Extremos 3’ De ADN Complementario fueron corridas en geles de agarosa y visualizadas, las
(3’RACE). Se realizó el 3’RACE usando la cola bandas del tamaño adecuado fueron extraídas del gel.

Tabla 1. Iniciadores utilizados en la caracterización de péptidos antimicrobianos de la piel de A. spurrelli. De arriba hacia abajo: Tres iniciadores
degenerados diseñados a partir de secuencias conocidas de precursores de péptidos antimicrobianos; tres iniciadores en el Kit de 3’ RACE AP,
AUP, AUAP; y tres iniciadores incluidos en el Kit de clonación pCR 2.1 TOPO M13 Reverse, M13 Forward y T7 Promoter.

Primers Secuencia Referencia


Primer degenerado A.spuF1 5’-GGC TTT CCT KAA GAA ATC TC-3’
Primer degenerado A.spuR1 5’-CCT CYT CAT CTT CAT TTT CTC-3’
Primer degenerado A.spuR2 5’-CAC TTT GCT CRT CRT CTT CTT G-3’
3’ RACE Adapter Primer 5’-GGC CAC GCG TCG ACT AGT ACT TTT AP primer INVITROGEN
TTT TTT TTT TTT T-3’
3’RACE Universal Amplification Primer 5’-CAU CAU CAU CAU GAC CGT TCA UAP primer INVITROGEN
GCT GGA TAT TAC-3’
3’ RACE Abridged Universal 5’-GGC CAC GCG TCG ACT AGT AC-3’ AUAP primer INVITROGEN
Amplification Primer
M13 Reverse Primer 5’-CAG GAA ACA GCT ATC AC GTC CTT pCR 2.1 TOPO
TGT CGA TAC TG-3’
T7 Promoter 5’-AGT GAG TGC TAT TA TCA CTC AGC pCR 2.1 TOPO
ATA AT-3’
M13 Forward(-20)Primer 3’-CTG GCC GTC GTT TTA C GAC CGG pCR 2.1 TOPO
CAG CAA AAT G-5’

Caracterización de péptidos antimicrobianos en anuros


Vargas et al.
60

Los fragmentos de A.spuF1-A.spuR1, A.spuF1-A. RESULTADOS


spuR2 y A.spuF1-AUAP (3’RACE) se ligaron al
vector pGEM®-T Vector System (PROMEGA Cat. Como resultado de la amplificación del ADN
No. A3610), por poseer una región de resistencia complementario de A. spurrelli con los iniciadores
a la ampicilina y alfa complementación. El específicos diseñados a partir de secuencias
protocolo fue realizado según las especificaciones conocidas de precursores peptídicos, se obtuvo
del fabricante. Las bacterias competentes se un gel de agarosa con varias bandas. Se pudieron
transformaron con los vectores que contenían los observar dos bandas de aproximadamente
fragmentos A.spuF1-A.spuR1, A.spuF1-A.spuR2 100 y 120 pb amplificada con los iniciadores
y 3’RACE. Para esta transformación se utilizaron A.spuF1-A.spuR1 y A.spuF1-A.spuR2. También se
las bacterias químicamente competentes One observó una banda de 357 pb aproximadamente,
ShotR TOP10 Competent Cells INVITROGEN correspondiente a la amplificación de la secuencia
(Cat. No. C40401). El protocolo se realizó según las total de interés, obtenida del 3’RACE con los
especificaciones del fabricante. Simultáneamente iniciadores A. spuF1-AUAP (3’RACE). (Figura 1).
a este protocolo se preparó el medio de cultivo
bacteriano. Para esto se usó el medio Luria-Bertoni
(LB) y Agar en 2 cajas Petri plásticas para cada
fragmento. Una vez polimerizado el medio, se
sembraron 30 μl de X-Gal INVITROGEN (Cat. No.
15520018) a un concentración de 40 mg/ml, y 15
μl de ampicilina ROCHE (Cat. No. 10835242001) a
una concentración de 50 mg/ml para cada placa.

Posteriormente a su transformación, las bacterias


fueron sembradas en el medio de cultivo
previamente preparado. Pasadas las 24 horas se
observó el crecimiento de colonias, y se marcó
con un círculo a las colonias recombinadas con
cada amplicón. Con el objetivo de conocer si las
colonias crecidas en las cajas Petri contenían el
inserto, se realizó un PCR de cada cultivo de Figura 1. Amplicones A.spuF1 con A.spuR1, A.spuR2 y AUAP
colonias, mediante iniciadores específicos del (3’RACE). De izquierda a derecha se puede observar: M, la
vector A.spuF1-A.spuR1, A.spuF1-A.spuR2 escalera de peso molecular (Ladder); 1 y 2, secuencias de 357pb
precursoras de dermaseptinas producto de 3’RACE; 3, amplicón
y A. spuF1-AUAP (3’RACE), con su respectiva
de 120pb obtenido del PCR anidado con A.spuF1 y A.spuR1; 4,
temperatura de acoplamiento. Se escogieron tres amplicón de 100pb obtenido del PCR anidado con A.spuF1 y
colonias de A.spuF1-A.spuR1, A.spuF1-A.spuR2 A.spuR2; 5, control negativo; 6, control positivo (3’RACE).
y 3’RACE. A continuación se purificó el plásmido
con el inserto de las colonias escogidas. Para este De la clonación de las secuencias A.spuF1-A.spuR1,
procedimiento se utilizó el kit High Pure Plasmid A.spuF1-A.spuR2 y A.spuF1-UAP (3’RACE)
Isolation para preparaciones mini (ROCHE Cat. en bacterias competentes, se obtuvieron varias
No. 11754777001). El Kit fue utilizado según las colonias transformadas con el inserto en la placa de
especificaciones del fabricante. Las muestras cultivo. A continuación se seleccionó una colonia
se enviaron a secuenciar con los iniciadores T7 para realizar una amplificación con los iniciadores
corriente arriba y SP6 corriente abajo, específicos A. spuF1 y AUAP. Como resultado, en el gel de
del vector. Las muestras fueron secuenciadas por el agarosa al 1 %, pudieron observarse bandas de 357
servicio de secuenciación MACROGEN Inc. pb aproximadamente, que corresponden al tamaño
esperado de la secuencia total del precursor
Para un análisis más profundo se realizó la traducción de los péptidos antimicrobianos. Se realizó el
de las secuencias nucleotídicas empleando el mismo procedimiento con A.spuF1-A.spuR1 y
programa BCM Search launcher de Baylor Collage of A.spuF1-A.spuR2. Finalmente se seleccionaron
Medicine HGSC. Se obtuvieron 6 marcos de lectura, tres colonias de cada inserto para ser purificadas y
tres en sentido 5’3’ y tres en sentido 3’5’. Cada posteriormente secuenciadas. Como resultado de la
secuencia obtenida fue alineada con las secuencias purificación del plásmido y su posterior secuenciación
aminoácidicas de péptidos antimicrobianos y de las se obtuvo la secuencia precursora del péptido de
especies más cercanas, seleccionando la secuencia Agalychnis spurrelli que cuenta con 357 pb (Figura 2)
mejor alineada usando el programa ClustalW del y dos amplicones más pequeños que pertenecían a la
European Bioinformatics Institute EMBL, que indicó amplificación de segmentos de la secuencia precursora
el índice de identidad entre ellas. de 100 y 120 pb.

REMCB 36 (2), 2015


61

de las especies Agalychnis annae, Agalychnis


callydrias, Phyllomedusa sauvagei y Phyllomedusa
hypochondrialis. (Tabla 2).

DISCUSIÓN
El ADN contiene empacada toda la información
genética que un organismo necesita para
desarrollarse y funcionar, y en base a esa información
este puede construir proteínas (Watson et al., 2007).
El ARN mensajero contiene la información genética
procedente del ADN para la síntesis de proteínas.
Estas a su vez son los productos finales de la mayoría
de rutas de información y tienen que ser sintetizadas
y transportadas en respuesta a las necesidades
celulares del momento (Lehninger et al., 2008).

La información de los precursores de péptidos


antimicrobianos presentes en la piel de los anfibios,
está codificada en el ADN de cada una de las células
del organismo. Sin embargo, estas secuencias son
traducidas exclusivamente en las células de la
Figura 2. Amplicón de A.spuF1-AUAP a partir de colonias piel para la producción de sustancias de defensa
transformadas. Los amplicones de ADN fueron obtenidos secretadas por las glándulas granulares (Tennessen
a partir de la amplificación de colonias recombinadas,
amplificadas con iniciadores A.spuF1-AUAP. De izquierda a
y Blouin, 2008). Las secuencias de estos péptidos son
derecha se observan la escalera de peso molecular seguida de muy similares entre especies relacionadas. (Figura 3).
las bandas uno y dos de 357pb.
Los anfibios de la familia Hylidae poseen
A continuación se procedió a comparar la secuencia precursores llamados preprodermaseptinas
precursora total de péptidos antimicrobianos de A. (Vanhoye et al., 2003) a partir de las cuales fueron
spurrelli con secuencias del banco genético National diseñados los iniciadores A.spuF1 corriente arriba,
Center of Biotechnology Information (NCBI). Los A.spuR1 y A.spuR2 corriente abajo. Es posible
índices de identidad obtenidos muestran que la encontrar ciertos segmentos de la secuencia de una
secuencia precursora del péptido de Agalychnis proteína en organismos de un grupo taxonómico
spurrelli se encuentra estrechamente relacionada y no en otros grupos y estos segmentos pueden
con secuencias precursoras de dermaseptinas y usarse como “secuencia firma” del grupo en el cual
péptidos relacionados con dermaseptinas, aisladas se encuentren (Lehninger et al., 2008).

Tabla 2. Índices de identidad de la secuencia A.spuF1-AUAP (3’RACE) de Agalychnis spurrelli comparados con las secuencias de sus
ortólogos en otras especies.

ESPECIE TIPO DE SECUENCIA IDENTIDAD MÁXIMA


Agalychnis annae mRNA for dermaseptine related peptide, clone AA 3-1 96%
Agalychnis callidryas mRNA for DRP-AC1 precursor (drp.AC1 gene) 89%
Phyllomedusa hypocondralis mRNA for dermaseptine H2 protein precursor (dsn-2 gene) 87%
Phyllomedusa hypocondralis mRNA for dermaseptine H1 protein precursor (dsn-1 gene) 87%
Agalychnis callidryas Dermaseptien like precursor DRP-AC-3 mRNA 90%
Phyllomedusa sauvagei mRNA for preprodermaseptine S13 (drsS13 gene) 83%
Phyllomedusa sauvagei Partial mRNA for preprodermaseptine S12 (drs12 gene) 83%
Phyllomedusa sauvagei mRNA for dermaseptin sVII 86%
Agalychnis annae mRNA for dermaseptin-related peptide, clone AA-3-6 81%
Phyllomedusa hypocondralis mRNA for preprodermaseptine H3 (dpp-H3 gene) 89%
Agalychnis callidryas mRNA for ARP-AC1 precursor 80%
Phyllomedusa hypocondralis mRNA for preprodermaseptine H4 91%
Phyllomedusa sauvagei mRNA preprodermaseptine S11 (drsS11 gene) 79%

Caracterización de péptidos antimicrobianos en anuros


Vargas et al.
62

presente en el mensajero de A. spurrelli. El alto


grado de conservación de estas preprorregiones se
debe a que se originó de una familia de multigenes
perteneciente a un ancestro común (Duda et al., 2002).
Sin embargo, a pesar de tener una preprorregión
altamente conservada evolutivamente, los péptidos
antimicrobianos poseen un extremo C-terminal
muy variable. Esta variabilidad da como resultado
una gran cantidad de péptidos de diferentes
tamaños, secuencias y espectro antimicrobiológico
(Vanhoye et al., 2003); no obstante, muchas de
estas sustituciones de aminoácidos observadas
en una familia de proteínas pueden ser de tipo
conservador, es decir, sustituciones en las cuales
un residuo de un aminoácido está remplazado por
otro que posee propiedades químicas similares
(Lehninger et al., 2008).

Para conocer el tamaño y la secuencia total del


precursor del péptido antimicrobiano de A. spurrelli
se realizó la técnica molecular llamada 3’RACE
(Rapid Amplification of cDNA Ends).

Esta técnica amplifica secuencias nucleotídicas a


partir de un ARN mensajero usado como templado.
El 3’RACE necesita dos secuencias iniciadoras
específicas que encierren a la secuencia de interés
y toma ventaja de la cola de poliA contenida en
al ARNm como iniciador genérico para sintetizar
Figura 3. Alineamiento de secuencias precursoras de péptidos ADN complementario (Sambrook y Russell, 2001).
antimicrobianos de especies de la subfamilia Phyllomedusinae. En el caso de A. spurrelli se tomó como iniciadores
Identidades nucleotídicas coloreadas, alineadas con el editor de a la preprorregión altamente conservada con el
alineamientos Bioedit.
iniciador A.spuF1 específico y el iniciador AUAP
genérico que se une a la región conocida en el
La amplificación de una porción pequeña del extremo 5’ (Figura 4). Como resultado se obtuvo
precursor a partir de estos iniciadores indica que una secuencia de 357 pb, consistente con la longitud
el dominio altamente conservado de péptidos de los precursores de péptidos antimicrobianos de
antimicrobianos de la familia Hylidae, está la familia Hylidae (Vanhoye et al., 2003).

Figura 4. Esquema de la región amplificada y clonada usando métodos moleculares. En azul se observan la prepro-región altamente conservada
de precursores de péptidos antimicrobianos usada como iniciador corriente arriba (A.spF1) y el iniciador de amplificación universal AUAP
corriente abajo. En verde se observa la secuencia amplificada del precursor de péptidos antimicrobianos de A. spurrelli con 357 pares de base.
Este fragmento y sus iniciadores se encuentran en el dominio lacZ- (3.9 kb) del vector de clonación pCR 2.0-TOPO.

REMCB 36 (2), 2015


63

El alto índice de identidad que se obtuvo mediante


la comparación y alineamiento de la secuencia
resultante, con las secuencias precursoras de
péptidos antimicrobianos presentes en el Banco
Génico, NCBI, demostró que el extracto crudo de
A. spurrelli contiene una dermaseptina o un péptido
relacionado con las dermaseptinas. Se puede
asegurar que se trata de una dermaseptina, por el
alto grado de similitud de secuencias ortólogas con
otras especies de la familia Hylidae como Agalychnis
Figura 5. Secuencia aminoacídica obtenida a partir de la
annae (mRNA for dermaseptin-related peptide, secuencia precursora de péptidos de Agalychnis spurrelli.
clone AA-3-1) con 96 %, Agalychnis callidryas (mRNA Secuencia de 75 aminoácidos amplificada a partir de A.spuF1-
for DRP-AC1 precursor (drp-AC1 gene) con 89 %, AUAP. La secuencia nucleotídica se encuentra subrayada.
Phyllomedusa hypochondrialis (mRNA for dermaseptin
H1 y H2 protein precursor) con 87 % y Phyllomedusa
sauvagei (mRNA for preprodermaseptin S 12 y S13) de péptidos de la familia Hylidae, una propieza
con un 83 % de similitud (Tabla 3). acídica que mantiene el extremo Arginina-
Lisina, y la región N-terminal de precursores de
Posterior al análisis de las secuencias de ADN dermaseptinas (Vanhoye et al., 2003).
complementario se procedió a traducir las
Mediante la comparación de las secuencias
secuencias aminoacídicas, se obtuvo como
nucleotídicas y aminoacídicas de A. spurrelli con los
resultado seis marcos de lectura, los cuales fueron
secuencias presentes en el banco génico NCBI, se
alineados con secuencias ortólogas presentes
obtuvieron índices de identidad que nos indican que
en el Banco Génico NCBI. Todos los marcos de
estos amplicones, y las secuencias aminoacídicas,
lectura tuvieron índices de identidad altos. Esto poseen un alto grado de similaridad con secuencias
podría indicar una estrecha relación en el origen ortólogas de A. annae.
de los péptidos antimicrobianos o incluso un
origen común de los mismos. El marco de lectura La diversificación de los loci pudo haber sido parte
3’5’ Frame 1, obtuvo la similaridad más alta con de una estrategia evolutiva desarrollada por estas
Agalychnis annae con un 90 %. Mientras que con las especies como resultado de cambios del nicho
otras especies antes mencionada fluctúa entre 86 % ecológico, tomando en cuenta el dramático cambio
y 46 %, lo cual podría suponer una estrecha relación evolutivo de predadores microbianos (Duda et al.,
en el origen de los péptidos antimicrobianos de 2002). El uso de una familia de proteínas para realizar
ambas especies (Figura 5). estudios evolutivos y de relaciones filogenéticas
requiere de la identificación de miembros de esta
Adicionalmente, la secuencia aminoacídica de A. familia con funciones similares en la gama más
spurrrelli presenta la región altamente conservada amplia posible de organismos. La información

Tabla 3. Índices de identidad de la secuencia aminoaminoacídica traducida a partir de A.spuF1-AUAP (3’RACE) de Agalychnis
spurrelli comparados con las secuencias de sus ortólogos en otras especies
Especie Tipo De Secuencia Identidad Máxima
Agalychnis annae mRNA for dermaseptine-related peptide, clone AA-3-1 58%
Phyllomedusa hypocondrialis mRNA for dermaseptine H1 protein precursor (dsn-1 gene) 45%
Agalychnis callydrias Dermaseptine-like precursor DRP-AC-3 41%
Phyllomedusa hypocondrialis mRNA for dermaseptin H2 protein precursor (dsn-2 gene) 45%
Agalychnis callydrias mRNA for DRP-AC-1 precursor 41%
Phyllomedusa sauvagei mRNA for preprodermaseptin S12 (drsS1 gene) 44%
Phyllomedusa sauvagei Partial mRNA for preprodermaseptin S13 (drsS1 gene) 46%
Agalychnis callydrias mRNA for ARP-AC-1 precursor 43%
Agalychnis annae mRNA for dermaseptine-related peptide, clone AA-3-3 38%
Agalychnis annae mRNA for dermaseptine-related peptide, clone AA-3-4 30%
Agalychnis callidryas mRNA for ARP-AC1 precursor 90%
Phyllomedusa hypocondrialis mRNA for phyllosepti-8 protein precursor 86%
Phyllomedusa sauvagei mRNA preprodermaseptin S9 (drsS9 gene) 86%

Caracterización de péptidos antimicrobianos en anuros


Vargas et al.
64

extraída de la familia de proteínas puede usarse Citogenética y Biomoléculas de Anfibios (LICBA),


para el análisis de divergencia y relación evolutiva. de la Escuela de Ciencias Biológicas de la PUCE
Sin embargo, esta información debe ser comparada por su constante colaboración. A la Pontificia
con investigaciones sobre fisiología y bioquímica Universidad Católica del Ecuador por el apoyo
de los organismos (Lehninger et al., 2008). financiero otorgado al proyecto: Caracterización
química y citogenética de anfibios ecuatorianos.
No obstante, la información obtenida a partir de la
secuencia precursora de péptidos antimicrobianos REFERENCIAS BIBLIOGRÁFICAS
de A. spurrelli ha servido, en este estudio, para la
preliminar identificación de uno de los péptidos Amiche M, Ladram A, Nicolas P. 2008. A consistent
antimicrobianos presente en las secreciones de la nomenclature of antimicrobial peptides isolated
piel de dicho organismo. from frogs of the subfamily Phyllomedusinae.
Peptides, 247: 870-875.
CONCLUSIONES
Barra D, Simmaco M. 1995. Amphibian skin: A
•La secuencia nucleotídica precursora de péptidos promising resource for antimicrobial peptides.
antimicrobianos presente en Agalychnis spurrelli, Trends in Biotechnology, 13(6): 205-209.
pertenece a los precursores de antimicrobianos
de la subfamilia Phyllomedusinae, ya que Charpentier S, Amiche M, Mester J, Vouille
fue amplificada con las regiones altamente V, Le Caer JP, Nicolas P, Delfour A. 1998.
conservadas características de este grupo Structure, Synthesis, and Molecular Cloning
taxonómico. of Dermaseptins B, a Family of Skin Peptide
Antibiotics. The Journal of Biological Chemistry,
•Gracias al alto grado de conservación de 273(24): 14690-14697.
las secuencias nucleotídicas precursoras de
péptidos antimicrobianos de la subfamilia Chuang PH. 2012. Evaluación de la actividad
Phyllomedusinae, estas pudieron ser anticancerígena del extracto peptídico crudo
adecuadamente usadas como iniciadores de Agalychis spurrelli. Tesis de Lienciatura en
para la caracterización molecular de péptidos Ciencias Biológicas, Pontificia Universidad
antimicrobianos relacionados. Católica del Ecuador, Quito, Ecuador.

•La secuencia precursora de Agalychnis spurrelli Cilveti C, Rivera M, Rodríguez-Riglos M, Alcocer I.


posee un alto grado de identidad con su 2013. Inhibición de Enterobacterias Portadoras
ortólogo en la especie Agalychnis annae, por de Carbapenemasas con Secreciones Peptídicas
lo cual puede inferirse una historia evolutiva de Anfibios Nativos Ecuatorianos. Revista
muy cercana de estas especies por presiones de Ecuatoriana de Medicina y Ciencias Biológicas,
evolución adaptativa. Volumen XXXIV(1,2): 85-98.

•La secuencia aminoacídica del péptido Coloma LA, Hoomoed MS, Quiguango-Ubillús A.
antimicrobiano obtenida de Agalychnis spurrelli y 2011. Anfibios de Ecuador. Fundación Otonga.
las de sus ortólogos Agalychnis annae, Agalychnis En línea <http//www.puce.edu.ec/Zoología/
callidryas, Phyllomedusa hypochondrialis y anfecua.htm> Consμltado: Marzo, 2012.
Phyllomedusa sauvagei, posee una región altamente
conservada, una propieza acídica que exhibe el De Lucca A, Bland J, Jacks T, Grimm C, Walsh T.
extremo Arginina-Lisina, y una región C-terminal 1998. Fungicidal and binding properties of the
multivariable, regiones que son características de natural peptides cecropin B and dermaseptin.
los precursores de dermaseptinas. Medical Mycology, 36:291-298.

AGRADECIMIENTOS Duda TF, Vanhoye D, Nicolas P. 2002. Roles


of Diversifying Selection and Coordinated
Los autores expresan su imperecedero Evolution in the Evolution of the Amphibian
agradecimiento a la Dra. Iliana Alcocer Negrete del Antimicrobial Peptides. Molecular Biology and
Laboratorio de Microbiología de la PUCE y a la Dra. Evolution, 19(6): 858-864.
Jeannete Zurita, de Zurita&Zurita Laboratorios,
por su incondicional apoyo. Al personal de los Lehninger AL, Nelson DL, Cox M. 2008. Principles of
laboratorios de Microbiología, de Biología del Biochemistry. W.H. Freeman. New York, USA.
Desarrollo y del Laboratorio de Investigaciones de

REMCB 36 (2), 2015


65

Simmaco M, Mignogna G, Barra D. 1998. Vargas A. 2012. Pruebas antimicrobianas de


Antimicrobial Peptides from Amphibian Skin: secreciones cutáneas de Agalychis spurrelli
What do they tell us? Biopolymers (Peptide (Anura: Hylidae) en cinco especies de
Science), 47: 435-450. levaduras patógenas del género Candida.
Tesis de Lienciatura en Ciencias Biológicas,
Tennessen JA, Blouin MS. 2008. Balancing Selection Pontificia Universidad Católica del Ecuador,
at a Frog Antimicrobial Peptide Locus: Quito, Ecuador.
Fluctuating Immune Effector Alleles? Molecular
Biology and Evolution, 25: 2669-2680. Watson JD, Caudy AM, Myers RM, Wtkowski
JA. 2007. Recombinant DNA. Genes and
Vanhoye D, Bruston F, Nicolas P, Amiche M. 2003. Genomes-a short course. pp. 85-87. W.H.
Antimicrobial Peptides from Hylid and Ranin Freeman and Company.
frogs originated from 150-million-year-old
ancestral precursor with a conserved signal
peptide but a hypermutable antimicrobial
domain. European Journal of Biochimestry,
207:2068-2081.

Caracterización de péptidos antimicrobianos en anuros


Vargas et al.
66

REMCB 36 (2), 2015


67

Sensibilidad antimicrobiana y detección de genes


de virulencia en aislados clínicos de Shigella spp.
Irina Villacrés1, Iliana Alcocer1, Jeannete Zurita2 y Mercedes Rodríguez-Riglos1
1
Laboratorio de Microbiología, Escuela de Ciencias Biológicas,
Pontificia Universidad Católica del Ecuador, Quito, Ecuador, iralcocer@puce.edu.ec

2
Facultad de Medicina, Pontificia Universidad Católica del Ecuador, Quito, Ecuador.

Recibido: 2015-08-07; aceptado: 2015-10-05

RESUMEN.- El género Shigella comprende las especies S. flexneri, S. sonnei, S. boydii y S. dysenteriae,
bacterias responsables de la shigelosis. Éste género se caracteriza por la presencia de multirresistencia a
antibióticos y una variedad de factores de virulencia que permiten la infección al hospedero. El objetivo de
este estudio fue establecer la sensibilidad antimicrobiana y detectar genes de virulencia “Invasion plasmid
antigen H“, ipaH; “Invasion-associated locus”, ial; “Shigella toxin” Stx; “Shigella enterotoxin 1A”, set1A; y
“Shigella enterotoxin 1B”, set1B en aislados clínicos de Shigella spp. Se analizaron 79 aislados obtenidos de
Zurita & Zurita Laboratorios y del hospital Vozandes. Mediante serotipificación, se registraron tres especies:
S. flexneri (64.6 %), S. sonnei (29.1 %), y S. boydii (6.3 %). La sensibilidad antimicrobiana siguió el método
de difusión con disco según las recomendaciones del Clinical and Laboratory Standars Institute (CLSI). La
resistencia obtenida fue a tetraciclina (96.20 %), ampicilina (94.9 %), trimetoprima/sulfametoxazol (86.1 %)
y cloranfenicol (84.8 %). No se registraron aislados de Shigella con resistencia a ciprofloxacino, azitromicina
ni a ceftriaxona. Se determinó la presencia de genes de virulencia por la reacción en cadena de la polimerasa
(PCR). Se determinó una alta prevalencia de los genes ipaH (91.1 %) e ial (82.3 %), los genes codificantes
de enterotoxina 1 (set1A y set1B) se encontraron en un 35.4 %. Los resultados obtenidos demuestran la
existencia de multirresistencia a antibióticos y cepas virulentas.

PALABRAS CLAVES: enterotoxinas, genes de virulencia, resistencia antimicrobiana, serogrupos, Shigella spp.
ABSTRACT.- The genus Shigella includes S. flexneri, S. sonnei, S. boydii and S. dysenteriae, which are
producers of shigelosis. The genus are characterized due to multidrug resistance to antibiotics and a
variety of virulence factors that allow the infection to host. The objective of this study was to establish the
antibiotic susceptibility and detection of virulence genes in clinical isolates of Shigella spp.: invasion plasmid
antigen H (ipaH), invasion-associated locus (ial), Shigella toxin (Stx), Shigella enterotoxin 1A (set1A), and
Shigella enterotoxin 1B (set1B). We analyzed 79 strains from “Zurita & Zurita Laboratorios” and “Hospital
Vozandes”. Three species were identified: S. flexneri (64.6 %), S. sonnei (29.1 %), and S. boydii (6.3 %) by
antiserum agglutination. The antimicrobial susceptibility was performed by following the disk diffusion
method and recommendations of the Clinical and Laboratory Standards Institute (CLSI). High resistance
was observed to tetracycline (96.2 %), ampicillin (94.9 %), trimethoprim/sulfamethoxazole (86.1 %), and
chloramphenicol (84.8 %). No resistance was identified to ciprofloxacin, ceftriaxone and azitromicin. The
analysis of the presence of virulence genes was performed using the Polymerase Chain Reaction (PCR). A
high prevalence of genes ipaH (91.1 %) and ial (82.3 %) was determined, the encoding genes of enterotoxin
1 (set1 and set1B) were found in 35.4 % of the isolates. The results demonstrate the existence of multidrug
resistances to antibiotics and virulent strains of the genus Shigella.

KEYWORDS: antimicrobial resistance, enterotoxins, serogroups, Shigella spp., virulence genes.

INTRODUCCIÓN a la familia Enterobacteriaceae (Terragno et al.,


2007). Las cuatro especies del género Shigella que
El género Shigella (Shiga, 1989) comprende bacilos provocan todas las manifestaciones clínicas de
Gram negativos de 0.3 a 1.0 μm diámetro y de 1 la shigelosis, que pueden causar desde diarrea
a 6 μm de longitud, no móviles, no formadores de acuosa hasta diarrea exudativa fulminante, son
esporas, anaerobios facultativos, pertenecientes Shigella dysenteriae, Shigella flexneri, Shigella boydii y

Resistencia y virulencia en Shigella spp


Villacrés et al.
68

Shigella sonnei. La enfermedad más grave resulta de asociados al género Shigella, los más relevantes en
la infección causada por las especies S. dysenteriae este estudio son los que intervienen en la invasión y
tipo 1. Se considera que la cepas de S. flexneri son colonización del epitelio intestinal como los genes
menos virulentas, mientras que, las de S. boydii ipaH (invasión plasmid antigen H), que permite
y S sonnei, generalmente, originan episodios la diseminación facilitada de Shigella a través de la
autolimitados de diarrea acuosa con fiebre. No se mucosa y la inhibición de la coagulación inducida
ha establecido hasta el momento la razón por la por trombina que provoca la eliminación de sangre
cual en los países industrializados predominan en las heces (Hale, 1991) e ial (invasión-associated
las infecciones por cepas se S. sonnei y S. boydii, locus) que promueve la internalización e invasión
mientras que, los aislamientos de S. dysenteriae y S. del tejido “blanco” gracias a la producción de
flexneri son característicos de los países en vías de adhesinas e invasinas y permite la diseminación
desarrollo (Zurita, 2012). intercelular de la bacteria y el traslado y secreción
de diversos factores de virulencia (Noriega et
Su identificación se fundamenta en características al., 1999). El gen ipaH conocido como “invasión
bioquímicas y antigénicas, en base a ellas se plasmid antigen H” ha sido observado en el 99
describen cuatro especies: Shigella dysenteriae % de aislados de Shigella, determinándose como
(Shiga, 1898), perteneciente al serogrupo A; Shigella el gen más estable de detectar debido a que se
flexneri (Flexner, 1900), concerniente al serogrupo encuentra en el cromosoma y en el ADN plasmidial
B; Shigella boydii (Boyd, 1938), perteneciente al en múltiples copias (Lin Thong et al., 2005).
serogrupo C; y, Shigella sonnei (Sonne, 1915),
perteneciente al serogrupo D. Los grupos A, B y La enterotoxina 1 (ShET-1), es una proteína
C se subdividen en serotipos (número arábigo) codificada en el cromosoma bacteriano por los
y subtipo (letra minúscula) que son 12, 14 y 18, genes set1A (subunidad A de la proteína) de
respectivamente. El grupo D tiene un solo serotipo. 309 pb y set1B (subunidad B de la proteína) de
Todas ellas pueden causar disentería bacilar, 147 pb. La importancia de la enterotoxina 1
aunque con diferente gravedad (Zurita, 2012). en la virulencia de Shigella se ha descrito más
recientemente. Esta toxina parece relacionarse
La Organización Mundial de la Salud (2010) estima con la fase temprana de la diarrea acuosa en la
la ocurrencia de 165 millones de casos y 1.1 millones shigelosis, expresándose con mayor frecuencia en
de muertes por año, de las cuales alrededor de S. flexneri 2a. Sin embargo, el mecanismo por el
576000 son de niños menores de 5 años de edad. cual inicia la diarrea durante la shigelosis aún no
está claramente definido (Vargas et al., 1999).
La transmisión de estas bacterias se produce
principalmente por ruta fecal-oral directa o Otro factor de virulencia es la exotoxina Shiga, que
indirecta en lugares que se caracterizan por una es liberada únicamente durante la lisis celular. Su
higiene deficiente (Kotloff et al., 1999). La infección efecto es bloquear la síntesis proteica en la célula
surge posteriormente a la ingestión de 10 a 100 eucariota (Henhly et al., 1996). La exotoxina Shiga
microorganismos y los síntomas se presentan de 12 es una enterotoxina que se asocia con el serotipo A1
a 96 horas relativas al período de incubación de la de S. dysenteriae. Esta exotoxina es codificada por
bacteria (Mandell et al., 2009). el gen Stx de 895 pb. La principal complicación de
la liberación de la toxina Shiga es el desarrollo del
Síndrome Urémico Hemolítico.
La shigelosis es una enfermedad diarreica aguda
autolimitada, sin embargo, hay condiciones en las Por lo expuesto, el objetivo fue establecer la
cuales se encuentra establecido el tratamiento cuyo sensibilidad antimicrobiana y detectar genes de
objetivo principal es bajar la carga microbiana y la virulencia ipaH, ial, Stx, set1A y set1B en aislados
intensidad de los síntomas. Se recomienda el uso clínicos de Shigella spp., por medio de pruebas
de ceftriaxona en lactantes menores de 6 meses que fenotípicas y genotípicas.
requieran hospitalización así como ciprofloxacino
en adultos mayores con deshidratación severa.
Debido a que el inóculo es muy bajo, también
MATERIALES Y MÉTODOS
se recomienda tratamiento en los casos de
Población de estudio.- El presente estudio incluyó un
hacinamiento (Zurita, 2012).
total de 79 aislados clínicos de Shigella spp., obtenidos
en Zurita & Zurita Laboratorios (Quito, Ecuador) y
El género Shigella presenta una variedad de
del hospital Vozandes en Quito. Fueron colectados
factores de virulencia que le permiten el ingreso
durante el año 2005 al año 2010. Las muestras
a la mucosa gástrica, evadiendo las defensas del
provienen de procesos infecciosos documentados.
hospedero. Varios de estos factores han sido

REMCB 36 (2), 2015


69

Los aislados se mantienen en la Colección Culture Collection, ATCC: S. sonnei 25931; S. boydii
Bacteriana Quito Católica, CB-QCA del (1) 9207; y S. flexneri (2b) 12022. Para los controles
Laboratorio de Microbiología en la Escuela de negativos se utilizó una gota de cloruro de sodio al
Ciencias Biológicas con registro de los códigos 0.85 % y la cepa Escherichia coli ATCC 25922.
hospitalarios, fechas de aislamiento, origen de los
aislados, sexo y edad de los pacientes. Sensibilidad a los antimicrobianos.- Para este
procedimiento fue utilizado el método de difusión
Identificación bioquímica del género Shigella.- con disco (Bauer et al., 1966) en agar Müller-Hinton
El género Shigella de acuerdo con sus reacciones (Difco TM) con sujeción a las recomendaciones
bioquímicas se identifica como un bacilo no propuestas por el Clinical and Laboratory Standars
mótil, no fermentador de lactosa, productor o no Institute (CLSI, 2015).
de ornitina descarboxilasa según la especie, no
productor de triptofanasas y que presenta una Detección molecular de genes de virulencia en
fermentación butilén-glicólica. Para evidenciar Shigella spp.- La extracción del ADN total se realizó
este perfil se realizaron las pruebas bioquímicas con el empleo del método sugerido por Carvalho
estándares: agar con triple azúcar y hierro (TSI), et al. (2001). La confirmación de la integridad del
motilidad, indol, ornitina (MIO) y rojo de metilo ADN para la realización de la reacción en cadena
(RM)/Vogues-Proskauer (VP), a partir de colonias de la polimerasa PCR fue realizada mediante la
aisladas en agar entérico Hecktoen (Difco, 2003). amplificación del gen codificante de la subunidad
16S del ribosoma bacteriano. Los iniciadores
Identificación serológica de las especies del utilizados para la amplificación del gen 16S
género Shigella.- La serotipificación se realizó descritos por Malhotra-Kumar et al. (2005) se
mediante la técnica de aglutinación en lámina encuentran detallados en la Tabla 1. Para medir el
propuesta por Edwars y Edwing (1972) y conforme peso molecular de las bandas obtenidas se utilizaron
a las recomendaciones del Manual Difco Shigella O 100 bp DNA Ladder TrackltTM (Invitrogen). Como
Antisera (2011). Mediante esta técnica se puso en control negativo se utilizó agua de grado molecular
evidencia la presencia de antígenos somáticos O y como control positivo para el gen 16S ARNr se
enfrentando el antisuero polivalente (anticuerpo) empleó la cepa S. flexneri ATCC (2b) 12022.
con la bacteria (antígeno). Las cepas fueron
enfrentadas con los cuatro antisueros policlonales El ciclo de amplificación del gen 16S fue llevado
comerciales Difco Shigella Antisera Poly de a cabo en un termociclador Labnet Multigene
serogrupos: Grupo A, S. dysenteriae, serotipos 1-7; Model TC9600-G programando un ciclo de
Grupo B, S. flexneri, serotipos 1-6; Grupo C, S. boydii, desnaturalización inicial a 93° C por 3 minutos,
serotipos 1-7; y, Grupo D, S. sonnei, serotipos I y II. seguido de 27 ciclos, los cuales consistieron en
Para la utilización de los antisueros policlonales un paso de desnaturalización a 93° C por 30
y la validación de los resultados, se realizaron segundos, seguido de un paso de anillamiento
controles positivos y negativos. Para el control a 59.3° C 45 segundos, y un último paso de
positivo se utilizaron las cepas American Type extensión a 65° C por 45 segundos; finalmente un

Tabla 1. Iniciadores utilizados para la identificación de varios genes asociados a mecanismos de virulencia en Shigella spp y el 16S.

Iniciador Gen de Secuencia de nucleótido (5’ a 3’) Tamaño Referencia


virulencia Amplicón (pb)
16S rRNA F rrs GAGTACGACCGCAAGGTTGA 100 Malhotra-Kumar et al. (2005)
16S rRNA R rrs CTGGTAAGGTTCTTCGCGTTG 100 Malhotra-Kumar et al. (2005)
ShET1AF set1A TCACGCTACCATCAAAGA 309 Fusano et al. (1995)
ShET1AR TATCCCCCTTTGGTGGTA
ShET1BF set1B GTGAACCTGCTGCCGATATC 147 Fusano et al. (1995)
ShET1BR ATTTGTGGATAAAAATGACG
ialR ial CTGGATGGTATGGTGAGG 320 Frankel et al. (1989)
ialR GGAGGCCAACAATTATTTCC
Shig1 ipaH TGGAAAAACTCAGTGCCTCT 423 Lüscher y Altewegg (1994)
Shig2 CCAGTCCGTAAATTCATTCT
StxF Stx CAGTTAATGTGGTTGCGAAG 895 Frankel et al. (1989)
StxFR CTGCTAATAGTTCTGCGCATC

Resistencia y virulencia en Shigella spp


Villacrés et al.
70

ciclo de extensión a 72° C durante 5 minutos. Los CB-QCA 3349 Shigella flexneri que posee cuatro de
productos resultantes de la reacción en cadena de los cinco genes en estudio: ipaH, ial, set1A y set1B.
la polimerasa fueron almacenados a -20° C hasta su Los productos de PCR fueron enviados a Macrogen
análisis electroforético. Korea para su secuenciamiento. Las muestras
fueron purificadas a partir de gel de agarosa con la
Para la identificación de genes de virulencia utilización del Kit Wizard ® SV Gel and PCR Clean-
en Shigella spp., se emplearon los iniciadores Up System. Las secuencias fueron editadas con el
previamente descritos por Fusano et al. (1995) y programa Genius versión 7.0 y alineadas con las
Lüscher y Altewegg (1994) los cuales se encuentran secuencias depositadas en el GENBANK mediante
detallados en la Tabla 1. la utilización de la herramienta BLAST.

Para la reacción en cadena de la polimerasa se usó Análisis estadístico.- El análisis porcentual de los
el ADN total. Las condiciones de amplificación resultados se realizó mediante el empleo de Microsoft
utilizadas son descritas por Lin Thong et al. (2005) Office Excel 2010 (©2010 Microsoft Corporation).
y Vargas et al. (1999). Como control negativo se Para el estudio de los resultados obtenidos tanto en
utilizó agua de grado molecular en lugar de ADN la serotipificación como en la presencia de genes de
y como control positivo para todos los genes en virulencia, y resistencia a antimicrobianos, se utilizó
estudio se empleó la cepa CB-QCA 3349 Shigella el método estadístico de análisis de correspondencias
flexneri pues este aislado posee cuatro de los cinco múltiples (MCA), con el cual se determinó la
genes en estudio: ipaH, ial, set1A y set1B. contribución de varios factores en un simple
evento o resultado, mediante la comparación de los
La PCR fue estandarizada en un volumen de 25 diferentes serotipos utilizados, con la presencia de
μl, que contiene: 12.5 μl de Green 0.4 mM de cada genes y la resistencia a antibióticos individualmente.
iniciador (Invitrogen) y 1 μl de ADN. Para este análisis se empleó el programa estadístico
informático “Statistical Package for the Social
El programa de amplificación de los genes se realizó Sciences” (SPSS) versión 12.0.
en un termociclador Labnet Multigene Model
TC9600-G. Se inició el programa de PCR con una RESULTADOS
desnaturalización inicial de 95° C por 5 minutos,
seguido de 30 ciclos con una desnaturalización a 95° C Población de estudio.- De los 79 aislados, 61
durante 50 segundos, anillamiento, para los genes muestras (77.20 %) fueron obtenidas a partir de heces,
ipaH, ial, y set1B a 52°C por 1.5 minutos; para el gen 18 muestras (22.8 %) a partir de secreciones vaginales.
set1A a 48° C por 1.5 minutos; para el gen Stx a 55° C
por 1.5 minutos; y, extensión a 72º C durante 2 Identificación serológica de las especies del género
minutos, seguido de un ciclo de extensión final a Shigella.- Por medio del método de aglutinación en
72° C por 7 minutos. lámina se obtuvo la identificación de las especies
del género Shigella, obteniéndose 51 aislados (64.6
El peso molecular de las bandas obtenidas para %) positivos para Shigella flexneri, 23 aislados (29.1
cada gen fue estimado visualmente mediante el %) para Shigella sonnei, 5 aislados (6.3 %) positivos
uso de 100 bp DNA Ladder TrackltTM (Invitrogen). para Shigella boydii, y 0 % de aislados positivos para
Shigella dysenteriae (Figura 1).
Análisis de los productos de amplificación.- Los
productos de PCR fueron analizados mediante
electroforesis horizontal en geles de agarosa al 1.0
% en tampón TBE 1 X (89 mM de Tris, 89 mM de
ácido bórico y 2.50 mM de EDTA). El programa de
electroforesis consistió en la aplicación de 8V/cm
durante 45 minutos en tampón TBE 0.5 X. La tinción
del gel se realizó con el empleo de SYBRGold
(Invitrogen). Los resultados fueron documentados
en el sistema de captura de imágenes MiniBis Pro
(DNR Bio- Imaging Systems) con la ayuda del
programa informático GelCapture 4.5.3.

Validación de los genes de virulencia.- Para


Figura 1. Porcentaje de identificación de las diferentes especies
validar el protocolo de amplificación y confirmar la
en la población total de aislados de Shigella spp. N=79
identidad de la cepa se utilizó como control el aislado

REMCB 36 (2), 2015


71

De los 51 aislados de Shigella flexneri, 33 (64.7 %) fueron


aislados de heces y 18 (35.3 %) de secreción vaginal.
De los 23 aislados de Shigella sonnei, 23 (100 %) fueron
aislados de heces. De los 5 aislados de Shigella boydii,
también el 100 % fueron aislados de heces.

Sensibilidad a los antimicrobianos.- La


sensibilidad a antimicrobianos obtenida para
los diferentes antibióticos enfrentados con los
aislados de Shigella spp., se observa en la Figura
2. Analizando globalmente el género, se observó
que 76 aislados (96.2 %) presentan una resistencia a Figura 3. Representación fotográfica en gel de agarosa de la
amplificación de los genes ipaH, ial, set1A y set1B en Shigella
tetraciclina, 75 aislados (94.9 %) fueron resistentes a spp. M, marcador de peso molecular (100pb); Pocillo 1, control
ampicilina, 68 aislados (86.1 %) fueron resistentes a positivo gen ipaH cepa CB-QCA 3349 Shigella flexneri; Pocillo
trimetoprima/sulfametoxazol, 67 aislados (84.8 %) 2, muestra positiva de Shigella spp. para el gen ipaH; Pocillo
presentaron resistencia a cloranfenicol, 7 aislados 3, control positivo gen ial cepa CB-QCA 3349 Shigella flexneri;
Pocillo 4, muestra positiva de Shigella spp. para el gen ial; Pocillo
(8.9 %) fueron resistentes a ácido nalidíxico, 5, control positivo gen set1A cepa CB-QCA 3349 Shigella flexneri;
4 aislados (5.1 %) presentaron resistencia a Pocillo 6, muestra positiva de Shigella spp. para el gen set1A;
nitrofurantoina y no se encontró aislamientos Pocillo 7, control positivo gen set1B cepa CB-QCA 3349 Shigella
con resistencia a ciprofloxacino, azitromicina ni a flexneri; pocillo 8, muestra positiva de Shigella spp. para el gen
set1B; Pocillo 9, control negativo, agua de grado molecular.
ceftriaxona, (Figura 2). Como control positivo fue
incluido el análisis de las cepas ATCC: S. sonnei
25931, S. boydii (1) 9207 y S. flexneri (2b) 12022, el gen ial se presentó en 65 aislados (82.3 %), 47
las cuales mostraron sensibilidad a todos los aislados (59.5 %) presentaron el gen set1B y 32
antibióticos utilizados. aislados (40.5 %) el gen set1A. Ningún aislado
evidenció presencia del gen Stx (Figura 4). Seis
aislados (7.6 %) no presentaron ningún gen de los
analizados en este estudio.

Figura 2. Porcentaje de resistencia a antibióticos dentro de la


población de Shigella spp. N=79
Figura 4. Porcentaje de presencia de los genes set1A, set1B, ial,
ipaH y Stx en la población total de aislados de Shigella spp. N=79
Detección molecular de los genes de virulencia en
Shigella spp.- Para el gen 16S ARNr se obtuvo un
98 % de identidad, para el gen ipaH se obtuvo un Según el análisis estadístico existe alta
100 % de identidad, para el gen ial se obtuvo el 99 heterogeneidad en los patrones de resistencia al
% de identidad en un total de 10 secuencias donde relacionarlos con las especies con una concentración
se producen alineamientos significativos, para el superior de casos de S. flexneri multirresistentes en
gen set1A se obtuvo 100 % de identidad y para el relación con las otras especies.
gen set1B se obtuvo un 99 % de identidad.
La presencia de los cuatro genes ipaH, ial, set1A y
Análisis de presencia o ausencia de genes de set1B en conjunto se encuentra exclusivamente en
virulencia.- El análisis de la presencia de los genes S. flexneri. Para S. sonnei se observó una mayor
fue evidenciado mediante la amplificación en gel concentración de casos con presencia de genes
de agarosa obteniéndose las bandas con el peso set1A y set1B. En el caso de S. boydii se observó una
específico para cada gen estudiado (Figura 3). mayor presencia del gen ial.

Los resultados obtenidos para el total de 79 indican En la Tabla 2 se encuentran en detalle los patrones
que 72 aislados (91.1 %) presentaron el gen ipaH, de virulencia en Shigella. Shigella flexneri tiene

Resistencia y virulencia en Shigella spp


Villacrés et al.
72

principalmente el patrón de virulencia 1 con la Entre los marcadores fenotípicos la serotipificación


presencia de los genes ipaH, ial, set1A y set1B es el método de mayor agudeza para la especiación
con 28 aislados que indican la producción de la del género Shigella. Este método permite realizar
enterotoxina 1 (set1A y set1B), la producción de estudios de vigilancia que determinen la prevalencia
los genes de la invasión y colonización del epitelio de serogrupos y serovariedades en diferentes
intestinal (ipaH) y de la producción de adhesinas zonas geográficas, ya sea en estudios de brotes o
e invasinas que permiten la diseminación de casos esporádicos (Guerrant et al., 1999). En este
intercelular de la bacteria (ial). En esta especie estudio se utilizó con el 100 % de éxito el método de
todos los aislados presentaron el gen ipaH excepto 4 serotipificación en los aislados de Shigella se obtuvo
aislados que no tuvieron ningún gen. En la especie la presencia de las especies S. flexneri, S. sonnei y S.
S. sonnei el patrón de virulencia prevalente fue boydii. No se han registrado en revistas indexadas,
el 4 con la presencia de los genes ipaH, ial y set1B hasta la fecha, cepas de S. dysenteriae en el Ecuador
en 11 aislados. En esta especie todos los aislados ni en 10 años de vigilancia de la resistencia (Zurita,
presentaron el gen ipaH excepto 2 aislados que no 2012). En este estudio, mediante serología, no se
tuvieron ningún gen. Finalmente en la especie S. identificó S. dysenteriae.
boydii se vio principalmente el patrón de virulencia
ipaH, set1B, ial y el patrón ipaH, ial. Todos los Estudios relativos a la identificación de especies
aislados en esta especie tuvieron el gen ial. dentro del género Shigella han determinado que

Tabla 2. Patrones de virulencia mostrados por los aislados de Shigella spp.

Especies
Genotipos de virulencia Patrón S. flexneri S. sonnei S. boydii Total de cepas %
1 ipaH,set1A,set1B, ial 28 28 35.4
2 ipaH, ial 7 7 2 16 20.3
3 ipaH, set1A, ial 1 1 1.3
4 ipaH, set1B, ial 6 11 2 19 24.1
5 ipaH, set1A 2 1 3 3.8
6 ipaH 3 2 5 6.3
7 ial 1 1 1.3
8 ninguno 4 2 6 7.6
Total 51 23 5 79 100.0

ipaH, invasión plasmid antigen H; ial, invasión-associated locus; set1A, enterotoxina 1-subunidad A; set1B, enterotoxina 1-subunidad B.

DISCUSIÓN en países en vías de desarrollo la circulación


prevalente es de S. flexneri y S. dysenteriae; mientras
Las enfermedades diarreicas a nivel mundial han que, S. sonnei y S. boydii son característicos en
sido atribuidas a diferentes agentes infecciosos y países industrializados.
uno de los más comunes es Shigella. Mundialmente
se producen unos dos mil millones de casos de En el presente estudio se observó que la especie
diarrea cada año y se consideran como la segunda más común es S. flexneri con un 64.6 %, seguida por
mayor causa de muerte de niños menores de S. sonnei con un 29.1 %, S. boydii con un 6.3 % y
cinco años (OPS, 2009). A nivel de Latinoamérica no se reportó S. dysenteriae. Estos datos concuerdan
y el Ecuador las enfermedades diarreicas agudas con los datos publicados para Latinoamérica,
(EDA) son la segunda causa de morbilidad en la especialmente estudios realizados en Brasil,
población en general y de mortalidad en niños Uruguay, Cuba y Argentina donde la información
menores de 5 años y adultos mayores (INEC, para la prevalencia de estas especies de Shigella
2009). Al ser las enfermedades transmitidas por es similar (Mota et al., 2005; Merino et al., 2004;
alimentos un problema de salud a nivel mundial se Ramírez et al., 2004; Silva et al., 2008).
considera imprescindible realizar la capacitación en
identificación y determinación de la sensibilidad de Durante años las enfermedades diarreicas como
los antibióticos en enfermedades entéricas debido a la shigelosis han sido tratadas mundialmente
razones epidemiológicas (OPS, 2009). con el uso de antibióticos como trimetoprima/
sulfametoxazol, ampicilina, ciprofloxacino y
azitromicina (Silva et al., 2008). Sin embargo, la

REMCB 36 (2), 2015


73

aparición de aislados multirresistentes ha limitado perianal por un cuadro anterior de diarrea y


el tratamiento y ha incrementado la prevalencia que por la proximidad anatómica llega a la zona
de la enfermedad (Silva et al., 2008). La diversidad genital, causa un proceso inflamatorio de la vulva
de fenotipos de resistencia mostrados por los y vagina acompañado de sangrado. Esto se debe
aislados pudiera deberse a que la resistencia de a que la fisiopatología de Shigella se manifiesta
este es mediada por plásmidos, con la excepción de igual manera que en el epitelio intestinal, en
para quinolonas y azitromicina y además por el epitelio vaginal que está exento de estrógenos
integrones o transposones que estén incorporados (Ocampo et al., 2014).
al cromosoma bacteriano (Ramírez et al., 2004).
El género Shigella produce principalmente
Estudios competentes relacionados con la enfermedades diarreicas que pueden llevar a
resistencia a antimicrobianos en Shigella spp. en serias complicaciones debido a que las diferentes
países de Latinoamérica como Brasil, Chile, Cuba, especies integrantes del género presentan factores
Argentina, y Uruguay reportan una alta resistencia de virulencia como genes de invasión celular,
a los antibióticos trimetoprima/sulfametoxazol, enterotoxinas y exotoxinas que afectan severamente
cloranfenicol y ampicilina (Silva et al., 2008; Boehme al paciente, lo cual posteriormente en casos severos
et al., 2002; Ramírez et al., 2004; Vila et al., 1994; puede llevar a la muerte (Jiménez y Achí, 2009).
Mota et al, 2005). Mientras que para países como
Canadá, Senegal e India se reporta una resistencia a El gen ipaH es considerado uno de los genes más
la ampicilina y tetraciclina (Bassa et al, 2010). estables y presentes en todas las especies de Shigella
en razón que se encuentra tanto en el cromosoma
Para Ecuador según Zurita (2012) el porcentaje bacteriano como en múltiples copias en ADN
de resistencia en Shigella flexnerii a ampicilina, plasmidial (Lin Thong et al., 2005) además este
tetraciclina, trimetoprima/sulfametoxazol y gen se encuentra identificado en otras bacterias
cloranfenicol sobrepasa el 60 %. Durante la patógenas como en E. coli enteropatógena, por lo
vigilancia del año 2000 al 2010 no se han detectado que se lo considera un gen con altas características
aislamientos de Shigella resistentes a cefalosporinas virulentas (Aranda et al, 2004). En los análisis
de tercera generación y quinolonas. Las otras realizados el gen ipaH fue encontrado en el 91.1 %
especies de Shigella como S. boydii y S. sonnei se de los aislados, postulándose como el de mayor
aíslan en bajo número por lo que, no permiten sacar presencia dentro de los genes analizados en este
conclusiones de porcentaje resistencia. No se han estudio. La variación de este porcentaje con lo
detectado aislamientos de S. dysenteriae durante descrito por otros autores se puede deber a que
estos diez años de vigilancia. las cepas negativas sufrieron mutación o deleción
del gen (Silva et al., 2008). Aunque esto es muy
En este estudio se observó una alta resistencia poco probable ya que el gen se encuentra en el
a tetraciclina, cloranfenicol, ampicilina y cromosoma bacteriano y en copias en el plásmido
trimetoprima/sulfametoxazol lo que concuerda de invasión, estos casos se observan en cepas poco
con los datos reportados a nivel mundial y virulentas o algunas que se han mantenido en
especialmente en Latinoamérica (Bassa et al., congelación por mucho tiempo como es el caso de
2010; Zurita, 2012). los aislados utilizados en este estudio (Silva et al.,
2008). Siete aislados (8.9 %) no presentaron el gen
Debido a que en los niños no está indicado el uso ipaH de estos 6 (7.6 %) tampoco presentaron los
de ciprofloxacino, se recomienda alternativamente otros genes de estudio.
utilizar el ácido nalidíxico (Replogle et al., 2000), pero
el inconveniente es que su uso genera rápidamente Aunque el gen ial está encargado de permitir la
resistencia. La cefalosporina de tercera generación invasión celular, en algunos casos no se observó
como ceftriaxona está indicada para lactantes que la presencia de éste. Tal comportamiento se debe
requieren hospitalización debido a la gravedad del a que el gen ial reside en una región del plásmido
cuadro clínico. En adultos y niños menores de 5 que es un “hot spot” para deleción espontánea
años está indicado ciprofloxacino como droga de (Lin Thong et al., 2005). En este estudio se
primera elección y la azitromicina está indicada comprobó esta afirmación obteniéndose una
para los niños que pueden ser manejados en forma presencia del gen en los aislados estudiados del
ambulatoria (Saurina et al., 2000). 82.3 % y es el segundo gen presente dentro de los
analizados en este trabajo.
En este estudio 18 aislamientos provinieron de
muestras de secreción vaginal aisladas en niñas En estudios anteriores autores describen que
menores de 9 años. La vulvovaginitis causada la presencia de los genes set1A y set1B juntos,
por Shigella, se debe a colonización de la zona únicamente se observan en la especie S. flexneri

Resistencia y virulencia en Shigella spp


Villacrés et al.
74

concluyéndose que estos genes se encuentran muy baja resistencia a nitroflurantoina. No se


altamente conservados en esta especie (Noriega et al., registraron aislados de Shigella con resistencia
1995; Vargas et al., 1999). Según los datos recopilados a ciprofloxacino, azitromicina ni a ceftriaxona.
en este análisis, se ratifica lo antes mencionado
porque se obtuvo un 35.4 % de presencia de estos •Los genes de virulencia se encuentran en alta
genes juntos y dentro de este porcentaje el 100 % proporción en los aislamientos de Shigella
de los aislados positivos pertenecen a la especie principalmente los genes ipaH e ial. Los genes
S. flexneri, es decir que al presentarse en conjunto ipaH permiten la invasión y colonización del
estos dos genes únicamente en la especie S. flexneri epitelio intestinal y los genes ial la formación
se podría afirmar que esta es la única especie de adhesinas e invasinas y la diseminación
productora de la enterotoxina ShET-1. intercelular de la bacteria.

La presencia de uno de los genes no indica que •Los genes set1A y set1B productores de
la cepa sea virulenta por lo que es importante la enterotoxina 1 ShET-1 se encontraron
evaluar los resultados globalmente (Lin Thong et exclusivamente en la especie S. flexneri que es
al., 2005). En este estudio se formaron patrones la especie prevalente lo que contribuye a una
de virulencia según los genotipos encontrados en mayor toxicidad.
los aislados estudiados. El patrón de virulencia
con mayor presencia es el número 1 (ipaH, set1A, •No se encontró Shigella toxin, esto se debe que esta
set1B, ial) lo que significa que la mayoría de los toxina es producida en su mayoría para la especie
aislados presentan 4 de los 5 genes estudiados. S. dysenteriae y en el análisis no se identificó esta
Estos resultados sugieren que la mayoría de cepas especie dentro de las muestras aisladas.
aisladas son de carácter altamente virulento.
AGRADECIMIENTOS
Los análisis estadísticos demostraron que existe Los autores desean agradecer al grupo de trabajo
una relación entre las especies y su patogenicidad del Laboratorio de Microbiología de la Escuela
y virulencia, así se determinó a la especie S. flexneri de Ciencias Biológicas, PUCE, Quito, a todo
con la mayor presencia de los genes de virulencia el personal de Zurita & Zurita Laboratorios y
estudiados y con la mayor multirresistencia del hospital Vozandes, Quito. Este estudio fue
a antimicrobianos. Las especies S. sonnei y S. realizado con fondos del Proyecto “Diversidad
boydii presentan a su vez genes de virulencia y Genómica y perfil de resistencia a antimicrobianos
multirresistencia pero en menor proporción que la en bacterias entéricas” (Código de Proyecto
especie S. flexneri. G13019) y del proyecto “Genotipaje de la resistencia
a antimicrobianos en bacterias entéricas” (Código
Los resultados conseguidos en este estudio G13034) financiados por la Pontificia Universidad
representan los primeros relacionados con genes Católica del Ecuador.
de virulencia y resistencia a antibióticos en el país.
En esta bacteria se observó claramente la presencia REFERENCIAS BIBLIOGRÁFICAS
de cepas multirresistentes a antibióticos utilizados
comúnmente como tratamiento primario de Aranda K, Fagundes-Neto U y Scaletsky I. 2004.
shigelosis, esto, combinado con la alta virulencia de Evaluation of Multiplex PCR for Diagnosis of
las cepas, representa un problema para el control y Infection with Diarrheagenic Escherichia coli
tratamiento de esta bacteria. and Shigella spp. Journal of Clinical Microbiology,
42 (12):5849-5853.
CONCLUSIONES
Bassa A, Dadie A, Guessennd N, Gbonon V, Dako E,
•La mayor prevalencia se determinó en la especie Dje M y Dosso M. 2010. Virulence Factors and
S. flexneri (64.6 %), seguida de la especie S. sonnei Resistance Profile of Shigella Isolated During
(29.1 %) y finalmente la especie S. boydii (6.3 %). Infectious Diarrhea in Abidjan, Côte D’Ivoire.
No se identificaron aislados pertenecientes a la Journal of Applied Sciences Research, 6 (6):594-599.
especie S. dysenteriae.
Clinical and Laboratory Standards Institute. 2015.
•Los aislados de Shigella flexneri, S. sonnei Performance standards for antimicrobial
y S. boydii presentaron mayor resistencia susceptibility testing; Twenty-fifth.
a tetraciclina, seguido de ampicilina, Informational Supplement, CLSI document.
trimetoprima/sulfametoxazol y finalmente, Clinical and Laboratory Standards Institute,
cloranfenicol. Mientras que presentaron una Wayne, Pennsylvania, USA. 240 pp.

REMCB 36 (2), 2015


75

Difco. 2011. Manual Difco Shigella Antisera Poly Malhotra-Kumar S, Lammens C, Piessens, J
O. Becton, Dickinson and Company. County y Goossens H. 2005. Multiplex PCR for
Clare, Ireland. pp. 11-13. Simultaneous Detection of Macrolide and
Tetracycline Resistance Determinants
Difco. 2003. Manual of Microbiological Culture in Streptococci. Antimicrobial Agents and
Media. BD Diagnostic Systems. USA 696 pp. Chemotherapy, 49 (11): 4798–4800.

Edwards P y Edwing W. 1972. Identification of Mandell GL, Bennett JE y Dolin R. 2009. Principles
Enterobacteriaceae. Third edition. Burgers Publ. and Practice of Infectious Diseases. 7th edition.
Co. Minneapolis, United States of America. Philadelphia, USA. Chap. 224.

Fusano A, Noriega F, Maneval D, Chanasongcram Merino A, Hreñuk E, Ronconi M y Alonso M.


S, Russell R, Guandalini S y Levine M. 1995. 2004. Resistencia a antibióticos y epidemiología
Shigella enterotoxin 1: an enterotoxin of Shigella molecular de Shigella spp. en el nordeste argentino.
flexneri 2a active in rabbit small intestine in Revista Panamericana de Salud Pública, 15 (4):219-24.
vivo and in vitro. Journal of Clinical Investigation,
95:2853-2861. Mota I, Varela G, Gadea M, Caffer M, Sirok A y
Schelotto F. 2005. Serotipos, perfil plasmídico
Guerrant RL, Hughes JM y Lima J. 1999. Diarrhea y antibiotipos de cepas de Shigella flexneri
in developing countries: magnitude, special aisladas de niños menores de 5 años con diarrea
setting and etiologies. Journal of Infectious sanguinolenta usuarios de los servicios de Salud
Diseases Supplement, 1:S41. Pública. Revista Médica de Uruguay, 21:30-36.

Hale T. 1991. Genetic basis of virulence in Shigella Noriega F, Liao FM, Maneval DR y Ren S. 1999.
species. Microbiological Reviews, 2:206-224. Formal SB and Levine M: Strategy for cross
protection among Shigella flexneri serotypes.
Henhly H, Sheff D y Stamnes M. 1996. Shiga toxin Infection & Immunity, 67(2):782-788.
facilitates its retrograde transport by modifying
microtubules dynamics. Molecular Biology Cell, Ocampo D,  Rahman, G,  Giugno S, Risso P y
17:4379-4389. Rubinstein A. Vulvovaginitis in a pediatric
population: relationship among etiologic
INEC. 2009. Anuario de Estadísticas Hospitalarias: agents, age and Tanner staging of breast
Camas y Egresos. Diez principales causas de development.  2014. Archivos argentinos de
morbilidad. Lista Internacional Detallada- pediatría,  112(1):65-74.
CIE-10.
Organización Panamericana de la Salud. 2009.
Jiménez K y Achí R. 2009. Interacciones celulares en Informe Anual de la Red de Monitoreo/
el proceso de invasión de Shigella spp. Revista Vigilancia de la Resistencia a los Antibióticos.
Panamericana de Infectología, 11 (2):56-61. Basilia- Brasil.

Klotloff KL, Winickoff JP, Ivanoff B, Clemens Organización Panamericana de la Salud, 2010
JD, Swerdlow DL, Sandonetti PJ, Adak http://www.who.int/topics/shigella/es/
GK y Levine MM. 1999. Carga mundial de [Consultado 6 de agosto de 2011].
infecciones por Shigella: implicaciones para
el desarrollo de vacunas y la aplicación de Ramírez M, Valdés N, Bravo L, Fernández A y Castañeda
estrategias de control. Bulletin of the World N. 2004. Perfil plasmídico resistencia antimicrobiana
Health Organization, 77 (8):651-666. en cepas de Shigella aisladas en Cuba. Revista Cubana
de Medicina Tropical, 56(3):178-85.
Lin Thong K, Ling Hoe S, Puthucheary S y Yasin R.
2005. Detection of virulence genes in Malaysian Replogle M, Fleming D y Cieslak O. 2000. Emergence
Shigella species by multiplex PCR assay. Journal of Antimicrobial-Resistance Shigellosis in
of Infectious Diseases, 5:5-8. Oregon. Clinical Infectious Diseases, 30:515-9.

Lüscher D y Altewegg M. 1994. Detection of Saurina G, Quale JM y Manikal VM. 2000.


Shigellae, enteroinvasive and enterotoxigenic Antimicrobial resistance in Enterobacteriaceae
E. coli in the polymerase chain reaction (PCR) in Brooklyn, NY: epidemiology and relation to
in patient returning from tropical countries. antibiotic usage patterns. Journal Antimicrobial
Molecular and Cellular Probes, 8:285-290. Chemotherapy, 45:895-8.

Resistencia y virulencia en Shigella spp


Villacrés et al.
76

Silva T, Nogueira A, Magalhaes F, Fagundes A Vargas M, Gascon J, Jiménez de Anta M y Vila J.


Pereira, L y Puccinelli P. 2008. Characterization 1999. Prevalence of Shigella Enterotoxins 1 and
of Shigella spp. by antimicrobial resistance 2 among Shigella Strains Isolated from Patients
and PCR detection of ipa genes in an infantile with Traveler’s Diarrhea. Journal of Clinical
population from Porto Velho (western Amazon Microbiology, 37 (11): 3608-3611.
region), Brazil. Memorias del Instituto Osxaldo
Cruz, Rio de Janeiro, 103 (7):731-733. WHO. 2011. 10 facts on antibmicrobial resistance.
Antimicrobial resistance. Fact sheet N°194.
Terragno R, Caffer M y Binsztein N. 2007. Disponible en: http://www.who.int/
Manual de procedimientos, diagnóstico y mediacentre/factsheets/fs194/en/index.html
caracterización de Shigella spp. Departamento [Consultado 6 de agosto de 2011].
de Bacteriología. Instituto Nacional de
Enfermedades Infecciosas. A.N.L.I.S. “Dr. Zurita J. 2012. Datos de Resistencia Bacteriana
Carlos G. Malbrán”. Centro Regional de en el Ecuador. En: Resistencia Bacteriana en
Referencia del WHO Global Salm Surv para el Ecuador. 49-78. Pontificia Universidad
América del Sur. Católica del Ecuador. Centro de Publicaciones.
Quito, Ecuador.
Vila J, Gascón J, Abadía S, Gómez J, Marco F y
Moreno A. 1994. Antimicrobial resistance of
Shigella isolates causing traveler’s diarrhea.
Antimicrobiological Agents Chemotherapy,
38(11):2668-70.

REMCB 36 (2), 2015


77

NOTA CIENTÍFICA

Redescubrimiento de Sigmodon inopinatus


(Rodentia: Cricetidae) en los Andes occidentales
de la provincia de Tungurahua, Ecuador
Diego G. Tirira1, 2 y Andrea Vallejo-Vargas1
1
Museo de Zoología, Pontificia Universidad Católica del Ecuador, Quito, Ecuador.
2
Fundación Mamíferos y Conservación, Quito, Ecuador. diego_tirira@yahoo.com

Recibido: 2015-07-30; aceptado: 2015-10-05

RESUMEN.- Sigmodon inopinatus es una especie endémica de los Andes occidentales del Ecuador y es
unos de los roedores más raros y menos conocidos del país. Su presencia ha sido documentada previamente
en tres localidades de dos zonas de las provincias de Chimborazo y Azuay. La presente nota científica
reporta una cuarta localidad para la especie luego de 30 años del último hallazgo (y a 92 años del primero)
y extiende su rango de distribución conocida en 33 kilómetros al norte. Este también es el primer reporte
para la especie fuera de un área protegida y en una zona medianamente intervenida. Se comenta sobre la
abundancia y conservación de la especie.

PALABRAS CLAVES: abundancia, conservación, Cordillera Occidental, extensión de distribución, páramo.

ABSTRACT.- Sigmodon inopinatus is endemic to the Western Andes of Ecuador and one of the rarest and
least known species of rodents in this country. Its presence has been previously documented in two areas
and three locations in the provinces of Chimborazo and Azuay. This scientific note reports a fourth locality
for the species, after 30 years of the latest finding (and 92 years of the first) and extends its range known
in 33 kilometers to the north. This is also the first report for the species outside a protected area and in a
moderately impacted site. We comment on the abundance and conservation of the species.

KEYWORDS: abundance, conservation, Cordillera Occidental, distribution extension, paramo.

INTRODUCCIÓN distribución se restringe a las partes altoandinas de


la Sierra centro y sur, dentro de los páramos de la
El género Sigmodon tiene amplia distribución Cordillera Occidental de los Andes, en las provincias
en el continente. Se lo encuentra desde de Chimborazo y Azuay (Tirira, 2007; Voss, 1992).
aproximadamente los 41º N, en los Estados Unidos,
a través de México y Centroamérica, hasta el norte La especie fue descrita sobre la base de 11 ejemplares
y noroccidente de Sudamérica (Voss, 2015). El colectados por George H. H. Tate y Harold E.
género incluye 13 especies (UICN, 2015), cuatro Anthony, entre el 24 y 26 de octubre de 1923, en
de ellas en Sudamérica y dos presentes en la fauna el páramo de Urbina (01º30’S, 78º44’W; Voss, 1992),
ecuatoriana: S. inopinatus (endémica para los Andes laderas nororientales del volcán Chimborazo, a una
occidentales del país) y S. peruanus (de los bosques altitud de 11 400 pies (3 474 metros sobre el nivel
secos del suroccidente de Ecuador y noroccidente del mar; Voss, 1992). Anthony (1924) indica que la
de Perú; Voss, 2015; Tirira, 2007). colección de esta serie fue uno de los hallazgos más
inesperados y sorpresivos de su extenso estudio
Sigmodon inopinatus Anthony, 1924 (o rata de campo en el Ecuador, en alusión a que era la
algodonera ecuatoriana), es una de las especies primera vez que el género Sigmodon era registrado
de roedores menos conocidas en el Ecuador, pues a tan elevada altitud; de hecho, hasta el presente, S.
se ha reportado únicamente de tres localidades inopinatus es la especie que mayor altitud alcanza
en dos áreas separadas del país (Tirira, 2011). Su dentro del género (Voss, 2015, 1992).

Redescubrimiento de Sigmodon inopinatus


Tirira y Vallejo-Vargas
78

Un segundo hallazgo para la especie ocurrió en géneros Agrostis, Calamagrostis, Cortaderia, Festuca y
1981, 59 años más tarde, en Chaupiurcu (02º53’S, Stipa, junto con parches de arbustos de los géneros
79º19’W; 3 750 metros), páramo del Cajas, provincia Diplostephium, Hypericum y Pentacalia; además,
de Azuay, a unos 170 kilómetros sur de la localidad posee una abundante diversidad de hierbas de
tipo (Barnett, 1999); en los años siguientes (1983 y roseta, rastreras y diversas formas de vida (Salgado
1984), otros tres ejemplares fueron capturados en et al., 2013; Ramsay y Oxley, 1997).
los alrededores de la laguna La Toreadora (02º46’S,
79º13’W; 4 000 metros), en la misma zona del La estructura de este ecosistema y composición de
Cajas (Barnett, 1999; Voss, 1992). Desde entonces, la vegetación está influenciada fuertemente por
la especie no había sido vuelta a colectar, hasta el las quemas asociadas con la ganadería extensiva
hallazgo que se documenta en esta nota científica. (Salgado et al., 2013); aunque no se confirmó la
quema del páramo durante la visita de campo,
Todas las localidades de colección mencionadas fue evidente la presencia de ganado vacuno en los
se encuentran dentro de la formación ecológica de alrededores del punto donde se registró este roedor.
páramo, una forma andina caracterizada por tener
un clima frío, mayormente húmedo y cubierto de El clima en la zona es frío y posee alta humedad
vegetación herbácea (principalmente gramíneas), (entre 80 y 90 %; Salgado et al., 2013).
habitualmente de pronunciada pendiente y con valles
planos y húmedos cubiertos por áreas pantanosas o Identificación.- El espécimen fue identificado con
vegetación de tipo almohadilla (Voss, 1992). la ayuda de la clave dicotómica de Voss (2015), la
descripción original de la especie de Anthony (1924)
Los sitios de colección en la provincia de Azuay e información complementaria disponible en Tirira
estuvieron en zonas húmedas, ligeramente pantanosas (2007). Para la identificación y como referencias se
y próximas a cuerpos de agua (Barnett, 1999); mientras tomaron ciertas medidas corporales y craneales,
que en la provincia de Chimborazo fueron en zonas según propone Voss (1992, 1988).
con buen drenaje y ligera pendiente (Voss, 1992;
Anthony, 1924). Se desconocen sus refugios. El ejemplar fue depositado en el Museo de Zoología
de la Pontificia Universidad Católica del Ecuador
Aspectos reproductivos sobre la especie son (QCAZ), de la ciudad de Quito.
desconocidos. La única información documentada
es que dos hembras presentaron cuatro embriones RESULTADOS Y DISCUSIÓN
cada una (una en julio y otra en octubre; Barnett,
1999; Anthony, 1924), número que estaría dentro El 21 de octubre de 2014 se encontró un macho
del rango inferior que se ha indicado para el género adulto de Sigmodon inopinatus (QCAZ 15672;
(Barnett, 1999). número de campo QKM 53000) en la localidad de
Chiquiurco, a menos de 200 metros del reservorio
La especie ha sido categorizada como En Peligro, de de agua homónimo, que extiende en 33 kilómetros
acuerdo con el Libro Rojo de los mamíferos del Ecuador al norte la distribución previamente conocida para
(Tirira, 2011), y como Vulnerable, según la Lista la especie. El sitio del hallazgo tenía una moderada
Roja de la UICN (UICN, 2015). Los localidades de pendiente y la vegetación circundante era típica
colección indicadas corresponden a sendas áreas de páramo, según se describió anteriormente.
protegidas: Reserva de Producción Faunística El individuo fue encontrado muerto sobre una
Chimborazo y Parque Nacional Cajas (Tirira, 2007). almohadilla, en un estado inicial de descomposición
que facilitó una adecuada preservación.
MATERIALES Y MÉTODOS
Las medidas tomadas al espécimen QCAZ
Área de estudio.- El hallazgo que se documenta 15672 fueron las siguientes (en milímetros; entre
a continuación se realizó en las estribaciones paréntesis se indican las medidas del holotipo,
occidentales de la provincia de Tungurahua, en la según Anthony, 1924, y entre corchetes el mínimo
localidad conocida como Chiquiurco (01º15’16”S, y máximo reportado para la especie en Tirira,
78º44’36”W; ca. 3 460 metros de altitud), a 20 2007): longitud de la cabeza y el cuerpo 118 (160)
kilómetros al oeste de Ambato, cantón Ambato. [136–167]; largo de la cola 79.5 (99) [78–79]; largo
de la pata posterior 27.8 (31) [28–30]; largo de la
La zona corresponde al ecosistema Herbazal del oreja 18.6 [14–22]; largo de las vibrisas mayores
páramo (Salgado et al., 2013). Se caracteriza por 32.6; largo del cráneo 33.0 (35.6); ancho del cráneo
la dominancia de gramíneas amacolladas con 14.8; longitud del hueso nasal 12.9 (12.8); largo de
una altura superior a 50 cm. La flora gramínea la hilera dental superior 18.2; largo de la hilera
representativa de este ecosistema corresponde a los dental inferior 14.8; largo del maxilar inferior 23.4;

REMCB 36 (2), 2015


79

ancho del cóndilo occipital 12.5; ancho del foramen Abundancia.- La evidencia indica que Sigmodon
incisivo 2.4; alto de los incisivos 6.9. Otras medidas inopinatus es una de las especies de roedores más
tomadas se indican en la tabla 1, junto con valores difíciles de encontrar en el Ecuador, según sugirió
reportados por Voss (1992); todas las medidas Tirira (2007) al tratarla como una especie rara.
tomadas siguieron los criterios de Voss (1988).
Durante el estudio de campo de 1923, G. H. H. Tate
Las características del espécimen QCAZ 15672 y H. E. Anthony colectaron 51 micromamíferos
coindicen que las indicadas en la descripción de no voladores en la zona de Urbina durante
la especie por Anthony (1924) y las reportadas por tres días consecutivos, con la captura de cuatro
Tirira (2007), que son: pelaje denso y suave; dorso especies correspondientes a los géneros Akodon,
de color marrón oscuro amarillento con numerosos Microryzomys, Thomasomys y Cryptotis; además
pelos negruzcos entremezclados y unos pocos de los 11 ejemplares de Sigmodon inopinatus, que
pelos sobresalientes con las puntas blancas que representaron un 18 % del total de capturas (según
le dan un ligero aspecto canoso; región ventral catálogo del American Museum of Natural History,
de color marrón grisáceo con la base de los pelos AMNH, en Tirira, 1995–2015).
de color gris oscuro. Hocico redondeado y romo;
ojos relativamente grandes; orejas redondeadas, En el estudio efectuado en el páramo del Cajas
negruzcas y bien peludas; vibrisas cortas y escasas. que permitió la captura de una nueva serie de S.
Cola más corta que la longitud de la cabeza y el inopinatus, entre 1981 y 1987, con un esfuerzo de 5 942
cuerpo (alcanzó un 67 %), bicolor (con pelos noches de trampeo, se capturaron 483 pequeños
oscuros por arriba, ligeramente más pálidos por mamíferos no voladores correspondientes a 19
debajo). Patas posteriores largas y angostas, con especies; de los cuales, apenas cinco ejemplares
la piel de la parte superior negra y recubierta de (1 %) fueron Sigmodon inopinatus; esto es un éxito
pelos de color marrón grisáceo; las plantas también de captura de 0.0001 por trampa utilizada.
fueron negras. Anthony (1924) indica que en la
serie capturada en Urbina existió poca variación en Entre los esfuerzos fallidos por registrar esta
el color de los individuos. especie, en un rango de 30 kilómetros a la redonda
de las localidades de colección indicadas por
En cuanto a las medidas corporales y craneales Barnett (1999) y Anthony (1924), se tienen los
registradas, la mayoría de ellas se encuentran dentro siguientes resultados:
de los rangos, o con mínimas variaciones, a las
reportadas para la especie por Tirira (2007) y Voss En las mismas estribaciones del volcán
(1992), con excepción de la longitud de la cabeza y Chimborazo (en altitudes superiores a los 3 400
el cuerpo, lo cual demostraría que se trataba de un metros) se pueden mencionar las siguientes
individuo joven y que todavía no había alcanzado el colecciones: entre 1930 y 1931, Franz Spillman
tamaño corporal de un adulto, algo que también es colectó cuatro ejemplares correspondientes a los
corroborado con el largo de la cola, que se encontraría géneros Akodon y Thomasomys (Tirira, 2013). En
dentro del rango inferior para la especie. mayo de 1939, A. Mena y A. Proaño capturaron 21

Tabla 1. Medidas craneales tomadas a Sigmodon inopinatus en tres localidades.


Medida Chiquiurco Urbina Cajas
(QCAZ 15672. m) (AMNH 2 m. 6 h) (BMNH 82.814. m)
Longitud cóndilo basal- 32.8 32.6 (29.4–34.8) 34.2
incisivos
Largo del diastema 9.7 9.5 (8.0–10.6) 10.5
Largo oclusal de los morales 7 6.7 (6.6–6.8) 6.8
Ancho del primer molar 2.35 2.2 (2.1–2.4) 2.2
Largo del foramen incisivo 7.2 7.3 (6.4–8.1) 7.8
Ancho del puente del palatino 3.5 2.7 (2.3–3.4) 3
Ancho de la placa cigomática 3.9 4.0 (3.4–4.6) 3.9
Menor ancho interorbital 4.6 4.3 (4.0–4.4) 4.8
Profundidad de los incisivos 2.2 1.9 (1.6–2.0) 2
Ancho de los incisivos 3.1 2.8 (2.3–3.1) 3.3
Ancho cigomático 20 20.2 (18.7–21.4) 21.6

Datos de Urbina y Cajas provienen de Voss (1992). Todas las medidas se indican en milímetros; m = macho; h = hembra. Acrónimos
de colección en anexo 1. Las medidas tomadas siguen a Voss (1992, 1988).

Redescubrimiento de Sigmodon inopinatus


Tirira y Vallejo-Vargas
80

ratones correspondientes a los géneros Phyllotis y (con las cuencas de los ríos Chanchán y Cañar
Thomasomys (catálogo del Field Museum of Natural de por medio). En tal escenario, es importante
History, en Tirira, 1995–2015). En la misma zona de realizar nuevos muestreos en localidades donde su
Urbina, Alfred L. Gardner realizó el 16 de agosto presencia sea esperada, con la finalidad de conocer
de 1976 un muestreo con la captura de siete ratones mejor sobre el estado de conservación de esta
correspondientes a dos especies de los géneros especie; hasta tanto, se considera que la categoría
Akodon y Phyllotis (catálogo del United States de conservación asignada por el Libro Rojo de los
National Museum, en Tirira, 1995–2015). mamíferos del Ecuador (Tirira, 2011) está justificada.

En un muestreo efectuado en julio de 1913, AGRADECIMIENTOS


antes del descubrimiento de esta especie, en las
mismas laderas del volcán Chimborazo, William El hallazgo ocurrió durante la evaluación del
B. Richardson, reportó la captura de siete ratones “Estado actual del ecosistema páramo en la provincia
del género Thomasomys (catálogo del AMNH, en de Tungurahua”, un proyecto de Geoinformática
Tirira, 1995–2015). y Sistemas Cia. Ltda. y el Gobierno Provincial de
Tungurahua, bajo financiamiento de la Corporación
En la provincia de Azuay, en la zona del páramo Alemana para el Desarrollo (Deutsche Gesellschaft
del Cajas, durante distintos muestreos efectuados für Internationale Zusammenarbeit, GIZ). A Efrén
entre 1922 y 2004, se colectaron entre 3 200 y Alvarado y Milton Tirado, quienes participaron de
4 100 metros de altitud, un total de 373 cricétidos la salida de campo donde se colectó el espécimen
correspondientes a siete géneros y 11 especies y aportaron con información sobre el área de
(Tirira, 1995–2015). estudio. A Ma. Alejandra Camacho y Santiago
Burneo, del Museo de Zoología de la Pontificia
En una evaluación ecológica rápida efectuada Universidad Católica del Ecuador (QCAZ), por el
entre octubre y noviembre de 2014 por los autores apoyo brindado para la preparación y preservación
de esta nota, en dos localidades del suroccidente del espécimen colectado. A la Dirección Provincial
de la provincia de Tungurahua y al norte del de Tungurahua del Ministerio del Ambiente por
volcán Chimborazo, se capturaron 12 ratones el permiso de investigación (No 07-2015 IC-FLO-
correspondientes a tres especies de los géneros FAU-DPAT/MA).
Akodon, Microryzomys y Thomasomys, con un
esfuerzo de seis días de muestreo y 50 trampas/día REFERENCIAS BIBLIOGRÁFICAS
(Tirira, 1995–2015).
Anthony HE. 1924. Preliminary report on
Conservación.- La vegetación nativa en el área del Ecuadorian mammals. No. 4. American Museum
registro reveló un moderado estado de conservación, Novitates, 114: 1–6.
sin ser evidentes impactos relevantes, como quemas,
reemplazo de la vegetación nativa por cultivos o Barnett AA. 1999. Small mammals of the Cajas
pastos introducidos o siembra de pinos. La única Plateau, southern Ecuador: ecology and natural
amenaza a considerar es la presencia de ganado history. Bulletin of the Florida Museum of Natural
vacuno disperso, con los consiguientes impactos de History, 42(4): 161–217.
pastoreo y pisoteo de los animales. La localidad no
se encuentra dentro de ninguna área protegida. Musser GG y Carleton MD. 2005. Superfamily
Muroidea. En: Wilson DE y Reeder DM (eds)
De acuerdo con Tirira (2011), la principal amenaza Mammal species of the World, a taxonomic and
para la especie es la pérdida de su hábitat natural, geographic reference: 894−1531. 3a edición. The John
algo que ya fue documentado por H. Anthony en Hopkins University Press. Baltimore, EE.UU.
sus apuntes de campo durante la colección de la
serie tipo: “the atmosphere was too smoky for successful Ramsay PM y Oxley ER. 1997. The growth form
photography because the local people were burning composition of plant communities in the
the grass” [“la atmosfera era demasiado densa y Ecuadorian paramos. Plant Ecology, 131: 173–192.
estaba cubierta de humo, lo cual no ayudaba para
la fotografía debido a que los campesinos locales Salgado S, Cuesta F, Báez S, Medina-Torres B, Josse
quemaban el pajonal]” (Voss, 1992). C y Romoleroux K. 2013. Herbazal del páramo.
En: Sistema de clasificación de los ecosistemas del
Otro factor a considerar es lo restringida y Ecuador continental: 139–141. Subsecretaría de
discontinua que es la distribución de S. inopinatus, Patrimonio Natural, Ministerio del Ambiente
pues se conoce solamente de dos áreas separadas del Ecuador. Quito, Ecuador. 232 pp.
y con pocas probabilidades de conexión entre ellas

REMCB 36 (2), 2015


81

Tirira DG. 1995–2015. Red Noctilio. Base UICN. 2015. IUCN Red List of threatened species.
de información no publicada sobre los International Union for Conservation of Nature
mamíferos del Ecuador. Grupo Murciélago and Natural Resources. Versión 2015.3. Página
Blanco. Quito, Ecuador. de Internet: www.iucnredlist.org. Consultada:
9-octubre-2015.
Tirira DG. 2013. Mamíferos ecuatorianos en museos Voss RS. 2015. Tribe Sigmodontini Wagner, 1843.
de historia natural y colecciones científicas: 4. En: Patton JL, Pardiñas UFJ y D’Elía G (eds)
El Museo Nacional de Brasil. Serie Zoológica, Mammals of South America. Volume 2: rodents:
8–9: 109–124. 566–571. The University of Chicago Press.
Chicago y Londres.
Tirira DG. 2011. Rata algodonera ecuatoriana
(Sigmodon inopinatus). En: Tirira DG (ed), Libro Voss RS. 1992. A revision of the South American
Rojo sobre los mamíferos del Ecuador: 121. 2a species of Sigmodon (Mammalia: Muridae),
edición. Fundación Mamíferos y Conservación, with notes on their natural history and
Pontificia Universidad Católica del Ecuador y biogeography. American Museum Novitates,
Ministerio del Ambiente. Publicación especial 3050: 1–56.
8. Quito, Ecuador.
Voss RS. 1988. Systematics and ecology of
Tirira DG. 2007. Guía de campo de los mamíferos Ichthyomyine rodents (Muroidea): patterns of
del Ecuador. Ediciones Murciélago Blanco. morphological evolution in a small adaptive
Publicación especial 6. Quito, Ecuador. 576 pp. radiation. Bulletin of the American Museum of
Natural History, 188(2): 259–439.

Anexo 1: Registros conocidos de Sigmodon inopinatus

Ejemplares [18]: Azuay, Chapiurcu: BMNH 82.814 (macho). La Toreadora: BMNH 84.348 (hembra; donado
a MEPN), 85.884 y 85.885 (sexo no indicado); además un ejemplar no colectado (sexo no indicado).
Chimborazo, Urbina: AMNH 66303 y 66311 (machos), 66304 a 66310 (holotipo), 66312, 66314 y 66512
(hembras). Tungurahua, Chiquiurco: QCAZ 15672 (macho).

Acrónimos de colecciones:

-AMNH: American Museum of Natural History, Nueva York


-BMNH: British Museum of Natural History, Londres
-MEPN: Museo de la Escuela Politécnica Nacional, Quito
-QCAZ: Museo de Zoología de la Pontificia Universidad Católica del Ecuador, Quito

Fuentes: Tirira (1995–2015), Barnett (1999), Voss (1992), Anthony (1924).

Redescubrimiento de Sigmodon inopinatus


Tirira y Vallejo-Vargas
82

REMCB 36 (2), 2015


83

COLECCIONES DE MUSEO

Las colecciones biológicas: Los tesoros escondidos


de un país mega-diverso.
Claudia Segovia-Salcedo1, 2, Luis Carrasco3 y Néstor Acosta Buenaño3
1
Universidad de las Fuerzas Armadas, Departamento de Ciencias de la Vida, Sangolquí, Ecuador.
mcsegovia@espe.edu.ec

2
Proyecto iDigBio. University of Florida, Florida Museum of Natural History, Gainesville, Fl. USA.

3
Ministerio del Ambiente. Subsecretaría de Patrimonio Natural del Ecuador. Quito, Ecuador
luis.carrasco@ambiente.gob.ec, nestor.acosta@ambiente.gob.ec

Recibido: 2015-07-31; aceptado: 2015-10-05

Ecuador, a pesar de su reducido tamaño, alberga nuevas aplicaciones para el uso de las mismas en
una de las más altas concentraciones de diversidad diferentes sectores de la sociedad (Drew, 2011). El
en el planeta y mucho de ella no está reflejada en objetivo de este artículo es presentar los resultados
nuestras colecciones biológicas (Suárez, 2014). Su de un breve inventario de las colecciones biológicas
ubicación en la intersección de la línea ecuatorial, del Ecuador con miras a la creación de la Base
junto con los Andes y la Amazonía, contribuye a Nacional de Datos de Biodiversidad (BNDB) y su
su gran riqueza biológica. Grandes naturalistas portal web dentro de la Subsecretaría de Patrimonio
como el Baron Alexander von Humboldt (1802- Natural del Ecuador del Ministerio del Ambiente.
1803), Jacques-Alexandre Goujoud Bonpland
(1799-1805), Charles Darwin (1835) entre otros, han En los meses de enero a mayo del presente año
explorado y colectado en el Ecuador, y muchos de se inició este proceso como un primer intento de
esos especímenes ecuatorianos se encuentran en integración de los herbarios, museos y colecciones
los museos de Historia Natural más importantes biológicas del Ecuador. A través de encuestas y
del mundo sin que científicos locales puedan visitas a diferentes instituciones se obtuvo el número
acceder. En la actualidad, la mayoría de los de especímenes, tipos y fecha de fundación. Si
especímenes ecuatorianos de colecciones recientes bien hemos logrado recopilar valiosa información,
se encuentran en instituciones locales públicas y algunas colecciones todavía deber ser encontradas
privadas, sin embargo, no sabemos con exactitud el e incluidas. Como resultado de este proceso
número de colecciones y de especímenes debido a descubrimos verdaderos tesoros para la comunidad
la falta de integración y apertura a la socialización científica que se encuentran depositados en nuestro
de quienes poseen estos datos. Esto ocasiona que país. El Instituto de Ciencias Biológicas de la Escuela
esta importante información no esté de forma Politécnica Nacional (EPN) tiene la única colección
organizada y al alcance de investigadores locales e paleontológica con más de 10 000 especímenes:
internacionales, tomadores de decisiones y público alberga las colecciones mastozoológica e ictiológica
en general. A pesar que a nivel mundial se están más grandes del Ecuador con ejemplares que datan
creando bases de datos y portales de biodiversidad de inicios del siglo anterior como un mono araña
con acceso libre como Global Biodiversity de la costa, Ateles fusciceps (1969, figura 1a), un
Information Facility (GBIF), Atlas of Living mono capuchino, Cebus albifrons, (1925, figura 1b)
Australia (www.ala.org.au), Integrated Digitized que según Tirira (2015) actualmente corresponde
Biocollection (www.idigbio.org), CONABIO a Cebus aequatorialis, y musaraña andina, Cryptotis
(Comisión Nacional para el Conocimiento y uso de equatoris (1951, figura 1c). Más de 30 000 ejemplares
la Biodiversidad) (Janken, 2013), en nuestro país no de mamíferos se encuentran depositados en las
hemos iniciado un proceso nacional de inventario colecciones de la Pontificia Universidad Católica del
de las colecciones biológicas para una posterior Ecuador (QCAZ), el Instituto de Ciencias Biológicas
digitalización. Los procesos de democratización de de la EPN y el Museo Ecuatoriano de Ciencias
la información de biodiversidad están creando una Naturales (MECN), con una representatividad
mayor interacción entre el público y las colecciones, taxonómica del 70 % de nuestra mastofauna.
fortaleciendo su existencia y además explorando

Colecciones Biológicas en el Ecuador


Segovia et al.
84

En el caso de los peces, las colecciones ictiológicas las especies de aves del país, que albergan varios
de la EPN y el MECN albergan más de 10 000 tipos y especímenes únicos.
especímenes catalogados y muchos más por
ser identificados. La mayoría de las muestras En la última década las colecciones herpetológicas han
pertenecen a la región de la Amazonía y representan crecido exponencialmente con énfasis en los Andes y
especialmente a las familias Characidae y la Amazonía, alcanzando más de 40 000 especímenes.
Loricaridae, convirtiéndole en un centro de Los esfuerzos de varias instituciones (QCAZ,
referencia para la zona norte de esta región. JAMBATU, MECN) han llevado a un incremento
en el número de descripciones de nuevas especies
Las colecciones entomológicas son las más grandes y por ende de publicaciones científicas (más de 30
del país con más de 1’300 000 ejemplares distribuidos artículos en una búsqueda utilizando las palabras
en cinco museos: QCAZ, MECN, EPN, Biblioteca claves Ecuador y Herpetología en los últimos 10 años
Aurelio Espinoza Pólit y USFQ. El museo QCAZ es a tráves de la base de datos Science Direct).
el que alberga la mayor cantidad de especímenes
con cerca de un millón de invertebrados, los grupos Finalmente, entre los 13 herbarios que brindaron
con mayor representatividad son los Carábidos y información mantienen más de 650 000
Lepidópteros. Otras colecciones importantes de especímenes con énfasis en la Flora Amazónica y
insectos se encuentran en la Fundación Biblioteca Andina con información desde mediados del siglo
Ecuatoriana Aurelio Espinoza Pólit (200 000 anterior. Las colecciones botánicas han permitido
mariposas) y en la Universidad San Francisco de clarificar el número, rango de distribución,
Quito con un enfoque en invertebrados acuáticos y estado de conservación de muchas de las
(aprox. 10 órdenes, número de especies no poblaciones vegetales en nuestro territorio, así
determinado). El Museo Ecuatoriano de Ciencias como la generación de varias obras de recopilación
Naturales (MECN) es el mayor repositorio de de la Flora del Ecuador. Sin duda los herbarios
pieles de aves en el Ecuador con más de 8 000 han sido las colecciones mejor organizadas y
especímenes con una representatividad del 80 % de preservadas en nuestro país. Es interesante conocer

Figura 1. Los especímenes más antiguos encontrados en las colecciones biológicas ecuatorianas ubicados en el Instituto de Ciencias
Biológicas de la Escuela Politécnica Nacional. A) Mono Araña de la Costa (Ateles fusciceps, 1969). B) Mono capuchino, Cebus albifrons,
(1925). C) Musaraña Andina (Cryptotis equatoris, 1951).

REMCB 36 (2), 2015


85

que en el Ecuador existe un herbario de Botánica botánica histórica perteneciente al Padre Sodiro
Económica en la USFQ, una Xiloteca (Herbario de en la Fundación Biblioteca Ecuatoriana Aurelio
la Universidad Técnica del Norte) y una colección Espinoza Pólit (Tabla 1, Figura 2).

Tabla 1. Datos recolectados de las colecciones biológicas ecuatorianas en esta investigación.

HERBARIOS
Institución Acrónimo Año Registros Tipos
Universidad Central del Ecuador Q 1860 12 535
Unidad Educativa Bolívar UEB 1921 3 000
Universidad Nacional de Loja LOJA 1949 45 000 66
Escuela Superior Politécnica del Chimborazo CHEP 1966 16 724
Pontificia Universidad Católica del Ecuador QCA 1971 200 000 1 000
Museo Ecuatoriano de Ciencias Naturales QCNE 1977 238 598 1 888
Universidad Técnica del Norte HUTN 1985 15 000
Universidad Central del Ecuador QAP 1989 90 000
Universidad San Francisco de Quito QUSF 1994 29 484 7
Universidad Técnica Particular de Loja HUTPL 2002 15 000
Universidad Técnica del Norte HUNT 2005 1 800
Universidad Tecnológica Indoamérica HUTI 2012 900 2
Fundacion B.E. Aurelio Espinoza Polit QPLS 2013 13 500 219
Universidad Tecnica de Cotopaxi UTC 2015 3 000
TOTAL 684 541 3 182
MUSEOS - VERTEBRADOS
Institución Acrónimo Año Registros Tipos
Universidad Central del Ecuador Q 1860 1 654
Unidad Educativa Bolívar UEB 1921 3 000
Colegio Teodoro Gómez de la Torre CTGT 1944 160
Escuela Politécnica Nacional EPN 1946 55 259 159
Universidad Técnica de Ambato MCCUTA 1969 555
Pontificia Universidad Católica del Ecuador QCAZ 1973 15 500
Escuela Superior Politécnica del Chimborazo ESPOCH 1975 20 000
Instituto Nacional de Biodiversidad - MECN MECN 1977 42 023 52
FundaciónHerpetológica Gustavo Orcés FHGO 1989 12 000
Universidad Técnica Particular de Loja MUTPL 2005 500
Centro - Jambatu CJ 2011 760 1
Pontificia Universidad Católica- Ambato PUCA 2011 339
Universidad Tecnológica Indoamerica MUZUTI 2011 8 186
Universidad San francisco de Quito MUSI 2014 7 600
Fundacion B.E. Aurelio Espinoza Polit FDPR 200 000
TOTAL 367 536 212
MUSEOS - INVERTEBRADOS
Institución Acrónimo Año Registros Tipos
Escuela Politécnica Nacional EPN 1946 79 357 42
Pontificia Universidad Católica del Ecuador QCAZ 1973 1’000 000 2 683
Instituto Nacional de Biodiversidad - MECN MECN 1977 59 227 71
Universidad Técnica del Norte UTN-in 2005 1 800
TOTAL 1’140 384 2 796

Colecciones Biológicas en el Ecuador


Segovia et al.
86

endémicas o amenazadas (Fisher & Davidson, 1998;


Graham et al., 2004; O’Connell et al., 2004; Shaffer
et al., 2009), además los datos de los herbarios nos
ayudan a entender los procesos de introducción y
distribución de especies invasoras. A través de la
información depositada en las colecciones podemos
determinar detalles de la historia natural de los
organismos (Krishtalka y Humphrey 2000; Miller
y Rogers, 2014). Los especímenes de museos nos
permiten definir indicadores de impacto ambiental
en los diferentes ecosistemas al ser fuente de
material genético, bioquímico e isotópico, así como
determinar vectores y controladores biológicos
de enfermedades (Graham et al., 2004; Lister &
Climate Change Research Group, 2011).

En los últimos años, las colecciones han influenciado


en la aplicación y el desarrollo de nuevas
herramientas bioinformáticas para la digitalización
e integración de bases de datos (Edwards et al.,
2000; Berents et al., 2010; Drew, 2011). Finalmente,
no podemos olvidar que las colecciones biológicas
juegan un papel fundamental en la educación
en todos los niveles, donde se puede incentivar
procesos de asociación, observación y análisis de
los objetos desde los niños hasta los adolescentes
(Cook et al., 2014; Powers et al., 2014; Knight-Davis
et al., 2015). Los especímenes de las colecciones
son una herramienta clave en el entrenamiento de
Figura 2. Número de registros y tipos reportados en las los estudiantes de pregrado, carreras biológicas
colecciones biológicas ecuatorianas y afines. Los museos de historia natural y las
colecciones biológicas son uno de los pocos sitios
Las colecciones biológicas son verdaderos legados donde convergen el público en general y los
de información que necesitan ser apoyados, científicos creando el ambiente adecuado para
mantenidos y protegidos por el Estado e entablar una comunicación directa sobre temas de
instituciones privadas (Hill et al., 2012; Stucky et conservación y manejo (Drew, 2011).
al., 2014). No solamente son el sitio de referencia
científica para el descubrimiento de nuevas A pesar de la falta de apoyo por parte de las
especies, sino que son sitios de generación de entidades estatales tanto a nivel locales como
conocimiento en diferentes ámbitos (Winker, central (bajo presupuesto, falta de capacitación
2004; Matsunanga et al., 2013). Una colección bien e infraestructuras adecuadas), las colecciones
curada puede ser fundamental para la creación de biológicas en nuestro país son numerosas y han
modelos de cambio climático que incluyan rangos permanecido activas por más de un siglo, pero la
de expansión y reducción de distribución, variación información todavía está incompleta, dispersa, y
fenológica o cambios evolutivos. Además, las muchas veces inaccesible. Necesitamos entonces,
colecciones biológicas permiten documentar crear una plataforma que nos permita compartir
cambios en la estructura de la comunidad en información para unir esfuerzos en áreas geográficas
épocas recientes o pasadas (Drew, 2011; Graham et y taxonómicas de interés, evitar la duplicación de
al., 2004; Lister & Climate Change Research Group, trabajo, y fortalecer a las colecciones pequeñas, de
2011), de ahí la importancia de los repositorios ahí la iniciativa de la creación de la Base Nacional
históricos como las muestras del padre Sodiro de Datos de Biodiversidad (BNDB) con los objetivos
que se encuentran albergadas en la Fundación de investigación, educación, manejo y conservación
Biblioteca Ecuatoriana Aurelio Espinoza Pólit, o de nuestro recurso más preciado: la Biodiversidad.
las muestras paleontológicas del EPN. Mediante El conocimiento sobre nuestra biodiversidad está
información de estas muestras como los rangos cambiando rápidamente y necesitamos generar
de distribución, podemos conocer los procesos mecanismos que nos permitan utilizar y contribuir
de disminución poblacional y así determinar a esa información con un manejo responsable y
áreas prioritarias de conservación para especies multidisciplinario de los datos.

REMCB 36 (2), 2015


87

El valorar nuestras colecciones biológicas es Drew J. 2011. The Role of Natural History Institutions
un deber de todos los ciudadanos. Conocerlas, and Bioinformatics in Conservation Biology.
apoyarlas, difundirlas, y protegerlas es una misión Conservation Biology, 25(6):1250-1252.
no solo de la comunidad científica y quienes las
posean, sino del Estado y de la sociedad. Esto se Edwards JL, Lane MA y Nielsen ES. 2000.
fundamenta en que las colecciones biológicas Interoperability of biodiversity databases:
guardan nuestra herencia de conocimiento para biodiversity information on every desktop.
las futuras generaciones. Una razón más por lo Science, 289(5488), 2312-2314.
cual la colaboración entre los curadores y los
investigadores es esencial para la inclusión de Graham CH. Ferrier S. Huettman F. Moritz C y
las colecciones en los proyectos de investigación. Peterson AT.. 2004. New Developments in
Es tiempo de crear una alianza nacional en favor museum-based informatics and application
de las colecciones biológicas para promover su in biodiversity analysis. Trends in Ecology and
continuidad en el tiempo y su apertura a los Evolution, 19(9):497-502.
desafíos del siglo XXI a través de una colaboración
entre academia y estado. Hill A, Gularnick R, Smith A, Sallans A, Gillespie
R, Denslow M, et al. 2012. The notes from
AGRADECIMIENTOS nature tool for unlocking biodiversity records
from museum records through citizen science.
Los autores agradecen a todas las instituciones que ZooKeys, 209:219-233.
abrieron sus puertas y compartieron su información.
A la Pontificia Universidad Católica del Ecuador Janken J. 2013. Biodiversity Online: Toward a
(QCAZ-mastozoología, QCA, Ambato), Instituto Network Integrated Biocollections Alliance.
de Ciencias Biológicas de la Escuela Politécnica Bioscience, 63(10):789-790.
Nacional, Universidad Central del Ecuador (Q y
QAP), Instituto Nacional de Biodiversidad (MECN- Knight-Davis S, Bruns T y Tucker G. 2015. Big
QCNE), al Herbario de la Universidad Nacional Things Have Small Beginnings: Curating a
de Loja, Fundación Herpetológica Gustavo Orcés, Large Natural History Collection–Processes
Centro Jambatu de Investigación y Conservación and Lessons Learned. Journal of Librarianship
de Anfibios; Universidad San Francisco de Quito and Scholarly Communication, 3(2).
(QUSF y MUSF), Universidad Técnica del Norte
(HUTN), Universidad Tecnológica Indoamérica Krishtalka L y Humphrey PS. 2000. Can natural
(HUTI), Universidad Técnica de Cotopaxi, Escuela history museums capture the future?.
Superior Politécnica del Chimborazo (Herbario y BioScience, 50(7):611-617.
Museo), Unidad Educativa Bolívar, Universidad
Técnica Particular de Loja (HUTPL), Fundación Lister AM y Climate Change Research group. 2011.
Biblioteca Ecuatoriana Aurelio Espinoza Polit, Natural History Collections as source of long
Colegio Teodoro Gómez de la Torre, Universidad term datasets. Trends in Ecology and Evolution,
Técnica de Ambato, y a Silva Carbón por su 26(4):153-154.
auspicio. Parte de la información presentada
pertenece al proyecto del Ministerio del Ambiente Matsunaga A, Thompson A, Figueiredo RJ,
“Inventario de Centros de Rescate”. Germain-Aubrey CC, Collins M, Beaman
RS y Fortes J. 2013. A computational-and
REFERENCIAS BIBLIOGRÁFICAS storage-cloud for integration of biodiversity
collections. En eScience (eScience), 2013 IEEE 9th
Berents P, Hamer M y Chavan V. 2010. Towards International Conference on pp. 78-87.
demand driven publishing: approaches to
the prioritization of digitization of natural Miller JT y Jolley-Rogers G. 2014. Correcting
history collections data. Biodiversity Informatics, the disconnect between phylogenetics and
7(2):113-119. biodiversity informatics. Zootaxa, 3754(2):195-200.

Cook JA, Edwards SV, Lacey EA, Guralnick RP, O’Connell AF, Gilbert AT y Hatfield JS. 2004.
Soltis PS, Soltis DE y Ickert-Bond S. 2014. Contribution of natural history collection data
Natural History Collections as Emerging to biodiversity assessment in national parks.
Resources for Innovative Education. BioScience, Conservation biology, 18(5):1254-1261.
64(8):725-734

Colecciones Biológicas en el Ecuador


Segovia et al.
88

Powers KE, Prather A, Cook J, Woolley J, Bart HL, Winker K. 2004. Natural history museums in a
Monfils AK y Sierwald P. 2014. Revolutionizing postbiodiversity era. BioScience, 54(5):455-459.
the Use of Natural History Collections in
Education. Science Education Review, 13(2):24-33. Tingley MW y Beissinger SR. 2009. Detecting range
shifts from historical species occurrences: new
Shaffer HB, Fisher RN y Davidson C. 1998. The role perspectives on old data. Trends in Ecology and
of natural history collections in documenting Evolution, 24(11):625-633.
species declines. Trends in Ecology and Evolution,
13(1):27-30. Tirira D. 2015. Mamíferos del Ecuador: Lista
Actualizada de Especies del Ecuador.
Stucky BJ, Deck J, Conlin T, Ziemba L, Cellinese
N y Guralnick R. 2014. The BiSciCol Triplifier:
bringing biodiversity data to the Semantic
Web. BMC bioinformatics, 15(1):257

Suárez L. 2014. ¿Cómo se explica tanta


biodiversidad en el Ecuador? pp. 50-51 en:
García, M., D. Parra P. y P. Mena V. 2013. El
País de la Biodiversidad: Ecuador. Fundación
Botánica de los Andes, Ministerio del Ambiente
y Fundación EcoFondo. Quito.

REMCB 36 (2), 2015


89

INSTRUCTIVO PARA AUTORES

Revista Ecuatoriana de Medicina y Ciencias Biológicas


CRITERIOS DE PUBLICACIÓN
La Revista Ecuatoriana de Medicina y Ciencias Biológicas (REMCB) publica las investigaciones científicas
originales que no hayan sido sometidas a publicación en ningún medio impreso o electrónico. Los campos
de investigación que se incluyen son las Ciencias Biológicas, Químicas, Bioquímicas, Ciencias Médicas,
Biotecnología, Conservación y Manejo de Recursos.

Los manuscritos podrán ser sometidos bajo las siguientes modalidades:

Trabajos científicos reportan resultados originales producto de un proceso de investigación científica,


en áreas de interés para la REMCB. Los autores son responsables del uso de datos de terceros. Los
trabajos científicos constarán de las siguientes partes: Título, Autor(es), Afiliación institucional, correo
electrónico del autor de correspondencia, RESUMEN, PALABRAS CLAVES:, ABSTRACT,
KEYWORDS: (escritos en inglés), INTRODUCCIÓN, MATERIALES Y MÉTODOS,
RESULTADOS, DISCUSIÓN, CONCLUSIONES (opcionales), AGRADECIMIENTOS
Y REFERENCIAS BIBLIOGRÁFICAS.
Notas científicas reportan resultados preliminares de procesos investigativos experimentales. Las notas
científicas constarán de las siguientes partes: Título, Autor(es), Afiliación institucional, correo electrónico
del autor de correspondencia, RESUMEN, PALABRAS CLAVES:, ABSTRACT, KEYWORDS:
(escritos en inglés), INTRODUCCIÓN, MATERIALES Y MÉTODOS, RESULTADOS Y
DISCUSIÓN (unidos), AGRADECIMIENTOS Y REFERENCIAS BIBLIOGRÁFICAS.
Artículos de revisión (Review): de un tema específico relacionado con los campos que incluye la revista.
Tendrán un formato personalizado por sus autores, pero es obligatorio el uso de las siguientes secciones:
Título, Autor(es), Afiliación institucional, correo electrónico del autor de correspondencia, el texto (con las
subdivisiones que sean apropiadas) y REFERENCIAS BIBLIOGRÁFICAS.

AUTOR DE CORRESPONDENCIA
El autor de correspondencia asume la responsabilidad de incluir a todos los autores de la investigación en el
orden apropiado, obtener el consentimiento de dichos autores antes de someter el manuscrito a la revista e
informar a los autores sobre todos los cambios de edición realizados al manuscrito antes de la publicación.
De igual manera el autor de correspondencia se responsabiliza de la comunicación con el comité editorial
y del cumplimiento del formato requerido por la revista y la aprobación de la versión final del manuscrito.

FORMATO DEL MANUSCRITO


Título en minúsculas, con una extensión máxima de 18 palabras, negrita, centrado, 14 puntos. Ejemplo:

Preferencia de estratos boscosos en la alimentación de


Turdus fuscater del Pasochoa
Autor o Autores: Nombre(s), Apellido(s), en negrita, 12 puntos. Ejemplo:

Juan Eduardo Pueblo P1 y Estelita Estrella2


Afiliación institucional: institución, ciudad, país, correo electrónico del autor encargado de la
correspondencia; si los autores representan a diferentes instituciones indicar con un superíndice numérico,
el texto en 10 puntos. Ejemplo:
90

1
Centro de Investigaciones Científicas del IASA, Facultad de Ciencias Agropecuarias, ESPE, Sangolquí, Ecuador. j_salazar@espe.edu.ec
2
Departamento de Zoología, Escuela de Biología, Universidad Amazónica del Uruguay.

RESUMEN: con una extensión máxima de 200 palabras

PALABRAS CLAVES: cinco palabras separadas por coma y en orden alfabético

ABSTRACT: resumen en inglés

KEYWORDS: cinco palabras en inglés, separadas por coma y en orden alfabético

INTRODUCCIÓN

En el contenido de esta sección se asume que el lector es un conocedor del tema por lo tanto debe ser concisa.

MATERIALES Y MÉTODOS

Esta sección debe proveer la información necesaria para entender y replicar los experimentos. En caso
de reportar nuevos procedimientos es necesario que se incluya información detallada de los mismos. De
forma opcional se pueden incluir anexos que complementen esta información. Es necesario mencionar las
marcas de los equipos y reactivos.

En los trabajos que así lo requieran es necesario presentar el listado del material examinado, con las
coordenadas de las localidades muestreadas y citar las instituciones depositarias de los especímenes.

RESULTADOS

Deben ser presentados en el mismo orden como fueron descritos en la sección de materiales y métodos. Los
datos cuantitativos deben ser presentados en tablas o figuras.

DISCUSIÓN

No repetir los resultados sino discutir sobre el significado de ellos al compararlos con datos existentes,
argumentar y resaltar la novedad de los mismos.

CONCLUSIONES
Es una parte opcional del texto, deben ser sintéticas y consistentes con los resultados y la discusión, se
deben separar con viñetas de círculo, por ejemplo:

•Las especies ecuatorianas D. chorlavi y D. rucux comparten el número cromosómico 2n=10 con las
especies que conforman el grupo de especies D. mesophragmatica.

•D. chorlavi y D. rucux difieren entre ellas en el tamaño y morfología del cromosoma 5.

REFERENCIAS BIBLIOGRÁFICAS

Serán citadas en orden alfabético según el apellido del primer autor y seguido de la letra del nombre; si
el mismo autor tiene dos o más artículos del mismo año, estos serán diferenciados alfabéticamente con
una letra. Si el mismo autor tiene dos o más artículos de diferentes años, estos serán citados en orden
cronológico del más antiguo al más reciente.

Cuando el artículo tiene más de seis autores, serán nombrados los seis primeros seguidos de et al.

REMCB 36 (2), 2015


91

Las referencias bibliográficas llevarán sangría especial francesa. Ejemplos:

a. Artículo de revista científica: Los nombres de las revistas deberán ser escritos en su forma completa y con cursiva:

Rodríguez-Guerra A, Barnes CW, Ordóñez MC, Salazar A y Soria CA. 2012. Identificación y evaluación de
algunos hongos con actividad celulásica aislados en Ecuador. Revista Ecuatoriana de Medicina y Ciencias
Biológicas 33(1 y 2): 65–81.

Duchicela EJ. 2004. Diversidad funcional de las micorrizas arbusculares asociadas a Brosimun utile en
condiciones naturales. Ciencia 7(8):65–77.

Staikou A y Lazaridou-Dimitriadou M. 1991. The life cycle, population dynamics, growth and secondary
production of the snail Xeropicta arenosa Ziegler (Gasteropoda: Pulmonata) in northern Greece. Zoological
Journal of Linnean Society 101:179–188.

b. Capítulo de libro
Eisenberg JF. 1979. Habitat, economy and society: some correlations, and hypotheses for the Neotropical
primates. En: Bernsteind IS y OE Smiths (eds) Primates ecology and human origins: ecologycal
influences on social organization: 215–262. Granland STPM Press. New York and London.

c. Tesis de grado
Astudillo Y. 2009. Identificación, caracterización y diferenciación de carbohidratos y proteínas en la secreción
de dorso y pie de la babosa terrestre Limas flavus (Mollusca: Gastropoda). Tesis de Licenciatura en
Ciencias Biológicas, Pontificia Universidad Católica del Ecuador. Quito, Ecuador.

d. Libros enteros
Gumport RI, Deis FH, Gerber N y Koeppe RE. 2006. Biochemistry, Sexta edición. Freeman and company.
USA. 627 pp.

e. Información proveniente de internet: Ciertas páginas que tengan información científica relevante
pueden citarse así:
Di Fiore A. 2001. Proyecto Primates Ecuador. Página de Internet: www.nyu.edu/projects/difiore.
Consultada 13-enero-2006.

CITAS EN EL TEXTO: use el siguiente formato para la citación de literatura en el texto, la cual debe
tener un orden cronológico del más antiguo al más reciente: (Barba et al. 2009, Barba 2010, Montenegro y
del Pino 2010, Salceda 2011a, b).

FIGURAS

Las figuras (esquemas, diagramas, dibujos, gráficos, fotografías y mapas), deben ser preparadas en formato
JPG o TIFF, de alta calidad, resolución mínima de 300 dpi, pueden ser a colores y cada una deberá ser
enviada en un archivo individual rotulado con el número correspondiente. Se sugiere utilizar programas
de edición de gráficos para la elaboración de las figuras. Las figuras de barras pueden presentarse en 2D
o 3D pero siempre deberán mostrarse en plano frontal. Las figuras compuestas por secciones deberán
identificar cada sección con una letra mayúscula que sea visible y de tamaño apropiado con la imagen. La
posible ubicación de las figuras debe señalarse en el texto del manuscrito con una cita entre paréntesis y
resaltado amarillo. Ejemplo (Figura 1, aquí). El comité editorial se reserva el derecho de ubicar las figuras
en función del espacio disponible.

Las figuras deberán ser numeradas en orden de aparición en el texto, deberán llevar una rotulación que
debe iniciar con la palabra Figura y el número arábigo correspondiente y un título conciso, en 10 puntos y
negrita, y a continuación una leyenda descriptiva (opcional) de la figura, ésta no debe ser una repetición del
texto. Incluir las definiciones de las abreviaciones usadas en la figura, si fuera el caso. Las leyendas deberán
enviarse en un archivo Word.
92

TABLAS

Las tablas deben presentarse con una rotulación en la parte superior la cual debe iniciar con la palabra
Tabla y el número arábigo correspondiente, luego un título conciso y explicativo en 10 puntos y negrita, y a
continuación una leyenda (opcional). Los símbolos o abreviaciones pueden explicarse al pie de la tabla. Las
tablas serán numeradas de acuerdo al orden de aparición en el texto y estarán construidas solo con líneas
horizontales que separen los encabezados. Deben ser preparadas en formato XLS (EXCEL), y cada tabla
presentarse en una hoja aparte, según el criterio de rigurosa economía de espacio. La posible ubicación
de las tablas debe señalarse en el texto del manuscrito con una cita entre paréntesis y resaltado amarillo.
Ejemplo (Tabla 1, aquí). El Comité Editorial se reserva el derecho de ubicarlas en función del espacio
disponible, o solicitar a los autores efectuar los cambios correspondientes.

NOMENCLATURA

Nombres científicos.- Los nombres científicos deben ser escritos en itálicas, y al ser citados por primera vez
en el texto se debe incluir el nombre del/los autor(es) de la descripción original de la especie.

Abreviaturas.- Utilizar la menor cantidad de abreviaturas. Definir la abreviatura la primera vez que
aparezca en el texto.

Numeración.- Las cifras decimales serán separadas con punto, ejemplo: 0.007 o 1.005 y un máximo de hasta
tres decimales. Los miles se escriben sin puntos ni comas, ejemplo: 18460, 593000. Los rangos de números
arábigos deben ser separados con el tipo de símbolo Word “en dash” (–).

Simbología.- Tomar como referencia el Sistema Internacional de Unidades (SI). Las coordenadas deberán
ser representadas así: 78°31´17.2” W 0°11´22”S. Escribir los símbolos o abreviaturas a continuación de la
cifra numérica, sin espacio entre ellos, ejemplo: 32%, 12ml, 88g, 46°C, 115°F. Se permite el uso de la letra
L en mayúscula o l en minúscula como símbolos del litro, a fin de evitar la confusión entre la cifra 1 (uno)
y la letra l (ele). El submúltiplo micro se representa con la letra griega μ seguido de la unidad de medida,
por ejemplo: μL, μg. Los símbolos de las unidades de medida no van seguidos de un punto, excepto al
final de una frase.

La escritura de palabras compuestas se sujetará a las reglas ortográficas correspondientes, pues se deben
emplear con guión o sin él según los casos, como en los siguientes ejemplos: físico-químico, teórico-práctico,
cirujano-anestesista, seudotumor, neurorradiología, intracraneal.

PRESENTACIÓN DEL MANUSCRITO


Los manuscritos deben ser presentados en formato Word, en idioma español o inglés, en formato de columna
normal, con los cuatro márgenes de 2.5cm, tipo de letra “Times New Roman” 12 puntos (excepto donde se
indica un tamaño diferente), doble espacio, justificado, sin sangría, numeración en líneas y páginas.
Los títulos de las secciones (INTRODUCCIÓN, MATERIALES Y MÉTODOS, RESULTADOS,
DISCUSIÓN, CONCLUSIONES, AGRADECIMIENTOS Y REFERENCIAS
BIBLIOGRÁFICAS) van en mayúsculas, negrita. Excepto en la introducción, en el resto de secciones
se pueden utilizar subtítulos. Los subtítulos van en el mismo párrafo con minúsculas, negrita, separados
del texto por punto y raya.

El autor de correspondencia deberá enviar el manuscrito original en versión electrónica vía e-mail a la
dirección, revecuatorianamedycb@gmail.com. El manuscrito deberá ir acompañado de los archivos de
figuras y tablas y un archivo con las leyendas de las mismas (no incluir las figuras y tablas dentro del
archivo de texto). Junto a este material se deberá enviar una carta dirigida al editor de la Revista en la
cual se debe indicar la originalidad del trabajo y describir el aporte de cada uno de los coautores a la
investigación. En los casos que se considere necesario, el editor solicitará la presentación de los permisos
de investigación y/ó los informes favorables de los comités de ética respectivos.

REMCB 36 (2), 2015


93

Los manuscritos serán revisados por árbitros anónimos asignados por el editor, su aprobación estará sujeta al
contenido científico, respaldado por el parecer de los árbitros y la resolución del editor, el mismo que solicitará
de los autores realizar los cambios y sugerencias pertinentes, acompañando las sugerencias respectivas.

El editor se reserva el derecho de rechazar los manuscritos cuando estos no cumplan con el formato o los
requerimientos establecidos por la revista.

INFORMACIÓN SOBRE LA REVISTA: información adicional y el instructivo para publicación


se encuentra disponible en el portal de la Revista Ecuatoriana de Medicina y Ciencias Biológicas (REMCB)
http://www.puce.edu.ec/revistaciencia.

Última actualización: noviembre 2015


94

REMCB 36 (2), 2015


95

FE DE ERRATAS

El siguiente artículo fue publicado en el Número 35 (1 y 2), 2014 de la REMCB, en ésta


edición se lo incluye como una fe de erratas con una corrección en el orden de los autores
96

REMCB 36 (2), 2015