Está en la página 1de 92

Métodos no Paramétricos

Pruebas de hipótesis en problemas de una muestra

Jimmy Corzo
(Dr.rer.nat)

Profesor Asociado
Departamento de Estadı́stica
Facultad de Ciencias
Universidad Nacional de Colombia

23 de febrero de 2018

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Pruebas de hipótsis

Una prueba de hipótesis es un procedimiento por el cual se verifica


la veracidad de una hipótesis (conjetura) denotada por H0
hecha sobre alguna caracterı́stica estadı́stica de una población
llamada parámetro

Requerimientos para probar una hipótesis:


Información o datos sobre el parámetro de interés.
Observaciones independientes X1 , . . . , XN
Una estadı́stica de prueba T
Una regla de decisión sobre la veracidad o no de la hipótesis
construida con los valores de la estadı́stica de prueba.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Pruebas de hipótsis

Una prueba de hipótesis es un procedimiento por el cual se verifica


la veracidad de una hipótesis (conjetura) denotada por H0
hecha sobre alguna caracterı́stica estadı́stica de una población
llamada parámetro

Requerimientos para probar una hipótesis:


Información o datos sobre el parámetro de interés.
Observaciones independientes X1 , . . . , XN
Una estadı́stica de prueba T
Una regla de decisión sobre la veracidad o no de la hipótesis
construida con los valores de la estadı́stica de prueba.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Pruebas de hipótsis

Una prueba de hipótesis es un procedimiento por el cual se verifica


la veracidad de una hipótesis (conjetura) denotada por H0
hecha sobre alguna caracterı́stica estadı́stica de una población
llamada parámetro

Requerimientos para probar una hipótesis:


Información o datos sobre el parámetro de interés.
Observaciones independientes X1 , . . . , XN
Una estadı́stica de prueba T
Una regla de decisión sobre la veracidad o no de la hipótesis
construida con los valores de la estadı́stica de prueba.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Pruebas de hipótsis: regla de decisión o región crı́tica
Valor p
Sea T la estadı́stica de prueba para una hipótesis H0 y t el valor
observado en la muestra. El valor-p se define como
valor − p = p̂ = P(T ≥ t)
Es decir, el valor p es la probabilidad de que la estadı́stica T tome
un valor mayor que el t observado.
Se puede rechazar H0 con el valor de la estadı́stica: por ejemplo
para hipótesis de una sola cola a la derecha, cuando
T ≥t
o se puede rechazar con el valor p, por ejemplo cuando
p̂ ≤ α
donde α es el nivel de significancia prefijado. Generalmente 0.05 o
0.01.
Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de
CAPÍTULO 1. una muestra:
Calidad de las pruebas de hipótsis

Se mide por
la potencia de la prueba que es la probabilidad de rechazar
la hipótesis cuando es falsa. Tomar una decisión correcta.
Coloquialmente: ”la probabilidad de rechazar mentiras”
1 − P(rechazar H0 cuando es falsa)
el nivel de significancia que es la probabilidad de aceptar la
hipótesis cuando es falsa. Tomar una decisión incorrecta. Error
tipo I:
Coloquialmente ”la probabilidad de aceptar mentiras”

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Calidad de las pruebas de hipótsis

Se mide por
la potencia de la prueba que es la probabilidad de rechazar
la hipótesis cuando es falsa. Tomar una decisión correcta.
Coloquialmente: ”la probabilidad de rechazar mentiras”
1 − P(rechazar H0 cuando es falsa)
el nivel de significancia que es la probabilidad de aceptar la
hipótesis cuando es falsa. Tomar una decisión incorrecta. Error
tipo I:
Coloquialmente ”la probabilidad de aceptar mentiras”

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Calidad de las pruebas de hipótsis

Calidad y errores en pruebas de hipótesis:

H0 Cierta Falsa
Acepta OK Error tipo II
Rechaza Error tipo I Potencia de la prueba

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


Aleatoriedad o Independencia

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE
ALEATORIEDAD
En términos muy generales, por una racha se entiende una
sucesión de sı́mbolos idénticos.

Por ejemplo,
• rachas de buena (mala) suerte refiriéndose a situaciones
repetidas en las que las cosas funcionan bien (mal) durante algún
perı́odo de tiempo.
• racha exitosa de un equipo cuando gana varios partidos seguidos.
• los periodistas suelen decir que el dollar “subió” o “bajó” en el
dı́a

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE
ALEATORIEDAD
Tipos de rachas más genrales incluyen más de dos sı́mbolos:
Por ejemplo la secuencia genética del DNA es el orden particular
en que se encuentran los nucleótidos en una molécula de ADN
TTTTCGGGGGGCCCTTTTAAAAA
A = adenina, C = citosina, G = guanina, T = timina

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE
ALEATORIEDAD

En el caso que se trata aquı́ solo se consideran sucesiones de 2


sı́mbolos, es decir, los eventos de interés son de tipo Bernoulli:

0000000000011111111110000011111000011000111010

donde los 1s representan la ocurrencia de un evento A y los 0´s


representan la no ocurrencia de A

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE ALEATORIEDAD

Una sucesión de este tipo se denotará por η1 , . . . , ηn , donde:



1 ocurre el evento A
ηj = para j = 1, . . . , n
0 no ocurre el evento A
A esta sucesión se le llama sucesión dicotomizada o muestra
dicotómica y a cada grupo de sı́mbolos iguales en la sucesión se le
denomina racha.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE ALEATORIEDAD

En el ejemplo anterior se distinguen R = 11 rachas:

00000000000
| {z } 1111111111
| {z } 00000
| {z } 11111
| {z } 0000 11 |{z}
|{z} |{z} 000 |{z}
111 |{z}
0 |{z}
1 |{z}
0 .
racha1 racha1 racha2 racha11

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE ALEATORIEDAD

La región crı́tica para la prueba se construye con el siguiente


argumento:
Muchas rachas en la sucesión observada son evidencia de que el
evento A tiende a ocurrir y no ocurrir sistemáticamente
Pocas rachas serı́an indicador de que hay agrupamientos en
alguno o en ambos extremos de la sucesión.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE ALEATORIEDAD

La hipótesis de interés es la hipótesis de aleatoriedad:

H0 : η1 , . . . , ηn son independientes

se utiliza R el número de rachas en la sucesión para contrastarla


contra alguna de las siguientes alternativas:
Hipótesis alternativas Región de rechazo
K1 : no aleatoriedad: η1 , . . . ηn tiene algún R ≤ rα/2 ó R ≥ r1−α/2
patrón de comportamiento no especificado
K2 : Tendencia: en la sucesión η1 , . . . ηn exis- R ≤ rα
te tendencia a los agrupamientos
K3 : Autocorrelación serial negativa de pri- R ≥ r1−α
mer orden en la sucesión η1 , . . . , ηn
En cualquier caso se rechaza cuando p̂ ≤ α, solo que para la hipótesis de
no aleatoriedad p̂ = P(R ≤ rα/2 ) + P(R ≥ r1−α/2 )

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE ALEATORIEDAD

Tendencia Autocorr serial de 1er orden

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE ALEATORIEDAD

Análogamente para las pruebas a una cola, los valores crı́ticos rα y


r1−α se definen de manera que P(R ≤ rα ) ≤ α y P(R ≥ r1−α ) ≤ α.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE ALEATORIEDAD

Solo para teorı́a


Distribución de R bajo H0 :

m−1 n−1
  
 2 r /2−1 r /2−1
cuando r es par


m+n

 
m


P(R = r ) =
m−1 n−1 m−1 n−1
    


 (r −1)/2 (r −3)/2 + (r −3)/2 (r −1)/2


 m+n
 cuando r es impar
m

para r = 2, 3, . . . , m + n. La demostración completa se encuentra


en Gibbons y Chakraborti (1992, páginas 70-72).

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE
ALEATORIEDAD

Solo para teorı́a


Valor esperado y varianza de R

2mn 2mn(2mn − m − n)
E (R) = 1 + y V (R) = . (1)
m+n (m + n)2 (m + n − 1)

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE
ALEATORIEDAD
Solo para teorı́a
Distribudión asintótica de R:
Wald y Wolfowitz (1940) demostraron que si el tamaño de la
muestra N = n + m crece de tal manera que m/N → λ y
n/N → 1 − λ, con λ fijo, 0 < λ < 1, entonces
   
R R
lı́m E = 2λ(1 − λ) ; lı́m var √ = 4λ2 (1 − λ)2
N→∞ N N→∞ N
y por tanto, la variable aleatoria
R − 2Nλ(1 − λ)
Z= √
2 Nλ(1 − λ)
converge en distribución a la distribución normal estándar cuando
N tiende a infinito.
Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de
CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE ALEATORIEDAD: Ejemplo

Ejemplo
En un conocido noticiero se reportó la siguiente sucesión de alzas
(1) y bajas (0) de la TRM durante el mes de enero de de 2010:
0 0 0 1 1 1 1 1 0 0 0 1 0 0 1
0 0 0 1 0 0 0 0 0 1 0 0 0 1 0

¿Se puede afirmar, a partir de esta sucesión que en el mes hubo


tendencia a la baja?

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE
ALEATORIEDAD

En la sucesión hay 13 rachas, 10 unos y 20 ceros, ası́ que


utilizando las expresiones (1) para el valor esperado y la varianza
de R el valor de la estadı́stica de prueba es:

13 − E (R)
z= p = −0,5599228
V (R)

Como el interés es saber si hubo tendencia a la baja en el valor de


la TRM al nivel de significancia α = 0,05 se utiliza la prueba de
rachas para la alternativa de tendencia.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE
ALEATORIEDAD

Calculos en R:
runs.test(x, ”left.sided”, plot = T, threshold = 0.5) de R se obtiene

p̂ = P(Z ≤ −0,5599228) = 0,2878

es decir p̂ > α, de manera que no se puede rechazar la hipótesis de


aleatoriedad de la sucesión de valores de la TRM en el mes de
enero. Y se concluye que no hubo ninguna tendencia en el ese mes.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE
ALEATORIEDAD
En algunas ocasiones, las observaciones están en forma numérica,
por ejemplo observaciones ordenadas en el tiempo X1 , . . . , XT , y
provienen de una distribución continua F , pero no satisfacen los
supuestos requeridos para llevar a cabo una prueba paramétrica.
Entonces, se puede construir una sucesión dicotomizada de la
siguiente manera:
(
1 si Xt < Xt−1
ηt (x) = j = 2, . . . , T
0 en otro caso
Ahora cada éxito corresponde a un incremento del instante t − 1 al
t, y el proceso implica la pérdida de una observación. El rechazo de
la hipótesis de aleatoriedad en este caso indica autocorrelación de
primer orden.
Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de
La hipótesis de simetrı́a

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE SIMETRÍA

Información requerida:
Muestra aleatoria X1 , . . . , Xn de una distribución continua F con
mediana cero. Hipótesis de interés:

H0 : F (x) = 1 − F (−x) ∀x ∈ <

La cual se prueba frente a alguna de las siguientes alternativas:

K1 : F (x) > 1 − F (−x), para al menos un x ∈ <


K2 : F (x) < 1 − F (−x), para al menos un x ∈ <
K3 : F (x) 6= 1 − F (−x), para al menos un x ∈ <

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE SIMETRÍA

K1 indica que la cola derecha de la distribución muestreada es


“mas pesada” que la cola izquierda;
K2 indica que la cola izquierda es más pesada que la cola derecha;
K3 indica que F no es simétrica sin especificar en cual de sus colas.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE SIMETRÍA

Existen varias pruebas para la simetrı́a de la distribución


muestreada. Aquı́ se utilizarán tres recientemente aparecidas
basadas en la diferencia entre la media y la mediana muestrales
(X̄ − θ̂) y se encuentran implementadas en R

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE SIMETRÍA
Las estadı́sticas de prueba son:
Prueba de Miao, Modarres y Gastwirth [2] que utiliza la estadı́stica:

N(X̄ − θ̂)
MGG = ,
J
donde r N
1 πX
J= |Xi − θ̂|.
2 2
i=1
Prueba de Cabilio y Masaro [1] que utiliza la estadı́stica:

N(X̄ − θ̂)
CM = ,
s
donde s 2 es la varianza muestral .
Prueba de Mira [3] basada en la estadı́stica:
M = 2(X̄ − θ̂),
Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de
CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE SIMETRÍA
Ejemplo
Se simulan 1000 observaciones de la distribución Normal
En R se usa el comando xN=rnorm(1000). los datos y la gráfica son los
siguientes.

Verificar que la prueba de rachas no rechaza la hipótesis de simetrı́a.


Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de
CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE SIMETRÍA

Calculos en R:
symmetry.test(xN, boot = F)
que produce los siguientes resultados
Symmetry test by Miao, Gel, and Gastwirth (2006)
data: xN¿
Test statistic = 0.25862, p-value = 0.7959
alternative hypothesis: the distribution is asymmetric.
Por o tanto No se rechaza la hipótesis de simetrı́a como era de
esperar dado que las observaciones provienen de una distribución
normal.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE SIMETRÍA
Ejemplo
Se simulan 1000 observaciones de la distribución Lognormal
xL< −rlnorm(1000)

Verificar que la prueba de rachas rechaza la hipótesis de simetrı́a

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de rachas para la HIPÓTESIS DE SIMETRÍA

Calculos en R:
symmetry.test(xL, boot = F)
que produce los siguientes resultados:

Symmetry test by Miao, Gel, and Gastwirth (2006)


data: xL
Test statistic = 7.2617, p-value = 3.824e-13
alternative hypothesis: the distribution is asymmetric.
Por o tanto Se rechaza la hipótesis de simetrı́a como era de
esperar dado que las observaciones provienen de una distribución
Lognormal.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


Prueba para la calidad del ajuste de la
distribución observada por una distribución
conocida

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de Kolmogorov-Smirnov para CALIDAD DEL AJUSTE

Información requerida:
Observaciones independientes X1 , . . . , Xn de una distribución
continua F
EL interés es averiguar si F tiene la forma de alguna F0 conocida:

H0 : F (x) = F0 (x), ∀x ∈ < vs K1 : F (x) 6= F0 (x) p. a. m. u x ∈ <

H0 : F (x) ≤ F0 (x), ∀x ∈ < vs K2 : F (x) > F0 (x) p. a. m. u x ∈ <


H0 : F (x) ≥ F0 (x), ∀x ∈ < vs K1 : F (x) < F0 (x) p. a. m. u x ∈ <
p. a. m. u: para al menos un

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de Kolmogorov-Smirnov para CALIDAD DEL AJUSTE

Solo para teorı́a


Para construir la estadı́stica de prueba se requiere la función de
distribución empı́rica que se define por:




0 x < X(1)
k

Fn (x) = X(k) ≤ x < X(k+1) para k = 1, 2, . . . , n − 1 (2)

 n
x ≥ X(n)

1

donde X(1) < X(2) < · · · < X(n) son las observaciones ordenadas en
forma ascendente.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de Kolmogorov-Smirnov para CALIDAD DEL AJUSTE

Estadı́sticas de prueba:
Dn = máx|F0 (x) − Fn (x)| para la alternativa K1
x∈<
Dn es la mayor distancia vertical entre F0 (x) y Fn (x).

Dn+ = máx(Fn (x) − F0 (x)) para la alternativa K2


x∈<
Dn+ es la mayor distancia vertical entre F0 (x) y Fn (x) cuando Fn
está por encima de F0

Dn− = máx(F0 (x) − Fn (x)) para la alternativa K3 .


x∈<
Dn− es la mayor distancia vertical entre F0 (x) y Fn (x) cuando F0
está por encima de Fn

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de Kolmogorov-Smirnov para CALIDAD DEL AJUSTE

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de Kolmogorov-Smirnov para CALIDAD DEL AJUSTE

Ejemplo
Para un estudio del consumo de gasolina de vehı́culos particulares,
se dispone de una muestra de 10 vehı́culos a los que se hicieron
mediciones del consumo en litros por cada 100 km. Se quiere saber
si los datos se ajustan a una distribución Normal de media 12 y
varianza 1.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de Kolmogorov-Smirnov para CALIDAD DEL AJUSTE

V. hipoteticos Val. Obs Vr ref. di+ di−


x Cons F0 = Φ(x(i) − 12) Fn (x(i) ) Fn (x(i−1) ) di+ di−
x(1) 11.5 0.3085 0.1 0.0 0.2085 0.3085
x(2) 11.8 0.4207 0.2 0.1 0.2207 0.3207
x(3) 12.0 0.5000 0.3 0.2 0.2000 0.3000
x(4) 12.4 0.6554 0.4 0.3 0.2554 0.3554
x(5) 12.5 0.6915 0.5 0.4 0.1915 0.2915
x(6) 12.6 0.7257 0.6 0.5 0.1257 0.2257
x(7) 12.8 0.7881 0.7 0.6 0.0881 0.1881
x(8) 12.9 0.8159 0.8 0.7 0.0159 0.1159
x(9) 13.0 0.8413 0.9 0.8 0.0587 0.0413
x(10) 13.2 0.8849 1.0 0.9 0.1151 0.0151

La mayor diferencia observada es dn = 0,3554.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


Calculos en R:
Vector con los datos
x=c(11.5, 11.8, 12.0, 12.4, 12.5, 12.6, 12.8, 12.9, 13.0, 13.2)
Vector centrado por la media hipotética que es 12
x=x-12
Prueba de KS
ks.test(x, ”pnorm”)
Se obtienen los siguientes resultdos
One-sample Kolmogorov-Smirnov test
data: x D = 0.35542, p-value = 0.1233 alternative hypothesis:
two-sided
En consecuencia se acepta la hipótesis de que el consumo de
gasolina proviene de una distribución normal de media 12 y
varianza 1

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de Kolmogorov-Smirnov para CALIDAD DEL AJUSTE

Para los cálculos se utilizaron las diferncias por encima y por


debajo de los datos con la distribución normal donde
x
(i) − 12   x − 12 
(i)
di+ = Fn (x(i) )−Φ , di− = Φ −Fn (x(i−1) ).
1 1
y se calcula
Dn+ = máx(dn+ , dn= )

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de Kolmogorov-Smirnov para CALIDAD DEL AJUSTE
Solo para teorı́a
Distribución exacta de las estadı́sticas de prueba



0 para v ≤ 0




1 R
1/2n+v R 3/2n+v R 2n−1/2n+v
P(Dn < + v) = 1/2n−v 3/2n−v · · · 2n−1/2n−v f (u)du para 0 <
2n 





1 para v ≥ 2n−1

2n

donde f (u)du = f (u1 , . . . , un )dun · · · du1 y



n! para 0 < u1 < u2 < · · · < un < 1

f (u)du = f (u1 , . . . , un ) =

0 en otro caso

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de Kolmogorov-Smirnov para CALIDAD DEL AJUSTE

Solo para teorı́a


Distribución asintótica de las estadı́sticas de prueba
 λ 
lı́m P Dn ≤ √ = Q1 (λ),
n→∞ n
donde

2 λ2
X
Q1 (λ) = 1 − 2 (−1)k−1 e −2k , λ > 0.
k=1

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


La prueba de K-S propositos especı́ficos
Ajuste a la Normal y a la exponencial

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de BONDAD DE AJUSTE de
Kolmogorov-Smirnov: Variaciones de Lilliefors

Solo para teorı́a


Dos modificaciones interesantes de la prueba de
Kolmogorov-Smirnov fueron propuestas por Lillifors. La primera
para bondad de ajuste a la distribución normal:
Consiste en usar la estadı́stica Dn de K-S pero sobre la sucesión de
las observaciones transformadas Z1 , . . . , Zn , definiendo:

Xi − X̄
Zi = , i = 1, . . . n
S
donde X̄ y S son la media y la desviación estándar de las
observaciones originales. Los valores crı́ticos se encuentran en la
tabla O del libro de Gibbons.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Prueba de BONDAD DE AJUSTE de
Kolmogorov-Smirnov: Variaciones de Lilliefors

Solo para teorı́a La segunda para la bondad del ajuste de la


distribución muestreada a distribución exponencial se encuentra en
que consiste en utilizar la estadı́stica de K-S sobre la sucesión
transformada:
Xi
Zi =

Los valores crı́ticos se encuentran en la tabla A15 del libro de
Conover

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


Pruebas para la hipótesis de localzación

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización:
1. La prueba del signo

Tipo de bservaciones requeridas


X1 , . . . , XN independientes, provenientes de F (x − θ), donde
continua. Se busca probar la hipótesis:

H0 : θ = 0 (3)

frente a alguna de las siguientes alternativas

K1 : θ > 0, o K2 : θ < 0, o K3 : θ 6= 0.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización:
1. La prueba del signo
La prueba del signo

La estadı́stica de prueba utilizada es el número de observaciones


positivas en la muestra que se calcula definiendo:

1 si Xi > 0
s(Xi ) =
0 si Xi ≤ 0

para obtener el número de observaciones positivas ası́:

N
X
S = # {Xi > 0} = s(Xi )
i=1

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización:
1. La prueba del signo
Ejemplo
En los años cincuenta, Matthews y otros investigadores realizaron
un experimento sobre la forma en que las aves orientan su vuelo.
En los entrenamientos de palomas mensajeras, las aves se entrenan
para llegar a casa desde varias distancias a lo largo de una lı́nea
especı́fica de entrenamiento. Para determinar si las aves
encuentran el camino a casa de manera sistemática desde puntos
con los que no están familiarizadas, se realizaron experimentos en
los cuales se tomaron las aves en dı́as soleados y se dejaron en
libertad desde puntos ubicados a 90 y 180 grados de la lı́nea de
entrenamiento. Una medida de interés era el ángulo entre la lı́nea
de vuelo de la paloma cuando desaparece en el horizonte y la lı́nea
de entrenamiento. Los ángulos se midieron entre 0 y 180 grados de
manera que no se distingue entre ángulos por encima o por debajo
de la lı́nea de entrenamiento.
Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de
CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización:
1. La prueba del signo

Ejemplo
Sea θ la mediana poblacional del ángulo de error. Cuando las
palomas no regresan a la casa este ángulo es θ = 90o . Una
hipótesis de interés consiste en suponer que las aves navegan
usando el sol y que esto implica que θ < 90o . Entonces se
construye una prueba para la hipótesis H : θ = 90o contra la
alternativa K1 : θ < 90o . Si se rechaza la hipótesis nula, se podrá
concluir que las palomas regresarán a la casa.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización:
1. La prueba del signo

Ejemplo: (Cont)
Los datos son los siguientes:

Ángulos de error de palomas mensajeras liberadas en dı́as soleados


6 7 9 17 18 18 22 28 32 35 36 42 42 42
48 48 51 52 53 55 56 57 58 63 72 83 91 97

Debido a que solo hay dos observaciones positivas el valor de la


estadı́stica es S = 2 con lo cual es muy poco probable que se
pueda aceptar la hipótesis de que θ = 90, como se verifica en lo
que sigue, usando la prueba del signo.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización:
1. La prueba del signo

Para los cálculos con R se utiliza un enfoque ligeramente diferente


de la prueba del signo que consiste en lo siguiente: Sea p la
probabilidad de éxito en una sucesión de experimentos Bernoullı́.
Entonces la hipótesis nula se formula ası́:
1
H0 : p = , que equivale a θ = 90
2
y se contrasta con alguna de las siguientes alternativas
1 1 1
K1 : p > , K2 : p < , K3 : p 6=
2 2 2
En este enfoque la prueba suele llamarse prueba binomial

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización:
1. La prueba del signo

Calculos en R:
Construir un vector con los datos
x.palomas=c(6, 7, 9, 17, 18, 18, 22, 28, 32, 35, 36, 42, 42, 42, 48,
48, 51, 52, 53, 55, 56, 57, 58, 63, 72, 83, 91, 97)
Calcular el número de éxitos
for (i in 1:28) {
if (x.palomas[i]> 90) s[i]=1 else s[i]=0
}
S=sum(s)

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización:
1. La prueba del signo

Calculos en R:
binom.test(S,28,0.5, ”less”)
que produce el siguiente resultado
Exact binomial test
data: S and 28
number of successes = 2, number of trials = 28, p-value =
1.516e-06
alternative hypothesis: true probability of success is less than 0.5
95 percent confidence interval:
0.0000000 0.2082047
sample estimates:
probability of success

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización:
1. La prueba del signo

Empates en la prueba del signo


El supuesto de continuidad de la distribución muestreada garantiza
que

P(Xi = 0) = 0 (caso1) y P(Xi = Xj ) = 0 (caso 2)

Sin embargo, estos dos casos pueden ocurrir en la práctica debido


a errores de medición o en el supuesto de continuidad de la varible
de estudio.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización:
1. La prueba del signo

Empates en la prueba del signo


Caso 1: Sea n0 el número de observaciones iguales a cero. La
manera más común de tratar el problema, cuando n0 es pequeño,
consiste en eliminar las observaciones iguales a cero y utilizar la
misma estadı́stica S, pero basada en las N − n0 observaciones
diferentes de cero. La nueva estadı́stica S también tiene
distribución binomial, pero con parámetros N − n0 y p = 1/2. En
todo caso, no será conveniente utilizar este procedimiento cuando
n0 sea muy grande con respecto a N.
El caso 2: no altera el cálculo de la estadı́stica de prueba porque
para calcularla sólo se requiere saber si una observación dada es
positiva o no.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización:
1. La prueba del signo

Solo para teorı́a

Comentario final

La prueba del signo es uniformemente más potente para la


alternativa de una cola, en condiciones muy generales
(Hettmansperger, 1984, pp. 9 y ss.).

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


Prueba del rango signado de wilcoxon

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Modelo de muestreo
Muestra aleatoria: X1 , · · · , XN , cada v.a. con función de
distribución F (x − θ), simétrica. Entonces θ es la única mediana (y
la media, cuando existe) y se encuentra en el centro de la
distribución.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

El problema de inferencia es construir una prueba para la hipótesis:

H0 : θ = 0 (4)
frente a alguna de las siguientes alternativas

K1 : θ > 0, o K2 : θ < 0, o K3 : θ 6= 0.
La estadistica de Wilcoxon es la suma de los rangos de las
observaciones positivas T que se calcula como sigue:

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon
Procedimiento para calcular los rangos en caso de una
muestra
construir la sucesión de valores absolutos de la muestra:

|X1 |, |X2 | · · · , |XN |

y ordenarlos de manera ascendente

|X |(1) < |X |(2) < · · · < |X |(N)

Entonces se define el rango absoluto Ri+ de Xi por

|Xi | = |X |(R + )
i

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Se define también Dj el anti-rango de |X |(j) como el subı́ndice que


tiene la observación de donde proviene |X |(j) , es decir por:

|XDi | = |X |(j) .

No es difı́cil verificar que


RD+i = i

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

La estrategia de Wilcoxon es sumar los rangos de las observacioens


positivas en la muestra:
N
X N
X
T = Ri+ s(Xi ) = iWi Wi = s(XDi )
i=1 i=1

donde 
1 Xi > 0
s(Xi ) =
0 Xi ≤ 0

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Ejemplo
Rosenzweig et al. (1972) reportan experimentos realizados para
determinar la influencia del medio ambiente en la anatomı́a del
cerebroa . En experimentos recientes se han asignado aleatoriamente
tres ratones de cada una de doce camadas para permanecer en
jaulas estándar de laboratorio: una enriquecida con varios juguetes
y otra empobrecida, donde los ratones permanecen aislados.
a
Tomado de Hettmansperger (1984).

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Ejemplo, Cont.
Se hacen observaciones de medidas, como el peso del cerebro, la
actividad enzimática y el peso de la corteza cerebral. Para este
caso se utilizará la medida de la ganancia en peso de la corteza
durante un perı́odo especı́fico para 12 ratones de cada jaula. Si se
comparan los ratones de un entorno empobrecido con los de un
entorno enriquecido se tiene un experimento pareado, donde los
pares se arman de manera natural con ratones que pertenecen a la
misma camada y tienen la misma configuración genética.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Ejemplo, Cont.
Sean X y Y las medidas del peso de la corteza cerebral en el
entorno empobrecido y en el entorno enriquecido, respectivamente.
Entonces la variable aleatoria de interés es la diferencia
D = Y − X . Los investigadores justifican que D tiene distribución
simétrica alrededor de 0 (en caso de duda, se puede verificar el
supuesto de simetrı́a con alguna prueba no paramétrica adecuada).
Denotando por θ el la mediana de la distribución de D, el
experimento produce 12 observaciones D1 , · · · , D12 , para la prueba
de la hipótesis H0 : θ = 0 versus K1 : θ > 0.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Pares
No de ratón Enriquecido (Y ) Empobrecido (X ) Diferencia
1 689 657 32
2 663 646 17
3 653 642 11
4 740 650 90
5 699 698 1
6 690 621 69
7 685 647 38
8 718 689 29
9 742 652 90

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Pares
No de ratón Enriquecido (Y ) Empobrecido (X ) Diferencia
10 651 661 −10
|{z}
11 687 612 75
12 679 678 1

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Valor absoluto de las


diferencias ordenadas Rangos
1 1,5
1 1,5
10
|{z} 3
11 4
17 5
29 6
32 7

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Valor absoluto de las


diferencias ordenadas Rangos
38 8
69 9
75 10
90 11,5
90 11,5

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Como sólo hay una observación negativa que es (−10), el valor


T = 75 es la suma de los rangos de las diferencias ordenadas,
excluyendo el rango de la diferencia negativa.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Calculos en R:
library(MASS) # load the MASS package
setwd(”C:/Users/JACS/Google Drive/NPar 2018/CodigoR”)
library(openxlsx)
CoCe< −read.xlsx(”CortezaCerebral.xlsx”, sheet = 1)

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon

Calculos en R:
wilcox.test(CoCeEnrriquecido, CoCeEmpobrecido, paired = T,
exact = F)
que produce el resultado:
Wilcoxon signed rank test with continuity correction
data: CoCe$Enrriquecido and CoCe$Empobrecido
V = 75, p-value = 0.00532
alternative hypothesis: true location shift is not equal to 0

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon
..Empates

Por el supuesto de continuidad de la distribución muestreada, en el


caso de las pruebas del signo y del rango signado de Wilcoxon es
claro que:
P(Xi = XJ ) = 0
Sin embargo, en la práctica puede ocurrir que dos o más
observaciones tomen el mismo valor, debido a inexactitud en los
aparatos de medición o a errores en el supuesto de continuidad.
Para tratar este problema existen varias alternativas, entre las
cuales se mencionan aquı́ las tres más comunes.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon
..Empates

Eliminación de observaciones empatadas


Si el número de observaciones empatadas no es muy grande con
respecto al tamaño total de la muestra, digamos inferior al diez por
ciento del total de datos (aunque en muestras pequeñas este
porcentaje debe ser inferior), de cada grupo de empates se puede
dejar una de las observaciones y realizar la prueba con la misma
estadı́stica de prueba sin que los resultados se alteren de manera
considerable.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon
..Empates

Asignación aleatoria de los rangos a las observaciones


empatadas
Este procedimiento consiste en asignar con algún procedimiento
aleatorio una de las permutaciones de los rangos que les hubieran
correspondido a las observaciones empatadas en caso de no haber
empates. Este procedimiento garantiza que la distribución de los
rangos y, por lo tanto, la distribución de la estadı́stica se
mantienen (Hájek, 1998, p. 131).

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon
..Empates
Por ejemplo para N = 10, después de ordenar los datos puede
ocurrir lo siguiente:

1er grupo de empates 2o grupo de empates 3er grupo de empates


1 2 3 4 5 6 7 8 9 10
2,1 2,1 3,2 3,2 3,2 3,2 3,2 4,1 4,1 4,1

Entonces a las dos primeras observaciones se les asigna una de las


2! = 2 permutaciones de los rangos 1 y 2, a las cinco siguientes se
les asigna una de las 5! = 120 permutaciones de los rangos 3, 4, 5,
6 y 7, y a las tres últimas se les asigna una de las 3! = 6
permutaciones de los rangos 8, 9 y 10. Los rangos asignados ası́
son una de las 10! permutaciones de los enteros entre 1 y 10.
Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de
CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon
..Empates

Asignación de rangos promedio


El procedimiento consiste en asignar a las observaciones de cada
grupo de empates el promedio de los rangos que les hubieran
correspondido en caso de no haberse presentado empates.
Después se calcula la región crı́tica usando la distribución de los
rangos promedio condicionada al número de empates y a la
longitud de éstos. La forma de hacerlo se ilustra más adelante.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon
..Empates

Ejemplo
Considérese el conjunto de datos: −2,1; −1,2; −0,5; 1,2; 2,2, en
el cual el valor 1.2 está positivo y negativo, es decir está empatada
una observación positiva con una negativa.
Los valores absolutos ordenados son: 0,5; 1,2; 1,2; 2,1; 2,2, donde
los datos subrayados distinguen las observaciones negativas.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon
..Empates

Asignación de los rangos promedio:

Rangos sin empates 1 2 3 4 5


Datos ordenados 0,5 1,2 1,2 2,1 2,2
Rangos promedio 1 2,5 2,5 4 5 T = 7,5

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


CAPÍTULO 1. una muestra:
Dos pruebas para la alternativa de localización
2. Prueba del rango signado de Wilcoxon
..Empates
Rangos promedio
1 2,5 2,5 4 5
Resultados posibles T
x x x y y 9
x x y x y 7,5
x y x x y 7,5
y x x x y 6
x x y y x 6,5
x y x y x 6,5
y x x y x 5
x y y x x 5
y x y x x 3,5
y y x x x 3,5

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


Taller capitulo UNA MUESTRA

1. Prueba de aleatoriedad. Utilizar los datos del IPC que se


encuentran en el archivo IPC 1990-2012.csv y la prueba de
rachas para identificar si durante el año 2010 hubo algún tipo
de no aleatoriedad e indicar de qué tipo fue.
2. Prueba de simetrı́a. Utilizar los datos de los rankings de
universidades que se encuentran en el archivo
ARWU 100 top y la pruebas del comando symmetry.test
para identificar si entre los puntajes hay alguna distribución
simétrica.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


Taller capitulo UNA MUESTRA

1. Prueba de aleatoriedad. Utilizar los datos del IPC que se


encuentran en el archivo IPC 1990-2012.csv y la prueba de
rachas para identificar si durante el año 2010 hubo algún tipo
de no aleatoriedad e indicar de qué tipo fue.
2. Prueba de simetrı́a. Utilizar los datos de los rankings de
universidades que se encuentran en el archivo
ARWU 100 top y la pruebas del comando symmetry.test
para identificar si entre los puntajes hay alguna distribución
simétrica.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


Taller capitulo UNA MUESTRA

3. Transformaciones para conseguir simetrı́a. Un método de


corregir problemas de asimetrı́a de la distribución muestreada
cuando se quiere utilizar la prueba del rango signado de
Wilcoxon es transformar las observaciones. Utilice alguna de

las transformaciones log (x), x1 , x, o x 2 sobre los
indicadores del ARWU para saber si alguna de estas
transformaciones no rechaza la hipótesis de simetrı́a.
4. Prueba de bondad del ajuste. Simular muestras de una
distribución normal y verificar si la modificación de Lillifors de
la prueba de bondad de ajuste decide correctamente sobre la
normalidad de la distribución muestreada.
5. Prueba de bondad del ajuste. Simular muestras de una
distribución exponencial utilizar la modificación de Lillifors de
la prueba de bondad de ajuste decide correctamente sobre la
forma exponencial de la distribución muestreada.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


Taller capitulo UNA MUESTRA

3. Transformaciones para conseguir simetrı́a. Un método de


corregir problemas de asimetrı́a de la distribución muestreada
cuando se quiere utilizar la prueba del rango signado de
Wilcoxon es transformar las observaciones. Utilice alguna de

las transformaciones log (x), x1 , x, o x 2 sobre los
indicadores del ARWU para saber si alguna de estas
transformaciones no rechaza la hipótesis de simetrı́a.
4. Prueba de bondad del ajuste. Simular muestras de una
distribución normal y verificar si la modificación de Lillifors de
la prueba de bondad de ajuste decide correctamente sobre la
normalidad de la distribución muestreada.
5. Prueba de bondad del ajuste. Simular muestras de una
distribución exponencial utilizar la modificación de Lillifors de
la prueba de bondad de ajuste decide correctamente sobre la
forma exponencial de la distribución muestreada.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


Taller capitulo UNA MUESTRA

3. Transformaciones para conseguir simetrı́a. Un método de


corregir problemas de asimetrı́a de la distribución muestreada
cuando se quiere utilizar la prueba del rango signado de
Wilcoxon es transformar las observaciones. Utilice alguna de

las transformaciones log (x), x1 , x, o x 2 sobre los
indicadores del ARWU para saber si alguna de estas
transformaciones no rechaza la hipótesis de simetrı́a.
4. Prueba de bondad del ajuste. Simular muestras de una
distribución normal y verificar si la modificación de Lillifors de
la prueba de bondad de ajuste decide correctamente sobre la
normalidad de la distribución muestreada.
5. Prueba de bondad del ajuste. Simular muestras de una
distribución exponencial utilizar la modificación de Lillifors de
la prueba de bondad de ajuste decide correctamente sobre la
forma exponencial de la distribución muestreada.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


[1] P. Cabilio and J. Masaro.
A simple test of symmetry about an unknown median.
The Canadian Journal of Statistics, 24(3):349–361, 1996.
[2] W. Miao, Y. Gel, and J. Gastwirth.
A new test of symmetry about an unknown median.
Random Walk, Sequential Analysis and Related Topics - A
Festschrift in Honor of Yuan-Shih Chow. Eds.: Agnes Hsiung,
Cun-Hui Zhang, and Zhiliang Ying, World Scientific Publishe,
pages 1–19, 2006.
[3] A. Mira.
Distribution-free test for symmetry based on Bonferroni’s
measure.
Journal of Applied Statistics, 26(8):959–972, 1999.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


[1] P. Cabilio and J. Masaro.
A simple test of symmetry about an unknown median.
The Canadian Journal of Statistics, 24(3):349–361, 1996.
[2] W. Miao, Y. Gel, and J. Gastwirth.
A new test of symmetry about an unknown median.
Random Walk, Sequential Analysis and Related Topics - A
Festschrift in Honor of Yuan-Shih Chow. Eds.: Agnes Hsiung,
Cun-Hui Zhang, and Zhiliang Ying, World Scientific Publishe,
pages 1–19, 2006.
[3] A. Mira.
Distribution-free test for symmetry based on Bonferroni’s
measure.
Journal of Applied Statistics, 26(8):959–972, 1999.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de


[1] P. Cabilio and J. Masaro.
A simple test of symmetry about an unknown median.
The Canadian Journal of Statistics, 24(3):349–361, 1996.
[2] W. Miao, Y. Gel, and J. Gastwirth.
A new test of symmetry about an unknown median.
Random Walk, Sequential Analysis and Related Topics - A
Festschrift in Honor of Yuan-Shih Chow. Eds.: Agnes Hsiung,
Cun-Hui Zhang, and Zhiliang Ying, World Scientific Publishe,
pages 1–19, 2006.
[3] A. Mira.
Distribution-free test for symmetry based on Bonferroni’s
measure.
Journal of Applied Statistics, 26(8):959–972, 1999.

Jimmy Corzo (Dr.rer.nat) Métodos no Paramétricos Pruebas de hipótesis en problemas de