Está en la página 1de 932

V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

1|P gi na
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Editores:
Isolina Guaiquil, Marcelo Leppe, Paulina Rojas, y Reiner
Canales.

Visiones de Ciencia Antrtica


Libro de Resmenes
IX Congreso Latinoamericano de Ciencias Antrtica

Copias adicionales de este libro se encuentran disponibles


en la Biblioteca Virtual del Instituo Antrtico Chileno, Plaza
Muoz Gamero 1055, Punta Arenas, PO BOX 620-9100;
(+56 61 298100); internet, http://www.inach.cl.

Copyrights 2017 por el Instituto Antrtico Chileno.

Cmo citar este libro:


Guaiquil, I., Leppe, M., Rojas, P., y R. Canales, Eds. 2017.
Visiones de Ciencia Antrtica, Libro de Resmenes, IX
Congreso Latinoamericano de Ciencias Antrtica, Punta
Arenas-Chile. Publicacin del Instituo Antrtico Chileno.

ISBN: 978-956-7046-11-9

2|P gi na
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Antrtica, ms importante que nunca


En 1959, cuando se firm el Tratado Antrtico, debe haber sido difcil, sino imposible, prever
la importancia que tendra el Continente Blanco para la comprensin de fenmenos naturales
contemporneos. Aunque los Aos Polares Internacionales ponan de relieve, cada vez con
ms argumentos, el rol clave de la Antrtica en la ciencia moderna, prevaleca la imagen
congelada, esttica, de un continente detenido en el tiempo.
Sin embargo, los ojos de los investigadores de decenas de pases estn puestos en las altas
latitudes ya casi con un sentido de urgencia: no se puede entender lo que pasa hoy en el
planeta (y ms grave an, lo que pasar) sin que sepamos primero qu sucede en los polos.
Los cientficos de Latinoamrica no son espectadores de este hecho. Son protagonistas del
avance del conocimiento polar, como est claramente demostrado en este extraordinario
congreso, el ms grande que se haya organizado hasta la fecha. Por cierto, ninguno trabaja
aislado, sino que es parte de una red enorme, que trasciende continentes, mares, idiomas y
culturas. Ms de 350 hombres y mujeres (ellas con una presencia cada da mayor), se han
congregado en Punta Arenas, ciudad de reconocido patrimonio histrico polar. Representan
a 15 pases con presencia antrtica y mostrarn ms de 250 trabajos de investigacin, ya sea
en su modalidad oral (127) o de pster (124).
Fue en agosto de 1897, hace ya 120 aos, que Adrien de Gerlache de Gomery (18661934),
oficial de la Marina belga, dejaba el puerto de Amberes al mando de la primera expedicin
antrtica de carcter cientfico. En su tripulacin, una verdadera tripulacin dorada, estaba
Georges Lecointe (observador geofsico, belga), Roald Amundsen (segundo oficial,
noruego), Frederick A. Cook (mdico, estadounidense), Henryk Arctowski (gelogo,
oceangrafo y meteorlogo, polaco), Emil Racovi (zologo y botnico, rumano), entre
otros, cuyos nombres forman parte de la toponimia austral y de bases y otras plataformas
logsticas. Como vern adems, no era solo una expedicin cientfica, sino que era una
expedicin internacional.
El 1 de diciembre de 1897 esta variopinta tripulacin ve la desdeada silueta de una joven
Punta Arenas, puerto clave en las navegaciones interocenicas, sin la competencia an del
canal de Panam, y que comenzaba a unir su nombre al de gran parte de las expediciones de
esta poca heroica de la exploracin polar.
Al regreso y luego de quince meses de arduo trabajo, donde Gerlache y sus hombres
redibujaron la cartografa de amplios sectores de la pennsula Antrtica y trajeron una
valiossima informacin geolgica, glaciolgica y biolgica, Amundsen escribira en su
diario: Punta Arenas ha crecido sorprendentemente. Hay luz elctrica y telfonos en todas
partes, han pavimentado y hay tiendas grandes y elegantes La moral y las costumbres de
la gente tambin han cambiado. Antes se sola deambular desastrado diariamente. Ahora se

3|P gi na
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

debe andar vestido a la ltima moda. El sector portuario est notoriamente ms activo que
dos aos atrs. Grandes buques, tanto de cargo como de pasajeros, vienen y van todos los
das.
Tras 120 aos, la necesidad de trabajar mancomunadamente, con genuino espritu antrtico
internacional, se mantiene, pero los desafos de la ciencia son mayores. Mientras esas
exploraciones buscaban hacer las primeras descripciones geogrficas y naturales del
territorio, las actuales intentar correr el lmite del conocimiento y comprender las
proyecciones y consecuencias de los fenmenos polares para el resto del planeta. Se trata de
una exploracin que nos revela un nuevo valor simblico para ese territorio y representa, por
ello, nuevos desafos y oportunidades para la ciencia latinoamericana. Las investigadoras e
investigadores de Latinoamrica han estado a la altura del desafo y nos presentan hoy los
resultados de sus afanes. No es casualidad que, a pesar de sus mltiples compromisos, la
nueva presidente del Consejo de Administradores de Programas Antrticos Nacionales
(COMNAP), Kelly K. Falkner, y el presidente del Comit Internacional de Investigaciones
Antrticas (SCAR), Steven Chown, hayan aceptado generosamente la invitacin a asistir a
este congreso. Eso habla de la importancia y respeto que ha alcanzado la ciencia polar
latinoamericana en el concierto cientfico mundial.
Nuestros ciudadanos, los que pueblan Amrica Latina, esperan noticias nuestras. Debemos
ser capaces de usar todas nuestras capacidades para mostrar, sobre todo a las nuevas
generaciones, la importancia de la Antrtica para el clima, el planeta y nuestras sociedades.
La comunidad cientfica antrtica debe asumir as, su rol educativo y cultural, permitiendo a
los ciudadanos conocer y apreciar la belleza y vulnerabilidad de un continente al que estamos
ms unidos de lo que aparenta.
Gracias a todos, a todas por el conocimiento compartido en estos das y sean bienvenidos,
una vez ms, a una ciudad y a una regin que vibra con fuerza al llamado de su vocacin
antrtica.

Dr. Edgardo Vega Artigues


Director
Instituto Antrtico Chileno (INACH)

4|P gi na
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

PREMBULO

El Comit Nacional de Investigaciones Antrticas (CNIA), seccin nacional del Comit


Cientfico de Investigacin Antrtica (SCAR), el Instituto Antrtico Chileno (INACH), la
Universidad de Magallanes (UMAG) y el Centro de Investigacin: Dinmica de Ecosistemas
Marinos de Altas Latitudes (IDEAL), queremos agradecer el auspicio de diversas
instituciones que han hecho posible este encuentro: la Ilustre Municipalidad de Punta Arenas,
el Servicio Nacional de Turismo, AGUNSA S. A., Antartica XXI, Importadora y
Distribuidora Arquimed Ltda., Comercial Patagona Ltda. (CCU), Empresa Portuaria Austral
(EPA), Empresa Nacional del Petrleo (ENAP), Geopark Chile Ltda., Logstica Antrtica
Polar SPA y Aerovas DAP S. A. A ellas se suman los Programas Antrticos
Latinoamericanos, que han confiado a Chile y, en especial, a la ciudad de Punta Arenas la
tarea de ser sede de este evento.

Tambin agradecemos a nuestros invitados especiales:

Dr. Steven L. Chown, presidente de SCAR.


Dr. Peter Convey, British Antarctic Survey, Reino Unido.
Dr. Jefferson Cardia Simes, vice-presidente de SCAR.
Dr. Bruno Danis, Universidad Libre de Bruselas, SCAR-EG en Informtica sobre
Biodiversidad Antrtica.
Dra. Kelly Kenison Falkner, presidente de COMNAP y directora del Programa Polar de
Estados Unidos (NSF).
Dr. David W. H. Walton, editor de Antarctic Science, lder de ACE.
Dr. Marcelo Reguero, Universidad Nacional de La Plata e Instituto Antrtico Argentino.

Un especial agradecimiento al do Lluvia cida, grupo magallnico de msica electrnica,


integrado por Hctor Aguilar y Rafael Cheuquelaf, quienes han preparado una nueva obra
musical denominada Ciencia Sur, compuesta para el IX Congreso Latinoamericano de
Ciencia Antrtica.

Este encuentro, que cumple doce aos en 2017, tras iniciarse en Argentina el ao 2005, tiene
por objetivos evaluar y difundir los avances de la ciencia polar antrtica latinoamericana,
todo en el contexto de las preguntas globales que aquejan al Continente Blanco y que se
resumen en las ochenta preguntas del SCAR Horizon Scan
(https://www.scar.org/library/scar-publications/horizon-scan/).

El Horizon Scan fue un gran ejercicio que ha permitido dar un marco conceptual a los
Programas Antrticos Nacionales (PAN). Las direcciones futuras de la ciencia en Antrtica
y el ocano Austral se determinan, en gran medida, por la inversin de los PAN, la gran
fuente de financiamiento de los proyectos cientficos. El Horizon Scan provee una buena
manera de entender el alcance global de la ciencia nacional, ms all de los objetivos
nacionales.

5|P gi na
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Sin embargo, el crecimiento de la ciencia antrtica latinoamericana impone nuevos desafos.


De publicar diez artculos anuales en 1988, hoy los pases latinoamericanos publican ms de
380 artculos WOS (estadsticas del Web of Science) en 2017.

Los latinoamericanos publicamos ahora ms, pero en qu idiomas? La evolucin de los


idiomas en que comunicamos nuestros resultados muestra que en el ao 2000 el 80 % de los
artculos era publicado en ingls, un 12 % en espaol y un 5 % en portugus. 16 aos ms
tarde, el 96 % son artculos en ingls, respondiendo a la necesidad de comunicar en el idioma
universal de las ciencias y al incremento de la colaboracin internacional. Las revistas
predilectas han sido Polar Biology (7,8 %), Antarctic Science (3,5 %) y Ameghiniana (1,5
%), pero crecientemente se ha comenzado a publicar artculos antrticos en revistas de
especialidad, con factores de impacto que las colocan en el primer quintil.

A pesar del incremento del nmero y calidad de las publicaciones antrticas


latinoamericanas, seguimos teniendo una gran brecha, dada fundamentalmente por la
discontinuidad del financiamiento, reglas claras que favorezcan la participacin de
cientficos y un marco general de transparencia y concursabilidad.

Un reciente anlisis compara la productividad cientfica antrtica de 50 pases. La bsqueda


en la base de datos WOS encontr 54.935 artculos publicados en 976 revistas cientficas
desde 1988. El 69 % de las publicaciones tuvieron su gnesis en cuatro pases: Estados
Unidos, Reino Unido, Alemania y Australia. Argentina aparece en el lugar 13, Brasil en el
22, Chile en el 23, Colombia y Uruguay en los lugares 47 y 50. Sin embargo, si hacemos el
mismo anlisis de los 50 pases que ms publican en ciencia antrtica, pero para el intervalo
2012-2016, es decir, los ltimos cinco aos, Argentina se mantiene en el lugar 13, Brasil sube
al 14 y Chile al 16. Colombia y Uruguay tambin suben al 39 y 46 respectivamente. Los
cuatro pases lderes del ranking se mantienen con porcentajes cercanos al 70 % de la
produccin total para el intervalo, pero los cinco pases latinoamericanos dentro de los 50
pases representan un 11 % de la produccin mundial de 2012 a 2016, mientras que para el
intervalo 2007-2011 solo representaban un 7 %.

Estas cifras representan un estmulo potente a nuestros programas y un desafo para las
naciones del continente ms prximo a la Antrtica: el desafo de hacer ciencia de
trascendencia para nuestros pueblos, sustentable en el tiempo y que colabore a responder las
grandes preguntas que asoman en el horizonte respecto a la Antrtica. El Congreso
Latinoamericano de Ciencia Antrtica es el espacio natural para cultivar el sueo de un
continente consignado a la paz y la ciencia.

Dr. Marcelo Leppe Cartes


Presidente
Comit Nacional de Investigaciones Antrticas, CNIA-SCAR Chile

6|P gi na
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

NDICE

Acosta Hospitaleche et.al. UN AVE LIMCOLA-VADEADORA DEL EOCENO DE LA 19


ISLA MARAMBIO, ANTRTIDA
Acua et.al. RIZOBACTERIAS PRODUCTORAS DE ACC DEAMINASA ASOCIADAS 23
A PLANTAS VASCULARES ANTRTICAS (DESCHAMPSIA ANTARCTICA Y
COLOBANTHUS QUITENSIS)
Acua et.al. EFECTOS DEL CALENTAMIENTO EXPERIMENTAL IN SITU SOBRE 27
LA COMPOSICIN Y ABUNDANCIA DE PROTENAS Y PIGMENTOS ASOCIADOS
AL FOTOSISTEMA I Y II DE DESCHAMPSIA ANTARCTICA DESV. (POACEAE)
Aguayo-Lobo et.al. ALIMENTACIN DE LAS ESPECIES DE CETCEOS 31
ODONTOCETOS EN AGUAS ANTRTICAS
Alarcn et.al CONDICIONES DE pH, pCO2 Y NUTRIENTES EN UN TRANSECTO 35
COSTA-OCANO AL SUR DE LA PENNSULA ANTRTICA: VERANO 2017
Alarcn et.al. ESTADO DE SATURACIN DEL CARBONATO DE CALCIO 38
ALREDEDOR DE LA PENNSULA ANTRTICA EN INVIERNO Y VERANO
Alarcn-Schumacher et.al. UNVEILING THE COMPOSITION OF THE ACTIVE 42
VIRAL FRACTION AND ITS DYNAMICS DURING A PHYTOPLANKTON BLOOM
IN A LATE ANTARCTIC SUMMER
Alcamn et.al. POTENCIALES INDICADORES BACTERIANOS ANTE EL 44
DERRETIMIENTO DE HIELO GLACIAR EN BAHA CHILE, ANTRTICA
Alfonsi et.al. RADIO SCIENCES RESEARCH ON ANTARCTIC ATMOSPHERE - 47
RESOURCE
Amenabar et.al. LAS COLECCIONES PALEONTOLGICAS Y GEOLGICAS 49
Arigony-Neto et.al. FLOW VELOCITIES AND SNOW ACCUMULATION DYNAMICS 53
AT UNION GLACIER, ELLSWORTH MOUNTAINS, ANTARCTICA
Aros et.al. CARACTERIZACIN TAXONMICA DE ECTOPARSITOS DE 57
Notothenia coriiceps (RICHARDSON, 1844) EN LA PENNSULA ANTRTICA
CHILENA
Arstica et.al. ANLISIS DE LA ACTIVIDAD ANTIMICROBIANA Y ESTRUCTURAL 61
DEL HOMOPPTIDO DE ARGININA POR UN SCAN-PRO SISTEMTICO.
Atalah et.al. CARACTERIZACIN DE DOS OXIDASAS DEPENDIENTES DE COBRE 64
PRESENTES EN EL TERMFILO ANTRTICO GEOBACILLUS SP. ID17
viles et.al. DESARROLLO DE UN BIOPOLMERO HEMISINTTICO FUNGICIDA 66
DE QUITOSANO FUNCIONALIZADO CON COMPUESTOS FENLICOS DE
Colobanthus quitensis
Barnes et.al. CLIMATE IMPACT ON BLUE CARBON POTENTIAL OF SUB-POLAR 70
CONTINENTAL SHELF SEABEDS
Barrientos et.al. POTENCIAL BIOTECNOLGICO DE ACTINOBACTERIAS 74
ANTRTICAS
Basset et.al. PATAGONIAN TRUE BUGS: IDIOSTOLIDAE (HEMIPTERA: 77
HETEROPTERA) ASSOCIATED TO Nothofagus
Bastas et.al. MIDDLE JURASSIC TO MIOCENE U-PB ZIRCON AND 40AR/39AR 79
HORNBLENDE GEOCHRONOLOGY OF THE ANTARCTIC PENINSULA
BATHOLITH: IMPLICATIONS FOR THE MAGMATIC AND TECTONIC
EVOLUTION OF ANTARCTIC PENINSULA
Bezus et.al. LEVADURAS ANTRTICAS. PRODUCCIN Y CARACTERIZACIN DE 82
Bezus et.al. EVALUACIN DEL POTENCIAL BIOTECNOLGICO DE LEVADURAS 86
AISLADAS DE LA PENNSULA FILDES
Bigurrarena Ojeda et.al. ESTUDIO PRELIMINAR DE COPROLITOS DE LA 90
FORMACIN AMEGHINO (JURSICO TARDO) DE LA PENNSULA ANTRTICA

7|P gi na
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Borrs-Chvez et.al. MADRES AL LMITE. EXPLORANDO LOS CAMBIOS 94


CONDUCTUALES DE FORRAJEO ASOCIADOS AL COSTO DE LA LACTANCIA
EN AMBIENTES EXTREMOS. EL LOBO FINO ANTRTICO (Arctocephalus gazella).
Bozkurt et.al. THE HIGHEST TEMPERATURE IN CONTINENTAL ANTARCTICA: 98
FOEHN EFFECT TRIGGERED BY AN ATMOSPHERIC RIVER)
Bravo et.al. EL ENSAMBLE DE ESPONJAS EN ISLA DOUMER (PENNSULA 99
ANTRTICA): RIQUEZA ESPECFICA, ABUNDANCIA Y DISTRIBUCIN
BATIMTRICA
Bravo et.al. TRADE-OFF BETWEEN GROWTH-REPRODUCTION VERSUS 102
FREEZING TOLERANCE IN RESPONSE TO WARMING ON ANTARCTIC
VASCULAR PLANTS
Bustos et.al. VARIABILIDAD Y TENDENCIAS CLIMTICAS EN EL NOROESTE DE 106
LA PENNSULA ANTRTICA: RECIENTE ENFRIAMIENTO
Cabaln et.al. INFECTIOUS DISEASES IN ANTARCTIC INHABITANTS: A 110
SYSTEMATIC REVIEW
Crdenas et.al. DISTRIBUCIN Y ABUNDANCIA DE INDICADORES 111
BIOGEOQUMICOS EN SEDIMENTOS SUPERFICIALES DEL PASO DE DRAKE,
DESDE EL ESTRECHO DE MAGALLANES AL ESTRECHO DE BRANSFIELD
Crdenas et.al. EXPLORANDO LOS EFECTOS DEL AUMENTO DE TEMPERATURA 115
EN ESPONJAS ANTARTICAS Y SU MICROBIOMA
Crdenas et.al. CDIGOS DE BARRAS GENTICO PARA IDENTIFICAR LA 119
DIVERSIDAD DE LA FAUNA DE PARSITOS DIGENEOS EN EL GASTRPODO
MARGARELLA ANTRTICA
Carrasco et.al. THE YEAR OF POLAR PREDICTION - SOUTHERN HEMISPHERE 122
(YOPP-SH): A WIN-WIN OPPORTUNITY TO PARTICIPATE IN AN
INTERNATIONAL EFFORT
Carrasco ANALYSING THE NEAR-SURFACE AIR TEMPERATURE AT FREI 126
STATION
Carrasco WARM EVENTS OBSERVED AT PATRIOT HILLS AND UNION GLACIER 130
IN THE INTERIOR OF WEST ANTARCTICA
Carrasco et.al. ANLISIS DE COMUNIDADES BACTERIANAS ENDOLTICAS 135
ANTRTICAS
Carrera et.al. CONDICIONES DE ESTABILIDAD DE LA COLUMNA DE AGUA 138
ASOCIADAS A ALTA PRODUCCIN PRIMARIA EN BAHA FILDES (6212S,
5857W), PENNSULA ANTRTICA, VERANO 2017
Carvalho et.al. COMUNIDADES FNGICAS ASOCIADAS CON DOS ESPECIES DE 142
MUSGOS BIPOLARES EN LA ANTRTIDA
Carvalho-Silva MOSS BIPOLARITY REVISITED 145
Casanova-Katny et.al. HEAT SHOCK RESPONSES OF THE MOSS Sanionia uncinata 148
UNDER EXPERIMENTAL WARMING
Casassa et.al. EFECTO DE LA RUPTURA DEL TMPANO A-68 DESPRENDIDO DE 151
LARSEN C EN JULIO 2017 EN LA ESTABILIDAD DE LA PLATAFORMA
Case and Ely THE BIOSTRATIGRAPHY OF THE LATEST CRETACEOUS 155
DINOSAUR FAUNA OF ANTARCTICA
Castillo et.al. ANLISIS MORFOMTRICO DE VALVAS DE LA LAPA Nacella 156
concinna DEPREDADAS POR LA GAVIOTA COCINERA Larus dominicanus EN
ANTRTIDA EXISTE DEPREDACIN SELECTIVA SOBRE LOS DIFERENTES
MORFOTIPOS?
Castillo et.al. THE ELLSWORTH MOUNTAINS CONNECTION WITH EAST 158
ANTARCTICA AND LAURENTIA

8|P gi na
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Castillo et.al. PROVENANCE AND AGE CONSTRAINTS OF PALAEOZOIC 161


SILICICLASTIC ROCKS FROM THE ELLSWORTH MOUNTAINS IN WEST
ANTARCTICA, AS DETERMINED BY DETRITAL ZIRCON GEOCHRONOLOGY
Cech et.al. ALMEJAS LA CARTE: ESTUDIO DE TRAZAS DE DEPREDACIN EN 165
VENRIDOS DEL EOCENO DE ANTRTIDA
Cereceda-Balic et.al. PRESENCIA DE ACIDO METANO SULFNICO EN NIEVE DEL 169
EXTREMO NORTE DE LA PENNSULA ANTRTICA: IMPLICANCIAS SOBRE EL
CAMBIO CLIMTICO
Cereceda-Balic et.al. CARACTERIZACIN DE AEROSOLES ATMOSFRICOS EN 173
TRAVESA MARTIMA PUNTA ARENAS - ANTRTICA
Cereceda-Balic et.al. CARACTERIZACIN DE AEROSOLES ATMOSFRICOS EN 177
LA PENNSULA ANTRTICA CHILENA
Chves et.al. DIFUSIVIDAD TRMICA APARENTE DEL SUELO EN LA PENNSULA 181
KELLER, ISLA REI GEORGE, ANTRTICA MARTIMA
Chves et.al. ACTIVE LAYER AND PERMAFROST THERMAL REGIME IN A 185
PATTERNET GROUND SOIL IN MARITIME ANTARCTIC RELATIONSHIP WITH
CLIMATE VARIABILITY MODELS
Chiang et.al.. MERCURY BIOMAGNIFICATION IN COASTAL AQUATIC FOOD 189
WEBS FROM PATAGONIA AND ANTARCTIC PENINSULA
Cid et.al. BACTERIAS PIGMENTADAS AISLADAS DE LA PENNSULA FILDES, 192
NTRTICA, SOBREVIVEN A RADIACIN UV-B.
Cid et.al. BSQUEDA DE PROTEINAS ANTICONGELANTES PUTATIVAS EN EL 196
GENOMA DE BACTERIAS AISLADAS DESDE LA FILSFERA DE Deschampsia
antarctica
Cid-Ramrez et.al. DETECCIN DE GENES DE RESISTENCIA E INTEGRONES EN 200
BACTERIAS MARINAS PROVENIENTES DE ISLA REY JORGE, ANTRTICA
Cipro et.al. BIRD COLONIES AS RELEVANT SOURCES OF POLLUTANTS IN 204
ANTARCTIC ECOSYSTEMS: PART 1 - TRACE ELEMENTS
Concheyro et.al. ESTADO ACTUAL DE LA MICROPALEONTOLOGA Y 208
PALINOLOGA DEL MESOZOICO Y CENOZOICO DE LA CUENCA JAMES ROSS,
ANTRTIDA
Contador et.al. LARGA VIDA EN EL SUR: FENOLOGA, DISTRIBUCIN Y 212
ECOFISIOLOGA DE LA MOSCA ANTRTICA ALADA, Parochlus steinenii, EN EL
SUR DE SUDAMRICA Y EN LAS ISLAS SHETLAND DEL SUR
Contreras et.al. POTENCIAL BIOTECNOLGICO DE EXTRACTOS DE 216
COLOBANTHUS QUITENSIS COMO BIOCONTROLADOR DE HONGOS
FITOPATGENOS NECROTRFICOS
Contreras et.al. EFECTOS DEL CAMBIO CLIMTICO REGIONAL SIMULADO EN 220
PLANTAS ANTRTICAS NATIVAS (Colobanthus quitensis Y Deschampsia antarctica) Y
NO NATIVAS (Poa annua Y Juncus bufonius)
Corbisier et.al. MONITORAMENTO DE LONGO PRAZO DOS IMPACTOS 225
ANTRPICOS DA ESTAO ANTRTICA BRASILEIRA COMANDANTE
FERRAZ (ILHA REI GEORGE): ANLISE DE ISTOPOS ESTVEIS DE C E N
Cordero et.al. REFLECTIVITY AT UNION GLACIER CAMP (ANTARCTICA) 229
Coria et.al. CARACTERIZACIN MICROBIOLGICA, GEOMORFOLGICA Y 230
FSICO-QUMICA DE SIETE LAGUNAS DEL ARCHIPILAGO JAMES ROSS
Correia et.al. FIRST IONOSPHERIC DISTURBANCES OBSERVED AT EACF BY 234
MEANS OF DEMOGRAPE ACTIVITIES
Correia et.al. PERMAFROST RESEARCH IN SITES CALM AND PAPAGAL NEAR 238
BULGARIAN ANTARCTIC BASE, HURD PENINSULA, LIVINGSTON ISLAND,
ANTARCTICA

9|P gi na
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Costa et.al. FUNGAL COMMUNITIES ASSOCIATED WITH RHIZOME AND 242


RHIZOSPHERE OF ANTARCTIC ANGIOSPERMS COLOBANTHUS QUITENSIS
AND DESCHAMPSIA ANTARCTICA
Costa y Vieira GEOMORFOLOGA Y SEDIMENTOLOGA DEL GLACIAR UNION, 246
MONTAAS ELLSWORTH, ANTRTICA OCCIDENTAL
Cuba-Daz et.al. EFECTO DEL CAMBIO CLIMTICO SOBRE LA FLORA NATIVA Y 250
NO- NATIVA DE LA ANTRTICA MARTIMA DESDE UNA PERSPECTIVA
MORFOFISIOLGICA
Cuba-Daz GERMOPLASMA ACTIVO DE PLANTAS VASCULARES ANTRTICAS: 254
iniciativa al servicio de la biologa vegetal antrtica.
Daher et.al. ANLISIS ESTADSTICO DE LOS SUELOS DE LAS ISLAS SHETLAND 258
DEL SUR, ANTRTICA
Daher et.al. GNESIS Y CLASIFICACIN DE SUELOS DE LA ISLA ROBERT, 262
ANTRTICA MARTIMA
Damiani et.al. CONTRIBUTION OF ENERGETIC PARTICLE PRECIPITATION TO 267
THE NATURAL VARIABILITY OF ANTARCTIC OZONE
Danis THE SCAR BIODIVERSITY INFORMATION ECOSYSTEM: MAKING YOUR 271
DATA COUNT
De Menezes et.al. ISOLATION AND IDENTIFICATION OF FUNGI PRESENT IN THE 273
GLACIAL ICE OF ANTARCTICA
Delgado et.al. AVANCES EN LA CARACTERIZACIN GEOQUMICA DE DOS 277
MUESTRAS DE SUELO DE LA ANTRTIDA COMO PARTE DE LA TERCERA
EXPEDICIN CIENTFICA DE COLOMBIA EN LA ANTRTIDA USANDO LAS
TCNICAS DE ANLISIS MEB, DRX Y GAMMA ESPECTROMETRA
Di Fonzo et.al. BIOQUMICA SANGUNEA DE TRES POBLACIONES ANTRTICAS 282
DE Pygoselis papua
do-Amaral et.al. FATTY ACID COMPOSITION OF SEAWEED DESMARESTIA 286
ANCEPS FROM 5 ANTARCTIC REGION
do-Amaral et.al. CHARACTERIZATION AND EVALUATION OF THE 290
ANTITUMORAL POTENTIAL OF EXTRACTS DERIVED FROM BROWN
SEAWEED OF THE SUB-ANTARCTIC REGION OF CHILE
Dopchiz et.al. DENSIDAD E NDICE DE ESTOMAS EN Deschampsia antarctica 294
EXPUESTA A IMPACTO ANTRPICO
Dotta et.al. CREATING VIDEOCLASSES ABOUT ANTARCTICA: AN 297
INTERDISCIPLINARY AND COLLABORATIVE PRODUCTION
Dotta y Elas-Piera TRAINING TEACHERS TO INTRODUCE THE POLAR 300
SCIENCES INTO THE SCHOOL CURRICULUM THROUGH A DISTANCE
LEARNING COURSE
Durn et.al. ISOLATION OF FUNGAL MICROORGANISMS FROM ANTARCTIC 303
PRISTINE ENVIRONMENT AND THEIR PUTATIVE USE IN Gaeumannomyces
graminis BIOCONTROL
Durand et.al. DESCRIPCIN DE LAS COMUNIDADES DE 307
MACROINVERTEBRADOS ASOCIADOS A DOS MACROALGAS ANTRTICAS Y
SU RELACIN CON LA COMPLEJIDAD DEL HBITAT
Espina et.al. ESTUDIOS PRELIMINARES CULTIVO-DEPENDIENTE DE LA 311
DIVERSIDAD MICROBIOLGICA Y VIRAL DEL GLACIAR UNIN, ANTRTICA.
Estrada et.al. ESTUDIOS INICIALES SOBRE LA IDENTIDAD REGIONAL 313
ANTRTICA DE HABITANTES DEL EXTREMO AUSTRAL
Farah et.al. ACTIVIDAD CELULOLTICA DE BACTERIAS ANTRTICAS 317
Fandez y CarvajalNEW DATA ON THE SUBGENUS RHINODERMACORIS 321
(INSECTA: HETEROPTERA: GELASTOCORIDAE), WITH COMMENTS ON ITS
GONDWANIAN ORIGIN AND RELATIONSHIPS

10 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Fernndez DEGLACIATION, SEISMIC STRATIGRAPHY AND RECORDS OF 325


ENVIRONMENTAL CHANGES FROM FJORDS AND BAYS OF PATAGONIA AND
THE ANTARCTIC PENINSULA
Fernandoy et.al. NUEVAS PERCEPCIONES REGIONALES DE LA SEAL DE 329
ISTOPOS ESTABLES DE AGUA EN EL EXTREMO NORTE DE LA PENNSULA
ANTRTICA Y SU POTENCIAL USO PARA ESTUDIOS CLIMTICOS
Fernandoy et.al. 40 Aos de registro de la divisoria de los glaciares Schanz-Schneider, 333
Montaas Ellsworth, Antrtica
Fern et.al. COMPARISON OF CMIP5 EARTH SYSTEM MODELS (ESMS) WITH 337
OBSERVATIONS OVER ANTARCTICA
Ferrada EL ANEXO VI AL PROTOCOLO AL TRATADO ANTRTICO SOBRE 338
PROTECCIN AMBIENTAL, SOBRE RESPONSABILIDAD POR LAS
EMERGENCIA AMBIENTALES. UNA VISIN CRTICA
Baha Ferreira et.al. EVALUACIN PRIMARIA DE LA COMPOSICIN 341
MICROBIANA DE LA BAHA DEL ALMIRANTADO Y REGIONES ADYACENTES -
CONTINENTE ANTRTICO
Figueirero et.al. ESTUDIO PRELIMINAR DE LOS CRIOSOLOS DE LOS MONTES 345
PATRIOT, ANTRTIDA OCCIDENTAL
Figuerero et.al. TAXONOMY, DIVERSITY AND PHYSIOLOGICAL 349
CHARACTERIZATION OF FUNGI PRESENT IN THERMAL SOILS OF
ANTARCTICA
Flores et.al. ANLISIS COMPARATIVO DE LA FAUNA PARASITARIA DE DOS 352
ESPECIES DE PATELLOGASTROPODA DEL GNERO Nacella
Fonseca-Gonzlez et.al. ESTRS TERMICO Y ACTIVIDAD ENZIMATICA EN 356
POLIQUETOS BENTONICOS SUBMAREALES DE LA PENNSULA ANTARTICA
Font y Gonzlez EXPRESIN DE ENZIMAS ANTIOXIDANTES EN Sterechinus 360
neumayeri: CARACTERIZACIN DE LA RESPUESTA FRENTE A ESTRS
TRMICO AGUDO.
Fuentealba-Urrutia et.al. RESISTENCIA A ANTIBITICOS EN BACTERIAS GRAM 362
NEGATIVAS AISLADAS DE HECES DE PINGINO PAPA (Pygoscelis papua) EN LA
ANTRTICA
Fuentes et.al. EFECTO DEL CALENTAMIENTO SOBRE LA RESPIRACIN FOLIAR 366
DE Deschampsia antarctica
Funes et.al. CARACTERIZACIN FSICO-QUMICA DE NIEVE DEL EXTREMO 370
NORTE DE LA PENNSULA ANTRTICA
Gallardo-Cerda et.al. ROL DE LOS MICROORGANISMOS EN LA TOLERANCIA AL 374
ESTRS EN PLANTAS ANTRTICAS: UNA SOCIEDAD EXTREMA
Garca et.al. ESTIMACIN DE LA ACTIVIDAD ANTI-OXIDANTE IN VITRO DE 377
LOS LQUENES POLARES DE LA ISLA REY JORGE ANTRTIDA
Garca et.al. EFECTO CITOPROTECTOR DE LOS EXTRACTOS DE LQUENES 381
ANTRTICOS EN CELULAS RENALES ENFRENTADAS A GENTAMICINA
Gelfo y Reguero PERSPECTIVAS SOBRE EL REGISTRO FSIL DE LOS 385
MAMFEROS TERRESTRES EN EL CONTINENTE ANTRTICO
Gerard et.al. GENETIC DIVERSITY OF Halicarcinus planatus POPULATIONS 389
(BRACHYURA, HYMENOSOMATIDAE) IN THE MAGELLANIC REGION
Gimnez et.al. DETECCIN Y ESTUDIO DE PLSMIDOS EN MUESTRAS DE 393
SEDIMENTO DE DIFERENTES SITIOS DEL CONTINENTE ANTRTICO
Giraldo-Barrios et.al. CARACTERIZACIN MORFOLGICA Y DISTRIBUCIN 397
ECOLOGICA DE TARDGRADOS DE LA ISLA DE LA MEDIA LUNA, ANTRTIDA
Giraldo et.al. ENSAMBLAJE DE COPEPODOS EPIPELGICOS EN EL ESTRECHO 401
DE GERLACHE (ANTRTICA) DURANTE EL VERANO AUSTRAL 2015

11 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Goin et.al. EL REGISTRO MS ANTIGUO DE LMINAS INTERPRISMTICAS EN 404


EL ESMALTE DE LOS METATHERIA (EOCENO TEMPRANO, PENNSULA
ANTRTICA)
Gonalvez et.al. DIVERSITY, DISTRIBUTION, PHYLOGENY AND ECOLOGY OF 408
FUNGAL COMMUNITIES PRESENT IN SEAWATER GRADIENTS ACROSS OF
THE NORTHERN ANTARCTICA
Gonzlez et.al. SCIENTIFIC RESEARCH IN ANTARCTIC AND SUB-ANTARCTIC 412
REGIONS: THE FONDAP-IDEAL CHALLENGES IN A HIGHLY VARIABLE
SCENARIO
Gonzlez-Wevar et.al. PATRONES BIOGEOGRFICOS EN MOLUSCOS DEL 414
OCANO AUSTRAL CON MODOS DE DESARROLLO CONTRASTANTES
Gouiric-Cavalli y Reguero PRIMER REGISTRO DE UN PEZ DE ALIMENTACIN 418
SUSPENSVORA EN EL JURSICO TARDO DE LA PENNSULA ANTRTICA
Guajardo et.al. OMUNIDADES EUCARIONTES MICROBIANAS FOTOSINTTICAS 422
DE BAHA FILDES, ANTRTICA: UNA CARACTERIZACIN TAXONMICA Y
FUNCIONAL.
Gualoto et.al. EVALUACIN DE LA TOLERANCIA AL PETRLEO DE 426
MICROORGANISMOS ANTRTICOS AISLADOS DE SUELOS ANTRTICOS (62S)
Guillemn et.al. ALGAS ROJAS: SECUENCIAS DE MARCADORES 430
CITOPLASMTICOS PERMITEN REVISITAR PATRONES BIOGEOGRFICOS Y
FILOGENTICOS EN LA REGIN DE LA PENNSULA ANTRTICA Y DE LAS
ISLAS SHETLAND DEL SUR
Haydr et.al. UN NUEVO CRNEO DE PINGINO ANTRTICO Y SUS 433
IMPLICANCIAS ACERCA DE LA DIVERSIDAD DE TAMAOS DURANTE EL
EOCENO DE LA ISLA MARAMBIO
Spencer BIOGEOGRAPHY OF THE SOUTHERN OCEAN ILLUMINATED BY THE 437
BULL-KELP GENUS DURVILLAEA
Hebel y Jaa ALGO IMPERCEPTIBLE PERO SENSATO: SUBPOBLACIN 441
GENTICA DE Sanionia Uncinata DENTRO DE LAS ZONAS ESPECIALMENTE
PROTEGIDAS ANTRTICAS (ASPA) Y OTRAS REAS DE ACCESO LIBRES DE
HIELO EN LA ANTRTICA Y PATAGONIA AUSTRAL
Hereme et.al. RESPUESTAS ASIMTRICAS AL CALENTAMIENTO GLOBAL 445
SIMULADO EN POBLACIONES DE COLOBANTHUS QUITENSIS A LO LARGO DE
UN GRADIENTE LATITUDINAL
Hernndez-Almaraz EXPRESIN DE GENES INMUNES Y APOPTTICOS EN 449
CELOMOCITOS DEL ERIZO ANTRTICO Sterechinus neumayeri, EXPUESTOS A
NANO-PLSTICOS
Herrera et.al. EFECTO DE LA DISPONIBILIDAD HDRICA Y LA VARIACIN DE 453
TEMPERATURA SOBRE POBLACIONES DE LA PATAGONIA SUR Y LA
ANTRTICA DE Colobanthus quitensis BAJO LA SIMULACIN DE UN CAMBIO
CLIMTICO
Herrera et.al. ANTIBITICOS EN EFLUENTES ANTRTICOS: UN POTENCIAL 457
DAO AL ECOSISTEMA
Hidalgo y Patricio PATRONES SINPTICOS QUE DIFICULTAN LAS 461
OPERACIONES AREAS EN LA ISLA REY JORGE
Hfer et.al. PAPEL DE LAS BAHAS COMO HOT-SPOTS BIOLGICOS EN LA 465
ZONA OESTE DE LA PENNSULA ANTRTICA
Huerta et.al. RIESGO DE EXTINCIN DE COLONIAS ANTRTICAS DE 469
PINGINOS ADELIA EN LA PENNSULA ANTRTICA OCCIDENTAL Y EL MAR
DE ROSS
Iannuzzi et.al. LOS ASENTAMIENTOS DE ANIMALES MARINOS AUMENTAN LA 473
EMISIN DE XIDO NITROSO EN SUELOS ANTRTICOS

12 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Idalino et.al. USO DE IMAGENS SENTINEL 2 PARA ANLISES DE RETRAO DE 477


GELEIRAS: COMPARATIVO ENTRE AMBIENTES NAS LATITUDES 44 E 62
Iriarte et.al. SPATIAL DISTRIBUTION OF DIATOM ASSEMBLAGES AND 481
PHOTOSYNTHETIC PROPERTIES DURING ANTARCTIC WINTER (NOAA-AMLR
2016)
Iturriaga et.al. DEFICIENCIA DE VITAMINA D EN POBLACIN ANTRTICA 485
CHILENA
Jures et.al. Dieta del pingino Adelia DURANTE un perodo de 13 aos 487
Kelly LA PARTICIPACIN DE SUDAMRICA EN EL RGIMEN ANTRTICO A 491
PARTIR DEL ESTUDIO DE LAS REUNIONES CONSULTIVAS DEL TRATADO
ANTRTICO (2007-2016)
Lamilla et.al. BIOSURFACTANTE DE Streptomyces luridus INHIBE LA FORMACIN 495
DE BIOFILM EN BACTERIAS PATGENAS
Leppe et.al. SIGNIFICADO DEL REGISTRO CRETCICO DE FLORA ANTRTICA 500
Y PATAGNICA: EL CASO DE Nothofagus
Levicoy et.al. DIVERSIDAD GENTICA DE BIVALVOS DEL GNERO Kidderia DE 504
REGIONES ANTRTICAS Y SUBANTRTICAS
Lirio et.al. 60 AOS DE RETROCESO GLACIARIO EN PENNSULA POTTER, 508
Llanillo et.al. CAMBIOS INTERDECADALES EN EL CONTENIDO DE CALOR Y 512
AGUA DULCE EN BAHIA MAXWELL, ISLA REY JORGE
Londoe et.al. ESTIMACIN DE LA ACTIVIDAD ANTI-INFLAMATORIA DE 513
EXTRACTOS DE LQUENES ANTRTICOS MEDIANTE LA PRUEBA DE LA
ESTABILIDAD DE LA MEMBRANA CELULAR EN GLBULOS ROJOS
Londoe et.al. ACTIVIDAD ANTIBACTERIANA DE EXTRACTOS ACETONA- 517
METANOLICOS DE LQUENES ANTRTICOS
Lpez-Cabrera y Olivero A NEW FOSSIL GONIASTERIDAE (ECHINODERMATA, 522
ASTEROIDEA) FROM THE EOCENE BILL HILL LOCALITY, LA MESETA
FORMATION, SEYMOUR/MARAMBIO ISLAND, ANTARCTICA
Lpez et.al. WALDO (BIVALVIA: GALEOMMATOIDEA) EN AGUAS ANTARTICAS 526
Y SUB-ANTARTICAS, DISTRIBUCIN Y RELACIONES EVOLUTIVAS CON SUS
HOSPEDADORES
Lorenzo LA POLTICA ANTRTICA DE NUEVA ZELANDA EN EL AREA MARINA 530
PROTEGIDA DEL MAR DE ROSS
Manrquez et.al. EVALUANDO FLUCTUACIONES DEL NIVEL DEL MAR COMO 534
POSIBLES FUENTES DE CONEXIN SUDAMERICA-ANTARTICA DURANTE EL
CRETCICO TARDO.
Mansilla et.al. NUEVO REGISTRO DE NOTHOFAGIDITES POTONI 1960 DEL 538
CRETCICO SUPERIOR DE ISLA NELSON, SHETLAND DEL SUR, ANTARTICA
Marambio et.al. COMPARACIN ECOFISIOLGICA DE LA ESPECIE Macrocystis 542
pyrifera (OCHROPHYTA), SIGUIENDO UN GRADIENTE DE SALINIDAD NATURAL
EN TRES POBLACIONES NATURALES PRESENTES EN LA REGIN DE
MAGALLANES, CHILE
Marinsek et.al. MONITOREO REMOTO DE VARIABLES MEDIOAMBIENTALES 546
EN EL NORESTE DE LA PENNSULA ANTRTICA
Martnez lvarez et.al. CAMBIOS EN LA DIVERSIDAD BACTERIANA ASOCIADA A 550
PROCESOS DE BIOREMEDIACIN POR BIOPILAS DE SUELOS ANTRTICOS
CONTAMINADOS CON HIDROCARBUROS EN LA BASE CARLINI (ARG.)
Martnez et.al. MODULACIN DE LOS GENES INMUNES RELACIONADOS CON 554
EL HIERRO EN Notothenia coriiceps DESAFIADO CON LPS
Martorell et.al. BIODIVERSIDAD Y BIOPROSPECCIN ENZIMTICA DE HONGOS 558
FILAMENTOSOS ANTRTICOS

13 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Mrquez et.al. ESTIMACIN DE LA INGESTA ENERGTICA DE LOS MACHOS 562


ADULTOS DEL LOBO FINO ANTRTICO ARCTOCEPHALUS GAZELLA SEGN EL
VALOR CALRICO Y APORTE PROPORCIONAL DE SUS PRINCIPALES PRESAS
Maturana et.al. PRIMERA APROXIMACIN BIOGEOGRFICA EN SISTEMAS DE 566
AGUA DULCE EN LA ANTRTICA Y PATAGONIA: LA HISTORIA DE Boeckella
poppei (CALANOIDE: CENTROPAGIDAE)
Matus et.al. GEOCHEMISTRY AND VERY LOW-GRADE SECONDARY MINERALS 570
OF THE EOCENE VOLCANIC ROCKS IN FILDES PENINSULA, KING GEORGE
ISLAND, SOUTH SHETLAND ISLANDS
Mndez et.al. ACTIVIDAD FOTOSINTTICA Y COMPOSICIN DE PIGMENTOS 574
EN DOS MORFOTIPOS DEL GNERO DURVILLAEA (FAMILIA:
DURVILLAEACEAE) EN LA ECORREGIN SUBANTRTICA DE MAGALLANES,
CHILE
Michel et.al. SEVEN-YEAR ACTIVE LAYER THERMAL MONITORING AT 578
FUMAROLA BAY, DECEPTION ISLAND, MARITIME ANTARCTICA
Moncada-Kopp et.al. ROL DE HMG EN LA RESPUESTA INMUNE DE Notothenia 582
coriiceps Y Notothenia rossi EXPUESTOS A LPS
Moreano ANTRTIDA Y SU NUEVA VISIN CIENTFICA: DESAFO 586
LATINOAMERICANO EN BENEFICIO DE LA OCEANOPOLTICA Y LA
DIPLOMACIA
Moreau et.al. REPRODUCTIVE STRATEGY IS PART OF THE BIOGEOGRAPHIC 590
PUZZLE: A CASE STUDY WITH ANTARCTIC SEA STARS (ECHINODERMATA,
ASTEROIDEA)
Moreno-Pino et.al. ESTUDIO DEL POTENCIAL METABLICO DEL MICROBIOMA 591
DE ESPONJAS ANTRTICAS ANALIZADO MEDIANTE METAGENMICA
Moreno et.al. ANLISIS FUNCIONAL DE LA DISTRIBUCIN ESPACIO- 595
TEMPORAL DEL MACROBENTOS ASOCIADO A ASPECTOS BATILITOLGICOS
Y VARIABLES AMBIENTALES DE LA ENSENADA MACKELLAR, ISLA REY
JORGE, ANTRTICA
Muoz et.al. CUANTIFICACIN DE PARSITOS EN PECES DE LA BAHA FILDES, 599
ISLA REY JORGE (ANTRTICA)
Naretto et.al. BIOGEOGRAFA DEL GNERO HARPAGIFER EN EL OCANO 602
AUSTRAL
Navarro et.al. RESPUESTA DEL PEZ NOTOTNIDO Harpagifer antarcticus A 607
ESCENARIOS FUTUROS DE CAMBIO CLIMTICO: MORTALIDAD,
METABOLISMO, CRECIMIENTO
Ocaranza et.al. NIVELES DE DIVERGENCIA EN GRUPOS DE MACROALGAS CO- 611
DISTRIBUIDAS A LO LARGO DE LA REGIN DE MAGALLANES Y DE
PENNSULA ANTRTICA
Ogaki et.al. FUNGI PRESENT IN MARINE SEDIMENTS OF ANTARCTICA 615
O'Gorman et.al. FIRST CRANIAL REMAINS OF A NON-ARISTONECTINE 619
ELASMOSAURID PLESIOSAUR FROM ANTARCTICA
Olivero y Lpez Cabrera TRACE FOSSIL PALEOGEOGRAPHY. LATE 623
CRETACEOUS PROGRESSIVE REPLACEMENT OF COSMOPOLITAN
ANTARCTIC ICHNOFOSSILS (CRUZIANA ICHNOFACIES):
PALEOENVIRONMENTAL IMPLICATIONS
Olivero et.al. DISCOVERY OF FOSSILIFEROUS BRECCIAS AT THE K-Pg 627
BOUNDARY AND UPPER LPEZ DE BERTODANO FORMATION, ANTARCTICA:
PALEOENVIRONMENTAL INTERPRETATION
Oa et.al. ESTUDIO PRELIMINAR DE LA DIVERSIDAD DE MICROORGANISMOS 631
ACUTICOS DE LOS LAGOS DE ISLA DEE

14 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Orellana et.al. INHIBICIN DEL CRECIMIENTO DE BACTERIAS PATGENAS 635


HUMANAS POR BACTERIAS ANTRTICAS AISLADAS DE LA RIZSFERA DE
Deschampsia antarctica
Orgueira et.al. SEGREGACIN DE NICHO ENTRE BALLENAS FIN (Balaenoptera 639
physalus) Y JOROBADAS (Megaptera novaengliae) EN EL REA DE LAS ISLAS
ORCADAS DEL SUR, ANTRTIDA.
Orgueira et.al. DIVERSIDAD Y DISTRIBUCIN DE PREDADORES TOPE EN EL 642
MAR DEL SCOTIA, ANTRTIDA: DEBEN AMPLIARSE LOS LMITES DE LA
ACTUAL REA MARINA PROTEGIDA?
Osorio-Aliaga et.al. EXPRESIN DE GENES INMUNES Y ANTIOXIDANTES EN 645
ERIZO ANTRTICO Sterechinus neumayeri, EXPUESTOS A Vibrio anguillarum.
Oyarzn et.al. metabolismo intermediario heptico en Harpagifer antarcticus 649
eXPUESTOS A DIFERENTES SALINIDADES Y TEMPERATURAS.
Palpolo et.al. UNA PEQUEA VENTANA AL EOCENO: PRESERVACIN 653
EXCEPCIONAL DE ESTRELLAS DE MAR EN LA FORMACIN LA MESETA, ISLA
MARAMBIO
Paschke et.al. RESPUESTAS FISIOLGICAS DE JUVENILES TEMPRANOS DEL 657
ISPODO Glyptonotus antarcticus A TEMPERATURA Y OXGENO DISUELTO
Pasqualetti et.al. COMPARATIVE METABOLIC PROFILING OF DIFFERENT 661
REPRODUCTIVE PHASES OF THE LIFE CYCLE OF GIGARTINA SKOTTSBERGII
SETCHELL & N.L.GARDNER (GIGARTINALES, RHODOPHYTA) FROM
ANTARCTIC AND SUB-ANTARCTIC REGIONS
Pasqualetti et.al. GIGARTINA SKOTTSBERGII y IRIDAEA CORDATA 665
(GIGARTINALES, RHODOPHYTA): UNA COMPARACIN DEL METABOLITOS
PRIMARIOS DE DOS CARRAGENOFITAS DE LAS REGIONES ANTRTICA Y
SUB-ANTRTICA
Paz et.al. COMPUESTOS BIOACTIVOS DE HONGOS ANTRTICOS CONTRA 669
Gaeumannnomyces graminis VAR. TRITICI
Perchivale et.al. ESTUDIO PRELIMINAR DE LA DIETA DE LOS PINGINOS 673
ADELIA EN ISLA MARAMBIO
Prez y Aravena ACTIVIDAD DIAZOTRFICA DE VIDA LIBRE Y SIMBITICA EN 676
LA GLACIAR UNIN, MONTAAS ELLSWORTH, ANTRTICA
Perfetti-Bolao y Barra CONTAMINANTES EMERGENTES EN LA ANTRTICA: 679
UNA REVISIN DE LOS ESTRGENOS
Petsch et.al. CAMBIOS CLIMTICOS Y AUMENTO DE LA VEGETACIN EN LA 683
PENINSULA FILDES, ANTRTICA
Petti et.al. COLEO BIOLGICA DO INSTITUTO OCEANOGRFICO DA USP: 687
PLATAFORMA PARA ESTUDO DA BIODIVERSIDADE BENTNICA DA BAA DO
ALMIRANTADO (ILHA REI GEORGE, ANTRTICA)
Pineda et.al. FORZANTE AMBIENTAL DE GRAN ESCALA Y LOCAL: 690
IMPLICANCIAS EN EL POTENCIAL HDRICO DE SANIONIA UNCINATA Y SU
ENTORNO (PENNSULA DE REY JORGE 62S)
Pino et.al. ESTN CONECTADOS LOS EVENTOS DE ENFRIAMIENTO A FINALES 691
DEL CRETCICO Y EL RECAMBIO FLORSTICO EN PATAGONIA Y
ANTRTICA?
Pinto et.al. RECONSTRUO DA TEMPERATURA DO AR PARA O PLAT 695
CENTRAL DO OESTE DA ANTRTICA
Piones et.al. IMPORTANCIA DE LAS INTRUSIONES DE AGUA CIRCUMPOLAR 699
PROFUNDA Y SU RELACIN CON HOTSPOTS BIOLGICOS EN LA REGIN
NORTE DE LA PENNSULA ANTRTICA
Pizarro et.al. MECANISMOS DE TOLERANCIA A LA DESECACIN EN EL MUSGO 703
ANTRTICO SANIONIA UNCINATA

15 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Poblete et.al. THE PATAGONIAN OROCLINE AND ITS ROL IN THE PATAGONIA- 707
ANTARCTIC PENINSULA SYSTEM
Poljak et.al. Abundancia inusual de focas cangrejeras en la zona de PUNTA Cierva, 711
Pennsula Antrtica?
Ponce et.al. EVALUACIN DE LA PRODUCCIN DE PROTENAS 715
ANTICONGELANTES PROVENIENTES DE BACTERIAS ANTRTICAS
Pradel et.al. EVIDENCE OF WARMING EFFECT ON ORGANIC MATTER OF 719
ANTARCTIC PENINSULA SOILS
Pucurull et.al. EXPRESIN HETERLOGA DE UNA POSIBLE MANGANESO 723
OXIDASA BACTERIANA DE ORIGEN ANTRTICO
Quartino et.al. EFECTO DEL CAMBIO CLIMTICO SOBRE LAS ALGAS MARINAS 727
BENTNICAS EN EL ECOSISTEMA COSTERO DE CALETA POTTER
Queres et.al. FUNGI FROM ANTARCTIC SOILS: TAXONOMY, DIVERSITY AND 730
BIOLOGICAL ACTIVITIES AGAINST NEGLECTED TROPICAL DISEASES AND
HERBICIDAL PROPERTIES
Quezada y Prez-Donoso BSQUEDA DE AZURINAS EN EXTREMFILOS PARA SU 734
APLICACIN COMO FOTOSENSIBILIZADORES EN CELDAS SOLARES
Raffi et.al. BIOSTRATIGRAPHICAL AND PALEOBIOGEOGRAPHICAL 738
SIGNIFICANCE OF LYTOCERATID AMMONOIDS FROM THE SANTONIAN-
MAASTRICHTIAN OF THE JAMES ROSS BASIN, ANTARCTICA
Rebolledo y Rodrigo CARACTERSTICAS SEDIMENTOLGICAS DE CALETA 742
POTTER (62S; 58W, ANTRTICA)
Remedios-De Len et.al. RELEVAMIENTO DE Parochlus steinenii, Gerke, 1889 746
(DIPTERA: CHIRONOMIDAE) EN ECOSISTEMAS DE AGUA DULCE
ANTRTICOS
Ricaurte-Bellota et.al. FORZAMIENTO AMBIENTAL DE CAMBIOS EN 750
PRODUCTIVIDAD MARINA DEL ESTRECHO DE GERLACHE, ANTRTICA
Rimondino y Argello DISTRIBUCIN ATMOSFRICA DE ENDOSULFAN EN 753
SITIOS COSTEROS SUBANTRTICOS Y ANTRTICOS DE LA REPBLICA
ARGENTINA
Ros et.al. AISLAMIENTO Y CARACTERIZACIN DE Pedobacter sp. 3.14.7 UNA 757
NUEVA BACTERIA QUERATINOLTICA PROVENIENTE DE LA ISLA REY
JORGE
Rivas et.al. CONCENTRACIONES DE ELEMENTOS POTENCIALMENTE TXICOS 761
EN SUELO EN UN GRADIENTE LATITUDINAL EXTREMO DESDE EL
CONTINENTE HASTA LA ANTRTICA
Rivas et.al. INTRODUCCIN AL CULTIVO IN VITRO DE PLANTAS ANTRTICAS 765
NATIVAS Y NO NATIVAS
Rodrguez et.al. EFECTOS DE LA TEMPERATURA Y SALINIDAD EN LA FASE 768
GAMETOFTICA DE macrocystis pyrifera L.C. AGARDH (PHAEOPHYCEAE), EN LA
REGIN DE MAGALLANES.
Rodrguez -Oroz et.al. PRELIMINARY RESULTS OF THE DISTRIBUTION OF SEA 772
SALT AND SNOW CHEMISTRY FROM THE SCHANZ-SCHNEIDER GLACIERS
DIVIDE, ELLSWORTH MOUNTAINS, ANTARCTICA
Rojas et.al. EFECTO DE LA ACTIVIDAD ANTICONGELANTE E INTERACCIN 776
LIPDICA DE SCANNING DE PROLINA DEL HOMOPPTIDO DE ARGININA DE
11 RESIDUOS
Rosenfeld et.al. VARIACIN ESPACIAL EN LA COMPOSICIN Y ESTRUCTURA 779
DE LAS COMUNIDADES COSTERAS ROCOSAS ENTRE ISLA HORNOS (PARQUE
NACIONAL CABO DE HORNOS) E ISLA GONZALO (ARCHIPILAGO DIEGO
RAMREZ)

16 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Ruiz Barlet et.al. AGUA PROFUNDA CIRCUMPOLAR EN EL ESTRECHO 783


BRANSFIELD Y SU RELACIN CON EL CAMBIO CLIMTICO
Ruscaso et.al. BIODEGRADACIN AERBICA DEL COLORANTE NARANJA 787
REACTIVO 16 POR UNA LEVADURA ANTRTICA
Sez et.al. INCREASING TEMPERATURE AND ITS EFFECTS ON 791
PHOTOSYNTHETIC PERFORMANCE OF ANTARCTIC VASCULAR PLANTS:
LESSONS FROM FIELD AND LABORATORY EXPERIMENTS
Salazar et.al CIUDADES ANTRTICAS Y PATRIMONIO COMN: 796
REPLANTEANDO EL ROL DE LAS PUERTAS DE ENTRADA
Snchez y Cid-Agero CULTIVO EXPERIMENTAL EN CONDICIONES DE 800
LABORATORIO DE LA CLORFITA Chlamydomonas sp., PROVENIENTE DE
HIELO ANTRTICO
Sandoval y Molina-Montenegro ROL DE LOS MICROORGANISMOS DEL SUELO 804
COMO FACILITADORES DEL PROCESO DE INVASIN DE Poa annua EN LA
ANTRTICA
Sanhueza et.al. EVOLUCIN DE LA RESPIRACIN EN Colobanthus quitensis AL 806
CALENTAMIENTO A CORTO Y LARGO PLAZO IN SITU DURANTE TRES
TEMPORADAS DE CRECIMIENTO
Santa Cruz et.al. DINMICA ESPACIO-TEMPORAL DE LOS CALADEROS DE 810
PESCA DE KRILL EN LA PENNSULA ANTRTICA
Santos et.al. BACTERIAS ANTRTICAS CON ACTIVIDAD b-GALACTOSIDASA 812
Santos et.al. IDENTIFICAO DE COBERTURA VEGETAL EM REAS LIVRES DE 816
GELO NA ILHA NELSON - ANTRTICA MARTIMA
Saucede et.al. MODELING SPECIES DISTRIBUTION PATTERNS IN THE CONTEXT 820
OF PAST AND FUTURE CLIMATE CHANGES: THE ANTARCTIC ECHINOID CASE
STUDY
Senra et.al. REGIME PEDOCLIMTICO DA CAMADA ATIVA NA ANTRTICA 822
MARTIMA E EM ALTA MONTANHA TROPICAL ANDINA
Seplveda et.al. MEASURING PROPERTIES OF THE ATMOSPHERE AND LOW 826
CLOUDS OVER KING GEORGE ISLAND
Seplveda et.al. IMPORTANCIA FUNCIONAL DE ORGANISMOS FORMADORES 830
DE HBITATS EN COMUNIDADES SUBMAREALES DE BAHA FILDES,
ANTRTICA
Servetto et.al. ACIDIFICACIN EN EL OCEANO AUSTRAL: EFECTO POTENCIAL 834
EN EL CORAL ANTARTICO Malacobelemnon daytoni
Servetto et.al. SEASONAL TROPHIC ECOLOGY OF THE DOMINANT ANTARCTIC 836
CORAL Malacobelemnon daytoni (OCTOCORALLIA, PENNATULACEA,
KOPHOBELEMNIDAE)
Short et.al. CHARACTERIZATION OF PUTATIVE ANTI-FREEZE PROTEINS FROM 840
Deschampsia antarctica
Signori et.al. SPATIAL DYNAMICS OF MICROBIAL DIVERSITY AND 843
COMMUNITY STRUCTURE IN THE PELAGIC ZONES AROUND THE ANTARCTIC
PENINSULA
Sime et.al. THE MAGELLANIC CHIRONOMID Halirytus magellanicus 846
Sime et.al. APLICACIN DE FILTROS DE IMAGEN Y DE NDICE 849
NORMALIZADO DE DIFERENCIA DE NIEVE, DE GLACIAR Y DE NIEVE Y HIELO
EN LOS GLACIARES DRUMMOND Y WIDDOWSON, PENNSULA ANTRTICA,
ANTRTICA
Sotille et.al. USO DE NDVI DE IMGENES DE VEHCULO AREO NO TRIPULADO 852
(VANT) PARA MAPEO DE VEGETACIN EN BAHA ESPERANZA, P. ANTRTICA
Souza et.al. TAXONOMIC STUDY OF FUNGI PRESENT CONCENTRIC RINGS OF 856
SICK MOSSES LIVING IN ANTARCTICA PENINSULA

17 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Suasnavas et.al. EVALUACIN DE LA ACTIVIDAD ANTIBACTERIANA DE 860


EXTRACTOS DE MICROALGAS DE LA ESTACIN ANTRTICA ECUATORIANA
PEDRO VICENTE MALDONADO USANDO CEPAS ATCC
Tetzner y Fernandoy EXTENSIN EN LA ESTIMACIN DE ACUMULACIN 864
SUPERFICIAL EN LA PLATAFORMA DE HIELO FILCHNER-RONNE,
ANTRTICA
Thomazini et.al. MAPPING AND MODELING THE SPATIAL VARIABILITY OF SOIL 868
ATTRIBUTES IN MARITIME ANTARCTICA
Torre et.al. ANTARCTIC BENTHOS UNDER INCREASING SEDIMENTATION, A 872
BALANCE BETWEEN SENSITIVITY AND STRATEGY
Torre et.al. NUEVOS REGISTROS DE OTOLITOS EOCENOS DE LA FORMACIN 873
LA MESETA ISLA MARAMBIO (SEYMOUR), ANTRTIDA
Ugalde Peralta et.al. GEOMORPHOLOGY OF THE SOUTHWESTERN MARGIN OF 877
THE BELLINGSHAUSEN ICE DOME (COLLINS GLACIER), FILDES PENINSULA,
KING GEORGE ISLAND, SOUTH SHETLAND ISLANDS
Valdivia et.al. UN COMPONENTE PERDIDO DE LA BIODIVERSIDAD: 881
EVALUACIN DE LA BIODIVERSIDAD DE LA PARSITOFAUNA EN DOS
ESPECIES PECES ANTRTICOS
Valladares et.al. PETROGRAFA Y GEOQUMICA DE XENOLITOS MANTLICOS 886
DE LA ISLA JAMES ROSS, ANTRTICA
Vallejos et.al. EFECTO DE LA TEMPERATURA EN LA ACTIVACION IN VIVO DE 890
RUBISCO EN Colobanthus quitensis (KUNTH) BARTL.
Vargas-Chacoff et.al. LA OSMORREGULACIN DEL PEZ NOTOTENIDO Harpagifer 895
antarcticus SE MODIFICA FRENTE A CAMBIOS DE TEMPERATURA Y SALINIDAD
Vsquez et.al. GERMINACIN DE SEMILLAS HETEROMRFICAS DE Colobanthus 899
quitensis (KUNTH) BARTL. BAJO CONDICIONES DE SALINIDAD.
Vsquez et.al. QUITINASA DE Curtobacterium luteum - 458 AISLADO DE 903
SEDIMIENTO MARINO DE ANTRTICA
Vsquez-Martnes et.al. DETECCIN E IDENTIFICACIN DE VIRUS PATGENOS 904
DE RELEVANCIA ACUCOLA EN PECES SILVESTRES CAPTURADOS EN
TERRITORIO ANTRTICO CHILENO
Verdy y Waller AMPHIPODA DE LAS BAHAS COLLINS Y DRAKE, ANTRTIDA 908
Vergara et.al. PESTICIDAS RGANO-CLORADOS EN FOCAS ANTRTICAS DEL 912
NOROESTE DE LA PENNSULA ANTRTICA
Vidal y Foppiano ON THE BIMODAL DISTRIBUTION OF PRECIPITATED 916
ELECTRONS FLUXES IN THE AUSTRAL AURORAL ZONE
Vieira et.al. EVIDENCIAS SEDIMENTARIAS DE ANTIGUO AMBIENTE MARINHO, 917
MONTAAS ELLSWORTH, ANTRTICA OCCIDENTAL
Willis et.al. BSQUEDA DE MICROORGANISMOS ANAEROBIOS ASOCIADOS A 921
LOS CICLOS GEOQUMICOS DEL HIERRO Y AZUFRE EN SEDIMENTOS
MARINOS DE LA CALETA POTTER, ANTRTIDA
Zenteno et.al. FUENTES DE CARBONO Y ESTRUCTURA TRFICA DE UNA 925
COMUNIDAD BENTNICA ANTRTICA
Ziga et.al. RESPUESTAS ANTIOXIDANTES EN EL MUSGO Polytrichastrum 930
alpinum, EN UN CONTEXTO DE CAMBIO CLIMTICO

18 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

UN AVE LIMCOLA-VADEADORA DEL EOCENO DE LA ISLA MARAMBIO,


ANTRTIDA
(A shorebird from the Eocene of Seymour Island, Antarctica)

Acosta Hospitaleche, C.1, Haidr, N. 2 y Reguero, M. 1, 3


1
Divisin Paleontologa Vertebrados, Museo de La Plata, Paseo del Bosque s/n, (B1900FWA) La Plata,
Argentina. CONICET. E-mail: acostacaro@fcnym.unlp.edu.ar 2IBIOMAR, CONICET, Bvd. Brown 2915,
U9120ACD, Puerto Madryn, Argentina. E-mail: nadiahaidr@gmail.com 3Instituto Antrtico Argentino.
Divisin Paleontologa Vertebrados, Museo de La Plata, Paseo del Bosque s/n, (B1900FWA) La Plata,
Argentina. CONICET. E-mail: regui@fcnym.unlp.edu.ar

De acuerdo a sus requerimientos ecolgicos, las aves se agrupan en distintos gremios, que
constituyen subgrupos dentro de una comunidad. La delimitacin de estos gremios se basa
en un recurso en particular y el modo en que es explotado, por ejemplo el tipo de dieta y el
modo de captura. Las aves vadeadoras, tambin conocidas como shorebirds, constituyen
un grupo muy bien representado en la actualidad, y cuyos integrantes estn agrupados
mayormente en el orden Charadriiformes. Se trata de aves costeras que se caracterizan por
sus patas largas que utilizan para desplazarse por los cuerpos de agua poco profunda y por
sus picos angostos y elongados, que entierran en el agua y el fango para obtener su presa
mediante distintas estrategias (e.g.: el playerito Tringa detecta visualmente los pequeos
invertebrados, la aguja Limosa limosa y la becacina Gallinago gallinago emplean las
terminales sensitivas del pico, y la avoceta Recurvirostra avosetta barre el sedimento con su
pico (Lifjeld,1984; Moreira, 1994; 1995).
En el caso de las aves fsiles, la estructura gremial puede ser analizada a travs del estudio
de la tafocenosis de cada una de las localidades fosilferas y la morfologa comparada de los
restos preservados. La localidad DPV 16/84 (Fig. 1) es uno de los sitios con mayor
abundancia y diversidad de aves eocenas de la Isla Marambio, y de toda la Antrtida. De all
provienen restos asignados a Ratites (Tambussi et al., 1994), Pelagornithidae (Cenizo et al.,
2015), Procellariiformes (Acosta Hospitaleche y Gelfo, 2017), Ciconiiformes (Jadwiszczak
et al., 2008) y numerosos restos de pinginos (Acosta Hospitaleche y Haidr, 2011, Acosta
Hospitaleche et al., 2017).
La estructura gremial de la localidad fosilfera DPV 16/84, como ocurre en otras localidades
del Palegeno de Antrtida, se encuentra dominada por los pinginos. Si bien estas son aves
piscvoras que obtienen sus presas mediante el buceo con persecucin, se conocen especies
de pinginos fsiles que habran sido ms generalistas en su dieta, posiblemente
incorporando otros organismos marinos (Haidr y Acosta Hospitaleche, 2012). A estos se les
suman los albatros y petreles (Procellariiformes) y las gaviotas pardas (Gaviiformes),
planeadores costeros que capturan peces sumergiendo parte del cuerpo en el agua, y las aves
pseudo-dentadas (Pelagornithidae), planeadoras costeras que habran capturado presas ms
livianas o que simplemente oponen menor resistencia a la captura, tales como crustceos,
moluscos o peces de pequeo porte (Acosta Hospitaleche, 2016).

19 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 1. Mapa de ubicacin donde se seala la localidad DPV 16/84, de donde proviene el pico
MLP 12-XII-1-156. Figure 1. Location map showing the fossiliferous locality DPV 16/84, from where the
MLP 12-XII-1-156 comes.

En la presente contribucin se describe un pico de ave (MLP 12-XI-1-156) perteneciente a


un Charadriiformes proveniente de la Formacin Submeseta (Priaboniano), en la Isla
Marambio (Fig. 1). El material, hallado en la Localidad DPV 16/84 durante la campaa
Antrtica de verano organizada por el Instituto Antrtico Argentino (IAA) en el ao 2012, se
encuentra depositado en la Divisin Paleontologa Vertebrados del Museo de La Plata
(MLP), Argentina.
El hallazgo del MLP 12-XI-1-156 (Fig. 2) en la localidad DPV 16/84 permite agregar a los
gremios mencionados, el grupo de aves limcolas vadeadoras, que sumergen sus picos en el
agua y el lodo para atrapar a sus presas. Este registro se suma a un reporte previo de un ave
similar a un ibis (Ciconiiformes), representado por un pico fragmentario (Jadwiszczak et al.,
2008). Este ltimo registro es muchas veces ignorado en los listados de la avifauna fsil
antrtica seguramente por tratarse de un material aislado e incompleto. Sin embargo, y como
era de esperar al comparar con comunidades actuales, el MLP 12-XI-1-156 confirma la
presencia de aves vadeadoras en las cosas antrticas durante el Eoceno.
La morfologa general del pico (Fig. 2) se encuentra totalmente adaptada para la bsqueda y
captura de alimento en cuerpos de agua poco profunda y/o lodos. Un gran nmero de especies
limcolas vadeadoras son clasificadas dentro de las familias Scolopacidae (playeros,
zarapitos, agujas, agujetas, vuelvepiedras, andarros, falaropos, y correlimos, entre otros) y
los Recurvirostridae (avocetas y cigeuelas o teros reales), todas ellas caracterizadas por el
desarrollo de un pico elongado y muy delgado (Burton, 1974; del Hoyo et al., 1996). Estas
estructuras resultan demasiado grciles y frgiles para su preservacin, por lo que estas aves
se encuentran mayormente representados en el registro fsil a travs de elementos
apendiculares (Bickart, 1990; Mayr, 2009 y referencias all citadas), los cuales son tan
caractersticos como los picos, por su hbito vadeador (del Hoyo et., 1996).

20 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 2. Pico MLP 12-XII-1-156: A, vista dorsal. B, vista ventral. C, vista lateral. Abreviaturas: ps, pila
supranasalis, ct, crista tomialis, rm, rostrum maxillare, s, sulcus ventralis, fc, facies lateralis, ano, apertura
nasi ossea, fvr, facies ventralis rostrali. Escala: 10 mm. Figure 2. Bill MLP 12-XII-1-156: A, dorsal view. B,
ventral view. C, lateral view. Abbreviation: ps, pila supranasalis, ct, crista tomialis, rm, rostrum maxillare, s,
sulcus ventralis, fc, facies lateralis, ano, apertura nasi ossea, fvr, facies ventralis rostrali. Scale bar: 10 mm.

El MLP 12-XI-1-156 recuerda al pico del gnero Himantopus (Fig. 3) en la elongacin de su


regin anterior, la compresin dorso-medial, y el desplazamiento posterior de la apertura nasi
ossea. Sin embargo, su tamao es mucho mayor al de cualquier representante actual del
gnero. Si bien el MLP 12-XI-1-156 no se encuentra completo, la porcin preservada permite
estimar una longitud del pico en aproximadamente 19.9 cm, correspondiente a un crneo de
28.2 cm de largo. De acuerdo a estos valores, que son slo estimaciones, y se encuentran
supeditadas a los hallazgos de materiales ms completos, el MLP 12-XI-1-156
correspondera a una "tero real o cigeuela un 176% ms grande que los representante
actuales (Fig. 3A).

Figura 3. A, Ubicacin del MLP 12-XI-1-156 en un crneo reconstruido en vista dorsal a partir de las
proporciones de Himantopus melanurus; B-D, crneo actual de H. melanurus en B, vista dorsal, C, vista
lateral y D, vista ventral. Escala: 10 mm (la escala de B,C,D es la misma). Figure 3. A, Location of the MLP
12-XI-1-156 in a reconstructed skull in dorsal view following the proportions of Himantopus melanurus; B-D,
modern skull of H. melanurus in B, dorsal view, C, lateral view, and D, ventral view. Scale bar: 10 mm (scale
form B,C,D is the same).

21 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

El gigantismo es un fenmeno frecuente en muchas especies fsiles, como ocurre en el caso


de los pinginos (Acosta Hospitaleche, 2014) y los Pelagornithidos (Cenizo et al., 2015), de
esta misma asociacin. El MLP 12-XI-1-156 corresponde indudablemente a un nuevo taxn,
de mayor talla que las aves limcolas actuales, muy similar a Himantopus en la morfologa
general del pico y seguramente de familia Recurvirostridae. El hallazgo de materiales ms
completos permitirn una descripcin ms integral de esta especie.

Agradecimientos
Al Instituto Antrtico Argentino por invitarnos a realizar trabajos de campo en la Isla
Marambio. A Diego Montalti y Mariana Picasso por el acceso a los materiales de
comparacin.

Referencias
Acosta Hospitaleche, C. 2014. New penguin giant bones from Antarctica: systematic and paleobiological
significance. Comptes Rendus Palevol., 13: 555-560
Acosta Hospitaleche, C. 2016. Evolucin de las aves marinas del extremo sur de Amrica del Sur y Antrtida.
Contribuciones del MACN "Historia evolutiva y paleobiogeogrfica de los vertebrados de Amrica del Sur"
XXX Jornadas Argentinas de Paleontologa de Vertebrados, 6: 173-182.
Acosta Hospitaleche, C., Reguero, M. y S. Santillana, S. 2017. Aprosdokitos mikrotero gen. et sp. nov, the
tiniest Sphenisciformes that lived in Antarctica during the Paleogene. Neues Jahrbuch fr Geologie und
Palontologie, 283: 25-34
Acosta Hospitaleche, C., y Gelfo, J. N. 2017. Procellariiform remains and a new species from the latest Eocene
of Antarctica. Historical Biology, 29(6), 755-769.
Acosta Hospitaleche, C., y Haidr, N. 2011. Penguin (Aves, Sphenisciformes) cranial remains from the La
Meseta Formation (Eocene) of Antarctic Peninsula (Antarctica). Antarctic Sciences, 23: 369-378.
Bickart, K. J. 1990. Part I: The Birds of the Late Miocene-Early Pliocene Big Sandy Formation, Mohave
County, Arizona. Ornithological Monographs, (44), 1-72.
Burton, 1974; Feeding and the feeding apparatus in waders: a study of anatomy and adaptations in the Charadrii
(no encuentro el trabajo).
Cenizo, M., Hospitaleche, C. A., y Reguero, M. 2015. Diversity of pseudo-toothed birds (Pelagornithidae) from
the Eocene of Antarctica. Journal of Paleontology, 89(5): 870-881.
del Hoyo, J., Elliott, A. and J. Sargatal eds. 1996. Handbook of the Birds of the World. Vol. 3. Hoatzin to Auks.
Lynx Edicions, Barcelona.
Jadwiszczak, P., Gadzicki, A., y Tatur, A. 2008. Short note: an ibis-like bird from the upper La Meseta
Formation (Late Eocene) of Seymour Island, Antarctica. Antarctic Science, 20(4): 413-414.
Lifjeld, J. T. 1984. Prey selection in relation to body size and bill length of five species of waders feeding in
the same habitat. - Ornis Scand. 15: 217-226
Mayr, G. 2009. Paleogene Fossil Birds. Springer-Verlag, Heidelberg.
Moreira, F. 1994. Diet, prey-size selection and intake rates of Black-tailed Godwits Limosa limosa feeding on
mudflats. Ibis, 136(3), 349-355.
Moreira, F. 1995. The winter feeding ecology of Avocets Recurvirostra avosetta on intertidal areas. I. Feeding
strategies. Ibis, 137(1), 92-98.
Tambussi, C. P., Noriega, J. I., Gazdzicki, A., Tatur, A., Reguero, M. A., y Vizcano, S. F. 1994. Ratite bird
from the Paleogene La Meseta Formation, Seymour Island, Antarctica. Polish Polar Research, 15(1-2): 15-20.

22 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

RIZOBACTERIAS PRODUCTORAS DE ACC DEAMINASA ASOCIADAS A PLANTAS


VASCULARES ANTRTICAS (DESCHAMPSIA ANTARCTICA Y COLOBANTHUS
QUITENSIS)
(ACC deaminase-producing rhizobacteria associated with native Antarctic vascular plants,
Deschampsia antarctica and Colobanthus quitensis).
Acua, J.1, Durn, P.2, Marileo, L.1, Inostroza, N.1, Viscardi, S.2, Maruyama, F.3 y Jorquera, M.A.1
1
Laboratorio de Ecologa Microbiana Aplicada, Departamento de Ciencias Qumicas y Recursos Naturales, Universidad
de La Frontera, Temuco, Chile. 2Laboratorio de Biotecnologa en Recursos Naturales, Ncleo Cientfico y Tecnolgico en
Biorecursos, Universidad de La Frontera, Temuco, Chile. 3Department of Microbiology, Graduate School of Medicine,
Kyoto University, Kyoto, Japan.

En la actualidad, los sistemas agrcolas dependen en gran medida de su capacidad adaptativa frente a
eventos climticos adversos como variaciones pluviomtricas extremas (sequa e inundaciones)
asociadas al cambio climtico. Estrategias de mitigacin que disminuyan el estrs abitico
provocados por dichos eventos extremos sobre las plantas deben ser desarrolladas de manera de
mantener la seguridad alimentaria para la poblacin. Bajo condiciones de estrs, las plantas presentan
cambios metablicos, como el aumento de las concentraciones intracelulares de etileno, fitohormona
que de producirse prolongadamente tiene efectos deletreos para la planta. En este sentido, es
ampliamente reconocido que existen un grupo de bacterias que promueven el crecimiento y la
tolerancia al estrs abitico en las plantas, denominadas como PGPB (del ingls Plant Growth
Promoting Bacteria). Este tipo de bacterias contribuye al crecimiento y sobrevivencia de las plantas
mediante diversos mecanismos, dentro de ellos, las produccin de la enzima 1-aminociclopropano-
1-carboxilato (ACC) deaminasa, que hidroliza el precursor inmediato del etileno, el ACC, brindan a
las plantas tolerancia a los efectos adversos que el estrs abitico pudiese generar sobre ellas,
promoviendo indirectamente su crecimiento (Penrose y Glick, 2003).
Ecosistemas extremos albergan una gran diversidad de plantas nativas que en coevolucin con
bacterias han desarrollado mecanismos adaptativos propios a las condiciones locales adversas.
Plantas vasculares que habitan el territorio antrtico tales como D. antarctica y C. quitensis albergan
bacterias que estn fuertemente adaptadas y podran brindar a las plantas mecanismos que les
permiten sobrevivir a condiciones extremas, ofreciendo una oportunidad atractiva para entender el
papel ecolgico de dichas bacterias con actividad ACC deaminasa en estos ecosistemas. Por tanto,
hipotetizamos que las bacterias que sintetizan ACC deaminasa son habitantes comunes de las plantas
vasculares antrticas, las cuales podran tener un rol protectivo para mejorar el crecimiento y la
sobrevivencia de stas. En este estudio se utilizaron tanto mtodos dependientes como independientes
de cultivo para examinar la estructura de la comunidad bacteriana y la ocurrencia de bacterias
putativas productoras de ACC deaminasa asociadas a la rizsfera, endsfera y filsfera de plantas
vasculares antrticas.

Materiales Y Mtodos
Muestras de plantas y sus respectivo suelo rizosfrico, fueron obtenidos desde ejemplares de D.
antarctica y C. quitensis durante el muestreo realizado en la Expedicin Cientfica Antrtica 2017
(ECA53) recorriendo las Islas Shetland del Sur y la Pennsula Antrtica. Las muestras de plantas
fueron divididas en sub muestras de rizsfera, endsfera y filsfera para las extracciones de ADN
total y para el aislamiento de bacterias cultivables desde los diversos compartimentos de las plantas.
La estructura de la comunidad bacteriana fue revelada a travs de PCR-DGGE segn lo descrito por
Iwamoto et al. (2000) y Jorquera et al. (2014). El anlisis de los perfiles de bandas DGGE se realizaron
a partir de un dendrograma utilizando el software Phoretix 1D Pro (TotalLab Ltd., Reino Unido).
Basado en la matriz obtenida, las diferencias entre las comunidades bacterianas se evidenciaron
mediante el anlisis del perfil de similitud (SIMPROF) con el ndice de similitud de Bray-Curtis y

23 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

visualizado por medio de un anlisis de Escalamiento Multidimensional no Mtrico (nMDS)


utilizando el software Primer 6 (Primer-E Ltd.).
En paralelo, bacterias cultivables que habitan la rizsfera, endsfera y filsfera, fueron aisladas desde
las muestras de plantas utilizando placas de agar con medio NM-1 y agar Pseudomona (PSD). Para
la rizsfera, 5 g de muestra fueron agitados por 5 min en tubos Falcon estriles con 45 ml de solucin
salina estril (SSS), segn los descrito por Jorquera et al. (2014). Para la endsfera, de acuerdo a
Barra et al. (2016), muestras de hoja y raz fueron lavadas y desinfectadas para la obtencin de un
macerado de tejido, el cual fue transferido a tubos Falcon estriles con 5 ml de SSS. Finalmente para
la filsfera, 1 g de hojas fueron dispuestos en tubos Falcon estriles con 45 ml de SSS y sometidos a
vortex durante 10 min para separar las bacterias adheridas. Aislados desde la rizsfera fueron
testeados para verificar su capacidad como putativos productores de ACC deaminasa mediante su
capacidad para crecer en el medio DF suplementado con 1-aminociclopropano-1-carboxilato (ACC)
(Calbiochem) como nica fuente de N (Penrose y Glick, 2003). El crecimiento bacteriano se
monitoreo diariamente y las cepas que crecieron en medio DF suplementado con ACC fueron
considerados como rizobacterias putativas productoras de ACC deaminasa.

Resultados Y Discusin

Figura 1. Escalamiento multidimensional no mtrico (nMDS) a partir de los perfiles de bandas obtenidos desde el DGGE
(16S rRNA gen) de las comunidades bacterianas asociadas a diferentes tejidos de plantas vasculares antrticas (A).
Estructura de la comunidad bacteriana presente en las en la rizsfera (B), endsfera (D) y filsfera (D) de plantas de
Deschampsia antarctica (n=11) y Colobanthus quitensis (n=4) generado por el software Primer 6 (Primer-E Ltd.) basado
en la matriz de Bray-Curtis usando valor de stress de <0,1 y con un P <0,05.

La estructura de las comunidad bacteriana generados a partir del perfil de bandas obtenidos en el
anlisis DGGE del gen 16S rRNA se muestran en la Figura 1. El anlisis nMDS mostr un patrn de
diferenciacin (similitud del 40%) entre las comunidades bacterianas de la rizsfera en comparacin
con la endsfera y la filsfera (Fig. 1A). Si analizamos cada compartimiento de la planta por separado,
las comunidades bacterianas de la rizsfera no revelaron un agrupamiento (similitud de un 40%) entre
s, independiente de la especie de planta analizada (D. Deschampsia y C. quitensis) (Fig. 1B). Sin
embargo, las comunidades bacterianas de la endsfera de las plantas formaron principalmente tres
grupos con una similitud de 40% (Fig. 1C), sugiriendo una distribucin asociado a la especie de
planta. Finalmente, la mayor disimilitud fueron observadas en las comunidades de bacterias en la
filsfera de las plantas, donde slo se encontr 3 mayores grupos (40% de similitud), independientes

24 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

de la especie de las plantas. El anlisis de nMDS indic diferencias en general entre las comunidades
presente en la rizsfera de las plantas nativas que habitan la antrtica en comparacin con los tejidos
de dichas plantas. La abundancia, la composicin y la actividad de las poblaciones de bacterias que
habitan la rizsfera y la endsfera pueden verse afectadas por una amplia variedad de factores
incluyendo el clima, la seleccin especfica de la planta y/o las propiedades del suelo (N, P y K). En
particular, se ha demostrado que la disponibilidad de carbono y el pH del suelo son factores
importantes que influyen en la composicin de las comunidades bacterianas. Nuestros resultados
coinciden con los trabajos de Teixiera et al. (2010) quien seala que las bacterias que habitan la
rizsfera de plantas vasculares antrticas tiene patrones similares de diversidad bacteriana entre las
dos especies de plantas, independiente del sitios de muestreo, argumentando en contra de la hiptesis
de que habra diferencias entre las comunidades de rizsfera de diferentes plantas.
En relacin al recuento bacteriano y aislamiento de bacterias putativas productoras de ACC
deaminasa, los resultados revelaron diferencias significativas (P0,05) en los recuentos de clulas
bacterianas entre las muestras de la rizsfera, endsfera y filsfera de plantas vasculares antrticas D.
antarctica y C. quitensis (Fig. 2A). Se observ una mayor abundancia de bacterias cultivables en
muestras de suelo de rizsfera (1~10106 UFC g-1 de suelo) en comparacin con muestras de la
endsfera (1~5104 CFU g-1 tejido) y las muestras de filsfera (1~5105 CFU g-1 de hoja) con ambos
medios de cultivo (NM-1 y PSD). Sin embargo, no se observaron diferencias significativas en el
nmero de bacterias totales entre los medios de cultivos para ambas plantas en todos los
compartimentos analizados. Finalmente, una mayor diversidad de fenotipos bacterianos se
visualizaron en medio de agar NM-1 en muestras de D. antarctica en comparacin con C. quitensis
(Fig. 2B). Se obtuvieron un total de 667 aislamientos (403 de rizsfera, 130 de endsfera y 134 de
filsfera) en funcin de su fenotipo. Un total de 381 aislamientos desde la rizsfera (94.5%) mostraron
la capacidad de crecer en medio de cultivo DF (Fig. 2C). Dentro de estos ltimos, 48 aislados (12%)
fueron capaces de crecer en medio DF suplementado con ACC como nica fuente de N, por lo que
se consideraron como bacterias putativas productoras de ACC deaminasa (Fig. 2D). Cabe destacar
que estos resultados son una primera aproximacin de la seleccin de cepas con actividad ACC
deaminasa desde los aislados obtenidos de plantas vasculares antrticas. A pesar de que nuestros
resultados sugieren que rizobacterias asociadas a plantas vasculares son potenciales productores de
ACC deaminasa, se requieren mayores experimentos de caracterizacin enzimtica y posterior ensayo
en condiciones de invernadero para evaluar su potencial uso como inoculante para aliviar el estrs en
plntulas de paltos.

Figura 2. Recuentos de bacterias heterotrficas totales en NM-1 (barras negras) y Agar Pseudomona (barras blancas)
presente en las en la rizsfera, endsfera y filsfera de Da antarctica (n=11) y C quitensis (n=4). Las barras representan el
error estndar y diferentes letras (en maysculas para NM-1 o minsculas para PSD) representan diferencias estadsticas

25 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

(P0.05) (A). Ejemplo de aislados cultivados (B). Numero de rizobacterias putativas productoras de la enzima ACC
deaminasa (C). Ejemplo de los crecimiento bacterianos en medio DF suplementado con ACC como nica fuente de N (D).

Conclusiones
Nuestros resultados sugieren que la estructura de las comunidades bacterianas podra estar
influenciada por cada compartimiento, independiente de las especies de las plantas estudiadas (D.
antarctica y C. quitensis) a excepcin de la endosfera. Sobre la base del conteo de unidades formadoras
de colonias, los compartimentos de las plantas evaluadas mostraron diferencias significativas
independientes del medio de cultivo utilizado (agar NM-1 y agar PSD), con un mayor recuento en
rizsfera. Finalmente, entre 667 aislados, 60% pertenecieron a la rizsfera, 19% endfita y 20%
filsfera, dentro de los rizobacterias solo 45 aislados (12%) se caracterizaron preliminarmente como
bacterias productoras de ACC deaminasa. Futuro trabajo estar enfocado a validar la actividad ACC
deaminasa y la utilidad de las bacterias productoras de ACC deaminasa para mejorar la tolerancia al
estrs en plantas de paltos bajo condiciones de campo.
Agradecimientos
Fondecyt Regular no. 1160302 e INACH Regular RT_02_16

Referencias
Barra, P.J., Inostroza, N.G., Acua, J.J., Mora, M.L., Crowley, D.E. y Jorquera M.A. 2016. Formulation of bacterial
consortia from avocado (Persea americana Mill.) and their effect on growth, biomass and superoxide dismutase activity of
wheat seedlings under salt stress. Applied Soil Ecology 102: 8091.
Iwamoto, T., Tani, K., Nakamura, K., Suzuki, Y., Kitagawa, M., Eguchi, M. y Nasu, M. 2000. Monitoring impact of in situ
biostimulation treatment on groundwater bacterial community by DGGE. FEMS Microbiology Ecology 32:129141.
Jorquera, M.A., Inostroza, N.G., Lagos, L.M., Barra, P.J., Marileo, L.G., Rilling, J.I., Campos, D.C., Crowley, D.E.,
Richardson, A.E. y Mora, M.L. 2014. Bacterial community structure and detection of putative plant growth- promoting
rhizobacteria associated with plants grown in Chilean agro-ecosystems and undisturbed ecosystems. Biology and Fertility
of Soils 50: 11411153.
Penrose, D.M. y Glick, B.R. 2003. Methods for isolating and characterizing ACC deaminase-containing plant growth-
promoting rhizobacteria. Physiologia Plantarum 118:1015.
Teixeira, L.C., Peixoto, R., Cury, J., Sul, W., Pellizari, V., Tiedje, J. y Rosado, A. 2010. Bacterial diversity in rhizosphere
soil from Antarctic vascular plants of Admiralty Bay, maritime Antarctica. The ISME 4:9891001.

26 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

EFECTOS DEL CALENTAMIENTO EXPERIMENTAL IN SITU SOBRE LA


COMPOSICIN Y ABUNDANCIA DE PROTENAS Y PIGMENTOS ASOCIADOS
AL FOTOSISTEMA I Y II DE DESCHAMPSIA ANTARCTICA DESV. (POACEAE)
(Effects of in situ experimental warming on the composition and abundance of proteins and
pigments associated to photosystem I and II of Deschampsia antarctica Desv. [Poaceae])

Acua, K.I.1, 2, Mora, M.2 y Bravo L.A.2, 3


1
Programa de Doctorado en Ciencias mencin Biologa Celular y Molecular Aplicada, Facultad de Ciencias
Agropecuarias y Forestales, Universidad de La Frontera, Casilla 54-D, Temuco, Chile. 2Center of Plant, Soil
Interaction and Natural Resources Biotechnology BIOREN, Universidad de La Frontera, Casilla 54-D,
Temuco, Chile. 3Departamento de Ciencias Agronmicas y Recursos Naturales, Facultad de Ciencias
Agropecuarias y Forestales, Universidad de La Frontera, Casilla 54-D, Temuco, Chile. E-mail:
k.acuna01@ufromail.cl

Los organismos vegetales llevan a cabo eficientemente la fotosntesis a lo largo de un amplio


rango de temperaturas aun cuando stas se alejan de su ptimo de crecimiento (Mackey et
al., 2013). Sin embargo, cuando las temperaturas son notoriamente inferiores, la consecuente
disminucin del metabolismo puede generar un desbalance entre la energa lumnica
absorbida y aquella utilizada por los procesos asimilativos. As, intensidades lumnicas
ptimas pueden volverse saturantes y perjudiciales para el aparato fotosinttico, induciendo
su fotoinhibicin y consecuente fotodao (Huner et al., 1996). Para evitar tal desbalance
energtico (y/o sus consecuencias), las plantas cuentan con eficientes mecanismos que les
permiten evitar la captura de energa lumnica en exceso y/o disipar eficientemente aquella
que ya ha sido absorbida. Entre los primeros se encuentran los cambios a nivel de la
estructura, organizacin y composicin de los fotosistemas (Kouril et al., 2013). Entre las
especies con notable capacidad para mantener el balance energtico a baja temperatura est
Deschampsia antarctica Desv., una de las dos plantas vasculares presentes en la Antrtica
martima. Si bien en esta regin seguirn predominando las temperaturas fras, es de amplio
conocimiento que la temperatura promedio del aire se encuentra en ascenso (a una tasa de
3,7C siglo-1). Son precisamente estos antecedentes los que hacen de D. antarctica un
excelente modelo tanto para el estudio de los mecanismos involucrados en la tolerancia a la
fotoinhibicin inducida por fro, as como tambin de los posibles efectos que el
calentamiento tendr sobre los mismos.

Materiales y Mtodos
1. Sitio de estudio y experimento de calentamiento in situ
Cercanas de la Base Cientfica Polaca Henryk Arctowski (Colina Puchalski), Isla Rey Jorge,
Antrtica Martima (620941S - 582810O). En el lugar se cuenta con dos condiciones
experimentales: individuos de D. antarctica creciendo bajo condiciones control o Espacio
Abierto (EA) o bajo condiciones de calentamiento experimental al interior de 13 cmaras
de calentamiento pasivo (OTC).
2. Extraccin de protenas tilacoidales y anlisis de inmunotransferencia
La metodologa fue bsicamente segn Bascun-Godoy et al., (2012). Para las
preparaciones tilacoidales se utiliz 100mg de tejido foliar. La carga de protenas en el gel
se bas en el contenido de clorofila de la muestra (1ug de clorofila/carril). Anticuerpos

27 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

utilizados: Anti-PsbA, Anti-PsaA, Anti-Lhcb1, Anti-Lhcb2, Anti-Lhcb4, Anti-Lhcb5, Anti-


Lhca1, Anti-Lhca2, Anti-Lhca3 y Anti-Lhca4 (Agrisera, Vnas, Suecia). Las protenas
fueron detectadas por ECL (Pierce, Rockford, USA) sobre una pelcula de rayos X (Fuji,
Tokyo, Japan). Las determinaciones densitomtricas fueron realizadas con el software
GelQuantNET.
3. Anlisis de pigmentos
Los pigmentos fotosintticos (clorofila a y b) y de fotoproteccin (ciclo de las xantfilas)
fueron extrados de acuerdo a la metodologa de Sez et al. (2012) y cuantificados por medio
de HPLC segn el mtodo propuesto por (Garcia-Plazaola & Becerril, 1999). El estado de
de-epoxidacin de la violaxantina fue calculado por medio de la frmula DEPS =
(Z+0,5A)/(V+A+Z).
4. Anlisis estadsticos
Se aplic estadstica paramtrica por medio de la prueba de t-student o, alternativamente,
estadstica no paramtrica a travs de la pruebas de U Mann-Whitney. El nivel de
significancia utilizado fue p 0,05; considerando un n = 3 para el anlisis de protenas y n =
6 para el anlisis de pigmentos. El programa de anlisis utilizado fue Statistica versin 7.0
(StatSoft, 2004).

Resultados y discusin
1. Efectos del calentamiento sobre las protenas asociadas al FSI y FSII
El incremento experimental de la temperatura in situ slo tuvo efectos significativos sobre el
FSII. En comparacin con EA, en OTC se detect alrededor de un 14% menos PsbA y
alrededor de un 11% menos Lhcb2 (Figura 1).

Figura 1. Efectos del calentamiento experimental in situ sobre la acumulacin de PsbA y Lhcb2 de D.
antarctica. En las grficas se exhibe el contenido relativo promedio ( error estndar) de cada protena (%)
respecto al nivel mximo determinado segn el anlisis densitomtrico de las bandas respectivas (imagen
sobre las grficas). n = 3; p 0,05.

Bajo condiciones de iluminacin, el polipptido PsbA (protena D1) exhibe una alta tasa de
recambio (Mizusawa et al., 2003). Por esto, la disminucin de los niveles de PsbA en D.
antarctica bajo calentamiento puede ser un indicativo de que temperaturas de crecimiento
ms clidas podran afectar directamente la eficiencia de dicho mecanismo. Esto se traducira

28 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

en la acumulacin de FSII daados y, por ende, inactivados o fotoinhibidos. Una forma de


evitar tal causa de fotoinhibicin puede ser la reduccin del tamao de la antena cosechadora
de luz. Esto disminuira la energa lumnica absorbida y, por ende, la presin de excitacin
sobre el FSII. Esto concuerda con la diminucin en OTC del polipptido Lhcb2, uno de los
principales componentes de la antena externa LHCII.
1. Efectos del calentamiento sobre los contenidos de pigmentos fotosintticos y de
fotoproteccin
El calentamiento experimental in situ no afecta los niveles de clorofila total, clorofila a y
clorofila b de D. antarctica. Asimismo, tampoco tiene incidencia sobre la razn de clorofila
a/b, siendo sta de 4,4 para ambos tratamientos. Consistente con lo ltimo son las nicas
diferencias detectadas. stas tienen relacin con los niveles de clorofila a un 77% mayor que
los de clorofila b tanto en EA como en OTC. En general, el principal componente de la antena
LHCII es la clorofila b (Kitajima & Hogan, 2003). Por lo tanto, los bajos niveles de este
pigmento tanto en EA como en OTC estaran indicando la reduccin del tamao de la antena
de D. antarctica en ambas condiciones experimentales. Sin embargo, el mecanismo utilizado
diferira de acuerdo a la temperatura de crecimiento imperante. El que plantas en OTC
exhiban simultneamente menos clorofila b y menos Lhcb2 que plantas en EA, podra
deberse a que las primeras regulan el tamao de la antena disminuyendo tanto el principal
componente proteico, el Lhcb2, como el principal componente de estabilidad del complejo,
la clorofila b; en tanto que plantas en EA lo haran slo por medio de la disminucin de la
clorofila b.

EA OTC
MD PA MD PA
Clorofila a 552,2 86,5a 509,9 25,1a 568,8 53,0a 512,0 44,9a
Clorofila b 124,4 19,6b 113,3 6,6b 131,7 15,8b 122,7 10,8b
Clorofila total 676,6 106,0 623,2 31,7 700,5 68,7 634,7 55,5
Cl a / Cl b 4,4 0,0 4,5 0,1 4,4 0,1 4,2 0,1
Violaxantina 40,1 9,1 75,8 3,5 53,5 4,1 74,2 5,7
Anteraxantina 26,3 2,6 19,8 0,8 35,1 3,2 15,0 1,5
Zeaxantina 61,5 4,5a 17,1 1,0 34,9 2,2b 7,5 2,1
DEPS 0,59 0,03 0,24 0,01 0,43 0,02 0,16 0,02

Tabla 1. Efectos del calentamiento experimental in situ sobre los contenidos de pigmentos fotosintticos y del
ciclo de las xantfilas (g Pig/gPF) en D. antarctica. MD: Medio da solar; PA: Pre-alba. n = 6; p 0,05.

En cuanto a las xantfilas, el calentamiento induce a medio da solar una menor acumulacin
de zeaxantina (Tabla 1). Esto se traduce en un estado de de-epoxidacin de la violaxantina un
27% inferior en individuos dentro de OTC. Tales diferencias en la acumulacin de zeaxantina
son mantenidas e incluso incrementadas durante la noche, alcanzando los individuos dentro
de OTC un 36% menos nivel de de-epoxidacin que aquellos creciendo en EA (Tabla 1).
Estos resultados podran estar relacionados a la menor presin de excitacin a la que estaran
expuestas las plantas dentro de OTC producto del reducido tamao de la antena cosechadora
de luz, as como tambin a un posible aumento en la capacidad de disipar eficientemente la
energa por medio de vas fotoqumicas que son favorecidas por temperaturas de crecimiento
ms clidas (ej.: fotosntesis).

29 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Conclusiones
1. Si bien el complejo LHCII-FSII de D. antarctica ya sea en EA u OTC estara en su unidad
mnima (C2S2), los mecanismos involucrados en la regulacin de su tamao estn
fuertemente ligados a la temperatura de crecimiento imperante. As, individuos que crecen
bajo temperaturas diurnas ms clidas ajustan su antena por medio de la disminucin de los
niveles de Lhcb2 y clorofila b; mientras que aquellas que lo hacen bajo temperaturas
predominantemente ms fras los hacen slo por medio del decaimiento en los niveles de
clorofila b.
2. Los inferiores niveles de de-epoxidacin exhibidos por D. antarctica dentro de OTC
indican que esta condicin disminuye la proporcin de energa que est siendo disipada por
medio del ciclo de las xantfilas. Esto ms que estar relacionado con un efecto perjudicial
del calentamiento sobre los procesos o reacciones que lo componen, podra ser la
consecuencia directa de la disminucin de la energa lumnica que es absorbida en exceso
gracias a la reduccin del tamao de la antena cosechadora de luz.
Agradecimientos
Beca Conicyt de Doctorado Nacional, Beca de Gastos Operacionales 21151625, Fondecyt
1151173 e INACH.

Referencias
Arnon, D. 1949. Copper enzymes in isolated chloroplasts; polyphenol oxidases in Beta vulgaris. Plant Physiology 24:115.
Bokhorst, S., Huiskes, A., Convey, P., Sinclair, B.J., Lebouvier, M., Vijver, B.V.D, Wall, D.H. 2011. Microclimate impacts
of passive warming methods in Antarctica: implications for climate change studies. Polar Biology 34:14211435.
Huner, N.P., Maxwell, D.P., Gray, G.R., Savitch, L.V., Krol, M., Ivanov, A.G., Falk, S. 1996. Sensing environmental
temperature change through imbalances between energy supply and energy consumption: Redox state of photosystem II.
Physiologia Plantarum 98:358364
Garcia-Plazaola, J.I., Becerril, J. 1999. A rapid high-performance liquid chromatography method to measure lipophilic
antioxidants in stressed plants: simultaneous determination of carotenoids and tocopherols. Phytochemical Analysis 10:
307313.
Kitajima, K. & Hogan, P. 2003. Increases of chlorophyll a/b ratios during acclimation of tropical woody seedlings to
nitrogen limitation and high light. Plant, Cell & Environment 26: 857-865.
Kouril, R. Wientjes, E. Bultema, J.B. Croce, R. & Boekema, EJ. 2013. High-light vs. low-light: Effect of light acclimation
on photosystem II composition and organization in Arabidopsis thaliana. Biochemica et Biophysica Acta 1827: 411-419.
Mackey, K.R.M., Paytan, A., Caldeira, K., Grossman, A., Moran, D., McIlvin, M. & Saito, M.A. 2013 Effect of Temperature
on Photosynthesis and Growth in Marine Synechococcus spp. Plant Physiology 163: 815-829.
Mizusawa, N., Tomo, T., Satoh, K., & Miyao, M. 2003. Degradation of the D1 Protein of Photosystem II under Illumination
in ViVo: Two Different Pathways Involving Cleavage or Intermolecular Cross-Linking. Biochemistry 42: 10034-10044.
Sez, P.L., Bravo, L.A., Latsague, M.I., Snchez, M.E., Ros, D.G. (2012) Increased light intensity during in vitro culture
improves water loss control and photosynthetic performance of Castanea sativa grown in ventilated vessels. Scientia
Horticulturae 138: 716.

30 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ALIMENTACIN DE LAS ESPECIES DE CETCEOS ODONTOCETOS EN


AGUAS ANTRTICAS (Feeding of the odontocete cetaceans species in antarctic waters)
Aguayo-Lobo, A.1 y L, Oyarzn-Galaz2

1
Departamento cientfico, Instituto Antrtico Chileno, Plaza Muos Gamero 1055, Punta Arenas, Chile. E-
mail: a.aguayo@inach.cl. 2Tesista de Biologa Marina, Universidad de Valparaso. Av. Borgoo 16344,
Reaca, Chile. E-mail: loyarzung@uv.cl

El objetivo de la presente contribucin es dar a conocer el escaso conocimiento que tenemos


sobre la alimentacin de las especies de cetceos odontocetos en aguas antrticas, con
excepcin de dos especies que han sido objeto de capturas comerciales en el pasado siglo
XX. Las especies de cetceos odontocetos, que se han registrado en aguas antrticas,
ascienden a 11 (Aguayo-Lobo & Acevedo 2008), agrupadas en 4 familias: Physeteridae con
una especie; Ziphiidae con 4; Delfinidae con 5; y Phocoenidae con una especie.

Resultados
Las dos especies de odontocetos que han experimentado la caza comercial en aguas antrticas
son: el cachalote y la orca. De estas dos, se ha podido examinar el contenido estomacal de
algunos ejemplares faenados por la industria ballenera. De las otras nueve especies de
odontocetos, el examen del contenido estomacal proviene de animales capturados
incidentalmente en las operaciones de la industria pesquera o, que han sido capturados por
los pescadores artesanales o, provienen de ejemplares varados vivos o muertos en las playas
del continente antrtico o en las islas antrticas y subantrticas.

Presas De Las Especies De Odontocetos


Cachalote, Physeter macrocephalus (Linnaeus, 1758)
Esta especie, en aguas antrticas, consume principalmente cefalpodos de las familias
Histioteuthidae, Onychoteuthidae, Octopoteuthidae, Cranchiidae, Ommastrephidae y
Architeuthidae (Matthews 1938; Gambell 1972); as como peces de los gneros Genypterus,
Hoplostethus, Polyprion, Jordanidia, y Dissostichus (Matsushita 1955). En aguas chilenas
consume principalmente cefalpodos de la familia Ommastrephidae y peces del gnero
Dissostichus y Genypterus (Clarke, Paliza y Aguayo 1988). El cachalote se alimenta
principalmente de 6 familias de cefalpodos y de 5 gneros de peces, as como de algunos
crustceos.

Zifio de Cuvier, Ziphius cavirostris (G. Cuvier, 1823)


Esta especie de distribucin cosmopolita, se alimenta en ambos hemisferios, principalmente
de calamares, peces y de algunos crustceos. Las familias de calamares que se han registrado
como presas son: Cranchiidae, Onychoteuthidae, Brachioteuthidae, Enoploteuthidae,
Octopoteuthidae, Histioteuthidae. Peces de aguas profundas y meso-pelgicos como
gadiformes (Moridae) y atheriniformes (Atherinidae), y crustceos decpodos y misidceos.
El Zifio de Cuvier se alimenta, segn Heyning (1989) principalmente de calamares, peces de
aguas profundas y mesopelgicos, y tambin de algunos crustceos.
Zifio de Arnoux, Berardius arnuxii (Duvernoy, 1851)

31 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Se conoce muy poco sobre su alimentacin, pues solo se ha examinado el contenido de un


estmago, segn Kasuya (2002), donde se encontraron picos de cefalpodos, sin determinar
la especie.

Hiperodonte del Sur, Hyperoodon planifrons (Flower, 1882)


Los cefalpodos constituyen el principal tem de la dieta de esta especie en aguas antrticas
(Clarke & Goodall 1994; Sekiguchi et al. 1993). La especie ms numerosa encontrada fue
Psychroteuthidae glacialis, que represent el 50% en nmero y la especie de ms masa fue
Kondakovia longimana, que represent el 54,8% en peso. Las otras especies de cefalpodos
fueron Taonius pavo, Galiteuthis glacilis, Theutowenia megalops, Discoteuthis discus,
Histioteuthis eltaninae, Alluroteuthis antarcticus, Mesonychoteuthis hamiltoni y
Liochranchia sp., las cuales representaron el 29,5% en nmero y el 18,3% en peso.
Finalmente Gonatus antarcticus fue el cefalpodo que represent el 6,3% en nmero y 7,4%
en peso. La nica especie de pez registrado como presa es Dissostichus eleginoides.

Mesoplodonte de Layardi, Mesoplodon layardii (Gray, 1865)


Las principales presas de esta especie son los cefalpodos, los cuales representaron el 94,8%
en los 14 estmagos examinados, constituyendo el 94,8% de las presas consumidas. Entre
los cefalpodos, los gneros ms abundantes fueron Histioteuthis y Taonius (Sekiguchi et al.
1996). Solo en dos estmagos se detectaron restos de peces (otolitos) y restos de crutceos.
Es interesante hacer notar, que el tamao de las presas consumidas por las hembras de esta
especie, no es significativamente ms grande que el de las presas capturadas por los machos,
como uno pudiese esperar por la morfologa de su dentadura.

Orca, Orcinus orca (Linnaeus, 1758)


La orca es la especie ms grande de la familia Delphinidae, y es el mximo predador de los
ecosistemas marinos en todos los mares del mundo. Sus presas principales son varias especies
de peces, mamferos marinos, aves marinas e incluso tortugas marinas. Entre los mamferos
marinos figuran especies de las familias Mustelidae, Phocidae, Otariidae, y varias especies
de odontocetos y misticetos (Jefferson et al. 1991; Dahlhein & Heyning 1999). En aguas
antrticas (Hoyt 1984) de 362 estmagos analizados, el 60% de las presas estuvo constituido
por peces y el 31% de ballenas minke, el 9% de especies de pinipedios y el 9% de
cefalpodos. Por tanto, esta especie consume principalmente peces (osteictos y condrictios)
y varias especies de mamferos marinos.

Caldern negro, Globicephala melas (Traill, 1809)


En aguas de Nueva Zelanda los cefalpodos Nototodarus sp. y Pinoctopus cordiforme fueron
las presas principales encontradas en 11 estmagos analizados (Beatson & OShea 2009). Y
en aguas de Tasmania las 4 especies ms importantes encontradas fueron Sepioteuthis
australis, Nototodarus gouldi, Enoploteuthis galaxias, Benthoctopus sp (Gales et al. 1992).
Y en el canal Beagle, Chile, en 7 estmagos analizados, las principales especies fueron
Chiroteuthis veranii, Martialia hyadesi y Moroteuthis ingens; siendo esta ltima la ms
abundante (Mancilla et al. 2013). En consecuencia, la dieta ms importante en aguas del
hemisferio sur de este delfn est constituida por cefalpodos.

Delfn cruzado, Lagenorhynchus cruciger (Quoy y Gaimard, 1824)

32 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

La principal dieta de esta especie poco estudiada, son los cefalpodos de las familias
Onychoteuthidae y Enoploteuthidae (Clarke 1986), consumiendo tambin pequeos peces de
la familia Myctophidae (gnero Krefftichthys) (Nichols 1908) y restos de crustceos sin
determinar (Goodall 2002).

Delfn liso del Sur, Lissodelphis peronii (Lacpde, 1804)


Entre las presas de esta especie de delfn pelgico para las aguas de Nueva Zelanda, se
informaron peces del gnero Macruronus y cefalpodos del gnero Nototodarus (Baker
1981). En aguas chilenas se han registrado peces de los gneros: Hygophum, Lampanyctus,
Bathylagus y Vinciguerria, siendo lejos predominante entre los peces el gnero Hygophum
(Torres & Aguayo 1979); adems estos autores informan cefalpodos de los gneros
Dosidicus, Gonatus, Mastigoteuthis y Chranchidae como presas. Van Waerebeek & Oporto
(1990) para las aguas chilenas, agregaron entre los peces a los gneros Engraulis,
Odontesthes y Trachurus. Por tanto, la alimentacin principal de esta especie son los peces.

Tunina overa, Cephalorhynchus commersonii (Lacpde, 1804)


El alimento de esta especie ha sido estudiado por Bastidas et al (1998), quienes informaron
que en 53 estmagos analizados se encontraron restos de peces de los gneros
Austroatherina, Espratus, Macruronus, restos de cefalpodos del gnero Loligo, y restos de
krill de Euphausia valentinii y E. lucens. Los peces constituyeron el 60% de ocurrencia, los
cefalpodos el 37% y el krill 3%. En consecuencia el principal alimento de esta especie son
peces y calamares. Dichos autores encontraron tambin pequeos restos de Crustceos
(misidceos, ispodos y anfpodos), as como de echinodermos, tunicados, porferos,
celenterados y poliquetos.

Marsopa de anteojos, Phocoena dioptrica (Lahille, 1912)


Segn Goodall (2002) solo se han examinado 4 estmagos, dos de los cuales estaban vacos,
uno con pequeas cantidades de anchoveta, Engraulis sp., y uno, con restos de algas no
determinadas. En consecuencia no se conoce casi nada sobre las presas de esta especie.

Discusin y Conclusiones
Se discuten los resultados y se concluye que: Primero, el cachalote en aguas antrticas y
subantrticas se alimenta principalmente de cefalpodos y en forma secundaria de peces.
Segundo, las cuatro especies de la familia Ziphidae se alimentan preferentemente de
cefalpodos. Tercero, de las 5 especies de la familia Delphinidae hay una, de la cual no hay
datos suficientes, (Lagenorhynchus cruciger). Otra especie (Globicephala melas) se alimenta
exclusivamente de cefalpodos y dos especies de esta familia (Lissodelphis peronii y
Cephalorhynchus comersonii), se alimentan principalmente de peces. Finalmente, la especie
ms grande de la familia Delphinidae (Orcinus orca) se alimenta en mayor proporcin dep,
y de varias especies de mamferos marinos y de aves, siendo los cefalpodos, los menos
representativos en sus presas. Cuarto, Phocena dioptrica, la Marsopa de anteojos, es la nica
representante de la familia Phocoenidae en aguas antrticas; de la cual no se conoce casi nada
sobre su alimentacin, salvo restos de algas no identificada y restos digeridos de Anchoveta,
Engraulis sp. Quinto, se espera que con el uso de mtodos no letales de istopos estables
cidos grasos, empleados actualmente, podamos aumentar en el futuro prximo nuestro
escaso conocimiento sobre la alimentacin de estas especies de odontocetos.
Agradecimientos

33 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

A INACH, por las facilidades otorgadas para preparar esta contribucin.

Referencias
Aguayo L, A & J Acevedo R. 2008. Las especies de mamferos marinos antrticos. Memorial Antrtico del Ejrcito,
Santiago. Vol 1:24-31.
Baker, A. N. 1981. The southern right whale dolphin Lissodelphis peronii (Lacepede) in Australasian waters. Record Nat.
Mus. New Zealand 2(4): 17-34.
Bastida, R., V. Lichtschein, y R. N. P.Goodall. 1988. Food habits of Cephalorhynchus commersonii off Tierra del Fuego.
Pp. 119-141, en: Biology of the Genus Cephalorhynchus (R. L. Brownell Jr. y G. P. Donovan, eds.). International Whaling
Commission, Special Issue 9.
Beatson E. L., S. OShea. 2009. Stomach contents of long-finned pilot whale, Globicephala melas, mass-stranded on
Farewell Spit, Golden Bay in 2005 and 2008. New Zealand J. Zool. 36(1): 47-58.
Clarke, M.R. 1996. Cephalopods as Prey. III. Cetaceans. Philos. Trans.R. Soc. Lond., Ser. B, 351: 1053-1065.
Clarke M & N Goodall. 1994. Cephalopods in the diets of three odontocete cetacean species stranded at Tierra del
Fuego, Globicephala melaena (Traill, 1809), Hyperoodon planifrons FLower, 1882
and Cephalorhynchus commersonii (Lacpde, 1804). Antarctic Science 6(2): 149-154.
Clarke R, O Paliza y A Aguayo L. 1988. Sperm whales of the southeast Pacific. Part. IV: Fatness, Food and Feeding.
Investigation on Cetacea. Ed. G. Pilleri. 21: 51-195.
Dahlhein, M.E. y J.E. Heyning. 1999. Killer Whale Orcinus orca (Linnaeus, 1758). pp. 281-322. En: Ridgway, S.H. y S.R.
Harrison (Eds.). Handbook of Marine Mammals. Vol. 6. The second book of dolphins and porpoises. Academic Press.
London.
Gales R, D Pemberton, M Clarke & C Lu. 1992. Stomach contents of long-finned pilot whales (Globicephala melas) and
bottlenose dolphins (Tursiops truncatus) in Tasmania. MarineMammal Science 8(4): 405-413.
Gambel, R. 1972. Sperm whales off Durbam. Discovery Rep. 35:199-358.
Goodall R.N.P. (2002) Hourglass Dolphin (Lagenorhynchus cruciger). In: Perrin WF, Wrsig B, Thewissen JGM (eds).
Encyclopedia of Marine Mammals, San Diego, pp 583585
Goodall, R. N. P. 2002. Spectacled porpoise. Pages 11581161 in W. F.Perrin, B.Wrsig, and J. G. M.Thewissen,
eds. Encyclopedia of marine mammals. Academic Press, San Diego , CA .
Heyning, J. E. 1989, Cuviers beaked whale, Ziphius cavirostris. pp.289-308. En: Ridgway, S. H. y S. R. Harrison (Eds.).
Vol.4. River Dolphins and the Larger Toothed Whales. Academic Press. London.
Hoyt, E. 1984. Orca the whale called killer. Camden, House. Ontario.
Jefferson T, P Stacey & R Baird. 1991. A review of Killer Whale interactions with other marine mammals: predation to co-
existence. Mammal Rev. 21(4): 151-180.
Kasuya, T. 2002. Giant beaked whales. pp. 519-522. En: Perrin, W.F., B. Wursig y J.G.M. Thewissen (Eds.). Encyclopedia
of marine Mammals. Academic Press. San Diego.
Mansilla L, C Olavarra & M Vega. 2012. Stomach contents of long-finned pilot whales
(Globicephala melas). Polar Biology 35:1929-1933.
Matsushita, T. 1955. Daily rhythmic activity of the sperm whales in Antarctic Ocean. Bull. Japan. Soc. Sci. Fish. 20:770-
773.
Matthews, L. H. 1938. The sperm whale, Physeter catodon. Discovery Rep. 17:93-168.
Nichols J (1908) Notes on two porpoises captured on a voyage into the Pacific Ocean. Bull Am Mus Hist 24: 217219
Sekiguchi K, N Klages & P Best. 1996. The diet of strap-toothed whales (Mesoplodon layardii). Journal of Zoology
(London) 239: 453-463.
Sekiguchi K, N Klages, K Findlay & P Best. 1993. Feeding habits and possible movements of southern bottlenose whales
(Hyperoodon planifrons). Proceedings of the NIPR Symposium on Polar Biology 6: 84-97.
Torres D & A Aguayo-Lobo. 1979. Hbitos alimentarios de Lissodelphis peronii (Lacpde, 1804) en Chile Central
(Cetacea: Delphinidae). Revista de Biologa Marina Departamento de Oceanologa, Universidad de Chile 16(3): 221-224.
Van Waerebeek, J Canto, J Gonzlez, J Oporto & JL Brito. 1991. Southern Rigth whale dolphins, Lissodelphis peronii off
the Pacific coast of South America. Zeitschrift fur Saugetierkunde 56: 284- 295

34 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

CONDICIONES DE pH, pCO2 Y NUTRIENTES EN UN TRANSECTO COSTA-


OCANO AL SUR DE LA PENNSULA ANTRTICA: VERANO 2017
(Conditions of pH, pCO2 and nutrient along a coastal-ocean transect in southern
Antarctic Peninsula: Summer 2017)

Alarcn, E.12, Giesecke, R.13, Hfer, J.13, Carrera, V.15, Mller, P.6, Torres, R.12, Iriarte,
J.L.134
1
Centro de Investigacin: Dinmica de Ecosistemas Marinos de Altas Latitudes (IDEAL), Punta Arenas,
Chile. e-mail: emilio.alarcon@uach.cl. 2Centro de Investigacin en Ecosistemas de la Patagonia (CIEP),
Coyhaique, Chile. 3Instituto de Ciencias Marinas y Limnolgicas, Universidad Austral de Chile, Valdivia,
Chile. 4Instituto de Acuicultura, Universidad Austral de Chile, Puerto Montt, Chile. 5Programa Magster en
Oceanografa, Universidad de Concepcin, Concepcin, Chile. 6Programa de Magster en Geografa y
Geomtica, Pontificia Universidad Catlica, Santiago, Chile.

El ecosistema marino antrtico es considerado como uno de los sistemas ms vulnerables y


susceptible a estresores globales (e.g. calentamiento global, acidificacin de los ocanos,
desalinizacin), pero es uno de los menos estudiados debido a su clima hostil y altos costos
operacionales. En el verano de 2017 (01 al 07 de febrero) se realiz un estudio preliminar
para caracterizar las condiciones qumicas de pH, pCO2 y concentracin de nutrientes
(nitrato, fosfato y cido silcico) en la capa 0 - 100 m a lo largo de un transecto costa-ocano
al sur de la Pennsula Antrtica (Fig. 1) en el marco de la campaa Antrtica ECA 53.
Se recolectaron muestras de agua de mar a los 0, 5, 10, 25, 50 y 100m de profundidad
utilizando botellas Glo-Flo de 5L. Se registr la salinidad y la temperatura con el CTD SBE
25 plus. El pH a 25 C se midi utilizando un mtodo espectrofotomtrico (DOE, 1994). Se
preservaron muestras de agua de mar para el posterior anlisis de alcalinidad total
(preservadas con cloruro de mercurio) y concentracin de nutrientes (muestras congeladas)
en el laboratorio de carbonatos del CIEP. La alcalinidad total fue medida por titulacin
potenciomtrica con un electrodo combinado de Ross utilizando el mtodo de Haraldsson et
al (1997). Los nutrientes fueron determinados espectrofotomtricamente segn el mtodo de
Strickland y Parsons (1968). Se utilizaron los datos de salinidad, temperatura, pH a 25C,
alcalinidad total, fosfato y cido silcico para calcular el pHin situ (escala total) y pCO2 (atm)
con el programa CO2SYS (Lewis y Wallace 1998) utilizando las constantes de disociacin
de cido carbnico derivadas por Mehrbach et al (1973) y re-modeladas por Dickson y
Millero (1987).
La distribucin vertical en las estaciones del transecto seal una capa superficial de menor
salinidad (~33), ms clida (~3 C), ms bsica (pHin situ > 8.1), baja en pCO2 (~200 atm)
y con concentraciones medias de nutrientes (nitrato < 10 M; fosfato < 1.0 M; cido silcico
<70 M), comparado con aguas profundas ms salinas (~34), fras (1 - 2 C), acdicas (< 8.0),
alta en pCO2 (> 400 atm) y alta en nutrientes (nitrato 15 - 20 M; fosfato 1.5 - 2.0 M; cido
silcico 70 - 90 M). Se observaron diferencias en el gradiente horizontal costa-ocano, con
una capa menos salina, ms bsica, baja en pCO2 (~200 atm) y baja en nutrientes al interior
de la baha comparado con la estacin ms externa de la baha.
La reduccin en nutrientes inorgnicos, altos valores de pH y bajos valores de pCO2
evidencian un comportamiento altamente autotrfico en la capa superficial dentro y fuera de

35 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

la baha. En la capa ms profunda fuera de la baha, este patrn es menos evidente, con una
columna de agua ms homognea. Las diferencias fsico-qumicas observadas en condiciones
de verano son consistentes con las estimaciones de productividad primaria (PP), encontrando
cerca de ocho veces ms PP al interior de la baha (valor integrado 0-25 m = 8885 mg C d-1
m-2) que en la estacin externa (valor integrado 0-25 m = 1109 mg C d-1 m-2). Altos niveles
de productividad primaria podran explicarse por la estratificacin superficial.
Sugerimos que la segregacin vertical de PP y la respiracin determinan fuertemente los
niveles de pH, pCO2 y concentracin de nutrientes inorgnicos en el perodo productivo de
esta zona de estudio.

Agradecimientos
A base cientfica Yelcho de INACH. Proyecto es financiado por FONDAP 15150003.

Referencias
Dickson, A. y Millero, F. 1987. A comparison of the equilibrium constants for the dissociation of carbonic acid
in seawater media. Deep Sea Research 34: 1733-1743.
DOE. 1994. Handbook of methods for the analysis of the various parameters of the carbon dioxide system in
sea water; version 2, A.G. Dickson and C. Goyet, eds., ORNL/CDIAC-74.
Haraldsson, C., Anderson, L., Hassellv, M., Hulth, S. y Olsson, K. 1997. Rapid, high precision potentiometric
titration of alkalinity in ocean and sediment pore waters. Deep Sea Res Part I: (44) 2031 2044.
Lewis, E. y Wallace, D. 1998. Program developed for CO2 system calculations. Oak Ridge, Oak Ridge National
Laboratory ORNL/CDIAC-105.
Mehrbach, C., Culberson, C., Hawley, J. y Pytkowicz, R. 1973. Measurement of the apparent dissociation
constants of carbonic acid in seawater at atmospheric pressure. Limnol. Oceanogr. 18: 897 907.

36 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 1: Estaciones oceanogrficas realizadas en la capa 0 - 100 m de profundidad en Baha Sur (64.9 S -
63.8 W) del 01 al 07 de febrero de 2017. Las estaciones PP corresponden a incubaciones in situ de 14 horas
aprox. para estimar la productividad primaria (PP). Figure 1: Oceanographic stations carried on layer 0 - 100
meters deep in South Bay (64.9 S - 63.8 W) from 1st to 7th February 2017. PP stations correspond to in situ
incubations of 14 hours approx. to estimate primary productivity (PP).

Figura 2: Perfiles verticales de salinidad, temperatura, pH, pCO2, nitrato y fosfato en el transecto costa-
ocano. Figure 2: Vertical profiles of salinity, temperature, pH, pCO2, nitrate and phosphate in the coast-
ocean transect.

37 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ESTADO DE SATURACIN DEL CARBONATO DE CALCIO ALREDEDOR DE


LA PENNSULA ANTRTICA EN INVIERNO Y VERANO
(Calcium carbonate saturation state around Antarctic Peninsula in winter and
summer)

Alarcn, E.12, Vergara, M.13, Reiss, C.4, Giesecke, R.15, Hfer, J.15, Carrera, V.16, Mller, P.7,
Torres, R.12, Iriarte, J.L.18.
1
Centro de Investigacin: Dinmica de Ecosistemas Marinos de Altas Latitudes (IDEAL), Punta Arenas,
Chile. e-mail: emilio.alarcon@uach.cl. 2Centro de Investigacin en Ecosistemas de la Patagonia (CIEP),
Coyhaique, Chile. 3Programa de Doctorado en Acuicultura, Universidad Austral de Chile, Puerto Montt
Chile. 4Administracin Nacional Ocenica y Atmosfrica (NOAA), USA. 5Instituto de Ciencias Marinas y
Limnolgicas, Universidad Austral de Chile, Valdivia, Chile. 6Programa Magster en Oceanografa,
Universidad de Concepcin, Concepcin, Chile. 7Programa de Magster en Geografa y Geomtica, Pontificia
Universidad Catlica, Santiago, Chile. 8Instituto de Acuicultura, Universidad Austral de Chile, Puerto Montt,
Chile.

Desde la Revolucin Industrial, gran cantidad de CO2 ha sido liberado a la atmsfera debido
principalmente a la quema de combustibles fsiles entre otras actividades contaminantes de
origen humano. Esto no slo est provocando un calentamiento global, sino que est
cambiando profundamente la qumica del agua de mar. Una proporcin de este CO2
antropognico ha sido absorbido por la superficie de los ocanos (Sabine et al 2004),
provocando un aumento en la presin parcial del CO2 (pCO2), una disminucin en el pH y
una reduccin en el estado de saturacin del carbonato de calcio (Caldeira y Wicket 2003,
Raven et al 2005). El ecosistema marino Antrtico no es una excepcin a este fenmeno
global, siendo este ecosistema uno de los ms vulnerables al continuo aumento de CO2 (Orr
et al 2005).
Con el objetivo de caracterizar los niveles actuales de pCO2 y estado de saturacin del
carbonato de calcio en el ecosistema marino Antrtico, se recolectaron muestras de agua de
mar en invierno (07 al 28 de agosto 2016: NOAA-AMLR Winter 2016) y verano (01 al 07
de febrero 2017) alrededor de la Pennsula Antrtica (Fig. 1). En la poca invernal, se
realizaron mediciones superficiales de salinidad, temperatura, pCO2, y adems, se colectaron
muestras discretas de agua de mar para el anlisis posterior de alcalinidad total a bordo del
rompehielos estadounidense Nathaniel B. Palmer. En condiciones de verano 2017, se midi
la salinidad, temperatura, pH a 25 C, y la alcalinidad total en la capa 0 - 100 m a lo largo de
un transecto costa-ocano al sur de la isla Anvers (65 S) en el marco de la campaa Antrtica
ECA 53. Se utilizaron los datos de salinidad, temperatura, pCO2 en invierno (pH @ 25 C en
verano) y alcalinidad total para calcular el pCO2 (atm) y el estado de saturacin de la calcita
y la aragonita (calcita y aragonita, respectivamente) con el programa CO2SYS (Lewis y
Wallace 1998) utilizando las constantes de disociacin de cido carbnico derivadas por
Mehrbach et al (1973) y re-modeladas por Dickson y Millero (1987).
En condiciones invierno 2016, el agua superficial estuvo super-saturada en carbonato de
calcio ( > 1) con valores promedio ( sd) de 1.9 (0.1) y 1.2 (0.03) para calcita y aragonita,
respectivamente. En condiciones estivales 2017, el agua superficial tambin estuvo super-
saturada para el carbonato de calcio, con niveles de dos veces ms altas que en invierno
(promedio ( sd) de 4.0 (0.2) y 2.5 (0.1) para calcita y aragonita, respectivamente). Los
niveles de de aguas profundas (bajo los 50 m) en verano fueron en promedio muy similares

38 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

(promedio ( sd) de 1.8 (0.6) y 1.2 (0.4) para calcita y aragonita, respectivamente) a los
niveles superficiales encontrados en condiciones invernales.
Nuestros resultados indican que el agua de mar superficial alrededor de la Pennsula Antrtica
se encuentra super-saturada ( > 1) para los cristales de calcita y aragonita tanto en invierno
como en verano. La baja temperatura (~ -1.5 C) y altos valores de pCO2 (entre 400 y 480
atm) determinan los bajos niveles de reportados en condiciones invernales. Los mayores
niveles superficiales de reportados en verano, pueden estar explicadas, en parte, por el
aumento de la temperatura (Opdyke y Wilkinson, 1993) y por efecto biolgico (e.g.
fotosntesis) en la poca estival (Alarcn et al, unpublished data). Finalmente, los bajos
reportados en condiciones invernales ( ~ 1.2) sugieren que este perodo es ms susceptible
a reducir sus niveles de en condiciones futuras de CO2.

Agradecimientos
Financiado por el programa NOAA-AMLR (C.R.) y FONDAP 15150003.

Referencias
Caldeira K, Wickett ME. 2003. Anthropogenic carbon and ocean pH. Science 425: 365.
Lewis, E. y Wallace, D. 1998. Program developed for CO2 system calculations. Oak Ridge, Oak Ridge National
Laboratory ORNL/CDIAC-105.
Mehrbach, C., Culberson, C., Hawley, J. y Pytkowicz, R. 1973. Measurement of the apparent dissociation
constants of carbonic acid in seawater at atmospheric pressure. Limnol. Oceanogr. 18: 897 907.
Opdyke BN, Wilkinson BH. 1993. Carbonate mineral saturation state and cratonic limestone accumulation.
American Journal of Science. 293:217 234.
Orr JC, Fabry VJ, Aumont O, Bopp L, Doney SC, Feely RA, Gnanadesikan A, Gruber N, Ishida A, Joos F, Key
RM, Lindsay K, Maier-Reimer E, Matear R, Monfray P, Mouchet A, Najjar RG, Plattner GK, Rodgers KB,
Sabine CL, Sarmiento JL, Schlitzer R, Slater RD, Totterdell IJ, Weirig MF, Yamanaka Y, Yool A. 2005.
Anthropogenic Ocean Acidification over the twenty-first century and its impact on calcifying organisms. Nature
437: 681-686.
Raven J, Caldeira K, Elderfield H, Hoegh-Guldberg O, Liss P, Riebesell U, Shepherd J, Turley C, Watson A.
2005. Ocean acidification due to increasing atmospheric carbon dioxide, Royal Society, London. 57 pp.
Sabine, C. L., Feely, R. A., Gruber, N., Key, R. M., Lee, K., Bullister, J. L., Wanninkhof, R., Wong, C. S.,
Wallace, D. W. R., Tilbrook, B., Millero, F. J., Peng, T.-H., Kozyr, A., Ono, T., y Rios, A. F., 2004. The oceanic
sink for anthropogenic CO2, Science, 305, 367371.

Figura 1: (A) Estaciones superficiales durante el crucero de invierno 2016 (agosto) y (B) transecto costa-
ocano en verano 2017 (febrero). Figure 1: (A) Surface stations during the winter cruise 2016 (August) and
(B) transect coast-ocean in summer 2017 (February).

39 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 2: Valores superficiales de Salinidad, Temperatura, Alcalinidad total, pCO2 y estado de saturacin de
la calcita y aragonita en Agosto 2016 (NOAA-AMLR). Figure 2: Surface values of salinity, temperature,
total alkalinity, pCO2 and saturation state of calcite and aragonite in August 2016 (NOAA-AMLR).

40 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 3: Perfil vertical de salinidad, temperatura, alcalinidad total, pCO2 y estado de saturacin de la calcita
y aragonita en el transecto costa-ocano durante el verano 2017. Figure 3: Vertical profile of salinity,
temperature, total alkalinity, pCO2 and saturation state of calcite and aragonite in the coast-ocean transect
during summer 2017.

41 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

UNVEILING THE COMPOSITION OF THE ACTIVE VIRAL FRACTION AND


ITS DYNAMICS DURING A PHYTOPLANKTON BLOOM IN A LATE
ANTARCTIC SUMMER
(Revelando la composicin de la fraccin viral activa y su dinmica durante un bloom de
fitoplncton a finales del verano antrtico)

Alarcn-Schumacher, T.1, Guajardo, S.1 y Dez B.1, 2


1
Departamento de Gentica Molecular y Microbiologa, Facultad de Ciencias Biolgicas, Pontificia
Universidad Catlica de Chile, Alameda #340, Santiago, Chile. 2Center for Climate and Resilience Research
(CR)2, Chile. E-mail: tbalarco@uc.cl

Viruses are the most abundant biological entities on the oceans and through their lytic and
lysogenic activity regulate and shape marine microbial communities (Berg et al., 1989).
Phytoplankton blooms on Southern Ocean, that account for nearly 20% of total primary
production (Arrigo et al., 1999), are influenced by nutrient availability, grazing and viral
activity, whereas their existence strongly influence bacterioplankton composition, carbon
sinking and flux to upper trophic levels, therefore having an impact on global climate (Yager
et al., 2001; Takahashi et al., 2002). Despite the importance of the summer phytoplankton
blooms in Antarctic marine waters little is known about the identity and role of viruses
associated to these events.
Here, the viral composition and dynamic on the 2014 summer pre- and top-phytoplankton
bloom in the Antarctic coastal waters of Chile Bay was assessed. We combined
physicochemical information with an integrate omics monitoring that included
metagenomics, metatranscriptomics and 16S iTag sequencing. We recovered genomic,
phylogenetic and functional information of dominant and active viral populations associated
to both bacterial and eukaryotic populations, and its putative relevant role on their regulation
(Figure 1). The study revealed a new Myovirus genome (Pp_ChB_T08) similar to those
infecting Pseudoalteromonas sp., and we propose, based on phylogenetic relationship and
genomic characteristics and structure, that together they could be part of a new genus on the
Myoviridae family. Additionally, we found the presence of two RNA viruses previously
proposed as important players regulating centric diatom bloom forming species, dominant in
the West Antarctic Peninsula. Further, we report for the first time the presence of a
Phaeocystis antarctica virus (PaV), which we propose to be infecting the Haptophyte P.
antarctica, one of the most important bloom forming organisms on Antarctica. We suggest
that this virus might have a relevant role on P. antarctica bloom decay and then impacting
on sulfur and carbon cycles in the Southern Ocean.

Acknowledgments
This work was supported by projects: Conicyt N DPI20140044 and FONDAP 15110009

References
Arrigo, K. R., Robinson, D. H., Worthen, D. L., Dunbar, R. B., DiTullio, G. R., VanWoert, M., & Lizotte, M.
P. (1999). Phytoplankton community structure and the drawdown of nutrients and CO2 in the Southern Ocean.
Science, 283(5400), 365-367.
Bergh, ., Brsheim, K. Y., Bratbak, G., & Heldal, M. (1989). High abundance of viruses found in aquatic
environments. Nature, 340(6233), 467-468.

42 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Takahashi, T., Sutherland, S. C., Sweeney, C., Poisson, A., Metzl, N., Tilbrook, B., ... & Olafsson, J. (2002).
Global seaair CO 2 flux based on climatological surface ocean pCO 2, and seasonal biological and temperature
effects. Deep Sea Research Part II: Topical Studies in Oceanography, 49(9), 1601-1622.
Yager, P. L., Connelly, T. L., Mortazavi, B., Wommack, K. E., Bano, N., Bauer, J. E., ... & Hollibaugh, J. T.
(2001). Dynamic bacterial and viral response to an algal bloom at subzero temperatures. Limnology and
Oceanography, 46(4), 790-801.

Figure 1. Taxonomic composition of viral populations on Chile Bay 2014 summer phytoplankton bloom.
Relative abundances of all viral reads were retrieved by metagenomics and metatranscriptomics from two
samples obtained under a low chlorophyll and a high chlorophyll period that were assigned against NAV
database. Only taxa with relative abundance > 1% are included, lower abundance taxa were grouped on others
category. Figura 1. Composicin taxonmica de poblaciones virales en la floracin del fitoplancton en la
Baha Chile en el verano de 2014. Las abundancias relativas de todas las lecturas virales fueron recuperadas
por metagenmica y metatranscriptmicas a partir de dos muestras obtenidas bajo un periodo de clorofila bajo
y alto que se asignaron contra la base de datos NAV. Slo se incluyen taxones con abundancia relativa> 1%
estn incluidos, los taxones de menor abundancia se agruparon en otras categoras.

43 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

POTENCIALES INDICADORES BACTERIANOS ANTE EL DERRETIMIENTO


DE HIELO GLACIAR EN BAHA CHILE, ANTRTICA
(Potential bacterial indicators of glacial meltwater injections at Bahia Chile, Antarctica)

Alcaman M.E.1, 2, Fuentes S.2, Testa G.1, Faras L.1, 3, Dez B.2, 3
1
Departamento de Oceanografa, Facultad de Ciencias Naturales y Oceanogrficas, Universidad de
Concepcin.2Departamento de Gentica Molecular y Microbiologa, Facultad de Ciencias Biolgicas,
Pontificia Universidad Catlica de Chile.3Centro de Ciencia del Clima y Resiliencia; CR2 Universidad de
Chile.

La composicin relativa y las capacidades fisiolgicas de las comunidades microbianas


marinas polares, estn sometidas a gradientes verticales muy fuertes de temperatura,
salinidad, luz, pH y nutrientes (Eicken, 1992; Arrigo & Sullivan, 1992), siendo afectadas de
una manera multifactica (Brettar et al., 2016), e influenciadas anualmente por ciclos
estacionales marcados y por propiedades del hielo marino y glaciares (Thingstad et al., 2008).
De acuerdo con esto, evidencia de una correlacin positiva entre la disminucin de la
salinidad y el aumento de la abundancia de picoeucariotas ha sido reportado para un bloom
estival en McMurdo, Antartica (Stoecker et al., 1990). Sin embargo, efectos similares de
cambios en salinidad y su efecto en la composicin de las comunidades microbianas, hasta
la fecha no se han develado. Baha Chile (62 27 60 S, 59 40 60 W) ubicada en la Isla
Greenwich de las islas Shetland del Sur (Antrtica) (Figura 1a), ha sido foco de nuestra
investigacin en los ltimos 5 aos (2013-2017). Un aparente gradiente de salinidad de agua
de mar superficial (Figura 1b) es posible observar desde aguas cercanas al glaciar hacia aguas
afuera de la baha, esperndose con ello cambios en la comunidad microbiana marina
superficial. Toma de muestras de agua de mar superficial (5m) para cada uno de los puntos
del gradiente de salinidad durante el periodo estival (Febrero-Marzo) durante los aos 2014-
2016, permitieron a travs de anlisis genmicos de secuenciacin por iTag del gen ARNr
16S, determinar la ubicuidad y dominancia de Bacteroidetes y Proteobacteria con un aumento
de los gneros Polaribacter y Sulfitobacter al disminuir la salinidad; mientras que en la
comunidad del hielo glaciar, otros gneros como Flavobacterium (Bacteroidetes) y miembros
de las Burkholderiales (-Proteobacteria) fueron dominantes. Las tasas de incorporacin de
15NH4Cl, K15NO3, H13CO3 y 15N2 a lo largo del gradiente de salinidad aumentaron en el
punto ms cercano al glaciar. Los altos valores de fijacin de C en el hielo son asociados a
la actividad bacteriana y Chlorophytas presentes. Adems, se realizaron ensayos de
microcosmos para evaluar el efecto de una disminucin en salinidad (~4 PSU), y
competencia de la comunidad microbiana proveniente del hielo glaciar sobre la del agua de
mar superficial una vez ocurrido el derretimiento. Despus de 7 das, la mezcla de
comunidades se mantiene con igual actividad asimiladora de N y C que el control de agua de
mar, pero la abundancia relativa de gneros como Polaribacter y Sulfitobacter aumentan con
la disminucin de la salinidad (Figura 2), corroborando los cambios naturales encontrados en
el gradiente en salinidad en la Baha. Estos resultados demuestran que la productividad del
sistema marino es resiliente ante la perturbacin, sugiriendo que algunos miembros de
Polaribacter y Sulfitobacter, pueden ser importantes indicadores de cambios en salinidad en
el sistema costero antrtico.

Agradecimientos

44 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Conicyt/Fondap 15110009 (CR)2; DPI20140044/Conicyt; Fondecyt Postdoctoral


N3170807. Patrocinado por la Universidad de Concepcin.

Referencias
Eicken, H. 1992. Salinity profiles of Antarctic sea ice: Field data and model results. J.
Geophys. Res. 97: 545-557.
Arrigo, K.R., Sullivan, C.W. 1992. The influence of salinity and temperature covariation on
the photophysiological characteristics of Antarctic sea ice microalgae. Journal of Phycology,
28, 746756
Brettar, I., Hfle, M., Pruzzo, C., Vezzulli, L. (2016). Climate Change and Microbial
Ecology; Ed: Marxsen, J. Academic Press.
Thingstad, T.F., R.G.J. Bellerby, G. Bratbak, K.Y. Brsheim, J.K. Egge, M. Heldal, A. et al..
2008. Counterintuitive carbon-to-nutrient coupling in an Arctic pelagic ecosystem. Nature
455, 387-390 doi:10.1038/nature07235
Stoecker D. K., Buck K.R., Putt, M. 1992. Changes in the sea-ice brine community during
the spring-summer transition, McMurdo Sound, Antarctica. I. Photosynthetic protists. Mar.
Ecol. Prog. Ser. 84: 265-278.

Figura 1. a) Ubicacin geogrfica de Baha Chile, Antrtica. b) Gradiente de salinidad en Baha Chile.
Figure 1. a) Geographical location of Baha Chile, Antarctica. b) Salinity gradient in Baha Chile.

45 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 2. Ensayo de microcosmos de cambios en salinidad. Dos diferentes ensayos incluyendo (P3 SW+ICE)
o no (P3 SW+ICE F) las comunidades del hielo revelan resiliencia de la comunidad del agua de mar ante la
perturbacin. T0/T7 representan el tiempo de incubacin, P3 SW control sin cambios de salinidad. Figure 2.
Test of microcosms of changes in salinity. Two different trials (P3 SW + ICE) or not (P3 SW + ICE F) glass
communities resolve the resilience of the seawater community to the disturbance. T0 / T7 represent the
incubation time, control of P3 SW without salinity changes.

46 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

RADIO SCIENCES RESEARCH ON ANTARCTIC ATMOSPHERE - RESOURCE


(Investigacin en radio ciencias en la atmsfera antrtica - RESOURCE)

Alfonsi L.1, Bergeot N. 2, Correia E.3,4, Gulisano A.5,6,7 and De Franceschi G.1
1
Instituto Nazionale di Geofisica e Vulcanologia, Italy, http://www.ingv.it. 2Royal Observatory of Belgium,
Belgium. 3 Instituto Nacional de Pesquisas Espaciais, Brazil. 4CRAAM, Universidade Presbiteriana
Mackenzie, Rua da Consolao 930, SP, Brazil. 5Instituto de Astronoma y Fsica del Espacio (UBA-
CONICET), Buenos Aires, Argentina. 6Departamento de Fsica and IFIBA, Facultad de Ciencias Exactas y
Naturales, Universidad de Buenos Aires (UBA), Buenos Aires, Argentina. 7Instituto Antrtico Argentino,
DNA, Buenos Aires, Argentina. E-mail: ecorreia@craam.mackenzie.br

RESOURCE is an international proposal for a Scientific Research Programme inside the


Scientific Committee of Antarctic Research (SCAR), with the purpose of gathering the
communities that investigate the atmosphere using radio probes at polar regions, particularly
in Antarctica. This program has as antecedent the research conducted by the Expert Group
GRAPE (GNSS Research and Application for Polar Environment) of SCAR, which has
demonstrated the potentialities of the GNSS data and expertise sharing to monitor and
observe the atmosphere.
The aim of this program is to provide insight on atmospheric processes, mainly ionosphere-
plasmasphere and troposphere contributions to understand the near-earth space environment
and to provide radio techniques to isolate this effects and help the radio devices users to
mitigate, calibrate and estimate the errors from these sources. The atmospheric processes
involved also modify the cosmic ray flux of particles at ground level, so these effects are also
important in a wider variety of instrumentation.
Several instruments working on radio frequencies are extensively used to probe the
atmosphere, such as VLF, VHF, UHF, and HF radars, GNSS receivers, radio beacons, and
microwave humidity sounders on satellites, and the use of them has generated valuable
knowledge on atmospheric physics at the poles and worldwide, but in order to address the
remaining open questions in the field it is necessary a synergy approach among different
research groups. It is the purpose of this paper to attract interested researchers in different
areas to join this initiative.
The Scientific Reasearch Programme RESOURCE will consolidate the important legacy
achieved by the EG-GRAPE by enhancing interactions between the scientists who measure
the Antarctic atmosphere with radio techniques. This paper aims to present RESOURCE and
to attract additional participants potentially interested to join the initiative.

References
Alfonsi, L., Cilliers, P.J., Romano, V., Hunstad, I., Correia, E., Linty, N., Dovis, F., Terzo, O., Ruiu, P., Ward,
J. and Riley, P., 2016. First Observations of GNSS Ionospheric Scintillations From DemoGRAPE Project.
Space Weather, 14(10), pp.704-709.
Bergeot N., J.-M. Chevalier, C. Bruyninx, G. Denis, T. Camelbeeck, T. Van Dam, O. Francis (2016), Study of
space weather impact on Antarctica ionosphere from GNSS data, Unlocking a continent: scientific research at
the Belgian Princess Elisabeth Station, Antarctica 2008-2016, BNCGG - BNCAR symposium, Brussels, April
29 2016.
Clilverd, M A, C J Rodger, N R Thomson, J B Brundell, Th Ulich, J Lichtenberger, N Cobbett, A B Collier, F
W Menk, A Seppl, P T Verronen, and E Turunen (2009), Remote sensing space weather events: the
AARDDVARK network, Space Weather, 7, S04001, doi: doi:10.1029/2008SW000412.

47 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Miao, J., K. Kunzi, G. Heygster, T. A. Lachlan-Cope, J. Turner, 2001: Atmospheric water vapor over Antarctica
derived from SSM/T2 data. J. Geophys. Res., 106, D10 (May 27), 10187--10203.
Terzo O., P. Ruiu, A. Scionti, L. Alfonsi, V. Romano, R. Romero, P. Cilliers, H. Theron, E. Correia, W. S.
Coura Borges, Cloud Computing Infrastructure for Polar GNSS e-Science applications, Session SCADM, "S35.
Data access and sharing for cutting edge science", XXXIV SCAR, Kuala Lumpur, 20-30 August 2016.

48 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

LAS COLECCIONES PALEONTOLGICAS Y GEOLGICAS


DEL INSTITUTO ANTRTICO ARGENTINO
(The Paleontological and Geological collections of the Instituto Antrtico Argentino)

Amenbar, C.R.1,2,3, Cparo, A. 1, Concheyro, A.1,2,3 Y J.M. Lirio1


1
Instituto Antrtico Argentino. 25 de Mayo 1151, 3 piso. CP 1650, San Martn, Buenos Aires, Argentina.
2
IDEAN Instituto de Estudios Andinos Don Pablo Groeber. Consejo Nacional de Investigaciones
Cientficas y Tcnicas. Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires. Pabelln II.
Ciudad Universitaria. CP 1428. Ciudad Autnoma de Buenos Aires, Argentina.
3
Departamento de Ciencias Geolgicas, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos
Aires, Argentina. E-mail. amenabar@gl.fcen.uba.ar; acuparo@hotmail.com; andrea@gl.fcen.uba.ar;
lirio@gmail.com

El Instituto Antrtico Argentino (IAA) fue creado el 17 de abril de 1951 por iniciativa del
Coronel Hernn Pujato ante la necesidad de la existencia de un organismo especializado que,
en forma permanente, orientara, controlara, dirigiera y ejecutara las investigaciones y
estudios de carcter cientfico-tcnico vinculados a las actividades antrticas argentinas. As
surgi el primer Instituto Antrtico del mundo, dedicado exclusivamente a las
investigaciones antrticas, que regula la actividad de ciencia y tecnologa que la Repblica
Argentina lleva a cabo en la Antrtida.
Desde su inicio, el IAA ha ido creciendo hasta ocupar una posicin destacada en los asuntos
antrticos y desde el verano de 1952/53 ha enviado regularmente investigadores y tcnicos a
este continente para realizar importantes actividades de investigacin en distintas reas de
las ciencias de la tierra, biolgicas, qumicas, de la atmsfera, del mar, medio ambiente,
psicologa antrtica y museo.
En el ao 1974 el IAA organiz la primera campaa antrtica de verano en el territorio
antrtico, y a partir de ese momento, continuaron desarrollndose casi ininterrumpidamente
campaas geolgico-paleontolgicas. En las sucesivas expediciones y hasta octubre de 2015,
los investigadores argentinos han recolectado miles de ejemplares fsiles y rocas. Los
mismos han sido depositados en prestigiosos museos, universidades e institutos de distintas
partes del pas, tales como el Museo Argentino de Ciencias Naturales Bernardino Rivadavia
(MACN), Museo de La Plata (UNLP), Universidad de Buenos Aires (UBA), Universidad
Nacional de Ro Negro (UNRN) y otros centros de investigacin. Estas instituciones albergan
colecciones que son estudiadas principalmente por sus investigadores y enmarcadas en
proyectos de investigacin propios. Hoy en da, algunos centros de investigacin priorizan el
resguardo de materiales que sus propios investigadores recolectan para su estudio,
disponiendo menos espacio para aquellos fsiles que no forman parte de la temtica de sus
investigaciones.
A partir de la adquisicin de la nueva sede del IAA, sito en el predio de la Universidad
Nacional de San Martn (UNSAM), y ante la necesidad de que el IAA contara con sus propias
colecciones, el 2 de octubre de 2015, se crea el primer Repositorio Antrtico de Colecciones
Paleontolgicas y Geolgicas del Instituto Antrtico Argentino (RAA). De esta forma, hoy
la institucin cuenta con un repositorio propio, de alcance internacional, con sus colecciones
preservadas, protegidas y tuteladas, con su propia base de datos lo que le permite administrar
con mayor eficacia los fsiles y rocas colectadas en las campaas antrticas y dirigir mejor
sus estudios cientficos.

49 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

El nuevo repositorio antrtico concentra la informacin de rocas y fsiles hallados en la zona


geogrfica que se encuentra al sur del paralelo 60 de latitud sur y colectados por
investigadores argentinos en sus campaas antrticas realizadas ininterrumpidamente cada
verano como parte del Plan Antrtico Anual elaborado por el IAA. Su presentacin oficial
ante la comunidad cientfica se realiz en un simposio sobre preservacin de colecciones
paleontolgicas en el marco del 11 Congreso de la Asociacin Paleontolgica Argentina,
desarrollado en la provincia de Ro Negro, Argentina, en octubre de 2016 (Amenbar et al.,
2016).

Repositorio Antrtico de Colecciones Paleontolgicas y Geolgicas del Instituto Antrtico Argentino.


Universidad Nacional de San Martn (UNSAM), Av. 25 de Mayo 1143, San Martn, Provincia de Buenos
Aires (CP 1650). Antarctic Repository of Paleontological and Geological Collections of the Argentinean
Antarctic Institute. National University of San Martn (UNSAM), Av. 25 de Mayo 1143, San Martn,
Province of Buenos Aires (CP 1650).

El RAA tiene como objetivo principal brindar el adecuado cuidado y puesta en valor de las
colecciones que lo conforman, implementando un protocolo para la conservacin y manejo
de los materiales coleccionados, colocando a disposicin del pblico la informacin existente
para que se sientan partcipes de la gran tarea que implica el conservar nuestro patrimonio
ms preciado -la naturaleza- y por lo tanto, estn convencidos de que su inters y
participacin permitirn mantener esa herencia natural que debemos dejar para las
generaciones futuras. De este modo, el material depositado en el RAA, representar una
excelente muestra de la diversidad paleontolgica y geolgica del continente Antrtico.
Como objetivos especficos se sealan los siguientes:
- Preservar fsiles y rocas colectados por los proyectos de investigacin argentinos y/o de
cooperacin internacional en la Antrtida.
- Mejorar la eficiencia en la recoleccin de informacin de las campaas paleontolgicas y
geolgicas.
- Fortalecer el conocimiento paleontolgico y geolgico antrtico, a travs del estudio de sus
materiales y de publicaciones cientficas.
- Difundir el conocimiento, a nivel nacional e internacional, mediante una base de datos que
est disponible para los investigadores, como as tambin a travs de exposiciones, talleres

50 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

o compartiendo informacin entre instituciones.


- Poner a disposicin de los investigadores de nuestro pas y del extranjero las colecciones
de fsiles y de rocas del continente antrtico a travs de prstamos, consultas, canje, moldes
y copias del material.
- Coordinar, mantener y actualizar datos relacionados con las actividades cientficas
realizadas por Argentina en la Antrtida.

Resultados
El RAA cuenta con dos grandes colecciones cientficas, la paleontolgica y la geolgica,
cuyos acrnimos son las siguientes:
Coleccin Geolgica Acrnimo
Coleccin de Rocas
Rocas gneas IAA-RI
Rocas Metamrficas IAA-RM
Rocas Sedimentarias IAA-RS
Rocas Piroclsticas IAA-RP
Coleccin de Minerales IAA-Mn
Coleccin Paleontolgica Acrnimo
Coleccin de Micropaleontologa IAA-Mi
Coleccin de Palinologa IAA-Pl
Coleccin de Paleobotnica IAA-Pb
Coleccin de Paleoinvertebrados IAA-Pi
Coleccin de Paleovertebrados IAA-Pv
Coleccin de Icnologa IAA-Icn

Tambin se cuenta con una coleccin didctica y de exhibicin que consiste en fsiles de
vertebrados, invertebrados, plantas e icnofsiles. Asimismo el RAA alberga sedimento para
anlisis micropaleontolgico-palinolgico y para la extraccin de restos microscpicos de
vertebrados. La Figura 1 muestra los porcentajes de cada coleccin cientfica paleontolgica,
y en la Figura 2 se presentan los porcentajes de ejemplares de cada coleccin por localidades.
Gran cantidad de material fsil se encuentra actualmente en estudio, en calidad de prstamo
y ser devuelto al RAA, una vez finalizado su estudio y publicados los resultados. Algunas
de las publicaciones realizadas hasta el momento con material depositado en el RAA incluyen
un trabajo sobre flora fsil de la Isla James Ross (Iglesias, 2016) y una tesis de Doctorado
sobre bivalvos de la Isla Marambio (Alvarez, 2017).
La coleccin geolgica posee an escasos ejemplares; sin embargo, aumentar con la
incorporacin de rocas y cortes petrogrficos.

51 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 1. Cantidad de ejemplares (en %)


por coleccin.Figure 1. Number of copies
(in%) per collection.

Figura 2. Cantidad de
ejemplares (en %) por
coleccin y por localidad.
Figure 2. Number of copies
(in%) by collection and by
location.

El RAA cuenta con un Reglamento de Manejo de Colecciones que puede ser consultado en
el sitio web oficial de la Direccin Nacional del Antrtico. En l se detalla toda la
documentacin necesaria y los pasos requeridos para realizar la consulta de material,
prstamos, donacin y canje de materiales, moldes y copias. El Reglamento de Manejo tiene
como objetivos:
1. Brindar los lineamientos necesarios para conservar, preservar y mantener de la mejor
manera posible el patrimonio fosilfero, rocas y minerales existentes en el RAA, as como
procurar la incorporacin de material nuevo. 2. Proveer el adecuado cuidado y puesta en
valor de las colecciones que conforman el RAA dada su importancia tanto cientfica como
educativa.

Conclusiones
El RAA es un centro de referencia taxonmica y reservorio de valiosas colecciones
paleontolgicas y geolgicas antrticas. Mediante la existencia del repositorio no slo se
preserva, protege, tutela y recupera el patrimonio paleontolgico y geolgico antrtico, sino
que tambin se fomenta la investigacin logrando una mayor visibilidad y difusin, a nivel
nacional e internacional, de las tareas cientficas que Argentina realiza en el continente
antrtico.

Agradecimientos
Al Instituto Antrtico Argentino, a los Dres. Coria y Reguero y abogados Dres. Penalta y
Perlini.

52 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Referencias
Alvarez, M. 2017. Anlisis sistemtico y filogenia de las subfamilias Tapetinae H. & A. Adams, 1857 y
Pitariinae (Bivalvia: Veneridae) del Cenozoico de Argentina y Antrtida. Universidad de Buenos Aires.
Amenbar, C.R., Cparo, A., Lirio, J.M., Concheyro, A., Reguero, M., Coria, N. 2016. Puesta en valor del
patrimonio paleontolgico antrtico: creacin del Repositorio de colecciones paleontolgicas y geolgicas del
Instituto Antrtico Argentino. 11 Congreso de la Asociacin Paleontolgica Argentina, General Roca,
provincia de Ro Negro. Libro de resmenes: 145-146.
Iglesias, A. 2016. New Upper Cretaceous (Campanian) flora from James Ross Island, Antarctica. Ameghiniana
53(3): 358-374. Sitio web oficial de la Direccin Nacional del Antrtico: http://www.dna.gov.ar/
FLOW VELOCITIES AND SNOW ACCUMULATION DYNAMICS AT UNION
GLACIER, ELLSWORTH MOUNTAINS, ANTARCTICA
(Dinmica de velocidad de flujo y acumulacin de la nieve del Glaciar Unin, Montaas
Ellsworth, Antrtica)

Arigony-Neto, J.1,2, Gomez, R.1,2, Goebel, C.1,2, Jaa, R.3,2 and J. Espinoza4,2
1
Instituto de Oceanografia, Universidade Federal do Rio Grande, Av. Itlia km 8, Rio Grande, Brazil. E-mail:
jorgearigony@furg.br. 2 Instituto Nacional de Cincia e Tecnologia da Criosfera, Brazil. 3 Instituto Antrtico
Chileno, Plaza Muoz Gamero 1055, Punta Arenas, Chile. E-mail: rjana@inach.cl. 4 Instituto Federal do Rio
Grande do Sul, Brazil.

Antarctica has an important role in regulate the global climate. The complexities of the heat
exchange and the interaction of ice shelves and land ice with the ocean and atmosphere make
prediction about climate change a challenge. Mass balance studies assess the contribution of
the ice sheet to the ocean. Therefore, to estimate accurately how the Antarctic Ice Sheet is
going to react to climate change in the future, it is very important a precise quantification of
both: the incoming mass by accumulation processes as precipitation and wind transported
snow, and the outcoming mass transport by dynamic flow of ice.
The Union Glacier is one of the major outlet glaciers of the southern part of the Ellsworth
Mountains in the Western Antarctic Ice Sheet, draining its ice mass into the Constellation
Inlet, which is part of the Ronne-Filchner Ice Shelf. The Ronne-Filchner Ice Shelf is the
second biggest ice shelf of Antarctica (443.140 km2), and is losing 115,4 45 Gt year-1 of
ice via basal melting (Rignot et al., 2013). Furthermore, there is some concerns about the
possibility of collapse of this ice shelf because of oceanic warming during the XXI century
(Hellmer et al., 2012). Union Glacier has a total length of 86 km from the upper divisor with
the Institute Ice Stream to its grounding line at Constellation Inlet, with an area of 2561 km2
(Rivera et al., 2010). The glacier valley is oriented southeast-northwest with several small
tributaries draining into it.
Few works on the glacier dynamics suggest a near steady state of Union Glacier, with a mean
surface mass balance of 0.18 m year-1 (Rivera et al., 2010; 2014), obtained from stakes
measurements on central valley. Others works with climate models and interpolation of field
data range the estimation between 0.2-0.33 m year-1 (Van de Berg et al., 2006; Arthern et al.,
2010). But no study aim to consider the local variability in snow accumulation as well as
distinct densification processes driven by wind exposure. Since this parameters will impact
on surface mass balance and in last case in the mass balance budget of its glacial drainage
basin.
Moreover, satellite backscattering measurements from a pair of high resolution SAR satellite
images allow for the estimation of surface flow velocities. Surface velocity allows to infer

53 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

shear stresses, basal friction and mass balance. This information can be used as input to ice
sheet models that can help understand glacier ice dynamics and how it could respond to
changes in climate.
This paper shows the spatial dynamics of flow velocities and snow accumulation on the
surface of Union Glacier, Antarctica, as estimated by using a synergic approach based on
SAR imagery and field measurements.

Methods
Surface velocity flow maps for two time periods were generated based on two pairs of
Cosmo-SkyMed HIMAGE, with 5 m spatial resolution. All 4 images were acquired between
December 2011 and January 2012. The surface velocities were calculated using an offset
tracking algorithm implemented within Gamma-SAR software (Werner et al., 2000).
Velocity fields were geocoded using the DLR TanDEM-X 12 m resolution digital elevation
model. Velocity data was compared with measurements of glacier displacement made using
a Leica DGPS during the field campaign carried out in December 2011 and January 2012.
X-band backscattering information of the COSMO-SkyMed imagery was also used in a
correlation analysis together with data from 7 snow pits dug and analysed during the
fieldwork of summer 2011/2012. The resulting relationship between backscattering and snow
parameters can be used for estimating snow density and grain size from X-band Cosmo-
SkyMed data. Two automatic weather stations (AWSs) are also measuring weather
parameters and snow accumulation in two sectors of Union Glacier. The first AWS was
installed in 2013 and the second one in 2015.

Results
The estimated glacier surface velocities (Figure 1) showed an agreement with previous
studies (Rivera, 2010; 2014) and field measurements by the authors, but showed areas with
velocity values one order of magnitude higher than measured in the field. This faster flowing
ice was found over the steepest and narrower parts of the glacier. Mean values of glacier
surface flow was estimated in 11.2 m year-1 with values ranging from near 0 to 102.5 m year-
1
(Figure 1).
Data from the automatic weather station installed in 2013 showed a total annual accumulation
of 627 mm of snow height for 2014, 428 mm during 2015, and 405 mm for 2016. During the
three years, the dominant wind direction was SW, with mean annual wind speeds of 11.98
km h-1 (2014), 13.96 km h-1 (2015), and 14.45 km h-1 (2016). The mean annual temperature
was -21.68 C (2014), -22.07 C (2015) and -20.76 C (2016).
Results from analysis of density and grain size maps, together with stratigraphic profiles from
snow pits and the main characteristics of wind direction and snow accumulation confirmed
a distinct pattern of snow deposition and densification along the glacier. Wind exposed areas
have larger grains of snow (i.e., 1-4 mm against 0.5-1 mm in wind protected areas), faceted
forms due to higher exposure to temperature gradient, more deposition layers and layers with
higher hardness. A cluster analysis was then realized using the snow density and grain size
maps and products derived from the digital elevation model (i.e., slope, aspect, wind effect)
for identifying spatially the different patterns of snow accumulation (Figure 2).

Conclusions
The findings of such a slow glacier reaffirms the idea of a glacier with a frozen bed (Rivera,
2014) and that the flux is mainly driven by ice creep. But because of Rutford ice stream acts

54 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

as a barrier for the ice flowing from the Union glacier into the Ronne ice shelf, being not only
held by the ice shelf but also by the ice stream, this affirmation should be treated cautiously.
Maps of the different patterns of snow accumulation derived from X-band SAR imagery
show a potential for explaining the influence of the topographic settings on snow transport
and accumulation. The next steps involve calibrating GPR transects in order to estimate the
rate of accumulation events in the depositional mapped zones.
Acknowledgments
Activities described here are part of the CNPq project number 461414/2014-7. Brazilian
National Institute for Cryospheric Science and Technology (INCT da Criosfera) and Instituto
Antrtico Chileno (INACH) are kindly acknowledged by provision of resources needed for
Brazilian-Chilean scientific collaboration. Chilean Air Force, Army, Navy and Direccin
Meteorolgica personnel at Estacin Cientfica Conjunta Glaciar Unin, are recognised for
logistical support provided during campaigns at Union Glacier. Italian Space Agency and
German Aerospace Centre allowed the access for Cosmo-SkyMed imagery and TanDEM-X
digital elevation models.

Figure 1: Union glacier surface velocity in magnitude (A) and flow direction (B) as estimated by a pair of
Cosmo-SkyMed images acquired during the austral summer of 2011/2012. Figura 1: Velocidad superficial
del Glaciar Union en magnitud (A) y direccin de flujo, estimada con el uso de imagenes Cosmo-SkyMed
obtenidas en el verano 2011/2012.

55 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figure 2: Different patterns of snow accumulation as a result of cluster analysis using the snow density and
grain size maps and products derived from the digital elevation model (i.e., slope, aspect, wind effect). Cluster
classes from dark green to light green are showing sectors more or less exposed to wind. The map also shows
the sites where field measurements were carried out. Figura 2: Distintos patrones de acumulacin de nieve
como resultado de anlisis de cluster usando los mapas de densidad y tamao de grano de la nieve y productos
generados con el modelo digital de elevacin (i.e., declividad, direccin, efecto del viento). Clases del cluster
del verde oscuro al claro mostrando sectores ms o menos expuestos al viento. El mapa tambin muestra
sitios donde se hizo las mediciones de terreno.

References
Hellmer, H. H., F. Kauker, R. Timmermann, J. Determann and J. Rae. 2012. Twenty-first-century warming of
a large Antarctic iceshelf cavity by a redirected coastal current. Nature, 485, 225228.
Rignot, E., S. Jacobs, J. Mouginot, and B. Scheuchl. 2013. Ice-Shelf Melting Around Antarctica. Science, 341
(6143): 266-270.
Rivera, A., R. Zamora, C. Rada, J. Walton, and S. Proctor. 2010. Glaciological Investigations on Union Glacier,
Ellsworth Mountains, West Antarctica. Annals of Glaciology, 51 (55): 9196.
Rivera, A. R. Zamora, Uribe, J., Jaa, R., and J. Oberreuter. 2014. Recent ice dynamic and surface mass balance
of Union Glacier in the West Antarctic Ice Sheet. The Cryosphere, 8: 1445-1456.
Werner, C., Wegmller, U., Strozzi, T., and A. Wiesmann. 2000. Gamma SAR and interferometric processing
software, in: Proc. ERS-ENVISAT Symposium, Gothenburg, Sweden, 1620 October 2000.

56 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

CARACTERIZACIN TAXONMICA DE ECTOPARSITOS DE Notothenia


coriiceps (RICHARDSON, 1844) EN LA PENNSULA ANTRTICA CHILENA
(Ectoparasites Taxonomy Characterization of Notothenia coriiceps (Richardson, 1844) in
Chilean Antarctic Peninsula)

Aros, V.1, Crdenas, L.2, Veliz, P.2 y Valdivia, I.1


1
Centro de Estudios del Cuaternario Fuego Patagonia y Antrtica (CEQUA), Espaa 184, Punta Arenas,
Chile. 2Universidad Austral de Chile, Instituto de Ciencias Ambientales y Evolutivas, Valdivia, Chile.

Entendiendo el parasitismo, como una relacin ecolgica donde hay dependencia fisiolgica
del parsito hacia el hospedador (de Vienne et al., 2013) y que cumple un rol ecolgico
importante (Marcogliese, 2004), ya que por lo menos un 50% de las especies del planeta son
consideradas parsitas (Price, 1980; Windsor, 1998), es necesario, en primera instancia,
conocer la composicin de la biodiversidad que est presente en los ecosistemas en general.
Actualmente, la informacin es escasa sobre la fauna parasitaria presente en la Antrtica, ms
an, en ectoparsitos. Aunque hay reportes de presencia de ectoparsitos, y trabajos con
morfologa tradicional que identifican estas especies, no existen trabajos con anlisis
moleculares.
La diversidad de peces en la Antrtica est dominada por el suborden Notothenioidei del
orden Perciformes, constituyendo el 77% de la diversidad presente en la plataforma
continental antrtica (Eastman, 2005). Notothenia coriiceps (Richardson, 1844), es una
especie endmica de la Antrtica, y representa junto a otros notothenioides la mayor
abundancia en aguas poco profundas de la pennsula, cumpliendo un rol significativo dentro
de este ecosistema (White & Burren 1992; Palm et al., 1998).
El objetivo de este estudio, es caracterizar taxonmica y molecularmente los ectoparsitos
encontrados en N. coriiceps utilizando dos mtodos que son complementarios entre s,
taxonoma clsica a travs de imgenes de microscopa electrnica y sistemtica molecular
con dos marcadores nucleares.

Materiales y Mtodos
Se recolectaron los parsitos desde 72 ejemplares de N. coriiceps, los que fueron capturados
en Baha Fildes (621257S - 585735O) e islote Isabel Riquelme de la rada
Covadonga (631915S - 575355O), Pennsula Antrtica, en la expedicin ECA52 -
2015, del Instituto Antrtico Chileno (INACH), entre los meses de Enero y Febrero.
La bsqueda de ectoparsitos, se realiz en primer lugar lavando al pez sobre un tamiz con
agua destilada, especialmente en la cabeza, branquias y aletas. Luego, bajo microscopio
estereoscpico se revis el material tamizado, separando cuidadosamente los parsitos. Los
especmenes fueron almacenados en alcohol absoluto, para su preservacin y posterior
anlisis molecular y aquellos seleccionados para ser fotografiados con microscopa
electrnica, guardados en glutaraldehdo.
La extraccin de ADN, se realiz con el Kit comercial E.Z.N.A tissue, que tiene un protocolo
estndar para tejidos biolgicos, sin embargo, se adecuaron algunos reactivos para una mejor
extraccin. Se amplific el gen 18S rRNA, usando partidores y protocolos obtenidos desde
Hall et al., (1999) y para el gen 28S rRNA desde Mollaret et al., 2000 y Le et al., 1993.

57 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

El producto de PCR, fue secuenciado en Macrogen, Seoul, Korea (www.macrogen.com). Las


secuencias fueron editadas y alineadas (creando una hebra consenso) con el programa
Geneious versin 10.2 (http://www.geneious.com). Se realiz una bsqueda por similitud en
la base de datos del NCBI (www.ncbi.nlm.nih.gov) usando el programa Blast. La
reconstruccin filogentica se hizo con el programa Mega v6.0 utilizando las aproximaciones
de Maximum Composite Likelihood (ML) y Neighbor Joining (NJ) con 1.000 bootstrap de
rplicas como soporte de nodos, realizando una bsqueda del mejor modelo evolutivo para
cada gen.

Resultados
Se analizaron un total de 42 peces Notothenia coriiceps en islote Isabel Riquelme de la rada
Covadonga y 30 en Baha Fildes. Los anlisis taxonmicos, se realizaron utilizando claves y
descripciones especializadas de parsitos registrados en peces del suborden Notothenioidei.
Clasificamos los ectoparsitos encontrados en clase Hirudinea, de la familia Piscicolidae,
concretamente Notobdella nototheniae (Figura 1, letra C) y clase Monogenea, familia
Capsalidae, especie Pseudobenedenia nototheniae (Figura 2, letra F).
En los anlisis moleculares, se analizaron un total de 5 individuos Hirudineos, de los cuales
se obtuvieron 5 secuencias para el gen 18S rRNA (ver Fig. 1) con un largo de base de 314
pb y 4 secuencias para el gen 28S rRNA (ver Fig. 1) con un largo de 403 pb. Para
Monogeneos un total de 5 individuos, de los cuales se obtuvieron 5 secuencias para el gen
18S rRNA (ver Fig. 2) con un largo de base de 432 pb y 4 secuencias para el gen 28S rRNA
(ver Fig. 2) con un largo de 886 pb. Desde NCBI, se usaron secuencias como grupos internos
y externo para ambas clases de ectoparsitos.
Como resultados preliminares, obtuvimos dos secuencias de individuos del orden Ispoda,
del gnero Gnathia. Ambas reconstrucciones filogenticas para Hirudineos son congruentes
entre s, al reunir nuestras secuencias (Fig. 1 A y B) en un mismo clado. Slo para el gen 18S
rRNA, existen secuencias disponibles en la base de datos de Notobdella nototheniae, las que
se reunieron con nuestras secuencias con un alto soporte de nodo (70/75). En las
reconstrucciones filogenticas de Monogeneos (Figura 2, D y E), tanto para el gen 18s rRNA
y 28S rRNA, nuestras secuencias se reunieron en un solo clado, con un porcentaje para ambos
genes y aproximaciones de 100%.

58 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 1. A y B = Reconstrucciones filogenticas basadas en el gen 18srRNA y 28SrRNA para Hirudineos


respectivamente. Sobre las diagonales las aproximaciones de Maximum Likelihood/Neighbor-Joining y sus
valores de bootstrap. En negro secuencias obtenidas desde la base de datos NCBI. C= Fotografa en
Microscopa Electrnica de Barrido de un Hirudineo obtenido desde N. coriiceps en la Antrtica Chilena.
Figure 1. A and B = Phylogenetic reconstructions based on the 18srRNA and 28SrRNA gene for Hirudineos
respectively. On the diagonals the Maximum Likelihood / Neighbor-Joining approximations and their
bootstrap values. In black sequences obtained from the NCBI database. C = Photograph in Scanning Electron
Microscopy of a Hirudineo obtained from N. coriiceps in the Chilean Antarctic.

Figura 2. D y E = Reconstrucciones filogenticas basadas en el gen 18srRNA y 28SrRNA para Monogeneos


respectivamente. Sobre las diagonales las aproximaciones de Maximum Likelihood/Neighbor-Joining y sus
valores de bootstrap. En negro secuencias obtenidas desde la base de datos NCBI. F= Fotografa en
Microscopa Electrnica de Barrido de un Monogeneo obtenido desde N. coriiceps en la Antrtica chilena.
Figure 2. D and E = Phylogenetic reconstructions based on the 18srRNA and 28SrRNA gene for
Monogeneos respectively. On the diagonals the Maximum Likelihood/Neighbor-Joining approximations and
their bootstrap values. In black sequences obtained from the NCBI database. F = Photograph in Scanning
Electron Microscopy of a Monogeneo obtained from N. coriiceps in the Chilean Antarctic.

Discusin y Conclusiones
La identificacin taxonmica realizada, junto al gen 18S rRNA, concuerdan en clasificar al
Hirudineo encontrado como Notobdella nototheniae. Sin embargo, para nuestro rbol
filogentico del gen 28S rRNA (Fig.1 B), no existen secuencias de esta especie en Genbank,
las que ayudaran a robustecer nuestro anlisis. En relacin a los ectoparsitos Monogeneos
(Fig. 2), luego un acucioso anlisis taxonmico concluimos que estamos en presencia
Pseudobenedenia nototheniae. No obstante, como en el caso de los Hirudineos, no existen
secuencias en la base de datos de esta especie para los genes utilizados en este estudio. Por
lo tanto, es necesario realizar ms anlisis moleculares, con otros genes en estos
ectoparsitos, para poder, rectificar nuestra clasificacin taxonmica y reforzar el anlisis

59 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

molecular, dado que existen secuencias con otros genes en la base de datos de NCBI para
nuestros ectoparsitos.

Agradecimientos
Proyectos Fondecyt 11161094 e INACH RT 22-14

Referencias
De Vienne, D., Refregier, G., Lopez-Villacncio, M., Tellier, A., Hood, M. E. & Ggiraud, T. 2013. Cospeciation
vs host-shift speciation: methods for testing, evidence from natural associations and relation to coevolution.
New Phytologist, 198, 347-385.
Eastman, J. & Eakin, R. 2000. An updated species list for notothenioid fish (Perciformes; Notothenioidei), with
comments on Antarctic species. Archive of Fishery and Marine Research, 48(1), 11-20.
Hall, K. A., Cribb, T. H., & Barker, S. C. 1999. V4 region of small subunit rDNA indicates polyphyly of the
Fellodistomidae (Digenea) which is supported by morphology and life-cycle data. Systematic
Parasitology, 43(2), 81-92.
Le, H. Lecointre, G., & Perasso, R. 1993. A 28S rRNA-based phylogeny of the gnathostomes: first steps in the
analysis of conflict and congruence with morphologically based cladograms. Molecular phylogenetics and
evolution, 2(1), 31-51.
Marcogliese, D. J. 2004. Parasites: small players with crucial roles in the ecological theater. EcoHealth, 1(2),
151-164.
Mollaret, I., Jamieson, B., & Justine, J. 2000. Phylogeny of the Monopisthocotylea and Polyopisthocotylea
(Platyhelminthes) inferred from 28S rDNA sequences. International Journal for Parasitology, 30(2), 171-185.
Palm, H., Reimann, N., Spindler, M. & Pltz, J. 1998. The role of the rock cod Notothenia coriiceps Richardson,
1844 in the life-cycle of Antarctic parasites. Polar Biology, 19(6), 399-406.
Price, P. W. 1980. Evolutionary biology of parasites (Vol. 15). Princeton University Press.
White, M. & Burren, P. 1992. Reproduction and larval growth of Harpagifer antarcticus Nybelin (Pisces,
Notothenioidei). Antarctic science, 4(04), 421-430.
Windsor, D. A. 1998. Controversies in parasitology, Most of the species on Earth are parasites. International
Journal for Parasitology, 28(12), 1939-19.

60 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ANLISIS DE LA ACTIVIDAD ANTIMICROBIANA Y ESTRUCTURAL DEL


HOMOPPTIDO DE ARGININA POR UN SCAN-PRO SISTEMTICO.
(Structural and Antibacterial Activity Analyses of Arginine Homopeptides by a Systematic
Proline Scan)

Arstica M.1, Guzmn F.2, Rojas R.1*, Ojeda C.2, Marshall S.3, Aguilar L.1, Carvajal P4.
1:
Instituto de Qumica, Pontificia Universidad Catlica de Valparaso (PUCV). Av. Universidad 330,
Valparaso, Chile. 2: Ncleo de Biotecnologa Curauma, PUCV. 3: Instituto de Biologa, PUCV. 4: Escuela de
Alimentos, PUCV. Correo: monica.arostica@gmail.com.

Los pptidos antimicrobianos (AMPs) son pptidos pequeos catinicos que juegan un rol
importante en el sistema inmune y han surgido como una alternativa a los antibiticos
convencionales debido a los bajos niveles de resistencia y citotoxicidad que presentan, el
origen de estos pptidos son muy variados, siendo el territorio antrtico una fuente de AMPs
novedosos debido a las condiciones extremas que resisten permitiendo ser una herramienta
adicional para el uso de estos pptidos en la conservacin y preservacin sobretodo en la
industria alimenticia. En estudios anteriores realizados en el Laboratorio de diseo y sntesis
de pptidos, se determin que el homopptido de Arginina de 11 residuos presenta actividad
antibacteriana en un amplio rango de cepas (Guzmn 2013), entrando en contacto con la
bacteria internalizndose en ella y adems de presentar una actividad adicional
anticongelante. La estructura secundaria que este homopptido presenta al entrar en contacto
con extractos de membranas bacterianas, se determin por dicrosmo circular (CD)
mostrando que presenta una propensin a la estructura de tipo hlice Poliprolina II (PPII).
En general, los AMPs son heteropptidos, presentando limitaciones a la hora de comprender
el rol que cumple cada aminocido en la secuencia al interaccionar con distintas membranas
bacterianas, es por esto que el homopptido de arginina, adquiere un rol relevante en el
estudio de las interacciones con las bacterias, debido a que las secuencias repetitivas permiten
un mejor reconocimiento de la interaccin de estos pptidos penetrantes. Este estudio busca
determinar las posiciones claves en la secuencia peptdica para poder potenciar y mejorar el
mecanismo de accin de este homopptido, por medio de un Scanning de Prolina (Scan-Pro)
simple, doble y triple que busca determinar las posiciones en donde la rigidez de la hlice es
importante para interaccionar con la bacteria y obtener de esta forma modelos de
heteropptidos funcionales con caractersticas determinadas para potenciar su efecto
antibacteriano.

Parte Experimental
Sntesis de los pptidos: El proceso de sntesis para todas las series de Scan-Pro Arginina de
11 residuos (Tabla 1), se llev a cabo utilizando la estrategia Fmoc lineal empleando el
mtodo en bolsas de polipropileno segn metodologa de Houghten (Carvajal 2016). Se
utilizaron bolsitas de 3x3.2 cm con 100 mg de resina Rink Amida de sustitucin 0.59 meq/gr
de resina. La caracterizacin y purificacin se realiz por HPLC y espectrometra de masas.
Preparacin de Liposoma: El extracto de Bacteria se obtuvo por sonicacin, centrifugacin
y finalmente obtencin de la fraccin polar del extracto que fue llevada a un proceso de
congelado y descongelado con nitrgeno lquido para finalmente agregarla al extrusor y
obtener un LUV del extracto de bacteria. Determinacin de la estructura secundaria: La
estructura se determin incubando el pptido con el extracto bacteriano a 37C por 1 hr. y

61 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

luego se midi la estructuracin del pptido en el medio por CD a 37C con un barrido de
190 a 250 nm.
Ensayo Antibacteriano: Se analiz la actividad antibacteriana determinando su mnima
concentracin inhibitoria (MIC), por ensayo en microplaca a tres concentraciones de pptido
10, 20 y 30 M en TSB para dos cepas una Gram positiva Staphylococcus aureus ATCC
25923 (ISP, Chile) y una Gram negativa Escherichia coli ATCC 25922 (ISP, Chile).

Pptido Secuencia Pptido Secuencia


P1 PRRRRRRRRRR R11 RRRRRRRRRRR
P2 RPRRRRRRRRR P1.11 PRRRRRRRRRP
P3 RRPRRRRRRRR P1.6.11 PRRRRPRRRRP
P4 RRRPRRRRRRR P2.10 RPRRRRRRRPR
P5 RRRRPRRRRRR P2.6.10 RPRRRPRRRPR
P6 RRRRRPRRRRR P3.9 RRPRRRRRPRR
P7 RRRRRRPRRRR P3.6.9 RRPRRPRRPRR
P8 RRRRRRRPRRR P4.8 RRRPRRRPRRR
P9 RRRRRRRRPRR P4.6.8 RRRPRPRPRRR
P10 RRRRRRRRRPR P5.7 RRRRPRPRRRR
P11 RRRRRRRRRRP P5.6.7 RRRRPPPRRRR
Tabla 1.- lista de pptidos sintetizados. Table 1.- List of synthesized peptides.

Resultados y Discusin
La estructura secundaria se determin en dos medios: LUV de extracto de Staphylococus
aureus y Escherichia coli. El Homopptido de Arginina de 11 residuos (R11) en el extracto
de bacteria Gram negativa presenta la mayor propensin a la hlice de Poliprolina II (PPII).
Al realizar modificaciones simples de Pro el extracto de Escherichia coli es el que se ve ms
afectado perdiendo su estructuracin en 3 sustituciones (P6, P7 y P9). Las sustituciones
dobles y triples presentan el mismo efecto en los dos medios estudiados que al realizar las
modificaciones la estructuracin PPII se pierde totalmente.
Los ensayos bacterianos muestran que la bacteria Gram positiva es ms susceptible,
disminuyendo su actividad, al realizar las sustituciones sistemticas de prolina comparado
con su homopptido de 11 residuos (R11). Para el Scan-Pro simple se evidencia un aumento
en el MIC en las posiciones 10 y 11 (P10 y P11) evidenciando el rol que juega la Arg en el
extremo carboxilo terminal, al realizar las sustituciones triples en P2.6.11 y P4.6.8 se pierden
totalmente su actividad antibacteriana contrastndose con lo visto en su estructura secundaria
donde pierde su conformacin. Para la bacteria Escherichia coli las modificaciones de
arginina por prolina no producen cambios significativos en la actividad comparado con R11.
La estructuracin PPII es importante en la interaccin del pptido con la membrana, pero al
entrar en la bacteria, esta se pierde y se puede deber principalmente a la flexibilidad que
presenta R11 y la interaccin que puede presentar con determinados blancos internos
moleculares. Las bacterias Gram positivas no presentan una pared celular a diferencia de las
Gram negativas lo que podra explicar la mayor susceptibilidad que presenta.

Conclusin

62 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Este estudio permiti determinar la relacin estructura y funcin antibacteriana que presenta
el homopptido de Arginina de 11 residuos y determinar las posiciones clave de su
interaccin en dos modelos de membrana en donde se determin que el extremo carboxilo es
una posicin importante en la actividad antibacteriana donde se puede potenciar su actividad
como futuro modelo de heteropptido funcional.

Agradecimientos
Proyecto Fondecyt 1140926. *Beca Doctorado PUCV.

Referencias
Guzman F. 2013. Inhibitory effect of short cationic homopeptides against Gram-positive bacteria. Journal of
Peptide Science 19 (12): 792-800.
Carvajal P. 2016. Inhibitory effect of short cationic homopeptides against Gram-negative bacteria. Aminoacid
48 (6):1445-1456.
Houghten R. 1985. General method for the rapid solid-phase synthesis of large numbers of peptides: specificity
of antigen-antibody interaction at the level of individual amino acids. Inmunology, 82 (15): 5131-51352.

63 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

CARACTERIZACIN DE DOS OXIDASAS DEPENDIENTES DE COBRE


PRESENTES EN EL TERMFILO ANTRTICO GEOBACILLUS SP. ID17
(Characterization of two copper dependent oxidases present in the Antarctic thermophile
Geobacillus sp. ID17)
Atalah, J.1, Muoz P.A.1, Blamey, J.M. 1
1
Fundacin Biociencia, Jos Domingo Caas 2280, uoa, Santiago, Chile. E-mail:
joaquin.atalah@gmail.com

Actualmente, la mayora de las enzimas utilizadas en la industria corresponden a hidrolasas


(Gunung et. al 2013). A pesar de que las enzimas oxidativas presentan una gran aplicabilidad
en diversas reas -tales como la produccin de textiles, sntesis de farmacuticos,
biorremediacin, industria papelera son una fraccin pequea de las enzimas desarrolladas
a escala industrial. Las lacasas (EC 1.3.10.2) son enzimas de la familia de las multi-cobre
oxidasas que han suscitado inters debido a su amplia especificidad de sustrato, la
variabilidad de sus propiedades entre cada especie, y su elusivo mecanismo de reaccin
(Solomon et.al. 1996; Morozova et.al.2007). Adems, son enzimas con potencial aplicacin
en la industria debido a no requerir cofactores y catalizar una reaccin limpia cuyo
principal residuo es agua. La presencia de cuatro centros de cobre en su sitio activo las
convierte en un modelo interesante para el estudio de la relacin entre la estructura y la
funcin de protenas. Estos tomos de cobre son adems responsables de las propiedades
catalticas de las lacasas y exhiben propiedades redox y espectroscpicas que son propias de
estas enzimas. Es posible encontrarlas en hongos, plantas y en procariontes. Las lacasas
bacterianas poseen ventajas desde el punto de vista aplicado por sobre las lacasas de hongos,
que hasta hoy se encuentran mejor caracterizadas(4). En general poseen una mayor
termoestabilidad, y exhiben un perfil de pH distinto, lo que permite ampliar el nmero de
aplicaciones de estas enzimas (Martins et. al. 2015)
Entre las oxidasas se encuentran tambin las peroxidasas (EC 1.11.1X), que acoplan la
reduccin de perxido a la oxidacin de su sustrato. La mayora de estas enzimas posee
grupos prostticos, algunas son flavoprotenas y todas poseen o bien un grupo hemo, o un
aminocido con actividad redox como una selenocistena. Uno de los ensayos ms utilizados
para la deteccin de las lacasas es la oxidacin de la siringaldazina (Harking & Obst 1973).
Las peroxidasas tambin son capaces de catalizar esta reaccin, por lo que un control
necesario en la deteccin de estas enzimas es la adicin de perxido para ver si acta como
activador o inhibidor de la reaccin.
Debido al gran potencial aplicado de las lacasas en comparacin con otras oxidasas, este
trabajo comenz con la purificacin de una actividad lacasa detectada en el extracto del
microorganismo termfilo antrtico Geobacillus sp. ID17, aislado de una muestra de suelo
recolectada en Isla Decepcin, una zona de alta actividad geotrmica. La muestra fue
obtenida en baha fumarola, en un sitio adyacente a una emisin fumarlica, donde fue
extrada desde el suelo a una profundidad de alrededor de 15 cm. El rango de temperatura
del sitio desde dnde se extrajo la muestra se encontraba entre los 75 C y 95 C y pH 6,0.
Luego de detectar en el extracto crudo de Geobacillus sp. ID17 la capacidad de oxidar la
singaldazina, se procedi a purificar la actividad lacasa responsable de este fenmeno.
Durante el proceso de purificacin se detect una actividad enzimtica adicional, activada
por perxido, que acepta la siringaldazina como sustrato pero posee la particularidad de ser

64 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

dependiente de cobre. Esta segunda enzima tambin fue purificada parcialmente para una
caracterizacin preliminar.
La purificacin de las enzimas se logr utilizando cromatografa de intercambio aninico y
exclusin molecular. Todos los ensayos enzimticos realizados fueron llevados a cabo en
base al mtodo de la siringaldazina establecido por Harkim y Obst.
Se logr purificar la actividad lacasa a homogeneidad, a juzgar por SDS-PAGE, y la enzima
con actividad peroxidasa dependiente de cobre fue purificada (O-SCQ) parcialmente.
Para la caracterizacin de las enzimas se determin el pH y la temperatura ptima, as como
su rango de sustratos. Como la actividad lacasa fue purificada en mayor grado se evalu
tambin su termoestabilidad y sus constantes cinticas.
La lacasa purificada demostr poseer una alta estabilidad trmica a 55 C y pH neutro. Siendo
ms termoestable que las lacasas comerciales disponibles. Se detect la mayor actividad
enzimtica en el rango entre 55 y 60 C, a pH 7,5, que corresponde con las condiciones
optimas de crecimiento del microorganismo. Adems la enzima posee una mayor
selectividad de sustrato que otras lacasas descritas a la fecha. Esta es la primera lacasa
termoestable caracterizada de una bacteria aislada desde una zona geotermal de la Antrtica,
y la primera lacasa intracelular descrita de este gnero bacteriano. En base a la masa
molecular estimada de su subunidad (23 kDa), y la masa molecular determinada para la
holoenzima (64 kDa), se podra concluir que sta lacasa es una protena trimrica.
La segunda enzima presente en el extracto crudo, O-SCQ, presenta mxima actividad a pH
8 y temperatura de 60C. El hecho de que su actividad peroxidasa dependa de cobre la vuelve
una enzima interesante, debido a que no existe ninguna peroxidasa reportada en la literatura
que tenga esta caracterstica. Sera interesante generar un protocolo de purificacin que
permita su mejor asilamiento y posterior caracterizacin, pues esta podra tratarse de una
nueva actividad enzimtica.

Agradecimientos
INACH, a la Universidad de Chile y a Fundacin Biociencia.

Referencias
Gurung, N., Ray, S., Bose, S., y Rai, V. 2013. A Broader View: Microbial Enzymes and Their Relevance in
Industries, Medicine, and Beyond. BioMed Research International, 2013:329121.
Harkin, J.M., Obst, J.R. 1973. Syringaldazine: an effective reagent for detecting laccase and peroxidase in fungi.
Experientia, 29:381387
Martins, L.O., Duro, P., Brissos, V., Lindley, P.F. 2015. Laccases of prokaryotic origin: enzymes at the
interface of protein science and protein technology. Cell Mol Life Sci. 72(5):911-22
Morozova, O.V., Shumakovich, G.P., Gorbacheva, M.A., Shleev, S.V., Yaropolov, A.I. 2007. "Blue" laccases.
Biochemistry (Mosc), 72(10):1136-50.
Solomon, E.I., Sundaram, U.M. y Machonkin, T.E. 1996. Multicopper Oxidases and Oxygenases. Chem Rev.
96(7):2563-2606

65 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

DESARROLLO DE UN BIOPOLMERO HEMISINTTICO FUNGICIDA DE


QUITOSANO FUNCIONALIZADO CON COMPUESTOS FENLICOS DE
Colobanthus quitensis
(Development of hemisynthetic biopolymer based don chitosan grafted with phenolic
compounds obtained from Colobanthus quitensis)

Avils, J.1; Vidal, C.1; Riveros, G.1; Ziga, G.E.1 y Contreras, R.A.1
1
Laboratorio de Fisiologa y Biotecnologa Vegetal, Departamento de Biologa, Facultad de Qumica y
Biologa, Universidad de Santiago de Chile, Santiago, Chile. javiera.aviles@usach.cl, claudia.vidal@usach.cl,
gabriela.riveros@usach.cl, gustavo.zuniga@usach.cl, rodrigo.contrerasar@usach.cl

Los cambios del medioambiente son sobrellevados en las plantas por varios mecanismos de
defensa, que alteran su plasticidad para lograr sobrevivir. Dentro de los mecanismos de
defensa, el metabolismo secundario juega un papel esencial, y explicara no solo la capacidad
de sobrevivir de muchas plantas, sino que tambin la diversidad de usos que estas tienen, los
que pueden ir desde el medicinal, hasta su manejo como plaguicidas naturales. La bsqueda
de nuevas fuentes de plaguicidas naturales se debe en parte, a la seleccin no intencional de
microorganismos multirresistentes y los hongos no son la excepcin, sumado a que se ha
demostrado el negativo efecto de los plaguicidas sintticos para la salud humana y para el
medioambiente en general. En el caso de Chile, al ser un potente productor agrcola, la
seleccin de cepas de ciertos fitopatgenos impacta significativamente la industria nacional,
siendo Botrytis cinerea uno de los principales problemas fitosanitarios (Latorre et al. 2015).
El quitosano ha demostrado ser un potencial controlador de este hongo, pero no ha llegado a
ser comparable con los fungicidas sintticos. Por otro lado, estudios previos en el Laboratorio
de Fisiologa y Biotecnologa Vegetal de la USACH han demostrado el potencial que tienen
extractos de Colobanthus quitensis para ser utilizados como biocontrolador de B. cinerea, es
por ello que en este trabajo se realiz el desarrollo de una matriz de quitosano funcionalizada
con metabolitos fenlicos obtenidos del cultivo in vitro de C. quitensis utilizando
funcionalizacin heterognea catalizada por la enzima polifenol oxidasa (tirosinasa, PPO)
(Sousa et al. 2009), con el objetivo de potenciar el efecto de ambas fuentes naturales con
potencial actividad fungicida.

Materiales y Mtodos
Material vegetal. Plntulas de C. quitensis cultivadas in vitro fueron micropropagadas y
crecidas en cmaras de cultivo a 142 C con fotoperodo de 18/6 h luz/oscuridad (Ziga et
al. 2008).
Preparacin de extractos y funcionalizacin de quitosano. Extractos fueron preparados
tomando tejido fresco de C. quitensis y extrayndolo de manera ultrasnica (50 Hz) en
metanol (J.T. Baker), el extracto resultante fue filtrado y lavado tres veces con n-hexano
(Merck). La fase polar (metanlica) fue llevada a sequedad y el slido resultante se
resuspendi en dimetilsulfxido (DMSO) a 40 mg/mL de concentracin. Posteriormente, la
funcionalizacin heterognea de quitosano se llev a cabo en matraces con 20 mL de buffer
fosfato (50 mM, pH 6.4), 1g de quitosano y 500 L del extracto. Como controles se utiliz
DMSO (control negativo) y 500 L de quercetina (20 mg/mL) como control positivo de
funcionalizacin. Todos los grupos experimentales fueron mantenidos a 25 C durante 20 h
con 27 U/mL de tirosinasa pura de champin (Sigma) en agitacin constante. La

66 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

funcionalizacin fue monitoreada por la oxidacin de los flavonoides en espectrofotmetro.


Los slidos funcionalizados fueron recuperados por filtracin y se lavaron sucesivamente
con Tween-20 (0.5%), finalmente fueron secados durante 48 h a 40 C (Sousa et al. 2009).
Ensayos de crecimiento miceliar. Se prepararon diluciones seriadas desde cero (control)
hasta 10 mg/mL de quitosano, quitosano funcionalizado con quercetina (quitosano-
quercetina) y quitosano funcionalizado con extracto de C. quitensis (quitosano-Cq)
disolviendo el polmero en cido actico al 0.25%. Se mezcl las diluciones con agar papa
dextrosa (PDA), sobre el cual se inocul un disco de micelio saturado en medio de la placa.
Se mantuvieron a 22 C durante 48 h y se midi el crecimiento radial.
Bioensayos de bio-pelculas en hojas. Hojas de Arabidopsis thaliana Col-0 de un mes de
edad fueron recubiertas con pelculas de quitosano, quitosano-quercetina y quitosano-Cq de
concentracin 10 mg/mL. Se montaron seis hojas de cada tratamiento en placas con agar 1%
y en medio se inocularon con un disco de micelio de B. cinerea. Al cabo de 48 h se evalu
los niveles de transcritos mediante qRT-PCR de genes relacionados a la respuesta a estrs
bitico (PR1, PR3 y PR5), un gen normalizador (-tubulina) y un gen especfico de B. cinerea
(Rpb2A) para cuantificar los niveles de infeccin en el tejido (Moretti et al. 2015) (Tabla I).
Para este ensayo, los RNA fueron purificados utilizando el kit Spectrum plant total RNA
(Sigma) y los transcritos se cuantificaron con el kit Brilliant II SYBR green one step
(Agilent).

Gen Secuencia F Secuencia R


PR1 5CCTCGTACATTCTCATGGTCAAT3 5CCATTGTTACACTGAACCCTAGC3
PR3 5TGTTTTGTTGTGTGTTTTTCCTG3 5AGCAATACCCTCCTGTAAATGGT3
PR5 5CCGAGGTAATTGTGAGACTGGAG3 5CCTGATTGGGTTGATTAAGTGCA3
Rpb2A 5GTGAAATCAACAACAATCACC3 5CGGCGCAAATGAGAAAGTGTG3
-tubulina 5ATGTTCAGGCGCAAGGCTT3 5TCTGCAACCGGGTCATTCAT3

Tabla I. Partidores utilizados en este estudio. Table I. Partitioners used in this study.

Anlisis estadstico. Todos los anlisis fueron realizados por triplicado y las diferencias
significativas fueron determinadas con ANOVA.

Resultados y Discusin
Funcionalizacin de quitosano. En primer lugar se determin la efectividad de la
hemisntesis, para ello se monitore la oxidacin de flavonoides catalizada por tirosinasa, en
presencia de quitosano (Fig. 1), determinndose la disminucin de la banda caracterstica de
280 nm, lo que dara indicativo de la efectiva oxidacin de los compuestos fenlicos, tanto
para quercetina (Fig. 1A), cmo para el extracto de C. quitensis (Fig. 1B). La disminucin
de la banda a 280 nm estara asociada al cambio estructural de los compuestos fenlicos, que
pasan a formar quinonas, las que al carecer del anillo aromtico, no tienen el mximo de
absorcin en esa zona del espectro UV (Sun et al. 1992; Sousa et al. 2009).

67 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 1. Espectros de absorcin UV-Visible de la reaccin


de oxidacin de compuestos fenlicos. (A) quercetina y (B)
extracto de C. quitensis. Figure 1. UV-Visible absorption
spectras in the reaction of oxidation of phenolic compounds.

Adicionalmente, se observ que el producto slido obtenido posea una apariencia distinta al
quitosano puro, en el caso del quitosano funcionalizado con quercetina, este gener un slido
anaranjado intenso, mientras que el funcionalizado con el extracto gener un slido de color
amarillo plido (Fig. 2). El cambio de color caracterstico se debe esencialmente a la
formacin de quinonas a partir del anillo fenlico (Sun et al. 1992).

Figura 2. Slidos de quitosano funcionalizado


obtenidos de la reaccin de hemisntesis catalizada por
tirosinasa. Figure 2. Grafted chitosan solides obtained
by hemisynthetic reaction catalized by tyrosinase.

Actividad antifngica. Una vez caracterizado el producto de la funcionalizacin enzimtica,


se analiz su actividad biolgica. Se observ que el quitosano mostr por si mismo actividad
biolgica, con una mxima actividad de un 25% de inhibicin respecto al control desde 2.5
hasta 10 mg/mL (Fig 3).
80
Quitosano
Quitosano+quercetina
Quitosano+Cq

60
% Inhibicin

40
Figura 3. Inhibicin del crecimiento de micelios de B. cinerea de quitosano y
productos funcionalizados. n=3, P<0.05.Figure 3. Micelial growth inhibition
of B. cinerea by chitosan and grafted products.
20

0 5 10
[Quitosano], mg/mL

En el caso del quitosano funcionalizado con quercetina, su actividad fue mejorada,


alcanzando una mximo de 40% de inhibicin del crecimiento miceliar, entre 5 a 10 mg/mL
(Fig. 3). Finalmente, cuando el quitosano fue funcionalizado con compuestos provenientes
del extracto de C. quitensis, la actividad biolgica fue sostenida, alcanzando sobre un 60%
a 10 mg/mL (Fig. 3). Esto dara cuenta de que la funcionalizacin hemisinttica de quitosano
permitira obtener un polmero mejorado en trminos de actividad botricida (Sousa et al.
2009).
Finalmente se determin la actividad de los productos obtenidos sobre hojas de A. thaliana
enfrentadas a la presencia de B. cinerea, los resultados mostraron que al cabo de 48 h, las
hojas tratadas con una biopelcula de quitosano funcionalizado con el extracto de C. quitensis
fueron colonizadas en menor grado (Fig. 4), adicionalmente mostraron una induccin de
68 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

genes de defensa (PR1, PR3 y PR5), as como menor nivel de transcritos del gen Rpb2A, que
codifica para la RNApol 2A de B. cinerea, el que sera un indicador del grado de colonizacin
del tejido por parte de B. cinerea (Moretti et al. 2015). Esto indicara que el polmero no slo
estara inhibiendo el crecimiento miceliar del hongo, sino que tambin inducira los
mecanismos de defensa propios de la planta, actuando a dos niveles (Hadwiger 2013) (Fig.
4, Tabla II).

Figura 4. Bioensayo sobre hojas de A.


thaliana. (A) control -, B, control +, (C)
quitosano, (D) quitosano-quercetina y (D)
quitosano-Cq. Izquierda da cero, derecha 48
h. Figure 4. Bioassay in A. thaliana leaves.

Gen
Tratamiento PR1 PR3 PR5 Rpb2A
+B. cinerea 1.010.05 62.060.25 131.610.81 56.520.52
+Quitosano 36.010.06 101.20.56 1.040.04 17.690.32
+Quitosano- 98.110.17 85.431.62 55.790.43 32.43036
quercetina
+Quitosano-Cq 50.300.09 58.770.30 159.850.89 4.780.22

Tabla II. Niveles de transcritos para PR1, PR3, PR5 y Rpb2A presentes en A. thaliana tratada con bio-
pelculas de los tres tratamientos de quitosano funcionalizado y como control negativo, hojas sin bio-
pelculas, luego de 3 das de inoculacin de B. cinerea. n=3, P<0.05. Table II. Levels of transcripts for PR1,
PR3, PR5 and Rpb2A present in A. thaliana treated with biofilms of the three treatments of chitosan
functionalized and as negative control, leaves without biofilms, after 3 days of B. cinerea inoculation. n = 3, P
<0.05.

Conclusiones
Se logr producir un polmero hemisinttico de quitosano funcionalizado con metabolitos
fenlicos de C. quitensis, el cual inhibe el desarrollo del hongo y puede inducir la defensa en
plantas cuando es aplicado como biopelcula.

Agradecimientos
Fondecyt 3160274 (RAC)

Referencias
Hadwiger LA (2013). Multiple effects of chitosan on plant systems: Solid science or hype. Plant Science
208:42-49.
Latorre BA, Elfar K y Ferrada EE (2015). Gray mold caused by Botrytis cinerea limits grape production in
Chile. Ciencia e investigacin agraria 42:305-330
Moretti C, Quaglia M, Cerri M, Nicosia DE y Buonaurio R (2015). A real-time PCR assay for detection and
quantification of Botrytis cinerea in Pelargonium x hortorum plants, and its use for evaluation of plant
resistance. European Journal of Plant Pathology 143 (1):159-171.
Sousa F, Guebitz GM y Kokol V (2009) Antimicrobial and antioxidant properties of chitosan enzymatically
functionalized with flavonoids. Process Biochemistry 44 (7):749-756.
Sun W-Q, Payne GF, Moas MSGL, Chu JH y Wallace KK (1992). Tyrosinase Reaction/Chitosan Adsorption
for Removing Phenols from Wastewater. Biotechnology Progress 8 (3):179-186.
Ziga GE, Zamora P, Ortega M y Obrecht A (2008) Short Note: Micropropagation of Antarctic Colobanthus
quitensis. Antarctic Science 21 (2):149-150.

69 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

CLIMATE IMPACT ON BLUE CARBON POTENTIAL OF SUB-POLAR


CONTINENTAL SHELF SEABEDS
(Efecto del cambio climtico en el potencial de carbono azul de los fondos subpolares de la
plataforma continental)

Barnes D.K.A.1, Sands C.J.1, Moreno B.2, Munoz-Ramirez C.3, Downey R.4, Held C.5,
Paulsen M.6, Moreau C.7, Bax N.8 and Morley S.1
1
British Antarctic Survey, NERC, Cambridge, UK; 2Universidad Cientifica del Sur, Lima, Peru; 3Universidad
de Concepcion, Chile; 4Australian National University, Canberra, Australia; 5Alfred Wegner Institute,
Bremerhaven, Germany; 6Bergen University, Bergen, Norway; 7Universite de Bruxelles, Bruxelles, Belgium;
8
University of Tasmania, Hobart, Australia. Email: dkab@bas.ac.uk

What little we know of high latitude southern continental shelves suggests that they provide
globally important carbon capture and storage. As well as oceanographic CO2 absorption,
biological fixation and trophic cascading are important but the latter are little understood or
quantified. Most foodweb carbon is pelagic, recycled through microbial loops but significant
masses are accumulated and immobilized within calcareous skeletons of benthos. Carbon
sequestration by benthos has potential of 106 tonnes per year in West Antarctic shelves alone,
but are highly variable in time and space. Burial potential is enhanced by negligible
anthropogenic (human harvesting) or natural (iceberg) trawling. Patagonian and subAntarctic
island shelves have considerable phytoplankton blooms, little or no sea ice and warmer sea
temperatures than Antarctica (enabling faster meal processing time by benthos) yet their
carbon sink potential remains unquantified. European, South American and other regional
scientists are collaborating on the Antarctic Circumnavigation Expedition (ACE) and
ICEBERGs projects to try to quantify benthic blue carbon storage. A bespoke camera lander
and camera-equipped trawls collected imagery, and benthos samples are allowing us to
estimate changes in intra and inter-shelf variability in benthos density and biomass. Growth
models constructed from age structure of sampled species with growth check lines (e.g.
bryozoans, bivalves, brachiopods) aid estimation of annual carbon accumulation. Preliminary
data and analyses suggest that continental shelves of 40-60S are globally significant, in
carbon storage, and could aid error reduction in climate models (see www.asccc.co.uk).

Introduction
Life on the seabed (benthos) accumulate and immobilize considerable carbon from their food
and the water column this is termed blue carbon (see fig. 1). Unlike most biologically
accumulated carbon (e.g. in most forests) this carbon is easily buried and thus genuinely
sequestered, and so the rate at which benthos capture, store and sequester carbon is important
to global climate and human health. The International blue carbon initiative of the United
Nations Environment Programme (http://thebluecarboninitiative.org/) argues that the 2% of
global area represented by coast is responsible for half of global carbon sequestration. The
cold waters between South America and Antarctica, despite the pace of marine growth being
typically slow, can be globally significant in carbon immobilization. This is because it seems
to be increasing with ongoing climate change, thus forming negative feedbacks (Barnes
2015). However almost nothing is known of the blue carbon potential of the considerable
subAntarctic continental shelf. Projects such as Antarctic Seabed Carbon Capture Change
(ASCCC) of the Antarctic Circumnavigation Expedition and the new NERC-Conicyt

70 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ICEBERGS work have established collaborations between European, South American and
other scientists to investigate benthic carbon standing stocks and production. Here we report
preliminary results from expeditions JR287 and ACE to collect benthic samples around cool
temperate, subAntarctic and Antarctic continental shelves.

Figure 1. Carbon pathway in a changing climate. Sea


ice losses around southern polar waters lead to longer
algal blooms. This gives benthic animals longer meal
times and increases their growth. Figura 1. Camino
del carbono en un clima cambiante. Las prdidas de
hielo marino alrededor de las aguas polares del sur
llevan a una proliferacin de algas ms prolongada.
Esto da a los animales bentnicos tiempos de comida
ms largos y aumenta su crecimiento.

Materials And Methods


Images and video as well as benthos samples were collected using video equipped trawls on
the ACE voyage (see fig. 2). Three trawls were typically taken per site. In contrast, trawls
and separate camera lander were deployed from JR287, at three sites at each of South
Georgia, Gough and Tristan da Cunha islands. Seabed images were analyzed for presence of
13 functional groups (Barnes & Sands 2017). Images were used to calculate densities of each
functional group. Biological samples are each assigned to a functional groups, aged where
possible and then analyzed for carbon content.

Figure 2. Benthic sample sites: Antarctic Circum-


navigation Expedition (white), JR287 cruise (yellow) and
previous relevant published work (orange). Detail of
Kerguelen Plateau sites are shown below. Figura 2.
Lugares de muestreo bentnicos: Expedicin de
Circunavegacin Antrtica (blanco), crucero JR287
(amarillo) y trabajo publicado relevante anterior
(naranja). Detalle de los sitios de la meseta de Kerguelen
se muestran a continuacin.

Results
We estimated the average standing stock of carbon around Atlantic islands to range from ~35
(Falkland/Malvinas) to 250 (Tristan da Cunha) gramsC m-2. If our sample estimates were
representative of the respective regions these scale to 35-286 tonnes km-2 (Table 1). These
values are many fold higher than calculated for South Orkney Island and South Georgia
seabeds respectively (see Barnes 2015, Barnes et al 2016). Scaled to the approximate seabed

71 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

areas (100-1000 m depth) such densities represent ~60,000-250,000 tonnes C (at Gough and
the Tristan da Cunha archipelago). Camera lander photographs at Tristan da Cunha (but not
Gough) and South Georgia showed that skeletal remains of this benthic carbonate is not
dissolved but buried, and thus there are strong chances of sequestration. Growth rates of
calcifying benthos such as corals and bryozoans vary considerably even within species
between locations, depths and water masses (Van Oevelen et al 2009, Roberts et al 2010,
Sabatier et al 2012, Barnes et al 2016). We used an estimate of 0.1g.m-2.day-1 across benthic
taxa, which in line with cold coral literature is slow compared to global mean reef production
2.57.4 g.m2.day1 or 2.2 g.m2.day1 of the nearest Carribean reefs (Mallela 2013). Our
estimates of carbon production for each shelf region vary from nearly 8000 t.yr-1 at Gough
to 28,000 t.yr-1 at Tristan da Cunha (Table 1).

Carbon kg Tristan da Falkland/ South South South Orkney Kerguelen


Gough I.
per m2 Cunha Malvinas Georgia Sandwich Is. Plateau

Standing 250 t km- 200 t km-2 45 t km-2 1 t.km-2 0.1 t km-2 9.8 t.km-2 >50 t.km2
2
stock 250,000 t 60,000 t * 43,000 t <1,000 t 423,000 t >100 m t

Evidence ICEBERG SUCS, SUCS & diver


SUCS none none None
of burial cruise? box core images, cores

Estimated
annual 28,000 t 7,800 t * 7,300 t > 100 t 55,000 t >> m t
production

Table 1 Carbon accumulation by shelf benthos around remote high latitude islands. The data are estimates of
Carbon standing stock (from camera lander images and trawl video and deployments). Estimates are given
for standing stock per km2 and for total 100-1000m, whether there is evidence of burial (sequestration),
estimates of annual production. Data for South Georgia and South Orkney islands from Barnes (2015) and
Barnes et al. (2016). *We did not multiply up the Patagonian shelf value as the area is not discrete and we do
not have values across its geographic scope.

Trawl camera imagery across the five sites sampled on the Kerguelen Plateau suggest the
standing stock of carbon there is considerably higher than South Georgia and South Orkney
Islands. There was considerable variability within and between Kerguelen Plateau sites, with
imagery suggest approximate values ranging
from ~190 (Pike Bank) to 20 (H2) grams C per
m2. As the Kerguelen Plateau spans 2.2 million
square km a combined value would scale up to
considerably more standing stock or annual
production than all other regions in Table 1
combined.
Figure 3. Dense benthos at K1 on the Kerguelen
Plateau. The image was taken by a GoPro Hero III
inside a modified miniAgassiz trawl and is 1.25 m
wide. Figura 3. Bentos denso en K1 en la meseta de
Kerguelen. La imagen fue tomada por una GoPro Hero
III dentro de una red de arrastre miniAgassiz
modificada de 1,25 m de ancho.
Discussion And Conclusions

72 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

High standing stocks of benthos, thus seabed blue carbon, is striking in images and powerful
conservation messages. However dense benthos does not equate to meaningful blue carbon
importance. Tristan da Cunha and Gough archipelagos have high standing stocks of
carbonate benthos (for which there is evidence of burial) but their shelf areas are small. South
Georgia has a large shelf area but the standing stocks of benthos are only high on hard
substrata, which form a tiny proportion of its area. The South Orkney Islands have moderate
benthic standing stocks but a large shelf area, and benthic carbon capture and storage has
doubled with sea ice losses so is part of a strong negative feedback on climate change (Barnes
et al 2016). The vast area of Kerguelen Plateau makes it important, irrespective of benthic
standing stock and productivity, and our work suggests these too are high. Three important
features emerge as key for strong blue carbon importance on high latitude continental
shelves; 1) large area, 2) high burial possibilities and 3) high productivity of carbonate
benthos (rather than lightly- or non-calcified groups, e.g. soft corals, sea cucumbers,
sipunculans and echiurans). The Kerguelen Plateau, Patagonian shelf and New Zealand
plateau are highly likely to be globally important blue carbon stores and amongst the biggest
negative feedbacks on climate change.

Acknowledgements
Darwin Initiative, Antarctic Circumnavigation Expedition & Jen Thomas.

References
Barnes, D.K.A. 2015. Antarctic sea ice losses drive gains in benthic carbon drawdown. Current Biology, 25:
789-790
Barnes, D.K.A., Ireland, L., Hogg, O.T., Morley, S., Enderlein, P. and Sands, C.J. 2016. Why is the South
Orkney Island shelf (the worlds first high seas marine protected area) a carbon drawdown hotspot? Global
Change Biology, 22: 1110-1120 Barnes, D.K.A. and Sands, C.J. 2017. Functional group diversity is key to
Southern Ocean benthic carbon pathways. PLoS One 12(6): e0179735.
Mallela, J. 2013. Calcification by reef-building sclerobionts. PloS One 8(3): e60010
Van Oevelen, D., Duineveld, G., Lavaleye, M., Mienis, F., Soetaert, K., Heip, C.H.R. 2009. The cold-water
coral community as a hot spot for carbon cycling on continental margins: A food-web analysis from Rockall
Bank (northeast Atlantic). Limnology and Oceanography, 54(6): 18291844
Roberts, J.M., Wheeler, A.J., Freiwald, A. and Cairns S.J. 2010. The biology and geology of deep-sea coral
habitats. 2010, Cambridge University press, Cambridge.
Sabatier, P., Reyss, J.-L., Hall-Spencer, J.M., Colin, C., Frank, N. and Tisnerat-Laborde, N. 2012. 210Pb-
226Ra chronology reveals rapid growth rate of Madrepora oculata and Lophelia pertusa on world's largest
cold-water coral reef. Biogeosciences, 9(3): 1253-1265

73 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

POTENCIAL BIOTECNOLGICO DE ACTINOBACTERIAS ANTRTICAS


(Biotechnological potential of Antarctic Actinobacterias)

Barrientos, L.1, 2; Lamilla, C.1, 2; Santos, A.1, 2; Pavez, M.1,2, Farah, S.1
1
Laboratorio de Biologa Molecular Aplicada, Centro de Excelencia en Medicina Traslacional, Avenida
Alemania 0458; 2Ncleo Cientfico y Tecnolgico en Biorecursos (BIOREN), Universidad de La Frontera,
Avenida Francisco Salazar, 01145 Temuco, Chile. leticia.barrientos@ufrontera.cl

Las condiciones climticas de la Antrtica, se caracterizan por situaciones ambientales muy


extremas, tales como temperaturas promedios de -17C, una marcada aridez del suelo debido
a las escasas precipitaciones anuales (200 mm), una baja disponibilidad de nutrientes, una
alta salinidad, y adems, una alta radiacin ultra violeta (Crdenas & Kraus, 2012). Estas
condiciones extremas han moldeado activamente a los microorganismos que habitan en todos
sus ambientes, lo que ha permitido la adaptacin de las bacterias a cada uno de los diferentes
nichos ecolgicos presentes en este continente. De este modo, estas son poblaciones
bacterianas nicas, y su expresin adaptativa se manifiesta por la produccin de diferentes
metabolitos activos, que les permiten tolerar los factores ambientales extremos
caractersticos y por otro, al desarrollo de compuestos que los ayuden en la competencia por
las pocas fuentes de nutrientes existentes en los diferentes ambientes antrticos (Martnez-
Rosales et al., 2012). Entre ellos, las actinobacteria estn ampliamente distribuidas en los
ecosistemas terrestres y acuticos. En los ltimos aos se les ha caracterizado como los
productores ms prolficos de nuevos compuestos con potencial uso biotecnolgico. Dado lo
anteriormente expuesto, el objetivo de este estudio fue aislar y caracterizar actinobacterias,
desde diferentes ambientes de la Antrtica, con el fin de determinar su potencial
biotecnolgico.

Materiales y Mtodos
Muestras de suelo, sedimento marino y agua de mar fueron recolectadas durante las
Expediciones Cientficas Antrticas 2013-2014. Los aislamientos bacterianos se realizaron
en placas con los medios de cultivo NM1, ISP2 e ISP3, y se incubaron a 4 y 15C, durante
cuatro semanas. Cada colonia bacteriana, con morfologa diferente, fue aislada y mantenida
en cultivo puro a -80C. A todas aquellas cepas aisladas que presentaron reaccin positiva
frente a la tincin de Gram y negativa frente a la tincin de endosporas, se les realiz
extraccin de DNA con el empleo del UltraClean Microbial DNA Isolation Kit, y el gen
16S rRNA fue amplificado utilizando los partidores 27F y 1492R. Los productos de PCR
obtenidos fueron secuenciados en Macrogen (Corea) y luego las secuencias comparadas
empleando BLAST. A cada aislado se le determin la morfologa microscpica y se
caracteriz mediante el kit APIZYM. Tambin, se evalu la actividad proteoltica, lipoltica,
amiloltica y celuloltica de cada uno de los aislados en agar R2A, suplementado, ya sea con
leche descremada en polvo (0,4%), Tween 80 (1%), almidn (0,4%), carboximetilcelulosa y
azul de tripn (0,4%) y (0,01%), respectivamente. Despus de 7 a 10 das de incubacin a
15C, se consider una reaccin positiva la formacin de un halo transparente alrededor de
las colonias. Las actividades proteoltica y amiloltica fueron confirmadas por la tincin de
las placas con solucin de Coomasie azul brillante y de lugol, respectivamente. Tambin, se
determin la actividad antifngica de estos aislados contra hongos fitopatgenos de

74 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

importancia agrcola mediante el empleo de cultivos duales en placas de agar papa (PDA) y
medio M1, y determinacin de la Concentracin Inhibitoria Mnima en microplacas. La
actividad antibacteriana contra algunas bacterias de importancia clnica, se realiz siguiendo
los estndares recomendados por la CLSI (2002).

Resultados y Discusin
Entre las cepas aisladas y mantenidas en cepario, se logr identificar un total de 30 cepas de
actinobacterias, pertenecientes a ocho gneros diferentes: Arthrobacter (16 cepas),
Streptomyces (seis cepas), Rhodococcus (tres cepas), Thermoleophilum (una cepa),
Janibacter (una cepa), Knoellia (una cepa), Brevibacterium (una cepa) y Curtobacterium
(una cepa). De estos aislamientos, 18 de ellos corresponden a actinobacterias aisladas desde
suelo (60%), 10 a aislamientos desde sedimentos, tanto marinos como de agua dulce (33%),
y dos aislamientos desde agua de mar (7%). Lee et al., (2012), en su trabajo encontraron
treinta y nueve actinobacterias que pertenecan a 12 gneros, desde cuatro muestras de suelo,
y empleando 12 diferentes medios de cultivo. La amplia distribucin de los diferentes
gneros de actinobacterias en la Antrtica implicara que presentan cierto grado de
endemismo, particularmente en el suelo y los sedimentos (Aislabie et al., 2006). En general,
la diversidad de bacterias viables y hongos es baja (aunque influenciados por las condiciones
ambientales locales), lo que apoya la hiptesis de que los ambientes extremos albergan
relativamente baja diversidad de especies (Gilichinsky et al., 2007; Smith et al., 2006). La
abundancia microbiana en las profundidades del mar es baja; sin embargo, existira una
diversidad filogentica que pudiera ser subestimada por los mtodos basados en cultivos.
Debido a esto, posiblemente, se deberan mejorar las metodologas de aislamiento, y as
poder recuperar una mayor diversidad microbiana en este ambiente.
Los resultados obtenidos en este estudio, mediante el ensayo bioqumico ApiZym, permite
observar marcadas diferencias entre los perfiles enzimticos de cada especie, sugiriendo las
diferencias de sus metabolismos Entre los resultados obtenidos se destaca el alto potencial
biotecnolgico de estas actinobacterias antrticas, ya que se observ que todos los aislados
producen, a lo menos, una enzima extracelular. Es as que 25 de las 30 actinobacterias
evaluadas (83%) produjeron proteasas, 13 presentaron actividad amilasa (43%), 24 de las
cepas presentaron actividad lipoltica (80%) y 7 presentaron actividad celuloltica (23%).
Esto tambin da prueba de la versatilidad de la microbiota cultivable de estos ecosistemas
para aprovechar las fuentes de nutrientes, que a veces son escasos en la Antrtica.
Con respecto a sus aplicaciones en la industria farmacutica, debemos destacar que la
mayora de estas bacterias presentaron algn grado de actividad antimicrobiana frente a
hongos y bacterias de importancia agrcola o clnica. Con respecto a la capacidad
antimicrobiana de las actinobacterias aisladas, 28 de 30 presentaron algn grado de actividad
frente a hongos y bacterias. El gnero Arthrobacter present actividad antifngica,
principalmente para el hongo fitopatgeno Rhizoctonia solani, y algunas de la especies de
este gnero presentaron actividad incluso en concentraciones bajas de metabolitos
secundarios (1,5%). Tambin, Janibacter limosus y S. cellulosae fueron capaces de inhibir
otro hongo fitopatgeno tal como Phytophthora infestans. La actividad antibacteriana frente
a patgenos clnicos fue menor en comparacin a la descrita anteriormente, con
concentraciones inhibitorias mnimas de 80% en su mayora. Sin embargo, el aislado
Arthrobacter sulfonivorans mostr actividad contra Enterococcus fecalis, bacteria de
importancia en infecciones de tipo hospitalaria, Thermoleophilum minutum tambin present
actividad frente a E. fecalis Otras cepas que tuvieron actividad antimicrobiana fueron

75 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Streptomyces cellulosae y S. thermospinosisporus. La actividad antimicrobiana de las


actinobacterias es extensamente relatada, sin embargo, muchas de las especies encontradas
en el ambiente extremo de la Antrtica son bacterias poco descritas y por ende poco
estudiadas, siendo un potencial de estudio para nuevos antimicrobianos.

Conclusiones
Los datos obtenidos a la fecha nos entregan promisorios resultados mostrando que los
ecosistemas antrticos, agua, suelo y sedimento marino, son una buena fuente para el
aislamiento de actinobacterias cultivables cuyos metabolitos bioactivos presentan una
diversidad de potenciales aplicaciones biotecnolgicas.

Agradecimientos
Proyecto INACH TR_14-12; FAPERJ/UFRO FPJ15-0009.

Referencias
Aislabie, J., Saul, D. and Foght, J. 2006. Bioremediation of hydrocarbon-contaminated polar soils.
Extremophiles, 10: 171-179
Crdenas, C., Kraus, S. 2012. Paleoclimatic and glaciological evidence of regional climate change. Anales del
Instituto de la Patagonia, 40: 31-37.
Gilichinsky, D.A., Wilson, G.S., Friedmann, E.I,, McKay, C.P., Sletten, R.S., Rivkina, E.M., Vishnivetskaya,
T.A., Erokhina, L.G., Ivanushkina, N.E., Kochkina, G.A., Shcherbakova, V.A., Soina, V.S., Spirina, E.V.,
Vorobyova, E.A., Fyodorov-Davydov, D.G., Hallet, B., Ozerskaya, S.M., Sorokovikov, V.A., Laurinavichyus,
K.S., Shatilovich, A.V., Chanton, J.P., Ostroumov, V.E., Tiedje, J.M. 2007. Microbial populations in Antarctic
permafrost: biodiversity, state, age, and implication for astrobiology. Astrobiology, 7(2): 275-311.
Martnez-Rosales, C., Fullana, N., Musto, H., Castro-Sowinski, S., 2012. Antarctic DNA moving forward:
genomic plasticity and biotechnological potential. FEMS Microbiology Letters, 331: 1-9.
Smith, J.J., Tow, L.A., Stafford, W., Cary, C., Cowan, D.A. 2006. Bacterial diversity in three different
Antarctic cold desert mineral soils. Microbial Ecology, 51: 413-421.

76 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

PATAGONIAN TRUE BUGS: IDIOSTOLIDAE (HEMIPTERA: HETEROPTERA)


ASSOCIATED TO Nothofagus
(Chinches patagnicas: los idiostolidae (Hemiptera: Heteroptera) asociados a
Nothofagus)

Basset C.1, Lencinas M.V.2 y Coscarn M.C.1

Divisin Entomologa, FCNyM, Universidad Nacional de La Plata, Paseo del Bosque s/n, CP 1900.
2
Centro Austral de Investigaciones Cientficas (CADIC)-CONICET

The hemipteran suborder Heteroptera, or true bugs, comprises about 40,000 species in 86
families and is one of the largest groups of non-holometabolous insects (Henry 2009). True
bugs are found in terrestrial, aquatic, and even marine habitats and their feeding preferences
range from phytophagous to zoophagous and hematophagous, involving monophagy, mixed
feeding, and parasitism. The group includes plant pests, beneficial species used in integrated
pest managemen, also human disease vectors (Mal de Chagas).
Idiostolidae is a family with a disjunct transantarctic distribution. Until now the family
comprising three genera with five species: Idiostolus insularis Berg and I. schaeferi Faundez
from southern South America, Trisecus pictus Bergroth from Tasmania, T. armatus
Woodward from New South Wales and Monteithocoris hirsutus Woodward from Tasmania.
(Schuh & Slater 1995; Fandez et. al. 2014).
Idiostolids are associated with Nothofagus Blume (Nothofagaceae) forest (Scudder 1962;
Schaefer & Wilcox 1969). A few hemipterans have a similar distribution (Scudder 1962;
Woodward 1968). According to Schaefer & Wilcox (1969) in basis to the distribution and
morphology, the family would have originated earlier in South America than in Australia.
The genus Idiostolus is distributed in south of Argentina (Coscarn in press) and Chile. There
are few data about the biology, it's known that are phytophagous insects (Schuh & Slater
1995). The species of Idiostolus has been collected in forests of Nothofagus betuloides
(Mirb.) Oerst (Scudder 1962 Schaefer & Wilcox 1969), has recently been found in cypress
Pilgerodendron uviferum (D. Don) Florin (Fandez et. al. 2014). They could be adapted to
live in very unfavourable zones, with very low temperatures (Carvajal et.al. 2011).
The objective of this contribution is to expand the knowledge of the genus Idiostolus, from
exo and endosomatic morphological characters of both male and female and meristic
characters. The material used in this study consists of specimens collected in Ushuaia through
pitfall, and specimens from the entomological collection of the Museum of La Plata. As result
of this analysis a new species is described.
Finally, we can conclude that it is necessary to collect more specimens, both males and
females, to know better the genus, its trophic habits, and its association with Nothofagus, and
as all activities on them, as well as natural and human promoted disturbances, could endanger
organism and function conservation.

Acknowledgments
This work was supported by Consejo Nacional de Investigaciones Cientficas y Tcnicas
(CONICET) and Agencia Nacional de Investigaciones Cientficas y Tcnicas

References

77 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Carvajal, MA & Fandez, EI. 2011. Notes on the distribution of Idiostolus insularis
Berg, 1881 (Hemiptera: Heteroptera: Idiostolidae). Boletn de Biodiversidad de Chile, 6, 30-32.
Coscarn, MC. (in press) A catalogue of the Heteroptera (Hemiptera) or true bugs of Argentina. Zootaxa.
Faundez, EI, Carvajal, MA y Ashworth, AC. 2014 Una nueva especie de Idisotolus Berg, 1883 (Hemiptera:
Heteroptera: Idiostoloidea: Idiostolidae) Anales Instituto Patagonia (Chile), 42(1):71-75.
Henry, TJ. 1997. Phylogenetic analysis of family groups within the infraorder Pentatomomorpha (Hemiptera:
Heteroptera), with emphasis on the Lygaeoidea. Annals of the Entomological Society of America, 90(3),275-
301.
Henry TJ. 2009 Biodiversity of Heteroptera. In: Foottit RG, Adler PH (eds) Insect biodiversity: science and
society. Blackwell Publishing Ltd., Oxford, pp 223263
Schaefer, CW. 1966. The morphology and higher systematic of Idiostolinae (Hemiptera: Lygaeidae). Annals of
the Entomological Society of America, 59, 602-613.
Schaefer, CW & Wilcox D. 1969. Notes on the Morphology, Taxonomy, and Distribution of the Idiostolidae
(Hemiptera-Heteroptera). Annals of the Entomological Society of America, 62(3), 485-502.
Schuh, RT & Slater, JA. 1995. True bugs of the World (Hemiptera: Heteroptera): Classification and Natural
History. Cornell University Press, Ithaca, New York.
Scudder, GGE. 1962. Results of the Royal Society Expedition to Southern Chile, 1958-59: Lygaeidae
(Hemiptera), with the description of a new Subfamily. The Canadian Entomologist, 94, 1064-1074.
Woodward, TE. 1968 The Australian Idiostolidae (Hemipetra: Heteroptera). Trans. Roy. Entomol. Soc. London
120: 253-61

78 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

MIDDLE JURASSIC TO MIOCENE U-PB ZIRCON AND 40AR/39AR


HORNBLENDE GEOCHRONOLOGY OF THE ANTARCTIC PENINSULA
BATHOLITH: IMPLICATIONS FOR THE MAGMATIC AND TECTONIC
EVOLUTION OF ANTARCTIC PENINSULA
(Geocronologa u-pb en zircn y 40ar/39ar en hornblenda del jursico medio al mioceno en
el batolito de la pennsula antrtica: implicancias para la evolucin magmtica y tectnica
de la pennsula Antrtica)

Bastias, J.1,*, Spikings, R.1, Ulianov, A.2, Schaltegger, U.1, Grunow, A.3, Herv, F.4, 5,
Riley, T.6, Burton-Johnson, A.6.
1
Earth Sciences Department, University of Geneva, rue de Marachers 13, 1205 Geneva, Switzerland. 2
Institute of Earth Sciences, University of Lausanne, Gopolis, 1015 Lausanne, Switzerland. 3 Byrd Polar and
Climate Research Center, The Ohio State University, 108 Scot Hall, 1090 Carmack Road, Columbus, OH
43210 USA. 4 Departamento de Geologa, Universidad de Chile, Plaza Ercilla 803, Santiago, Chile. 5 Carrera
de Geologa, Universidad Andrs Bello, Sazi 2119, Santiago, Chile. 6 British Antarctic Survey, Cambridge,
CB3 OET, UK. * joaquin.bastias@unige.ch

The origin and genesis of the mechanism that formed the arc of the Antarctic Peninsula has
been in dispute since the interpretation of Vaughan and Storey (2000), who suggested that
these plutonic rocks are part of an allochthonous arc, contradicting the traditional
interpretation that these rocks are autochthonous and are part of continental arc formed along
the southern margin of Gondwana (Suarez, 1976). The rocks of the Antarctic Peninsula
Batholith spans ages from ~240 to 9 Ma and are emplaced for over 1300 km long and 200
km wide. They play a key role in the comprehension of the tectonic evolution of the region,
since that those rocks can register the tectonic environment within which magmatism was
occurring. We present the preliminary results of the RT0614-INACH project, which
consider: i) U-Pb zircon and hornblende 40Ar/39Ar crystallization ages, ii) chemical studies
of major and trace elements and iii) Nd-Sr-Pb bulk-rock isotopic compositions.

Previous Work
The Antarctic Peninsula Batholith intrudes in the north the Paleozoic-Mesozoic low-grade
meta-sedimentary rocks of the Trinity Peninsula Group (e.g. Castillo et al., 2016), and the
Late Jurassic-Paleogene volcanic-sedimentary fore-arc sequences (e.g. Herv et al., 2006;
Bastias, 2014). Further south, it intrudes schists and ortho- and paragneisses with Triassic to
Carboniferous metamorphic ages (e.g. Flowerdew et al., 2005; Leat et al., 1995). Jurassic
plutons are localized mainly in the central Antarctic Peninsula. They are peraluminous with
high 87Sr/86Sri, and are considered to be the product of partial fusion produced by the input
of mafic magmas in a crust composed of schists and gneisses (Leat et al., 1995). Early
Cretaceous plutons crop mainly along the west flank. They are dominated by metaluminous
with relatively low 87Sr/86Sri compositions that have been interpreted to be formed by locally
garnet-bearing in the lower crust (Leat et al., 1995).
The magmatic activity of the Antarctic Peninsula Batholith spans from the Middle Triassic
to the Miocene with a peak during the Early Cretaceous. However, there are gaps in the Early
Jurassic and Late-Jurassic-Early Cretaceous, which have been interpreted as arc compression
(Leat et al., 1995).
Results

79 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

The samples are located in the plutons and dikes from the west coast of the northern Antarctic
Peninsula and the South Shetland Islands. The U-Pb zircon ages range between ~160 Ma
(Stonington Island) to ~9 Ma (Cornwallis Island), with a peak in the Early Cretaceous (Albian
and Aptian). The geochemical composition shows prevalent calc-alkaline metaluminous,
supra-subduction zone rocks (Pearce et al., 1984), with no significant variation in the time.
Although, some intrusions in the period of ~ 118-112 Ma yielded peraluminous signatures.
The compositions of the trace elements in the magmatic rocks consistently show
characteristic convergent margin affinities (Pearce, 1996). Generally, rocks are enriched in
LILE/HFSE, negative NB, P and Ti anomalies, and flat REE. The Upper Jurassic to Eocene
intrusions were emplaced in a constant, approximately stationary position, at the west flank
of the Antarctic Peninsula. Nevertheless, the Miocene magmatism is displaced ~50 km
westwards, which is currently exposed on Watkin Island (~22 Ma), Snodgrass Island (~19
Ma), Litchfield Island (~19 Ma) and Cornwallis Island (~26 Ma).

Discussion
Major and trace elements compositions suggest that the plutonic rocks of the Antarctic
Peninsula Batholith was formed in an arc setting during the ~ 160 Ma to the 22 Ma. The new
crystallization ages suggests that the position of the magmatic arc was stationary during the
period of ~ 160 to 20 Ma. This is inconsistent with a terrane collision event at ~ 100 Ma,
which probably caused an outboard shift of the arc axis. The identification of a westward
displacement of the Miocene rocks may be related to the formation of the oceanic lithosphere
of the Scotia Plate at the north, by changing the configuration of the regional plate dynamics,
provoking a westward migration of the arc. The Miocene magmatism (~ 26 to 22 Ma)
represents the last record of the activity of the subduction in the Antarctic Peninsula. The
westward displacement registered in this period may be due to a retreat in the trench.

Acknowledgments
Authors would like to thanks the support of INACH for the 2015-2016 field campaign in the
frame of the RT0614-project.

References
Bastias, J. 2014. Mineraloga y geocronologa U-Pb en las Islas Shetland del Sur, Antartica, un multienfoque
para Punta Hannah, Isla Livingston y Cabo Wallace, Isla Low (Ms Thesis) Geology Department, Universidad
de Chile, Santiago (http://www. repositorio.uchile.cl/handle/2250/115611).
Castillo, P., Fanning, M., Herv, F., Lacassie, J.P. 2015. Characterisation and tracing of Permian magmatism
in the south-western segment of the Gondwanan margin; UPb age, LuHf and O isotopic compositions of
detrital zircons from metasedimentary complexes of northern Antarctic Peninsula and western Patagonia.
Gondwana Res. http://dx.doi.org/10.1016/j.gr.2015.07.014.
Herv, F., Faundez, V., Brix, M., Fanning, M. 2006. Jurassic sedimentation of the Miers Bluff Formation,
Livingston Island, Antarctica: evidence from SHRIMP U-Pb ages of detrital and plutonic zircons. Antarctic
Science, 18(2): 229-238.
Flowerdew, M., Millar, I., Vaughan, A., Leat, O. 2005. Age and tectonic significance of the Lassiter Coast
Intrusive Suite, Eastern Ellsworth Land, Antarctic Peninsula. Antarctic Science, 17, 443-452.
Leat, P., Scarrow, J., Millar, I. 1995. On the Antarctic Peninsula batholith. Geological Magazine, 132 (4): 399-
412.
Suarez, M. 1976. Plate-tectonic model for southern Antarctic Peninsula and its relation to southern Andes.
Geology, 4, 211-214.
Pearce, J., Lippard, S., Roberts, S. 1984. Characteristics and tectonic significance of supra-subduction zone
ophiolites. Journal of Petrology, 25(4): 986-983.
Pearce, J. 1996. Sources and settings of granitic rocks. Episodes ,19: 120-125.

80 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Vaughan, A.; Storey, B. 2000. The eastern Palmer Land shear zone: A new terrane accretion model of the
Mesozoic development of the Antarctic Peninsula. Journal of the Geological Society, 157:1243-1256.

81 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

LEVADURAS ANTRTICAS. PRODUCCIN Y CARACTERIZACIN DE


-GLUCOSIDASAS
(Studies of Antarctic yeast for -glucosidase production)

Bezus, B.1; Cano, C. 2; Garmendia, G.3; Vero, S.3; Cavalitto, S.1 y Cavello, I1.
1
CINDEFI (UNLP, CONICET La Plata). 50 y 115, La Plata, Bs As - Argentina. 2 Departamento de
Investigacin en Alimentos, Fac. de Cs Qcas, UAdeC, Coahuila, Mxico. 3Ctedra de Microbiologa,
Departamento de Biociencias, Facultad de Qumica, Universidad de la Repblica, Montevideo, Uruguay.
Email: icavello@biotec.quimica.unlp.edu.ar

Durante las ltimas dcadas se ha reconocido el potencial biotecnolgico de los


microorganismos adaptados al fro, que ofrecen beneficios tanto desde un punto de vista
econmico como ecolgico. Las enzimas que stos producen ofrecen la ventaja de ser
altamente activas a temperaturas moderadas y bajas, en contraparte con sus homlogas
mesfilas, propiedades de inters tanto en la investigacin bsica como en la industria
(Margesin et al., 2005). La industria alimenticia ha mostrado un creciente inters por las
enzimas, en particular el sector vitivincola ha centrado su atencin en las pectinasas y las
glucosidasas. Estas ltimas cumplen un rol fundamental en el desarrollo de perfil de aroma
en vinos, ya que liberan por hidrlisis los terpenos voltiles a partir de sus precursores
glucosilados no voltiles. Las -glucosidasas presentes en la uva por lo general son inestables
en las condiciones de produccin de vino (pH cido, presencia de etanol), por lo que la
atencin se ha centrado en la bsqueda de enzimas exgenas (Barbagallo et al., 2004). La
prospeccin entre microorganismos adaptados al fro ofrece la posibilidad de descubrir
enzimas con nuevas propiedades, y con la ventaja de obtener altas velocidades catalticas a
temperatura ambiente o menores, lo cual es de sumo inters a nivel industrial.

Objetivo
Se plante como objetivo la bsqueda y seleccin de una cepa antrtica capaz de producir la
enzima -glucosidasa en cultivos sumergidos utilizando residuos agroindustriales como
sustrato y la posterior caracterizacin del extracto enzimtico producido por dicha levadura.

Materiales y Mtodos
Microorganismos - Bioprospeccin de la produccin de -glucosidasas
Se trabaj con una coleccin de levaduras antrticas provenientes de la Isla Rey Jorge
(expediciones 2012-2013). La bsqueda se realiz utilizando el medio Glicerol Esculina
Agar (Gonzalez-Pombo et al., 2008) en el cual las cepas productoras de -glucosidasa
desarrollan un halo color marrn-parduzco alrededor de la colonia, seleccionndose aquella
con mayor relacin halo/tamao de colonia.
Produccin de -glucosidasas en cultivos sumergidos con diferentes sustratos
Para el estudio de la produccin enzimtica en cultivos sumergidos se realizaron una serie de
cultivos utilizando un medio mineral mnimo con diferentes residuos como sustratos: pomaza
de uva, afrecho de trigo, cascara de naranja dulce y cascara de naranja amarga (10g/l, 20C,
120 rpm). A su vez se realizaron cultivos utilizando glucosa (20 g/l, YPD), celobiosa (20 g/l,
YPC) y una mezcla de glucosa y celobiosa (16 g/l de celobiosa, 4 g/l de glucosa, YPD+C)
como fuentes de carbono. Para cada cultivo se tomaron muestras diariamente durante 5 das,

82 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

determinndose la actividad -glucosidasa de acuerdo al protocolo de Gonzlez-Pombo et


al. (2008).

Caracterizacin de los extractos enzimticos obtenidos


Los extractos enzimticos provenientes de los medios en los que se detect la mayor
actividadfueron caracterizados bioqumicamente determinndose el pH ptimo y la
estabilidad al pH. Se estudi el efecto de la glucosa, etanol, metabisulfito de sodio, EDTA y
distintos iones metlicos sobre la estabilidad de la enzima.
SDS-PAGE acoplado a zimograma
Para cada uno de los extractos enzimticos se realiz SDS-PAGE acoplado a zimograma.
Para la realizacin del zimograma, luego de la corrida electrofortica el gel se sumergi en
Tritn X-100 (2.5% v/v) para reconstituir la enzima. Luego, se incub con 4-
metilumberifenil-b-D-glucopiransido (MUG, 0.5 mM). Luego de 30 min de incubacin las
bandas se visualizaron bajo luz UV (=365 nm).

Resultados
El 44% de las levaduras provenientes de la Isla Rey Jorge fue capaz de producir b-glucosidasa
en medios solidos agarizados, siendo Guehomyces pullulans 8E la levadura seleccionada para
continuar con el estudio de la produccion enzimtica por presentar la mayor relacion halo de
hidrolisis / tamao de colonia.
Para el estudio de la produccin enzimtica por parte de G. pullulans se realizaron cultivos
sumergidos utilizando distintos sustratos, entre ellos varios residuos agroindustriales
(pomaza de uva, afrecho de trigo, cascara de naranja dulce y cascara de naranja amarga). En
todos los casos, la actividad -glucosidasa se detect a partir de la primera muestra a las 24h
de cultivo. La mxima produccin enzimtica se obtuvo utilizando pomaza de uva (0.009
U/ml, 24 -26h), seguida por naranja dulce (0.009 U/ml, 54-56 h). Tanto para Naranja amarga
como para Afrecho de trigo la mxima actividad enzimtica fue de alrededor de 0.003 U/ml.
En cuanto a los medios comnmente utilizados para la produccin de -glucosidasa (YPD,
YPD+C, YPC) se observ que la presencia de celobiosa aumenta la expresin enzimtica en
un 900% (0.0009 U/ml) comparado a lo expresado en presencia de glucosa (0.0001 U/ml),
haciendo suponer la presencia de al menos una - glucosidasa inducible expresada por G.
pullulans.
En cuanto a la caracterizacin de los extractos enzimticos provenientes de los cultivos YPC,
pomaza de uva y de naranja, se pudo observar que el pH ptimo de los extractos se encuentra
entre 3.0 y 4.0, siendo ms amplio para el caso del extracto enzimtico obtenido en el medio
YPC (3.0-6.0).
Con respecto a la estabilidad de los extractos enzimticos frente a distintas concentraciones
de glucosa, se observ inhibicin por glucosa a todas las concentraciones estudiadas, sin
embargo esta inhibicin fue ms evidente para los extractos enzimticos provenientes de los
cultivos de pomaza de uva y cscara de naranja. En cuanto al extracto enzimtico proveniente
de YPC, se observ que el mismo es ms estable incluso a concentraciones de glucosa de
200 g/l donde luego de una hora de incubacin se retiene cerca del 60 % de actividad
enzimtica.
En cuanto a la estabilidad frente a distintas concentraciones de Etanol se observ que,
inversamente a lo sucedido con glucosa, los extractos provenientes de los cultivos de pomaza
de uva y cscara de naranja presentaron un 60% de actividad residual luego de 1h de

83 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

incubacin en presencia de 20% v/v de Etanol, en tanto que el extracto enzimtico


proveniente de YPC present slo un 23% de actividad residual.
Por otro lado, la estabilidad de los extractos enzimticos frente a 140 mg/l de SO2 total (250
mg/l de Metabisulfito de Sodio) se vio muy poco afectada para el caso de los todos los
extractos enzimticos.
Los metales monovalentes y divalentes Na+, K+, Mg+2, Zn+2 Mn+2, Co+2, Hg+2, Ca+2 (1 mM)
presentaron un efecto levemente positivo (aumentando la actividad residual luego de 1 h de
pre-incubacin entre un 10-20%) para los extractos enzimticos provenientes de cultivos con
pomaza de Uva y cscara de Naranja. Del mismo modo la pre-incubacin con EDTA no
modific la actividad enzimtica. Sin embargo, para el caso del extracto enzimtico
proveniente de YPC se observ que Mg+2 y Zn+2 inhibieron la actividad enzimtica, Na+,
Mg+2, Co+2y Ca+ presentaron un efecto positivo en tanto que K+ y Hg+2 no modificaron la
actividad enzimtica. En esta oportunidad, la pre-incubacin con EDTA disminuye la
actividad enzimtica en un 22%.
Con el fin de determinar el perfil enzimtico de los distintos extractos producidos por G.
pullulans se procedi a realizar una electroforesis (SDS-PAGE) acoplada a zimograma. Se
observ que se obtiene diferente bandeo de protenas cuando G.pullulans crece con distintos
sustratos. Al crecer en un medio con celobiosa como sustrato inductor produce al menos dos
enzimas con actividad -glucosidasa detectadas en el zimograma de pesos moleculares
aparentes cercanos a 80 KDa. En tanto que al crecer con pomaza de Uva o cscara de Naranja
produce slo una protena con actividad -glucosidasa de peso molecular aparente cercano a
80 KDa (Fig.1).

Figura 1. SDS-PAGE acoplado a zimograma para la


deteccin de actividad -glucosidasa utilizando MUG
como sustrato. Figure 1. SDS-PAGE and zimogram for the
detection of -glucosidase activity. MUG was used as
susbtrate.

Discusin Y Conclusiones
El presente trabajo se desarroll con el objetivo de contribuir a la investigacin sobre la
potencial aplicacin de levaduras no-Saccharomyces en el desarrollo del aroma en vinos,
centrndonos en la produccin y caracterizacin de extractos enzimticos con actividad -
glucosidasa por una cepa antrtica de G. pullulans. Se demostr que los extractos enzimticos
presentan varias caractersticas atractivas que hacen que pueda ser tenido en cuenta como
potencial candidato en el desarrollo de aromas en vinos blancos. El uso de sustratos de bajo
costo (residuos agroindustriales) produce extractos enzimticos similares bioqumicamente
entre s, en tanto que en presencia de celobiosa el extracto producido difiere de los anteriores.
Una de las caractersticas ms atractivas que presentan estos extractos es el pH ptimo de
trabajo que presentan. Todos los extractos enzimticos poseen pH ptimo cido entre 3-4,
que es el pH de los vinos. Generalmente las -glucosidasas producidas por levaduras son

84 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

inestables o presentan baja actividad a estos pH (Barbagallo et al., 2004). Si bien la actividad
enzimtica es inhibida por glucosa (para el caso de cultivos con pomaza de Uva o cscara de
naranja), esto no presenta un obstculo importante, dado que este tipo de enzimas
generalmente se agregan al vino al final de la fermentacin alcohlica, momento en el cual
el porcentaje de azcar es bajo. Estas propiedades la convierten en una opcin prometedora
para su futura utilizacin en el proceso de desarrollo de aroma en vinos. Con respecto al
estudio de la produccin de este tipo de enzimas por parte de levaduras antrticas, existe un
reporte del ao 2002 en donde se realiza la bsqueda y estudia la produccin por parte de
Cryptoccocus albidus de -glucosidasa utilizando celobiosa (Pavlova et al., 2002). Este es el
primer reporte de la produccin y caracterizacin sistemtica de -glucosidasas por la
levadura antrtica G. pullulans.

Agradecimientos
Al CINDEFI-CONICET, Instituto Antrtico Uruguayo, ANII, Pedeciba.

Referencias
Barbagallo R. N., Spagna G., Palmeri R., Restuccia C. & Giudici P. 2004. Selection, characterization and
comparison of -glucosidase from mould and yeasts employable for enological applications. Enzyme and
Microbial Technology 35: 58-66.
Gonzalez-Pombo P., Prez G., Carrau F., Guisn J. M., Batista-Viera F. & Brena B. M. 2008. One-step
purification and characterization of an intracellular -glucosidase from Metschnikowia pulcherrima.
Biotechnology Letters 30: 1479-1475.
Margesin R., Fauster V. & Fonteyne P. A. 2005. Characterization of cold-active pectate lyases from
psychrophilic Mrakia frigida. Letters in Applied Microbiology. 40: 453-459.
Pavlova K.,Angelova G.,Savova I.,Grigorova D. & Kupeno L. 2002. Studies of Antarctic yeast for -
glucosidase production.World Journal of Microbiology and Biotechnology 18: 569-573.

85 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

EVALUACIN DEL POTENCIAL BIOTECNOLGICO DE LEVADURAS


AISLADAS DE LA PENNSULA FILDES
(Assessment of the biotechnological potential of yeasts isolated from Fildes Peninsula)

Bezus, B.1; Costa, M.1; Garmendia, G.2; Vero, S.2; Cavalitto, S.1 y Cavello, I1.
1
CINDEFI (UNLP, CONICET La Plata). 50 y 115, La Plata, Bs As - Argentina. 2Ctedra de Microbiologa,
Departamento de Biociencias, Facultad de Qumica, Universidad de la Repblica, Montevideo, Uruguay.
Email: icavello@biotec.quimica.unlp.edu.ar

Los ambientes fros se encuentran ampliamente distribuidos alrededor en nuestro planeta,


entre ellos se incluyen las zonas polares, montaas, y profundidades de mares y ocenos. La
Antrtida se considera el lugar terrestre ms fro y con menor disponibilidad de agua, y
adems recibe diariamente altos niveles de radiacin solar (Carrasco et al., 2012). A pesar de
estas condiciones adversas para la vida, ha sido ampliamente colonizada por distintos seres
vivos, entre ellos una amplia variedad de bacterias, hongos, algas y levaduras. A modo de
adaptacin, estos organismos han evolucionado para lidiar con estas condiciones extremas,
desarrollando distintos cambios estructurales al nivel de membranas, protenas constitutivas
y enzimas (Gerday et al., 2000). stas ltimas han sido foco de atencin en los ltimos
tiempos, ya que al provenir de microorganismos adaptados al fro poseen potencial en
distintas aplicaciones biotecnolgicas (Martorell et al., 2017). Entre sus propiedades
generales, pueden mencionarse las altas velocidades catalticas a moderadas y bajas
temperaturas (dadas por su alta flexibilidad), su elevado nivel de estereoespecificidad, y su
termolabilidad. Estas caractersticas permiten que puedan ser utilizadas a temperaturas bajas
o moderadas, siendo innecesarios ciclos de calentamiento, evitando reacciones indeseadas
que podran ocurrir a temperaturas mayores, y la ventaja de poder ser inactivadas por
temperatura cuando sea requerido, ofreciendo beneficios econmicos en cuanto al uso de
energa (Cavicchioli et al., 2002). Entre los microorganismos estudiados provenientes de
zonas fras, la mayora pertenecen al reino Bacteria, mientras que las levaduras han sido
estudiadas en menor proporcin (Margesin et al., 2005; Martorell et al., 2017). La
bioprospeccin de enzimas entre levaduras adaptadas al frio nos ofrece la oportunidad de
encontrar nuevas enzimas, que pueden ser de mucha utilidad tanto en el campo de la ciencia
bsica como la aplicada. El objetivo del presente trabajo fue el aislamiento, identificacin y
caracterizacin de levaduras antrticas provenientes de muestras recolectadas durante la
campaa Antarkos XXXII (Mayo 2016). Se estudi la bioprospeccin de enzimas de inters
biotecnolgico y la tolerancia a metales pesado.

Materiales y Mtodos
Sitios de muestreo, aislamientos e identificacin de levaduras adaptadas al fro.
Durante la Expedicin Antarkos XXXII (BCAA-Mayo 2016) se recolectaron 11 muestras
slidas de las zonas 125a, 125d, 125g y 125f sealadas en la Figura 1 (depsitos de lquenes
en afloramientos rocosos, guano de pinginos, y material particulado encontrado sobre rocas,
musgos y plumas y guano de pingino) as como tambin muestra de agua marina de la zona
125d - Half Three Point. Para el aislamiento de levaduras 1 g de muestra se puso en contacto
con 9.0 ml de solucin fisiolgica y se realiz el plaqueo de distintas diluciones en Dicloran
Rosa de Bengala Cloranfenicol Agar (DRBC). En el caso de la muestra de agua marina, la
misma se filtro a travs de filtros de 0.45 mm de poro reticulado y luego se coloc el filtro

86 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

en una placa de DRBC. Las placas se incubaron a 6 y 20C y se observaron diariamente


durante 7 y 15 das, respectivamente. Se seleccionaron aquellas colonias que presentaron
diferente morfotipo, las cuales fueron purificadas por agotamiento en placas de YPD. La
identificacin se llev a cabo a nivel de especie por anlisis de secuencias de la regin D1/D2
divergente del gen 26S rDNA (Peterson y Horn, 2009).

Figura 1. Mapa de la Pennsula Fildes. En crculo se


indican los sitios de muestreo. Figure 1. Map of
Fildes Peninsula. Sampling location are pointed with
circle.

Perfil de enzimas extracelulares


El perfil de actividades enzimticas propio de cada levadura aislada se estudio utilizando
diferentes medios agarizados suplementados con el sustrato de la enzima que se deseaba
estudiar. De este modo, para el estudio de la produccin de proteasas se utiliz agar leche.
Para el estudio de xilanasas, celulasas, amilasas e inulinasas se utilizo un medio compuesto
por (gL-1): 2.0 extracto de levadura, 5.0 peptona, 0.5 MgSO4, 0.5 NaCl, 0.15 CaCl2 y 20.0
agar suplementado con xilano, carboximetilcelulosa, almidn soluble o inulina (10 gL-1)
respectivamente. El estudio de la produccin de pectinasas se llev a cabo en un medio
conteniendo pectina ctrica como sustrato y (gL-1): 1.4 (NH4)2SO4, 2.0 K2HPO4, 0.2
MgSO4.7H2O y 1 ml de una solucin de metales traza. El estudio de la produccin de
esterasas se llev a cabo en un medio suplementado con Tween 80 y en el caso de -
glucosidasa se utiliz el medio Esculina Glicerol Agar definido por Perez et al., 2010. Luego
de 7 das a 20C o 14 das a 6C las placas conteniendo xilano o carboximetilcelulosa se
revelaron con una solucin de Rojo Congo-NaCl y las que contenan almidn o inulina se
revelaron con solucin de Lugol (Carrasco et al., 2012). El desarrollo de un halo de
degradacin alrededor de la colonia es indicativo de la produccin de la enzima en estudio.
La produccin de -glucosidasa se evidenci por la aparicin de un halo marrn alrededor
de la colonia.
Evaluacin de tolerancia a metales en levaduras antrticas
La tolerancia a metales pesados por parte de las levaduras antrticas se llevo a cabo mediante
un ensayo cualitativo de difusin en agar. Se prepar medio YNBG (0.5%) al cual se le
perfor un dique de 7.0x0.5x0.3cm (largo x ancho x profundidad). Las colonias se sembraron

87 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

perpendicularmente al dique y luego ste se llen con 900 l de la solucin acuosa del metal
a estudiar. Como control negativo se utiliz una cepa de Saccharomyces cerevisiae.

Resultados y Discusin
Durante la ltima campaa antrtica del ao 2016 se recolectaron muestras de suelos,
musgos, material de nidos e incluso guano de pingino y muestras marinas de las cuales se
logr aislar e identificar un total de 45 levaduras. Segn su capacidad de crecer a temperaturas
mayores de 20C se logr clasificar a las mismas en psicrfilos facultativos o psicrotolerantes
(n=20) y psicrfilos estrictos (n=15). Las 15 levaduras psicrofilas estrictas pertenecen a los
gneros Mrakia, Phenoliferia y Holtermaniella, en tanto que las psicrotolerantes pertenecen
a los gneros Cystobasidium, Cryptococcus, Debaryomyces y Metschnikowia. En este
estudio las levaduras del gnero Mrakia fueron las ms frecuentemente aisladas, seguidas las
pertenecientes al gnero Cystobasidium y Cryptococcus (Figura 2).

Figura 2. Diversidad de levaduras adaptadas


al fro (Campaa 2016). Figure 2. Yeast
biodiversity adapted to cold. (Campaa
2016)

Basados en la literatura, las levaduras que habitan provenientes de hbitats martimos y


terrestres de regiones antrticas y sub-antrticas pertenecen principalmente a los gneros
Cryptococcus, Candida, Rhodotorula y Mrakia (). En este trabajo, otros gneros como
Phenoliferia, Holtermaniella, Debaryomyces y Metschnikowia han sido tambin aislados.
Levaduras del gnero Mrakia han sido aisladas de varias regiones fras del mundo como el
rtico, Alaska, Alpes, Patagonia y Antrtida. Tsuji et al. (2013) reporta que el 35% de las
levaduras cultivables aisladas de sedimentos de lagunas y suelo del Este antrtico pertenecen
a este gnero, resultados similares fueron reportados por Martorell et al. (2017).
El estudio de la produccin de enzimas extracelulares se dividi en dos: la capacidad de
producir enzimas extracelulares por parte de las levaduras psicrotolerantes fue estudiada a
6C y a temperatura ambiente, en tanto que para las levaduras psicrfilas este estudio se
realiz solo a 6C. Se pudo observar que ninguna de las levaduras psicrotolerantes fue capaz
de producir actividad proteoltica a ninguna de las dos temperaturas estudiadas. El 50% de
las levaduras psicrotolerantes fue capaz de producir -glucosidasa a 20C, un 40% produjo
actividad esterasa y una menor proporcin fue capaz de producir amilasas, inulinasas y
xilanasas (20%). Se pudo observar que los porcentajes de produccin enzimtica disminuy
al ser estudiadas a 6C, salvo para la actividad celuloltica que se increment de un 15 a un
20%, respectivamente. Las levaduras identificadas como Cryptococcus victoriae (n=5)
fueron las que demostraron el mayor nmero de enzimas extracelulares, C. victoriae 3.1.

88 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

2016 y C. victoriae 3.3.2016 expresaron 6 de las 8 actividades estudiadas, en tanto que la


cepa aislada de agua marina C. victoriae 3.2016 fue capaz de desplegar 5 de las 8 estudiadas.
En cuanto a las levaduras psicrfilas, se observ que todos los aislamientos produjeron al
menos dos actividades enzimticas. Ninguna fue capaz de producir actividad xilanoltica, sin
embargo el 87% fue capaz de producir actividad proteoltica y el 73 % actividad -
glucosidasa y esterasa. El 60% produjo actividad celuloltica y el 40% produjo actividad
inuloltica. Siendo estos porcentajes mayores a los obtenidos para el grupo de las levaduras
psicrotolerantes. El 100% de las levaduras identificadas como Mrakia sp. fueron capaces de
desarrollar actividad proteoltica, celuloltica y -glucosidasa. Del mismo modo, el 100% de
las levaduras identificadas como Phenolifera psychrophila produjeron actividad proteasa,
esterasa, amilasa, inulinasa y -glucosidasa.
Existen varios estudios que demuestran que levaduras provenientes de ambientes extremos
pueden ser aplicadas en la bioremediacin de efluentes lquidos de origen industrial. Por esta
razn se estudi la tolerancia de las levaduras psicrotolerantes a diferentes metales pesados
utilizando la tcnica de difusin en agar. Ninguna de las levaduras estudiadas fue tolerante
al ion Cu+2 (1.5 gL-1), sin embargo el 100% de ellas resultaron tolerantes al ion Li+1 (6.5 gL-
1
). El 85% de las levaduras resultaron ser tolerantes tanto a Ni+2 como a Zn+2 y el 65%
tolerante a Cd+2.

Conclusiones
A partir de los resultados obtenidos se puede observar que las levaduras aisladas en esta
campaa pueden contribuir a los procesos industriales que requieren enzimas con alta
actividad cataltica a bajas temperaturas y tambin podran utilizarse en el tratamiento de
efluentes contaminados con metales como nquel y zinc. Los mtodos qumicos tradicionales
para el tratamiento de metales pesados son solo efectivos para altas concentraciones de los
mismos, pero no a bajas concentraciones, por lo que el uso de estas levaduras podra ser un
complemento que mejore los tratamientos disponibles.

Agradecimientos
Al CINDEFI-CONICET, Instituto Antrtico Uruguayo, ANII, Pedeciba.
Referencias
Carrasco M., Rozas J. M., Barahona S., Alcano J., Cifuentes V. & Baeza M. 2012. Diversity and extracellular
enzymatic activities of yeasts isolated from King George Island, the sub- Antarctic region. BMC Microbiology.
12:251.
Cavicchioli R., Siddiqui K. S., Andrews D. & Sowers K. R. 2002. Low-temperature extremophiles and their
applications. Current Opinion in Biotechnology. 13: 253-261.
Gerday C., Aittaleb M., Bentahir M., Chessa JP, Claverie P., Collins T., DAmico S., Dumont J., Garsoux G.,
Georlette D., Hoyoux A., Lonhienne T., Meuwis MA. & Feller G. 2000. Cold-adapted enzymes: from
fundamentals to biotechnology. Trends in Biotechnology. 18(3):103-107
Margesin R., Fauster V. & Fonteyne P. A. 2005. Characterization of cold-active pectate lyases from
psychrophilic Mrakia frgida. Letters in Applied Microbiology . 40: 4534.
Martorell M. M., Ruberto L. A. M., Fernndez P. M., Castellanos de Figueroa L. I. & Mac Cormack W. P.
2017. Bioprospection of cold-adapted yeasts with biotechnological potential from Antarctica. Journal of Basic
Microbiology. 9999: 1-13.

89 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ESTUDIO PRELIMINAR DE COPROLITOS DE LA FORMACIN AMEGHINO


(JURSICO TARDO) DE LA PENNSULA ANTRTICA
(Preliminary study of the coprolites from the Ameghino Formation (Late Jurassic) of the
Antarctic Peninsula)

Bigurrarena Ojeda, M.A.1, Gouiric-Cavalli, S.2,3, Prez, L.M.3,4, Reguero, M.2,5


1
Facultad de Ciencias Naturales y Museo, Universidad Nacional de La Plata, Calle 122 y 60, B1900FWA, La
Plata, Buenos Aires, Argentina. mauricioandres.b.ojeda@gmail.com. 2Divisin Paleontologa Vertebrados,
Museo de La Plata, Facultad de Ciencias Naturales y Museo, Universidad Nacional de La Plata, Paseo del
Bosque s/n, B1900FWA, La Plata, Buenos Aires, Argentina, gouiric@fcnym.unlp.edu.ar. 3CONICET,
Consejo de Investigaciones Cientficas y Tcnicas, Godoy Cruz 2290 C1425FQB, Ciudad Autnoma de
Buenos Aires, Argentina. 4Divisin Paleozoologa Invertebrados, Museo de La Plata, Facultad de Ciencias
Naturales y Museo, Universidad Nacional de La Plata, Paseo del Bosque s/n, B1900FWA, La Plata, Buenos
Aires, Argentina. pilosaperez@gmail.com. 5Instituto Antrtico Argentino, Campus Miguelete, 25 de Mayo
1151, 3 piso B1650HMK, San Martn, Buenos Aires, Argentina. egui@fcnym.unlp.edu.ar

La Direccin Nacional del Antrtico (DNA) a travs del Instituto Antrtico Argentino (IAA),
anualmente lleva a cabo las denominadas Campaas Antrticas de Verano (CAV). En dichas
campaas se enmarca la labor paleontolgica de numerosos investigadores de la Divisin de
Paleontologa de Vertebrados del Museo de La Plata (FCNyM-UNLP), tan es as, que en
enero de 2016 se realiz la primera exploracin paleontolgica con personal de dicha divisin
a los afloramientos marinos del Jursico tardo de la Formacin Ameghino. El rea
prospectada, se ubica en la Pennsula Antrtica (Cabo Longing), cercana al refugio
Ameghino. Como resultado, se recuperaron una gran cantidad de restos de vertebrados, en
su mayora ostectios, escasos restos de reptiles marinos, plantas vasculares y numerosos
coprolitos (Fig. 1).

Figura 1. Pennsula Antrtica, localidad prospectada (crculo rojo,


CAV2016), en la Formacin Ameghino, Cabo Longing.
Figure 1. Antartic Peninsula, prospected locality (red circle,
CAV2016), in the Ameghino Formation, Cape Longing.

El trmino coprolito (del griego kopros= estircol, y lithos= piedra) fue acuado por
William Buckland (1829) para hacer referencia a defecaciones fosilizadas de vertebrados,
reconocidas por su estructura y morfologa (Aceolaza, 2012). Existen profusos estudios
sobre este tipo de evidencia fsil, cuenta de ello se puede consultar en la sntesis realizada
por Hntzschelet al. (1968). La geologa de la Formacin Ameghino (= Nordenskjld) ha
sido estudiada en detalle (ej. Medina y Ramos, 1982; Farquharson, 1982; Whitham y Doyle,
1989; Whitham, 1993; Kiesslinget al. 1999; Scasso y Kiessling, 2001; Scasso, 2001) a partir
de lo cual fueron definidos dos miembros. Uno inferior, denominado Mb. Longing
(Kimmeridigiano-Titoniano tardo temprano), con depsitos caracterizados como de un
ambiente anxico, y uno superior, Mb. Ameghino (Titoniano tardo-Berriasiano), asociado a

90 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

un ambiente disxico. En cuanto a la paleontologa de la Formacin Ameghino, est


caracterizada por el contenido de una fauna de invertebrados compuesta por ammonoideos,
nautiloideos, bivalvos y radiolarios (Medina y Ramos, 1982; Kiessling et al., 1999). En tanto
los vertebrados all preservados, se puede resaltar la existencia de peces, como lo detallan
Richter y Thomson (1989), Arratia et al. (2004) y los reportes preliminares de la CAV 2016,
publicados por Gouiric-Cavalli et al. (2016). En el presente trabajo se reporta y describen los
primeros coprolitos hallados en la Fm. Ameghino. Estas piezas, con contenido de restos de
vertebrados, conforman la primera mencin para el Jursico superior de la Pennsula
Antrtica. El material analizado totaliza 176 piezas, halladas en el Mb. Longing de la
Formacin Ameghino. La muestra permitir realizar observaciones y consideraciones
paleoecolgicas y tafonmica de los organismos productores del resto y del ambiente
depositacional en el que fue preservado.

Materiales y Mtodos
Los materiales analizados se encuentran alojados en el Repositorio Antrtico de Colecciones
Paleontolgicas y Geolgicas del Instituto Antrtico Argentino (IAA), bajo los nmeros
IAA-Pv-423 (1 a 170). Para el estudio cuantitativo de los ejemplares se tomaron mediciones
utilizando un calibre digital; en este paso slo se contemplaron aquellas muestras que
presentaban coprolitos completos. Las medidas tomadas fueron: largo mximo (L) y ancho
mximo (A), o simplemente dos mediciones perpendiculares entre s, en los coprolitos
equidimensionales (~ circulares). A partir de stas, se obtuvo la relacin Largo/Ancho (L/A),
para la caracterizacin morfolgica de la muestra. Los elementos medidos se corresponden
con los nmeros IAA-Pv-423 (1 a 105).Los materiales fueron estudiados bajo lupa binocular
Stemi 2000-C. Las imgenes fueron tomadas con una cmara Canon PowerShot G10
montada a la lupa binocular. Los elementos ilustrados (Fig. 2), corresponden a los siguientes
nmeros: IAA-Pv-423 N35; IAA-Pv-423 N14; IAA-Pv-423 N82; y IAA-Pv-423 N68.
Para el anlisis de Rx se utiliz un difractmetro PANalyticalXPert PRO, y se midi el polvo
fino pasado como roca total.

Resultados Preliminares
Anlisis cuantitativo. A partir del anlisis cuantitativo realizado sobre la muestra se pudo
observar que el 38% del material corresponde a piezas incompletas, es decir, que el coprolito
se encuentra fragmentado, mientras que el 62% restante, se encuentran completas. De los
resultados obtenidos, se pudo clasificar los coprolitos completos en: formas circulares (L/A
= 1-1,49), promedios: L= 21,21mm yA=16,80mm, sumando un 58% del total; subcirculares
(L/A = 1,5-1,99), promedios: L= 23,32mm y A=14,16mm, sumando un 31,5% del total; y
elongadas (L/A > 2), promedios: L= 25,53mm y A=
10,52mm, sumando un 10,5%. Cabe destacar la
presencia de coprolitos con contornos
subrectangulares, con ngulos ~ 90 (Fig. 2).
Figura 2: a.- Coprolitocircular (grande), b.- circular (pequeo),
c.- subcircular-subrectangular, d.- elongado. Escala grfica =
10mm. Figure 2: a.- Coprolite circular (large),b.- circular
(small), c.-subcircular-subrectangular, d.- elongated.
Graphicscale = 10mm.

91 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Contenido interno. Se han encontrado principalmente elementos seos fragmentados,


aunque algunos poseen elementos completos asignados a ostectios. Los fragmentos de hueso
ms frecuentes son escamas (hueso compacto), elementos largos (lepidotricos y costillas) y
vrtebras. El anlisis de las escamas permiti diferenciar escamas ganoides, las que en
algunos casos preservan el esmaltoide y escamas cicloides, en las cuales se pueden observar
los circuliy los radiien los campos de la escama. En algunos casos las escamas se preservaron
como una impresin sobre otros elementos seos o sobre el sedimento de la matriz.
Composicin taxonmica. Las vrtebras, escamas, lepidotricos y algunos fragmentos del
crneo han permitido determinar, de manera preliminar, la composicin taxonmica del
contenido de los coprolitos; se han identificado la presencia de aspidorrnquidos
(Actinopterygii, Teleosteomorpha) y telesteos (Actinopterygii, Ichthyodectiformes).
Caractersticas tafonmicas. Todos los coprolitos estudiados presentan fracturas en
mosaico; asimismo, exhiben marcadas diferencias respecto de la coloracin del contenido
interno. Existen piezas de coloracin homognea (blanco, celeste, azul, negro), mientras que
otras presentan variaciones en una misma pieza que combinan el blanco con el azul, blanco
con celeste, y raramente blanco con negro. En muchos casos se observa un relleno mineral
en los huesos (ej. elementos largos huecos), conformado en la mayora por minerales oscuros,
aunque se registran en algunas piezas minerales claros (blanco-grisceos). Algunos minerales
observados, dispuestos en drusas, podran corresponderse con cristales de cuarzo, registrados
en la difractometra de Rx, realizada sobre el material.

Comentarios Finales
La importancia paleoecolgica del estudio de coprolitos radica en la posibilidad de investigar
las relaciones trficas de una comunidad. Si bien, como lo afirman Chin et al. (2002), no es
sencillo reconocer el organismo productor de las fecas (depredador), stas nos brindan una
valiosa informacin sobre los organismos depredados. Adems, puede ayudar a comprender
la historia tafonmica de los restos fsiles y su relacin con el ambiente depositacional. En
este sentido, el reporte de coprolitos con restos de ostectios del Miembro Longing de la
Formacin Ameghino (Jursico superior), permite inferir condiciones preservacionales
especiales en la unidad que merecen ser analizadas en detalle.
Del estudio preliminar del material, se reconocieron claras diferencias morfolgicas
agrupadas en 3 formas generales (circulares, subcirculares y elongadas). Observaciones
detalladas permitieron reconocer diferentes huesos de peces, principalmente escamas,
elementos elongados (lepidotricos y costillas) y vrtebras, todos pertenecientes a ostectios
(Aspidorhynchiformes e Ichthyodectiformes). Este hallazgo permite comparar con unidades
equivalentes del hemisferio sur con condiciones similares, como por ejemplo la Formacin
los Catutos de la Cuenca Neuquina, donde la presencia de los grupos hallados en Fm.
Ameghino, est bien documentada.
Finalmente, los rasgos tafonmicos observados en la muestrapermiten inferir condiciones
depositacionales especiales. La existencia de restos esqueletales frgiles (ej. escamas
inmersos en una matriz con caractersticas variables, tanto en la coloracin como en la
presencia de minerales cristalizados en los espacios vacios de los fragmentos seos, permiten
reconocer diferencias fosil diagenticas entre las piezas. Sumado a las fracturas en mosaico
del hueso periosteal, perpendiculares a los ejes mayores de los huesos alargados y la
disposicin orientada dentro de los coprolitos, permite inferir diferentes vas tafonmicas en
las piezas que componen la muestra. Con las caractersticas observadas en el material
analizado, se impone la necesidad de profundizar y diversificar los anlisis de los materiales,

92 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

as como aumentar la muestra para lograr una poblacin representativa de la unidad y


aumentar la posibilidad de reconocer al gestor de estas fecas jursica.

Agradecimientos
A la DNA e IAA, proyecto: PICTO 2010-0093; ANPCyT, proyecto PICT 2015-0253.

Referencias
Aceolaza, F.G. 2012. Coprolitos en el Terciario (Mioceno Superior-Plioceno Inferior) de Entre Rios
Argentina. ScientiaInterfluvius, 3(1): 41-53.
Arratia, G., Scasso, R. y Kiessling, W. 2004. Late Jurassic fishes from Longing Gap, Antarctic Peninsula.
Journal of Vertebrate Paleontology 24, 4155.
Buckland, W. 1829. On the discovery of coprolites or fossil faeces, in the Lias at Lyme Eegis, and in other
formations. Transaction Geological Society London, 2(3): 223-236.
Chin, K. 2002. Analyses of coprolites produced by carnivorous vertebrates. Paleontological Society Papers, 8:
43-50.
Farquharson, G.W. 1982. Sedimentation in the northern Antarctic Peninsula and its relationship to the southern
Andes. Journal of the Geological Society of London, 139: 721727.
Gouiric-Cavalli, S. y Rasia, L.L. 2016. First record of Pachycormiformes (Osteichthyes, Actinopterygii from
the Mesozoic of Antarctica and the past distribution of the suspension feeding clade. XI Congreso de la
Asociacin Paleontolgica Argentina, General Roca, Ro Negro, Libro de Resmenes 15.
Hntzschel, W., El-Baz, F. y Amstutz, G.C. 1968. Coprolites, an annotated bibliography. Mem. Geol. Soc.
Amer. 108: 1-132.
Kiessling, W., Scasso, R., Zeiss, A., Riccardi, A., and Medina, F. 1999. Combined radiolarian-ammonite
stratigraphy for the Late Jurassic of the Antarctic Peninsula: implications for radiolarian stratigraphy.
Geodiversitas, 21: 687713.
Medina, F.A. and Ramos, A., 1981: Geologa de las inmediaciones del Refugio Ameghino (6426S -58 59O).
Tierra de San Martn, Pennsula Antartica. 8 Congreso Geolgico Argentino, Actas II: 871882.
Richter, M. and Thomson, M.R.A., 1989. The first Aspidorhynchidae (Pisces: Teleostei) from Antarctica.
Antarctic Science, 1: 5764.
Scasso, R.A. y Kiessling, W. 2001. Diagenesis of Upper Jurassic concretions from the Antartic Peninsula.
Journal of Sedimentary Research, 71(1): 88-100.
Scasso, R.A. 2001. High-frequency explosive volcanic eruptions in a Late Jurassic volcanic arc: the Ameghino
Formation, Antartic Peninsula. Journal of Sedimentary Research, 71(1): 101-106.
Whitham, A.G., y Doyle, P. 1989. Stratigraphy of the Upper Jurassic Lower Cretaceous Nordenskjld
Formation of Graham Land, Antarctica. Journal of South American Earth Sciences, 2: 371384.
Whitham, A.G. 1993. Facies and depositional processes in an Upper Jurassic to Lower Cretaceous pelagic
sedimentary sequence, Antartica. Sedimentolgy, 40: 331-349.

93 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

MADRES AL LMITE. EXPLORANDO LOS CAMBIOS CONDUCTUALES DE


FORRAJEO ASOCIADOS AL COSTO DE LA LACTANCIA EN AMBIENTES
EXTREMOS. EL LOBO FINO ANTRTICO (Arctocephalus gazella).
(Moms on the edge. Exploring foraging behavior and the cost of lactation under extreme
environments. The case of the Antarctic fur seal [Arctocephalus gazella])

Borras-Chavez, R.1, Goebel M.E.2, Villegas-Amtmann, S.3, Costa D.P.3, Faria J.M.1 y
Francisco Bozinovic1
1
Center of Applied Ecology and Sustainability-CAPES, Pontificia Universidad Catlica de Chile. Avenida
Libertador Bernardo OHiggins 380, Santiago, Chile. Email: rfborras@uc.cl. 2Antarctic Ecosystem Research
Division, NOAA, NMFS, Southwest Fisheries Science Center, 8604 La Jolla Shores Drive, La Jolla, CA
92037, USA. 3Department of Ecology and Evolutionary Biology, University of California Santa Cruz, Santa
Cruz, California, USA.

Estudiar la conducta de forrajeo asociada a cada especies, es crucial para comprender la


relacin entre la adquisicin de energa y el resultante xito reproductivo, lo que tiene un
efecto directo a escala poblacional. Por esto, las conductas de forrajeo son consideradas como
el puente entre la fisiologa del individuo y la ecologa de poblaciones (Scantlebury et al
2014). Por ejemplo, una decisin a corto plazo de un individuo, como la seleccin de un
hbitat de forrajeo por sobre otro, se ver reflejada en consecuencias a largo plazo como el
crecimiento o sobrevivencia de sus cras (Lea et al 2006). En este contexto, cualquier cambio
en el ambiente que afecte el hbitat donde se alimentan, afectar primero el comportamiento,
por sobre los patrones poblacionales (Morris et al 2009) lo que destaca cun importante es
comprender en detalle todos los aspectos de la ecologa de forrajeo de una especie.
El evento reproductivo ms costoso en trminos energticos para cualquier mamfero es la
lactancia (Gittleman and Thompson 1988) y se hace indispensable poder entender como los
individuos lidian con las mltiples limitaciones de las etapas que componen el periodo de
crianza. El estudio de forrajeadores de lugar central- organismos que desde un hogar base se
desplazan a un lugar distante de forrajeo retornando para entregar alimento a sus cras (Orians
& Pearson 1979) permite determinar cmo en una ventana corta de tiempo, los organismos
logran adquirir la energa suficiente para su propio mantenimiento y el de sus cras, aplicando
diferentes estrategias de maximizacin energtica. Este lapso de tiempo es denominado un
viaje de forrajeo. En este contexto, uno de los modelos marinos mejores estudiados ha sido
el lobo fino antrtico (Arctocephalus gazella).
La conducta de forrajeo del lobo fino antrtico es modelada por dos grupos de factores;
extrnsecos e intrnsecos. Extrnsecos son aquellos asociados al hbitat en el que se
desenvuelven (eg distribucin y abundancia de la presa, variabilidad ambiental, etc. Lea et al
2002, Lea et al 2006) e intrnsecos propios de la especie y de cada individuo. Algunos
elementos intrnsecos, por ejemplo son el tamao y edad de la hembra variables que perfilan
los sitios a explorar (McDonald et al 2009). Aunque conocemos bastante de estos ltimos,
los factores intrnsecos menos estudiados, son aquellos asociados a la presencia o ausencia
de la cra los cuales a su vez estn relacionados directamente con el evento de lactancia. Por
ejemplo, aunque se asume que el primer viaje a alimentarse es diferente a los consecutivos
durante el periodo de crianza, se desconoce cules son aquellas diferencias en la conducta de
forrajeo. Se esperara que estas diferencias fuesen ms agudas an cuando se trata de colonias
al lmite de su distribucin geogrfica y fisiolgica, ya que estn siendo presionadas adems,

94 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

por los factores extrnsecos inherentes al lugar. El objetivo del presente estudio fue
determinar las diferencias en la conducta de forrajeo de hembras de lobo fino antrtico en
tres etapas; (1) Cuando la cra recin ha nacido (primer viaje, asociado a la demanda
energtica de recuperacin post-parto), (2) periodo de lactancia, y (3) viajes realizados
posterior al fallecimiento de la cra (periodo en que la hembra ya no debe proveer de leche a
la cra). Explorar detalladamente como modifican sus conductas en estas etapas a lo largo de
la temporada de crianza, nos permitir determinar el verdadero costo conductual asociado a
la lactancia.
El estudio fue llevado a Cabo en Cabo Shirreff, Isla Livingston (62.459S, 60.789W). Para
este objetivo se analizaron los viajes realizados por 9 hembras capturadas en las temporadas
2016-17. La metodologa de captura e instrumentacin se encuentra descrita en Mcdonald et
al 2009. Time Deph Recorder (TDR) fueron instalados en cada hembra al inicio de la
temporada un da inmediatamente post parto. Las cras fueron marcadas con una letra con
decolorante para pelo para su seguimiento a lo largo de la temporada. Los TDRs fueron
configurados para obtener datos de temperatura, profundidad y luz cada un segundo cuando
el animal se encontraba en el mar. De esta manera se logr obtener la duracin de los viajes,
la duracin del tiempo invertido en la costa de regreso con las cras, la frecuencia de los
buceos y otras 12 variables especficas de cada buceo las cuales no son discutidas en el
presente trabajo. La frecuencia de buceos fue calculada por hora lo que permite entregar una
tasa de buceos/ Hora, que se entiende como una medida de esfuerzo de buceo.
Los viajes obtenidos por hembra fueron divididos en 3 etapas, el 1er viaje post-parto (PP), los
viajes de lactancia (L) y los viajes posteriores a la muerte de la cra (PM). Gracias a un
monitoreo visual diario de las hembras, las cras eran declaradas muertas cuando pasaban 4
das tras la llegada de la hembra desde un viaje. Los instrumentos eran mantenidos en las
hembras 1-3 viajes post-mortem de la cra, salvo para la hembra A44 la cual incluye ms
viajes para efectos grficos pero que no fueron incorporados en el anlisis (Fig 1).
A travs de modelos mixtos lineales que tomaran en cuenta como factor aleatorio las
diferencias individuales por hembra, se analiz si existan diferencias significativas en la
duracin de los viajes, el tiempo de regreso en las colonias y el esfuerzo de buceo
(Buceos/hora) entre los tres grupos (PP, L y PM). Cuando existan diferencias se realiz un
Post Hoc Test Tukey para determinar entre qu grupos se daban dichas diferencias.
Se encontraron diferencias significativas para todas las variables analizadas. La duracin de
los viajes fue significativamente mayor en L (promedio: 3.2 das) que en PM (promedio: 1.3
das) (p= 0.0001) pero no hubo diferencias en la duracin de los viajes entre el primer viaje
de las hembras (PP: promedio: 2.7 das) y los restantes (p=0.6). La duracin de los viajes s
fue distinta entre PP y los viajes Post Partum (PM). Para el caso de hembras lactando al lmite
sur de la distribucin de la especie, el autor ha determinado en trabajos previos (Borras-
Chavez et al in prep) que los viajes son significativamente ms cortos en hembras lactando
en esta rea (promedio de 3.4 das) que en otros sectores donde la hembra se distribuye. Esto
explica el que no existan diferencias entre los PP y los L, ya que para otros sectores donde
los viajes de hembras lactando son ms largos (8 das; Lea et al 2002), se han visto diferencias
en la duracin con respecto al primer viaje post-partum. Interesante sera ver si las reas
exploradas son distintas entre PP y L mediante el uso de GPS.
Respecto al tiempo en costa, el cual se encuentra asociado al tiempo invertido con las cras,
no se tom en cuenta PP en este anlisis ya que para poder obtener tiempos de descanso entre
viajes se necesitan al menos dos viajes y PP solo considera el primer viaje de la hembra. Se
encontraron diferencias significativas (p =0.001) entre L (Promedio: 1.6 das) y PM

95 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

(Promedio: 3.0 das). Esto se debe a que las hembras pasan ms tiempo a la espera de la cra
que ha desaparecido y por lo mismo a su vez, acortan la duracin de los viajes de forrajeo.
Esta estrategia Post-Mortem generalmente dura entre 2 y 4 viajes luego que la cra muere y
posteriormente comienzan a tener viajes regulares nuevamente o en ocasiones no vuelven
hasta la siguiente temporada probablemente tras aceptar que la cra ha desaparecido (Ver
Figura 1).
El esfuerzo de buceo mostro diferencias significativas entre L (17 Buceos/Hr) y PP (10
Buceos/Hr) (p= 0.0001) y entre PP y PM (18 buceos/Hr) (p< 0.001). No hubo diferencias
significativas entre L y PM (p= 0.693). Aunque no se encontraron diferencias en la duracin
de los viajes entre PP y L, si existen diferencias en la manera en la que los individuos se
esfuerzan al bucear. Los individuos muestran una frecuencia de buceo mucho menor en el
primer viaje post parto que en los consecutivos viajes durante la lactancia (10 Buceos/Hr vs
17 Buceos/Hr respectivamente). Esta diferencia puede estar dada por la presin ejercida de
tener que retornar a la brevedad tras haber tenido a sus cras 2 a 3 das previo al primer viaje.
Al no haber diferencias significativas entre los buceos lactando y los buceos post-Mortem,
esto sugiere que las exigencias fisiolgicas de la lactancia siguen operando por un tiempo
incluso tras la muerte de la cra.
La figura 1 es un ejemplo (Hembra N 44) del comportamiento de forrajeo durante las tres
etapas, patrn seguido por la mayora de las hembras. La duracin del viaje y el tiempo en la
costa parecieran ser parte de una misma estrategia de forrajeo ya que ambas variables son
constantes desde el nacimiento hasta la muerte de la cra (Viajes cortos y tiempos en costa
cortos). Esto asegura un aprovisionamiento energtico constante para la cra durante este
periodo. Sin embargo, el esfuerzo de buceo va aumentando a medida que la temporada
transcurre. Esto puede estar relacionado a los requerimientos energticos de las cras, una
cra de 3 kilogramos necesita mucha menos energa que una de 15 kg, peso promedio de las
cras tras los primeros 10 viajes. El primer viaje de la hembra cuenta con reservas de grasa
acumuladas durante el invierno para la produccin de leche. A medida que estas se acaban,
las hembras se ven forzadas a adquirir ms alimento aumentando el esfuerzo de buceo. La
diferencia significativa encontrada en el esfuerzo de buceo entre PP y L tambin pueden
deberse al evento del parto en s, donde el objetivo de las hembras es recuperar fuerzas
realizando buceos cortos pero efectivos. Tras la muerte de las cras, los tiempos en costa
aumentan a la espera de que las cras aparezcan nuevamente pero los tiempos de viaje
disminuyen, permitiendo el retorno rpido de las hembras. El esfuerzo de buceo sigue en
aumento ya que la produccin de leche sigue ocurriendo (los tres viajes Post muerte de la
cra ocurren en un lapso menor a 10 das). Finalmente, cuando la muerte de la cra es asumida
por la hembra, las hembras comienzan nuevamente a realizar viajes ms largos los cuales ya
no siguen un patrn establecido entre el tiempo de duracin de los viajes y el tiempo en costa
(Fig 1).
Entender el detalle de la conducta de forrajeo en cada etapa del periodo de crianza y
particularmente en ambientes extremos, nos permite entender como los organismos lidian
con la obtencin de alimento. Adems, la informacin generada en este tipo de estudios
permite alimentar modelos energticos sobre cunto es el costo de vivir al lmite de la
distribucin geogrfica de la especie. Esto a su vez, permite entender como las especies
podran comportarse ante los nuevos escenarios de cambio climtico predichos. Las
estrategias conductuales asociadas a estas conductas demuestran una clara maximizacin
energtica de los individuos en la corta ventana que tienen para alimentarse. Lograr estimar
tasas metablicas al momento de alimentarse pareciera ser la etapa necesaria en el futuro. El

96 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

acoplamiento de estos datos fisiolgicos y los datos de conducta obtenidos en el presente


trabajo podran revelar el verdadero costo de la lactancia en ambientes extremos.

Figura 1: Duracin de los viajes (Das), Tiempo en la costa (Das) y Tasa de buceo (buceos/Hr) de un
individuo a lo largo de la temporada de
crianza. Cada zona coloreada representa
una etapa distinta de la temporada. La
gris representa el primer viaje Post Parto
(PP), la celeste los viajes realizados
durante la lactancia (L) y en Rosado los
viajes realizados una vez que la cra ya
haba sido declarada muerta (viajes post
Mortem (PM). Figure 1: Length of trips
(Days), Coastal time (Days) and Dive
rate (diving / hr) of an individual in the
length of the breeding season. Each
colored zone represents a different stage
of the season. The gray represents the
first trip postpartum (PP), the light blue,
the trips completed during the lactation
(L) and in pink the trips realized once the
breeding had already been declared dead
(trips post Mortem (PM).

Agradecimientos
INACH N: DT _02-15, Beca
CONICYT Folio N : 21130059. Programa AMLR del National Oceanic and Atmospheric
administration (NOAA).

Referencias
Lea M.A., Hindell M., Guinet C. y Goldsworthy S. 2002. Variability in the diving activity of Antarctic fur seals,
Arctocephalus gazella, at IIes Kerguelen. Polar Biol 25: 269-279.
Lea M.A., Guinet C., Cherel Y., Duhamel G., Dubroca L., Pruvost P. y Hindell M. (2006) Impacts of climatic
anomalies on provisioning strategies of a Southern Ocean predator. Mar Ecol Progr Ser 310: 77-94.
McDonald B.I., Goebel M.E., Crocker D.E., Tremblay Y. y Costa D.P. 2009. Effects of maternal traits and
individual behavior on the foraging strategies and provisioning rates of an income breeder, the Antarctic fur
seal. Mar Ecol Prog Ser 394: 277-288.
Morris D.W., Kotler B.P., Brown J.S., Sundararaj V. y Ale S.B. 2009. Behavioral Indicators for conserving
mammal diversity. Annals of the New York Academy of sciences 1162: 334-356.
Orians G.H. y Pearson N.E. 1979. On the theory of central place foraging. En: Horn DJ, ET Stairs, RT Mitchell
(eds) Analysis of ecological systems. Ohio State University Press, Columbus, OH. 155-177.
Scantlebury D.M., Mills M.G.L, Wilson R.P., Wilson J.W., Mills M.E.J, Durant S.M., Bennett N.S., Bradford
P., Marks N.J. y Speakman J.R. 2014. Flexible energetics of cheetah hunting strategies provide resistance
against kleptoparasitism. Science, 345(6205): 79-81.

97 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

THE HIGHEST TEMPERATURE IN CONTINENTAL ANTARCTICA: FOEHN


EFFECT TRIGGERED BY AN ATMOSPHERIC RIVER)
(La temperatura ms alta en la Antrtida continental: Efecto Foehn gatillado por un ro
atmosfrico)

Bozkurt, D.1, Rondanelli, R.1,2, Marn, J. C.3 and Garreaud, R.1,2


1
Center for Climate and Resilience Research, University of Chile, Santiago, Chile. 2 Department of
Geophysics, University of Chile, Santiago, Chile. 3 Department of Meteorology, University of Valparaiso,
Valparaiso, Chile.

Between 18 and 27 March 2015, the west coast of South America (northern, central, and
southern Chile) as well as the AP experienced a series of extreme hydrometeorological events
just at the beginning of the austral fall. Within these dates, a record high-temperature of
17.5oC occurred on 24 March 2015 at the Esperanza Research Base located near the northern
tip of the Antarctic Peninsula (AP). The event is examined with the goal of identifying large-
and local-scale forcings using surface station data, satellite imagery, and reanalysis data as
well as numerical simulations. MODIS Antarctic Ice Shelf Image Archive of Larsen B Ice
Shelf illustrates a clear immediate trace of ice coverage disintegration as well as melt ponds
on the ice-covered surface, showing a large impact on ice shelves by a single extreme event.
The main synoptic-scale features during the extreme temperature event were an anomalous
northwest-southeast midlevel ridge, a surface anticyclone stretching from South America to
the AP, and a deep low-pressure center over the Amundsen-Bellingshausen Sea. A strong
atmospheric river event resulted in warm and moist air advection toward the AP, eventually
triggering a Foehn episode at Esperanza. A topography removal numerical experiment using
a regional climate model results in the disappearance of the Foehn Effect along the eastern
coast of the AP where maximum near-surface air temperature is reduced by 12oC with respect
to a control simulation, so a large part of the warming anomaly (~ +12oC of ~ +17oC) can be
attributed to Foehn Effect. Although large-scale warm air advection corresponds to a minor
part of the warming anomaly (~ +5oC), it has a crucial role in determining the extremeness
of the temperature event as well as providing water vapor for latent heat release, possibly the
main Foehn mechanism of this event. The evidence of long-term and recent-term trend
changes in near-surface air temperature in the lee side and low-level zonal wind speed and
vapor transport in the windward side highlights that local-scale forcing triggered by large-
scale forcing may play a key role in the occurrence of extreme temperature events over the
AP. The occurrence of these extreme temperature events in the AP opens the questions of
what controls their frequency as well as what is the relative role of these events in the fate of
ice shelves in the eastern side of the AP.

98 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

EL ENSAMBLE DE ESPONJAS EN ISLA DOUMER (PENNSULA


ANTRTICA): RIQUEZA ESPECFICA, ABUNDANCIA Y DISTRIBUCIN
BATIMTRICA
(Sponge assemblage in Doumer Island (Antarctic Peninsula): Species richness, abundance
and bathymetric distribution)

Bravo, D.1,2, Montiel, A.3, Fernandez, J.C.C.4,5, Hajdu, E.4, Gonzlez-Aravena, M.2 y C.A.
Crdenas2
1
Carrera de Biologa Marina, Universidad de Valparaso, Chile. E-mail: d.bravo1602@gmail.com.
2
Departamento Cientfico, Instituto Antrtico Chileno, Punta Arenas, Chile. 3Laboratorio de Hidrobiologa,
Instituto de la Patagonia, Universidad de Magallanes, Punta Arenas, Chile. 4Museu Nacional, Departamento
de Invertebrados, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil. 5Programa de Ps-
Graduao em Oceanografia, Universidade do Estado do Rio de Janeiro, Rio de Janeiro, Brazil.

El ensamble de esponjas constituye un importante componente de la comunidad bentnica


antrtica dominando frecuentemente en estos fondos marinos (Gutt & Starmams 1998;
Dayton et al. 2016). Adems, cumplen numerosos roles funcionales, dentro de ellos brindan
hbitat biognico para otros invertebrados y peces y tambin poseen importantes
asociaciones con diversos microorganismos (McClintock et al. 2005; Bell 2008). Numerosos
reportes indican que en la Antrtica las comunidades bentnicas de la zona submareal poseen
una zonificacin batimtrica (Dayton et al. 1974; Nonato et al. 2000; Gutt 2001; Teixid et
al. 2002; Barnes & Brockington 2003), donde las esponjas se vuelven ms predominantes a
partir de los 20 m de profundidad (Dayton et al. 1974; Zamorano 1983; Barnes &
Brockington 2003). La aparente ausencia de esponjas sobre los 20 metros de profundidad ha
sido atribuida al efecto abrasivo producido por los tmpanos de hielo (EAH), el cual presenta
una relacin inversa al incremento de la profundidad (Dayton et al. 1974; Barnes 2016). En
las reas litorales antrticas, el EAH es mucho ms intenso debido a la alta cantidad de
tmpanos y a la formacin de hielo marino generando condiciones ambientales heterogneas,
por lo que las distribuciones de las especies de esponjas tienden a ser altamente fragmentadas.
Lo anterior resulta en que no se observan patrones continuos en la distribucin de los
organismos bentnicos (Smale 2008). Por otro lado, en Antrtica es importante considerar
que estudios sobre la porferofauna de reas submareales someras ( 20 m) son
considerablemente escasos. En este contexto, los objetivos de este estudio fueron determinar
los patrones de riqueza especfica, abundancia y distribucin batimtrica del ensamble de
esponjas en la zona submareal somera antrtica.
El rea de estudio se ubic en la costa frente a la Base Yelcho (645224S; 633600W)
la cual se encuentra en la Isla Doumer (Archipilago Palmer; Pennsula Antrtica). En verano
de 2016 y 2017 se realizaron transectas submarinas a 10 y 20 m de profundidad por medio
de buceo autnomo, tomando fotocuadrantes (50x50 cm) en cuatro sitios de la isla ubicados
en Cabo Kemp, Canal Peltier y dos en Baha Sur.
A partir de un total de 160 fotocuadrantes (40 m2) se analiz la distribucin, riqueza de
especies y abundancia (cobertura) de esponjas entre sitios y profundidades.
En total se identificaron 17 especies de esponjas alrededor de la isla, siendo Baha Sur y Cabo
Kemp los sitios de mayor riqueza de especies (11), mientras que Canal Peltier present la
menor (3). El anlisis por profundidad indica que la mayor riqueza de especies ocurri a 10
m. Al comparar los datos de riqueza de especies, no hubo diferencias significativas entre

99 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

sitios y profundidades. Por otro lado, no se identific un patrn claro en la distribucin de la


riqueza de especies, siendo ms bien similar alrededor de la isla.
El sitio Cabo Kemp present la mayor abundancia de esponjas (6,1%), mientras que los sitios
restantes presentaron coberturas inferiores a 3%. En trminos de abundancia entre los sitios
muestreados no hubo diferencias significativas. En cuanto a la distribucin de esponjas, no
se encontr un patrn segregado por las dos profundidades estudiadas.
Estudios previos alrededor de la isla describen un total de 10 gneros y 12 especies de
esponjas (Zamorano 1983; Crdenas et al. 2016), menor a lo reportado en el presente estudio.
Dentro de las esponjas identificadas, 6 gneros y slo 3 especies coinciden con la riqueza
taxonmica descrita para la isla, siendo este trabajo una contribucin al conocimiento de la
riqueza taxonmica de la isla.
Como ha sido sugerido por diversos estudios, el EAH es un evento natural con una dinmica
compleja en trminos altamente espaciales y temporales, afectando en diferentes niveles
alrededor de Antrtica (Brown et al. 2004; Smale et al. 2007; Barnes 2016). Los resultados
obtenidos indican la presencia de slo un ensamble de esponjas y reflejan la gran influencia
de tmpanos alrededor de Isla Doumer, actuando en similar magnitud entre los sitios
escogidos y las profundidades de 10 y 20 m. Nuestros resultados son consistentes con las
condiciones descritas por Smale (2008) para Isla Adelaida (Pennsula Antrtica), en donde
la condiciones locales del EAH impiden una zonificacin entre las profundidades estudiadas,
lo cual produce el patrn de distribucin observado en el ensamble de esponjas,
constituyendo una zona submareal altamente dinmica y heterognea.

Agradecimientos
A los buzos y personal logstico de INACH. Estudio financiado por Fondecyt #11150129.

Referencias
Barnes, D.K.A. 2016. Iceberg killing fields limit huge potential for benthic blue carbon in Antarctic shallows.
Global Change Biology, doi: 10.1111/ gcb.13523.
Barnes, D.K.A. y Brockington, S. 2003. Zoobenthic biodiversity, biomass and abundance at Adelaide Island,
Antarctica. Marine Ecology Progress Series, 249: 145-155.
Bell, J.J. 2008. The functional roles of marine sponges. Estuarine, Coastal and Shelf Science, 79: 341-353.
Brown, K.M., Fraser, K.P.P., Barnes, D.K.A. y Peck, L.S. 2004. Links between the structure of an Antarctic
shallow-water community and ice-scour frequency. Oecologia, 141: 121-129.
Crdenas, C.A., Newcombe, E.M., Hajdu, E., Gonzlez-Aravena, M., Geange, S.W. y Bell, J.J. 2016. Sponge
richness on algae-dominated rocky reefs in the Western Antarctic Peninsula and the Magellan Strait. Polar
Research, 35: 30532.
Dayton, P.K., Robilliard, G.A., Paine, R.T. y Dayton, L.B. 1974. Biological accommodation in the benthic
community at McMurdo Sound, Antarctica. Ecological Monographs, 44: 105-128.
Dayton, P.K., Jarrell, J., Kim, S., Thrush, S., Hammerstrom, K., Slattery, M. y Parnell, E. 2016. Surprising
episodic recruitment and growth of Antarctic sponges: Implications for ecological resilience. Journal of
Experimental Marine Biology and Ecology, 482: 38-55.
Gutt, J. 2001. On the direct impact of ice on marine benthic communities, a review. Polar Biology, 24: 553-
564.
Gutt, J. y Starmans, A. 1998. Structure and biodiversity of megabenthos in the Weddell and Lazarev Seas
(Antarctica): ecological role of physical parameters and biological interactions. Polar Biology, 20: 229-247.
McClintock, J.B., Amsler, C.D., Baker, B.J. y Van Soest, R.W.M. 2005. Ecology of Antarctic marine sponges:
an overview. Integrated and Comparative Biology, 45: 359-368.

100 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Nonato, E.F., Brito, T.A.S., De Paiva, P.C., Petti, M.A.V. y Corbisier, T.N. 2000. Benthic megafauna of the
nearshore zone of Martel Inlet (King George Island, South Shetland Islands, Antarctica): depth zonation and
underwater observations. Polar Biology, 23: 580-588.
Smale, D.A. 2008. Continuous benthic community change along a depth gradient in Antarctic shallows:
evidence of patchiness but not zonation. Polar Biology 31: 189-198.
Smale, D.A., Barnes, D.K.A. y Fraser, K.P.P. 2007. The influence of depth, site exposure and season on the
intensity of iceberg scouring in nearshore Antarctic waters. Polar Biology 30: 769-779.
Teixid, N., Garrabou, J. y Arntz, W.E. 2002. Spatial pattern quantification of Antarctic benthic communities
using landscape indices. Marine Ecology Progress Series, 242: 1-14.
Zamorano, J.H. 1983. Zonacin y Biomasa de la macrofauna bentnica en Baha South, Archipilago Palmer,
Antrtica. Instituto Antrtico Chileno, Serie Cientfica 30: 27-38.

101 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

TRADE-OFF BETWEEN GROWTH-REPRODUCTION VERSUS FREEZING


TOLERANCE IN RESPONSE TO WARMING ON ANTARCTIC VASCULAR
PLANTS
(Compromiso entre crecimiento-reproduccin versus tolerancia al congelamiento en la
respuesta al calentamiento de las plantas vasculares antrticas)

Bravo, L1, Short, S1, Sierra-Almeida, A23,. Hinostroza, J1, Mella, C1 Acua, K1and
Graether, S4
1
Plant Physiology and Molecular Biology Laboratory, Dpt Agronomic Sciences and Natural Resources,
Universidad de La Frontera, Temuco, Chile .2Ecobiosis, Dpt of Botany, Universidad de Concepcin,
Concepcin, ChilE. 3Institute of Ecology and Biodiversity (IEB), Santiago, Chile. 4Dpt of Molecular and
Cellular Biology, University of Guelph, Ontario, Canada.
leon.bravo@ufrontera.cl

The expansion of populations of vascular plant species Deschampsia antarctica and


Colobanthus quitensis in Maritime Antarctica as a consequence of regional warming of the
Antarctic Peninsula is accepted now by the scientific community (Lewis Smith, 2003, Chown
& Convey 2007, Lee at al., 2017). However, the precise mechanisms by which warming has
caused this population increase (or plant biomass increase) is not yet fully understood, a
combination of growth, vegetative expansion, increased probability of seedling
establishment, increase in the frequency of mature seed production (Convey 1996), and
stimulation of dormant seeds from soil banks are part of plausible mechanisms (Chown &
Convey 2007). Even though warming is more favorable for plant growth, it may have
unsuspected negative consequences. For instance, there is a tradeoff between stress tolerance
and plant growth and productivity (Morales & Munne-Bosch 2016) Therefore, it is possible
to hypothesize that warming will increase plant growth and reproduction but consequently
will reduce plant stress tolerance. In particular, these plant species are very freezing hardy
(Bravo et al., 2001). In this work, we will assess how in situ warming affects freezing
tolerance of Antarctic vascular plants.

Materials and Methods


We have conducted a field experiments near Arctowski Station (62 9'49.62"S;
5828'7.02"W, Almiralty Bay, KGI) by installing open top chambers (OTC) to warm a patch
of vegetation in situ. After 4 years of warming, several physiological parameters were
measured in order to estimate the in situ warming effects on plant growth, using orthogonal
photography of plants and a calibration curve between the rosette area of each plant and its
shoot biomass. The frequency of flowering has been measured in OTC and OS. Additionally,
laboratory experiments at different temperatures (5 and 11C) have been developed to assess
the effect of temperature on reproductive allocation of C. quitensis. Thermal analyses and
freezing tolerance measurements were performed in these two vascular species growing
inside OTC and in the open space (OS). Apoplastic fluid extracted in the field essencially as
described by Bravo and Griffith (2005) was assayed for ice recrystallization inhibition (IRI)
as described by Huges et al., 2013. The apoplastic protein extract was dissolved at different
protein concentration using 30% sucrose. The solution (5 L) was applied between a glass
cover slip and the glass slide, and placed on a freezing stage under a microscope. The sample
was cooled to -40C at a rate of 30C/min, after which the temperature was raised to -6C at

102 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

a rate of 30C/min. At this point the temperature was held constant and a picture was taken
to represent t=0 min. After one hour at -6C, a second picture of the sample was taken to
represent t=60 min. The presence of ice recrystallization inhibition was verified by visual
comparison of samples between t=0 and t=60 min.

Results and Discussion


Our results confirmed that plants of both species accumulated more biomass in OTC than
plants in OS after four growing seasons (Fig. 1). Deschampsia antarctica accumulated more
biomass in all instances OS and OTC than C. quitensis, however, the response of plant growth
to warming differ between species. For instance, in D. antarctica the growth rate was higher
during the first season of measurements (between 2013-2014) and then growth rate tends to
decrease. The opposite was observed for C. quitensis, where the effect of OTC on growth
rate was more pronounced from the second growing season ahead. This is partially consistent
with previos published results (Day et al. 2008, 2009). This is also consistent with a higher
reproductive growth exhibited by both species as a higher frequency of flowers recorded in
the field in OTC. This is also consistent with laboratory experiments in which, under
controlled increased temperature, plants were bigger and produced more flowers (Fig 2A)
but reproductive allocation did not change significantly. Actually, plants growing at lower
temperature (5C) exhibited a tendency to a bigger reproductive effort (Fig 2B). This is not
entirely consisten with previos results (Convey 1996) where these authors have observed a
higher reproductive allocation in plants from warmer latitudes. However, local refuges can
likely account for these discrepancies.

6 4

Da OS Cq OS
5 Cq OTC
Da OTC
3
4
Biomass (g)

Biomass (g)

3 2

2
1
1

0 0
2013 2014 2015 2016 2013 2014 2015 2016
Season Season

Figure 1. Estimation of plant biomass of D. antarctica (Da) and C. quitensis (Cq) during four growing
seasons in plants from OTC and OS. Figura 1. Estimacin de la biomasa de las plantas de D. antarctica (Da)
y C. quitensis (Cq) durante cuatro estaciones de crecimiento en OTC y OS.

103 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

A B

Figure 2. Flowering under two experimental tempereature conditions 5C and 11C. Average number of
flowers/plant (A) during a flowering event (n=8 plants). The number of flowers corrected by the rossette area
of the plant (B) as a proxy of plant size, express the reproductive effort under these two experimental
conditions. Figura 2. Floracin bajo dos condiciones experimentales de temperatura 5C y 11C Promedio de
nmero de flores/planta (A) durante un evento de floracin (n=8 plantas). El numero de de flores por rea de
la roseta, como una aproximacin al tamao de la planta, representa el esfuerzo reproductivo bajo estas dos
condiciones experimentales.

Figure 3. Ice recrystallization inhibition (IRI) in apoplastic extracts of D. antarctica obtained from plant in
the field under in situ warming (OTC) and from a close patch of Antarctic tundra (OS). Figura 3. Inhibicin
de la recristalizacin de hielo (IRI) en extractos apoplsticos de D. antarctica obtenidos en campo bajo
calentamiento in situ (OTC) y desde un parche cercano de tundra antrtica (OS).

Freezing tolerance (LT50) was lower in C. quitensis than D. antarctica, confirming our
previous results (Bravo et al., 2001). Interestingly, vulnerability to freezing damage did not
exhibited significant differences between OTC and OS for both species. Ice nucleation

104 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

temperature (INT) was reduced in OTC growing plants, specially in C. quitensis, this was
not associated to leaf water content differences between OTC and OS observed in C. quitensis
and may reflect a transition from a tolerance mechanism to an ice avoidance supercooling in
OTC treated C. quitensis.
This is not the case of D. antarctica which mantains a similar INT in OTC and OS. The
resilience of D. antarctica was also consistent with plant antifreeze activity determined by
IRI in plants growing under OTC and OS under field conditions, where no major changes
were observed in the IRI activity of apoplastic protein from leaves of D. antarctica (Fig.3)
where it is observed that growth of ice crystals after 60 min of ice recrystallization induction
at -6 was observed at the same protein dilusion of the apoplastic extracts from plants
growing since 2013 in OTC and OS. The dilusion in which IRI was lost was from 0.05 mg/ml
and below in both experimental conditions (Fig. 3).

Conclusions
Warming affect plant growth, promoting bigger plants with more flowers, without necesarilly
altering reproductive allocation or reproductive effort at least in C. quitensis. Plants exposed
to in situ warming after four growing seasons did not exhibited a higher freezing
vulnerability. D. antarctica maintains the investment in cryoprotection such as antifreeze
proteins in the apoplast with similar IRI activity after warming. A lower INT in C. quitensis
growing in OTC may reflect a strategy change from freezing tolerance to avoidance by
supercooling, which according to the literature may be a cost effective change.

Acknowledgments
FONDECYT 1151173, PIA-CONICYT 11-02

References
Bravo L.A. and Griffith M. (2005) Characterization of antifreeze activity in Antarctic plants. Journal
of Experimental Botany. 56: 1189-1196.
Bravo, L.A. , Ulloa, N., Ziga, G. E., Casanova, A., Corcuera, L. J., Alberdi, M. (2001) Cold
resistance in Antarctic angiosperms. Physiologia Plantarum 111: 55-66.
Chown S.L., Convey P. (2007) Spatial and temporal variability across lifes hierarchies in the
terrestrial Antarctic. Phil. Trans. R. Soc. B 362: 23072331.
Convey P (1996) Reproduction of Antarctic flowering plants. Antarct Sci 8:127-134.
Day, T.A., Ruhland C.T. Xiong F.S. (2008) Warming increases aboveground plant biomass and C
stocks in vascular-plant-dominated Antarctic tundra. Global Change Biology 14: 1827-1843.
Hughes S.L., Schart V., Malcolmson J., Hogarth K.A., Martynowicz D.M., Tralman-Baker E., Patel
S.N., Graether SP. (2013) The importance of size and disorder in the cryoprotective effects of
dehydrins. Plant Physiol. 163: 1376-1386.
Lee, J.R., Raymond B., Braceggirdle T.J., Chads I., Fuller R.A., Shaw J.D. (2017). Climate change
drives expansion of Antarctic ice-free habitat. Nature doi:10.1038/nature22996.
Morales M. Munn-Bosch S. (2016) Oxidative Stress: A Master Regulator of Plant Trade-Offs?.
Trends in Plant Science 21: 996999.
Smith R.I.L. (2003) The enigma of Colobanthusd quitensis and Daschampsia antarctica in Antarctica.
In: Huiskes, A. H.L., Gieskes, W.W.C., Roizema, J., Schorno, R.M.L, Van der Vies, S.M. and Wolff,
W.J. (eds) Antarctic Biology in a Global Context. Buckhuys Publisher, Leiden, The Netherlands, pp
234-239.

105 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

VARIABILIDAD Y TENDENCIAS CLIMTICAS EN EL NOROESTE DE LA


PENNSULA ANTRTICA: RECIENTE ENFRIAMIENTO
(Variability and climate trends in the Northwest of the Antarctic Peninsula:
recent cooling)

Bustos, M. A.1 Vsquez, R.1 Herrera, M.1 Villarroel, C.1


1
Direccin Meteorolgica de Chile. Av. Portales 3450, Estacin Central, Santiago. E-mail:
maria.bustos@dgac.gob.cl, ricardo.vasquez@dgac.gob.cl, mariajose.herrera@dgac.gob.cl,
cvilla@dgac.gob.cl.

A partir de la segunda mitad del siglo XX, la Pennsula Antrtica (en adelante PA) ha
experimentado un aumento en la temperatura, siendo el sector Oeste una de las reas de
calentamiento ms rpido del planeta, (Vaughan et al., 2003). Sin embargo, a partir de
comienzos de la dcada del 2000, la tendencia positiva logra revertirse, en particular, la
temperatura mnima en Frei que pas de 0.21C0.35C/dcada en el periodo 1970-2000 a
0.11C0.71C/dcada durante 1970-2010 (Carrasco, 2013). Se distinguen dos fases, una de
calentamiento entre los aos 1979 y 1997 y otra de enfriamiento entre los aos 1999 y 2014
(Turner et al., 2016). El presente estudio busca aportar con informacin actualizada,
incluyendo el evento El Nio 2015-16, al entendimiento de las causas de este cambio en la
tendencia de la temperatura y la modulacin del clima en la PA, mediante modos de
variabilidad climtica y su relacin entre el perodo clido y la fase positiva del Modo Anular
del Sur (SAM) (Marshall et al., 2006) y el perodo fro con las teleconexiones entre los
trpicos y latitudes altas (Trenberth et al., 2014).

Materiales y Mtodos
Se utiliz datos diarios de estaciones chilenas meteorolgicas ubicadas en la PA (tabla 1). Se
logr componer una base de datos continua, homogenizada y de calidad, utilizando el paquete
estadstico R Climatol (Guijarro, 2011). Para la identificacin del cambio de tendencia en las
series, se utiliz un promedio mvil centrado en 10 aos. Este cambio fue reconocido por el
mtodo entre los aos 1999 y 2000, separando la serie entre los aos 1965-1999, llamado
Periodo Clido y 2000-2016 como Periodo Fro. Las tendencias lineales se calcularon
mediante el mtodo de los mininos cuadrados y su significancia mediante un mtodo no
paramtrico, Montecarlo (Wilks, 2006). Los respectivos periodos se relacionaron estadstica
y espacialmente con los modos de variabilidad, tales como el SAM representado por el ndice
de la Oscilacin Antrtica (AAO) y el ndice de la Oscilacin del Sur (IOS).

Estacin Perodo Latitud Longitud Altura (m)


Eduardo Frei 1970-2016 -62.11 -58.58 45
Arturo Prat 1965-2016 -62.28 -59.39 5
Bernardo OHiggins 1981-2016 -63.19 -57.53 10

Tabla 1: Estaciones meteorolgicas con el perodo utilizado, su ubicacin geogrfica y la altura. Table 1:
Weather stations with the period used, their geographical location and height.

Resultados

106 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Se demostr que las series no son homogneas, identificando saltos en los aos 1993 en Frei
y 2004 en Prat. Gracias a metadata se puede sostener que los cambios son artificiales (cambio
de estacin y de metodologa). Una vez corregidas las series, se logr establecer que la
temperatura media en el sector noroeste (en adelante NW) de la PA ha presentado un continuo
aumento, con una tendencia de 0.14C por dcada entre 1965-2016 (Fig. 1a), este valor es
influenciado por el alza en la temperatura mnima, la que muestra un incremento de
0,3C/dcada. La temperatura mxima no presenta una tendencia significativa (Fig. 1b).
a b Figura 1: (a) Evolucin temporal de la
temperatura media (lnea azul) y su tendencia
(lnea roja). (b) Temperaturas extremas
(superior mxima, inferior mnima) y su
respectiva tendencia en el NW de la PA.
Figure 1: (a) Temporal evolution of the
average temperature (blue line) and its trend
(red line). (B) Extreme temperatures (upper
maximum, lower minimum) and their
respective trend in the NW of the PA.
Figura 2: Tendencias estacionales de la
temperatura media en la PA para el perodo
1965-2016. Figure 2 Seasonal trends of mean temperature in
PA for the period 1965-2016.
Con relacin al comportamiento estacional, las
tendencias manifiestan un significativo
calentamiento principalmente en otoo e invierno,
con un incremento promedio de 0.26C/dcada (Fig.
2). Cabe destacar, que la mayor tendencia se observ
en OHiggins de 0.33C/dcada en invierno austral.
Por otro lado, el verano y la primavera no muestran
tendencias significativas. Los resultados anteriores
no reflejan la real variabilidad de la serie. En el periodo clido, se distinguen dos etapas con
diferentes grados de tendencia, la primera fase entre los aos 1965 y 1989 (+0.4C/dcada)
y posteriormente entre los aos 1990 y 1999 (+0.86C/dcada) (Fig. 3). En el periodo fro,
se observa un decrecimiento de la temperatura media (-0.58C/dcada) entre los aos 2000
y 2016 (Fig. 3). Un estudio anterior identific este punto de inflexin entre tendencias
positivas y negativas, entre los aos 1998 y 1999, (Turner et al., 2016). En ambos periodos,
clido/fro, las mayores tendencias positivas/negativas se observaron en invierno, siendo esta
estacin la que aporta al valor de la tendencia (Tabla 2).
Figura 3: Promedio mvil de la temperatura media
en el NW de la PA centrado en 10 aos, indicando
tendencia (tringulos rojos=positiva y azules=
negativa), su intensidad (tringulos pequeos=baja,
tringulos grandes=mayor tendencia). El fondo
rojo=perodo clido, el fondo azul = perodo fro.
Figure 3: Average moving average temperature in
NW of PA centered on 10 years, indicating trend
(positive red triangles and negative blue trend),
intensity (small triangles, low tendency, large
triangles greater tendency). The red background
indicates a warm period, the background in blue
color, a cold period.

107 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Tabla 2: Tendencias estacionales de la


temperatura media para el perodo clido
(1965-1999) y fro (2000-2016). Los
tringulos rojos, indican tendencias
positivas, los azules, negativas, el tamao
del tringulo indica la magnitud de la
tendencia y el punto gris, las estaciones con
un grado de confianza del 90%. Seasonal
trends of the mean temperature for the warm
period (1965-1999) and cold (2000-2016).

Discusin
El promedio anual de las temperaturas medias de las estaciones chilenas ubicadas en la PA
muestra un calentamiento durante el perodo analizado, sin embargo, durante las ltimas
dcadas se ha observado un descenso de la temperatura media. El punto de inflexin entre el
perodo clido y fro encontrado en este estudio (2000) difiere entre 9 y 12 meses, respecto a
Turner et al., 2016, probablemente debido a la cantidad de estaciones utilizadas y al largo de
las series.
a) b)
Figure 4: (a) Correlacin entre AAO
y temperatura del aire durante el
perodo clido (1965-1999) y (b)
correlacin entre SOI y presin
durante el perodo fro (2000-2016).
Figure 4: (a) Correlation between
AAO and air temperature during the
warm period (1965-1999) and (b)
correlation between SOI and pressure
during the cold period (2000-2016).

Con respecto al entendimiento de las probables causas de la variabilidad de la temperatura


en la PA, se puede considerar: el perodo clido (1965-1999) coincide con la fase positiva
del Modo Anular del Sur (SAM), principalmente en el verano como respuesta del
agotamiento del ozono estratosfrico y al aumento de las concentraciones de gases de efecto
invernadero (Thomson and Solomon, 2002), lo que permite desarrollar condiciones ms
clidas. Asimismo, existe una buena relacin ( 0.8) entre el ndice AAO (que representa el
SAM) y la temperatura superficial del aire en la PA (Fig. 4a), por lo que podra ser atribuible
a esta causa el aumento de temperatura registrado durante este perodo. Con respecto al
periodo fro, una de las causas dinmicas podra ser el fortalecimiento del centro de baja
presin en el Mar de Amundsen (ASL, por sus siglas en ingls), que se relaciona con bajas
temperaturas y con la formacin de hielo marino, a esto se suma el incremento de la
frecuencia de condiciones ciclnicas en el Paso Drake, asociado con un intenso jet de
latitudes medias que advecta aire fro hacia la PA (Turner et al., 2016). Tales mecanismos se
reflejan en las correlaciones entre la AAO y la temperatura con el periodo clido y el ndice
de Oscilacin del Sur (SOI) con la presin para el periodo frio (Fig. 4b). En este ltimo
periodo, se observa una asociacin con la presin cercana al sector de ASL que podra ser
influenciada por las condiciones del Pacfico Tropical de manera inversa.

108 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Conclusiones
Los resultados de este estudio corroboran lo evidenciado en estudios anteriores respecto a las
tendencias y a los mecanismos dinmicos que podran influir en el comportamiento de la
temperatura en el NW de la PA. Sin embargo, el presente estudio aporta al entendimiento del
comportamiento de la variabilidad de la temperatura en la PA, con la actualizacin de la
informacin en la presente dcada, incluyendo el evento de El Nio 2015-16. En resumen, la
temperatura media superficial en la PA ha experimentado un aumento del orden de
0.14C/dcada durante el perodo 1965-2016. Se distinguen dos perodos con diferentes
tendencias de temperatura, un perodo clido (1965-1999) y otro perodo fro (2000-2016).
Para el perodo clido, el mayor calentamiento se ha presentado en invierno, con tasas del
orden de 0.5C/dcada, mientras que, para el perodo fro, la disminucin de la temperatura
se registra durante todas las pocas del ao. Una de las razones que podran explicar el
perodo clido, es la fase positiva del SAM, caracterstica que permite generar condiciones
ms clidas, existiendo una buena relacin entre el ndice AAO y la temperatura superficial
en el sector de la PA. Mientras que, durante el perodo fro, las anomalas de presin en el
sector de ASL influye en el descenso de la temperatura y, por ende, el perodo de
enfriamiento, se puede asociar con las condiciones ms fras que se han observado durante
los ltimos aos en el Ocano Pacfico Tropical.

Referencias
Carrasco, J.F. 2013. Decadal changes in the near-surface air temperature in the western side of the
Antarctic Peninsula. Atmos. Clim. Sci, (3): 275-281.
Guijarro, J.A. 2011. Users guide to Climatol. Instituto Nacional de Meteorologa, Centro
Meteorolgico en Illes Balears.
Marshall, G.J., Orr, A., van Lipzig, N. P. M. y King, J.C. 2006. The impact of a changing Southern
Hemisphere Annular Mode on Antarctic Peninsula summer temperatures. J. Clim, (19): 5388-5404.
Marshall, G.J. y J.C. King 1998. Southern Hemisphere circulation anomalies associated with extreme
Antarctic Peninsula winter temperatures, Geophys. Res. Lett, (25): 2437-2440.
Oliva, M., Navarro F, Hrbcek F., Hernndez A., Nvlt D., Pereira P., Ruiz-Fernndez P., y Trigo R.
2016. Recent regional climate cooling on the Antarctic Peninsula and associated impacts on the
cryosphere, Sci Total Environ.
Thompson, D.W.J. y Solomon S. 2002. Interpretation of recent Southern Hemisphere climate change.
Science, (296): 895-899
Trenberth K.E., Fasullo J.T., Branstator G. y Phillips A.S. 2014. Seasonal aspects of the recent pause
in surface warming. Nature Clim, Chang, (4): 911-916.
Turner J., Lu H., Whrite I., King J.C., Phillips T., Hosking J.S., Bracegirdle T.J., Marshall G. J.,
Mulvaney R. y Deb P. 2016. Absence of 21st century warming on Antarctic Peninsula consistent with
natural variability. Nature Clim, (535): 411-415.
Vaughan, D.G. 2013. Recent rapid regional climate warming on the Antarctic Peninsula. Clim.
Change, (60): 243-274.
Wilks, V.S. 2006. Statistical Methods in the Atmospheric Sciences, 2nd Edition, Academic Press,
London.

109 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

INFECTIOUS DISEASES IN ANTARCTIC INHABITANTS: A SYSTEMATIC


REVIEW
(Enfermedades infecciosas en habitantes antrticos: una revisin sistemtica)

Cabaln, C.1, Corts, H.2, Keim, F.2, Loyola, M.2, Medina, R.A.1, 3, Borzutzky. A.1, 3

1
Department of Pediatric Infectious Diseases and Immunology, School of Medicine, Pontificia Universidad
Catlica de Chile; 2Instituto Nacional General Jos Miguel Carrera. 3Millennium Institute on Immunology
and Immunotherapy, School of Medicine, Pontificia Universidad Catlica de Chile, Santiago, Chile.

There is limited information about diseases that have affected or potentially could affect
scientists and military in Antarctic. In particular, due to the isolation conditions of this
continent the study of human diseases is very relevant. In fact, the Scientific Committee on
Antarctic Research has identified among the top priorities to be investigated over the next
two decades: How will humans, diseases and pathogens change, impact and adapt to the
extreme Antarctic environment? (Kennicutt, M.C.,2015). The purpose of this study was to
identify and classify the infectious diseases that have been reported in short-term temporal
residents of Antarctic through a systematic bibliographical review. The bibliographic search
was done in the PUBMED database using ad-hoc MESH terms for human infectious diseases
in Antarctica, and manually in the International Journal of Circumpolar of Health. The
inclusion criteria were: study and reports about human and infectious diseases in Antarctica.
The exclusion criteria were studies not performed in humans, illnesses occurring in Antarctic
cruises or outside the Antarctic continent, or registered during travel of expeditions before
arrival to Antarctica. The initial search found 386 articles of which, according to exclusion
and inclusion criteria, only 12 were included in the full analysis. The result of the analysis
shows that the most common infectious diseases in the Antarctic population were respiratory
and gastrointestinal viral illnesses. Additionally, in 9 studies disease-causing pathogens were
identified including Influenza A and B, parainfluenza 1,2 and 3, adenovirus, mumps, herpes
simplex, rhinovirus, Coxsackievirus, and Staphylococcus aureus. We reviewed the data
recorded comparing infection-affected people versus healthy temporal residents and we
found that the cases reported as patients with an infectious disease never surpassed the
healthy Antarctic temporal residents. In conclusion, this systematic review shows that short
term temporal Antarctic residents have presented common infectious diseases, probably
brought from other continents by travelers, and do not appear to have developed any
infections endemic to Antarctica.

Acknowledgment
This study was funded by Instituto Antrtico Chileno grant number RT 28-15.

References
Kennicutt, M.C, Chown, S.L., Cassano, J.J. & Sutherland, W.J. 2015. A roadmap for Antarctic and Southern
Ocean science for the next two decades and beyond. Antarctic Science 27(1), 318.

110 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

DISTRIBUCIN Y ABUNDANCIA DE INDICADORES BIOGEOQUMICOS EN


SEDIMENTOS SUPERFICIALES DEL PASO DE DRAKE, DESDE EL
ESTRECHO DE MAGALLANES AL ESTRECHO DE BRANSFIELD
(Distribution and abundance of biogeochemical proxies in surface sediments of the Drake
Passage, from the Strait of Magellan to the Bransfield Strait)

Crdenas, P.1,2,3, Lange, C.B.2,3,4, Vernet, M.5, Srain, B.2,4, Mller, J.6, Vorrath, M.E.6,
Ehrhardt, S.6, Kuhn, G.6, Iriarte, J.L.2,3,7
1
Programa de Magister en Ciencias mencin Oceanografa. Chile. e-mail: paolacardenas@udec.cl. 2Centro
COPAS Sur-Austral. Chile. 3Centro FONDAP-IDEAL. Chile . 4Departamento de Oceanografa, Universidad
de Concepcin. 5Scripps Institution of Oceanography, University of California, La Jolla. USA. 6Alfred
Wegener Institute, Helmholtz Centre for Polar and Marine Research, Bremerhaven. Alemania. 7Instituto de
Acuicultura, Universidad Austral de Chile. Chile

El Ocano Austral es un componente fundamental del sistema climtico del planeta con
importantes implicancias en los ciclos biogeoqumicos. La oceanografa fsica del Ocano
Austral se caracteriza por el flujo ininterrumpido de la Corriente Circumpolar Antrtica
(ACC) alrededor del Continente Antrtico ejerciendo una influencia en la circulacin
ocenica global. La extensin latitudinal de la ACC se estrecha en el Paso de Drake el cual
presenta cerca de 800 km de extensin desde el margen continental chileno a la Pennsula
Antrtica. De esta manera los frentes oceanogrficos del Ocano Austral, los cuales
representan variaciones zonales de las propiedades del agua, se acercan entre s. Ubicado en
la zona subantrtica se encuentra el Frente Subantrtico (SAF), al sur se ubica el Frente Polar
(PF) y el Frente Sur de la ACC (SACCF), el ms cercano al Continente Antrtico (Orsi et al.,
1995). En este escenario se observa un gradiente climtico/oceanogrfico natural, desde
condiciones menos fras, hmedas y sin hielo marino estacional al norte, a condiciones ms
fras y secas que incluyen hielo marino estacional al sur (e.g., Ducklow et al., 2007). La
composicin y distribucin de los sedimentos marinos es clave para comprender los ciclos
biogeoqumicos globales, mecanismos de transporte, comportamiento de las corrientes de
fondo, reconstrucciones del ambiente pasado y la respuesta del ocano al cambio climtico.
Sin embargo, los sedimentos del Paso de Drake son un rea prcticamente inexplorada. Por
lo tanto, nuestro principal objetivo es determinar si la variacin latitudinal en la composicin
biogeoqumica de los sedimentos superficiales (carbono orgnico total (TOC), pigmentos,
esteroles, opal biognico (%Opal) y carbonatos (%CaCO3)) responde al gradiente
climtico/oceanogrfico mencionado. La importancia de este estudio radica en entregar
nueva informacin sobre la aplicabilidad de las variables estudiadas con el fin de contribuir
a las investigaciones paleoceanogrficas y paleoclimticas futuras.

Materiales y Mtodos
El muestreo se realiz a bordo del rompehielos Polarstern en la expedicin PS97
Paleoceanography of the Drake Passage (PaleoDrake) realizada entre el 16 de febrero y el
8 de abril del 2016. El muestreo de sedimentos superficiales en 53 estaciones (Figura 1) se
realiz mediante un sacatestigo mltiple (Multicore, MUC 67, de 8 tubos, 6 cm de dimetro
interno y 60 cm de longitud) (Lamy, 2016). Cada tubo fue submuestreado a intervalos de 1
cm, de los cuales para fines de este estudio, se analiz solo la fraccin superficial de cada

111 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

estacin. Las submuestras fueron utilizadas para anlisis de %TOC mediante un analizador
configurado para la determinacin de carbono-sulfuro luego de la remocin de carbonatos
con cido clorhdrico. Se midieron clorofila y feopigmentos en los sedimentos mediante
fluorometra segn la metodologa de Holm-Hansen et al. (1965) y Lorenzen et al. (1966).
Se analizaron los esteroles por medio de cromatografa de gases acoplada a espectrometra
de masas. Tanto pigmentos como esteroles se presentan estandarizados por TOC. El %Opal
se midi siguiendo la metodologa de Mortlock & Froehlich (1989) y el contenido de CaCO3
fue determinado de acuerdo a: (%carbono total%TOC)*8,33. Todos los parmetros fueron
corregidos por contenido de agua y sales (Kuhn, 2013)

Figura 1. rea de estudio. Estaciones de


muestreo de sedimentos superficiales. Se
observan los diferentes frentes oceanogrficos
en el Paso de Drake (SAF= Frente
Subantrtico; PF=Frente Polar; SACCF=
Frente Sur de la ACC). Figure 1. Study area.
Sampling stations of surface sediments. The
oceanography fronts in the Drake Passage
(SAF= Subantarctic Front; PF=Polar Front;
SACCF=Southern Antarctic Circumpolar
Current Front) are indicated.

Resultados
El TOC present valores en un rango de 0,07 a 1,2%, de los cuales los mayores porcentajes
se encontraron al sur del SACCF (Figura 2A). Los pigmentos y los esteroles totales
presentaron un patrn del similar al TOC (Figuras 2B y 2C, respectivamente) con
incrementos pronunciados en las estaciones correspondientes a las Islas Shetland del Sur. Se
determinaron un total de 13 esteroles con una predominancia de (3b)-cholest-5-en-3-ol
(colesterol), (3)-Stigmast-5-en-3-ol (-sitosterol), Ergosta-5,22-dien-3-b-ol (brasicasterol)
y (3b,22E)-Stigmasta-5,22-dien-3-ol (estigmasterol). Respecto al %Opal se observaron
bajos contenidos cerca del margen continental chileno (3%) y altos porcentajes en el
Estrecho de Bransfield (19%). En las cercanas de PF y SAACF tambin se observ un
incremento de %Opal (Figura 3A). En contraste, los mayores porcentajes de CaCO3 (>50%)
se encontraron en el margen continental chileno disminuyendo fuertemente hacia la
Pennsula Antrtica (<4%) (Figura 3B). Los extremadamente altos porcentajes en las
estaciones PS97/044-1 y PS97/045-1 se corresponden con una dominancia de foraminferos
(Lange et al., 2016).

112 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 2. Distribucin de parmetros


geoqumicos orgnicos preservados en los
sedimentos superficiales desde el margen
continental chileno al Estrecho de Bransfield
(Crucero PS97). A) Carbono orgnico total
(%TOC); B) Concentracin de pigmentos
totales y razn clorofila/feopigmentos
utilizado como proxy de la preservacin de la
clorofila (Sa et al., 2012); C)
Concentracin de esteroles totales. Se
observan los diferentes frentes
oceanogrficos en el Paso de Drake (SAF,
PF, SACCF).
Figure 2. Distribution of geochemical
organic parameters preserved in the surface
sediments from the Strait of Magellan to the Bransfield Strait (Cruise PS97). A) Total Organic Carbon (%TOC);
B) Concentration of total pigments and the chlorophyll/phaeopigments ratio (Sa et al., 2012) as a proxy of
chlorophyll preservation; C) Concentration of total sterols. The oceanography fronts in the Drake Passage
(SAF= Subantarctic Front; PF=Polar Front; SACCF=Southern Antarctic Circumpolar Current Front) are
indicated.

Figura 3. Distribucin de parmetros geoqumicos


inorgnicos preservados en los sedimentos superficiales
desde el margen continental chileno al Estrecho de
Bransfield (Crucero PS97). A) Opal Biognico (%Opal) y
B) Carbonatos (%CaCO3). Se observan los diferentes
frentes oceanogrficos en el Paso de Drake (SAF, PF,
SACCF).
Figure 3. Distribution of geochemical inorganic
parameters preserved in the surface sediments from the
Strait of Magellan to Bransfield Strait (Cruise PS97). A)
Biogenic Opal (%Opal) and B) Carbonates (%CaCO3). The
oceanography fronts in the Drake Passage (SAF=
Subantarctic Front; PF=Polar Front; SACCF=Southern Antarctic Circumpolar Current Front) are indicated.

Discusin y Conclusin
Los pigmentos totales (clorofila+feopigmentos) preservados en los sedimentos superficiales
indican claras diferencias de concentracin en toda la extensin de nuestra zona de estudio,
de los cuales las mayores concentraciones se encuentran al sur de la SACCF y en el Estrecho
de Bransfield dando evidencia de la mayor produccin primaria exportada y en consecuencia
mayor biomasa fitoplanctnica de la zona (Figura 2B) (e.g., Garca-Muoz et al., 2013). La
razn clorofila/feopigmentos usada comnmente como indicador de preservacin de
clorofila-a (Sa et al., 2012), si bien presenta bajos valores para toda la zona de estudio
(indicando degradacin) se observan dos incrementos importantes (indicando buena
preservacin) en el PF y Estrecho de Bransfield (Figura 2B). Resultados preliminares de
comparacin entre clorofila-a integrada en la columna de agua (0100m) con los sedimentos
superficiales muestran patrones disimiles, sugiriendo una alta degradacin en la zona de
estudio. Los esteroles ms abundantes de la zona de estudio son: el colesterol (producido por
algas pero ms aceptado como biomarcador de organismos consumidores), -sitosterol
(descrito como producto de Phaeocystis y diatomeas pennadas), brasicasterol (mayormente
aceptado como marcador de diatomeas) y estigmasterol (presentado en algunas algas marinas
pero mayormente aceptado como proxy de fuentes terrgenas) (e.g., Volkman 2003; Villinsky
et al., 2008) se distribuyen en prcticamente toda la extensin de la zona de estudio. Un

113 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

resultado novedoso para el Estrecho de Bransfield es la presencia de 275,22 el cual ha sido


descrito como producto de blooms de diatomeas en la polinia del Mar de Ross (Villinsky et
al., 2008). Los altos porcentajes de opal biognico encontrados en la Pennsula Antrtica se
podran relacionar con la alta productividad silcea de la zona y una buena preservacin en
el sedimento subyacente (Figura 3A). A pesar del bajo contenido observado en el Paso de
Drake se presentan algunas excepciones sobre el PF y el SACCF, lo que podra estar
relacionado a la surgencia de aguas profundas que aporta acido silcico que favorece
principalmente la produccin de diatomeas (Chase et al., 2015). Aguas agotadas en acido
silcico hacia el norte del PF favoreceran el desarrollo del fitoplancton calcreo (Chase et
al., 2015) lo que se condice con nuestros resultados de CaCO3 (Figura 3B).

Agradecimientos
Alejandro vila, Vctor Acua, Vania Carrera, Jack Pan, Capitn y tripulacin del
rompehielos Polarstern y cientficos y tcnicos de la expedicin PS97. AWI-Bremerhaven,
CONICYT-PIA COPAS Sur-Austral PFB-31 y Centro FONDAP-IDEAL 15150003,
CONICYT-PFCHA/MagisterNacional/2017-22171017.
Referencias
Chase, Z., Kohfeld, K. E., & Matsumoto, K. 2015. Controls on biogenic silica burial in the Southern Ocean. Global
Biogeochemical cycles, 29, 119.
Ducklow, H. W., Baker, K., Martinson, D. G., Quetin, L. B., Ross, R. M., Smith, R. C., Stammerjohn, S. E., Vernet,
M. & Fraser, W. R. 2007. Marine pelagic ecosystems: the West Antarctic Peninsula. Philosophical Transactions of
the Royal Society B: Biological Sciences, 362(1477), 6794.
Garca-Muoz, C., Lubin, L. M., Garca, C. M., Marrero-Daz, A., Sangr, P. & Vernet, M. 2013. A mesoscale study
of phytoplankton assemblages around the South Shetland Islands (Antarctica). Polar Biology, 36(8), 11071123.
Holm-Hansen, O., Lorenzen, C. J., Holmes, R. W. & Strickland, J. 1965. Fluorometric determination of chlorophyll.
Journal du Conseil, 30, 315.
Kuhn, G. 2013. Don't forget the salty soup: Calculations for bulk marine geochemistry and radionuclide
geochronology, Goldschmidt 2013. Conference Abstract, Florence Mineralogical Mag., July 2013, p. 1519.
Lamy, F. 2016. The Expedition PS97 of the Research Vessel POLARSTERN to the Drake Passage in 2016, Berichte
zur Polar- und Meeresforschung=Reports on polar and marine research, Bremerhaven, Alfred Wegener Institute for
Polar and Marine Research, 701, 571 p.
Lange, C. B., Rebolledo, L., Schulz, H., Mller, J., Arz, H., Lamy, F. & PS97 Shipboard Party. (2016). Composition
of surface sediments across the Drake Passage related to ocean productivity, terrigenous input, currents, and ice
proximity. International Conference on Paleoceanography, 29 August al 2 de September, 2016. Utrecht, Holanda.
Poster # P-180.
Lorenzen, C. J. 1966. A method for the continuos measurement of in vivo chlorophyll concentrations. Deep-Sea
Research, 13, 223227.
Mortlock, R. A., & Froelich, P. N. 1989. A simple method for the rapid determination of biogenic opal in pelagic
marine sediments. Deep Sea Research Part A, Oceanographic Research Papers, 36(9), 14151426.
Orsi, A. H., Whitworth, T., & Nowlin, W. D. 1995. On the meridional extent and fronts of the Antarctic Circumpolar
Current. Deep-Sea Research Part I, 42(5), 641673.
Sa, E., Isla, E., Grmare, A., Gutt, J., Vtion, G., & DeMaster, D. J. 2011. Pigments in sediments beneath
recently collapsed ice shelves: The case of Larsen A and B shelves, Antarctic Peninsula. Journal of Sea Research,
65, 94102.
Villinski, J. C., Hayes, J. M., Brassell, S. C., Riggert, V. L., & Dunbar, R. B. 2008. Sedimentary sterols as
biogeochemical indicators in the Southern Ocean. Organic Geochemistry, 39(5), 567588.
Volkman, J. K., 2003. Sterols in microorganisms. Applied Microbiology and Biotechnology, 60, 495506.

114 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

EXPLORANDO LOS EFECTOS DEL AUMENTO DE TEMPERATURA EN


ESPONJAS ANTARTICAS Y SU MICROBIOMA
(Assessing the effects of increased seawater temperature on Antarctic sponges and their
microbiome)

Crdenas, C.A.1, Morales-Vicencio, F.2, Trefault, N.3, Gonzlez-Aravena, M.1, Font, A.1,
Bravo, D.4, Santibaez, P.1, Fernandez, J.C.C.5,6, Hajdu, E.5
1
Departamento Cientfico, Instituto Antrtico Chileno, Punta Arenas, Chile. E-mail: ccardenas@inach.cl
2
Carrera de Biotecnologa, Universidad de Antofagasta, Antofagasta, Chile. 3 Centro de Genmica y
Bioinformtica, Facultad de Ciencias, Universidad Mayor, Santiago, Chile. 4 Escuela de Biologa Marina,
Universidad de Valparaso, Chile. 5 Museu Nacional, Departamento de Invertebrados, Universidade Federal
do Rio de Janeiro, Rio de Janeiro, Brazil. 6 Programa de Ps-Graduao em Oceanografia, Universidade do
Estado do Rio de Janeiro, Rio de Janeiro, Brazil.

Las esponjas son importantes componentes de las comunidades bentnicas en muchos sitios
alrededor de Antrtica (Dayton et al. 1974, Zamorano 1983, Crdenas et al. 2016), en donde
cumplen roles claves como provisin de alimento, refugio y hbitat para muchos otros
organismos (McClintock et al. 2005). De acuerdo a la literatura, las esponjas cumplen una
serie de otros importantes roles funcionales en los ecosistemas en donde habitan (Bell 2008),
sin embargo, muchos de ellos an no han sido estudiados en ecosistemas antrticos. Uno de
ellos son las importantes asociaciones que poseen una diversa variedad de microrganismos,
es as como se considera a las esponjas como reservorios de una excepcional diversidad
microbiana (Thomas et al. 2016). A la fecha existen muy pocos trabajos que han estudiado
el microbioma de esponjas antrticas (Webster et al. 2004, Rodriguez-Marconi et al. 2015),
por lo que el conocimiento sobre su diversidad, especificidad y roles an desconocida.
Considerando los dramticos cambios que la zona occidental de la Pennsula Antrtica ha
sufrido en los ltimos 60 aos a travs del incremento en la temperatura del aire y del mar y
sus efectos directos e indirectos en el ambiente fsico de la zona (Meredith et al. 2017), y
considerando las proyecciones a futuro, organismos marinos como las esponjas podran ser
afectados negativamente por estas variaciones ambientales, y por tanto afectaran no solo a
las especies sino tambin a los procesos en el ecosistema antrtico.
A pesar de que las comunidades microbianas asociadas a esponjas en general son estables
ante variacin ambiental (Friedrich et al. 2001, Crdenas et al. 2014), existe evidencia que
algunas especies seran sensibles a incrementos en la temperatura del agua, en zonas donde
existe poca variabilidad trmica (Lopez-Legentil et al. 2011, Simister et al. 2012). Por lo
anterior es que las esponjas podran constituir un buen modelo para detectar efectos
producidos por el cambio climtico en el ecosistema antrtico. Para ellos nos planteamos
estudiar los patrones de distribucin de las esponjas, y su relacin con las comunidades
microbianas y como stas podran variar por efecto de cambios ambientales.
El presente estudio se desarrolla alrededor de Isla Doumer (645224S; 633600W) en
el Archipilago de Palmer, Pennsula Antrtica, en donde se ubica Base Yelcho. Durante el
verano austral de 2016 y 2017 hemos realizado transectos a travs de buceo en 10 y 20 m de
profundidad. Adicionalmente se instalaron sensores de Temperatura/luz en los transectos
estudiados, los cuales fueron recuperados al ao siguiente. Se realizaron colectas de trozos
de esponjas desde los transectos y desde otros lugares alrededor de la isla (Figura 1).
Adicionalmente desarrollamos un experimento de marcaje de individuos para estudiar la
115 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

variabilidad temporal de diversas esponjas. El material fue procesado y preservado en


RNALater en el laboratorio de base Yelcho (INACH). Posteriormente luego de la extraccin
de DNA genmico se procedi a secuenciar las muestras a travs de la plataforma MiSeq
Illumina en el Centro de Genmica y Bioinformtica (UMayor).
A travs de secuenciacin masiva hemos estudiado las comunidades microbianas asociadas
a diversas especies antrticas. A travs de los muestreos realizados hemos podido estudiar la
variacin en el microbioma a nivel intra e interespecfico. Por medio de muestreos de
individuos en aos sucesivos estudiamos la estabilidad del microbioma en relacin a cambios
de temperatura observados en Baha Doumer
Para analizar los patrones en el microbioma a nivel intraespecfico, se analizaron especies de
esponjas con al menos 3 rplicas. El anlisis arroj una alta diversidad microbiana para las
especies estudiadas, siendo Hymeniacidon sp., la que present los valores ms altos,
registrndose 1000 OTUs. En general la riqueza de OTU en las especies estudiadas vari
entre 800 y 200 OTUs. Las comunidades microbianas mostraron ser especficas entre las
diversas especies de esponjas analizadas.
Los filo ms importantes en trminos de abundancia y diversidad detectados en las muestras
analizadas corresponden a Proteobacteria con un total de 1577 OTUs, principalmente
comprendidos en cinco clases (Alfa, Beta, Gamma, Delta y Proteobacteria no clasificadas).
Otros filo abundantes fueron Bacteroidetes y Verrucomicrobiales. Estos patrones coinciden
con los reportados para otras especies de esponjas estudiadas en otras latitudes (e.g.
Hentschel et al. 2002; Taylor et al. 2007).
Especies como Haliclona (Rhizoniera) sp., una de las ms conspicuas en Isla Doumer, es
dominada por Betaproteobacteria, mientras que para el caso de Hymeniacidon sp. e Isodyctia
sp. 2, el microbioma es dominado por Gammaproteobacteria. En general lo anterior es
consistente con lo reportado para otras especies antrticas. De acuerdo a estos resultados, las
especies estudiadas corresponden a esponjas del tipo LMA (Low Microbial Abundance).
El material colectado a partir de los individuos marcados de distintas especies, muestreados
consecutivamente en 2016 y 2017 nos permitir estudiar potenciales variaciones en el
microbioma de estas especies y correlacionarlo con la variacin estacional y de corto plazo
que hemos registrado en Isla Doumer. La secuenciacin del trasncriptoma de alguna de estas
especies a travs de RNA-seq, nos permitir evaluar la expresin de genes asociados a la
respuesta a estrs ambiental

Agradecimientos
Al personal que apoy en terreno en Yelcho. Financiamiento Fondecyt #11150129.

116 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

A B C

D E F

G H I

Figura 1. Ejemplos de algunas especies de esponja colectadas en en isla Doumer, archipilago de Palmer, las
cuales fueron estudiadas para analisar las comunidades microbianas asociadas. A) Dendrilla antartica, B)
Haliclona (Rhizoniera) sp, C) Haliclona (Soestella) Chilensis, D) Haliclona (Soestella) sp., E) Hymeniacidon
sp., F) Iophon sp. 2, G) Iophon unicorne, H) Isodictya sp. 2 e I) Tedania (Tedaniopsis) wellsae.

Figure 1. Examples of some species of sponges collected on Doumer Island, Palmer Archipelago, which were
studied for the analysis of the associated microbial communities. A) Dendrilla antartica, B) Haliclona
(Rhizoniera) sp, C) Haliclona (Soestella) Chilensis, D) Haliclona (Soestella) sp., E) Hymeniacidon sp., F)
Iophon sp. 2, G) Iophon unicorne, H) Isodictya sp. 2 e I) Tedania (Tedaniopsis) wellsae.

Referencias
Bell, J.J. 2008. The functional roles of marine sponges. Estuarine, Coastal and Shelf Science, 79: 341-353.
Crdenas, C.A., Newcombe, E.M., Hajdu, E., Gonzlez-Aravena, M., Geange, S.W. y Bell, J.J. 2016. Sponge
richness on algae-dominated rocky reefs in the Western Antarctic Peninsula and the Magellan Strait. Polar
Research, 35: 30532.
Crdenas, C.A., Bell, J.J., Davy, S.K., Hoggard, M, y Taylor, M.W. 2014. Influence of environmental variation
on symbiotic bacterial communities of two temperate sponges. FEMS Microbiology Ecology, 88:516-527.
Dayton, P.K., Robilliard, G.A., Paine, R.T. y Dayton, L.B. 1974. Biological accommodation in the benthic
community at McMurdo Sound, Antarctica. Ecological Monographs, 44: 105-128.
Friedrich, A.B., Fischer, I., Proksch, P., Hacker, J. y Hentschel, U. 2001. Temporal variation of the microbial
community associated with the mediterranean sponge Aplysina aerophoba. FEMS Microbiology Ecology. 38:
105113.
Hentschel, U., Piel, J., Degnan, S.M., y Taylor, M.W. 2012. Genomic insights into the marine sponge
microbiome. Nature Reviews Microbiology, 10: 641-654
Lopez-Legentil, S., Song, B., McMurray, S.E. y Pawlik, J.R. 2011. Bleaching and stress in coral reef
ecosystems: hsp70 expression by the giant barrel sponge Xestospongia muta. Molecular Ecology, 17:1840-
1849.

117 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Meredith, M.P., Stefels, J., y van Leeuwe, M. 2017. Marine studies at the western Antarctic Peninsula: priorities,
progress and prognosis. Deep-Sea Research II (In press).
McClintock, J.B., Amsler, C.D., Baker, B.J. y Van Soest, R.W.M. 2005. Ecology of Antarctic marine sponges:
an overview. Integrated and Comparative Biology, 45: 359-368.
Rodrguez-Marconi, S., De la Iglesia, R., Dez, B., Fonseca, C.A., Hajdu, E. y Trefault, N. 2015.
Characterization of bacterial, archaeal and eukaryote symbionts from Antarctic sponges reveals a high diversity
at a three-domain level and a particular signature for this ecosystem. PloS One, 10:e0138837.
Simister, R., Taylor, M.W., Tsai, P., Fan, L., Bruxner, T.J., Crowe, M.L., y Webster, N. 2012. Thermal stress
responses in the bacterial biosphere of the Great Barrier Reef sponge, Rhopaloeides odorabile. Environmental
Microbiology, 14:3232-3246
Taylor, M.W., Radax, R., Steger, D. y Wagner, M. 2007. Sponge-associated microorganisms: evolution,
ecology, and biotechnological potential. Microbiology and Molecular Biology Reviews, 71:295-347.
Thomas, T., Moitinho-Silva, L., Lurgi, M., Bjrk, J.R., Easson, C., Astudillo-Garcia, C., Olson, J.B., Erwin,
P.M., Lopez-Legentil, S., Luter, H., Chaves-Fonnegra, A., Costa, R., Schupp, P.J., Steindler, L., Erpenbeck, D.,
Gilbert, J., Knight, R., Ackermann, G., Lopez, J.V., Taylor, M.W., Thacker, R.W., Montoya, J.M., Hentschel,
U. y Webster, N.S. 2016. Diversity, structure and convergent evolution of the global sponge microbiome.
Nature Communications, 7:11870.
Webster, N.S., Negri, A.P., Munro, M.M.H.G. y Battershill, C.N. 2004. Diverse microbial communities inhabit
Antarctic sponges. Environmental Microbiology, 6:288-300.
Zamorano, J.H. 1983. Zonacin y Biomasa de la macrofauna bentnica en Baha South, Archipilago Palmer,
Antrtica. Instituto Antrtico Chileno, Serie Cientfica 30: 27-38.

118 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

CDIGO DE BARRAS GENTICO PARA IDENTIFICAR LA DIVERSIDAD DE


LA FAUNA DE PARSITOS DIGENEOS EN EL GASTRPODO MARGARELLA
ANTRCTICA.
(DNA Barcoding to identify the parasite faune of digenean in the gastropod Margarella
antrctica)

Crdenas L.1, Rocha N.1, Flores K.1, Oliva M. 2


1
Instituto de Ciencias Ambientales y Evolutivas, Fondap IDEAL. Universidad Austral de Chile. 2. Instituto de
Ciencias Naturales Alexander von Humboldt, Facultad de Ciencias del Mar y Recursos Biolgicos,
Universidad de Antofagasta, P.O. Box 170, Antofagasta, Chile. Email correspondencia:
leylacardenas@uach.cl.

El Ocano Austral es caracterizado por un alto nivel de endemismo. La corriente circumpolar


y su asociado patrn oceanogrfico han permitido el desarrollo de una biodiversidad nica
(Clarke et al. 2005). En este ambiente sin embargo uno de los grupos menos estudiados son
los parsitos marinos. Hoy en da existe un acuerdo general de que los efectos mediados por
el parsito pueden ser significativos porque dan forma a la dinmica de la poblacin de
acogida, alteran la competencia interespecfica, influyen en el flujo de energa y parecen ser
importantes impulsores de la biodiversidad (Hudson et al., 2006). En este contexto su estudio
parece ser una urgencia. Por otro lado, en el Ocano Austral, la gran mayora de los reportes
de parsitos han sido en peces nototenidos y en la mayora de los casos sus ciclos de vida son
aun desconocidos o incompletos. Invertebrados marinos, son hospedadores intermediarios de
muchos endoparsitos, en especial digeneos y por lo tanto parsitos de este grupo deberan
estar presentes en los invertebrados marinos en todos los sistemas donde ellos estn
presentes.
El gnero Margarella fue descrito por Thiele (1893), correspondiendo a un grupo de
gasterpodos cuyas especies se caracterizan por presentar una concha de pequeo a mediano
tamao, espira baja, expandida en la ltima vuelta, columela gruesa sin dentculos e interior
de la concha nacarado (Rosenfeld et al., 2011). Habitan en substratos duros o sobre algas
pardas, tanto en la zona intermareal como submareal en la Patagonia y en la Antrtica
(Zelaya, 2004). Margarella antarctica tiene amplia distribucin en la antrtica y ha sido
reportada desde los 0 a los 460 m de profundidad (Gutt et al., 1998). Es una especie con
desarrollo directo y baja movilidad en los adultos, produce capsulas de huevo que son fijadas
al sustrato rocoso o algas y desde estas emergen juveniles (Hoffman et al., 2011). Dentro de
sus depredadores se ha descrito a peces nototenidos (Barrera-Oro & Casaux 1990). Se
alimenta sobre algas como Desmarestia sp. y Himantothallus grandifolius. Hasta la fecha
solo existe un reporte de una nica especie de digeneo parasitando M. antarctica (Grafe ,
1971). El parsito fue identificado como Plagioporus pennelli, especie que actualmente
corresponde a Macvicaria Georgiana (Zdzitowiecki 1990, Laskowski & Zdzitowiecki 2005).
En este trabajo se examinan 132 individuos, todos colectados en la Base Yelcho
(6452'33.63"S; 6335'1.92"O), durante la ECA 54 con el objetivo de caracterizar la fauna
de parsitos de M. antarctica mediante anlisis de cdigo de barras gentico. Los individuos
analizados presentaron un largo, ancho, alto promedio de 9,94 (mm), 8,04 y 5,89 (mm) ,
respectivamente con un peso promedio de 0,25 gramos. En estos individuos fueron
identificados parsitos digeneos principalmente en el sistema digestivo. Dos estadios larvales

119 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

estn presentes, esporocistos y cercarias (Figura 1). La prevalencia de esporocistos fue de


17,42% mientras que para cercarias libres fue de 1,52%. La abundancia para los esporocistos
fue calculada en 36,07 mientras que para cercarias libres fue de 8,03. Finalmente la intensidad
media fue de 207 para esporocistos y 530 para cercarias libres. Anlisis filogenticos con el
gen ITS2 muestran que esporocistos y cercarias libres corresponderan a la misma especie,
sugiriendo que el parasito encontrado pertenece a la familia Opecoelidae, quedando en un
mismo clado con otras especies de Renicola (Figura 2). Actualmente trabajamos en los
protocolos de amplificacin para otros 3 genes nucleares para confirmar este resultado.

A B

C D

Figura 1. Imgenes de microscopia electrnica de morfotipos de parsitos recolectados desde el hospedador


Margarella antarctica. A: Esporocisto, B: Cercaria, C: Ventosa oral de cercaria (20 m), y D: Ventosa
ventral de cercaria (20 m). Scanning electronic microscopy of parasites collected from Margarella
antrctica.

Figura 2. Reconstruccin filogentica basada en el gen ITS2 para miembros de la clase Digenea. Sobre los
nodos se muestras los valores del soporte estadstico del rbol de Mxima Verosimilitud. Bf: Baha Fildes,
RC: Rada Covadonga y Ye: Yelcho. Phylogenetic reconstruction base don ITS2 gene to Digenean species. On
the each node the bootstrap anlisis for mximum likelihood approach.

120 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Referencias
Clarke, A., Barnes, D. K., & Hodgson, D. A. (2005). How isolated is Antarctica?. Trends in Ecology &
Evolution, 20(1), 1-3.
Hudson, P. J., Cattadori, I. M., Boag, B., & Dobson, A. P. (2006). Climate disruption and parasitehost
dynamics: patterns and processes associated with warming and the frequency of extreme climatic events.
Journal of Helminthology, 80(2), 175-182.
Rosenfeld, S., Aldea, C., & Ojeda, J. (2011). Nuevos antecedentes sobre la biologa y distribucin del
gasterpodo Margarella expansa (Sowerby, 1838). Amici Molluscarum, 19, 19-26.
Zelaya, D. G. (2004). The genus Margarella Thiele, 1893 (Gastropoda: Trochidae) in the southwestern Atlantic
ocean. The Nautilus, 118(3), 112-120.
Gutt, J., & Schickan, T. (1998). Epibiotic relationships in the Antarctic benthos. Antarctic Science, 10(4), 398-
405.
Hoffman, J. I., Clarke, A., Linse, K., & Peck, L. S. (2011). Effects of brooding and broadcasting reproductive
modes on the population genetic structure of two Antarctic gastropod molluscs. Marine Biology, 158(2), 287-
296.
Casaux, R. J., Mazzotta, A. S., & Barrera-Oro, E. R. (1990). Seasonal aspects of the biology and diet of
nearshore nototheniid fish at Potter Cove, South Shetland Islands, Antarctica. Polar Biology, 11(1), 63-72.
Graefe G (1971) Die Temperatur des Lebensraumes und ihre Wirkung auf Cercarien. berlegungen und
Versuche im Anschlu an Beobachtungen in der Antarktis. Parasitologische Schriftenreihe, 21:151156
Zdzitowiecki K (1990) Antarctic representatives of the genus Macvicaria Gibson & Bray, 1982 (Digenea
Opecoelidae), with descriptions of two new species. Syst Parasitol 16:169179
Laskowski Z, Zdzitowiecki K (2005) The helminth fauna of some notothenioid fishes collected from the shelf
of Argentine Islands, West Antarctica. Pol Polar Res 26:315324

121 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

THE YEAR OF POLAR PREDICTION - SOUTHERN HEMISPHERE (YOPP-SH):


A WIN-WIN OPPORTUNITY TO PARTICIPATE IN AN INTERNATIONAL
EFFORT
(El Ao de la Prediccin Polar - Hemisferio Sur: una oportunidad ganadora para participar
en un esfuerzo internacional)

Carrasco, J.F1 and Bromwich, D.H.2


1
Universidad de Magallanes, Avda Bulnes 01855, Punta Arenas, Chile. 2 Polar Meteorology Group, Byrd
Polar and Climate Research Center, The Ohio State University, Columbus, Ohio, USA

The interest in the polar regions has been growing due to their sensitivity to climate change.
They are remote areas that play a significant role in the Earth's climate and therefore, changes
in those areas can affect environments and ecosystems around the world. However, there is
still lack of understanding of many aspects of how polar climate operates and interacts with
polar and non-polar environments and ecosystems. The three fastest warming regions during
the last century have been Alaska, Siberia and the Antarctic Peninsula; and model projections
toward the end of this century indicate a continuing warming in these polar regions. This
suggest that these cold areas are highly sensitive to climate change and, therefore, there is a
need for better understanding of the oceans, atmosphere and land masses in the high polar
latitudes, and their interactions and impacts. Although the advance of operational and climate
models have improved short-term forecast and climate prediction, there is still a need for
improving these capabilities in the polar regions (Jung et al., 2016). Recognizing this, several
initiatives are underway for improving polar science and predictions. One particularly
important international initiative is the Year of Polar Prediction (YOPP), which will take
place between mid-2017 and mid-2019, centered on the year 2018 (WWRP/PPP No. 4,
2016).
International efforts for carrying out multidisciplinary research in polar regions have been a
permanent concern of the scientific community. The first International Polar Year (IPY) was
proposed by Karl Weyprecht who stated, before the Geographical Society in London in 1875,
Decisive scientific results can only be attained through a series of synchronous expeditions,
whose task it would be to distribute themselves over the Arctic regions and to obtain one
years series of observations made according to the same method (Luedecke, 2004). Even
though Weyprecht died in March 1881, his proposal was accomplished with the participation
of eleven nations in 1882-83 in the Arctic region where twelve stations were deployed and
more than 700 men confronted the dangers of Arctic service to establish and relieve these
stations between 1881 and 1884 (Wood and Overland 2006). This was the first cooperative
research that joined nations to coordinate expeditions and collect meteorological and
geophysical observations in a polar region. Fifty years later, the second IPY was undertaken
in 1932-33 once again in the northern polar region, even though the initial proposal was to
include Antarctica. This time, researchers coming from forty nations participated in
collecting meteorology, magnetism, aurora, and radio science data. The third IPY is the well-
known International Geophysical Year that was proposed by the Council of Scientific Union
and took place in 1957-58. In this opportunity, research on both Arctic and Antarctica were
carried out, including research from outside of the polar regions. Many meteorological
stations that are still functioning today were installed during the third IPY. More recently,

122 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

the International Council for Science (ICSU) and the WMO organized what become the
fourth IPY, which was accomplished in 2007-08. One legacy of this initiative was the
creation of the Global Integrated Polar Prediction System (GIPPS) by the WMO. On the other
hand, the World Weather Research Program (WWRP) of the WMO established the Polar
Prediction Project (WWRP-PPP) with the mission of Promote cooperative international
research enabling development of improved weather and environmental prediction services
for the polar regions, on time scales from hours to seasonal (WWRP/PPP No. 4, 2016);
while the World Climate Research Program (WCRP) of the WMO established the Polar
Climate Predictability Initiative (PCPI) with similar mission but for prediction services on
time scales from a season and beyond.
YOPP is a key element of the WWRP-PPP and its goal is to Enable a significant
improvement in environmental prediction capabilities for the polar regions and beyond, by
coordinating a period of intensive observing, modelling, prediction, verification, user-
engagement and education activities (WWRP/PPP No. 4, 2016). However, YOPP is not the
fifth IPY although some elements resemble the previous ones.

Improving the predictions for polar regions, within the framework of YOPP, requires
collaborative international research for achieving the following objectives (copied from the
WWRP/PPP No. 4 (2016):
1. Improve the existing polar observing system (enhanced coverage, higher-quality
observations).
2. Gather additional observations through field programs aimed at improving understanding
of key polar processes.
3. Develop improved representation of key polar processes in (un)coupled models used for
prediction.
4. Develop improved (coupled) data assimilation systems accounting for challenges in the
polar regions such as sparseness of observational data.
5. Explore the predictability of the atmosphere-cryosphere-ocean system, with a focus on
sea ice, on time scales from hours to a season.
6. Improve understanding of linkages between polar regions and lower latitudes, assess skill
of models representing these linkages, and determine the impact of improved polar prediction
on forecast skill in lower latitudes.
7. Improve verification of polar weather and environmental predictions to obtain better
quantitative knowledge on model performance, and on the skill, especially for user relevant
parameters.
8. Identify various stakeholders and establish their decision-making needs with respect
to weather, climate, ice and related environmental services.
9. Assess the costs and benefits of using predictive information for a spectrum of users and
services.
10. Provide training opportunities to generate a sound knowledge base (and its transfer
across generations) on polar prediction related issues.

The YOPP will take place from mid-2017 to mid-2019, centered on the year 2018, during
which extended period of coordinated intensive observational, modelling, prediction and user
engagement activities are expected to take place in order to improve polar prediction
capabilities on time scales from hourly to seasonal. YOPP is expected to foster relationships
with partners, provide common focused objectives, and be held over somewhat more than a

123 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

one-year period in association with field campaigns providing additional observations


(WWRP/PPP No. 4, 2016). YOPP has been implemented in three different stages: a
Preparation Phase, a Core Phase (when the actual intense observing period should occur),
and a Consolidation Phase (Figure 1). The Core Phase in the Northern Hemisphere has
already begun in June 2017.

Figure 1. Three stages of YOPP, including the main activities for each stage. Figura 1. Tres etapas de YOPP,
incluyendo las actividades principales para cada etapa.

During the fourth international YOPP Planning Workshop held at WMO in Geneva in July
2015 (Goessling et al., 2015), the establishment of a Coordinating Committee for YOPP
activities in the Southern Hemisphere was proposed with the mission of promoting Antarctic
and Southern Ocean research that contributes to YOPP. The coordination Committee is led
by Dr. David H. Bromwich of the Polar Meteorology Group - Byrd Polar and Climate
Research Center at The Ohio State University, and information of the YOPP-SH can be found
at http://polarmet.osu.edu/YOPP-SH/. The task of the YOPP-SH coordination committee is
identify the Special Observing Period(s) and enhanced observing to be undertaken during
YOPP in the Southern Hemisphere (WWRP/PPP No. 4, 2016). The first YOPP-SH Planning
Meeting was held at Columbus, Ohio-USA in June 2016 and the second at Boulder,
Colorado-USA in June 2017. One important outcome from the first meeting was that there
was a general agreement that the Special Observing Period for YOPP-SH should take place
during the austral summer season, namely mid-November 2018 to mid-February 2019. In
both meetings, a large number of projects and additional observation programs from different
countries that will be undertaken during the Special Observing Period were presented.

The Coordination Committee for YOPP-SH calls the scientific community and national and
international organizations to join the effort of collaborating with the Special Observing

124 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Period in Southern Hemisphere that will improve the prediction capabilities and our
understanding of the physical processes and dynamic interactions among the different
components of the polar climate system. Joining this international effort is a win to win
opportunity so that all data gathered will be shared to the joined parties. Your polar project
can be endorsed by YOPP, information and guidelines can be found at
http://www.polarprediction.net/yopp/yopp-endorsement.html.

Acknowledgment
Fondecyt N 1151034 and N 1161130.

References
Goessling, H. F., Jung, T. , Klebe, S., Baeseman, J., Bauer, P., Chen, P., Chevallier, M., Dole, R., Gordon, N.
D., Ruti, P., Bradley, A., Bromwich, D. H., Casati, B., Chechin, D., Day, J. J. , Massonet, F., Mills, B. , Renfrew,
I. A. , Smith, G., Tatusko, R. 2016: Paving the Way for the Year of Polar Prediction, Bulletin of the American
Meteorological Society, doi/10.1175/BAMS-D-15-00270.1.
Jung, T. , Gordon, N. D. , Bauer, P. , Bromwich, D. H. , Chevallier, M. , Day, J. J. , Dawson, J. , Doblas-Reyes,
F. , Fairall, C. , Goessling, H. F. , Holland, M. , Inoue, J. , Iversen, T. , Klebe, S. , Lemke, P. , Losch, M. ,
Makshtas, A. , Mills, B. , Nurmi, P. , Perovich, D. , Reid, P. , Renfrew, I. A. , Smith, G. , Svensson, G. ,
Tolstykh, M. and Yang, Q. 2016. Advancing polar prediction capabilities on daily to seasonal time scales,
Bulletin of the American Meteorological Society, doi/10.1175/BAMS-D-14-00246.1.
Luedecke, C. 2004. The first International Polar Year (1882-83): A big science experiment with small science
equipment. Proceeding of the International Commission on History of Meteorology 1.1: 55-64.
Wood, K.R. and Overland, J.O. 2006. Climate lessons from the first International Polar Year. Bulletin of
American Meteorological Society, 87(12): 1685-1697. DOI:10.1175/BAMS-87-12-1685.
WWRP/PPP No. 4. 2016. WWRP Polar Prediction Project Implementation Plan for the Year of Polar Prediction
(YOPP). World Meteorological Organization, 68 pp.

125 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ANALYSING THE NEAR-SURFACE AIR TEMPERATURE AT FREI STATION


(Analizando la temperatura del aire superficial en la Estacin Frei)

Carrasco, J.F.1
1
Universidad de Magallanes, Avenida Bulnes 01855, Punta Arenas, jorge.carrasco@umag.cl.

The Antarctic Peninsula (AP) is one of the regions where air surface temperatures have
experienced substantial warming at higher rate than global average (Vaughan et al. 2001,
2003, Turner et al. 2005, Din et al. 2011, Bromwich et al. 2013) during the second half of the
20th century. During the last two decades this warming has momentarily declined or even a
slight no significant cooling has been detected (Carrasco 2013, Turner et al. 2016, Oliva et
al. 2017). Averages of the mean and extreme air temperatures (minimum and maximum) are
usually analyzed for climate change studies. Here, a different approach is introduced for
studying the air temperature behavior recorded at Frei Station located in King George Island
(62120S, 585751W), in the northern tip of the Antarctic Peninsula.

Materials And Methods


Daily weather observations carried out at the Chilean station Eduardo Frei by personnel of
the Direccin Meteorolgica de Chile, allow a detailed analysis of the behavior of
meteorological variables at different timescales. In this occasion, near-surface minimum and
maximum air temperatures (Tmin and Tmax) data are analyzed from 1970 to 2015. The daily
data also allow estimating the starting and ending freezing season. This period is defined as
all days when the Tmax is permanently below zero degrees, after filtering out the daily
variability. To determine the annual freezing season, the original daily Tmax were smoothed
by applying an exponential filter (Rosenblth et al. 1997) given by:
yt = cxt + (1 c ) yt 1 t = 2,3,.........n (1)
and zt = cyt + (1 c )zt +1 t = (n 1), (n 2),.....1 (2)
Where equations (1) and (2) are respectively the first forward and second backward
smoothing. The first value yt is the average of the first 10 values of the series and zt
corresponds to the final value of the first
10
Freezing period smoothing. The degree of smoothing (c)
Maximum Air Temperature

5
can range from 1 (maximum, reproducing
0 the original data) to 0 (obtaining a straight
-5 line). Here, we used c = 0.11 and c = 0.2
Initial freezing Ending freezing for filtering the high frequency inter-daily
-10
period period
-15 and annual variability, respectively.
-20
Original daily data Figure 1 shows an example of the
Smooth data
procedure used for determining the
-25
freezing season, in this case for 1975. By
1

109
127
145
163
181
199
217
235
253
271
289
307
325
343
361
19
37
55
73
91

Julian days applying the filter, the longer (weekly or


monthly) behavior stands out and, the
Figure 1. Smoothing behavior of the maximum air initial and final days of the freezing season
temperature for 1975. Figura 1. Comportamiento can be determined.
suavizado de la temperatura mxima para 1975. Results

126 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Firstly, the usual analysis indicates an overall warming observed in the annual mean
temperature (Tmean), mainly during the eighties and nineties and a cooling during the last
fifteen years (Figure 2). An overall positive trend took place until around 2000 and a slight
negative trend afterward. The Tmin is the one that shows significant warming (higher than
the Tmax) mainly until 2000 and a cooling afterward (Figure 3). This results in a negative
trend of the average diurnal temperature range (DTR, which is the difference between Tmax
and Tmin) during the 1970-2015 period. Table 1 shows the annual and seasonal decadal
trends of the extremes, the mean air temperature and the DTR for the analyzed period.

Season Tmin Tmax Tmean DTR


Summer -0,02 -0,26 -0,14 -0,24
Autumn 0,03 -0,03 0,14 -0,35
Winter 0,47 0,00 0,23 -0,47
Spring 0,08 -0,28 -0,10 -0,36
Annual 0,21 -0,15 0,03 -0,35

Table 1. Decadal trends of the mean and


extremes air temperature and the diurnal
temperature range at Frei station for the 1970-
2015 period. Bold numbers means statistically
significant at 5% level.
Tabla 1. Tendencia decadal de la temperatura
media y extremas y de la oscilacin diaria en la
estacin Frei para el periodo 1970-2015.
Nmeros en negrilla significan que son
estadsticamente significativos al 5%.
6

2
Air temperature

-2

-4

-6
Tmin Tmean Tmax DTR
-8
1970
1973
1976
1979
1982
1985
1988
1991
1994
1997
2000
2003
2006
2009
2012
2015

Figure 2. Near-surface air temperature behavior at


Frei station. Dashed lines are annual means while
solid curves are the tendency given by the
exponential filter.
Figura 2. Comportamiento de la temperatura del aire
superficial en la estacin Frei. Lneas punteadas son
los promedios anuales y curvas slidas la tendencia
dada por el filtrado exponencial.

Secondly, Figure 3 shows the annual duration of the freezing season and the starting and
ending day. Results indicate no significant change in the starting of the freezing season,

127 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

which occurs around mid-April. The ending freezing season reveals a significant change of
about one month, from the late October to late November. This implies that the number of
freezing (non-freezing or melting) days has increased (decreased) mainly during the last 15
years (Figure 4).

Discussion
Traditionally analysis resolves that significant warming has taken place during the winter
(June-July-August) and in the Tmin, while the Tmax has shown less warming until the year
2000 and significant cooling afterward mainly in the spring and summer seasons. This results
in an overall cooling of the Tmax over the 1970-2015 period and a corresponding negative
trend in the DTR. Another approach for analyzing the air temperature behavior is examined.
This consists in determining the freezing season corresponding to the time of the year when
Tmax is, on average, permanently below zero degrees Celsius, therefore, no melting is
expected during this period. This means that there is a starting and an ending day for each
season over the years, which is determined after filtering out the inter-daily variability
(Figure 1).
366
At Frei station, the result indicates that
305 the freezing season has extended about
one month, from the late October to late
244 November, resulting also in a shortening
Julian day

183
of the non-freezing period or warming
day season, which can be defined as the
122 time when the Tmax is above zero
Starting day degrees. The results reveal an overall
61 Ending day
Freezing season warming during the last quarter of the
0 20th Century, but a slight cooling
1970
1973
1976
1979
1982
1985
1988
1991
1994
1997
2000
2003
2006
2009
2012
2015

afterward, mainly due to the changes in


the winter Tmin. However, at the same
Figure 3. Annual duration of the freezing season and the time, there has been an increase of the
starting and ending day at Frei station. freezing season duration.
Figura 3. Da de comienzo, trmino y duracin anual del To expand the analysis, the same
periodo de congelamiento en la estacin Frei. procedure was carried out with Rothera
(673508S, 680759W) and Faraday/Vernadsky (651444S, 641528W) stations
records, located to the south of Frei station on the western side of the AP. Figure 4 graphs
the freezing season for Rothera station for the 1977-2015 period, while Figure 5 corresponds
366 to Faraday/Vernadsky station for the 1970-2015 period. Both locations present different
305
results from that found at Frei. They do not show an increase of the freezing season although
Rothera does reveals an increase during the 2000-2015 period (Figure 4). On the other hand,
244 the shortening of the freezing season at Faraday/Vernadsky can clearly be observed in Figure
Julian day

5, which also reveals that the starting day is occurrring later in the year, from mid-
183 Starting day
Freezing season April to early-May. This means a longer summer melting season. To complement
122
Ending day this analysis, the annual number of days for which the Tmax was above zero
degrees Celsius (ANPD), were calculated for the three stations. Faraday/Vernadsky
61 shows a significant positive trend over the 1948-2015 period, even during the last
0
15 years. A positive trend takes place at Rothera station between
1977 and 2000, and a negative trend afterward. No changes are
1977
1979
1981
1983
1985
1987
1989
1991
1993
1995
1997
1999
2001
2003
2005
2007
2009
2011
2013
2015

128 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

observed at Frei station between 1970 and 1990, but afterwards a negative trend can be
observed, which is more significant after 2000.
366

305

244

Julian day
183

122

61 Ending day
Freezing days
Starting day
0
1970
1973
1976
1979
1982
1985
1988
1991
1994
1997
2000
2003
2006
2009
2012
2015
Figure 6. Starting and ending day of the freezing Figure 7. Starting and ending day of the freezing
season at Rothera station. season at Faraday/Vernadsky station.
Figura 6. Da de comienzo y trmino del periodo de Figura 7. Da de comienzo y trmino del periodo de
Conclusion
congelamiento en la estacin Rothera congelamiento en la estacin Faraday/Vernadsky.
The overall result at Frei station indicates a warming until 2000, mainly driven by the Tmin
in winter, and a slight cooling afterward. Also, the duration of the freezing season has
increased since the ending day has changed from late October to late November during the
1970-2015 period. However, only Rothera shows a slight increase of the freezing season after
2000, while Faraday/Vernadsky reveals a decrease over the 1970-2015 period. These
behaviors concur with the behaviors of the ANPD, at each station. The analysis indicates that
Faraday/Vernadsky station is the one that consistently shows a warming over the observed
period (1948-2015), even during the last 15 years when a cooling has been taking place to
the north (at Frei) and south (Rothera). This might suggest different north-south
environmental and biophysical responses to the variability of the freezing season. For
example, Petlicki et al. (2017) indicates that the reduction of ice mass loss in Ecology Glacier
at King George Island is probably related to the decreasing summer temperature. The
increase of the freezing season and the decreasing ANPD at Frei also support the conclusion
of Petliki et al. (2017; see Figures 4, 5 and 8). Cook et al. (2014) found an increasing ice loss
from north to south in the western side of the AP. This might concur with the fact that
Faraday/Vernadsky and Rothera stations show an overall decrease of the freezing season,
mainly at Faraday/Vernadsky, which also experienced a significant increase of the ANPD.
Further analysis is needed on the differential temperature behavior in the western AP and its
impacts.

Acknowledgments
This work is supported by the Fondecyt N 1151034.

References
Bromwich, D. H., J. P. Nicolas, A. J. Monaghan, M. A. Lazzara, L. M. Keller, G. A. Weidner, and A. B. Wilson,
2013: Central West Antarctica among the most rapidly warming regions on Earth. Nature Geoscience, 6, 139-
145, doi: 10.1038/ngeo1671.
Carrasco, J.F., 2013. Decadal changes in the near-surface air temperature in the western side of the Antarctic
Peninsula. Atmospheric Climate Sciences, 3, 275281.

129 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Cook, A.J., Vaughan, D.G., Luckman, A.J. and Murray, T. 2014. A new Antarctic Peninsula glacier basin
inventory and observed area changes since the 1940s. Antarctic Science 26(6), 614-624.
Din, Q., D.S. Batisti and M. Kuttel, 2011. Winter warming in West Antarctica caused by central tropical Pacific
warming. Nature Geoscience, 4, 398-403, doi: 10.1038/ngeo1129.
Oliva, M., Navarro, F., Hrbek F., Hernndez, A., Nvlt, D., Pereira, P., Ruiz-Fernndez, J., and Trigo, R.,
2017. Recent regional climate cooling on the Antarctic Peninsula and associated impacts on the cryosphere,
Science of the Total Environment, 580, 210223.
Petlicki, M., Szilo J., MacDonell, S., Vivero, S. & Bialik, R. (2017). Recent decelaration of the ice elevation
change of ecology glacier (King George Island, Antarctica). Remote Sensing, 9, 520; doi:10.3390/rs9060520.
Rosenblth, B., Fuenzalida, H.A. & Aceituno, P. (1997). Recent temperatures variations in southern South
America. International Journal of Climatology, 17, 67-85.
Turner, J., Lu, H.,White, I., King, J.C., Phillips, T., Scott Hosking, J., Bracegirdle, T.J.,Marshall, G.J.,
Mulvaney, R., Deb, P., 2016. Absence of 21st century warming on Antarctic Peninsula consistent with natural
variability. Nature 535. http://dx.doi.org/10.1038/nature18645.
Turner, J., T.A. Lachlan-Cope, S. Colwell, G.J. Marshall and W.M. Connolley. 2005. Significant warming of
the Antarctic winter troposphere. Science, 311, 1914-1917.
Vaughan, D. G., Marshall, G. J., Connolley, W. M., King, J. C., and Mulvaney, R.: Climate Change: Devil in
the Detail, Science, 293, 17771779, 2001.
Vaughan, D.G., G.J. Marshall, W.M. Connolley, C. Parkinson, R. Mulvaney, D.A. Hodgson, J.C. King, C.J.
Pudsey, J. Turner, 2003. Recent rapid regional Climate Warming on the Antarctic Peninsula, Climate Change,
V60 I3, p. 243-274.

WARM EVENTS OBSERVED AT PATRIOT HILLS AND UNION GLACIER IN


THE INTERIOR OF WEST ANTARCTICA
(Eventos clidos observados en los Montes Patriot y Glacier Union en el
interior de la Antrtica Occidental)

Carrasco, J.1
1
Universidad de Magallanes, Avenida Bulnes 01855, Punta Arenas. Correo. jorge.carrasco@umag.cl

Recently Nicolas et al. (2017) described an intense melt event that took place when near-
surface air temperature were 0C or above during 10-21 January 2016, affecting large portion
of the Ross Ice Shelf. A main factor associated with this event was the presence of a blocking
high over the Southern Ocean, north of Amudsen Sea. The ridge configuration suggests
strong north-south warm-marine air advection towards the Ross Ice Shelf region. This event
took place during the strong El Nio 2015-16 and it can be responsable for it, but not
conclusive connection must be done between the event and El Nio (Nicolas et al. 2017).
Other unusual warm event occurred in the northern tip of the Antarctic Peninsula (AP) where
the Argentine Esperanza Base registered a record high temperature of 17.5C on 24 March
2015, this is one day after the Argentine Marambio Base had registered 17.4C (Skansi et al.
2017). This time, a midlatitude tropospheric ridge developed southward reaching the
northern AP on 23 March. This ridge pattern origined warm advection towards the area and
westerly winds towards the mountain range and foehn winds in its lee side resulting in high
temperatures in the eastern slope of the peninsula. Skansi et al. (2017) indicated that the
highest extreme temperature recorded south of latitude 60S is 19.8C and occurred on 30
January 1982 at Signy Island (6043S 4536W), located to the northeast of the northern tip
of the AP (around 650 km from Esperanza Base). Once again, a tropospheric ridge was
passing over the region advecting warm air and generating foehn winds in the lee side of the
South Orkney Island where the weather station was located (Skansi et al. 2017). As Skansi
et al. (2017) mentioned, a WMO committee recommended two subregions for establishing

130 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

extreme temperature records in the southward 60S. One is the Antarctic continent and all
islands immediately adjacent to it (which discard Signy Island), and the other is all region
above 2500 m.a.s.l., which includes mostly the East Antarctica. Thus, the temperature
recorded at Esperanza Base became to be the highest ever recorded in Antarctic continent
since instrumental measurements. On the other hand, the highest temperature measured
within the Antarctic subregion above 2500 m.a.s.l. is -7C recorded by an automatic weather
station at D-80 (706S, 13453E, 2500 m.a.s.l.) on 28 December 1989 (Skansi et al.2017).
The 500-hPa field for this day revealed a troposphere ridge whose axes was just to the west
of the station. Warm air advection circulated counterclockwise towards D-80.
In between the coastal areas of the Antarctic continent and the adjacent islands, where
extreme air temperature can eventually reach far above 0C, and the subregion above 2500
m, where surface temperature can eventually increase but not likely above 0C; there is an
extensive region where the near-surface air temperature can eventually reach above 0C (and
cause a melting event), but not likely as high as to those near the coastal areas. This is the
case of an air temperature registered in the interior of West Antarctica at Patriot Hills
(8008'S, 8116' W., 855 m.a.s.l.), that reached 3C at 14 UTC on 7 December 1997, and the
one recorded at Union Glacier (79.76S, 83.27W, elevation 767 m.a.s.l.) with air
temperature reaching 3.3C at 21 UTC on 21 February 2013 (Figure 1). Here a description
of these events is presented, as well as, their possible relation with El Nio Southern
Oscillation (ENSO). For the analysis it was used the data obtained in situ and the reanalysis
data obtained from the ERA-Interim reanalysis (Dee et al. 2011).

Figure 1. Three hourly air temperature, station pressure and wind speed measurement taken at Patriot Hills(
left) between 21 November and 15 December 1997, and at Union Glacier (right) between 7 and 27 February

131 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

2013. Figura 1. Mediciones trihoraria de la temperature del aire, presin de estacin y velocidad del viento en
los Montes Patriot (izquierda) entre el 21 de noviembre y 15 de diciembre de 1997, y en el Glaciar Unin
(derecha) entre el 7 y 27 de febrero de 2013.

SYNOPTIC-SCALE ANALYSIS
The mean sea-level pressure and 500 hPa for 1-8 December 1997 (Figure 2) and 21-22
February 2013 (Figure 3) were constructed using the ERA-Interim reanalysis (Dee et al.
2011). For the first case, the surface analysis (Figures 2a) revealed a cyclonic circulation in
the southern polar ocean to the north of Amundsen Sea and another in southern Atlantic
ocean to the north of Queen Maud Land. In between of these two cyclonic circulations,
developed a ridge over the Antarctic Peninsula with a high-pressure system centered just east
of Drake Passage to the northeast of the peninsula. The 500-hPa analyses also resolved a
ridge over the peninsula extended towards West Antarctica (Figure 2b), revealing the
midtropospheric characteristic of the ridge. The low-ridge-low pattern prevailed between 1
and 8 December, and the associated synoptic-scale circulation advected warm-marine air
from Bellingshausen Sea towards Hollick-Kenyon Plateau and the vicinity of Patriot Hills.
The ridge started to develop on 30 November and weakened after 9 December. Its maximum
intensity and amplitude took place on 3 and 4 December, respectively, but the synoptic-scale
pattern maintained the warm advection towards Patriot Hills area until 7 December. For the
second case, the surface and 500 hPa fields show similar configuration that the first one, i.e.,
the presence of a midtropospheric ridge although this time the pressure and the gpm the
orientation of its axis is more northerly.

Preliminary Enso
To investigate the frequency of these warm events, which are associated with the
development of tropospheric ridge in the southern ocean, it was used the 500-hPa
geopotential height analyses from the ERA-Interim reanalysis (Dee et al. 2011). An area
enclosing Patriot Hills and Union Glacier (cutting out region lon= 278.789 / 280.898, lat=-
82.104 / -79.999) was selected for downloading the daily 500 hPa for the 1979-2016 period
from KNMI Climate Explorer (http://climexp.knmi.nl).

Figure 2. a) Mean sea level pressure (in hPa) and b) 500 hPa (in gpm) analyses for 1-8 December 1997,
constructed using the ERA-Interim reanalysis. Figura 2. Anlisis del promedio de la presin a nivel del mar
((a) en hPa) y 500 hP ((b) en metros geopotenciales) para el 1-8 de diciembre de 1997, construidos usando el
Anlisis ERA-Interim.

132 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figure 3. a) Mean sea level pressure (in hPa) and b) 500 hPa (in gpm) analyses for 21-22 February 2013,
constructed using the ERA-Interim reanalysis. Figura 3. Anlisis del promedio de la presin a nivel del mar
((a) en hPa) y 500 hP ((b) en metros geopotenciales) para el 21-22 de Febrero de 2013, construidos usando el
Anlisis ERA-Interim.

The time series of the geopotential heights at 500 hPa allow looking for similar behavior to
that observed during the 5-7 December 1997, i.e., periods of at least three consecutive days
with geopotencial heights above the corresponding 2.0 standard deviation. To determine this
values the annual mean daily average and the 2.0 standard diviation were calculated for the
1979-2000 period. Then, the daily simulated geopotential height anomalies for each year
were compared with the corresponding 2.0 standard deviation. This gives us a series of days
with geopotential heights above the threshold given by the 2.0 standard deviation. These
periods were defined as extreme positive gpm events. Table 1 shows the numbes of events
that met this criterion, a total of 100 events occurred during the 1979-2016 period that range
from 1 to 7 events, only 2 years (out of 38 years) did not registered any event. Thirteen years
with events (34%) concured with El Nio occurrence while nine years (24%) with La Nia
and sixteen (42%) with neutral conditions.
The composite mean and anomalies fields at the sea-level pressure and 500 hPa analyses for
the extreme positive gpm events were constructed using the 20 Century Reanalysis Daily
Composites database (20CRV2c) available via internet at www.esrl.noaa.gov (Kalnay et al.
1996). A blocking ridge configuration is clearly depicted over the AP with significant
positive anomalies around 72S, 70W at sea-level pressure and around 76S, 74W at 500
hPa. This pattern suggests warm advection towards the Ellsward Land in interior of West
Antarctica that can eventually reach Patriot Hills/Union Glacier area.

133 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

In summary, even thought the warming event Table 1. Number of events, duration (days above
observed in 1997 occurred during ENSO years, the 90% confidence level). EN: El Nio, LA: La Nia
they may occur at anytime that a blocking ridge and N: neutral conditions.
builds up in the area of the Antarctic Peninsula and
Ellsworth Land. Tabla 1. Nmero de eventos, duracin (das por
encima del nivel de confianza del 90%). EN: El
Acknowledgements Nio, LA: La Nia y N: condiciones neutrales.
This work is supported by the Fondecyt N
1151034.

References
Dee, D.P., Uppala, S.M., Simmons, A.J., Berrisford, P., Poli,
P., Kobayashi, S., Andrae, U., Balmaseda, M.A., Balsamo,
G., Bauer, P., Bechtold, P., Beljaars, A.C.M., vamn de Berg,
L., Bidlot, J., Bormann, B., Delsol, C., Dragani, R., Fuentes,
M., Geer, A.J., Haimberger, L., Healy, S.B. Hersbach, H.,
Hlm, E.V., Isaksen, L., Kallberg, P., Kohler, M.,
Matricardi, M., McNally, A.P., Monge-Sanz, B.;M.,
Morcrette, J.-J., Park, B.-K., Peubey, C., de Rosnay, P.,
Tavalato, C., Thpaut, J.-N. and Vitart, F. 2011. The ERA-
Interim reanalysis: configuration and performance of the
data assimilation system. Quart. J.R. Meteorol. Soc., 137,
553-597 (DOI:10.1002/qj.828)
Kalnay, E., Kanamitsu, M., Kistler, R., Collins, W. Deaven,
D., Gandin, L., Iredell, M., Saha, S., White, G., Woollen, J.,
Zhu, Y., Chelliah, M., Ebisuzaki, W., Higgins, W.,
Janowiak, J., Mo, K.C., Ropelewski, C., Wang, J., Leetmaa,
A., Reynolds, R., JenneR., and Joseph, D. 1996. The
NCEP/NCAR Reanalysis 40-year Project. Bull. Amer.
Meteor. Soc., 77, 437-471.
Nicolas, J.P., Vogelmann, A.M:, Ryan C. Scott R.C.,,
Wilson, A.B., Cadeddu, M.P., Bromwich, D.H., Johannes
Verlinde6, Lubin, D., Lynn M. Russell, L.M., Jenkinson, C.,
Heath H. Powers, H.H., Ryczek. M., Gregory Stone, G. and
Jonathan D. Wille, J.D. 2017. January 2016 extensive
summer melt in West Antarctica favoured by strong El Nio.
Nature Communications 8:15799. DOI: 10.1038/nco.
Skansi, MLA, King, J., Matthew, Lazzara, A., Randall
Cerveny, S., Stella, J.L., Solomon, S., Jones, P., Bromwich,
D., Renwick, J., Burt, C.C., Peterson, T.C., Brunet,
Driouech, M.F., Vose, R. and Krahenbuhl, D. 2017.
Evaluating Highest Temperature Extremes in the Antarctic. Eos, 98, https://doi.org/10.1029/2017EO068325.

134 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ANLISIS DE COMUNIDADES BACTERIANAS ENDOLTICAS ANTRTICAS


(Analysis of antarctic endolitic bacterial communities)

Carrasco V.1, Vivanco L.2, Amarelle V.1, Snchez L.2, Fabiano E.1,
1
Departamento de Bioqumica y Genmica Microbianas Instituto de Investigaciones Biolgicas "Clemente
Estable".2Departamento de Ciencias Geolgicas, Facultad de Ciencias, UDELAR.

Las comunidades endolticas estn constituidas por microorganismos capaces de colonizar


las grietas, poros y fisuras de las rocas, las cuales brindan a estos organismos proteccin
frente a condiciones ambientales extremas de viento, desecacin, alta radiacin UV y
fluctuaciones en la temperatura, condiciones habituales en lugares como la Antrtida. A la
vez, los depsitos minerales de las rocas, pueden ser utilizados como fuentes de nutrientes y
energa por las bacterias all presentes. En consecuencia, las bacterias endolticas participan
activamente en los procesos de biotransformacin y deterioro de las rocas, ya sea mediando
su desgaste como fomentando la biodeposicin de minerales (Wierzchos et al. 2012; Horath
and Bachofen 2009; Warscheid and Braams 2000). Basndonos en la hiptesis que las rocas
antrticas albergan una comunidad bacteriana particular, an muy poco explorada, nos
planteamos analizar dos comunidades endolticas antrticas en cuanto a su diversidad y
fisiologa, haciendo especial hincapi en la evaluacin de la respuesta frente a la presencia
de metales y la produccin de pigmentos. En particular, los objetivos especficos propuestos
comprenden: la identificacin de los gneros a los que pertenecen las bacterias que integran
la comunidad microbiana, la identificacin de cepas cultivables capaces de crecer en
presencia de metales y de cepas productoras de pigmentos, conocer si existe alguna
correlacin entre ambas caractersticas y, por ltimo, detectar regiones genmicas
responsables de estas caractersticas que puedan expresarse en Escherichia coli. Para alcanzar
estos objetivos, emplearemos estrategias complementarias que involucran estudios clsicos
funcionales de bacterias cultivables, as como aproximaciones metagenmicas. (Lorenz and
Eck 2005; Cowan et al. 2005; Martiny et al. 2011). Con estas aproximaciones esperamos
obtener resultados originales que aporten al conocimiento de las comunidades endolticas y
que generen antecedentes para posibles desarrollos biotecnolgicos futuros, particularmente
en el campo de la biorremediacin de ambientes contaminados con metales pesados.

Materiales y Mtodos
1. Colecta y procesamiento de las muestras
Se colectaron 2 muestras de roca, identificadas como andesitas baslticas, de los alrededores
de la Base Cientfica Antrtica Artigas (BCAA), Isla Rey Jorge, Antrtida, y se procesaron
en el laboratorio de la Base. El tratamiento de las muestras consisti en una desinfeccin de
superficie mediante lavados sucesivos con etanol 70% y con agua destilada estril, de manera
de obtener nicamente la comunidad bacteriana endoltica. Posteriormente la roca se macer
con mortero estril y se resuspendi el material obtenido en un volumen adecuado de agua
destilada estril. Las muestras se procesaron por triplicado.
2. Aislamiento de bacterias cultivables y generacin de la coleccin
Alcuotas de 100 L de las muestras de roca macerada en suspensin se plaquearon en medio
R2A slido con o sin agregado de sales metlicas. Los cultivos se incubaron a 4C, se

135 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

realizaron los conteos de las unidades formadoras de colonia y se seleccionaron colonias en


base a su fenotipo para conformar la coleccin de bacterias cultivables.
3. Identificacin de los gneros bacterianos
La identificacin de los gneros se realiz por anlisis de la secuencia del 16S ADNr. Las
secuencias se obtuvieron por amplificacin por PCR y secuenciacin a partir de las cepas
cultivables. Las secuencias obtenidas fueron ensambladas y depuradas mediante la
utilizacin de los softwares DNABaser y FinchTV, respectivamente. Para determinar los
gneros de los aislamientos de la coleccin se emple el seqmatch, disponible en el sitio web
del Ribosomal Database Project.
4. Anlisis de tolerancia a metales
Se realizaron ensayos de tolerancia a metales en medio slido y en medio lquido. Para ello
se evalu el crecimiento bacteriano, ya sea como aparicin de unidades formadoras de
colonia o como determinacin de densidad ptica a 620nm, en medios suplementados con
distintas concentraciones de metales. Los metales ensayados fueron: Ag+, Cd2+, Co2+,
Cu2+, Mn2+, Ni2+, Zn2+.
5. Anlisis de los pigmentos producidos por las bacterias
Se seleccionaron 26 aislamientos productores de pigmentos de diferentes tonalidades y de
distintos gneros bacterianos a fin de caracterizar la naturaleza qumica de stos. Para ello,
se ensayaron diferentes protocolos de extraccin y purificacin en presencia de diferentes
solventes orgnicos. Las fracciones coloreadas obtenidas se analizaron por
espectrofotometra.
6. Extraccin de ADN metagenmico y construccin de la biblioteca metagenmica
Alcuotas del macerado de roca se utilizaron como material de partida para la extraccin del
ADN metagenmico. Para esto, se estn analizando diferentes protocolos y se pretende
optimizar la tcnica de extraccin a partir de rocas. Una vez obtenido el ADN metagenmico
en la cantidad y calidad adecuadas, se proceder con la construccin de la biblioteca
metagenmica segn la metodologa puesta a punto en nuestro laboratorio. A grandes rasgos,
sta consta del clonado del ADN metagenmico en un vector adecuado y su incorporacin
en el hospedero, E. coli, mediante el empleo de un kit comercial. Posteriormente, se evaluar
la metagenoteca a fin de detectar funciones relacionadas a la tolerancia a metales y a la
produccin de pigmentos (metagenmica funcional).

Resultados
Tras el procesamiento de 2 muestras de roca, se gener una coleccin de 102 aislamientos de
cepas bacterianas endolticas antrticas. Un 58% de los aislamientos resultaron ser bacterias
gram positivas, de los filos Actinobacteria, Firmicutes y Deinococcus-Thermus. En cuanto a
las bacterias gram negativas, se encontraron representantes de Bacteroidetes, Proteobacteria
(alfa, beta y gamma) y Cyanobacteria. A nivel de gnero, se identificaron 27 gneros
distintos, siendo los predominantes Arthrobacter (33%), Sphingomonas (10%) y
Mucilaginibacter (6%). En cuanto a los conteos de bacterias hetertrofas cultivables, se
obtuvieron aproximadamente 102 unidades formadoras de colonia por gramo de roca, en
promedio.
La respuesta a metales observada mostr distintos perfiles. Se identificaron cepas tolerantes
e incluso multitolerantes a metales, destacndose algunos aislamientos en los cuales el
crecimiento fue mayor en los medios con el agregado de determinados metales que en el
medio sin agregado de metales, en particular en presencia de Mn. Los ensayos en medio
slido demostraron que ms del 50% de los aislamientos resultaron ser tolerantes a Mn+2

136 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

(3mM), ms de un 40% toleraron Cu+2(1mM) y aproximadamente un 10% de las cepas


fueron tolerantes a Zn+2(1mM) y a Ni+2(1mM). Pedobacter sp. UYP1 result ser la cepa
con caractersticas ms interesantes, revelando mayores niveles de tolerancia a metales, tanto
en medio slido como en medio lquido, y en la mayora de los metales.
Se eligieron 26 aislamientos coloreados, de distintos gneros, para analizar sus pigmentos.
Tras su extraccin, purificacin y anlisis espectrofotomtrico se obtuvieron 6 tipos distintos
de espectros que se asimilan a los reportados para carotenoides.
En cuanto a la aproximacin metagenmica, al momento se ha obtenido ADN metagenmico
pero no de la calidad y cantidad necesaria como para proceder con la construccin de la
biblioteca. Por ello, nos encontramos intentando optimizar su obtencin mediante distintos
protocolos. La coleccin de bacterias endolticas cultivables analizada en el presente trabajo
demostr ser diversa, siendo los gneros identificados caractersticos de ambientes
endolticos. En particular se encontr una presencia y distribucin de gneros similar a la
encontrada por Walker y Pace (Walker and Pace, 2007) en rocas de tipo granito, donde se
report una alta diversidad bacteriana y se destac la abundancia de Actinobacterias. Los
resultados obtenidos hasta el momento apoyan la hiptesis acerca de la relevancia de estos
nichos para prospectar bacterias resistentes a metales y elucidar la contribucin de esta
comunidad bacteriana en los ciclos biogeoqumicos de metales.

Referencias
Cowan D. et al. 2005. Metagenomic Gene Discovery: Past, Present and Future. Trends in biotechnology 23(6):
32129.
Horath T. and Bachofen R. 2009. Molecular Characterization of an Endolithic Microbial Community in
Dolomite Rock in the Central Alps (Switzerland). Microbial ecology 58(2): 290306.
Lorenz P. and Eck J. 2005. Outlook: Metagenomics and Industrial Applications. Nature Reviews Microbiology
3(6): 51016.
Martiny A.C. et al. 2011. Functional Metagenomics Reveals Previously Unrecognized Diversity of Antibiotic
Resistance Genes in Gulls. Frontiers in Microbiology 2.
Walker J. J. and Pace N. R. 2007. Phylogenetic composition of Rocky Mountain endolithic microbial
ecosystems. Applied and Environmental Microbiology 73(11): 3497504.
Warscheid T. and Braams J. 2000. Biodeterioration of Stone: A Review. International Biodeterioration &
Biodegradation 46(4): 34368.
Wierzchos J. et al. 2012. Microorganisms in Desert Rocks: The Edge of Life on Earth. International
microbiology 15(4): 17383.
Programa de Desarrollo de las Ciencias Bsicas (PEDECIBA), Agencia Nacional de Investigacin e Innovacin
(ANII), Sociedad Uruguaya de Microbiologa (SUM), Instituto Antrtico Uruguayo (IAU).

137 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

CONDICIONES DE ESTABILIDAD DE LA COLUMNA DE AGUA ASOCIADAS


A ALTA PRODUCCIN PRIMARIA EN BAHA FILDES (6212S, 5857W),
PENNSULA ANTRTICA, VERANO 2017
(High primary production associated to water column stability in Baha Fildes, Antarctic
Peninsula, summer 2017)

Carrera, V.1,4, Hfer, J.1,2, Garcs, J.1,2, Piones, A.1,2,5 & Iriarte, J.L.1,3
1
Centro de Investigacin: Dinmica de Ecosistemas Marinos de Altas Latitudes (IDEAL), Punta Arenas,
Chile. e-mail: vania.mcarrera@gmail.cl. 2Instituto de Ciencias Marinas y Limnolgicas, Universidad Austral
de Chile, Valdivia, Chile. 3Instituto de Acuicultura, Universidad Austral de Chile, Puerto Montt, Chile.
4
Programa Magster en Oceanografa, Universidad de Concepcin, Concepcin, Chile.
5
COPAS Sur Austral, Universidad de Concepcin, Concepcin, Chile.

En el actual escenario de cambio global se hace necesario complementar la limitada


informacin que se posee de los procesos bio-fsicos que ocurren al norte de la Pennsula
Antrtica, debido a que esta regin es la que se ha visto ms influenciada por cambios
ambientales producidos por el calentamiento global (IPCC, 2013). En las zonas costeras de
las Islas Shetland del Sur, las estimaciones de produccin primaria (PP) han sido
contrastantes, fluctuando entre valores <0.5 gC m-2 d-1 y >2 gC m-2 d-1 (Arrigo et al. 1998,
2008; Vernet et al. 2008), y se ha hipotetizado que factores tales como la estabilidad de la
columna de agua, la profundidad de la capa de mezcla, y la penetracin de la luz actan como
principales moduladores de la PP en la regin (Vernet et al. 2008; Egas et al. 2017). Dada la
variabilidad en la magnitud, se obtuvieron estimaciones de la produccin primara en relacin
a las condiciones fsicas de la columna de agua, en Baha Fildes, al norte de la Pennsula
Antrtica en condiciones de verano (Enero 2017).

Mtodos
En el marco de la campaa Antrtica ECA-53, se realizaron tres incubaciones en dos
estaciones oceanogrficas localizadas una al interior de la baha, adyacente al glaciar Collins
(E1), y otra al centro, alejada del glaciar (E2) (Fig. 1). En cada estacin se realiz una
caracterizacin hidrogrfica con un perfilador CTD (SBE 25+) hasta 150 m de profundidad,
y se realizaron incubaciones in situ de Produccin Primaria (PP) (una en E1 y dos en E2) a
cuatro profundidades estndares (0, 5, 10 y 25 m), durante 14 horas de luz, utilizando botellas
de borosilicato (125 mL). La magnitud de PP fue estimada por diferencia de la concentracin
de oxgeno disuelto al inicio y finalizacin de la incubacin en botellas claras y oscuras
(Strickland, 1960). La concentracin de oxgeno fue medida anterior y posteriormente a las
incubaciones usando una sonda ptica Fibox4-a (PreSens), con lecturas obtenidas desde una
membrana incluida internamente a la botella. Los datos fueron expresados en tasas de
carbono incorporado a paritr de los valores de oxgeno liberado. En las mismas 4
profundidades se obtuvieron muestras de agua para estimar la clorofila total. Adicionalmente,
se utilizaron los datos meteorolgicos de la Armada de Chile, de la estacin Base Antrtica
Baha Fildes.

138 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 1. Ubicacin del rea de estudio en Baha Fildes. RJ=Isla Rey Jorge, BE=Base Escudero, BF=Baha
Fildes, GC=Glaciar Collins. Los diamantes amarillos representan la localizacin de las estaciones E1 Y E2.
Figura 1. Location of the study area in Fildes Bay. RJ=Isla Rey Jorge, BE=Base Escudero, BF=Baha Fildes,
GC=Glaciar Collins. Yellow diamonds represent the location of stations E1 and E2.

Resultados
Durante el mes de enero 2017, en Baha Fildes, se registraron vientos predominantes del este,
con valores hasta 65 Km h-1, y usualmente con das de bastante nubosidad (entre 6/8-8/8 de
cielo cubierto) (Fig. 2). Se observaron altos valores de productividad primaria neta integrada
y clorofila-a total en ambas estaciones, asociados a das de menor intensidad de viento, y una
estabilizacin de la columna de agua. Las estimaciones de PP sealaron una baja variabilidad,
siendo el doble en la estacin al centro de la baha (E2: 4.9 gC m-2 d-1), en comparacin al
valor integrado de la estacin adyacente al glaciar (E1: 2.4 gC m-2 d-1). Sin embargo, se
observ una alta variabilidad diaria, registrndose bajos valores integrados de produccin
primaria neta y clorofila-a en la estacin E2, asociada a una columna de agua ms
homognea, producto de los fuertes vientos ocurridos los das previos al muestreo, de hasta
35 nudos (Fig. 2). Esta tendencia se refleja en la estimacin de la profundidad ftica (1% de
penetracin de luz) en los distintos das de muestreos (Tabla 1).

Da Estacin Chl-a total Prof. capa


(mg m2) ftica (m)
13/01/17 E1 285.52 22.5
14/01/17 E2 72.64 69
18/01/17 E2 38.99 55

Tabla 1. Clorofila total integrada hasta 25 m, y profundidad de la capa ftica, en Baha Fildes, durante enero
del 2017. Table 1. Integrated total chlorophyll up to 25 m, and depth of the photic layer, in Fildes Bay, during
January 2017

139 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Discusin
Los resultados preliminares sugieren fuertes diferencias a escala espacial (estaciones cerca y
lejos del glaciar) y temporal (entre das), producto de la dinmica de la baha y las
condiciones climticas observadas durante el verano. Comparativamente, estimaciones
similares en magnitud (1 y 8 gC m-2 d-1) fueron registradas en Baha Sur (Antarctica) durante
similar perodo, sugiriendo dinmicas similares en bahas costeras de las Islas Shetland del
Sur. La variabilidad de corto perodo en productividad primaria puede ser explicada,
parcialmente, por la estratificacin superficial y estabilizacin de la columna de agua, niveles
de radiacin ptimos y no limitacin de nutrientes de acuerdo al modelo de Sverdrup
(Sverdrup, 1953). La informacin obtenida durante 2017, ms el complemento a realizar
durante el verano 2018, generar una base de datos que alimentar un modelo de simulacin
sobre las condiciones bio-fsicas de reas hot spots en la regin costera de la Antrtica, en
el marco del cambio climtico global.

Figura 2. Direccin y velocidad de viento y nubosidad en Baha Fildes durante enero 2017. a) Rosa de
vientos; b) Nubosidad de 1-8; c) Componente U y V del viento. Los das en que se realizaron estaciones
oceanogrficas se indican con tringulos negros. La estacin realizada en el da 18 fue posterior a un evento
de temporal. Figure 2. Direction and speed of wind and cloudiness in Fildes Bay during January 2017. a)
Compass rose; b) Cloudiness from 1-8; c) Component U and V of the wind. The days on which
oceanographic stations were made are indicated by black triangles. The station made on the 18th was after a
temporary event.

Agradecimientos
A la base cientfica Julio Escudero de INACh. Financiado FONDAP 15150003.

140 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Referencias
Arrigo K.R., G.L. van Dijken & S. Bushinsky. 2008. Primary production in the Southern Ocean, 1997-2006.
Journal of Geophysical Research, 113, C08004, doi:10.1029/2007JC004551.
Arrigo, K.R., Worthen, D., Schnell, A. y Lizotte, M.P. 1998. Primary production in Southern Ocean waters.
Journal of Geophysical Research-Oceans, 103: 15587-15600.
Egas C., C. Henrquez-Castillo, N Delherbe, E. Molina, A. Lpez Dos Santos, P. Lavin, R. de la Iglesia, D.
Vaulot & N. Trefault. 2017. Antarctic Science, doi:10.1017/S0954102016000699.
Strinckland J.D. 1960. Measuring the production of marine phytoplankton. Bull. Fisheries Res. Board Can.,
122: 172 p.
Sverdrup H.U. 1953. On conditions for the vernal blooming of phytoplankton. Journal du Conseil International
pour IExploration de la Mer. 18: 287-295.
Vernet M., D Martinson, R Iannuzzi, S. Stammerjohn, W. Kozlowski, K. Sines, R Smith & I Garibotti. 2008.
Primary production within the sea-ice zone west of the Antarctic Peninsula. I Sea ice, summer mixed layer, and
irradiance. Deep-Sea Research II 55:2068-2085.

141 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

COMUNIDADES FNGICAS ASOCIADAS CON DOS ESPECIES DE MUSGOS


BIPOLARES EN LA ANTRTIDA
(Fungal communities associated with two species of bipolar mosses in Antarctica)

Carvalho, C.R.1, Ferreira, M.C.1, Avritzer, S.C.1, Gonalves, V.N.1, Carvalho-Silva, M.2,3,
Cmara, P.E.A.S.3, Rosa, L.H.1
1
Laboratory of Polar Microbiology and Tropical Connections, Department of Microbiology, Federal
University of Minas Gerais, MG, Brazil. E-mail: lhrosa@icb.ufmg.br. 2Institute of Agriculture Science,
Federal University of Vales of the Jequitinhonha and Mucuri, MG, Brazil. 3Department of Botany, University
of Braslia, Braslia, Brazil

Mosses are a major component of the vegetation in ice-free regions of Antarctica. They play
an important role in the colonization of ice-free land, accumulation of organic matter, release
of organic exudates, and provide a food and habitat resource for invertebrates (OCHYRA et
al., 2008). Polytrichastrum alpinum (Hedw.) G.L.Sm. was the first moss species reported
from the Antarctic (EIGHTS 1833) and it is one of the commonest and most widely
distributed species throughout the maritime Antarctic (OCHYRA et al., 2008). Additionally,
Polytrichastrum juniperinum Hedw. is the least common of all species of the genus in
Antarctic but it is a pioneer species growing on gravelly soil and humus, glacial debris,
volcanic ash and cinders in dry or moist and generally open habitats, sometimes at margins
of melt water rills and in seepage areas (OCHYRA et al., 2008). The aim of the present study
was to examine the diversity of epiphytic, endophytic, and rhizosphic fungi associated with
bipolar P. alpinum and P. juniperinum collected in Antarctica.

Methods
Five gametophytes of P. alpinum and P. juniperinum were collected in seven and two points
respectively at King George Island (Antarctic Peninsula). Fragments of healthy
gametophytes were subjected to surface sterilization and inoculated onto Sabouraud agar
containing 100 g mL1 chloramphenicol (Sigma) for isolation of endophytic fungi. The
epiphytic fungi were isolated using the same gametophytes, which were submitted to
sonication (5 min) in 0.85% NaCl followed at serial dilution. Then, 100 L of a 103 dilution
was inoculated onto Sabouraud agar containing 100 g mL1 chloramphenicol (Sigma). For
isolation of rhizosphere fungi 1 g of each sample was added to 9 mL of 0.85% NaCl and 100
L of a 103 dilution was inoculated onto Sabouraud agar containing 100 g mL1
chloramphenicol (Sigma). All the plates were incubated at 15 C for 60 days. Mycelial DNA
the fungi were extracted and Internal Transcribed regions (ITS) were sequenced and the
compared to another sequences in GenBank through Basic Local Alignment Search Tool
(BLAST) (ROSA et al. 2009). The mosses were identified according its macro- and
micromorphological characteristics and deposited in the University of Brasilia Herbarium.

Results And Discussion


From the both mosses samples 217 fungi isolates (129 of filamentous fungi and 88 of yeasts)
were recovered. From P. alpinum were obtained 172 isolates and from P. juniperinum 45.
Nineteen filamentous fungal taxa were identified by molecular biology methods. Thelebolus
sp., Pseudogymnoascus sp., and Tumularia sp. were the most abundant taxa recovered.

142 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

However, the most part of the fungal communities included singles taxa (minor components).
Taxa of Exophiala, Fusicladium, Hymenoscyphus, Leptosphaeria, Tumularia, and
Leohumicola genus displayed low sequences similarities when compared with sequences of
type species deposited in the GenBank database and may represent new Antarctic fungal
species. Thelebolus sp. and Glarea sp. were isolated as epiphytes, endophytes, and as
rhizospheric fungi. In contrast, six taxa occur only as endophytes, and one as rhizospheric.
Additionally, some taxa represent unusual fungi from Antarctica, like Pochonia sp.,
Oleoguttula sp., Tumularia sp., Leohumicola sp., and deserve further taxonomic and
ecological role studies. Pseudogymnoascus sp., Glarea sp., Chalara pseudoaffinis,
Gyoerffyella entomobryoides, Helotiales sp., Leotiomycetidae sp., Microdochium
phragmitis, Phaeosphaeria sp., and Pochonia sp. were isolated only by P. alpinum. In
contrast, Cladosporium sp., Exophiala sp., Fusicladium sp., Leptosphaeria sp., and
Oleoguttula sp. were isolated only by P. juniperinum.

Conclusion
Our results suggest that bipolar antarctic mosses shelter rich and diverse fungal communities,
including taxa phylogenetically near to symbionts, decomposer, and pathogenic (plants and
animals) fungi. In addition, some fungi recovered may represent new endemic antarctic
species. Further studies will be conduced to determinate if the fungal communities from these
two antarctic mosses are similar or not from those living in Arctic.

Acknowledgments
We acknowledge the financial and strategic support from CNPq, FAPEMIG, CAPES,
PROANTAR, INCT Criosfera and Brazilian Navy.

References
Eighls, J. Description of a new crustaceous animal found on the shores of the South Shetland Islands,
with remarks on their natural history. Transactions of the Albany Institute, v.2, 53-69, 1833.
Ochyra, R.; Smith, R. I. L.; Bednarek-Ochyra, H. The illustrated moss flora of Antarctica. Cambridge
University Press, 2008
Rosa, L. H.; Vaz, A. B. M.; Caligiorne, R. B.; Campolina, S.; Rosa, C. A. 2009. Endophytic Fungi
Associated With The Antarctic Grass Deschampsia antarctica Desv. (Poaceae). Polar Biology, 32:
161-167.

143 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Table 1. Molecular identification of fungal communities associated with two species of bipolar mosses using BLASTn searches of the ITS1-5.8S-ITS2 region.
Tabla 1. Identificacin molecular de las comunidades de hongos asociados con dos especies de musgos bipolares utilizando BLASTn bsquedas en la regin ITS1-
5.8S-ITS2.
Moss UFMGCBb Substratec N of Top BLAST search results (GenBank Query Identity No. of bp Proposed species or
speciesa isolates accession number)d coverage (%) (%) sequenced taxonomic group
and analysed (GenBank accession n)
PA, PJ 12652 EP, EN, R 27 Thelebolus globosus (DQ028268) 96 96 438 Thelebolus sp.
PA 12644 EP, EN 12 Geomyces destructans (EU884921) 100 99 456 Pseudogymnoascus sp.
PA, PJ 12686 EN 10 Tumularia aquatica (AY265337) 99 96 429 Tumularia sp.
PA, PJ 12723 EN, R 5 Mortierella sclerotiella (HQ630310) 98 98 520 Mortierella sp.
PA, PJ 12728 R 4 Mortierella elongatula (NR111582) 98 96 514 Mortierella sp.
PA 12619 EP, EN, R 4 Glarea lozoyensis (NR137138) 96 92 435 Glarea sp.
PA, PJ 12707 EP, R 3 Leohumicola minima (NR121307) 97 92 441 Leohumicola sp.
PA, PJ 12693 EN, R 4 Monographella lycopodina (JF440979) 100 99 495 M. lycopodina
PA 12612 EP, R 2 Chalara pseudoaffinis (FR667224) 100 98 423 C. pseudoaffinis
PA 12689 EN 2 Gyoerffyella entomobryoides (KC834056) 100 98 428 G. entomobryoides
PA 12709 R 2 Mortierella amoeboidea (NR111579) 98 99 545 Mortierella sp.
PA 12637 EN, R 2 Mortierella parvispora (JX976076) 97 98 535 Mortierella sp.
PA 12603 EP 2 Pseudogymnoascus verrucosus 100 99 409 Pseudogymnoascus sp.
(KJ755525)
PA 12731 R 1 Helotiales sp. (JX001628) 100 98 437 Helotiales sp.
PJ 12681 EN 1 Cladosporium austroafricanum 100 100 429 Cladosporium sp.
(KT600381)
PJ 12625 EP 1 Exophiala cancerae (NR137766) 100 95 504 Exophiala sp.
PJ 12626 EP 1 Fusicladium catenosporum (EU035427) 100 95 441 Fusicladium sp.
PA 12636 EP 1 Hymenoscyphus haasticus (KC164648) 96 91 430 Leotiomycetidae sp.
PJ 12684 EN 1 Leptosphaeria ebuli (KP744446) 100 93 463 Leptosphaeria sp.
PA 12674 EN 1 Microdochium phragmitis (NR132916) 100 99 419 M. phragmitis
PA 12702 EN 1 Mortierella gamsii (HQ630340) 98 99 523 Mortierella sp.
PA 12706 R 1 Mortierella turficola (NR111583) 97 99 521 Mortierella sp.
PJ 12624 EP 1 Oleoguttula mirabilis (KF310031) 89 99 421 Oleoguttula sp.
PA 12687 EN 1 Phaeosphaeria alpina (KF251181) 100 97 437 Phaeosphaeria sp.
PA 12635 EP 1 Pochonia sp. (KU686687) 97 100 459 Pochonia sp.
Identification were performed using BLASTn searches of the ITS-5.8S rRNA gene region of filamentous fungi, and the percentage of identity with the best
BLASTn match is shown. aMoss species of isolation: PA= Polytrichastrum alpinum, PJ= Polytrichastrum juniperinum .bUFMGCB = Culture Collection of
Microorganisms and Cells of the Federal University of Minas Gerais; cSubstrate of isolation: EN=Endophyte, EP=Epiphytic, R=Rhizosphere; dITS sequences.

144 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

MOSS BIPOLARITY REVISITED


(Bipolaridad de musgo revisitada)

Carvalho-Silva, M.1,2 & Cmara, P.E.A.S.1


1
Programa de Ps Graduao em Botnica, Universidade de Braslia, UnB, Campus Darcy Ribeiro, Asa
Norte, 70910-900, Braslia, DF, Brazil. E-mail: silvamicheline@gmail.com; paducamara@gmail.com.
2
Universidade Federal dos Vales do Jequitinhonha e Mucuri, UFVJM, Instituto de Cincias Agrrias, Campus
Una, 38610-000, Una, MG, Brazil.

With only two native flowering plants, Antarctic vegetation is dominated by mosses. There
are about 110 moss species (Ochyra et al. 2008) below the parallel 60oS, 11 of them endemic.
About 45% of these species are bipolar, including the most common ones, with occurrences
in both Antarctic and Artic regions, with or without intermediates. The occurrence in
intermediate region are usually on high elevations like the Andes. There is currently no
definitive explanation for this phenomenon. Phylogenetic studies are crucial in helping
understanding the factor behind the bipolar distribution, like continental drift or long distance
dispersal events but mainly the monophyletism of such species that may or may not exist. It
was a first hypothesis that at least some of the bipolar species in Antarctica would come out
as being not monophyletic meaning that they are probably different species that share
homoplasious morphological features that have mislead taxonomists in the past.

Material And Methods


In order to test that hypothesis, we have selected nine bipolar species (Hypnum revolutum
(Mitt.) Lindb., Bartramia patens Brid., Polytrichum piliferum Hedw, P. strictum, P.
juniperinum, Polytrichastrum alpinum (Hedw.) G.L. Sm., Pohlia cruda (Hedw.) Lindb., P.
nutans (Hedw.) Lindb. and Bryum pseudotriquetrum (Hedw.) G. Gaertn., B. Mey. & Scherb.,
and have extracted its DNA to perform molecular phylogenetic analysis according to the
protocol of Cmara (2010). Selected markers were chosen for PCR amplification including
least markers from at least two genomes (different DNA markers were selected for each
species). Sequencing reactions were done in Korea by Macrogen Inc. Phylogenetic analyses
were done under Parsimony, Likelihood and Bayesian using the software PAUP, RAXML
and Mr. Bayes respectively, according to the protocols used by Cmara & Shaw (2013).
Northern hemisphere samples were obtained from herbaria collections on loan or donated
from AAS, BM, CAS, H, L, MO, NY, RB, S, SP, TUR and UB. The material from Antarctica
or south hemisphere was obtained during field surveys in Antarctica between November
2014 and 2017, under the all species of the Antarctic Programs.

Results And Discussion


Results have show that all nine species investigated are indeed bipolar and for monophyletic
units with its congeners from the Arctic regions, however we also found many taxonomic
problems that will affect the diversity assessment of Antarctic mosses. We are moving now
towards the phylogeography study and understanding its effects on conservation.
Hypnum revolutum was considered a bipolar strict and our data has shown that this species
is in fact bipolar, but it does not belong into the genus Hypnum or the family Hypnaceae,
being a representative of Pylasiaceae (the only one in Antarctica). We are describing it as a
new genus.

145 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Bartramia patens initially not considered as bipolar, but included in this study due to its close
similarity and taxonomic history with the north hemisphere species Bartramia ithyphylla
Brid. So far, B. patens is considered an endemic from Southern South America, including
Antarctica, Tierra del Fuego, Patagonia, Falklands, Prince Edward, Kerguelen and South
Georgia islands, however our data suggests B. patens from Antarctica is a different species
from those in South America and both are different from the close related B. ithyphylla from
the northern hemisphere. The South America samples may constitute a new species as well.
Pohlia nutans and P. cruda both tells us the same history as they both form monophyletic
units with its northern hemisphere pairs, being therefore both bipolar species, despite its
variable morphology that has somehow shaded it taxonomic status.
Bryum pseudotriquetrum is a bipolar with intermediates that is one of the most ubiquitous
(Ochyra et al. 2008) and widespread species of moss in Antarctica. It also exhibits high
morphological plasticity. Our data suggest that this species does not happen to occur in
Antarctica being restricted to the Northern hemisphere. In Antarctica and southern
hemisphere, it is actually another species of Bryum, however this species is bipolar too.
Polytricum piliferum, P. strictum and P. juniperiunm all belong to the same taxonomic
Polytrichum section Juniperifolia, the last two are particularly difficult to separate from each
other as their morphology overlaps. The most of the Polytrichum from Antarctic is smaller
than the same species from North hemisphere, however, our data suggest these three species
are bipolar.
Polytrichastrum alpinum is a bipolar species, also one of the most common and widespread
species in maritime Antarctica (Ochyra et al. 2008), our data has shown that it does form a
monophyletic clade with its northern hemisphere pairs, our data has shown only one variety
of P. alpinum in Antarctica with the similar morphology and genetic with P. alpinum var.
alpinum from Arctic region.
After having collected and observed specimens both in the field and in herbaria, but also
having had the chance to investigate its DNA under a phylogenetic perspective, we have
found that all nine investigated species are in fact bipolar corroborating previous literature
(Ochyra et al. 2008), species do show some morphological variations among its northern
hemisphere pairs, but this could probably be assigned as ecological variations due to the
particular conditions found in Antarctica. However, we have found one third of our species
(3 out of 9) needed extensive taxonomic study and are one new genus, one new species and
one is a different species. It raises a concern that little is know on the taxonomy of Antarctic
species as this is the first effort to phylogenetically investigate them. This has strong
consequences for conservation.
For an explanation on how mosses do move from polar regions and which direction, little
has been shown. Lewis et al. (2011) has demonstrated that north hemisphere migrating birds
have the potential to carry, within its feathers, bryophyte propagule and this could pose a
possible explanation, however it has not been demonstrated if propagule remains viable when
birds reach the South Hemisphere and if they do carry specific bipolar species. It is known
that in the early reports of antarctic vegetation contains some bipolar species such as
Polytrichastrum alpinum, consequently at least this species was already there when man
arrived and have not been human introduced, but this is not true for some other species. We
thing that case, birds, human introduction, but also Long Distance Dispersal are still
possibilities that should not be discarded.

Acknowledgments

146 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

PROANTAR, MCTI, CNPq, Brazilian Navy.

References
Cmara, P.E.A.S. 2010. Mtodos de extrao de DNA de Brifitas para estudos filogenticos. Heringeriana
3:11-17.

Cmara, P.E.A.S. & Shaw, A.J. 2013. A Molecular Phylogeny of the Moss Genus Taxithelium
(Pylaisiadelphaceae) Based on Plastid, Mitochondrial and Nuclear Markers. Systematic Botany. 38(4): 861
868.
Lewis, L.R., Behling, E., Gousse, H., Qian, E., Elphick, J-F.L., Bty, J., Liebezeit, J., Rozzi, R., Goffinet, B.
2014. First evidence of bryophyte diaspores in the plumage of transequatorial migrant birds. PeerJ 2: 31-43.
Ochyra, R., Lewis Smith, R.I., Bednarek-Ochyra H. 2008. The illustrated moss flora of Antarctica. Cambridge:
Cambridge University Press.

147 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

HEAT SHOCK RESPONSES OF THE MOSS Sanionia uncinata UNDER


EXPERIMENTAL WARMING
(Tolerancia al shock trmico en el musgo Sanionia uncinata expuesto a calentamiento
experimental)

Casanova-Katny A.1, Ziga-Gonzlez P.2, Encina F.1, Robinson S.3, Rosenstiel T.4,
Eppley S.5
1
Ncleo de Estudios Ambientales, Universidad Catlica de Temuco, Rudecindo Ortega 02950, Temuco,
Chile. 2 Instituto de Ciencias Biolgicas, Universidad de Talca, 1 Poniente 1141 Talca, Chile. 3 Centre for
Sustainable Ecosystem Solutions, University of Wollongong, Wollongong, NSW, Australia. 4 Center for Life
in Extreme Environments, Department of Biology, Portland State University, Portland, Oregon, 97207, USA.
5
Department of Biology, Portland State University, PO Box 751, Portland, Oregon, USA

Bryophytes are major components of green landscapes of Antarcticas small ice-free areas.
Antarctic mosses, extend from maritime Antarctica well into the continent. Sanionia uncinata
is one of the dominant species. Our study focused on heat resistance of this bipolar moss to
understand its growth pattern and responses to global climate change, which is affecting
Antarctica. We installed open top chambers (OTC) during seven years on Fildes Peninsula
in order to compare heat shock responses of bryophytes growing inside the OTC and in
control plots. We observed no change in photochemical efficiency (Fv/Fm) one hour after
heat shock (from 15-40C), with values above 0.7. Interestingly, one hour later, Fv/Fm values
were decreasing, with the lowest values (< 0.6) at 36-40C. That is, the photochemical
apparatus in Sanionia uncinata is able to tolerate thermal shock, indicating that this moss
could survive high temperatures in the future warming scenario.

Introduction
Antarctica is the only continent where cryptogams (lichen and mosses) are dominating the
terrestrial ecosystem. Bryophytes are major components of green landscapes in Antarctic ice-
free areas. Mosses, with more 120 species, extend from maritime Antarctica well into the
continent. The bipolar Sanionia uncinata is one of the dominant species (Ochyra et al. 2008);
its cover is most extensive on the Shetland Is. Archipelago, reaching the southern part of the
west Antarctic Peninsula. Sanionia uncinata is a monoecius species which does not form
sporophytes in Antarctica, but reproduces asexually. Considering that the Antarctic peninsula
is experimenting the most intense warming observed on the planet during the last decades,
reaching 3C in the last 50 years, and that it has been shown that the two Antarctic vascular
plants increased plant population (Torres-Mellado et al. 2011), and that we shown that
Polytrichastrum alpinum increase the production of sporophytes after long term warming
(Casanova-Katny et al. 2016). We could shown that warmed mosses reduced investment in
cellular stress defences, but invested more towards primary productivity and gametangia
development (Shortlidge et al. 2017). Our principal question was how the new climate
scenario will influence development and growth of this Antarctic moss. We hypothesized
that S. uncinata will increase heat resistance, as a consequence of long term exposure to long-
term passive warming.

148 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Material and Methods


We installed open top chambers (OTCs) for seven years on Fildes Peninsula, King George
Island (figure 1). We began with the experimental warming during the summer 2008. The
experiments were carried out at two sites, Juan Carlos Point (6212 S 5859W, 37 m a. s.
l.) and La Cruz Plateau (6212S, 5857 W, 41 m a. s. l.). Juan Carlos Point, which is
characterized by northern exposure towards Drake Passage, has a predominance moss-herb
community, dominated by the moss Sanionia uncinata and Polytrichastrum alpinum. La
Cruz Plateau is located in the interior of Fildes Bay, which is oriented towards Bransfield
Strait, with a moss-lichen community dominated by Sanionia uncinata and the the lichens
Usnea aurantiacoatra (Jacq.) Bory and Himantormia lugubris (Hue) I.M. Lamb. Air
temperature inside the OTC were significantly higher, with increasing of 1.0-1.5 C along
the vertical canopy gradients.

Figura 1: maps of South Shetland Archipelago and King George Islands. Fildes Peninsula (insert) shows both
study sites (PJC= Punta Juan Carlos and CMA: Meseta La Cruz), where the OTC were installed. Figura 1:
mapas del archipilago de las Shetland del Sur y de las Islas del Rey Jorge. La pennsula de Fildes (inserto)
muestra ambos sitios de estudio (PJC = Punta Juan Carlos y CMA: Meseta La Cruz), donde se instalaron los
OTC.

Figure 2: Open top chambers an


in situ warming experiments
installed during summer of 2008
on Fildes Peninsula. 9 OTCs were
installed on Punta Juan Carlos
and 10 on Meseta La Cruz.
Figura 2: Cmaras abiertas, un
experimento de calentamiento in
situ instalado durante el verano de
2008 en la pennsula de Fildes. Se
instalaron 9 OTC en Punta Juan
Carlos y 10 en Meseta La Cruz.

149 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Results and Discusion


We compared heat shock responses of bryophytes growing inside the OTCs and in control
plots (figure 2), using chlorophyll fluorescence measurements (Casanova-Katny et al. 2010)
of mosses exposed during one hour to heat under laboratory conditions.
We observed no change in photochemical efficiency (Fv/Fm) one hour after heat shock (15-
40C), with Fv/Fm values above 0.7. Interestingly, in the same samples one hour later, we
observed, Fv/Fm values were decreasing for plants that experienced heat shock in the range
of 20-30C, with the lowest Fv/Fm values (< 0.6) for plants that experienced higher levels of
heat shock (36-40C). However, 24 h later, only gametophytes that had experienced the
highest level of heat shock (40C) did not recover photochemical efficiency. Surprisingly,
values of Fv/Fm did not differ between OTC and controls, although during the experiment
lipid peroxidation was higher in mosses inside the OTCs compared to mosses in control plots.
No marked changes were observed in carbohydrate and chlorophyll content under OTC and
control conditions.

Conclusion
Our results suggest that the photochemical apparatus of Sanionia uncinata is able to tolerate
thermal shock, indicating that this moss could survive high temperatures in a future warming
scenario.

Acknowledgments
INACH 0307, FONDECYT 1120895.

References
Casanova-Katny A, Ziga G, Corcuera L, Bravo L & Alberdi M. 2010. Deschampsia antarctica Desv. primary
photochemistry performs differently in plants grown in the field and laboratory. Polar Biology 33(4): 477-483.
Casanova-Katny A. Torres-Mellado G & Eppley S. 2016 Reproductive output of mosses under experimental
warming on Fildes Peninsula, King George Island, maritime Antarctica. Rev. Chilena de Hist. Natural.
DOI: 10.1186/s40693-016-0061-y
Ochyra R, Smith RIL & Bednarek-Ochyra H. 2008. The illustrated moss flora of Antarctica. Cambridge
University Press. Cambridge 560 pp.
Shortlidge, Erin; Eppley, Sarah; Kohler, Hans; Rosenstiel, Todd; Zuiga, Gustavo; Casanova-Katny, Anglica
2017 "Warming reduces the physiological barrier to reproductive success in an Antarctic moss". Annals of
Botany, 119: 27-38.
Torres-Mellado GA, Jaa R, Casanova-Katny MA 2011 Antarctic hairgrass expansion in the South Shetland
archipelago and Antarctic Peninsula revisited. Polar Biology 34: 1671-1688.

150 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

EFECTO DE LA RUPTURA DEL TMPANO A-68 DESPRENDIDO DE LARSEN


C EN JULIO 2017 EN LA ESTABILIDAD DE LA PLATAFORMA
(Effect of the breakup of iceberg A-68 calved off Larsen C in July 2017 on the stability of
the ice shelf)

Casassa, G.1,2, McGrath, D.3, Steffen, K.4


1
Geoestudios, Los Aromos 3371, San Jos de Maipo, Regin Metropolitana, Chile. E-mail
gino.casassa@gmail.com. 2Universidad de Magallanes, Punta Arenas, Chile. 3Colorado State University, Fort
Collins, USA. 4Swiss Federal Research Institute WSL, Birmensdorf, Switzerland.

John Mercer predijo en 1978 (Mercer, 1978) que un signo que ha comenzado un
calentamiento peligroso en la Antrtica es el colapso de las plataformas de hielo de la
Pennsula Antrtica. La notable profeca de Mercer se transform en realidad a los pocos
aos (principios de 1980s) con el colapso de la plataforma de Wordie en el sector occidental
de la Pennsula. El posterior colapso de diversas plataformas en la Pennsula, incluyendo el
Larsen Inlet en 1989, Prince Gustav y Larsen A en 1995, Larsen B en 2002 y Jones en 2003,
junto con el acelerado calentamiento observado en la Pennsula en las ltimas dcadas del
siglo XX han confirmado la profeca de Mercer (Tabla 1). El reciente desprendimiento de
julio de 2017 del gigantesco tmpano A-68, de 193 km de largo, un rea de 5.800 km2 (Tabla
2) y una masa del orden de 1 trilln (1018) de toneladas de hielo, plantea la gran interrogante
si es que con este evento ha comenzado el inexorable colapso del Larsen C, la mayor
plataforma de la Pennsula. Una buena parte de la comunidad glaciolgica es de la opinin
que este tipo de desprendimientos constituye un fenmeno natural y episdico, que ocurren
con una recurrencia de varias dcadas e incluso cada siglo, y que en los prximos aos y
dcadas el frente del Larsen debiera avanzar para volver a una posicin similar al periodo
anterior al desprendimiento. En este trabajo se analiza la evidencia cientfica acerca del
estado de la plataforma Larsen C antes del desprendimiento, particularmente la prdida
reciente de masa por adelgazamiento. Se describe tambin un registro de datos de radar
terrestre obtenidos hace 5 aos durante una campaa conjunta realizada con la NSF-EE.UU.,
que indican el relevante rol de las fracturas basales (rifts), los ice rises y las zonas de
sutura en la estabilidad de las plataformas. Se realiza un anlisis crtico de la evidencia,
incluyendo el hiato en el calentamiento observado en la Pennsula desde principios de este
siglo, concluyendo acerca de las probabilidades futuras de colapso del Larsen C y su efecto
en los hielos interiores.

Mtodo
Durante las temporadas de verano de 2010/2011 y 2011/2012 se realizaron perfiles con radar
terrestre a lo largo de 31 km de transectas en el sector norte de la plataforma de Larsen C. Se
utiliz un sistema de radar pulsado Mal Geoscience a una frecuencia de 25 MHz (6.8 m de
longitud de onda en hielo) impulsado por una moto de nieve con una velocidad promedio de
4.5 m/s. Las trazas de radar tienen una resolucin de 16-bits y un tiempo de 4000 ns,
promediando en terreno 16 trazas. Se utiliz una velocidad de onda de radar de 0.173 m/ns,
calculada asumiendo una disminucin lineal desde 0.190 m/ns en la neviza superficial hasta
0.168 m/ns en profundidad en la transicin neviza/hielo. Datos GPS de doble frecuencia con
un receptor Trimble GeoXT y correcciones por marea en la plataforma permitieron obtener
coordenadas superficiales con una precisin horizontal y vertical de 1 y 2 m respectivamente.

151 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Se obtuvieron profundidades de hielo a partir de reflejos de la interfaz de la base de la


plataforma con el ocano. Basado en de hiprbolas de difraccin se detectan grietas basales
en la plataforma, midiendo cmo evolucionan a medida que son advectadas hacia el frente
de la plataforma. Se analizan tambin imgenes satelitales GeoEye de 1,65 m de resolucin
que muestran en detalle la distribucin de grietas superficiales. Se utiliza el modelo elstico
lineal de mecnica de fractura (LEFM) de Van der Veen (1998) para investigar la sensibilidad
de la profundidad de penetracin de las grietas en base a los cambios observados en las grietas
en los registros de radar.

N NOMBRE E/W Lat. REA REA C %


INICIAL/AO FINAL/AO
1 Prince Gustav E 64,3S 1632 km2/1950s 100 km2/1995 S 6%
2 Larsen Inlet E 64,4S 407 km2/1986 0 km2/1989 S 0%
3 Larsen A E 64,6S 4021 km2/1950s 320 km2/1995 S 8%
4 Larsen B E 65,5S 11573 km2/1960s 6831 km2/2000 S 17%
5 Mller W 67,3S 78 km2/1950s 40 km2/2009 N 51%
6 Larsen C E 67,5S 56131 km2/1960s 50837 km2/1986 N 91%
7 Jones W 67,5S 29 km2/1950s 0 km2/2003 S 0%
8 Wordie W 69,3S 1420 km2/1950s 139 km2/2009 S 10%
9 Wilkins W 70,5S 16577 km2/1950s 11144 km2/2009 P 67%
10 Larsen D E 71,7S 21716 km2/1960s 22602 km2/2009 N 104%
2 2
11 George VI W 72.2S 25984 km /1950s 24045 km /2009 N 93%
12 Bach W 72,4S 4798 km2/1950s 4487 km2/2009 N 94%
13 Stange W 73,5S 8286 km2/1970s 8022 km2/2009 N 97%

Tabla 1. Principales plataformas flotantes de la Pennsula Antrtica, ordenadas de norte a sur, indicando
cambios de rea, rea remanente (%) y aquellas que han colapsado (C: S=S; N=No) en aos recientes. E/W
indica si estn al oeste de la Pennsula (W) o bien al este (E). Fuente: Cook y Vaughan, 2010.

Figura 1. Izquierda: imagen satelital Moderate Resolution Imaging Spectroradiometer (MODIS) Mosaic of
Antarctica (MOA) de la plataforma Larsen C. La transecta de radar se indica mediante la lnea en que los

152 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

colores corresponden a las elevaciones superficiales a partir de los datos GPS. El recuadro negro indica la
ubicacin de la figura de la derecha. Coordenadas polar estereogrfica (plano secante 71S, meridiano 0,
elipsoide World Geodetic System 1984 - WGS84), donde el eje horizontal y vertical corresponden a la
coordenada este y norte, respectivamente, en m. Derecha: imagen Landsat Image Mosaic of Antarctica
(LIMA) del borde de la Pennsula Churchill mostrando ondulaciones superficiales. Los recuadros negros
indican la ubicacin de los perfiles de radar (R) y las imgenes Geoeye de alta resolucin (G). Imgenes
adaptadas de McGrath et al. (2012).

N TMPANO LARGOxANCHO REA FECHA PLATAFORMA


1 B-15 295x37 km 11.000 km2 Marzo 2000 Ross
2 A-38 144x48 km 6.900 km2 Octubre 1998 Ronne
3 A-68 193x30 km 5.800 km2 Julio 2017 Larsen C
4 C-19 200x31 km 5.500 km2 Mayo 2002 Ross
5 B-9 154x35 km 5.390 km2 Octubre 1987 Ross

Tabla 2. Los 5 tmpanos ms grandes desprendidos de Antrtica desde el inicio de la era satelital. Fuente:
U.S. National Ice Center, NOAA Satellite Operations Facility; earthobservatory.nasa.gov; Wikipedia.

Resultados
A partir de los registros de radar obtenidos se observan 27 grietas basales a lo largo de una
transecta de 31 km, perpendiculares al flujo, en el sector norte de la plataforma Larsen C,
asociadas a una serie de ondulaciones superficiales visibles hasta el frente mismo (Fig. 1).
Los registros de radar de la zona ms cercana a la Pennsula Churchill muestra numerosas
hiprbolas de difraccin superpuestas, indicativas de un gran nmero de pequeas fracturas
basales, donde aparecen las grandes grietas basales con una separacin mayor, que
inicialmente penetran hasta una altura de unos 130 m en el interior del hielo, equivalente al
40% del espesor del hielo. El modelo LEFM predice de manera adecuada la altura de
penetracin de las grietas, indicando que las altas tensiones en esta regin producen la
formacin y propagacin de grietas basales, que son luego advectadas hacia el frente
desprendente de la plataforma. Asumiendo que esta es en efecto la ubicacin y el mecanismo
mediante el cual se forman las grietas basales, este proceso entonces ha ocurrido por un
mnimo de 400 aos, basado en la distancia de 155 km de las ondulaciones superficiales y
las actuales velocidades del hielo.

Discusin y Conclusiones
Postulamos que las grietas basales se forman a medida que el flujo de hielo de Cabinet Inlet
rodea el Cabo Alexander en la Pennsula Churchill, flujo que posteriormente se acelera,
produciendo un adelgazamiento del hielo al unirse con el cuerpo principal de la plataforma.
Cuando el hielo se adelgaza suficientemente, las grietas basales pueden penetrar hasta la
superficie, produciendo fracturas que alcanzan todo el espesor del hielo, conocidas como
rifts, que pueden provocar el fracturamiento de la plataforma. Este mecanismo genera el
desprendimiento de los grandes tmpanos como el A-68 ocurrido en julio de 2017. La
plataforma Larsen C est disminuyendo de cota 7 2 cm/ao, provocado por prdida de hielo
(28 18 cm/ao) y prdida de aire de la neviza (4 3 cm/ao) (Holland et al., 2015), que
puede ser explicado por un aumento del derretimiento basal y/o divergencia de hielo, y la
prdida de aire por menores tasas de acumulacin o bien mayor derretimiento superficial y/o
compactacin. A medida que se adelgaza y se fractura el hielo y retrocede el frente
desprendente, la plataforma se puede despegar de los ice rises que actan como puntos de
anclaje, y la plataforma puede desestabilizarse y comenzar a retroceder en forma acelerada.

153 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

El fracturamiento por grietas basales se puede intensificar asimismo si existe derretimiento


en superficie, con acumulacin de agua en los sectores bajos de las ondulaciones superficiales
asociadas a las grietas basales, en un proceso conocido como hidrofracturas, mecanismo que
ayud a provocar el colapso de la plataforma Larsen B. En el caso de Larsen C, en la
actualidad el derretimiento superficial no es sustancial, y no existe peligro por
hidrofracturamiento en el corto plazo. Sin embargo, el adelgazamiento actual es al menos en
parte una respuesta al calentamiento ocenico y/o atmosfrico, que puede aumentar en el
futuro, y un evento natural y episdico como el desprendimiento del tmpano A-68 podra
gatillar el colapso de la plataforma en el futuro. Lo cual no elimina la posibilidad que el
desprendimiento de este tmpano pueda generar un retroceso del frente de la plataforma
Larsen C de unos 40 km, hasta alcanzar el arco compresivo donde existen esfuerzos
tensionales al interior de Larsen C que podran hacer colapsar la mayor parte de la plataforma
(Kulessa et al., 2014).

Figura 2. Imagen infrarroja VIIRS (Visible


Infrared Imaging Radiometer Suite) a bordo
del satlite NOAA/NASA NPP (Suomi
National Polar-orbiting Partnership) del 17 de
julio de 2017 que muestra el tmpano A-68,
que se ha fragmentado en los tmpanos A-
68A (152 x 46 km) y A-68B (12 x 6 km).

Fuente: http://www.natice.noaa.gov/doc/USNIC_IcebergA68A-A68B_press_release_17Jul_final.pdf.

Agradecimientos
US NSF OPP research grant 0732946, BAS, INACH.

Referencias
Cook, A.J. and Vaughan, D.G. 2010. Overview of areal changes of the ice shelves on the Antarctic Peninsula
over the past 50 years. Cryosphere, 4(1): 7798.
Holland, P.R., Brisbourne, A., Corr, H.F.J., McGrath, D., Purdon, K., Paden, J., Fricker, H.A., Paolo, F.S. and
Fleming, A.H. 2015. Oceanic and atmospheric forcing of Larsen C Ice-Shelf thinning, Cryosphere, 9(3): 1005-
1024, doi:10.5194/tc-9-1005-2015.
Kulessa, B., Jansen, D., Luckman, A.J., King, E.C. and Sammonds, P.R. 2014. Marine ice regulates the future
stability of a large Antarctic ice shelf. Nature Communications, 5(3707): doi:10.1038/ncomms4707.
McGrath, D., Steffen, K., Scambos, T., Rajaram, H., Casassa, G., Rodrguez. J.L. 2012. Basal crevasses and
associated surface crevassing on the Larsen C Ice Shelf, Antarctica and their role in ice shelf instability. Annals
of Glaciology, 58-60: 10-18.
Mercer, J. H. 1978. West Antarctic ice sheet and CO2 greenhouse effect: a threat of disaster. Nature, 271; 321
325.
Van der Veen, C.J. 1998. Fracture mechanics approach to penetration of bottom crevasses on glaciers. Cold
Regions Science and Technology, 27(3): 213223.

154 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

THE BIOSTRATIGRAPHY OF THE LATEST CRETACEOUS DINOSAUR


FAUNA OF ANTARCTICA
(Biostratigrafa de la ltima fauna de dinosaurios del Cretcico en Antrtica)

Case, J1, Ely, R2


1
Department of Biology, Eastern Washington University, Cheney, WA. USA 99004.
2
Department of Geology, Eastern Washington University, Cheney, WA. USA 99004.

A biostratigraphic analysis of all Late Cretaceous, non-avian Antarctic dinosaurs indicated


with confidence, the near contemporaneous occurrence of most of the dinosaur species from
the James Ross Basin. Three dinosaur taxa from the Cape Lamb Member of the Snow Hill
Island Formation, the elasmarian ornithopod, Morrosaurus antarcticus, the Naze
deinonychosaur and the Cape Lamb hypsilophodont, are all associated with the invertebrate
fauna of the Gunnarites antarcticus faunal assemblage and more specifically are within the
more restrictive 50 meter stratigraphic range of the ammonite, Diplomoceras lambi. A
chronostratigraphic 87Sr/86Sr datum corresponding to an absolute age of 71.0 +0.2 Ma has
been recovered from the upper part of the Diplomoceras lambi biostratigraphic range. All
three of these dinosaur taxa are earliest Maastrichtian in age. Three other dinosaur taxa, the
elasmarian iguanodontian Trinisaura santamartaensis, the ankylosaur Antarctopelta
oliveroi, and a lithostrotian titanosaur have been described from the Santa Marta Cove area
and the lastest Campanian, Herbert Sound Mbr. (=Gamma Mbr.) also of the Snow Hill Island
Formation. These dinosaur species occur immediately below the association of
Neograhamites cf. kiliani with the first occurrence of the ammonite Gunnarites antarcticus,
at the very top of the Gamma Mbr. section within 150 meters of the Gamma Mbr. - Cape
Lamb Mbr. unconformity with the base of the Cape Lamb Mbr. being assigned as the
Campanian-Maastrichtian Boundary at 72.1 Ma. All six dinosaur species from the Antarctic
Peninsula most likely occur within a one million year time span from 71 Ma to 73 Ma.

155 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ANLISIS MORFOMTRICO DE VALVAS DE LA LAPA Nacella concinna


DEPREDADAS POR LA GAVIOTA COCINERA Larus dominicanus EN
ANTRTIDA EXISTE DEPREDACIN SELECTIVA SOBRE LOS DIFERENTES
MORFOTIPOS?
(Morphometric analysis from shells of the limpet Nacella concinna predated by kelp gulls
Larus dominicanus in Antarctica. Does selective predation on the different morphotypes
exist?)

Castillo, S.1, de Aranzamendi, M. C.1, Martnez, J. J.2 y Sahade, R.1


1
Instituto de Diversidad y Ecologa Animal (CONICET-UNC) y Facultad de Ciencias Exactas, Fsicas y
Naturales, Universidad Nacional de Crdoba. Av. Vlez Sarsfield 299. 5000. Crdoba, Argentina. 2Instituto
de Ecorregiones Andinas. Universidad Nacional de Jujuy. CONICET. Av. Bolivia 1239. 4600. San Salvador
de Jujuy. Argentina.

La lapa Nacella concinna es uno de los macro-invertebrados ms abundantes de la Pennsula


Antrtica, distribuyndose desde la zona del litoral hasta aproximadamente los 100 metros
de profundidad. En base a la morfologa de la valva y el sector en el que habitan los
individuos, se han descrito dos morfotipos: uno tpico del litoral (L), con una valva alta y
gruesa, y otro del sublitoral (SL), con una valva ms achatada y delgada (Walker 1972). La
depredacin de individuos por parte de la gaviota cocinera Larus dominicanus en el litoral
ha sido propuesta junto a otros factores como la exposicin al aire, al oleaje y el impacto del
hielo como posibles causantes de esta separacin morfolgica (Nolan 1991). En general, las
gaviotas depredan sobre lapas en el litoral o sublitoral somero para luego desechar sus valvas
en sitios de acumulacin en el supralitoral denominados basureros de alimentacin. Nolan
(1991) utilizando morfometra tradicional, encontr una preferencia de las gaviotas hacia
individuos con forma de pera y mostr diferencias entre la forma del litoral (elptica) y la del
sublitoral (aperada), lo cual podra sugerir un efecto de la depredacin sobre los individuos
del litoral. En este trabajo nos proponemos evaluar la posible existencia de una presin de
depredacin diferencial de L. dominicanus sobre N. concinna en el litoral de Caleta Potter,
Isla 25 de Mayo, Islas Shetland del Sur, lugar donde se estima que entre el 10 % y el 14 %
de la mortalidad anual de las lapas se debe al consumo de las gaviotas (Favero 1997).

Materiales Y Mtodos
Se evaluaron valvas obtenidas en Caleta Potter durante la campaa antrtica de verano 2013
- 2014 de individuos provenientes del litoral y del sublitoral, y se las compar con valvas
provenientes de basureros de alimentacin de L. dominicanus mediante morfometra
tradicional y Anlisis Elptico de Fourier (EFA) en vista dorsal y lateral. Se realizaron anlisis
de componentes principales, grficos de densidad y tests de Kolmogorov-Smirnov para
comparar las distribuciones de los tres grupos.

Resultados
Los resultados obtenidos por morfometra tradicional y EFA lateral permiten visualizar con
claridad las diferencias entre los morfotipos. Por otro lado, el EFA dorsal describi continuos
de variacin relacionados al ancho general de la valva y entre una forma elptica a una
aperada, pero no aport informacin de utilidad para distinguir entre los morfotipos. En
cuanto a los basureros de alimentacin, el EFA lateral y la morfometra tradicional mostraron

156 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

que los individuos depredados corresponden principalmente al morfotipo L. Por otro lado, se
encontr mediante el EFA dorsal una preferencia por parte de las gaviotas hacia una
morfologa aperada, dato que corrobora la existencia de una depredacin selectiva.

Discusin
El hecho de que las valvas encontradas en los basureros de alimentacin de las gaviotas
posean, en mayor frecuencia, una forma notoriamente ms aperada que las del litoral, sugiere
como haba sido indicado previamente por Nolan (1991), la existencia de una depredacin
diferencial sobre este carcter. Sin embargo, y a diferencia de lo reportado por este autor, en
el presente trabajo no se encontraron diferencias en este aspecto entre las lapas del litoral y
del sublitoral, lo cual no hace posible plantear que la depredacin por parte de L. dominicanus
sea un factor determinante en la separacin de ambos morfotipos.

Conclusiones
En base a lo observado, no se encuentra justificacin para indicar a la depredacin por parte
de L. dominicanus sobre N. concinna como una de las causas biolgicas que conduciran a la
diferenciacin de los morfotipos.

Agradecimientos
Se agradece a G. Alurralde, al IAA, al IDEA (CONICET-UNC) y al CIN.

Referencias
Favero, M.; Silva, P.; Ferreyra, G. 1997. Trophic relationships between the kelp gull and the Antarctic limpet
at King George Island (South Shetland Islands, Antarctica) during the breeding season. Polar Biology 431436.
Nolan, C. P. 1991. Size, Shape and Shell Morphology in the Antarctic Limpet Nacella Concinna at Signy Island,
South Orkney Islands. Journal of Molluscan Studies. 57:225238.
Walker, A. J. M. 1972. Introduction to the ecology of the Antarctic limpet Patinigera polaris (Hombron and
Jaquinot) at Signy Island, South Orkney Islands. British Antarctic Survey. Bull. 28:4971.

157 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

THE ELLSWORTH MOUNTAINS CONNECTION WITH EAST ANTARCTICA


AND LAURENTIA
(La conexin de las montaas Ellsworth con Antrtica del este y Laurentia)

Castillo, P.1*, Fanning, C.M.1, Fernandez, R.2, Poblete, F.3


1
Research School of Earth Sciences, The Australian National University, Mills Road, Canberra ACT 0200,
Australia. 2 Institute for Geophysics, Jackson School of Geosciences, The University of Texas at Austin,
10100 Burnet Road, Austin, Texas 78758, USA. 3 Instituto de Ciencias de la Ingeniera, Universidad de
OHiggins, Gamero 357, Rancagua, Chile. *E-mail: paula.castillo@anu.edu.au

The Ellsworth-Whitmore Mountains crustal block (EWM, Fig. 1) of West Antarctica (Dalziel
and Elliot, 1982) is a critical element in any reconstruction of the palaeo-Pacific margin of
Gondwana between Africa and East Antarctica. Current palaeogeographic reconstructions of
the southern palaeo-Pacific margin of Gondwana place the Ellsworth-Whitmore Mountains
block in a position between South Africa and Antarctica, but as part of West Gondwana. This
is based on a similar rift setting during the Cambrian in South Africa, Falkland/Malvinas
Islands and the Ellsworth Mountains (Curtis, 2001; Curtis et al., 1999). Dalziel (1997, 2014)
proposed that it was Laurentia that rifted and drifted from this part of Gondwana, and that it
was still attached to Gondwana until the Cambrian. This model has significant implications
for the Cambrian explosion of life (Dalziel, 2014). However, the ages for magmatic rocks,
which should be related to this rifting, are poorly constrained. Correlations have been mostly
based on stratigraphic and fossil observations.

Figure 1. Location map of the


study rea. AP, Antarctic
Peninsula;EWM, Ellsworth
Mountain block;MBL, Marie
Byrd Land; TI, Turston Island;
SR, Shackleton Range; PM,
Pensacola Mountain; HR,
Heritage Range. Red line is for
the Transantarctic Mountains.
Figura 1. Mapa de la zona de
estudio en Antrtica y los
bloques corticales de Antrtica
del Oeste: AP, Pennsula
Antrtica; EWM, bloque de las
Montaas Ellsworth-Whitmore;
MBL, Marie Byrd Land; TI, Isla
Thurston; SR, Shackleton
Range; PM, Pensacola
Mountains; HR, Heritage
Range. Linea roja representa las
montaas transantrticas.

158 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Methods
In this study, we combine zircon U-Pb geochronology, Lu-Hf and O isotope data for two
igneous rocks from the Heritage Range in the Ellsworth Mountains (Fig. 1). The aim is to
provide chronological constraints and to test different tectonic models, as well as likely
connections of the EWM with East Antarctica. The combined analysis of the stable O and
radiogenic Hf isotopic compositions in igneous zircon provides valuable information about
several aspects of magmatic systems, especially the relative contribution of juvenile depleted
mantle input and/or recycled or long-lived crustal sources (Hawkesworth and Kemp, 2006;
Kemp et al., 2007).

Results
New U-Pb zircon dating of a micro-diorite (EHD0701A) gives an igneous crystallisation age
of 682 10 Ma (Fig. 2). These zircons have positive initial Hf and mantle-like 18O values
that indicate that rifting, which affected Mesoproterozoic crust, likely occurred in the
Cryogenian. A Cambrian magmatic event is recorded by zircons from a basaltic andesite
(EHD0305A) dated at 518 6 Ma (Fig. 2). This magmatism is also related to an extensional
setting, but one that is different from the Cryogenian micro-diorite. The Cambrian zircons
have elevated 18O values ranging from 7.59 to 9.07, indicating a strong sedimentary
influence on the magma source and crustal recycling.

Concordia Age = 518.2 6.2 Ma

Figure 2. New U-Pb data for igneous samples from the EWM in Tera-Wasserburg Concordia plots. A stacked
histogram for sample EHD0701A is also shown. Error ellipses are at the 2 level. On the left are the U-Pb
zircon ages (206Pb/238U) versus initial Hf and 18O values for zircons of both samples. Error bars are at the 2
level. Grey area is the value for zircon with mantle 18O (Valley et al., 2005)]. Figura 2. Nuevos datos U-Pb
de muestras de rocas gneas de las EWM en diagramas Tera-Wasserburg. Tambin se muestra un inserto de
histograma para la muestra EHD0701A. Elipses de error son de 2 sigma. En la izquierda se muestran las

159 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

edades U-Pb de circn (206Pb/238U) versus valores de Hf inicial y 18O en circn para ambas muestras. Las
barras representan error 2 sigma. El rea gris es el valor de circones con signatura mantlica de 18O (Valley
et al., 2005).
Discussion And Conclusion
Our data provide the first evidence of in-situ Cryogenian magmatism in the EWM and
support a continuation of Cryogenian rift-related magmatism from East Antarctica (e.g.
Cooper et al., 2010; Goodge et al., 2002) into the EWM. Therefore, it connects these blocks
before the formation of Gondwana. This rift affected Mesoproterozoic (ca. 1200 Ma) crust
and agrees with the break-up of Rodinia in the context of the southwest United States and
East Antarctica configuration (SWEAT; Moores, 1991). The Cryogenian rift-related
magmatism was followed by a second, Cambrian (ca. 520 Ma) magmatic event, related to an
extensional setting, which we interpret to result from the tectonic escape scenario after
collision of the Australo-Antarctic with West Gondwana/Indo-Antarctic plates (Castillo et
al., 2017).

Acknowledgements
.This work was supported by the Anillo Antrtico ACT-105 and Instituto Antrtico Chileno
(INACH) 161 projects. We greatly appreciate the help of our skilled mountaineer Bernab
Lpez and the Twin Otters crew of the Grupo 6, Chilean Air Force. Fieldwork campaigns to
the Ellsworth Mountains were made thanks to INACH, with support from Antarctic, Logistic
& Expedition (ALE).

References
Castillo, P., Fanning, C.M., Fernandez, R., Poblete, F., Herve, F. 2017. Provenance and age constraints of
Paleozoic siliciclastic rocks from the Ellsworth Mountains in West Antarctica, as determined by detrital zircon
geochronology. Geological Society of America Bulletin, https://doi.org/10.1130/B31686.1.
Cooper, A.F., Maas, R., Scott, J.M., and Barber, A.J.W. 2010. Dating of volcanism and sedimentation in the
Skelton Group, Transantarctic Mountains: Implications for the Rodinia-Gondwana transition in southern
Victoria Land, Antarctica. Geological Society of America Bulletin, 123:681702.
Curtis, M.L., Leat, P.T., Riley, T.R., Storey, B.C., Millar, I.L., and Randall, D.E. 1999. Middle Cambrian rift-
related volcanism in the Ellsworth Mountains, Antarctica: tectonic implications for the palaeo-Pacific margin
of Gondwana. Tectonophysics, 304:275299.
Curtis, M.L. 2001. Tectonic history of the Ellsworth Mountains, West Antarctica: Reconciling a Gondwana
enigma. Geological Society of America Bulletin, 113:939958.
Dalziel, I.W.D., and Elliot, D.H. 1982. West Antarctica: probem child of Gondwanaland. Tectonics, 1:319.
Dalziel, I.W.D. 1997. Overview, NeoproterozoicPaleozoic geography and tectonics: Review, hypothesis,
environmental speculation. Geological Society of America Bulletin, 109: 1642.
Dalziel, I.W.D. 2014. Cambrian transgression and radiation linked to an Iapetus-Pacific oceanic connection?.
Geology, 42:979982.
Goodge, J.W., Myrow, P., Williams, I.S., and Bowring, S.A. 2002. Age and provenance of the Beardmore
Group, Antarctica: Constraints on Rodinia Supercontinent breakup. Journal of Geology, 110:393406.
Hawkesworth, C.J., and Kemp, A.I.S. 2006. Using hafnium and oxygen isotopes in zircons to unravel the record
of crustal evolution. Chemical Geology, 226:144162.
Kemp, A.I.S., Hawkesworth, C.J., Foster, G.L., Paterson, B.A., Woodhead, J.D., Hergt, J.M., Gray, C.M., and
Whitehouse, M.J. 2007. Magmatic and crustal differentiation history of granitic rocks from Hf-O isotopes in
zircon. Science, 315:980983.
Moores, E.M. 1991. Southwest U.S.-East Antarctic (SWEAT) connection: a hypothesis. Geology, 19:425428.
Valley, J. W., Lackey, J. S., Cavosie, A. J., Clechenko, C. C., Spicuzza, M. J., Basei, M. A. S., Bindeman, I.
N., Ferreira, V. P., Sial, A. N., King, E. M., Peck, W. H., Sinha, A. K., and Wei, C. S. 2005. 4.4 billion years
of crustal maturation: oxygen isotope ratios of magmatic zircon. Contributions to Mineralogy and Petrology,
150(6):561580.

160 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

PROVENANCE AND AGE CONSTRAINTS OF PALAEOZOIC SILICICLASTIC


ROCKS FROM THE ELLSWORTH MOUNTAINS IN WEST ANTARCTICA, AS
DETERMINED BY DETRITAL ZIRCON GEOCHRONOLOGY
(Procedencia y restricciones de edad de las rocas siliciclsticas paleozoicas de las montaas
de Ellsworth en la Antrtida occidental, determinadas por geocronologa de circones
detrticos)

Castillo, P.1*, Fanning, C.M.1, Fernandez, R.2, Poblete, F.3, Herv, F.4,5
1
Research School of Earth Sciences, The Australian National University, Mills Road, Canberra ACT 0200,
Australia. 2 Institute for Geophysics, Jackson School of Geosciences, The University of Texas at Austin,
10100 Burnet Road, Austin, Texas 78758, USA. 3 Instituto de Ciencias de la Ingeniera, Universidad de
OHiggins, Gamero 357, Rancagua, Chile. 4 Departamento de Geologa, Universidad de Chile, Plaza Ercilla
803, Santiago, Chile. 5 Carrera de Geologa, Universidad Nacional Andres Bello, Sazie 2119, Santiago, Chile.
* E-mail: paula.castillo@anu.edu.au

The Ellsworth-Whitmore Mountains block (EWM) is one of the most isolated fragments
forming West Antarctica (Fig. 1). This block, largely ice covered, is most extensively
exposed in the Ellsworth Mountains, where there is an extensive record of sedimentation
from early Cambrian to Permian times (Webers et al., 1992; Flowerdew et al., 2007).
However, the tectonic history and the palaeogeographic significance of the EWM remain
enigmatic (Dalziel, 2007).

Methods And Results


New sensitive high-resolution ion microprobe (SHRIMP) U-Pb detrital zircon ages from
Cambrian to PermianCarboniferous siliciclastic units in the Ellsworth Mountains constrain
their provenance and maximum depositional age (Fig. 2), as well as providing key
information as to the tectonic evolution of a problematic region. The Cambrian Heritage
Group was deposited in an active continental rift setting and has main zircon components of
late Mesoproterozoicearly Neoproterozoic age (ca. 1300900 Ma) with little to no
contributions from older cratons. Two meta-volcaniclastic samples of the Union Glacier
Formation (lower Heritage Group) have U-Pb zircon ages of ca. 675 Ma indicating proximal
Cryogenian volcanism, thereby raising questions as to the depositional age of this unit.
Igneous and metamorphic zircons of late Neoproterozoicearly Cambrian age (650530 Ma)
are a secondary component in the upper part of this group. The passive margin sediments of
the overlying upper CambrianDevonian Crashsite Group record an up-sequence increase in
late NeoproterozoicCambrian detrital zircons (ca. 650480 Ma). The youngest detrital
zircons were dated at ca. 480 Ma with major peaks at ca. 530 and 500 Ma. Similar patterns
are recorded in the PermianCarboniferous Whiteout Conglomerate, with main components
at ca. 650500 Ma, and an absence of detrital zircons younger than Cambrian.

161 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figure 1. Sketch map of Antarctica showing the studied area and crustal blocks of West Antarctica: AP,
Antarctic Peninsula; EWM, Ellsworth-Whitmore Mountains block; MBL, Marie Byrd Land; TI, Thurston
Island. Top right figure is the reconstructed middle to late Cambrian palaeo-Pacific Ocean, after Curtis (2001).
Bottom right figure shows a simplified geological map of the Ellsworth Mountains. Sample locations (circled
numbers): (1) 13EG-01; (2) 13EG-02; (3) EHD2302A; (4) PH-10; (5) EHD0801A; (6) 13EG-05; (7)
EHD1705A; (8) EA6; (9) EAM1001B; (10) 13EG-15; (11) 13EG-10). Figura 1. Mapa de la zona de estudio
en Antrtica y los bloques corticales de Antrtica del Oeste: AP, Pennsula Antrtica; EWM, bloque de las
Montaas Ellsworth-Whitmore; MBL, Marie Byrd Land; TI, Isla Thurston. Figura superior derecha es la
reconstruccin del margen paleo-Pacfico durante el Cmbrico medio a tardo (Curtis, 2001). Figura inferior
derecha muestra un mapa geolgico simplificado de las Montaas Ellsworth. Locacin de muestras (nmeros
en crculos). (1) 13EG-01; (2) 13EG-02; (3) EHD2302A; (4) PH-10; (5) EHD0801A; (6) 13EG-05; (7)
EHD1705A; (8) EA6; (9) EAM1001B; (10) 13EG-15; (11) 13EG-10.

Discussion And Conclusion


The results, combined with stratigraphic constraints, suggest that sediments of the lower
Heritage Group were derived from the palaeo-Pacific margin of the Australo-Antarctic plate.
Cryogenian igneous zircon ages from the Union Glacier Formation indicate proximal rift-
related magmatism, previously only recognised in the Transantarctic Mountains, and are
interpreted as being related to the break-up of Rodinia. Sediments from the upper Heritage
Group were derived from proximal sources, likely in Coats Land and Dronning Maud Land,
with possible extensions into the Shackleton Range. This area was probably uplifted during
the final amalgamation of Gondwana, which restricted the supply of sediment from older
cratons. Sediments from the Crashsite Group allow for a more expansive source region,

162 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

which could have been located in Dronning Maud Land, the Shackleton Range, the
Transantarctic Mountains and/or Southern Africa. Sediments of the Whiteout Conglomerate,
together with comparisons with other coeval glaciogenic strata, indicate that deposition
during the PermianCarboniferous was similar to that in the Transantarctic Mountains. Our
data support that the Ellsworth-Whitmore Mountains crustal block was once part of the
Australo-Antarctic plate rather than the southern African sector.

Figure 2. Summary and comparison of the detrital zircon components of sandstone samples. Relative
probability density plot (grey area) and kernel density estimator (KDE, black line) versus preferred age. Black

163 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

dotted line indicates the age of the meta-volcaniclastic samples). Figura 2. Resumen de resultados y
comparacin de las edades de circones detrticos. Diagrama de densidad de probabilidad relativa (rea gris
oscura bajo la curva) y estimador de densidad Kernel (KDE, lnea negra) versus la edad preferida. Lnea
punteada negra indica la edad de las muestras meta-volcanoclsticas.

Acknowledgments
This work was supported by the Anillo Antrtico ACT-105 and Instituto Antrtico Chileno
(INACH) 161 projects. We greatly appreciate the help of our skilled mountaineer Bernab
Lopez and the Twin Otters crew of the Grupo 6, Chilean Air Force. Fieldwork campaigns to
the Ellsworth Mountains were made thanks to INACH, with support from Antarctic, Logistic
& Expedition (ALE).

References
Curtis, M.L., Leat, P.T., Riley, T.R., Storey, B.C., Millar, I.L., and Randall, D.E. 1999. Middle Cambrian rift-
related volcanism in the Ellsworth Mountains, Antarctica: tectonic implications for the palaeo-Pacific margin
of Gondwana. Tectonophysics, 304:275299.
Dalziel, I.W.D., 2007, The Ellsworth Mountains: Critical and Enduringly Enigmatic, in Cooper, A.K., and
Raymond, C.R., eds., Antarctica: a keystone in a changing world; Online Proceedings of the 10th ISAES. U.S.
Geological Survey and The National Academies, USGS OF20071047, Short Research Paper 004.
Flowerdew, M.J., Millar, I.L., Curtis, M.L., Vaughan, A.P.M., Horstwood, M.S.A., Whitehouse, M.J., and
Fanning, C.M. 2007. Combined U-Pb geochronology and Hf isotope geochemistry of detrital zircons from early
Paleozoic sedimentary rocks, Ellsworth-Whitmore Mountains block, Antarctica. Geological Society of America
Bulletin, 119:275288.
Webers, G.F., Craddock, C., and Splettstoesser, J.F. 1992. Geology and paleontology of the Ellsworth
Mountains, West Antarctica, Geological Society of America of America Memoir, 459 p.

164 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ALMEJAS LA CARTE: ESTUDIO DE TRAZAS DE DEPREDACIN EN VENRIDOS


DEL EOCENO DE ANTRTIDA
(Clams la carte: Study on predation traces in venerids from the Eocene of Antarctica)

Cech, N. B.1, Brezina, S. S.2, Palpolo, E. E.3, Casado, S. A.4 y S. Santillana5


1, 2, 3, 4
Instituto de investigaciones en Paleobiologa y Geologa, UNRN-CONICET, Avenida Roca 1242, General Roca,
Ro Negro, Argentina. E-mail: ncech@unrn.edu.ar; sbrezina@unrn.edu.ar; eepalopolo@unrn.edu.ar;
sacasadio@unrn.edu.ar. 5Instituto Antrtico Argentino, 25 de Mayo 1143, San Martn, provincia de Buenos Aires,
Argentina. ssantillana@dna.gov.ar.

Los gasterpodos de las familias Naticidae y Muricidae suelen ser depredadores infaunales de
comunidades marinas de moluscos en fondos blandos, tales como bivalvos, escafpodos e incluso
otros gasterpodos. El registro de dicha interaccin bitica es muy rico y ha sido descripto tanto en
asociaciones fsiles como modernas (Mondal et al., 2017), aportando al conocimiento de varios
aspectos respecto a las interacciones predador-presa. El registro fsil de trazas de depredacin ha
tenido una dramtica radiacin desde el comienzo del perodo Cretcico y varios estudios se han
enfocado en la identificacin del depredador, las relaciones entre el tamao de las perforaciones y el
tamao del depredador (selectividad de la presa), la distribucin preferencial de las perforaciones
(selectividad de sitio) entre otros aspectos (Kong et al., 2015). En este trabajo se estudi la relacin
predador-presa a partir del registro de trazas de depredacin sobre dos especies de venridos
(Euromalhea florentinoi y Retrotapes antarcticus) de la Formacin La Meseta, del Eoceno de la
Antrtida.
La Formacin La Meseta (Eoceno) est expuesta en las islas Seymour y Cockburn ubicadas en el
extremo norte de la Pennsula Antrtica y constituye la parte superior del relleno de la cuencaJames
Ross. Esta unidad representa un valle inciso compuesto, de unos 250 m de espesor y cuyos depsitos
corresponden a facies deltaicas, estuarinas y marinas (Marenssi, 2006). Marenssi et al. (1998)
subdividi la Formacin La Meseta en seis Alomiembros. De base a techo son el Valle de las Focas,
Acantilados, Campamento, Cucullaea I, Cucullaea II y Submeseta. Los especmenes estudiados aqu
provienen del Alomiembro Submeseta, tambin considerado por otros autores como Formacin
Submeseta (Montes et al., 2013). Siguiendo el mapa de Montes et al (2007) la ubicacin de las
muestras tomadas corresponde a las siguientes coordenadas 64 14' 28' S, 78'' 56 38' 43,19''W; 64
14' 30,39'' S, 56 38' 44,53''W y 64 14' 25''S, 56 35' 31,34'W. Las muestras de venridos fueron
colectadas al azar usando cuadratas de 0,25 m2. Adems se colectaron arbitrariamente muestras con
perforaciones de depredacin a fin de contar con un mayor N para evaluar seleccin de sitio y
correlaciones entre el tamao estimado del predador y el tamao de la presa.
Un total de 853 especmenes fueron observados bajo lupa binocular y depositados en la coleccin del
Instituto Antrtico Argentino (IAA), Ciudad Autnoma de Buenos Aires. Para cada espcimen se
determin la presencia/ ausencia de perforaciones y las mismas fueron clasificadas como
perforaciones hechas por natcidos o murcidos y asignadas al icnognero Oichnus Bromley. Para
todos los especmenes se tomaron medidas de largo y ancho utilizando un calibre digital. Adems,
cada perforacin fue clasificada como completa o incompleta. Para evaluar la preferencia de tamao
de la presa se realiz una correlacin usando el dimetro externo de la perforacin como una
estimacin del tamao del depredador y el largo como tamao de la presa. Las variables consideradas
respecto a las perforaciones y a las conchillas perforadas, estn descriptas en la tabla 1. La frecuencia
de ataque se define como la proporcin de la poblacin de la presa que es atacada y se calcul como
la proporcin de conchillas perforadas en las muestras (completas e incompletas). La frecuencia de
perforacin se calcul dividiendo el nmero total de conchillas perforadas con agujeros completos
por el nmero total de especmenes observados. La probabilidad de xito del evento de depredacin
depende de la proporcin de presa respecto al tamao del depredador. Por esto, para estudiar el papel
de la seleccin del tamao en la depredacin exitosa, se calcul la tasa de xito dividiendo el nmero

165 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

de perforaciones completas por el nmero total de perforaciones (agujeros completos y agujeros


incompletos). La frecuencia relativa de ataques fallidos referidos como efectividad de presa fue
calculada como el nmero de perforaciones incompletas dividido por el nmero total de intentos de
perforacin (completos e incompletos). Todos los anlisis estadsticos se realizaron con los softwares
Past y R 3.2.0 (2015). Cada valva se dividi en nueve sectores. Se realiz un test de Bondad de Ajuste
a fin de evaluar una posible preferencia de los depredadores por perforar alguna de las reas de la
conchilla.
Especie E. florentinoi R. antarticus
Muestra M3 M2 M1 M4 M5
Tipo de muestreo Al azar Al azar Al azar Selec. Selec.
N 507 95 123 75 53
Nmero de conchillas perforadas (n) 46 6 31 75 53
Nmero de conchillas no perforadas (n) 461 89 92 0 0
Frecuencia de ataque (AF) 0.09 0.06 0.25
Frecuencia de perforacin (DF) 0.09 0.03 0.24
Alto de conchilla (mm)
Conchillas perforadas
Media 23.51 35.94 27.17
Mediana 23.65 35.76 26.71
Mximo 34.48 43.35 35.44
Mnimo 13.12 29.58 19.04
Concillas no perforadas
Media 25.94 35.5 28.67
Mediana 26.38 35.68 28.42
Mximo 41.27 59.25 44.9
Mnimo 10.42 26.41 11.76
Altura de valvas perforadas completas(mm)
Media 22.69 32.63 27.36 30.03 34.25
Mediana 23.52 33.90 26.94 30.70 34.43
Altura de valvas perforadas incompletas (mm)
Media 34.03 35.24 21.38 36.47 44
Mediana 34.03 37.12 21.38 36.78 43.37
Parmetros calculados para las perforaciones
Nmero de perforaciones (n) 46 6 31 75 53
Nmero de perforaciones completas (n) 44 3 30 71 50
Nmero de perforaciones fallidas (n) 2 3 1 4 3
Tasa de xito (SR) 0.96 0.5 0.97
Efectividad de la presa (PE) 0.04 0.5 0.03
Proporcin de perforaciones mltiples 0 0 0 1 1
Tabla 1. Parmetros calculados en las muestras estudiadas. Table 1. Parameters calculated in the studied samples.

Los especmenes estudiados presentaron un 95 % de articulacin, con un estado de preservacin


intermedio (con un grado alto a intermedio de disolucin y un grado intermedio de deformacin por
compactacin). Las muestras tomadas al azar no presentan una distribucin normal. Cuando dichas
muestras fueron comparadas entre s, se encontraron diferencias significativas en las medianas del
tamao de valva (test Kruskall-wallis, p=0.00001). De acuerdo al test de comparaciones mltiples de
Dunn, stas muestras se pudieron agrupar en M1, M2 y M3, mientras que las muestras seleccionadas
son M4 y M5. Los resultados de los estadsticos descriptivos y frecuencias de perforacin fueron
sintetizados en la tabla 1. Por otro lado, se realiz Tests de Wilcoxon cuyos resultados se detallan en
la tabla 2.

Tipo de N Valvas no perf. vs valvas perf. Valvas con perf. completas vs valvas con perf.
muestreo (valor de p) incompletas (valor de p)
azar 123 M1 0.07018* 0.1935
azar 95 M2 0.3411 0.4
azar 507 M3 0.0003954* 0.001932*

166 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Tabla 2. Test de Wilcoxon para comparar las alturas de las valvas en las diferentes muestras. Se indican los valores
significativos de p con *. Table 2. Wilcoxon test to compare shells height in different samples. Significant p-values are
indicated with *.
En las muestras M1, M2, M3 el tamao de depredador (estimado a partir del dimetro externo de la
perforacin) no present diferencias significativas entre las tres muestras (test de Kruskall-Wallis, p=
0.5360191). Para las muestras al azar, no se hallaron preferencias por ninguna de las valvas en ningn
caso. Tampoco hubo seleccin de sitio de perforacin. Por otro lado, existe slo una correlacin
positiva entre tamao del individuo y el de la perforacin en la M3 (n=41; Rs=0.43). Para las muestras
seleccionadas, tampoco existe preferencia por ninguna de las valvas. S existe una preferencia por los
sitios 2 y 5 en las valvas perforadas de M5 para R. antarcticus.
Los anlisis tafonmicos indican que se trata de una concentracin parautctona, que ha sufrido poco
transporte, y ha sido acumulada en un ambiente de baja a moderada energa. Los venridos poseen
relleno sedimentario igual al resto del estrato y no poseen signos de haber sido exhumados luego de
su sepultamiento (Allison y Briggs, 1991). Las conchillas con estructuras de chalky y pitted
observadas evidencian disolucin moderada. Varios ejemplares con pocos signos de disolucin
presentan fragmentacin en mosaico. Los ejemplares que han sufrido una disolucin moderada a alta,
poseen lneas de crecimiento plegadas y deformadas pero sin fracturas por lo que la disolucin fue
sincrnica al proceso de compactacin, y por tanto, las valvas tuvieron un comportamiento plstico.
Al analizar material suelto no se pudo evaluar la orientacin de los ejemplares en planta, ni las
caractersticas tafonmicas del afloramiento para poder comprender mejor el origen de la
concentracin estudiada.
Las frecuencia de perforaciones de natcidos sobre venridos para la muestra M3 (9%) y M2 (3%)
son similares a los ya reportados por Kelley et al. 1997 (2%) para el Eoceno de la Formacin La
Meseta as como de otras localidades (ver Kelley y Hansen, 2007). Werner et al. (2004) registraron,
en los tramos superiores de Formacin la Meseta, frecuencias de ataque de Polinices sp. sobre
bivalvos del orden del 2.5% siendo levemente ms bajos a los hallados en M3 (9%) y M2 (6%). Sin
embargo, M1 no sigue la misma tendencia ya que present una frecuencia de perforacin y una
frecuencia de ataque ms alta (alrededor de 24 % en ambos ndices), es decir la intensidad de
depredacin es mayor. La tasa de xito del depredador es alta, con ms del 90% para M1 y M3, pero
en M2 slo alcanza el 50% (ver tabla 1). En tanto que la efectividad de la presa en escapar del
depredador es muy baja (ver tabla 1). El tamao de la presas parece ser un factor importante en la
seleccin y xito del depredador. Esto se evidencia en M2 con rangos de tamaos de valvas mayores
(30 mm a 45 mm) asociado a tasas de xito de predador mucho ms bajos. Las muestras con tasas de
xito de predador ms alta poseen rangos de tamaos de valvas menores tanto para M1 (20-40mm)
como para M3 (10-35mm). Esto ltimo concuerda con Vemeij (1987) que propone que los tamaos
refugios de las presas se corresponden con tamaos mayores de presa que resisten el ataque del
depredador. Tanto las comparaciones entre valvas perforadas y no perforadas (M1 y M3) como las
de valvas con perforaciones completas e incompletas (M3) resultaron ser significativas (ver tabla 2).
En ambos casos se evidencia una preferencia del tamao de presa, es decir, se prefieren las presas de
menor tamao cuyo rango vara entre 10 y 35 mm. Asimismo, Chattopadhyay y Dutta (2013)
observaron que los especmenes con perforaciones incompletas son mayores que los que tenan
perforaciones completas. Estos autores sugieren un lmite manipulable de la presa para tamaos
especficos de depredadores, pasado este lmite el depredador ya no tiene xito. El tamao de los
depredadores estimado no muestra diferencias significativas entre las muestras seleccionadas al azar
sin embargo se encontraron diferencias en la intensidad de depredacin. En M1 donde los valores de
frecuencia de perforacin y de ataque son los ms altos correspondindose con tamaos intermedios
de valvas. Kingsley-Smith (2003) y autores all citados tambin encontraron que la depredacin por
natcidos parece ser ms intensa en valores medios de valvas. Argumentan que la mortalidad de los
bivalvos inicialmente aumenta con el tamao de presa hasta llegar a un mximo que representa el
tamao preferencial, luego la mortalidad disminuye progresivamente hacia los tamaos mximos de
presa. Si bien no existe una fuerte correlacin entre el dimetro externo de las perforaciones y el

167 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

tamao de la presa, no es posible negar que s exista una seleccin de la presa por parte del depredador.
Algunos estudios experimentales han demostrado que an en ataques viables a menudo se asocian a
correlaciones dbiles entre el dimetro externo de la perforacin y el tamao de la presa
(Chattopadhyay and Baumiller, 2007, 2009). No fueron observadas preferencia por ninguna de las
valvas. En este sentido algunos autores (e.g. Chattopadhyay y Dutta, 2013; Kingsley-Smith et al.,
2003) proponen que en casos de valvas simtricas esto no es esperado. S en cambio para valvas
asimtricas, ya que se esperara una preferencia debida a una mayor facilidad en la manipulacin o
por cuestiones relacionadas al costo de perforar una u otra valva (Fretter y Graham, 1994). Respecto
a la seleccin del sitio de la perforacin, en R. antarcticus se observa una preferencia por los sitios 2
y 5 que corresponden a las reas del umbo y central, respectivamente. Esta seleccin puede asociarse
a una mayor facilidad de manipulacin durante la perforacin de la presa y en la posicin del msculo
aductor (Chattopadhyay y Dutta 2013).
Por lo expuesto se concluye que: a) Respecto al xito del depredador y la efectividad de la presa,
podemos afirmar que el tamao de la presas parece ser un factor importante en la seleccin y xito
del depredador. Son preferidas las presas de menor tamao cuyo rango vara entre 10 y 35 mm.
Adems, en M1 los valores de frecuencia de perforacin y de ataque (intensidad de predacin) son
los ms altos y se corresponden con tamaos intermedios de valvas, b) Si bien no existe una fuerte
correlacin entre el dimetro externo de las perforaciones y el tamao de la presa, no se descarta una
posible seleccin por parte del depredador de la presa, c) No existe una preferencia del depredador
por ninguna de las valvas, probablemente debido a que las mismas son simtricas en ambas especies
analizadas y d) El depredador muestra preferencia por perforar el umbo y el centro de las valvas en
R. antarcticus, probablemente asociada a una mejor manipulacin de la presa.
Referencias
Allison, P. A. y Briggs, D. E., 1991. Taphonomy: releasing the data locked in the fossil record. Plenum, New York. 560pp.
Chattopadhyay, D. y Baumiller, T. K., 2007. Drilling under threat: an experimental assessment of the drilling behavior of
Nucella lamellosa in the presence of a predator. Journal of experimental marine biology and ecology, 352 (1): 257-266.
Chattopadhyay, D. y Baumiller, T. K., 2009. An experimental assessment of feedings rates of the muricid gastropod Nucella
lamellosa and its effect on a cost-benefot analysis. Journal of shellfish research, 28(4): 883-889.
Chattopadhyay, D. y Dutta, S., 2013. Prey selection by drilling predators: a case study from Miocene of Kutch, India.
Palaeogeography, Palaeoclimatology, Palaeoecology, 374: 187-196.
Kingsley-Smith, P. R., Richardson, C. A. y Seed, R., 2003. Stereotypic and size-selective predation in Polinices pulchellus
(Gastropoda: Naticidae) Risso 1826. Journal of Experimental Marine Biology and Ecology, 295: 173190.
Kelley, P. H. y Hansen, T. A., 2007. A case for cannibalism: confamilial and conspecific predation by naticid gastropods,
Cretaceous through Pleistocene of the United States Coastal Plain. In: Elewa, A. M. T. (ed.): Predation in organisms. Berlin:
Springer, 151170.
Kelley, P. H., Thomann, C. D., Hansen, T. A., Aronson, R. B. y Blake, D. B., 1997. A world apart but not so different:
predation by naticid gastropods in Antarctica and the US Gulf Coast during the Eocene. Geological Society of America
Abstract with Programs, 29: 107.
Kong, D., Lee, M. y Lee, S., 2015. Traces (ichnoespecies Oichnus paraboloides) of predatory gastropods on bivalve shells
from the Seogwipo Formation, Jejudo, Korea. Journal of Asia-Pacific Biodiversity, 8: 330-336.
Marenssi, S. A., 2006. Eustatically controlled sedimentation recorded by Eocene strata of the James Ross Basin, Antarctica.
In: Francis, J. E., Pirrie, D. y Crame, J. A. (eds.): Cretaceous-Tertiary high-latitude palaeoenvironments, James Ross Basin,
Antarctica. Special Publication of the Geological Society of London, 258: 125133.
Marenssi, S., Santillana, S. N. y Rinaldi, C. A., 1998. Paleoambientes sedimentarios de la Aloformacin La Meseta
(Eoceno), Isla Marambio (Seymour), Antrtida. Instituto Antrtico Argentino, Contribucin 464: 151.
Mondal, S., Goswami, P. y Bardhan, S., 2017. Naticid confamilial drilling predation through time. Palaios, 32: 278-287.
Montes, M., Nozal, F., Santillana, S., Marenssi, S., Olivero, E., & Maestro, A. 2007. Nuevo mapa geologico escala 1: 20.000
de la Isla Marambio (mar de Weddell, Antartida). In: Actas del VI Simposio Argentino y III Latinoamericano sobre
Investigaciones Antrticas CD-ROM. Resumen Expandido: Vol. 8.
Montes, M., Nozal, F., Santillana, S., Marenssi, S., and Olivero, E.2013. Mapa geolgico de Isla Marambio (Seymour).
Antrtida;escala 1:20.000. 1 edicin. Serie Cartogrfica
Vermeij, G.J.1987. Evolution and escalation.An ecological history of life.Princeton,NJ:Princeton University Press, 527pp.
Werner, J. E., Blake, D. B., y Aronson, R. B., 2004. Effects of late Eocene cooling on Antarctic marine communities. Boll.
Geofis, 45(2): 262-65.

168 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

PRESENCIA DE ACIDO METANO SULFNICO EN NIEVE DEL EXTREMO


NORTE DE LA PENNSULA ANTRTICA: IMPLICANCIAS SOBRE EL
CAMBIO CLIMTICO
(Presence of methanesulphonic acid in snow of the northernmost Antarctic Peninsula:
Implication on climate change)

Cereceda-Balic, F1,2; Jorquera, S.1, Snchez, C.1; Llanos, P1; Vidal V.1,2,
Fadic X1, Funes, M.1
1
Centro de Tecnologas Ambientales (CETAM) y 2) Departamento de Qumica, Universidad Tcnica
Federico Santa Mara (UTFSM), Valparaso, Chile. francisco.cereceda@usm.cl

El Dimetilsulfuro (DMS), es un compuesto derivado del proceso de osmeoproteccin de


microorganismos marinos (Duane, 2002), que se oxida en la atmsfera, formando aerosoles
de sulfato no marino y cido metanosulfnico (MSA), posteriormente el MSA es
transportado desde la atmsfera ocenica hasta el continente antrtico por influencia de los
vientos e incorporado en la superficie de la nieve por deposicin seca y/o hmeda. A
diferencia del sulfato, el cual puede tener diversas fuentes de emisin (volcnicas,
antropognicas, etc.), el MSA es producido exclusivamente por la oxidacin del DMS
biognico, convirtindolo en un buen indicador de la actividad microbiolgica de la
superficie marina. El aumento de la temperatura ocenica genera una mayor produccin de
fitoplancton marino, aumentando entonces la concentracin de MSA atmosfrico y a su vez,
produciendo una mayor tasa de deposicin de este compuesto en la nieve antrtica. Es por
ello, que el MSA se usa como trazador indirecto (proxie) de cambio climtico, en particular
en un ambiente aislado como el ocano que rodea el continente Antrtico (Han et al., 2001).
La parte norte de la Pennsula Antrtica es considerada uno de los lugares ms sensibles del
planeta al cambio climtico, debido a su mayor exposicin geogrfica a un aumento en la
temperatura atmosfrica, evidencia de esto es el desprendimiento de las plataformas de hielo
ms grandes del continente en esta zona geogrfica (Han et al., 2001). Por lo anteriormente
expuesto el objetivo del presente trabajo es cuantificar la concentracin de MSA en muestras
de nieve de la pennsula antrtica norte con miras a estudiar sus implicancias en el cambio
climtico.

Parte Experimental
Las muestras se recolectaron abarcando una superficie de aproximadamente 1 km sobre el 2

glaciar, en donde se tomaron al menos 3 muestras representativas de un rea de 1 m c/u. En 2

cada caso la muestra de nieve superficial se recolect con una profundidad de 5 cm, utilizando
una pala de tamao adecuado de material inerte y previamente lavada para evitar
contaminacin. En el caso de las calicatas (snow pit), se realiz una excavacin de
aproximadamente 3 m de profundidad y las muestras se tomaron de forma similar a lo
anterior, con la diferencia que en cada pozo de nieve se tomaron muestras cada 50 cm, para
anlisis posteriores. Ambos tipos de muestras se recolectaron durante las campaas Antrtica
ECA 50, 51 y 52 (2014-2016), en el glaciar La Paloma (LP) (6321'20''S, 5748'21''O, 409
msnm). Solo muestras superficiales se recolectaron en la plataforma de hielo Larsen C,
(2009) (6831'53''S, 6421'50''O) y la Base OHiggins del Ejrcito de Chile (2014)
(6319'14.93"S; 5754'0.42"O). Todas las muestras fueron analizadas para MSA en su forma

169 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

inica (Metanosulfonato) e iones mayoritarios. La preparacin de las muestras se realiz bajo


campana de flujo laminar y el anlisis se realiz mediante Cromatografa Inica.

Resultados y Discusin
La figura 1 exhibe una comparacin de la concentracin de MSA obtenidas en el presente
estudio y en Dumont D'urville, que fue de 0,08 Eq/L, 1984 (lado oriental de la Antrtica
6642 S, 14000 E) (Maupetit y Delmas, 1992). La concentracin de MSA, en el glaciar La
Paloma 2014 y Larsen C fue aproximadamente 6 veces mayor que en Dumont D'urville,
mientras que La Paloma 2015, fue 18 veces mayor y La Paloma 2016 fue 10 veces mayor
con respecto Dumont D'urville.

Figura 1 MSA en nieve superficial. Figure 1. MSA in surface snow.

La figura 2 presenta el perfil de concentracin de MSA en calicatas realizadas en el Glaciar


La Paloma (2014, 2015 y 2016). Se puede observar para los 3 aos, que la mayor
concentracin se registr en el estrato comprendido entre los 100 y 150 cm de profundidad.
Considerando que la calicata representa la nivologa de 1 ao y tomando en cuenta la taza de
deposicin de nieve en esta zona costera de la Pennsula Antrtica, estos mximos de
concentracin podran ser atribuidos en este estrato, al aumento de la temperatura y cantidad
de luz (posterior al invierno), lo que genera una mayor actividad biognica y procesos
fotoqumicos atmosfricos que favorecen la produccin de DMS y posterior conversin a
MSA (Maupetit y Delmas, 1992). La similitud en los perfiles de concentracin podra indicar
una tasa de acumulacin de nieve similar entre los distintos aos en el Glaciar La Paloma,
as como tambin, el inicio del periodo clido en la misma poca del ao durante el periodo
estudiado.

Figura 2. Concentracin de MSA en calicatas para las campaas 2014, 2015 y 2016. Figure 2. MSA
concentration in snowpits for campaigns 2014, 2015 and 2016.

Los valores promedio de concentracin en calicata para MSA, obtenidos en el Glaciar La


Paloma fueron 1,6; 5,5 y 3,5 veces mayores que lo observado en la isla Rey Jorge para los
aos 2014, 2015 y 2016, respectivamente. El aumento en la concentracin de MSA en La
170 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Paloma con respecto a lo registrado en la isla Rey Jorge y Dumont D'urville, podra ser
explicado por un aumento de la actividad biognica en el mar circundante al extremo norte
de la pennsula Antrtica, debido a un aumento de la temperatura del mar en 0,3C por
dcada, segn se ha observado desde el ao 1980 (Schmidtko et al., 2014), lo que sumara
aproximadamente 0,75C desde el ao 1991 a la fecha. La figura 3 muestra la correlacin
entre el MSA y sulfato no marino (nssSO ) en calicata. Se observa que el ao 2014, present
4
2-

una correlacin de R =0,96 entre MSA y el nssSO , lo que indicara que el nssSO
2
4
2-
4
2-

provendra directamente de la conversin de DMS. El ao 2015, la correlacin es


prcticamente nula (R =0,002), lo que podra indicar que el ingreso al continente antrtico de
2

nssSO es de un origen distinto a la conversin de DMS. Posibles fuentes de este nssSO


4
2-
4
2-

podran ser aerosoles marinos (Ver resumen MG968KG presentado en este congreso)
volcanes y/o fuentes antropognicas. El ao 2016, el valor de R fue igual a 0,40, lo que 2

podra indicar una contribucin de fuentes mixta, biognicas, volcanes y/o antropognicas
sobre la Pennsula Antrtica. Por ejemplo, se registr actividad en los volcanes Copahue y
Villarrica en el mes de octubre del ao 2014, y marzo 2015 respectivamente (Sernageomin),
ambos eventos ocurrieron despus de las campaas antrticas que se realizan entre enero y
febrero de cada ao y sus emisiones podran haber impactado al extremo norte de la Pennsula
Antrtica, reflejado en los ndices de correlacin entre MSA y nssSO en el ao 2015 y 2016. 4
2-

Como antecedente, se han reportado pobres correlaciones entre el MSA y nssSO en la Baha 4
2-

de Terra Nova en el mar de Ross (7351,9 S, 16341,5 E) lado oriental de la Antrtica,


situacin que fue interpretada como evidencia de fuentes distintas de emisin para el nssSO 4
2-

a la transformacin del DMS (Udisti et al., 1993).

Figura 3. Anlisis de regresin entre la concentracin de MSA y nssSO en el Glaciar La Paloma. Figure 3.
4
2-

Regression analysis between the concentration of MSA and nssSO , Glacier La Paloma.
4
2-

En la Figura 4 se presenta la variacin en calicata de la relacin MSA/nssSO , calculada en 4


2-

moles de acuerdo con lo descrito por de Mora et al. (1997). Se puede observar que existe una
alta variabilidad entre los distintos estratos y entre los distintos aos de campaa, en el ao
2014 vari entre un 14% y 43,5%, el 2015 vari entre un 4,7% y 52,0%, mientras que el 2016
vari entre un 13,1% y un 125,5%. De Mora y colaboradores (1997), observaron para la

171 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

relacin MSA/nssSO , tambin una alta variabilidad, la cual oscil entre 1,14% y 55,6% en
4
2-

una calicata de 2 m de profundidad, realizada en plateau Antrctico (78"1.5'S, 139"48.2'E).


Nuestros valores para la relacin MSA/nssSO , fueron comparables a lo reportado por de
4
2-

Mora, as como tambin a lo reportado para la isla Rey Jorge, donde el valor promedio para
la relacin MSA/nssSO , (calculada en moles) fue de un 40% para un testigo de hielo de 9
4
2-

m (Han et al., 2001). El alto valor observado para la relacin MSA/nssSO , en el primer 4
2-

estrato de la calicata en el ao 2016, no es una situacin excepcional y ha sido observada


anteriormente en Dumont D'urville (Maupetit y Delmas, 1992).

Figura 4. Perfil de la relacin de MSA/nssSO en calicata, Glaciar La Paloma. Figure 4. Profile of MSA /
4
2-

nssSO ratio in snowpit, La Paloma Glacier


4
2-

Conclusiones
El incremento de la concentracin de MSA, en el extremo norte de la Pennsula Antrtica
(Glaciar La Paloma), podra indicar muy probablemente un aumento de la actividad
biognica en el ocano, debido a un aumento de la temperatura del ocano Antrtico en el
perodo estudiado, entre 1984 y 2017.

Agradecimientos
Inach RT18-12, MT08-15. Ejrcito de Chile.

Referencias
Duane, Y. (2002). Dimethylsulfoniopropionate: Its source, role in the marine food web, and biological
degradation to Dimethylsulfide. Applied and environmental microbiology 68, 5804-5815.
De Mora, S. Wylie, D. Dick, A. (1997). Methanesulphonate and non-sea salt sulphate in aerosol, snow, and ice
on the East Antarctic plateau. Antarctic Science 9 (1): 46-55.
Han, Jiankang; Xie, Zichu; Zhang, Xinping; Dai, Dongsheng; Mayewski, Paul Andrew; Twickler, M.S.,
(2001).Methanesulfonate in the firn of King George Island, Antarctica.Journal of Glaciology, Vol 47, No 159.
Maupetit, F. y Delmas, R. J. (1992) Chemical composition of falling snow at Dumont d'urville, Antarctica.
Journal of Atmospheric Chemistry, 14, 31-42.
Sernageomin, Reporte de Actividad Volcnica.
Schmidtko, S. Heywood, K.J., Thompson, A.F, Aoki S. 2014. Multidecadal warming of Antarctic waters.
Science 346 (6214), 1227-1231 (2014).
Udisti, R. Casella, F. Piccardi, G. (1993). The role of methanesulphonic acid in snow samples from Terra
Nova Bay (Antarctica). In Restelli, G. & Angeletti, G. eds. Dimethylsulphide, oceans, atmosphere and
climate. Dordrecht: Kluwer Academic Publishers, 153-162.

172 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

CARACTERIZACIN DE AEROSOLES ATMOSFRICOS EN TRAVESA


MARTIMA PUNTA ARENAS - ANTRTICA
(Characterization of atmospheric aerosols in maritime cruise Punta Arenas -
Antarctica)

Cereceda-Balic F.1,2, Funes F.1, Fadic X.1, Vidal V.1,2.


1
Centro de Tecnologas Ambientales (CETAM). 2Departamento de Qumica, Universidad Tcnica Federico
Santa Mara, Av. Espaa 1680, Valparaso, Chile. francisco.cereceda@usm.cl.

El continente antrtico es considerado como una de las zonas ms prstinas del planeta debido
a su lejana de asentamientos humanos significativos, sin embargo a partir de 1960 ha habido
reportes de la presencia de contaminantes antropognicos como por ejemplo Compuestos
Orgnicos Persistentes (COPs), Anhidrosacridos, Hidrocarburos Aromticos Policclicos
(HAPs), etc., los cuales fueron transportados hasta esta remota zona del planeta desde sus
fuentes de emisin (Khairy et al. 2016). Este hecho indica que existe transporte de
contaminantes atmosfricos desde los asentamientos humanos hacia la Antrtica a travs del
ocano. La Antrtica, como parte de la crisfera juega un importante rol en el balance
energtico del planeta ya que un pequeo descenso del albedo de la nieve puede incrementar
significativamente la cantidad de radiacin solar absorbida por la superficie (Khairy et al.
2016). Esta retroalimentacin del albedo de nieve ha sido considerada la amplificacin
positiva ms significativa del aumento de la temperatura superficial global (Lee y Liuo 2012).
En este sentido es importante entender cmo llegan hasta el continente antrtico aquellos
contaminantes que son capaces de modificar el albedo de la nieve al depositarse sobre ella,
como es el caso del material particulado y principalmente el Black Carbon (IPCC 2007).
Una forma de determinar el perfil de concentracin de material particulado y Black Carbon
que existe entre la zona poblada ms cercana (Punta Arenas, Chile) y el continente antrtico
es monitorear estos contaminantes en dicho trayecto ocenico, por lo tanto se realiz una
campaa de monitoreo sin precedentes en el marco de la Expedicin Cientfica Antrtica
(ECA 51) organizada por el Instituto Antrtico Chileno (INACH) durante Enero de 2015, en
donde se midi en forma continua la concentracin de de estos contaminantes en la travesa
ocenica entre Punta Arenas y la pennsula Antrtica norte (Base OHiggins).

Materiales y Mtodos
Se logr efectuar un monitoreo indito de material particulado (MP) (concentracin y
distribucin por tamaos) adems de concentracin de Black Carbon en el trayecto entre P.
Arenas y Base OHiggins. El trayecto considerado en las mediciones se dividi en 4
secciones (figura 1) que corresponden a: Trayecto 1: Punta Arenas hasta el inicio del Paso
Drake a travs de los canales australes; Trayecto 2: Paso Drake; Trayecto 3: Archipilago
Fildes; Trayecto 4: Archipilago Fildes hasta Base OHiggins.

173 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 1. Trayecto de monitoreo y sus sub-divisiones. Figure 1. Monitoring trajectory and sub-divisions.

Para llevar a cabo las mediciones se instalaron los siguientes equipos de monitoreo a bordo
del buque AP41-Aquiles de la Armada de Chile: Espectrmetro Lser de Aerosoles Grimm
EDM 107 para la medicin cada 1 minuto de la concentracin de material particulado PM10,
PM2,5 y PM1, adems de su distribucin por tamaos en 31 canales entre 0,27 y 34 m;
Microetalmetro Aethlabs AE51 para la medicin cada 1 minuto de la concentracin de
Black Carbon y Estacin Meteorolgica HOBO para la medicin de T, Presin baromtrica,
%HR, direccin y velocidad de viento. Los equipos de monitoreo fueron instalados en el
sector del plpito, sobre el puente de mando del buque, hacia la proa respecto del escape de
emisiones del motor (Figura 2). Dada la ubicacin de los equipos de monitoreo y para evitar
contaminacin producto de las emisiones propias del buque (disel), se descartaron todos los
datos en los cuales la direccin de viento registrada por la estacin meteorolgica fuera de
popa a proa, es decir, aquellos que pudieran haber sido alterados por las emisiones de la
chimenea; los cuales representan un 13% del total de la data obtenida.

Resultados y Discusiones
La concentracin de material particulado (MP) y de Black Carbon (BC) obtenidos en la
travesa Punta Arenas - Antrtica se pueden observar en la Figura 2.

Figura 2. Concentracin de MP y BC en trayecto P. Arenas Base OHiggins. Figure 2. PM and BC


concentration in P. Arenas Base OHiggins journey.

174 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Se realizaron anlisis estadsticos de rangos mltiples y de Kruskal Wallis para establecer si


existe diferencia estadsticamente significativa (95% de probabilidad) entre las
concentraciones de contaminantes medidos en los distintos trayectos de la travesa (figura 3),
los resultados muestran que existen diferencias estadsticamente significativas PM10 en el
siguiente orden de mayor a menor concentracin: Archipilago Fildes (T3), seguido del Paso
Drake (T2), los canales australes (T1), y finalmente el trayecto Fildes - Base OHiggins (T4).
Para PM2, 5 y PM1 las mayores concentraciones fueron observadas en los trayectos T2 y T3
(entre ellos no existen diferencias estadsticamente significativas), seguido del trayecto T1
cuya concentracin es significativamente distinta y menor, y finalmente las menores
concentraciones fueron observadas en el trayecto T4.

Figura 3. Anlisis estadsticos de rangos mltiples y de Kruskal Wallis para datos de material particulado.
Figure 3. Kruskal Wallis a multiple range statistical tets results for PM

La mayor concentracin de MP observada en el archipilago Fildes puede deberse a que en


este sector se realizaron gran cantidad de maniobras de carga y descarga del buque para as
abastecer a las bases del sector, esto implic alta cantidad de movimiento de embarcaciones
menores alrededor del buque el cual permaneci detenido por largos periodos de tiempo.
Durante el trayecto por el Paso Drake, tambin se observaron concentraciones importantes
de MP presumiblemente debido a un importante aporte de aerosoles marinos producidos por
la gran cantidad de rompientes de olas de este sector. Por ltimo el trayecto 4 result ser el
que present menores concentraciones de MP debido a ser el ms alejado de cualquier fuente
de emisin y no presentar condiciones de mar agitado como en el Paso Drake.
Respecto de la concentracin de BC, sta present sus mayores valores (estadsticamente
significativos, 95% probabilidad) en el trayecto T1 seguido en orden decreciente y distintos
significativamente por el trayecto T3, trayecto T2 y finalmente el trayecto T4 (figura 4).

175 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 4. Anlisis estadsticos de rangos mltiples y de Kruskal Wallis para datos de Black Carbon. Figure
4. Statistical analysis of multiple ranges and Kruskal Wallis for Black Carbon data

BC est ms asociado exclusivamente a fuentes de combustin, por lo tanto que haya


presentado los mayores valores en el trayecto T1 es coincidente con la mayor cercana a
ciudades y fuentes de combustin de biomasa, cercanas al continente durante el paso por los
canales australes. En segundo lugar aparece el trayecto T3 en donde los niveles de BC
estaran asociados a las faenas de carga y descarga del buque Aquiles explicadas
anteriormente. Por ultimo las menores concentraciones de BC fueron observadas en los
trayectos T2 y T4 (sin diferencia estadsticamente significativa entre ello), ambos sitios
correspondientes a mar abierto, alejados de fuentes de emisin de BC.

Agradecimientos
Los autores agradecen al proyecto INACH RT_18-12 por el apoyo financiero y logstico y al
Ejrcito de Chile, Armada de Chile y Fuerza Area de Chile por su colaboracin

Referencias
Khairy. M., Luek. J., Dickhut. R., Lohmann. R. Levels, sources and chemical fate of persistent organic
pollutants in the atmosphere and snow along the western Antarctic Peninsula. 2016. Environmental Pollution,
216: 304-313.
Lee. W. y Liuo. K. 2012. Effect of absorbing aerosols on snow albedo reduction in the Sierra Nevada.
Atmospheric Environment, 55: 425-430.
Intergovernmental Panel on Climate Change (IPCC) 2007. Climate Change 2007: The Physical Science Basis.
Cambridge University Press: 996.

176 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

CARACTERIZACIN DE AEROSOLES ATMOSFRICOS EN LA PENNSULA


ANTRTICA CHILENA
(Atmospheric aerosol characterization in chilean Antarctic Peninsula)

Cereceda-Balic, F.1,2, Funes, M.1, Fadic, X.1, Vidal, V.1,2


1
Centro de Tecnologas Ambientales (CETAM). 2Departamento de Qumica, Universidad Tcnica Federico
Santa Mara, Av. Espaa 1680, Valparaso, Chile. francisco.cereceda@usm.cl.

La importancia de los aerosoles en el fenmeno del cambio climtico global an est lejos
de entenderse completamente. En este sentido, la crisfera juega un importante rol en el
balance energtico del planeta ya que un pequeo descenso del albedo de la nieve puede
incrementar significativamente la cantidad de radiacin solar absorbida por la superficie1.
Esta retroalimentacin del albedo de nieve ha sido considerada la amplificacin positiva ms
significativa del aumento de la temperatura superficial global2. Hay algunas propiedades
fsicas de la nieve que pueden modificar su albedo, como la temperatura de la superficie de
nivosa, tamao de grano, densidad, profundidad de nieve, ngulo zenital solar, etc. siendo la
temperatura la ms importante para la estabilidad del albedo de la nieve3. Un aspecto poco
conocido en la disminucin del albedo de la crisfera es el papel de las partculas
atmosfricas (MP) capaces de absorber radiacin solar como por ejemplo Black Carbon (BC)
y polvo natural o antropognico. Black Carbon es un fuerte absorbente de radiacin solar en
su espectro visible e infra rojo (IR) con una eficiencia entre 50 y 200 veces mayor que el
polvo3, Tanto MP como BC poseen grandes fuentes de emisin tanto naturales como
atropognicas y poseen gran estabilidad en la atmsfera permitindoles ser trasladados a
grandes distancias pudiendo llegar a sitios remotos como por ejemplo la Antrtica.
Esta investigacin tiene como objetivo mejorar la comprensin de los fenmenos asociados
con la deposicin de aerosoles en la nieve de la Antrtica y su impacto sobre el cambio
climtico global. Durante la Expedicin Cientfica Antrtica (ECA 51), se midi albedo, BC,
concentracin de partculas PM10, PM2.5, PM1.0 y su distribucin por tamao entre 0,25 a
34 m en 31 canales diferentes, as como parmetros meteorolgicos, en el norte de la
Pennsula Antrtica Chilena durante una semana en la meseta de Infantera, 6 Km al Sur-Este
de la Base OHiggins en un sector conocido como glaciar La Paloma (LP, 6321'20'' S,
5748'21'' W, 409 msnm). Adicionalmente, se tomaron muestras de nieve superficial y
profunda (snow pit) para realizar especiacin qumica tanto orgnica as como inorgnica,
con el fin de intentar establecer el origen de los aerosoles depositados sobre la nieve antrtica.

Materiales y Mtodos
Durante enero del ao 2015, ECA 51, organizada por el Instituto Antrtico Chileno
(INACH), se realiz una campaa de monitoreo en el sector La Paloma donde se determin
la concentracin y distribucin por tamaos en tiempo real de material particulado utilizando
un espectrmetro laser de aerosoles Grimm EDM 107, Alemania. Tambin se realizaron
mediciones en tiempo real de concentracin de Black Carbon atmosfrico utilizando un
aethalometro porttil AE51 Aethlabs, EE.UU. Por ltimo, la medicin de Albedo se realiz
utilizando un radimetro neto CNR4, Kipp & Zonen, Holanda. Conjuntamente con los
equipos de medicin se instal una estacin meteorolgica porttil (HOBO, Onset, EE.UU.)
para medicin de temperatura, %HR, presin atmosfrica, direccin y velocidad de viento.

177 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Adicionalmente a las mediciones en tiempo real, se tomaron muestras de nieve superficial y


profunda con fines de especiacin qumica orgnica de Hidrocarburos Aromticos
Policclicos. Para la toma de muestras de nieve superficial se seleccion un rea de alrededor
de 1 km2, en donde se ubicaron los sitios de muestreo con una separacin de alrededor de
200 m entre ellos, en cada sitio seleccionado se demarc un rea de 1m2, donde la nieve fue
removida y homogenizada hasta una profundidad de 5 cm utilizando palas de material
plstico previamente lavadas. Una vez homogenizada se tomaron las muestras utilizando las
mismas palas y depositndolas en bolsas de polietileno estriles (Nasco, WhirlPak, EE.UU.),
finalmente las muestras fueron depositadas debidamente rotuladas en contenedores del tipo
Termo Box para posteriormente ser trasladadas congeladas hasta Valparaso para su anlisis
en el CETAM. Las muestras de nieve profunda se tomaron cavando un pozo de nieve
(calicata) contiguo a cada sitio de toma de muestras de nieve superficial, el rea de cada
calicata fue de aproximadamente 4 m2 para as poder trabajar con comodidad en su interior,
y la profundidad de las calicatas fue de alrededor de 3 m, las calicatas se cavaron utilizando
palas metlicas, posteriormente la pared de muestreo fue raspada utilizando palas de
policarbonato previamente lavadas. Desde la calicata se tomaron muestras de nieve cada 50
cm utilizando palas plsticas previamente lavadas, depositndolas en bolsas de polietileno
estriles WhirlPak, para posteriormente ser almacenadas debidamente rotuladas en
contenedores del tipo Termo Box para finalmente ser trasladadas congeladas hasta
Valparaso para su anlisis en el CETAM. El anlisis de HAPs se realiz mediante HPLC-
FLD.

Resultados y Discusiones
La temperatura ambiente medida en el sector La Paloma present un valor promedio de
-0,15C durante el perodo de monitoreo (enero, 2015). La mxima temperatura registrada
alcanz 5.1 C y la mnima de -4,5 C, registrndose una amplitud mxima en el perodo de
9,6 C. Por otro lado, la Humedad Relativa present un promedio de 97,3%, con una mnima
de 63,2% y una mxima de 100,0%, cabe destacar que a partir del da 27 de enero la humedad
ambiente fue de 100%, hecho altamente perjudicial para los equipos de medicin que al
condensar humedad en su superficie, sumado a las bajas temperaturas provoca su
congelamiento.
Se logr realizar la medicin de concentracin y distribucin por tamaos de material
particulado (PM) en el glaciar La Paloma durante la realizacin de la ECA 51, para energizar
los equipos de monitoreo se instal y utiliz con xito un sistema de energa fotovoltaica,
adems se realiz la aproximacin final al sitio de monitoreo a pie, dejando las motos de
nieve estacionadas aproximadamente a 500 m al Este del lugar de medicin para as evitar
cualquier tipo de contaminacin en las muestras recolectadas. La concentracin de material
particulado (PM10, PM2,5 y PM1) es menor a 2 gm-3 durante casi todo el perodo de
muestreo a excepcin de los das 28 y 31 de Enero, das en que no se acudi al lugar de
muestreo y la concentracin de material particulado alcanz valores de 6 y 19 gm-3
respectivamente, esto sumado a que la Base OHiggins no se encuentra en la direccin del
viento predominante de la zona, y a la ausencia de otras fuentes de material particulado fino
en la zona, se puede inferir que las alzas en concentracin de material particulado observadas
los das 28 y 31 de Enero podran atribuirse a transporte de contaminantes desde otras
latitudes.
La concentracin promedio de BC observada (ECA 51) fu de 36 56 ngm-3, esta
concentracin es 3 veces menor a la observada en la estacin McMurdo (105 ngm-3) tambin

178 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ubicada en la zona costera4 antrtica y es 9 veces menor a la observada en un sitio considerado


como prstino como los Himalayas (320469 ngm-3)5. Sin embargo, a pesar de su baja
concentracin, la presencia de BC en un sitio prstino como La Paloma indica transporte de
contaminantes desde latitudes remotas.
En la figura 1, presenta la variacin de la radiacin de longitud de onda corta incidente y
reflejado, as mismo el albedo calculado, durante el periodo comprendido entre el da 29 de
enero y 1 de febrero del 2015. El promedio de la radiacin incidente de onda corta fue de
261,4 wm2 y el promedio de la radiacin reflejada fue de 207,3 wm2. El promedio de albedo
diurno para la radiacin de onda corta fue entonces de 0,82. La literatura indica que el valor
de albedo en nieve fresca y limpia est entre 0,8-0,9, mientras que en hielo con presencia de
sustancias exgenas (contaminantes o impurezas) es 0,36. Por lo tanto dado el valor de albedo
medido en La Paloma, podra inferirse que la deposicin de aerosoles como por ejemplo BC
sobre la nieve del sector estudiado no estara afectando al balance radiativo en esta zona de
la pennsula antrtica, debido a las bajas concentraciones actuales de BC medidas en esta
zona de la Antrtica, sin embargo existe la presencia de aerosoles capaces de absorber
radiacin solar cuyo efecto acumulativo est todava por descubrirse.

Figura 1: Radiacin de onda corta incidente (RadSoSWin), radiacin de onda corta reflejada (RadSoSWre) y
albedo medido desde el 29 de enero al 01 de febrero de 2015. Figure 1. Short-wave incident radiation
(RadSoSWin), reflected short-wave radiation (RadSoSWre) and albedo measured from 29 January to 1
February 2015.

Se realiz el anlisis de concentracin de 16 EPA HAPs en nieve superficial y profunda


obtenida en el sector La Paloma (ECA 51), a partir de los resultados obtenidos se calcularon
cocientes de concentracin para poder asignar fuentes. El clculo del cociente de
concentracin IP/(IP + BghiP) para muestras de nieve profunda en el sector La Paloma arroj
valores entre 0,3 y 0,7, rango que contiene al valor de referencia 0,6 que indica fuentes de
quema de lea, ya que no existen fuentes cercanas de quema de lea es posible suponer que
la contaminacin por HAPs observada en nieve profunda en el sector La Paloma podra
corresponder a transporte a largas distancias de aerosoles generados por este tipo de fuentes,
los cuales se depositaran en la nieve por deposicin seca (partculas-BC-BrC) y/o hmedas
(nieve).

Agradecimientos
Los autores agradecen al proyecto INACH RT_18-12 por el apoyo financiero y logstico y al
Ejrcito de Chile, Armada de Chile y Fuerza Area de Chile por su colaboracin.

Referencias

179 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Lee, W. y Liuo, K. 2012. Effect of absorbing aerosols on snow albedo reduction in the Sierra Nevada.
Atmospheric Environment, 55: 425-430.
Intergovernmental Panel on Climate Change. 2007. Climate Change 2007: The Physical Science Basis.
Cambridge University Press: 996.
Ming, J., Wang, P., Zhao, S., y Chen, P. 2013. Disturbance of light-absorbing aerosols on the albedo in a winter
snowpack of Central Tibet. Journal of Environmental Sciences, 25(8): 1601-1607.
Hansen, A., Lowenthal, D., Chow, J., y Watson, J. 2001. Black Carbon Aerosol at McMurdo Station, Antarctica.
Journal of the Air & Waste Management Association, 51(4): 593-600.
Marinoni, A., Cristofanelli, P., Laj, P., Duchi, R., Calzolari, F., Decesari, S., Sellegri, K., Vuillermoz, E., Verza,
G., Villani, P., y Bonasoni, P. 2010. Aerosol mass and black carbon concentrations, a two year record at NCO-
P (5079 m, Southern Himalayas). Atmospheric Chemistry and Physics, 10: 8551-8562.
Lliboutry. 1956. Nieves y glaciares de Chile. Fundamentos de Glaciologa. Ediciones de la Universidad de
Chile: 471.

180 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

DIFUSIVIDAD TRMICA APARENTE DEL SUELO EN LA PENNSULA


KELLER, ISLA REI GEORGE, ANTRTICA MARTIMA
(Apparent thermal diffusivity of soils in the Keller Peninsula, King George Island,
Maritime Antarctica)

Chaves, D.A.1, Lyra, G. B.2, Francelino, M. R.3; Silva, L.D.B. 2; Schaefer, C.E.R.G.3
1
Inst. Federal do Rio de Janeiro, Campus Pinheiral, CEP 27197-000 Pinheiral RJ. 2 Universidade Federal
Rural do Rio de Janeiro (UFRRJ). BR 465, Km 7, Campus Universitrio - Zona Rural, Seropdica - RJ,
23851-970. 3 Departamento de Solos, Universidade Federal de Viosa (UFV).

Diversos fatores influenciam os processos de transferncia de calor na camada ativa do solo


e as propriedades trmicas do solo, tais como a temperatura e umidade do solo, a textura
(granulometria), alm da cobertura de neve e vegetao, as quais funcionam como isolantes,
que depende da estrutura, densidade e espessura dessas coberturas no solo, ou como tampo,
que a resistncia a variaes de temperatura. Contudo, os processos de transferncia de
energia entre o solo e o ar so mais efetivos em ambientes com ausncia tanto da neve como
da vegetao (Salamene, 2013).
Para estimar a difusividade trmica de sries temporais de temperatura do solo, vrios
modelos tm sido desenvolvidos, contudo nenhum deles considera as variveis de umidade
do solo, visto que um solo orgnico ou mineral possui composio qumica e teores de
umidades diferentes, o que leva a uma alterao no regime trmico. Sabe-se ainda que a
quantidade de solutos (molculas ou ons) dispersos na soluo pode diminuir o ponto de
congelamento de um lquido no-voltil (Crioscopia). Contudo em ambientes periglaciais
fundamental a anlise da temperatura considerando a umidade do solo, visto que nesse
ambiente, parte da gua do solo se solidifica sazonalmente (Almeida et al., 2014; Michel et
al., 2014).
Dessa forma, o objetivo deste trabalho foi analisar o fluxo de energia no perfil do solo,
compreendido atravs do estudo da difusividade trmica aparente do solo (DTA). Visa
compreender influncia da umidade do solo sob a DTA, visto que a maior quantidade de gua
lquida no solo pode acelerar o aquecimento do solo, o que resulta em alta condutividade
trmica e reduzidos valores da DTA.

Material e Mtodos
Foram instalados quatro stios de monitoramento de temperatura e umidade do solo na
Pennsula Keller, localizada na Ilha Rei George, no Arquiplago das Shetlands do Sul. Os
mesmos foram nomeados conformes marcos geogrficos locais: Ipanema (620509,00S,
582448,97W; 96m), Refgio II (620421,33S, 582458,11W; 70 m), Punta Plaza
(62 05 19,14S, 582423,98W; 65m) e Solo com Padro (620520,08S,
582430,31W; 93m). Os sensores de temperatura do solo (modelo L107E da Campbell
Scientific Inc,) foram instalados verticalmente com profundidades de 5, 10, 30, 50 e 100 cm
ao longo do perfil de solo. Os sensores de umidade do solo (modelo CS616-L, Campbell
Scientific Inc.) foram instalados a 10, 30, 50 e 100 cm de profundidade para determinar o
contedo volumtrico de gua ao longo do perfil. Todos os sensores foram conectados a um
sistema de aquisio e armazenamento automtico de dados (datalogger CR 1000 Campbell
Scientific Inc, Utah, USA), com fornecimento de energia por bateria blindada de alta

181 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

resistncia. O sistema foi programado para armazenar os dados de temperatura e umidade do


solo a cada hora. O sensor de temperatura do ar foi instalado a 1 m acima da superfcie do
solo, sendo constitudo de um sistema termistor protegido contra radiao, ventilado e com
acurcia de 0,1 C. Os sistemas de aquisio e armazenamento de temperatura e umidade
do solo foram acondicionados em compartimentos de 120 L de PVC de alta densidade, as
quais estavam parcialmente enterradas.
A difusividade trmica aparente do solo (DTA) foi estimada para as diferentes estaes do
ano, atravs da equao (Eq.1) de McGaw et al. (1978):

= / 2 +
2
Eq. (1)
em que:
DTA = difusividade trmica aparente do solo (m2 s-1); Z = incremento da profundidade (m);
T = incremento do tempo (s); T = Temperatura; i = Posio de profundidade; e j = posio
de tempo.
Para todos os stios a difusividade trmica aparente (DTA) do solo foi estimada utilizando as
temperaturas nas profundidades intermedirias e calculada de hora em hora. No software Past
1.34 foram realizados o teste de regresso linear mltipla, que foi usado para verificar se a
umidade est correlacionada aos valores da difusividade. Os valores da varivel dependente
(DTA) foram gerados em leituras horrias, posteriormente foi realizada a mdia mensal
considerando todos os anos e comparados, tambm pelas mdias mensais de todos os anos,
com as variveis independentes (umidade do solo nas diferentes profundidades).
O ndice N-fator foi analisado para avaliar a influncia da espessura da neve na difusividade
trmica aparente do solo (DTA). O ndice N-fator relaciona a temperatura do ar com a
temperatura do solo, empregando os valores de graus dias de congelamento do solo. Para
estimar o ndice N-fator (n-F) foi relacionado os graus dias de congelamento da temperatura
do ar (FDDa) com os graus dias de congelamento da temperatura do solo a 5 cm (FDD),
calculado pela Eq. 2:
n-F = FDD/FDDa
Eq. (2)
A temperatura 5 cm foi escolhida por estar mais prxima a superfce o que permite ter
maior relao com a cobertura de neve no solo; ressalta-se que nenhuma medio direta da
espessura da neve foi feito in loco.

Resultados e Discusso
Para o clculo da mdia sazonal da difusividade trmica aparente observou-se que quando a
variao da mdia da temperatura do solo se aproximava de 0,03 C a difusividade estimada
pela eq. 1 apresentava valores at trs ordens de grandeza maiores que nas outras condies
trmicas. Quando os valores das temperaturas nas diferentes profundidades do solo
consideradas na determinao da difusividade esto prximos ou na isotermia, o
denominador da eq. 1 se aproximava de zero e com isso a difusividade tende a infinito. Com
base nessa restrio e na preciso dos sensores optou-se por desconsiderar os valores da
variao da temperatura entre -0,04 C e +0,04 C.
A DTA variou sazonalmente, o que indicou que o teor de gua no solo pode aumentar o fluxo
de energia atravs de percolao, mas tambm pode absorver e emitir energia nos processos
de congelamento e descongelamento. De maneira geral, os valores da difusividade

182 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

apresentaram tendncia negativa a DTA10 e positiva a DTA30 e DTA50 no inverno em quase


todos os stios. Apesar das precipitaes na forma lquida serem mais frequentes no vero,
associado com temperaturas do ar acima de 0 C, essas precipitaes tambm ocorrem no
inverno, porm em menor porcentagem de ocorrncia com 26% das precipitaes lquidas
no inverno e 59,1% no vero. Foi observado que os valores de difusividade tiveram menor
variabilidade em condies mais frias, essencialmente a camadas mais profundas.
Quando o solo apresenta baixa difusividade significa que esse material tem baixa capacidade
de conduzir energia e alta capacidade de armazen-la e vice-versa. Entre os stios, Refgio
II e Ipanema foram os que apresentaram com maior frequncia, menores e maiores valores
de DTA (prximo superfcie), respectivamente. Isso permitiu inferir que o stio mais
sensvel mudana de temperatura foi Refgio II, ou seja, leva mais tempo para atingir uma
nova condio de equilbrio e Ipanema foi o stio que responde mais rapidamente s
mudanas de temperatura.
No incio do descongelamento do solo (primavera-vero), com a umidade mais alta, a DTA
apresentou maiores valores, isso porque a gua preenche os espaos vazios e proporciona
maior contato entre as partculas do solo, o que acarreta no aumento da propagao de calor
e consequentemente na difusividade trmica. Os valores do ndice N-fator tambm so
influenciados pela profundidade e pelas propriedades trmicas do solo, assim como os
processos dominantes da camada ativa esto relacionados com as fases de congelamento e
descongelamento do solo (Riseborough, 2003). Dessa forma relacionou-se o ndice N-fator
de congelamento com a DTA para avaliar a influncia da espessura da neve sobre a superfcie
do solo. Para melhor visualizar os resultados foi feito a soma acumulada dos dados de DTA
e do N-fator.
O N-fator mostrou que a espessura da neve resfria o solo mais rapidamente prximo a
superfcie, e assim mantm os valores da DTA (prximo superfcie) menores do que nas
demais profundidades. Contudo, quando a cobertura da neve relativamente fina e com alto
albedo, a superfcie do solo torna-se mais fria. Quando a espessura da neve aumenta (maior
que 40 cm), o efeito isolante da cobertura de neve aumenta e resulta num aquecimento da
superfcie do solo. Se a neve for espessa, esta pode durar at o final da primavera ou no vero
o que resulta em resfriamento do solo em profundidade. Isso ocorre porque h bloqueio da
frente de congelamento, o que retarda o fluxo de calor em profundidade e tambm menor
absoro de energia solar com consequentemente diminuio da temperatura do solo em
superfcie.

Concluses
O modelo da difusividade trmica aparente do solo (DTA) apresenta boa relao para inferir
em dados da difusividade. Contudo, h a necessidade de desconsiderar os valores da variao
da mdia da temperatura do solo que se aproximam de 0,03 C. Isso acontece devido
tendncia do modelo ao se aproximar da isotermia (variao da temperatura do solo com a
profundidade igual zero) a difusividade tender ao infinito. Os stios apresentam tendncia
negativa a DTA10 e positiva a DTA30 e 50, no inverno, em todos os stios. No vero os valores
apresentaram tendncia positiva em quase todos os stios, com valores mais elevados de
DTA. Isso permite inferir que no inverno pode ter ocorrido precipitao na forma lquida na
maioria dos stios. A difusividade aumentou com a diminuio da profundidade do solo. A
umidade do solo influencia na DTA no stio Ipanema e Punta Plaza com mais de 70,0 e 63,0
% de probabilidade, respectivamente. Nos demais stios, Refgio II e Solo com Padro, a
umidade pode influenciar na DTA (p>0,05), contudo o coeficiente de determinao (r2) no

183 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

explicou a maior parte da variabilidade dos valores observados. Os ndices N_fator variam
entre anos e entre sitios e a relao entre o N_fator de congelamento acumulado e a DTA
acumulada foi inversamente proporcional quando comparada com a difusividade acumulada
calculada prxima a superfcie (DTA10), porm quando se compara o N_fator com a DTA
em profundidade, essa relao se aproxima.

Agradecimentos
Ao Programa Antrtico Brasileiro (PROANTAR), ao CNPq pelo financiamento do projeto.
Marinha Brasileira pelo apoio logstico aos trabalhos de campo.

Referncias
Almeida, I.C.C., Schaefer, C.E.G.R., Fernandes, R.B.A., Pereira, T.T.C., Nieuwendam, A., Pereira, A.B., 2014.
Active layer thermal regime at different vegetation covers at Lions Rump, King George Island, Maritime
Antarctica: In Permafrost and periglacial research in Antarctica: New results and perspectives, Geomorphology
11-15, 225:36-46.
Mcgaw, R.W., Outcalt, S. I., Ng, E. 1978. Thermal properties and regime of wet tundra soils at Barrow, Alaska,
in: Third International Conference on Permafrost, National Research Council of Canada, Ottawa, Canada, 47
53.
Michel, R.F.M., Schaefer, C.E.G.R., Simas, F.M.B., Francelino, M.R., Fernandes-Filho, E.I., Lyra, G.B.,
Bockheim, J.G. 2014. Active-layer thermal monitoring on the Fildes Peninsula, King George Island, maritime
Antarctica. Solid Earth Discuss. 6, 126.
Riseborough, D., 2003. Thawing and freezing indices in the active layer. First results from 2000 to 2001. In:
Phillips, M., Springman, S.M., Arenson, L. (Eds.), Proceedings of the 8th International Conference on
Permafrost. Balkema, Lisse, Zurich, pp. 953958.
Salamene, S., 2013. Regime trmico da camada ativa na Pennsula Keller, Ilha Rei George, Antrtica (2008-
2011): contribuio ao monitoramento de ambientes periglaciais. Tese (Doutorado em Cincias Ambientais e
Florestais). UFRJ. Seropdica. 77p.

184 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ACTIVE LAYER AND PERMAFROST THERMAL REGIME IN A PATTERNED


GROUND SOIL IN MARITIME ANTARCTICA, AND RELATIONSHIP WITH
CLIMATE VARIABILITY MODELS
(Rgimen trmico de la capa activa y del permafrost en un suelo modelado en la Antrtida
martima y relacin con los modelos de variabilidad climtica)

Chaves D.A.a, Lyra G.B. b, Francelino M.R. c, Silva L.D.B. d, Thomazini A.c, Schaefer
C.E.G.R. c
a
Instituto Federal do Rio de Janeiro, Campus Pinheiral, 27197-000 Pinheiral, Rio de Janeiro, Brazil, email:
daniela.chaves@ifrj.edu.br. b Departamento de Cincias Ambientais, Instituto de Florestas, Universidade
Federal Rural do Rio de Janeiro, 23851-970 Seropdica, Rio de Janeiro, Brazil, email: gblyra@gmail.com.
c
Departamento de Solos, Universidade Federal de Viosa, 36570-000 Viosa, Minas Gerais, Brazil, email:
marcio.francelino@gmail.com; andre.thz@gmail.com; carlos.schaefer@ufv.br. d Departamento de
Engenharia, Universidade Federal Rural do Rio de Janeiro, 23851-970 Seropdica, Rio de Janeiro, Brazil,
email: irriga@ufrrj.br

Permafrost and active layer studies are important to understand and predict regional climate
changes. The objectives of this work were: i) to characterize the soil thermal regime and its
interannual variability and in a patterned ground soil in Maritime Antarctica. The study was
carried out at Keller Peninsula, King George Island, Maritime Antarctica. Six soil
temperatures probes were installed at different depths (10, 30 and 80 cm) in the polygon
center (Tc) and border (Tb) of a patterned ground soil. We applied cross-correlation analysis
and standardized series were related to the Antarctic Oscillation Index (AAO). The estimated
active layer thickness was approximately 0.75 cm in the polygon border and 0.64 cm in the
center, indicating the presence of permafrost (within 80 cm). Results indicate that summer
and winter temperatures are becoming colder and warmer, respectively. Considering similar
active layer thickness, the polygon border presented greater thawing days, resulting in greater
vulnerability to warming, cooling faster than the center, due to its lower volumetric heat
capacity (Cs). The influence of southern winds from high latitudes, in the south facing slopes,
favored freeze in the upper soil layers, and also contributed to keep permafrost closer to the
surface. The observed cooling trend is linked to the regional cli- mate variability modes
influenced by atmospheric circulation.

Introduction
The cryosphere is one of the most sensitive components of the Earth system to climate change
and variability (Turner et al., 2016). In the last decades, the rate of regional warming has
varied considerably, profoundly modifying many ecosystem processes, especially in polar
regions (Turner et al., 2016). Hence, understanding climate-induced changes are essential for
observational studies and numerical modeling related to climate change variability (Michel
et al.,2012; IPCC, 2014). In this context, permafrost represents an important terrestrial
component due to the large energy and mass transfer capacity between this layer and the
Earth surface. Also, permafrost are known to be extremely sensitive to climate warming, with
great implications on local and global ecosystem dynamics (Michel et al., 2012). Hence,
changes in the permafrost will results in many changes in the Earth System. In the last years,
permafrost warming and increasing active layer thickness has been observed worldwide
(Pogliotti et al., 2015). However, recent studies reported reduction of active layer thickness,

185 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

resulting in higher permafrost table in volcanic soils from Maritime Antarctica (De Pablo et
al., 2017), but none monitoring of patterned ground is yet available. Maritime Antarctica is
recognized as a key region for monitoring climate changes, in which soil thermal regime
(active layer and permafrost dynamics) can be used as a climate change indicator (Almeida
et al., 2017). The objectives of this work were: i) to characterize the soil thermal regime
(active layer thickness and permafrost formation) and its interannual variability and ii) to
evaluate the influence of different climate variability modes to the observed soil thermal
regime in a patterned ground soil in Maritime Antarctica.

Material and methods


The study was carried out at a patterned ground are in Keller Peninsula, located at King
George Island, part of South Shetlands. In the patterned ground area, vegetation cover is
scarce, occurring a few crustose lichens and cyanobacteria. Also, due the strong process of
soil cryoturbation, the polygon border presents higher amounts of rock fragments with
different sizes, while the polygon center is mainly composed by fine sediments. Soil
temperature probes were placed at 10, 30 and 80 cm depth in the polygon center (Tc) and
border (Tb), in one of the polygons. All probes were connected to a Campbell Scientific
CR1000 data logger, recording data at hourly intervals from January 2011 to December 2014.
Soil temperature temporal data were analyzed by hourly means for all studied depths in the
polygon center and border. The following parameters were calculated: freezing days; thawing
days; number of freezethaw days; number of isothermal days; freezing and thawing degree
days (Guglielmin et al., 2008). The depth of the active layer and the top of permafrost was
estimated by a simple linear regression analysis be- tween the mean annual soil temperature
at different depths, as well as the annual maximum and minimum soil temperatures.
Subsequently, cross-correlation analysis was applied in the standardized air temperature
series, related to the AAO, also known as SAM, as well as to the Southern Oscillation Index
(SOI), in order to represent the variability associated with the El Nio Southern Oscillation
(ENSO) phenomena.

Results and discussion


Differences below to 0.2 C were recorded between subsequent soil layers (1030 and 30
80 cm), and up to 0.3 C between the most distant soil layers (10 and 80 cm), with little
differences between the polygon center and border. Soil temperatures were higher in the
polygon border compared to the polygon center in the summer period at 10 and 30 cm depth,
with little differences in the winter (Table 1, Fig 2 and 3). Overall, monthly air and soil
temperatures showed a negative linear tendency from December 2011 to December 2014,
but not statistically significant (F-test; p < 0.05) (Fig. 2). Statistical significant (p b 0.05)
delay of 1 and 5 days between the atmosphere and soil thermal response occurred, indicated
by the negative lag.
Overall, thawing days tended to decrease with depth in both locations, and no thawing
condition occurred at 80 cm depth during the studied period. Considering similar active layer
thickness, the polygon border presented higher thawing days. Elevated freezing conditions
were observed to occur from May to November 2012 in the polygon border at 10 cm depth
(7 months) and from May 2012 to January 2013 in the border at 80 cm depth (11 months).
An increase of the freezing days were observed to occur from 2011 to 2014 for the 30 and
80 cm depth. Isothermal days tended to decrease with depth, especially in the in the summer
2012, 2013 and 2014. When soil temperature anomalies of ENSO were positive, soil

186 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

temperatures were also positive. Due the strong process of soil cryoturbation, the polygon
border presents higher amounts of rock fragments with different sizes, while the polygon
center is mainly composed by fine sediments. The polygon border presents elevated capacity
to warm and cool faster than the center due to the smaller heat capacity (low volumetric heat
capacity of its minerals), especially at 10 and 30 cm soil depth. The soil water content is able
to buffer sudden temperature changes and to maintain a strong zero curtain effect in the
polygon center.
Keller Peninsula is receiving more cold air due to atmospheric air circulations, favoring
freezing conditions in the region, as observed in this study. With the summer becoming
colder, the observed trend will increase the extent of permafrost in the studied region. Ramos
et al. (2017) also demonstrated a decreasing active layer thickening in Deception Island
(about 1.5 cm year1), from 2006 to 2014, as a result of snow cover duration. In this context,
snow cover, combined with cooler temperatures, will reduce the melting as well as modify
freezing and thawing processes. In this perspective, the current trend can help the
preservation of permafrost in the Maritime Antarctica region, in accordance with the results
observed in this study. Hence, active layer thickening is decreasing and permafrost is
becoming closer to the surface, and forming at mid-slope positions.

Table 1. Mean annual air (Tair) and soil temperature in the polygon center and border at different depths from
2011 to 2014 in Keller Peninsula, Maritime Antarctica. Values in parenthesis represent the standard deviation.
Tabla 1. Aire anual promedio (Tair) y temperatura del suelo en el polgono centro y frontera a diferentes
profundidades de 2011 a 2014 en la Pennsula de Keller, Antrtida Martima. Los valores entre parntesis
representan la desviacin estndar.
--------------------------Soil temperature--------------------------
Year ---Tair--- ----------------Center---------------- ----------------Border----------------
10 cm 30 cm 80 cm 10 cm 30 cm 80 cm
2011 -4.8 ( -2.6 ( -2.5 ( -2.4 ( -2.8 ( -2.7 ( -2.5 (
5.8) 2.2) 2.0) 1.7) 2.4) 2.1) 1.7)
2012 -3.2 ( -2.3 ( -2.3 ( -2.2 ( -2.3 ( -2.3 ( -2.2 (
4.6) 2.5) 2.1) 1.7) 2.8) 2.4) 1.8)
2013 -2.9 ( -1.8 ( -1.8 ( -1.9 ( -1.8 ( -1.8 ( -1.9 (
4.8) 1.7) 1.5) 1.3) 1.9) 1.6) 1.2)
2014 -2.9 ( -1.8 ( -1.8 ( -1.8 ( -1.7 ( -1.8 ( -1.8 (
3.8) 1.4) 1.2) 1.0) 1.5) 1.3) 1.0)
Fig. 2. Active layer thermal regime in the polygon border (a) and center (b), and the box-plot of mean
monthly air temperature from 2011 to 2014. The box represents the 1th and 3th quartile, vertical bars the
maximum and minimum values, and the circumferences the outliers. Fig. 2. Capa activa del rgimen trmico
en el borde del polgono (a) y el centro (b), y el grfico en caja de la temperatura media mensual del aire

desde el 2011 al 2014. El cuadro representa el 1 y el 3 cuartil, valores mnimos, y las circunferencias de
los valores atpicos.

187 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Fig. 3. Box-plot of mean monthly soil temperature from 2011 to 2014 in the polygon border and center. The
box represents the 1th and 3th quartile, vertical bars the maximum and minimum values, and the
circumferences the outliers. Fig. 3. Recuadro de la media de la temperatura mensual del suelo de 2011 a 2014
en el polgono fronterizo y centro. La caja representa el 1 y el 3 cuartil, las barras verticales de los valores
mximo y mnimo, y la circunferencia de los valores atpicos.
Conclusions
In Maritime Antarctica, the summer and winter period are becoming colder and warmer,
respectively, demonstrating a regional trend owing extreme natural internal variability of the
regional atmospheric circulation. This result in permafrost is being formed closer to the soil
surface. Higher amount of rock fragments in the polygon border turns it more sensitive to
energy variation at the surface, resulting in thawing and freezing faster compared with the
center.

References
Almeida, I.C.C., Schaefer, C.E.G.R., Michel, R.F.M., Fernandes, R.B.A., Pereira, T.T.C., Andrade, A.M.,
Francelino, M.R., Fernandes Filho, E.I., Bockheim, J.G., 2017. Long term active layer monitoring at a warm-
based glacier front from Maritime Antarctica. Catena 149, 572581.
De Pablo, M.A., Ramos, M., Molina, A., 2017. Snow cover evolution at the Limnopolar Lake CALM-S site in
Byers Peninsula, Livingstone Island, Antarctica. Catena 149, 538547.
Guglielmin, M., Ellis Evans, C.J., Cannone, N., 2008. Active layer thermal regime under different vegetation
conditions in permafrost areas. A case study at Signy Island (Mari- time Antarctica). Geoderma 144, 7385.
IPCC, 2014. Climate change 2014. In: Team, C.W., Pachauri, R.K., Meyer, L.A. (Eds.), Synthesis Report.
Contribution of Working Groups I, II and III to the Fifth Assessment Re- port of the Intergovernmental Panel
on Climate Change. IPCC, Geneva, Switzerland.
Michel, R.F.M., Schaefer, C.E.G.R., Poelking, E.L., Simas, F.N.B., Fernandes Filho, E.I., Bockheim, J.G.,
2012. Active layer temperature in two Cryosols from King George Is- land, Maritime Antarctica.
Geomorphology 155156, 1219.
Pogliotti, P., Guglielmin, M., Cremonese, E., Morra di Cella, U., Filippa, G., Pellet, C., 2015. Warming
permafrost and active layer variability at Cime Bianche, Western European Alps. Cryosphere 9, 647661.
Ramos, M., Vieira, G., de Pablo, M.A., Molina, A., Abramov, A., Goyanes, G., 2017. Recent shallowing of the
thaw depth at Crater Lake, Deception Island, Antarctica (2006 2014). Catena 149, 519528.
Turner, J., Lu, H., White, I., King, J.C., Phillips, T., Hosking, J.S., Deb, P., 2016. Absence of 21st century
warming on Antarctic Peninsula consistent with natural variability. Nature 535 (7612), 411415.

188 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

MERCURY BIOMAGNIFICATION IN COASTAL AQUATIC FOOD WEBS


FROM PATAGONIA AND ANTARCTIC PENINSULA
(Biomagnificacin de mercurio en tramas trficas costeras de Patagonia y pennsula
Antrtica)

Chiang, G.a, g *, Kidd, K.A.b, Diaz-Jaramillo, M.c, Espejo, W.a, d, Jara, S.d, ODriscoll, N.J.e,
Munkittrick, K.R.b, f.
a
MERI Foundation, 5682 Kennedy Ave, Vitacura-Santiago. Chile. b Department of Biology, Faculty of
Sciences, University of New Brunswick, Saint John NB. Canada. c Instituto de Investigaciones Marinas y
Costeras, Universidad Nacional de Mar del Plata, Mar del Plata. Argentina. d Department of Aquatic Systems,
Faculty of Environmental Sciences, Universidad de Concepcion, Concepcion. Chile. e Department of Earth &
Environmental Sciences, Acadia University, Wolfville NS. Canada. f COSIA, Suite 1700, 520 5th Ave SW
Calgary AB, Canada. *Corresponding author: Gustavo Chiang, gchiang@fundacionmeri.cl

Mercury contamination is a global issue due to it long distance transport and potential for
toxic effects (Mergler et al., 2007). Methylmercury (MeHg) in particular accumulates in
aquatic and terrestrial biota and biomagnifies through the food webs (Atwell et al., 1998;
Campbell et al., 2005; Fitzgerald et al., 2007; Kidd et al., 2012; Lavoie et al., 2013). Aquatic
ecosystems are particularly susceptible to Hg biomagnification (Fitzgerald et al., 2007). In
aquatic ecosystems, Hg(II) and MeHg are accumulated mainly by algae and bacteria,
transferring Hg to zooplankton in the water column and benthic invertebrates in the sediment
and rocky substrates (Atwell et al., 1998; Campbell et al., 2005; Fitzgerald et al., 2007).
Slower excretion of MeHg compared to intake from diet and water/sediment results in
bioaccumulation in the organisms at the base of the food web and biomagnification through
the food web (Fabris et al., 2006; Hammerschmidt and Fitzgerald, 2006; Kidd et al., 2012;
Lavoie et al., 2013). Stable nitrogen isotopes (15N:14N; expressed as 15N) have been used to
characterize trophic relationships in aquatic food webs, where increasing 15N values
typically indicates higher trophic positions within a food web (Cabana and Rasmussen, 1994;
Post, 2002). Since Hg biomagnifies in aquatic food webs and upper-trophic-level organisms
have primarily MeHg as the dominant form of mercury, the simple relationship between
MeHg and 15N values of the organisms within the food web is used to quantify the degree
of biomagnification, using the following equation: log10Hg= a + b15N; where the slope (b)
of this regression (Trophic magnification Slope, TMS) has been used as an indicator of
biomagnification potential of Hg in food webs since the early 1990s (Yoshinaga et al., 1992).
The intention of this study is, by the quantification of MeHg in biota of Patagonia and
Antarctic coastal food webs; (1) To evaluate the existence of mercury and a significant
difference between TMS in Antarctica and Patagonia due to the difference in the
characteristics of the ecosystems and their food web structure. (2) The influence of the
discharge of fresh water either by river (Patagonia) or glacial (Antarctic) in the
biomagnification slope of MeHg. (3) The role of higher vertebrates (fish, marine birds and
marine mammals) in the influence on biomagnification rate.

Results
The results from our study showed in coastal Patagonia, that mercury concentrations differed
considerably among trophic levels and functional groups among the two locations: In the site
closer to the Marchant river mouth (MMR) Fish Hg concentrations were highest, with

189 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

concentrations up to 43.6 times higher than the grazers/filtering macroinvertebrates. Off the
coast at Yalac Island (MYI), differences between trophic levels were not as dramatic, with
the predatory fishes showing the highest Hg concentrations, with mean values that were about
14.6 times higher than those of the macroinvertebrates; however predatory fishes at MYI had
half the mean Hg concentrations of the fish from MMR.
In the food webs of Antarctica, mean Hg concentrations in biota were slightly different
between the Antarctic Peninsula and southern Shetland Islands. At Cape Shirreff (ACS), no
fishes could be collected at this site, but marine bird feathers showed a mean mercury
concentration that was 131.5 times higher than those the present in grazer
macroinvertebrates. Highest Hg concentrations were found in seals of with a mean 345 times
that of the grazers and 2.6 times that of marine birds. At Paradise Bay (APB), benthic grazers
had a mean mercury concentration of 0.016 (mg Kg-1 d.w.), that is almost double the
concentration found in the same functional group at ACS. The notothenid fish collected at
this site showed similar mercury concentrations to the fish collected at the mouth of the
Marchant River (MMR), but were double the mean concentration of the fish found off shore
at MYI. At the same time the mean Hg concentration in these notothenid fish was 21.1 times
higher of the baseline (benthic grazer macroinvertebrates) in Paradise Bay.

Figure 1. Biomagnification slopes for mercury, using data for a) whole foodweb and b) macroinvertebrates
and fish only. (MMR: Melimoyu-Marchant River; MYI: Melimoyu Yalac Island; APB: Antarctica Paradise
Bay; ACS: Antarctica Cape Shirreff). Figura 1. Pistas de biomagnificacin para el mercurio, utilizando datos
para a) toda la red de alimentos y b) macroinvertebrados y peces solamente. (MMR: Ro Melimoyu-Marchant,
MYI: Isla Melimoyu Yalac, APB: Antarctica Paradise Bay, ACS: Antrtida Cabo Shirreff).

Discussion And Conclusions


The data presented in this manuscript showed significant differences between sampling sites
in Patagonia and Antarctica for mercury TMS. These could be explained by ecosystem
characteristics and food web processes that may interact to influence Hg TMS and/or by food
web structure (Atwell et al., 1998; Kidd et al., 2012; Lavoie et al., 2013).
Mercury is being biomagnified in the coastal environments of the southeast Pacific Ocean.
We observed an effect of the food web composition and possible effects of freshwater inputs
on TMS. According to our data we could be observing a biodilution effect on mercury by
marine mammals and birds in Antarctica. Finally, given the importance of mercury as a

190 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

global pollutant and the lack of information regarding its bioaccumulation and
biomagnification on marine coastal environments in southern eastern Pacific Ocean, it is
necessary to identify the possible latitudinal effect we observed on the magnification rates
among trophic levels.

References
Atwell, L., Hobson, K.A., Welch, H.E., 1998. Biomagnification and bioaccumulation of mercury in an arctic
marine food web: Insights from stable nitrogen isotope analysis. Can. J. Fish. Aquat. Sci. 55, 11141121.
doi:10.1139/cjfas-55-5-1114.
Cabana, G., Rasmussen, J.B., 1994. Modelling food chain structure and contaminant bioaccumulation using
stable nitrogen isotopes. Nature 372, 255257.
Campbell, L.M., Norstrom, R.J., Hobson, K.A., Muir, D.C.G., Backus, S., Fisk, A.T., 2005. Mercury and other
trace elements in a pelagic Arctic marine food web. Sci. Total Environ. 351-352, 247263.
Corsolini, S., 2009. Industrial contaminants in Antarctic biota. Journal of Chromatography A 1216: 598612
Fabris, G., Turoczy, N.J., Stagnitti, F., 2006. Trace metal concentrations in edible tissue of snapper, flathead,
lobster, and abalone from coastal waters of Victoria, Australia. Ecotoxicol. Environ. Saf. 63, 286292.
doi:10.1016/j.ecoenv.2004.11.006
Fitzgerald, W.F., Lamborg, C.H., Hammerschmidt, C.R., 2007. Marine biogeochemical cycling of mercury.
Chem. Rev. 107, 641662. doi:10.1021/cr050353m
Kidd, K.A., Muir, D.C.G., Evans, M.S., Wang, X., Whittle, M., Swanson, H.K., Johnston, T., Guildford, S.,
2012. Biomagnification of mercury through lake trout (Salvelinus namaycush) food webs of lakes with different
physical, chemical and biological characteristics. Sci. Total Environ. 438, 135143.
doi:10.1016/j.scitotenv.2012.08.057
Hammerschmidt, C.R., Fitzgerald, W.F., 2006. Methylmercury cycling in sediments on the continental shelf of
southern New England. Geochim. Cosmochim. Acta 70, 918930. doi:10.1016/j.gca.2005.10.020
Lavoie, R.A., Jardine, T.D., Chumchal, M.M., Kidd, K.A., Campbell, L.M., 2013. Biomagnification of
mercury in aquatic food webs: A worldwide meta-analysis. Environ. Sci. Technol. 47, 1338513394.
Post, D.M., 2002. Using stable isotopes to estimate trophic position: Models, methods, and assumptions.
Ecology 83, 703. doi:10.2307/3071875
Yoshinaga, J., Suzuki, T., Hongo, T., Minagawa, M., Ohtsuka, R., Kawabe, T., Inaoka, T., Akimichi, T., 1992.
Mercury concentration correlates with the nitrogen stable isotope ratio in the animal food of Papuans.
Ecotoxicol. Environ. Saf. 24, 3745. doi:10.1016/0147-6513(92)90033-Y

191 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

BACTERIAS PIGMENTADAS AISLADAS DE LA PENNSULA FILDES,


NTRTICA, SOBREVIVEN A RADIACIN UV-B.
(Isolated pigmented bacteria of the Peninsula Fildes, Antarctica, survive to UV-B radiation)

Cid, N.1, Gonzlez-Rocha, G.1, Domnguez, M.1, Vergara, L.2, Bello-Toledo, H.1
1
Laboratorio de Investigacin en Agentes Antibacterianos, Facultad de Ciencias Biolgicas, Universidad de
Concepcin. Email: nicocid@udec.cl. 2Departamento de Ciencias Biolgicas y Qumicas, Facultad de
Ciencia, Universidad San Sebastin.

El aumento del agujero de la capa de ozono sobre la Antrtica ha ocasionado un ecosistema


con condiciones extremas que va ms all de las bajas temperaturas, y que radica en el
incremento de la radiacin UV, principalmente UV-B (280 a 315 nm), generando un
ambiente con condiciones determinantes en las caractersticas de los microorganismos que
habitan el lugar. Existe evidencia de la accin protectora de algunos pigmentos contra la
radiacin UV. Por esto, el objetivo de este trabajo fue determinar la sobrevida de bacterias
aisladas en la Antrtica, con y sin pigmento, a la exposicin a radiacin UV-B.

Materiales y Mtodos
Se emplearon 18 aislados bacterianos obtenidos de diferentes muestras en la pennsula Fildes,
Antrtica, los que presentan pigmento amarillo (4), violeta (1), naranjo (4), rojo (4) y aislados
no pigmentados (5). Adems, se incluy como controles las siguientes cepas: S. aureus
ATCC 29213, S. aureus ATCC 25923, E. coli ATCC 25922 y A. baumannii ATCC 19606.
Se realiz curvas de crecimiento a cada uno de los aislados en caldo R2A y al mismo tiempo
se determin la produccin de pigmento, a la longitud de onda respectiva para cada color.
Para determinar la supervivencia bacteriana a la radiacin UV-B, se cultiv en caldo R2A
cada uno de los aislados hasta obtener la mayor produccin del pigmento. A partir de este
cultivo se depositaron 7 ml en una placa de Petri los que fueron irradiados con una lmpara
Vilber Lourmat UV-B a 16 cm a una intensidad de 0,75 umol m-2 s-1, con pulsos de 1, 2, 4,
6, y 8 min. Posteriormente, se realiz recuentos bacterianos mediante la tcnica de microgota
en placas de agar R2A, evitando toda exposicin a la luz blanca para impedir la
fotoreactivacin. Finalmente se identific, mediante secuenciacin del ADNr 16S, los
aislados con mayor supervivencia.

Resultados y Discusin
La mayor produccin de pigmentos se obtuvo alrededor de los 7 das de incubacin y, al
evaluar la supervivencia de estos cultivos a la radiacin UV-B se obtuvo diferentes curvas
de sobrevida, las cuales se presentan en la Figura 1. Se observa que algunos aislados
bacterianos pigmentados poseen mayor sobrevida que las cepas ATCC y las no pigmentadas
(donde la mayora de los aislados no sobrevivi a los 6 min de exposicin). No obstante,
existen aislados pigmentados que tienen un comportamiento similar a las cepas ATCC y a
los aislados no pigmentados. Por otra parte, se puede observar que entre los aislados con
pigmentos similares hay un comportamiento dependiente de la cepa, ya que aislados con
pigmentos similares persisten ms tiempo que otros, mostrando que son capaces de absorber
ms energa. De los aislados estudiados, algunos con pigmentos rojo (M42R0-15(3)), naranjo
(M42R0-15(4), y M26R0-15-1) y amarillo (M71R0-12-1) fueron los que presentaron mayor
capacidad para sobrevivir a la radiacin UV-B, soportando una energa sobre 1538.4 J/m2

192 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

durante 8 min de exposicin, concordando con la radiacin UV-B acumulada diariamente en


la Antrtica. Sin embargo, el aislado violeta (M52112-1) sobrevive a menos de 769.2 J/m2
(Figura 2).
Los aislados bacterianos antrticos con mejor sobrevida a la radiacin UV-B (Tabla 1),
presentaron una supervivencia del 1% del inculo inicial, excepto el aislado amarillo
M71R012-1, que mostr supervivencia menor a 0,01% (Figura 2).

Figura 1: Sobrevida a la irradiacin UV-B con lmpara Vilber Lourmat UV-B de aislados bacterianos
obtenidos de diferentes muestras en la Pennsula Fildes, Antrtica. Figure 1: UV-B radiation survival with
Vilber Lourmat UV-B lamp of bacterial isolates obtained from different samples of the Fildes Peninsula,
Antarctica.

193 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 2: Porcentaje de sobrevida de los aislados con mejor sobrevida a la irradiacin UV-B y de la cepa
ATCC19606 utilizada como control no pigmentado. Figure 2: Percentage of survival of isolates with better
survival to UV-B irradiation and of strain ATCC19606 used as non-pigmented control.

Aislado Especie Color Nmero de Acceso


M42R0-15(3) Arthrobacter agilis Rojo LN774732.1
M71R0-12-1 Microbacterium pumilum Amarillo KV-488(T)
M42R0-15(4) Curtobacterium flaccumfaciens Naranjo AJ312209
M26R0-15-1 Curtobacterium flaccumfaciens Naranjo AJ312209

Tabla 1: Identificacin de aislados bacterianos con mayor sobrevida a radiacin UV-B. Table 1:
Identification of bacterial isolates with greater survival to UV-B radiation

Se determin que la densidad ptica, a las longitudes de onda determinadas como potenciales
absorbentes de los pigmentos involucrados, fue mayor conforme aumentaba la densidad
bacteriana, lo que podra ser un indicio de que la produccin de pigmentos se incrementa con
el crecimiento bacteriano, alcanzando en la fase estacionaria la mayor absorcin,
incrementndose en algunos casos aun ms de lo que aumenta la absorcin a los 540 nm,
densidad ptica a la cual se evalu el crecimiento bacteriano, lo que es sugerente de la
participacin de quorum sensing en algunos casos como mecanismo mediador en la
produccin de pigmentos.
La supervivencia a radiacin UV-B fue mayor en 4 aislados bacterianos identificados como
Arthrobacter agilis, Microbacterium pumilum y Curtobacterium flaccumfaciens, estos
presentan una supervivencia similar a cepas de Deinococcus radiodurans, que es cercana al
1%, cuando son irradiados con UV-C con una energa aproximada de 1500 J/m2, y
porcentajes de sobrevivencia a radiacin UV-B, similares a los encontrados en algunas
bacterias aisladas del ambiente marino, con la misma energa acumulada.
Algunos compuestos que pueden estar influyendo en la mayor supervivencia de estas
bacterias a la radiacin UV-B puede ser la produccin de metabolitos secundarios, entre ellos
pigmentos. Se ha demostrado, en otros organismos, que la produccin de pigmentos aumenta
con la radiacin UV-B y, en este caso, justamente entre las bacterias que poseen mayor
supervivencia no se encuentran aquellas no pigmentadas o pigmentadas de color blanco.
A. agilis, M. pumilum y C. flaccumfacien, tal como se evidencia en la tabla 1 poseen
pigmentos rojo, amarillo y naranjo, respectivamente. Segn la literatura estas especies
presentan carotenoides, los cuales podran estar cumpliendo un rol de proteccin contra la

194 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

radiacin UV-B en las cepas estudiadas; sin embargo, puede que se encuentren presentes otro
tipo de pigmentos o compuestos, los cuales sern necesarios de estudiar en investigaciones
futuras.

Conclusin
La presencia de pigmento puede ser un factor favorable al momento de resistir la radiacin
ultravioleta; sin embargo, es necesario estudiar con mayor detalle los componentes de cada
cepa que hacen posible este fenmeno.
El estudio de los microorganismos de la Antrtica es importante debido a las condiciones
extremas de este ambiente, lo cual nos puede proveer de nuevos compuestos con fines
biotecnolgicos interesantes.

Agradecimientos
Al Instituto Antrtico Chileno (INACH) por el financiamiento entregado al Proyecto RT_06-
12 y a CONICYT-PFCHA/ Magster Nacional/ 2017-22171998 por financiar estudios de
magster.

Referencias
Arrange, A. A., Phelps, T. J., E. Benoit, R., Palumbo, A. V., and White, D. C. (1993) Bacterial
sensitivity to UV light as a model for ionizing radiation resistance. J. Microbiol. Methods. 18, 127
136.
Gao, Q., and Garcia-Pichel, F. (2011) Microbial ultraviolet sunscreens. Nat. Rev. Microbiol. 9, 791
802.
Joux, F., Jeffrey, W. H., Lebaron, P., and Mitchell, D. L. (1999) Marine bacterial isolates display
diverse reponses to UV-B radiation. Appl. Environ. Microbiol. 65, 38203827.
Mcclean, K. H., Winson, M. K., Fish, L., Taylor, A., Chhabra, S. R., Camara, M., Daykin, M., John,
H., Swift, S., Bycroft, B. W., Stewart, G. S. A. B., and Williams, P. (1997) Quorum sensing and
Chrornobacteriurn violaceurn: exploitation of violacein production and inhibition for the detection
of N-acyl homoserine lactones. Microbiology. 143, 37033711.
Rozema, J., van Geel, B., Bjrn, L. O., Lean, J., and Madronich, S. (2002) Toward Solving the UV
Puzzle. Science (80-. ). 296, 16211622.
Tian, B., Xu, Z., Sun, Z., Lin, J., and Hua, Y. (2007) Evaluation of the antioxidant effects of
carotenoids from Deinococcus radiodurans through targeted mutagenesis, chemiluminescence, and
DNA damage analyses. Biochim. Biophys. Acta. 1770, 902911.

195 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

BSQUEDA DE PROTEINAS ANTICONGELANTES PUTATIVAS EN EL


GENOMA DE BACTERIAS AISLADAS DESDE LA FILSFERA DE Deschampsia
antarctica
(Search of putative antifreeze proteins in the genome of bacteria isolated from
Deschampsia antarctica phyllosphere)

Cid, F.1, Maruyama, F.2, Murase, K.2, Graether, S.P.3, Larama, G.4, Bravo, L.A.5 y
Jorquera, M.A.4,5
1
Programa de Doctorado en Ciencias de Recursos Naturales, Universidad de La Frontera, Temuco, Chile.
2
Department of Microbiology, Graduate School of Medicine, Kyoto University, Kioto, Japan. 3Department of
Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, Canada. 4Laboratorio de Ecologa
Microbiana Aplicada, Departamento de Ciencias Qumica y Recursos Naturales, Universidad de La Frontera,
Temuco, Chile. 5Ncleo Cientfico Tecnolgico en Biorecursos (BIOREN-UFRO), Universidad de La
Frontera, Temuco, Chile. E-mail: milko.jorquera@ufrontera.cl

Las protenas anticongelantes (PACs) son de gran inters biotecnolgico [Cid et al., 2016].
Recientemente, hemos aislado cepas bacterianas desde la filsfera de Deschampsia
antarctica que muestran actividad anticongelante medida como inhibicin de la
recristalizacin del hielo (IRH) [Cid et al., 2017]. A pesar de que las PACs se han encontrado
en una gran variedad de organismos de ambientes fros, hay un limitado conocimiento sobre
PACs de origen bacteriano. Por lo cual, los objetivos de este estudio fueron analizar la
informacin gentica contenida en el genoma de las cepas bacterianas con actividad IRH
aislada de la filsfera de D. antarctica y detectar genes putativos de PACs que pudieran estar
envueltos en su actividad de IRH.

Materiales y Mtodos
Cepas bacterianas y extraccin de ADN: ADN genmico fue extrado desde cultivos puros
de 6 cepas con actividad de IRH utilizando el Kit UltraClean (Mo-Bio Laboratories, Inc.).
Secuenciacin del genoma, ensamblaje y afiliacin taxonmica: La secuenciacin del
genoma se realiz utilizando el Kit de preparacin Nextera XT DNA Library y la plataforma
Illumina MiSeq (Illumina Inc.). La calidad de las lecturas fue verificada y limpiadas con
Trimmomatic (versin 0.3.2) y FASTQ. Luego, un ensamblaje de novo se llev a cabo
utilizando A5-MiSeq. Adems, BAsic Rapid Ribosomal ARN Predictor
(https://github.com/tseemann/barrnap) y HMMER se utilizaron para predecir la ubicacin de
genes ARN ribosomales (ARNr) y las secuencias de protenas homlogas, respectivamente.
En relacin con la asignacin taxonmica, los genes 16S ARNr se compararon en Ribosomal
Database Project (https://rdp.cme.msu.edu/) y Genbank (BLAST;
https://blast.ncbi.nlm.nih.gov/Blast.cgi). Todas las secuencias se depositaron en Genbank
como SRX2422488 a SRX2422493.
Anlisis del genoma: El borrador del genoma de las cepas fue anotado utilizando el servidor
myRAST (http://rast.nmpdr.org/), y el sistema SEED (http://www.theseed.org) fue usado
para organizar los genes en categoras funcionales (subsistemas) sobre la base de su
asignacin taxonmica. En genoma de las cepas Pseudomonas protegens Pf5, Pseudomonas
sp. L10.10, Janthinobacterium sp. KBS0711 y Janthinobacterium sp. PAMC fueron usados
como referencia.

196 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Bsqueda de PACs: En primer lugar, se realiz una bsqueda directa de PACs y del dominio
DUF3494 utilizando los genes anotados utilizando el servidor Web CD-Search Tool
(https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Luego la presencia de PACs fue
investigado utilizando un anlisis de TBLASTN (https://blast.ncbi.nlm.nih.gov/Blast.cgi).
Para ello se descargaron 36 secuencias de PACs verificadas fenotpicamente (PACs-FV) de
la base de datos Uniprot (http://www.uniprot.org/). Mediante este anlisis, solo tres
secuencias nucleotdicas (SC1-38PA, SC5-38PA y SC68-43NM1) mostraron coincidencias
con regiones de PACs-FV. Las secuencias de nucletidos se tradujeron a secuencias de
aminocidos con ExPASy Translate (https://www.expasy.org/). Se utiliz LALIGN de
ExPASy (http://embnet.vital-it.ch/software/LALIGN_form.html) para obtener la mejor
alineacin entre las PACs putativas y la correspondiente PACs-FV. Las secuencias de
aminocidos de las PACs putativas tambin fueron analizadas con BLASTP
(https://blast.ncbi.nlm.nih.gov/Blast.cgi) y el predictor iAFP-Ense (http://www.jci-
bioinfo.cn/iAFP-Ense). Finalmente, se re-analiz la presencia del dominio DUF3494
descargando su perfil HMM desde Pfam (http://pfam.xfam.org/) y se utiliz el software
HMMER para buscar homlogos secuenciales en bases de datos.

Resultados
Cepa Genoma %GC Cepa cercana (no. acceso) Similitud No. acceso
(bp) (%)
Pseudomonas sp. 28NM1 6,011,157 59.3 Pseudomonas mandelii 99 SRX2422488
(NR_024902)
Pseudomonas sp. 43NM1 6,143,947 59.4 Pseudomonas lini 99 SRX2422489
(NR_029042)
Janthinobacterium sp. 15PA 5,970,068 62.5 Janthinobacterium lividum 99 SRX2422490
(NR_026365)
Pseudomonas sp. 38PA 5,910,368 58.7 Pseudomonas brassicacearum 99 SRX2422491
(NR_074834)
Pseudomonas sp. 20AA 6,365,839 60.1 Pseudomonas poae RE*1-1-14 99 SRX2422492
(NR_102514)
Pseudomonas sp. 19PA 5,638,727 57.5 Pseudomonas frederiksbergensis 99 SRX2422493
(NR_117177)

Tabla 1. Resumen de los resultados obtenidos de la secuenciacin del genoma de las cepas con actividad de
IRH. Table 1. Summary of results obtained from genome sequencing of strains with IRH activity.

Figura 1. Abundancia y categorizacin funcional de los genes en los borradores de genomas de las cepas
Pseudomonas (a) y Janthinobacterium (b). Cepas Pf5, L10.10, KBS0711 y PAMC25724 son genomas de

197 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

referencia. Figure 1. Abundance and functional categorization of genes in draft genomes of the Pseudomonas
(a) and Janthinobacterium (b) strains. Strains Pf5, L10.10, KBS0711 and PAMC25724 are reference
genomes.

Tabla 2. Alineamientos de secuencias de las cepas 38PA y 43NM1 con PACs fenotpicamente verificadas
(PACs-FV) de Pseudomonas putida GR12-2 (Q68VA9) y Marinomonas primoryensis (A1YIY3). Table 2.
Sequence alignments of 38PA and 43NM1 strains with phenotypically verified PACs (Pv-PACs) of
Pseudomonas putida GR12-2 (Q68VA9) and Marinomonas primoryensis (A1YIY3).

No. de Query Subject Similitud Positivos Gap % Longuitud de Valor E Bit


match (no. acceso) (scaffold-cepa) (%) (%) alineamineto score
1 Q68VA9 SC1-38PA 31 46 3 153 2x10-12 67.4
2 Q68VA9 SC1-38PA 32 46 5 167 2x10-10 67.0
3 Q68VA9 SC5-38PA 31 51 8 188 7x10-10 59.3
4 Q68VA9 SC5-38PA 34 49 4 101 1x10-7 52.0
5 Q68VA9 SC5-38PA 28 46 4 166 2x10-7 51.6
6 Q68VA9 SC5-38PA 33 48 6 99 1x10-6 48.5
7 A1YIY3 SC68-43NM1 42 58 7 67 2x10-6 50.8
8 A1YIY3 SC68-43NM1 40 60 7 67 3x10-6 50.1
9 A1YIY3 SC68-43NM1 39 58 7 71 3x10-6 49.7
10 A1YIY3 SC68-43NM1 39 55 7 67 7x10-5 45.4
11 A1YIY3 SC68-43NM1 37 55 7 67 2x10-4 44.3
12 A1YIY3 SC68-43NM1 38 62 3 71 3x10-4 43.1
13 A1YIY3 SC68-43NM1 39 61 2 59 9x10-4 41.6
14 A1YIY3 SC68-43NM1 35 61 10 62 0.003 40.0


no. acceso en Uniprot (http://www.uniprot.org/)
Discusin
En este estudio, los datos de secuenciacin revelaron la presencia de 5 cepas de Pseudomonas
y 1 cepa de Janthinobacterium con tamaos de genoma entre 5,6 y 6,3 Mbp y 58-63% de
contenido de G+C (Tabla 1). Los tamaos y los contenidos de G+C son similares a los
reportados para otras cepas antrticas de Pseudomonas y Janthinobacterium [Rodrguez-
Rojas et al., 2016; Koo et al., 2016].
En relacin con la abundancia y categorizacin funcional de los genes (Fig. 1). Diferencias
en los genes relacionados con el metabolismo de macronutrientes (C, N y P) fueron
observadas entre cepas secuenciadas y de referencias. Por ejemplo, la cepa de referencia P.
protegens Pf5, aislada de la rizsfera de plantas, contena ms genes relacionados con C que
las cepas de la filsfera. La rizsfera es el compartimento de la planta con mayor actividad
microbiana, porque los exudados de las races representan una fuente rpida y fcil de C y
energa para los microorganismos. Por el contrario, la filsfera de las plantas ha sido descrita
como un ambiente oligotrfico con algunos "oasis" de nutrientes relativamente abundantes.
Curiosamente, la mayor abundancia de genes asociados con el metabolismo de N se encontr
en las cepas de la filsfera. Estudios tambin se ha sugerido que las bacterias que viven en la
filsfera de las plantas son diaztrofos activos y pueden contribuir con las necesidades de
nitrgeno para su husped [Frnkranz et al., 2008].
La presencia de genes de PACs no fue observada en los genomas secuenciados; sin embargo,
tres alineamientos parciales con PACs fueron observadas. Los scalffolds denominados SC1-
38PA y SC5-38PA, contenan secuencias que se alineaban con la PAC de P. putida GR12-2

198 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

(Tabla 2), una protena extracelular, rica en glicina y alanina con una masa molecular de
16415 kDa y un punto isoelctrico de 5,3 [Xu et al., 1998]. El scaffold SC68-43NM1
contena secuencias que se alinearon con la PAC de M. primoryensis, una protena
excepcionalmente grande (1,5 MDa) que contiene un sitio de unin a hielo en un segmento
de 322 aminocidos con 13 repeticiones en tndem de 19 aminocidos [Guo et al., 2012]. En
adicin, el anlisis utilizando predictor de PACs, iAFP-Ense, indic que las secuencias
alineadas podran ser clasificadas como PACs.

Conclusiones
La secuenciacin del genoma revel la presencia de Pseudomonas y Janthinobacterium. El
anlisis de secuenciacin tambin revel las similitudes y diferencias en la presencia y
abundancia de genes implicados en subsistemas funcionales de metabolismo de nutrientes
(carbono, nitrgeno y fsforo). El anlisis tambin mostr alineamientos parciales con
protenas anticongelantes putativas (PACs) basado en alineaciones con las secuencias de
PACs fenotpicamente verificados (PACs-FV). Sin embargo, se requieren mayores esfuerzos
para confirmar, caracterizar y atribuir la actividad IRH con la presencia de PACs codificadas
en el genoma. En el mismo sentido, el papel de la bacteria de la filsfera en la adaptacin y
supervivencia de las plantas antrticas tambin debe ser abordado y confirmado en futuras
investigaciones.

Agradecimientos
INACH RT_02_16, Fondecyt 1160302, INACH DT_01-13, beca CONICYT 21140534, beca
MECESUP FRO1204 y beca UFRO.

Referencias
Cid, F.P., Inostroza, N.G., Graether, S.P., Bravo, L.A. y Jorquera, M.A. 2017. Bacterial community structures
and ice recrystallization inhibition activity of bacteria isolated from the phyllosphere of the Antarctic vascular
plant Deschampsia Antarctica. Polar Biology 40: 1319-1331.
Cid, F.P., Rilling, J.I., Graether, S.P., Bravo, L.A., Mora, M.L. y Jorquera, M.A. 2016. Properties and
biotechnological applications of ice binding proteins in bacteria. FEMS Microbiology Letters 363(11): fnw099.
Frnkranz M, Wanek W, Richter A, et al (2008) Nitrogen fixation by phyllosphere bacteria associated with
higher plants and their colonizing epiphytes of a tropical lowland rainforest of Costa Rica. ISME J 2:561-570.
Guo, S., Garnham, C., Whitney, J., Graham, L.A. y Davies, P.L. (2012) Re-evaluation of a bacterial antifreeze
protein as an adhesin with ice-binding activity. PLoS One 2012;7:e48805.
Koo, H., Strope, B.M., Kim, E.H., Shabani, A.M., Kumar, R., Crowley, M.R., Andersen, D.T. y Bej, A.K.
(2016) Draft Genome Sequence of Janthinobacterium sp. Ant5-2-1, isolated from proglacial lake Podprudnoye
in the Schirmacher Oasis of East Antarctica. Genome Announcement 4:1-2.
Rodrguez-Rojas, F., Tapia, P., Castro-Nallar, E., Undabarrena, A., Muoz-Daz P., Arenas-Salinas, M., Daz-
Vsquez, W., Valds, J. y Vsquez, C. (2016) Draft genomes sequence of a multi-metal resistant bacterium
Pseudomonas putida ATH-43 isolated from Greenwich island, Antarctica. Frontier in Microbiology 7:1-5.
Sun, X., Griffith, M., Pasternak, J.J. y Glick, B.R. (1995) Low temperature growth, freezing survival, and
production of antifreeze protein by the plant growth promoting rhizobacterium Pseudomonas putida GR12-2.
Canadian Journal of Microbiology 41:776-784.
Xu, H., Griffith, M., Patten, C.L. y Glick, B.R. (1998) Isolation and characterization of an antifreeze protein
with ice nucleation activity from the plant growth promoting rhizobacterium Pseudomonas putida GR12-2. Can
J Microbiol 44:64-73.

199 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

DETECCIN DE GENES DE RESISTENCIA E INTEGRONES EN BACTERIAS


MARINAS PROVENIENTES DE ISLA REY JORGE, ANTRTICA
(Detection of resistance genes and integrons in marine bacteria from King George Island,
Antarctica)

Cid-Ramrez, K1., Castillo-Prado, N1., Lazo, I1., Domnguez, M1., Gonzlez-Rocha, G1.,
Lima, C1., Vergara, L2., y Bello-Toledo, H1.
1
Laboratorio de Investigacin en Agentes Antibacterianos. Departamento de Microbiologa. Facultad de
Ciencias Biolgicas. Universidad de Concepcin. 2 Departamento de Ciencias Biolgicas y Qumicas.
Facultad de Ciencia. Universidad San Sebastin.

La Organizacin Mundial de la Salud ha informado que la resistencia a antibiticos es una


de las mayores amenazas para la salud mundial, seguridad alimentaria y desarrollo de los
pases como resultado del mal uso y abuso de estos frmacos en el humano, la industria
ganadera, agricultura y acuicultura. La resistencia a antibiticos se presenta naturalmente, en
bacterias patgenas y no patgenas, productoras y no productoras de antibiticos, puesto que
la mayora de los antibacterianos son producidos por microorganismos (Martnez, J., 2008).
Distintos autores han informado el aislamiento de bacterias multiresistentes en el ambiente.
La Antrtica permite estudiar este fenmeno natural, pues es considerado un hbitat con baja
intervencin antrpica, debido al difcil acceso y las extremas condiciones climticas. Sin
embargo, el aumento del turismo en la zona, el asentamiento de bases cientficas y militares
y la constante presencia de vectores biolgicos, que viajan largas distancias, podra favorecer
la introduccin de genes de resistencia en la microbiota Antrtica (Chee-Sanford et al., 2009).
Por lo anterior, el objetivo de este trabajo fue detectar e identificar genes de resistencia a
antibiticos (GRA) en bacterias aisladas de muestras de agua de mar de zonas con diferente
intervencin antrpica en Pennsula Fildes, Antrtica.

Materiales y Mtodos
Zona de muestreo, aislamiento y caracterizacin fenotpica: Muestras de agua de mar
fueron obtenidas en la 49a expedicin cientfica antrtica (2013), de localidades geogrficas
informadas en Tabla 1. Se seleccion 81 colonias diferentes, considerando morfologa,
tamao, color y textura.
Resistencia a antibiticos: Se determin mediante difusin en agar, segn normas del CLSI
(2016), reemplazando el agar Mueller-Hinton por agar Marino y temperatura de incubacin
a 15C. Se ensayaron 16 antibiticos de importancia clnica de diferentes familias
(betalactmicos, aminoglicsidos, quinolonas, tetraciclina, cloranfenicol, trimetoprin y
sulfonamidas). Se consider como presuntivas portadoras de GRA los aislados con halos de
inhibicin cuyo dimetro fue 14 mm para los antibiticos ensayados.
Deteccin e identificacin de genes de resistencia: En la Tabla 2 se muestra los diferentes
GRA y de integrasas investigados. La extraccin de ADN se realiz mediante Chelex 5% y
proteinasa K. La visualizacin de los productos de PCR se realiz a travs de electroforesis
en geles de agarosa y visualizados en transiluminador UV.

200 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Zona A Posicin geogrfica Ubicacin


M1 6212'08.6''S 5856'43.4''W Frente a Isla Albatros
M11 6212'02.9''S 5856'36.5''W Trayecto Glaciar Collins, frente a Isla Albatros
Zona B
M27 6211'53.0''S 5859'36.6''W Laguna Playa Elefantes
M28 6211'48.3''S 5859'40.5''W Intermareal sector norte Playa Elefantes
M29 6211'56.9''S 5859'42.6''W Fosa intermareal
M30 6212'00.9''S 5859'56.5''W Sector Sur elefanteras
M38 6212'52.5''S 5856'35.0''W Frente Base Muralla China
M39 6212'34.8''S 5855'56.6''W Frente a refugio Argentino
Zona C
M2 6213'49.8''S 5856'05.7''W Llegando a Estrecho Nelson
M3 6213'50.4''S 5900'26.5''W Estrecho Nelson
M12 6211'20.2''S 5852'13.9''W Trayecto Glaciar Collins
M14 6210'08.4''S 5851'06.1''W Desembarco Glaciar Collins
Tabla 1: Localizacin geogrfica de los sitios de muestreo (coordenadas de latitud y longitud). Zona A:
influencia humana permanente, Zona B: presencia permanente de animales y Zona C: remota, con difcil
acceso y slo algunas aves transitorias.
Table 1: Geographical location of sampling sites (latitude and longitude coordinates). Zone A: permanent
human influence, Zone B: permanent presence of animals and Zone C: remote, with difficult access and only
some transient birds.

Identificacin de aislados bacterianos portadores de GRA: Aquellos aislados en los


cuales se detect uno o ms GRA fueron identificados mediante amplificacin y
secuenciacin del ADNr 16S (Macrogen Corp). Posteriormente, las secuencias obtenidas
fueron comparadas con la base de datos del NCBI utilizando BLAST y Bioedit.

Familia Antibitico Genes pesquisados


Betalactmicos blaCTX-M1, blaCTX-M2, blaCTX-M8, blaCTX-M9, blaCTX-M25, blaTEM, blaSHV, blaGES,
blaPER-1, blaPER-2, blaAmpC
Aminoglicsidos aac(6)Ib, aac(3)II, aac(3)IIA
Quinolonas qnrA, qnrB, qnrC, qnrS
Fenicoles floR, cmlA, catII
Tetraciclinas tetA, tetB, tetC
Inhibidores de c. flico sul1, sul2, sul3, dfrAI, dfrAVII, dfrVII
Genes de integrasa intI1, intI2, intI3

Tabla 2: Genes de resistencia investigados en los aislados bacterianos obtenidos desde muestras de agua mar
en Isla Rey Jorge, Antrtica.
Table 2: Resistance genes investigated in bacterial isolates obtained from samples of seawater in Rey Jorge
Island, Antarctica.

Resultados
La Figura 1 muestra que en las 3 zonas estudiadas el nmero de cepas resistentes a
antibiticos son similares. Adems, se visualiza que gran parte de los aislados presenta
susceptibilidad disminuida a la mayora de los antibiticos, principalmente, para el grupo de
los aminoglicsidos.

201 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 1: Distribucin de halos de inhibicin (mm) para los aislados obtenidos de muestras de agua de mar
desde 3 zonas con diferente actividad antropognica en Isla Rey Jorge, Antrtica. Figure 1: Distribution of
inhibition zones (mm) for the isolates obtained from sea water samples from 3 zones with different
anthropogenic activity in Rey Jorge Island, Antarctica.
AMP: ampicilina, CEF; cefalotina, CXM: cefuroxima, CTX: cefotaxima, CAZ: ceftazidima, FEP: cefepime,
STR; estreptomicina, KAN; kanamicina, GEN; gentamicina, AMK; amikacina, NAL; cido nalidxico, CIP;
ciprofloxacino, TET; tetraciclina, CHL; cloranfenicol, TMP; Trimetropin, SUL: sulfametoxazol.

Deteccin de genes de resistencia e identificacin de cepas


En la Tabla 3 se presenta los GRA detectados en las zonas estudiadas y puede observarse que
el gen que se detect en mayor nmero de cepas fue aac(6)Ib (27 aislados), seguido de qnrB
(12 aislados) y, qnrS (3 aislados). Adems, en 21 aislados (25,9%) se detect los genes intI1
e intI2, que codifican para la integrasa clase 1 y 2, respectivamente. En ninguno de los

202 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

aislados se detect integrn clase 3. En 32/81 aislados se detect al menos un GRA,


encontrndose 8 cepas con 2 GRA y una cepa con 3 GRA. La identificacin de las cepas
revel una amplia diversidad de gneros bacterianos, siendo los ms frecuentes Klebsiella,
Pseudomonas, Pseudoalteromonas y Marinomonas.
Genes de Zona A Zona B Zona C Total de
Resistencia (actividad humana) (actividad animal) (remota) aislados
qnrS 0 1 2 3
qnrB 3 3 8 14
aac (6)Ib 7 4 16 27
intI1 5 4 12 21
intI2 5 4 11 21
Tabla 3: Genes de resistencia detectados en los aislados bacterianos obtenidos de muestras de agua de mar en
3 zonas con diferente actividad antrpica en Isla Rey Jorge, Antrtica. Table 3: Resistance genes detected in
bacterial isolates obtained from seawater samples in 3 zones with different anthropogenic activity in Rey
Jorge Island, Antarctica.

Discusin y Conclusiones
De acuerdo a los halos de inhibicin exhibidos por los aislados obtenidos en las 3 zonas de
muestreo, FEP y CIP, fueron los antibiticos a los cuales se present mayor susceptibilidad,
independiente de la zona de su aislamiento. En cambio, el grupo de antibitico con menor
nmero de aislados susceptibles correspondi a los aminoglicsidos. En general, se observ
que los aislados presentaron amplios perfiles de resistencia, incluyendo antibiticos de
diferentes familias. Cabe destacar que a pesar de presentar resistencia a betalactmicos,
tetraciclinas y fenicoles, no se encontraron genes de resistencia asociados a estos antibiticos.
En el caso de la resistencia observada a TMP y SUL, ambos inhibidores de sntesis de cido
flico, se consider como un resultado falso positivo debido a la modificacin del medio de
cultivo, de agar Mueller Hinton (CLSI) a agar marino.
Con respecto a los GRA un elevado nmero de cepas portaban el gen aac(6)Ib, lo cual
concuerda con los perfiles de resistencia obtenidos en los antibiogramas, considerando que
codifica una enzima que confiere resistencia a los aminoglicsidos, incluidos amikacina.
Tambin result importante la deteccin de los genes qnrS y qnrB que codifican
susceptibilidad disminuida a quinolonas, como ciprofloxacina. Estos genes son de
localizacin plasmdica, lo que puede permitir su diseminacin, inter o intra especie. Por otra
parte, la presencia de integrn clase 1 y 2 en los aislados bacterianos, especialmente, en la
zona C, dan cuentan de la posibilidad que los GRA pueden localizarse en estas plataformas
genticas favoreciendo su movilizacin dentro del resistoma Antrtico.

Agradecimientos
A INACH por el financiamiento del proyecto INACH RT 16_12.

Referencias
Chee-Sanford, J., Mackie, R., Koike, S., Krapac, I., Lin, Y., Yannarell, A., Maxwell, S., Rustam, I., and
Aminov, R. 2009. Fate and transport of antibiotic residues and antibiotic resistance genes following land
application of manure waste. J Environ Qual 38:10861108.
CLSI. Performance Standards for Antimicrobial Disk Susceptibility Tests, and Methods for Dilution
Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically, Edition (2016). CLSI. Wayne, PA:
Clinical and Laboratory Standards Institute
Martnez, J. 2008. Antibiotics and antibiotic resistance genes in natural environments. Science 321:365367.

203 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

BIRD COLONIES AS RELEVANT SOURCES OF POLLUTANTS IN


ANTARCTIC ECOSYSTEMS: PART 1 - TRACE ELEMENTS
(Colonias de aves como fuentes relevantes de contaminantes en ecosistemas antrticos:
parte 1 - elementos traza)

Cipro C.V.Z.1,2, Bustamante P.2, Petry M.V.3, Montone R.C.1


1
LabQOM, Instituto Oceanogrfico, Universidade de So Paulo.2LIENSs Universit de La
Rochelle.3Laboratrio de Ornitologia e Animais Marinhos Universidade do Vale do Rio dos Sinos.

"Global distillation" is classically pointed as the biggest responsible for contaminant inputs
in Polar ecosystems. Besides that, mercury (Hg) and other trace elements (TE) present natural
sources as well, which could have local significance (e.g. Mo de Ferro et al., 2013). The
biologically mediated transport is typically ignored, but might represent an important input
at the local (Huang et al., 2014) or regional (Blais et al., 2007) scales not only for TE, but to
other contaminants as well. In this respect, the concentration of non-essential TE along the
life of organisms (bioaccumulation), and also along the trophic webs (biomagnification)
added to the fact that individuals gather in large numbers into large colonies and excrete on
land are particularly noticeable for seabirds during the reproductive season. In maritime
Antarctica, seabird colonies represent the major source of nutrients for terrestrial ecosystems
(Smykla et al., 2007). Colonies can play this role due to not only the guano (Finger et al.,
2017), but also to eggs (Brasso et al., 2012), bird tissues and prey present in this structures
(Emslie et al., 2014). However, this input of nutrients by these sources comes along with an
input of contaminants as well, by a more direct influence of the contaminants present in the
excretion itself or of the transport of TE during biogeochemical cycles (e.g. Malandrino et
al., 2009). Nevertheless, only a few studies proposed colonies (e.g. Roosens et al., 2007) as
important secondary contaminant sources for Polar ecosystems. In a previous study using
vegetation as indicator (Cipro et al., 2011), we showed that the degradation of animal derived
organic matter (from seabird colonies for instance) could constitute non-negligible sources
of organic contaminants. In this context, the present work constitutes a geographical and
ecological enlargement of scope and reach as well as a refinement of our previous work. It
aims to evaluate the influence of seabird colonies as secondary sources of TE using soil and
vegetation as indicators in maritime Antarctic terrestrial ecosystems considering
geographical variation, distance to the colonies and the different bird species with different
feeding ecology strategies.

Material and Methods


Samples of lichen (n=55), mosses (n=58) and soils (n=37), were collected in 13 locations
within the South Shetlands Archipelago in the austral summers of 2013-14 and 2014-15
during cruises of the Brazilian Antarctic Programme and divided in two types: "colony"
(within the colony itself for soil and within the colony or bordering it for vegetation) and
"control" (at least 50m away from the respectively closest colony) with properly cleaned
gear, frozen aboard and kept frozen until arrival at the University of So Paulo/Brazil, where
they underwent lyophilisation. For further detail, Hg analyses followed Blvin et al. (2013),
the remaining TE followed Lucia et al. (2016) and stable isotope analyses (SIA) followed
Chouvelon et al. (2012). Normal distribution and log-link function generalized linear models

204 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

(GLM) were built to assess the influence of categorical and continous variables in the results
found. Model selection was based on Akakes Information Criteria for small sample sizes
(AICc).
Results in regard to Hg, results show some prevailing patterns. For soils, control samples
were less contaminated than colony ones in all cases. Mosses, in turn, presented overall
similar levels when compared to soil, with one notable exception, Ferraz, located next to the
Brazilian Scientific Station, which could be due to several reasons: fossil fuel burning, less
year-round ice cover and the fire from February 2012, which consumed the whole station
core and roughly 70% of the total facilities (see Guerra et al., 2013). Lichens presented
overall levels mostly in the same order of magnitude as mosses, except the sampling sites
close to research stations, confirming Ferraz as a likely Hg source due to prevailing westerly
and southwesterly winds (Wielbinska and Skrzypczak, 1988). Another local source are
volcanoes. Deception Island is an active volcano and Penguin Island, where the S. vittata
samples were collected, is an ancient volcano crater, with samples from these sites clearly
distinguished from the rest. Such conditions may also affect Hg levels in vegetation as well
via marine spray for instance, which has significant influence in the composition of Antarctic
soils (Malandrino et al., 2009). Regarding Cd in a general way, soil concentrations were
comparatively higher than mosses, followed by lichens, evidentiating lesser mobility when
compared to Hg, likely due to lesser atmospheric deposition and re-suspension among other
reasons. Moreover, Cd concentrations remained under the limit of detection in all but one of
the soil control sites suggesting the input of this element starkly linked to the bird colonies.

Discussion and conclusions


Hg in lichens presents no significant correlation to other TE in control sites, probably due to
the fact that they lack a true root system and absorb contaminants directly from the air
(Villeneuve et al., 1988), with no interaction with the substrata (Olech, 1994). However, in
colony samples Hg presented significant correlations (+Pb, +Se, -Zn, -d15N, -%N) indicating
not only the re-suspension/re-emission from colonies as a common source for Hg and these
other TE but also for N. In a previous work (Cipro et al., 2011), negative correlation with
d15N was associated with ammonia and volatile or re-suspended contaminants whereas
positive correlation was associated with the less volatile ones and/or more water-soluble N
as the ammonium. Cd in lichens, on the other hand, is clearly related to the organic matter
content, since it correlates to %N in both control and colony sites and with d 15N in colony
sites as well. Taking mosses into consideration, a significant positive correlation with Pb
could indicate a common source for control sites.
The same conclusion could be taken in regard to Co, Cr and Ni presenting significant
negative correlations with Hg in colony sites: these TE would most likely come from natural
sources rather than a colony input. This is reinforced by the fact these three elements
presented significant negative correlations with indicators organic matter (%C and/or %N).
Cd, in turn, presented significant positive correlation with %N and negative with %C in
colony sites, which is apparently contradictory, but could be related to the ornithogenic soil
composition and decaying processes as previously described. In respect to soil, the influence
of colonies in Hg concentrations has been previously reported (e.g. Choy et al., 2010) and
confirmed by significant positive correlations for both %C and %N. The same pattern is
repeated for Cd as well as the same significant positive correlation with As, Se and Zn
detected in mosses colony samples. Thanks to the GLM, it is possible to notice some patterns.
Firstly, the factors are quite similar between Hg and Cd models, especially for colony

205 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

samples of mosses and soil. Moreover, for colony samples, there seems to be some effect of
the matrix species factor but the colony species factor seems to be more present and in models
with higher Akaike weights, suggesting it as the most prominent in explaining both Hg and
Cd concentrations. This is likely due to different feeding ecology among species, and
therefore, to contaminants levels in droppings, but also to some variables that could not yet
have been explored: colony size and/or density, directly linked to the local TE input. T-tests
between colony and control sites showed that lichens presented comparatively less
significant difference between both sites than mosses, which presented comparatively less
difference than soil. Lichens presented markedly differences in d13C and %N. Mosses, in
turn, presented significant difference for most of the stable isotopes, %C and %N, and, among
TE, particularly for Hg, likely due to the influence of runoff water. Finally, soil presented
differences between control and colony sites for almost all of the cases, with two notable
exceptions: Cd, due to analytical issues, confirming its input in this matrix closely related to
bird colonies; and d15N, which presented significant difference only in Phalacrocorax
atriceps colonies.
To conclude, in most cases, soil seems to be the best indicator to assess bird colonies as TE
sources in these particular ecosystems as this matrix presented comparatively more
differences between control and colony sites than vegetation. Bird colonies are clearly local
sources of organic matter, Cd and Hg and likely of some other TE (As, Se and Zn).
Conversely, Co, Cr, Ni and Pb come most likely from other origins. Both natural and
anthropogenic sources for these TE have been reported previously and further research would
be needed to separate them. In a general way, isotopes were more useful for vegetation
(particularly mosses) as indicators of colonies influence whereas elemental composition was
more useful for soil. Local Hg sources could be inferred from high levels in control sites and
also from location and wind patterns. Further studies could assess the influence of bird
population parameters on the results found.

Acknowledgements
To the financing organisms in the University of La Rochelle: CPER (Contrat de Plan tat-
Rgion) and FASEP (Fonds dtude et daide au secteur priv). C.V.Z. Cipro received
scholarships from FAPESP (So Paulo Research Foundation, Brazil. Grant #2014/15989-0
and grant #2015/07209-8). M. V. Petry received funding from INCT-APA (Instituto
Nacional de Cincia e Tecnologia Antrtico de Pesquisas Ambientais) (CNPq Process
n574018/2008-5), FAPERJ (E-26/170.023/2008) and was supported by the SECIRM,
MMA and MCTI. C. Churlaud, M. Brault-Favrou, G. Guillou and B. Lebreton from LIENSs
are to be thanked for their assistance during analyses.

References
Blais, J.M., Macdonald, R.W., Mackay, D., Webster, E., Harvey, C., Smol, J.P., 2007. Biologically Mediated
Transport of Contaminants to Aquatic Systems Critical Review Biologically Mediated Transport of
Contaminants to Aquatic Systems, 41: 10751084.
Blvin, P., Carravieri, A., Jaeger, A., Chastel, O., Bustamante, P., Cherel, Y., 2013. Wide range of mercury
contamination in chicks of southern ocean seabirds. PLoS One, 8: e54508.
Brasso, R.L., Polito, M.J., Lynch, H.J., Naveen, R., Emslie, S.D., 2012. Penguin eggshell membranes reflect
homogeneity of mercury in the marine food web surrounding the Antarctic Peninsula. Sci. Total Environ., 439:
16571.
Chouvelon, T., Spitz, J., Caurant, F., Mndez-Fernandez, P., Autier, J., Lassus-Dbat, a., Chappuis, a.,
Bustamante, P., 2012. Enhanced bioaccumulation of mercury in deep-sea fauna from the Bay of Biscay (north-

206 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

east Atlantic) in relation to trophic positions identified by analysis of carbon and nitrogen stable isotopes. Deep
Sea Res. Part I Oceanogr. Res. Pap., 65: 113124.
Choy, E.S., Gauthier, M., Mallory, M.L., Smol, J.P., Douglas, M.S. V, Lean, D., Blais, J.M., 2010. An isotopic
investigation of mercury accumulation in terrestrial food webs adjacent to an Arctic seabird colony. Sci.Total
Environ., 408: 185867.
Cipro, C.V.Z., Yogui, G.T., Bustamante, P., Taniguchi, S., Sericano, J.L., Montone, R.C., 2011. Organic
pollutants and their correlation with stable isotopes in vegetation from King George Island, Antarctica.
Chemosphere, 85: 3938.
Emslie, S.D., Polito, M.J., Brasso, R., Patterson, W.P., Sun, L., 2014. Ornithogenic soils and the paleoecology
of pygoscelid penguins in antarctica. Quat. Int., 352: 415.
Finger, A., Lavers, J.L., Dann, P., Kowalczyk, N.D., Scarpaci, C., Nugegoda, D., Orbell, J.D., 2017. Metals
and metalloids in Little Penguin (Eudyptula minor) prey, blood and faeces. Environ. Pollut., 223: 567574.
Guerra, M.B.B., Neto, E.L., Prianti, M.T.A., Pereira-Filho, E.R., Schaefer, C.E.G.R., 2013. Post-fire study of
the Brazilian Scientific Antarctic Station: Toxic element contamination and potential mobility on the
surrounding environment. Microchem. J.,110: 2127.
Huang, T., Sun, L., Wang, Y., Chu, Z., Qin, X., Yang, L., 2014. Transport of nutrients and contaminants from
ocean to island by emperor penguins from Amanda Bay, East Antarctic. Sci. Total Environ., 468469: 578
583.
Lucia, M., Strm, H., Bustamante, P., Gabrielsen, G.W., 2016. Trace Element Concentrations in Relation to the
Trophic Behaviour of Endangered Ivory Gulls (Pagophila eburnea) During Their Stay at a Breeding Site in
Svalbard. Arch. Environ. Contam. Toxicol., 71: 518529.
Malandrino, M., Abollino, O., Buoso, S., Casalino, C.E., Gasparon, M., Giacomino, A., La Gioia, C., Mentasti,
E., 2009. Geochemical characterisation of Antarctic soils and lacustrine sediments from Terra Nova Bay.
Microchem. J., 92: 2131.
Mo de Ferro, A., Mota, A.M., Canrio, J., 2013. Sources and transport of As, Cu, Cd and Pb in the
environmental compartments of Deception Island, Antarctica. Mar. Pollut. Bull., 77: 341348.
Olech, M., 1994. Lichenological assessment of the Cape Lions Rump , King George Island , South Shetland
Islands; a baseline for monitoring biological changes. Polish Polar Res., 15: 111130.
Roosens, L., Van Den Brink, N., Riddle, M., Blust, R., Neels, H., Covaci, A., 2007. Penguin colonies as
secondary sources of contamination with persistent organic pollutants. J. Environ. Monit., 9: 8225.
Smykla, J., Woek, J., Barcikowski, A., 2007. Zonation of Vegetation Related to Penguin Rookeries on King
George Island , Maritime Antarctic. Arctic, Antarct. Alp. Res., 39: 143151.
Villeneuve, J.-P., Fogelqvist, E., Cattini, C., 1988. Lichens as bioindicators for atmospheric pollution by
chlorinated hydrocarbons. Chemosphere, 17: 399403.
Wielbinska, D., Skrzypczak, E., 1988. Mean air temperatures at definite wind directions at Arctowski Station
,. Polish Polar Res., 9: 133145.

207 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ESTADO ACTUAL DE LA MICROPALEONTOLOGA Y PALINOLOGA DEL


MESOZOICO Y CENOZOICO DE LA CUENCA JAMES ROSS, ANTRTIDA
(Micropaleontology and palynology of the Mesozoic and Cenozoic of the James Ross
Basin, Antarctica)

Concheyro, A.1,2,3, Amenbar, C.R.1,2,3, Carams, A.2, Lirio, J.M.1, Adamonis, S. 3,


Maceiras, G.3 y A. Mackern3
1
Instituto Antrtico Argentino (IAA). 25 de Mayo 1151, CP 1650, San Martn, Buenos Aires, Argentina.E-
mail: andrea@gl.fcen.uba.ar; amenabar@gl.fcen.uba.ar; lirio@dna.gov.ar. 2Instituto de Estudios Andinos
Don Pablo Groeber. Consejo Nacional de Investigaciones Cientficas y Tcnicas (IDEAN-CONICET).
Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires. Pabelln II. Ciudad Universitaria.
CP 1428. Ciudad Autnoma de Buenos Aires, Argentina. carames@gl.fcen.uba.ar. 3Departamento de
Ciencias Geolgicas, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Argentina. E-
mail: suad@gl.fcen.uba.ar; gabrielmaceiras72@yahoo.com.ar; alanmackern@gmail.com

La Cuenca James Ross, NE de la Pennsula Antrtica, es una de las cuencas sedimentarias


antrticas ms significativas por el gran espesor de sus sedimentitas marinas depositadas
durante dos eventos transgresivo-regresivos mayores (Jursico-Eoceno). Ha sido
intensamente investigada desde comienzos del siglo XX por su contenido paleontolgico de
invertebrados, vertebrados y plantas, aunque los estudios de microfsiles y palinomorfos son
escasos. Esta contribucin seala el estado de las investigaciones en foraminferos, briozoos,
nanofsiles calcreos, esporas, granos de polen y quistes de dinoflagelados, hallados en
sedimentitas mesozoicas y cenozoicas de las islas Marambio, Cerro Nevado (Refugio Suecia
y Sanctuary Cliffs), Vega (Cabo Lamb), Cockburn, Humps, James Ross (Tumbledown Cliffs,
Cabo Lachman, Caleta Santa Marta, El Morro, Punta Ula, Punta Ekelf, Punta Redonda,
Punta Rabot, Cabo Hamilton) y del occidente de la Pennsula Antrtica (Nunatak Pedersen).
Se analiza la informacin publicada y la obtenida a partir de muestras propias de perfiles
estratigrficos levantados en detalle.

Foraminferos y briozoos. Los foraminferos del Cretcico comprenden 348 taxones


aglutinados, bentnicos calcreos y planctnicos, casi todos del Cretcico Superior, excepto
algunas formas halladas en las islas James Ross, Cerro Nevado y Marambio (Macfadyen,
1966; Holland, 1910). Macfadyen (1966) describi 17 especies del Campaniano superior-
medio, en rocas de Tumbledown Cliffs, actualmente asignadas al Albiano superior. Olivero
(1975) describi 10 especies aglutinadas de la Formacin Snow Hill Island (Refugio Suecia).
Huber (1988) impuls el conocimiento del Campaniano-Daniano, recuper 138 especies
cretcicas (14 planctnicas, 124 bentnicas calcreas y aglutinadas) de las formaciones Snow
Hill Island y Lpez de Bertodano (Is. Cerro Nevado y Marambio) y de la Formacin Snow
Hill Island (Is. Vega y James Ross). En los estratos danianos de la Formacin Sobral (Is.
Marambio) se hall la especie planctnica Globastica daubjergensis y 6 especies bentnicas.
Punta Ekelf (F. Snow Hill Island, SE I. James Ross) result diversa en foraminferos del
Campaniano tardo-Maestrichtiano temprano (Carams et al., 2016). Hradeck et al. (2011)
y Florisbal et al. (2013), en el NO de la I. James Ross, recuperaron foraminferos de las
formaciones Whisky Bay y Hidden Lake (Albiano-Coniaciano) y de la Formacin Santa
Marta (Coniaciano-Santoniano). Gadzicki y Majewski (2012) reportaron foraminferos
eocenos en la Formacin La Meseta (Is. Marambio). Carams y Concheyro (2013) y
Concheyro et al. (2014) estudiaron los foraminferos de las diamictitas de Cabo Lamb, una

208 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

de ellas fue asignada al Pleistoceno, de otra se obtuvo retrabajo cretcico y la ltima brind
un foraminfero autctono con una capa interna idntica a los linings de los preparados
palinolgicos de la misma muestra. Otras microfaunas de las formaciones Hobbs Glacier,
Fiordo Beln, Gage y Terrapin (I. James Ross) se asignaron al Mioceno, Plioceno tardo y
Plioceno tardo-Pleistoceno (Bertels-Psotka et al., 2001; Concheyro et al., 2007; Lirio et al.,
2003). En isla Cockburn se hallaron especies pliocenas y cretcicas retrabajadas (Holland,
1910; Gadzicka y Gadzicki, 1994, Gadzicki y Webb, 1996).
Se reconocieron briozoos en el Eoceno de las formaciones La Meseta, I. Marambio (Hara,
2007, 2015; Taylor et al., 2008), Hobbs Glacier, Mioceno-Plioceno, de islas Marambio y
James Ross (Marenssi et al., 2010; Concheyro et al., 2007) y Weddell Sea, Plioceno superior
de I. Marambio (Gadzicki et al., 2004); en la Formacin Cockburn Island, Plioceno superior,
de I. Cockburn (Gadzicki y Webb, 1996), como as tambin en una diamictita pleistocena
de la I. Vega (Adamonis et al., 2015).
Nanofsiles calcreos. La nanoflora incluye 89 especies mesozoicas y 12 cenozoicas, con
algunas biomarcadoras. Huber et al., (1983) y Farquharson (1983) mencionaron nanofloras
en I. Marambio y en el Nunatak Pedersen, del Campaniano-Maestrichtiano y Turoniano-
Maestrichtiano, respectivamente. Concheyro (2004) y Amenabar et al., (2014a) precisaron
edades campanianas y maastrichtianas para la Formacin Snow Hill Island (Is. Marambio,
Cerro Nevado y James Ross). En las sedimentitas de la Formacin Santa Marta, que aflora
en los Riscos Lachman, se hallaron nanofsiles del Campaniano inferior (vbenick et al.,
2012; Guerra et al., 2015). La nanoflora cretcica ha sido incluida en la Provincia Austral y
presenta afinidad con las del Plateau de Malvinas y Ocano Austral (Wind, 1979). La
Formacin La Meseta (I. Marambio) dio nanofsiles biomarcadores del Ypresiano tardo-
Bartoniano (Concheyro et al., 2016). Una nanoflora retrabajada del Cretcico Superior, con
el primer registro austral de nanocnidos se recuper de una diamictita de la Isla Vega
(Concheyro et al., 2014).
Palinologa. Se registraron cientos de especies marinas y continentales (Amenbar et al.,
2014a). Cranwell (1966) y Hall (1977) analizaron polen, esporas y dinoflagelados de las Is.
Marambio y Cerro Nevado. Askin (1988) caracteriz el lmite K/Pg en la I. Marambio y
present una biozonacin informal para la cuenca basada en dinoflagelados. Baldoni y
Barreda (1986) compararon los palinomorfos antrticos con los de Argentina y Chile.
Dettmann y Thomson (1987) analizaron sedimentitas cretcicas de los grupos Gustav y
Marambio (Is. Marambio, James Ross y Vega). Olivero y Palamarczuk (1987) estudiaron los
dinoflagelados cenomanianos de Tumbledown Cliffs. Pirrie y Riding (1988) analizaron la
palinologa de la I. Humps, asignndola al Campaniano-Maastrichtiano temprano.
Palamarczuk et al., (1990) estudiaron los dinoflagelados de la Formacin Rabot (Punta
Redonda) correlacionndola con la Formacin Santa Marta y en 1992 colegas extranjeros
dieron a conocer resultados palinolgicos en Antarctic Science. di Pasquo y Martin (2013)
presentaron una biozonacin con dinoflagelados de pennsula El Morro. Carams et al.,
(2016) dieron a conocer una asociacin cretcica de Punta Ekelf. Los palinomorfos
continentales de la I. Marambio se utilizaron para reconstruir el paleoclima del K/Pg
(Bowman et al., 2014). Askin et al., (1991) analizaron palinomorfos marinos y continentales
de Is. Marambio, Cockburn y reas adyacentes para el Eoceno y Oligoceno. Wrenn y Hart
(1988) y Bowman et al., (2016) contribuyeron a la bioestratigrafa de dinoflagelados
palegenos de la I. Marambio, mientras que Bowman et al., (2013) y Amenbar et al.,
(2014b) los utilizaron como indicadores paleoambientales. En las diamictitas de Punta Ekelf
y Cabo Lamb se reconocieron palinomorfos retrabajados del Cretcico (Concheyro et al.,

209 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

2014). Recientemente, Concheyro et al., (2016) recuperaron dinoflagelados de la Formacin


La Meseta (I. Marambio) caractersticos de la Flora Transantrtica (Eoceno medio-tardo)
cuestionando la edad eocena temprana considerada previamente por otros autores.

Conclusiones
Las asociaciones micropaleontolgicas y palinolgicas mesozoicas-cenozoicas acotaron las
edades y sugirieron los paleoambientes de las sedimentitas. La exploracin de nuevas
localidades, el incremento del muestreo y la implementacin de novedosas tcnicas de
laboratorio permitirn conocer con mayor detalle la historia geolgica de la cuenca.

Agradecimientos
Al IAA por el soporte logstico-cientfico y al IDEAN-CONICET (contribucin C-136).

Referencias
Adamonis, S., Hara, U. y Concheyro, A. 2015. Late Cenozoic Bryozoa from Diamictites of Cape Lamb, Vega Island,
Antarctic Peninsula. Polish Polar Research, 36(4): 325-341.
Amenbar, C.R., Carams, A., Lescano, M. y Concheyro, A. 2014a. Palinologa y Micropaleontologa del Cretcico de la
Cuenca James Ross, Antrtida. Estado actual del conocimiento. Boletn Geolgico Minero, 125(1):1-26.
Amenbar, C.R., Candel, S. y Guerstein, R.G. 2014b. Small Antarctic Late Cretaceous chorate dinoflagellate cysts:
biological and palaeoenvironmental affinities. Palynology, 38: 303-323.
Askin, R.A. 1988. The palynological record across the Cretaceous/Tertiary transition on Seymour Island, Antarctica. En:
Feldmann, R.M. y Woodburne, M.O. (eds), Geology and Paleontology of Seymour Island, Antarctic Peninsula. Geological
Society of America, Memoir, 169: 155-162.
Askin, R.A., Elliot, D.H., Stilwell, J.D. y Zinsmeister, W.J. 1991.Stratigraphy and Paleontology of Campanian and Eocene
sediments, Cockburn Island, Antarctic Peninsula. Journal of South American Earth Sciences, 4 (1/2): 99-117.
Baldoni, A.M. y Barreda, V. 1986. Estudio palinolgico de las formaciones Lpez de Bertodano y Sobral, isla
Vicecomodoro Marambio, Antrtida. Boletn de IG-USP, Instituto de Geociencias, Universidad de San Paulo, 17: 89-98.
Bertels-Psotka, A., Concheyro, A. y Salani, F.M. 2001. Las Diamictitas de cabo Hamilton, isla James Ross, Antrtida.
Caracterizacin estratigrfica, sus microfsiles. 4 Congreso de Geologa y Minera de la Sociedad Cubana de Geologa
(Habana), en CD-ROM.
Bowman, V.C., Riding, J.B., Francis, J.E., Crame, J.A. y Hannah, M.J. 2013. The taxonomy and palaeobiogeography of
small chorate dinoagellate cysts from the Late Cretaceous to Quaternary of Antarctica. Palynology, 37: 151169.
Bowman, V., Francis, J., Askin, R., Riding, J. y Swindles, G. 2014. Latest CretaceousEarliest Paleogene vegetation and
climate change at the high southern latitudes: palynological evidence from Seymour Island, Antarctic Peninsula.
Palaeogeography, Palaeoclimatology, Palaeoecology, 408: 26-47.
Bowman, V., Ineson, J. Riding, J., Crame, J., Francis, J., Condon, D., Whittle, F., Ferraccioli, F. 2016. The Paleocene of
Antarctica: Dinoflagellate cyst biostratigraphy, chronostratigraphy and implications for the palaeo-Pacific margin of
Gondwana. Gondwana Research, 38: 132-148.
Carams, A. y Concheyro, A. 2013. Late Cenozoic Foraminifera from diamictites of Cape Lamb, Vega Island, Antarctic
Peninsula. Ameghiniana, 50(1): 114-135.
Carams, A., Amenbar, C.R. y Concheyro, A. 2016. Upper Cretaceous foraminifera and palynomorphs from Ekelf coast
Section, Ekelf Point, Eastern James Ross Island, Antarctic Peninsula. Ameghiniana, 53(3): 333-357.
Concheyro, A. 2004. Mesozoic Calcareous Nannofossils from Larsen Basin, Southern Antarctic Peninsula. International
Symposium on the Geology and Geophysics of the Southernmost Andes, the Scotia Arc and the Antarctic Peninsula.
Bolletino di Geofisica teorica ed applicata, 45: 255-257.
Concheyro, A., Salani, F.M., Adamonis, S. y Lirio, J.M. 2007. Los depsitos diamictticos cenozoicos de la cuenca James
Ross, Antrtida: una sntesis estratigrfica y nuevos hallazgos paleontolgicos. Revista de la Asociacin Geolgica
Argentina, 62: 568585.
Concheyro, A., Carams, A., Amenbar, C.R. y Lescano, M. 2014. Nannofossils, foraminifera and microforaminiferal
linings in the Cenozoic diamictites of Cape Lamb, Vega Island, Antarctica. Polish Polar Research, 35(1): 1-26.
Concheyro, A., Amenbar, C.R., Santillana, S., Montes Santiago, M.J. y Borja Nozal Martn, F. 2016. Primer registro de
nanofsiles calcreos en la Formacin La Meseta (Eoceno medio), Isla Marambio, Antrtida. XI Congreso de la Asociacin
Paleontolgica Argentina. Gral. Roca, Resmenes: 126.
Cranwell, L.M. 1966. Senonian dinoflagellates and microspores from Snow Hill and Seymour Island. Journal of the Arizona
Academy of Sciences, 4: 136.
Dettmann, M.E. y Thomson, M.R.A. 1987. Cretaceous palynomorphs from the James Ross Island area, Antarctica-a pilot
study. British Antarctic Survey Bulletin, 77: 13-59.

210 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

di Pasquo, M. y Martin, J.E. 2013. Palynoassemblages associated with a theropod dinosaur from the Snow Hill Island
Formation (Lower Maastrichtian) at the Naze, James Ross Island, Antarctica. Cretaceous Research, 45: 135-154.
Farquharson, G. 1983. Evolution of Late Mesozoic sedimentary basins in the northern Antartic Peninsula. En: Oliver, R.L.,
James, P.R. y Jago, J.B. (eds.) Antarctic Earth Science. Australian Academy of Science, Canberra and Cambridge University
Press, Cambridge: 323-327.
Florisbal, L.S., Kochhann, K.G.D., Baecker-Fauth, S., Fauth, G., Viviers, M.C., De Arajo Carvalho, M. y Rodrigues Cabral
Ramos, R. 2013. Benthic foraminifera, ostracods and radiolarians from the Lachman Crags Member (Santa Marta
Formation), Upper Santonian-Lower Campanian (Upper Cretaceous) of James Ross Island, Antarctica. Revista Brasileira
de Paleontologa, 16(2): 181-196.
Gadzicka, E. y Gadzicki, A. 1994. Recycled Upper Cretaceous calcareous nannoplankton from the Pecten Conglomerate
of Cockburn Island, Antarctica. Polish Polar Research,15: 313.
Gadzicki, A. y Majewski, W. 2012. Foraminifera from the Eocene La Meseta Formation of the Isla Marambio (Seymour
Island), Antarctic Peninsula. Antarctic Science, 24: 408-416.
Gadzicki, A. y Webb, P.N. 1996. Foraminifera from the Pecten Conglomerate (Pliocene) of Cockburn Island, Antarctic
Peninsula. Palaeontologia Polonica, 55: 147174.
Gadzicki, A., Tatur, A., Hara, U. y del Valle, R.A. 2004. The Weddell Sea Formation: post-Late Pliocene terrestrial glacial
deposits on Seymour Island, Antarctic Peninsula. Polish Polar Research, 25: 189-204.
Guerra, R.M., Concheyro, A., Lees, J., Fauth, G., Carvalho, M.A. y Ramos, R.R.C. 2015. Calcareous nannofossils from
the Santa Marta Formation (Upper Cretaceous), northern James Ross Island, Antarctic Peninsula. Cretaceous Research, 56:
550562.
Hall, S.A. 1977. Cretaceous and Tertiary dinoflagellates form Seymour Island, Antarctica. Nature, 267: 239-241.
Hara, U. 2007. Biogeographical relationship of the South America. Antarctic Cenozoic bryozoan biota: The example of
austral genus Aspidostoma in Antarctica: A Keystone in a Changing World. In: A.K. Cooper and C.R. Raymond et al. (eds.)
Proceedings of the 10th ISAES, USGS OpenFile Report 20071047, Extended Abstract: 214.
Hara, U. 2015. Bryozoan internal moulds from the La Meseta Formation (Eocene) of Seymour Island, Antarctic Peninsula.
Polish Polar Research, 36: 2549.
Holland, R. 1910. The fossil foraminifera. Wissenschaftliche Ergebnisse der Schwedischen Sdpolar-Expedition, 190103.
Geologie und Palontologie, 3(9): 112.
Hradeck, L., Vodrka, R. y Nvlt, D. 2011. Foraminifera from the Upper Cretaceous of northern James Ross Island
(Antarctica): a preliminary report. Czech Polar Reports, 1 (2): 88-95.
Huber, B.T. 1988. Upper Campanian-Paleocene foraminifera from the James Ross Island region, Antarctic Peninsula. En:
Feldmann, R.M. y Woodburne, M.O. (eds.), Geological Society of America. Memoir, 169: 163-252.
Huber, B.T., Harwood, D.M. y Webb, P.N. 1983. Upper Cretaceous microfossil biostratigraphy of Seymour Island,
Antarctic Peninsula. Antarctic Journal of the United States, 18(5):72-74.
Lirio, J.M., Nez, H.J., Bertels-Psotka, A. y del Valle, R.A. 2003. Diamictos fosilferos (MiocenoPleistoceno):
Formaciones Beln, Gage y Terrapin en la isla James Ross, Antrtica. Revista de la Asociacin Geolgica Argentina, 58:
298310.
Macfadyen, W.A. 1966. Foraminifera from the Upper Cretaceous of James Ross Island. British Antarctic Survey, Bulletin,
8: 75-87.
Marenssi, S.A., Casadio, S. y Santillana, S.N. 2010. Record of Late Miocene glacial deposits on Isla Marambio (Seymour
Island), Antarctic Peninsula. Antarctic Science 12 (2):193198.
Olivero, E.B. 1975. Perfil geolgico, descripcin de la fauna de amonites y geomorfologa del extremo NE de las islas Cerro
Nevado, Grupo de Islas James Ross, sector Antrtico Argentino. Facultad de Ciencias Exactas y Naturales, Universidad de
Buenos Aires, Tesis de Licenciatura, 48 pp.
Olivero, E.B. y Palamarczuk, S. 1987. Amonites y dinoflagelados Cenomanianos de la isla James Ross, Antrtida.
Ameghiniana, 24: 35-49.
Palamarczuk, S., Lirio J.M. y Marenssi, S. 1990. Dinoflagelados del Cretcico Superior (Campaniano superior) de la
Formacin Rabot en el sudeste de la isla James Ross, Antrtida. VII Reunin de Paleobotnicos e Palinologos. Brasil.
Buletim, 16. USP. Publiao especial.
Pirrie, D. y Riding, J.B. 1988. Sedimentology, palynology and structure of Humps Island, northern Antarctic Peninsula.
British Antarctic Survey Bulletin, 80: 1-19.
vbenick, L., Vodrka, R. y Nvlt, D. 2012. Calcareous nannofossils from the Upper Cretaceous of northern James Ross
Island, Antarctica: a pilot study. Geological Quarterly, 56: 765-772.
Taylor, P., Casadio, S. y Gordon, D. 2008. A rare form of frontal shield development in the new cheilostome bryozoan
genus Uharella from the Eocene of Antarctica. Palontologische Zeitschrift, 82: 262268.
Wind, F.H. 1979. Maestrichtian-Campanian nannofloral provinces of the South Atlantic and Indian Oceans. En: Talwani,
M., Hay, W.W. y Ryan, W.B. (eds.), Results of Deep Drilling in the Atlantic Ocean, American Geophysical Union, Maurice
Ewing, Serie, 3: 124-137.
Wrenn, J.H. y Hart, G.F. 1988. Paleogene dinoflagellate cyst biostratigraphy of Seymour Island, Antarctica. Geological
Society of America. Memoir, 169: 321-447.

211 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

LARGA VIDA EN EL SUR: FENOLOGA, DISTRIBUCIN Y ECOFISIOLOGA


DE LA MOSCA ANTRTICA ALADA, Parochlus steinenii, EN EL SUR DE
SUDAMRICA Y EN LAS ISLAS SHETLAND DEL SUR
(A long-lived life in the southern pole: phenology, distribution and ecophysiology of the
winged midge of Parochlus steinenii through the South Shetland Islands)

Contador, T1,2., Kennedy, J1,2,3., Gaan-Mora, M1, Convey, P4., Simoes, F4,5., Bizama, G6.,
Morales, L6
1
Laboratorio Wankara de Estudios Dulceacucolas, Universidad de Magallanes. 2Programa de Conservacin
Biocultural Subantrtica, Instituto de Ecologa y Biodiversidad. 3Department of Biological Sciences,
University of North Texas, USA. 4British Antarctic Survey, Cambridge, UK. 5Cambridge University, UK.
6
Universidad de Chile

El continente Antrtico ha sido categorizado como un laboratorio natural para los estudios
del cambio climtico a nivel global (Convey 2006) ya que ofrece un conjunto de ecosistemas
clave que permiten mejorar la compresin de las consecuencias del cambio climtico en la
biota terrestre y acutica (Huiskes et al. 2006). Sin embargo, la Antrtida martima, se
caracteriza por presentar climas menos extremos, con temperaturas y precipitaciones ms
elevadas que en el continente (Toro et al. 2007). Adems, pocas especies de vertebrados
terrestres son residentes de la Antrtida y aparte de las aves, la fauna terrestre se compone
principalmente de invertebrados, con solo dos especies de insectos holometbolos (Convey
y Block 1996): Parochlus steinenii y Belgica antarctica (Diptera: Chironomidae). La mosca
antrtica sin alas B. antarctica es endmica y ha sido ampliamente estudiada debido a que
presenta adaptaciones que le permiten vivir en condiciones con temperaturas bajo cero
durante gran parte del ao. P. steinenii presenta un rango de distribucin amplio, que se
extiende desde el sur de Bariloche, en el continente sudamericano, a las Islas Shetland del
Sur en la Antrtida martima. Los objetivos de este estudio son 1) contribuir al conocimiento
actual sobre la distribucin y preferencias de hbitats de P. steinenii en las Islas Shetland del
Sur, 2) estudiar la fenologa y fisiologa de la especie y 3) proporcionar una lnea base para
realizar estudios que permitan proyectar cambios en su fenologa y distribucin como
consecuencia del cambio climtico global.

Materiales y Mtodos
rea de estudio. El estudio se llev a cabo en las islas Shetland del Sur (61-63S, 53-62O),
en las islas Decepcin, Livingston, Roberts, Nelson y Rey Jorge. El clima es caracterstico
de la Antrtida martima, con temperaturas que superan los 0C desde Diciembre a Marzo,
humedad ambiental alta (95%) y precipitaciones anuales de 450 mm aproximadamente
(Hann y Reinhardt 2006).
Metodologa de muestreo, preferencias de hbitat y caractersticas fsico-qumicas. Las
expediciones fueron organizadas por el Instituto Antrtico Chileno (INACH) y se realizaron
a bordo del Buque AP Aquiles durante enero y febrero de 2014 - 2016. Los censos para
determinar la distribucin de P. steinenii se llevaron a cabo en las reas libres de hielo de las
islas mencionadas y en dos zonas de la Pennsula Antrtica (alrededores de la base Antrtica
Chilena OHiggins y la isla Litchfield). Se busc exhaustivamente en todos los ros, arroyos,
lagunas y lagos accesibles durante un periodo de 3-6 horas, dependiendo de las condiciones
climticas. La presencia/ausencia se determin revisando la orilla de cada hbitat,

212 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

confirmando la presencia de larvas, pupas o adultos bajo piedras, rocas, sedimento y


vegetacin sumergida. Para determinar la preferencia de hbitat de la especie, se identificaron
hbitats permanentes (lagos y ros profundos) y no permanentes (lagunas o pozas poco
profundas) segn Hahn y Reinhardt (2006). Adems, se caracterizaron tres tipos de
microhbitats en cada lugar de muestreo: rocas y sedimento (arena y piedras de 320 cm),
musgos y lquenes acuticos y pingineras (pozas o arroyos cercanos a sitios de anidamiento
de pinginos). Cada sitio visitado fue georeferenciado con un GPS modelo Garmin 78s. Se
instalaron data loggers de temperatura HOBO (modelo U22 Water Temp Pro v2) en dos
sitios permanentes (lagos Kitiesh y Langer) en la Isla Rey Jorge para registrar la temperatura
mnima, mxima y promedio del agua.
Fenologa y Tolerancias trmicas. Se colectaron especmenes vivos (larvas, pupas y
adultos) desde dos lagos de la isla Rey Jorge. Los individuos fueron crados desde huevo-
adulto, en el Laboratorio Wankara de estudios dulceacucolas en Isla Navarino y se
calcularon Grados Das de Desarrollo (Growing Degree Days). Se realizaron ensayos
experimentales para cada etapa de desarrollo, siguiendo el Mtodo Dinmico de Crticos
Trmicos, para obtener el CTmin y CTmax. Durante cada ensayo, 6 especmenes fueron
colocados individualmente en contenedores de plstico, para luego ser sumergidos en un
bao de agua digital termorregulado.
Prediccin de distribucin actual y potencial. Se desarrollaron capas climticas utilizando
datos desde 1960-2015 desde la AWS del British Antarctic Survey y AEMET. Los modelos
de distribucin espcial fueron obtenidos utilizando MaxENT, ENMTools, PostGIS, Qgis,
Quantarctica y R.
Anlisis espaciales y estadsticos. Se realiz un anlisis espacial de proximidad con el
software PostGIS. Se utilizaron anlisis de procesos espaciales puntuales univariables
(RStudio, Versin 0.98.1102, paquetes Spatstat y Maptools) para analizar la distribucin de
P. steinenii en las Islas Shetland del Sur. Para evaluar el tipo de distribucin observada (Ho:
P. steinenii presenta una distribucin espacial completamente aleatoria), se utiliz el modelo
de intensidad constante de Poisson o de Complete Spatial Randomness (CSR) (Baddeley
2000, 2005). Especficamente, se utiliz el anlisis univariado del K de Ripley, utilizando el
rea total las islas inspeccionadas. Los resultados fueron analizados utilizando la funcin L(r)
r, la cual es una transformacin de la funcin K de Poisson con un valor constante = 0.

Resultados
Distribucin de P. steinenii en las Islas Shetland del Sur. De los 37 puntos de ocurrencias
obtenidos, 26 son puntos de presencia de P. steinenii y 11 puntos de ausencia, situndose las
presencias en las Shetland del Sur, principalmente en la islas Rey Jorge, Livingston y
Decepcin (Figura 1). Las tablas de proximidad calculadas muestran que el 77% de los
puntos de presencia de P. steinenii se encuentran a menos de 3.5 km de distancia, siendo los
lagos ms cercanos entre ellos Limnopolar con Somero a 0.6 km de distancia (isla
Livingston), Crter con Zapatilla a 0.8 km de distancia (isla Decepcin) y Langer con Tern
a 1.8 km (isla Rey Jorge).

213 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 1. A) Distribucin actual y


potencial de Parochlus steinenii a lo
largo de las islas Shetland del Sur. B)
rea de influencia (buffer) de 3.5 km en
las zonas de presencia de P. steinenii.
Figure 1. A) Current and potential
distribution of Parochlus steinenii
along the South Shetland Islands. B)
area of influence (buffer) of 3.5 km in
the areas of presence of P. steinenii.

Preferencias de hbitats y
caractersticas fsico-qumicas. El anlisis de la distribucin de P. steinenii en cuanto a su
preferencia de hbitat, indica que en general prefiere hbitats permanentes a no permanentes,
(Test de Chi-cuadrado, p < 0.0001), siendo encontrado principalmente en las orillas de lagos
profundos, bajo rocas y sedimento fino o entre musgos y lquenes sumergidos (Test de Chi-
cuadrado, p = 0.0007). En general, no existen diferencias significativas en las caractersticas
fsico-qumicas entre hbitats permanentes y no permanentes durante los eventos de
muestreo. El anlisis de procesos espaciales puntuales seala que P. steinenii presenta una
distribucin agregada a lo largo de las islas estudiadas. Se observa que generalmente, hay
una mayor densidad de presencias en la Islas Livingston, Rey Jorge y Decepcin, lo que se
puede confirmar por la funcin de Ripley L(r)-r obtenida para la distribucin de P. steinenii
(Test de Montecarlo p= 0.039).
Tolerancias trmicas y fenologa. Los datos de temperatura del agua, registrados para dos
lagos habitados por P. steinenii en la isla Rey Jorge, muestran un periodo de temperaturas
sobre 0oC, entre noviembre y marzo de cada ao. Adems, P. steinenii presenta un rango
amplio de tolerancias trmicas, alcanzando un rango ptimo entre los 0-15oC. Su fenologa
es de carcter merovoltina
(una generacin de
adultos cada tres aos)
(Figura 2).
Figura 2. Fenologa de P.
steinenii desde 2014-2016 en
el Lago Kitiesh, Isla Rey
Jorge. Las lneas de color rojo,
verde, negro, naranja y azul
indican las generacin de
adultos en eclosin. Figure 2.
Phenology of P. steinenii from
2014-2016 on Lake Kitiesh,
King George Island. The lines
of red, green, black, orange
and blue indicate the
generation of adults in hatching.

214 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Discusin y Conclusiones
Con respecto a la distribucin de P. steinenii en las Islas Shetland del Sur, se puede concluir
que presenta una distribucin agrupada, siendo las islas Livingston y Rey Jorge las que
presentan el mayor nmero de presencias registradas por este estudio (Figura 1). Por otro
lado, su distribucin potencial incluye la Pennsula Antrtica, en dnde no ocurre
actualmente (Indice de Boyle, 0.98). Es importante sealar que estas islas presentan las reas
libres de hielo de mayor tamao entre las Shetland del Sur y que poseen un gran nmero de
lagos permanentes y otros cuerpos de agua dulce temporales, generados por el deshielo
durante la poca de verano. Los sitios permanentes proveen el hbitat ideal para P. steinenii:
lagos profundos con un nivel de agua estable, ros y arroyos con orillas rocosas y/o musgos
y lquenes acuticos. Con estos antecedentes, se podra concluir que probablemente P.
steinenii no sea una especie generalista en su eleccin de hbitats, ya que en cuanto a la
Antrtida martima se refiere, se vera restringida a lagos y otros cuerpos de agua dulce
permanentes. Esta especificidad en hbitat permitira que P. steinenii pueda ser utilizado
como una especie indicadora de los procesos asociados al cambio climtico global, por al
menos dos razones: a) cualquier cambio en las condiciones actuales (ej. aumento en reas
libres de hielo) podra inducir una expansin en su distribucin a sitios en los que actualmente
no se registra su presencia (otras islas en las Shetland del Sur o la Pennsula Antrtica) ya
que adems, presenta un rango trmico ptimo amplio y b) un aumento en las temperaturas
actuales podra generar cambios en los patrones fenolgicos, alargando o acortando su
periodicidad.

Agradecimientos
Agradecemos el soporte entregado por el proyecto INACH 48_16, FONDECYT 11130451
e INACH (Fl_03-13) otorgados a Tamara Contador.
Referencias
Baddeley, A., Turner, R. (2000): Practical maximum pseudolikelihood for spatial point patterns. Australia
and New Zealand Journal of Statistics, 42, 283322.
Baddeley, A., Turner, R. (2005): Spatstat: an R package for analyzing spatial point patterns. Journal of
Statistical Software, 12, 142.
Convey, P., Block, W. (1996): Antarctic Diptera: Ecology, physiology and distribution European Journal of
Entomology 93, 1-13.
Convey, P. (2006): Antarctic climate change and its influences on terrestrial ecosystems, En D.M. Bergstrom,
P. Convey, and A.H.L. Huiskes, (eds.), Trends in Antarctic Terrestrial and Limnetic Ecosystems: Antarctica as
a Global Indicator, Springer, Dordrecht.
Hahn, S., Reinhardt, K. (2006): Habitat preference and reproductive traits in the Antarctic midge Parochlus
steinenii (Diptera: Chironomidae). Antarctic Science, 18(02), 175.
Huiskes, A.H.L, Convey, P., Bergstrom, D.M (2006): 1. Trends in Antarctic terrestrial and limnetic
ecosystems: Antarctica as a global indicator En D.M. Bergstrom, P. Convey, and A.H.L. Huiskes, (eds.),
Trends in Antarctic Terrestrial and Limnetic Ecosystems: Antarctica as a Global Indicator, Springer, Dordrecht.

215 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

POTENCIAL BIOTECNOLGICO DE EXTRACTOS DE COLOBANTHUS


QUITENSIS COMO BIOCONTROLADOR DE HONGOS FITOPATGENOS
NECROTRFICOS
(Biotechnological potential of extracts from Colobanthus quitensis as a biocontrol of
necrotrophic fungal phytopathogens)

Contreras, R.A.1; Pizarro, M.1; Gonzlez-Coloma, A.2; Mendoza, L.3 y Ziga, G.E.1
1
Laboratorio de Fisiologa y Biotecnologa Vegetal, Departamento de Biologa, Facultad de Qumica y
Biologa, Universidad de Santiago de Chile, Santiago, Chile. rodrigo.contrerasar@usach.cl,
marisol.pizarro@usach.cl, gustavo.zuniga@usach.cl. 2Laboratorio de Bioplaguicidas, Instituto de Ciencias
Agrarias (ICA), Consejo Superior de Investigaciones Cientficas (CSIC), Madrid, Espaa. azu@ica.csic.es.
3
Laboratorio de Micologa, Departamento de Qumica de los Materiales, Facultad de Qumica y Biologa,
Universidad de Santiago de Chile, Santiago, Chile. leonora.mendoza@usach.cl.

La presin de seleccin existente en el territorio Antrtico martimo ha generado una


restringida biodiversidad, lo que incluye a las plantas vasculares, de las cuales tan solo se ha
determinado la presencia de dos especies nativas (Alberdi et al. 2002). Una de ellas es
Colobanthus quitensis, una angiosperma dicotilednea de la familia de Caryophyllaceae, de
la cual se tiene muy poca informacin metabolmica. El ambiente inhspito general de su
hbitat ha permitido que esta especie evolucione con determinados mecanismos que le
permiten completar su ciclo de vida (Convey, 1996), dichos mecanismos de supervivencia
son transversales y permitiran proyectar aplicaciones secundarias, una de ellas el biocontrol
de plagas. Chile tiene como una de sus principales actividades econmicas la industria
frutcola, la que se ve altamente impactada por la presencia de fitopatgenos, como hongos
necrotrficos que generan prdidas significativas (Latorre et al. 2015). Considerando la
habilidad natural de C. quitensis para sobrevivir en ambientes inhspitos es que se evalu el
potencial fungicida de sus metabolitos, utilizando como modelo el hongo necrotrfico
Botrytis cinerea.

Materiales y Mtodos
Material vegetal. Plntulas de C. quitensis fueron cultivadas in vitro (Ziga et al. 2008) a
142 C con fotoperodo de 18/6 h luz/oscuridad. Uvas de mesa cv. Red Globe fueron
obtenidas desde el comercio en Santiago de Chile.
Preparacin de extractos. 30g de tejido fresco de C. quitensis fue pulverizado en nitrgeno
lquido hasta obtener un polvo fino, posteriormente se extrajo con 100 mL de metanol (J.T.
Baker, grado HPLC). La mezcla fue sonicada a 50 Hz por una hora a 25 C. La solucin fue
filtrada en papel Whatman n2, el filtrado fue lavado tres veces sucesivas con n-hexano
(Merck, grado HPLC), la fraccin metanlica fue recuperada y llevada a sequedad en
rotavapor. El producto slido fue resuspendido en metanol a una concentracin de 100
mg/mL.
Ensayo de inhibicin de conidios. B. cinerea fue crecido en medio Saboraud lquido
(Merck) a 22 C por 48 h (Ribera et al. 2008). Un volumen de 100 L de cultivo con 3E5
conidios/mL fue subcultivado en 2.8mL de medio Saboraud lquido y se agregaron diluciones
seriadas de 100 L de extracto metanlico de C. quitensis desde cero (control) a 1mg/mL. El
cultivo fue mantenido en agitacin a 22 C por 48 h. Alcuotas de 20 L fueron obtenidas

216 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

para determinar el contenido de conidios utilizando cmara de Neubauer, utilizando azul de


lactofenol (Merck) como colorante. Los resultados fueron expresados como conidios/mL.
Inhibicin del crecimiento radial de micelios. Inculos de 3E5 conidios/mL fueron
crecidos en agar papa dextrosa (PDA, Merck) durante 72 h a 22 C en oscuridad.
Posteriormente, discos de 1 mm de micelio saturado fueron puestos en el medio de placas de
PDA previamente tratadas con diluciones seriadas de extracto metanlico de C. quitensis
desde cero (control) a 1 mg/mL. El crecimiento fue monitoreado a las 8, 24, 48 y 72h. La
tasa de crecimiento se obtuvo a partir de la derivada de la curva de crecimiento radial para
cada caso (Ribera et al. 2008).
Bioensayos en uva de mesa cv. Red Globe. Uvas de mesa fueron esterilizadas
superficialmente lavando con hipoclorito de sodio al 5% y 0.5% de tween-20, posteriormente
se aplic una capa de extracto metanlico disuelto en goma geln al 2%. Se utiliz diluciones
seriadas entre cero (control) y 400 g/mL. Sobre las uvas se aplic un inculo de micelio
saturado de B. cinerea y se mantuvo a 22 C en oscuridad, al cabo de 72 h se evalu el
crecimiento del hongo y cmo parmetros de calidad de la uva se determin el contenido de
azcares totales mediante el mtodo de antrona sulfrica (Zuiga et al. 1996) y el contenido
de antocianinas totales (Giusti y Wrolstad 2001).
Anlisis estadsticos. Todos los experimentos fueron realizados por triplicado y las
diferencias significativas fueron determinadas por anlisis de varianza (ANOVA) utilizando
el software GraphPad Prism 6.

Resultados y Discusin
Actividad antifngica de extractos polares de C. quitensis. En primer lugar, se obtuvo un
extracto polar a partir la separacin lquido-lquido, de color amarillo oscuro (Fig.1).

Figura 1. Fotografa del cultivo in vitro de C. quitensis (A) y del extracto polar (B). Figure 1. Picture of in
vitro culture of C. quitensis (A) and the polar extract (B)).

En orden para analizar su actividad biolgica, en primer lugar se analiz el efecto sobre el
cultivo lquido de conidios de B. cinerea. Se determin que el extracto de C. quitensis gener
un decrecimiento exponencial en el nmero de conidios en el cultivo lquido (Fig. 2A),
determinando una concentracin inhibitoria del 50% (IC50) de 95 g/mL. En segundo lugar
se determin el mismo efecto, pero en el desarrollo de micelios de B. cinerea, en este caso,
se determin una IC50 de 68.7 g/mL (Fig. 2B), adicionalmente se observ que la extensin
miceliar es completamente inhibida desde 500 g/mL (Fig. 2B y 2C).

217 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 2. Actividad fungicida del extracto polar de C. quitensis. Efecto en conidios (A) y micelios (B y C).
n=3, P<0.05. Figure 2. Fungicidal activity of polar extract of C. quitensis).

Bioensayos sobre uva de mesa. En primer lugar se determin el efecto del extracto en
recubrimientos basados en goma geln, un recubrimiento comestible (Danalache et al. 2016).
A partir de concentraciones de 100 g/mL de extracto de C. quitensis no se observ daos
aparentes sobre el tejido de la fruta, manteniendo su apariencia respecto al control negativo
(sin inocular con hongo) (Fig. 3).

Figura 3. Bioensayo de actividad botricida sobre uva de mesa cv. Red Globe. Los controles se presentan en
(A), control negativo sin inocular y control positivo (inoculado con B. cinerea), el bioensayo de la pelcula
comestible se observa en (B), en donde el control positivo corresponde a la goma geln sin extracto y luego
las respectivas diluciones del extracto. Figure 3. Bioassay of botricidal activity in table grape cv. Red Globe).

Finalmente, con el objetivo de determinar la calidad de los frutos, se determin el contenido


de azcares y antocianinas en exocarpo (cscara) y mesocarpo (pulpa) de las uvas de mesa.
El contenido de azcares representa una medida para el sabor (Liu et al. 2006), mientras que
las antocianinas para el color de los frutos (Mazza y Francis, 1995).
Tanto para el caso de azcares totales, as como el contenido de antocianinas, se determin
que la infeccin con B. cinerea gener una disminucin del contenido de ambos grupos de
metabolitos, debido a que el hongo los utilizara como fuente de carbono (Agudelo-Romero
et al. 2015). En uvas tratadas con extracto, se determin que ambos grupos de metabolitos
mantienen su concentracin sin diferencias significativas respecto al control negativo (sin
inocular) (Fig. 4), correlacionando con lo observado en trminos de infeccin (Fig. 3), por lo

218 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

que el extracto protegera no solo de la infeccin, sino que tambin mantendra la calidad de
los frutos.

Figura 4. Parmetros de calidad de uvas de mesa inoculadas con B. cinerea. En primer lugar se presenta el
contenido de azcares totales (A) y en segundo lugar el contenido de antocianinas totales (B). n=3, P<0.05.
Figure 4. Quality parameters of table grapes inoculated with B. cinerea.

Conclusiones
Extractos polares de C. quitensis tienen el potencial para controlar el desarrollo e infeccin
de hongos necrotrficos como B. cinerea, tanto in vitro, como in vivo. Esto proyecta a esta
especie como fuente de metabolitos de inters biotecnolgico para su uso como
biocontrolador de plagas para la agricultura. Para finalizar esta investigacin, queda
determinar el mecanismo de accin del extracto, as como su composicin qumica.

Agradecimientos
Financiado por Fondecyt 3160274 (RAC).

Referencias
Agudelo-Romero P, Erban A, Rego C, Carbonell-Bejerano P, Nascimento T, Sousa L, Martnez-Zapater JM,
Kopka J y Fortes AM (2015). Transcriptome and metabolome reprogramming in Vitis vinifera cv. Trincadeira
berries upon infection with Botrytis cinerea. Journal of Experimental Botany 66 (7):1769-1785.
Alberdi M, Bravo LA, Gutirrez A, Gidekel M y Corcuera LJ (2002). Ecophysiology of Antarctic vascular
plants. Physiologia Plantarum 115 (4):479-486.
Convey P (1996). Reproduction of Antarctic flowering plants. Antarctic Science 8 (2):127-134.
Danalache F, Carvalho CY, Alves VD, Moldo-Martins M y Mata P (2016). Optimisation of gellan gum edible
coating for ready-to-eat mango (Mangifera indica L.) bars. International Journal of Biological Macromolecules
84:43-53.
Giusti MM y Wrolstad RE (2001). Characterization and Measurement of Anthocyanins by UV-Visible
Spectroscopy. In: Current Protocols in Food Analytical Chemistry. John Wiley & Sons, Inc.
Latorre BA y Elfar K, Ferrada EE (2015) Gray mold caused by Botrytis cinerea limits grape production in
Chile. Ciencia e investigacin agraria 42:305-330
Liu H-F, Wu B-H, Fan P-G, Li S-H y Li L-S (2006). Sugar and acid concentrations in 98 grape cultivars
analyzed by principal component analysis. Journal of the Science of Food and Agriculture 86 (10):1526-1536.
Mazza G y Francis FJ (1995). Anthocyanins in grapes and grape products. Critical Reviews in Food Science
and Nutrition 35 (4):341-371.
Ribera A, Cotoras M y Ziga GE (2008). Effect of extracts from in vitro-grown shoots of Quillaja saponaria
Mol. on Botrytis cinerea Pers. World Journal of Microbiology and Biotechnology 24 (9):1803.
Zuiga GE, Alberdi M y Corcuera LJ (1996). Non-structural carbohydrates in Deschampsia antarctica Desv.
from South Shetland Islands, Maritime Antarctic. Environmental and Experimental Botany 36 (4):393-399.
Ziga GE, Zamora P, Ortega M y Obrecht A (2008). Short Note: Micropropagation of Antarctic Colobanthus
quitensis. Antarctic Science 21 (2):149-150.

219 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

EFECTOS DEL CAMBIO CLIMTICO REGIONAL SIMULADO EN PLANTAS


ANTRTICAS NATIVAS (Colobanthus quitensis Y Deschampsia antarctica) Y NO
NATIVAS (Poa annua Y Juncus bufonius)
(Effects of simulated regional climate change on natives (Colobanthus quitensis and
Deschampsia antarctica) and non-natives (Poa annua and Juncus bufonius) antartic plants)

Contreras, P.1, Vsquez, D.1, Navarrete, E.2, Rivera, C.1 y Cuba-Daz, M.1,2*
1
Laboratorio de Biotecnologa y Estudios Ambientales, 2Departamento de Ciencias y Tecnologa Vegetal,
Escuela de Ciencias y Tecnologa, Universidad de Concepcin, Campus Los ngeles, Chile. e-mail:
paolcontreras@udec.cl, *mcuba@udec.cl.

El continente antrtico presenta condiciones climticas extremas (Alberdi et al. 2002), sin
embargo, no ha quedado exento del cambio climtico; las temperaturas en la Antrtica
pueden aumentar en +0.56C por dcada (Turner et al. 2009) por lo que para los prximos
50 aos se espera un aumento de ms de 2C de la temperatura promedio en verano (6C)
(Edwards & Smith, 1988). Este aumento de la temperatura generar un aumento de un 40%
de la disponibilidad hdrica (Molina-Montenegro et al. 2012) lo que podra beneficiar el
establecimiento de especies invasoras como Juncus bufonius y Poa annua, traducindose en
un efecto negativo sobre las especies nativas Colobanthus quitensis y Deschampsia
antarctica. Esto se podra atribuir a una competencia interespecfica entre estas especies
(Molina-Montenegro et al. 2012; 2015), es por ello que el objetivo de este trabajo fue analizar
la respuesta de las cuatro especies vasculares presentes en la Antrtica frente a un cambio
climtico regional simulado.

Materiales y Mtodos
Se utilizaron 80 plantas de cada una de las especies, C. quitensis y D. antarctica (nativas) y
J. bufonius y P. annua (no nativas), las cuales fueron sometidas a un periodo de aclimatacin-
irrigacin de 30 das a dos temperaturas; 6C (temperatura promedio alcanzada en verano) y
8C (temperatura aprox. alcanzada con el cambio climtico en cmaras de cultivo) y con dos
regmenes hdricos, uno con riego disminuido, con respecto a lo descrito por Molina-
Montenegro et al. 2012 (H2O) y uno con 40% ms de agua (+H2O), un periodo de dficit
hdrico entre los das 30 y 44 para simular un periodo de prdida de agua por congelamiento
del suelo y finalmente, se instaur el sistema de riego hasta el da 74 (periodo de
recuperacin). Al final de cada periodo se estimaron las siguientes razones a partir de
variables morfolgicas: largo raz/largo foliar, ancho de hoja/largo de hoja, nmero de hojas,
brotes y flores.

Resultados y Discusin
Colobanthus quitensis (Tabla 1) en el perodo de aclimatacin-irrigacin present una
relacin largo raz/largo foliar significativamente mayor a 8C en ambas condiciones hdricas
pero en el tratamiento 8C H2O disminuy significativamente durante la etapa de dficit
hdrico, indicando que el aumento de la temperatura beneficiara a esta especie pero este
crecimiento es afectado por la falta de agua. Resultados similares con un incremento
significativo en el largo de planta al aumentar la temperatura y la disponibilidad hdrica ha
sido observado en esta especie (Fuentes et al. 2017). El nmero de hojas no mostr
diferencias en el periodo de irrigacin, increment significativamente para el tratamiento 8C

220 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

+H2O durante el perodo de dficit hdrico lo que se mantuvo durante la recuperacin, periodo
donde se observ un mayor incremento del nmero de hojas a 6C independientemente de la
condicin hdrica pero sin diferencias significativas con 8C +H2O. Esto podra estar
relacionado con los mecanismos de aclimatacin especficos de esta especie a su hbitat,
donde despus de un breve tiempo de aclimatacin, podra adaptarse gradualmente a
condiciones especficas de su ambiente extremo (Parnikoza et al. 2011).

Tabla 1. Efecto combinado de la temperatura y la disponibilidad hdrica en las razones largo raz/largo foliar
(cm) y ancho de hoja/largo de hoja (mm), el nmero de hojas, brotes y flores en la especie Colobanthus
quitensis al finalizar los periodos de aclimatacin-irrigacin, deshidratacin y recuperacin. Table 1.
Combined effect of temperature and water availability on root length/leaf length (cm) and leaf width/leaf
length (mm) ratios, the number of leaves, shoots and flowers in the species Colobanthus quitensis at the end
of the acclimation-irrigation, dehydration and recovery periods.

Los valores presentados corresponden a la Media Desviacin estndar. Letras iguales no difieren
estadsticamente (p<0,05). The values presented correspond to the mean standard deviation. Equal letters do
not differ statistically (p<0.05).

En Deschampsia antarctica (Tabla 2), ya en el periodo de aclimatacin-irrigacin se pudo


observar un efecto significativamente positivo de la temperatura en la relacin largo
raz/largo foliar, con valores mayores a 8C, independientemente de la disponibilidad hdrica.
En cambio, en el periodo de recuperacin, esta relacin incremento positivamente en el
tratamiento 6C +H2O sin observarse diferencias significativas con ambos tratamientos a
8C, indicando un mayor crecimiento a mayor temperatura pero donde la disponibilidad
hdrica es ms relevante an a temperaturas ms bajas (6C+H2O). Molina-Montenegro et
al. (2015) observaron un incremento de la biomasa total en plantas de D. antarctica evaluadas
en condiciones similares de incremento de temperatura y disponibilidad hdrica. Los
resultados anteriormente descritos son respaldados por el aumento significativo de hojas
durante el perodo de recuperacin con respecto a las etapas de aclimatacin-irrigacin y
dficit hdrico, con excepcin del tratamiento 6 H2O que solo present diferencias
significativas con respecto al perodo de irrigacin.

221 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Tabla 2. Efecto combinado de la temperatura y la disponibilidad hdrica en las razones largo raz/largo foliar
(cm) y ancho de hoja/largo de hoja (mm), el nmero de hojas, brotes y flores en la especie Deschampsia
antarctica al finalizar los periodos de aclimatacin-irrigacin, deshidratacin y recuperacin. Table 2.
Combined effect of temperature and water availability on root length/leaf length (cm) and leaf width/leaf
length (mm) ratios, the number of leaves, shoots and flowers in the species Deschampsia antarctica at the end
of the acclimation-irrigation, dehydration and recovery periods.

Los valores presentados corresponden a la Media Desviacin estndar. Letras iguales no difieren
estadsticamente (p<0,05). The values presented correspond to the mean standard deviation. Equal letters do
not differ statistically (p<0.05).

Juncus bufonius (Tabla 3) en general evidenci una tendencia a presentar mayores relaciones
largo raz/largo foliar en todos los tratamientos en el periodo de aclimatacin-irrigacin, con
una disminucin en el periodo de dficit hdrico, pero solo significativo a 8C +H2O. En la
recuperacin la tendencia fue a continuar disminuyendo esta relacin sin observarse
diferencias significativas entre los tratamientos, esto evidenciara que ms que el incremento
de la temperatura y la disponibilidad hdrica, un periodo de dficit hdrico afectara
notoriamente la recuperacin de esta especie. Recientemente se observ que el incremento
de temperatura y disponibilidad hdrica influenci positivamente el largo foliar en esta
especie (Fuentes-Lillo et al. 2017) y previamente se ha establecido que esta especie es muy
susceptible al dficit hdrico (Cope & Stace, 1978). Una tendencia similar sigue la relacin
largo foliar/ancho foliar (Tabla 3). El aumento de la temperatura favoreci en incremento en
el nmero de hojas y brotes, con cierta tendencia a mostrar mejores valores con mayor
disponibilidad hdrica, resultados similares observaron (Fuentes-Lillo et al. 2017).

Tabla 3. Efecto combinado de la temperatura y la disponibilidad hdrica en las razones largo raz/largo foliar
(cm) y ancho de hoja/largo de hoja (mm), el nmero de hojas, brotes y flores en la especie Juncus bufonius al
finalizar los periodos de aclimatacin-irrigacin, deshidratacin y recuperacin. Table 3. Combined effect of
temperature and water availability on root length/leaf length (cm) and leaf width/leaf length (mm) ratios, the
number of leaves, shoots and flowers in the species Juncus bufonius at the end of the acclimation-irrigation,
dehydration and recovery periods.

222 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Los valores presentados corresponden a la Media Desviacin estndar. Letras iguales no difieren
estadsticamente (p<0,05). The values presented correspond to the mean standard deviation. Equal letters do
not differ statistically (p<0.05).

Poa annua (Tabla 4) fue favorecido por la temperatura ms alta en todos los periodos, con
cierta tendencia a disminuir la relacin largo raz/largo foliar durante el dficit hdrico pero
sin diferencias significativas. Resultados similares obtuvieron Molina-Montenegro et al.
(2015) quienes observaron un incremento en la biomasa de P. annua en un estudio cambio
climtico simulado. El nmero de hojas y brotes incremento durante todo el estudio para
alcanzar los mximos valores al final, lo que evidencia que la especie es favorecida por estas
condiciones y que el dficit hdrico temporal no la afecta.

Tabla 4. Efecto combinado de la temperatura y la disponibilidad hdrica en las razones largo raz/largo foliar
(cm) y ancho de hoja/largo de hoja (mm), el nmero de hojas, brotes y flores en la especie Poa annua al
finalizar los perodos de aclimatacin-irrigacin, deshidratacin y recuperacin. Table 4. Combined effect of
temperature and water availability on root length/leaf length (cm) and leaf width/leaf length (mm) ratios, the
number of leaves, shoots and flowers in the species Poa annua at the end of the acclimation-irrigation,
dehydration and recovery periods.

Los valores presentados corresponden a la Media Desviacin estndar. Letras iguales no difieren
estadsticamente (p<0,05). The values presented correspond to the mean standard deviation. Equal letters do
not differ statistically (p<0.05).

223 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Conclusiones
Las especies nativas se vieron levemente favorecidas por el aumento de la temperatura, sin
embargo, su crecimiento se vio limitado por el perodo de dficit hdrico; D. antarctica, vio
afectado su crecimiento a bajas temperaturas con menor disponibilidad hdrica. J. bufonius
se vio favorecido con el aumento de temperaturas y disponibilidad hdrica pero el perodo de
dficit hdrico afect de forma significativa su crecimiento teniendo dificultades para
recuperarse. Poa annua se vio favorecida con el aumento de la temperatura y disponibilidad
hdrica y el perodo de dficit hdrico no afect de forma significativa su crecimiento. La
especie Poa annua present un mejor desarrollo frente a las dems especies vindose
favorecida por el cambio climtico.

Agradecimientos
Proyectos INACH RG_02-13 y Fondecyt-INACH 1140441.
Referencias
Alberdi, M., Bravo, L.A., Gutierrez, A., Gidekel, M., Corcuera, L.J. 2002. Ecophysiology of antartic vascular
plants. Physiology Plantarum, 115: 479-486.
Edwards JA, Smith RIL. 1988. Photosynthesis and respiration of Colobanthus quitensis and Deschampsia
antarctica from the Maritime Antarctic. Br Antarct Surv Bull 81: 43-63
Cope, T.A., Stace, C.A. 1978. The Juncus bufonius L. aggregate in Western Europe. Watsonia, 12: 113128
Fuentes-Lillo E., Cuba-Daz M., Rifo S. 2017. Morpho-physiological response of Colobanthus quitensis and
Juncus bufonius under different simulations of climate change. Polar Science 11: 11-18.
Molina-Montenegro M., Carrasco-Urra F., Rodrigo C., Convey P., Valladares F., Gianoli E. 2012. Occurrence
of the Non-Native Annual Bluegrass on the Antarctic Mainland and Its Negative Effects on Native Plants.
Conservation Biology, 26: 717723.
Molina-Montenegro M, Galleguillos C, Oses R, Acua-Rodrguez I, Lavn P, Gallardo-Cerda J, Torres-Daz
C, Diez B, Pizarro G, Atala C. 2015. Adaptive phenotypic plasticity and competitive ability deployed under a
climate change scenario may promote the invasion of Poa annua in Antarctica. Biol invasions, 8: 1-16
Molina-Montenegro M., Torres C., Carrasco F., Gonzles L., Gianoli E. 2012. Plasticidad fenotpica en dos
poblaciones antrticas de Colobanthus quitensis (Caryophyllaceae) bajo un escenario simulado de cambio
global. Gayana Bot, 69: 152-160.
Parnikoza I., Kozeretska I., Kunakh V. 2011. Vascular Plants of the Maritime Antarctic: Origin and Adaptation.
American Journal of Plant Sciences, 2: 381-395.
Turner J., Bindschadler R., di Prisco, Convey P., Fahrbach E., Gutt J., Hodgson D., Mayewski P., Summerhayes
C. (Eds.). 2009. Antarctic Climate Change and the Environment. Scientific Committe on Antarctic Research,
50: 237-259.

224 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

MONITORAMENTO DE LONGO PRAZO DOS IMPACTOS ANTRPICOS DA


ESTAO ANTRTICA BRASILEIRA COMANDANTE FERRAZ (ILHA REI
GEORGE): ANLISE DE ISTOPOS ESTVEIS DE C E N
(Long-term monitoring of anthropogenic impacts from the Brazilian Antarctic Station
Comandante Ferraz (King George Island): Stable isotope analysis of C and N)

Corbisier, T.N.1, Bromberg, S.1, Gheller, P.F.1, Monteiro, G.S.C., Petti, M.A.V.1
1
Instituto Oceanogrfico, Universidade de So Paulo, Departamento de Oceanografia Biolgica, Praa do
Oceanogrfico 191, 05508-120 So Paulo, Brazil. E-mail: tncorbis@gmail.com

O estudo de teias trficas importante para compreender os processos e o funcionamento


dos ecossistemas (Libralato et al., 20154). Esse conhecimento tambm pode prover
informao sobre a variao espacial ou temporal nas comunidades marinhas causadas por
impactos naturais ou humanos no ambiente. Istopos estveis vm sendo usados para traar
a transferncia da matria orgnica de diferentes origens ao longo das teias trficas (Peterson,
1999). As assinaturas isotpicas no tecido dos consumidores esto relacionadas composio
isotpica de sua dieta (Voc o que voc come). Ocorre um enriquecimento dos istopos
mais pesados entre o consumidor e seu alimento, p.ex. de carbono (13C/12C) e nitrognio
(15N/14N) em cerca de 1 e 3-5, respectivamente (Fry 2006). As razes de C e N
(expressas como 13C e 15N) so utilizadas para indicar a fonte de matria orgnica e o 15N,
tambm o nvel trfico.
A eutrofizao ou o aumento da carga orgnica nos ambientes marinhos costeiros podem ser
resultado de contribuies de efluentes de esgoto. A anlise dos istopos estveis de C ou N
tambm til para identificar a fonte, a extenso e o destino do C e N de esgoto
biologicamente disponveis (Peterson, 1999; Waldron et al., 2001; Rogers, 2003). O material
de origem de esgoto tem usualmente baixo valor de 13C. Em oposio, os valores de 15N
de sedimento sob influncia de esgoto so mais enriquecidos em 15N e podem ser
relacionados alta concentrao de amnia de origem antropognica (Peterson, 1999;
Waldron et al., 2001; Rogers, 2003; Conlan et al., 2006; Michener & Lajtha, 2007).
Atividades cientficas e logsticas na Antrtica tem introduzido compostos antropognico em
reas outrora prstinas (Martins et al., 2005). Assinaturas isotpicas de C e N de esgoto j
foram detectadas em sedimento e organismos bentnicos prximo Estao McMurdo
(Conlan et al., 2006). A influncia de esgoto, hidrocarbonetos alifticos e aromticos
policclicos foi detectada apenas prximo do emissrio de esgoto da Estao Brasileira
Comte Ferraz (CF), numa distncia de 200 m na coluna de gua e de 400 m (esteris
humanos) e 700 m (hidrocarbonetos) no sedimento. A contaminao pontual e restrita s
proximidades de CF, em especial em relao sada do esgoto (Bicego et al., 2009).
Estudos pretritos de anlises das razes isotpicas de C e N em teias trficas bentnicas na
enseada Martel foram realizados em cinco perodos de vero (Fig. 1):
1996/1997 rea em frente CF - Anlise das fontes de carbono para a comunidade
bentnica da zona rasa (Corbisier et al., 2004)
2000/2001 Duas reas: CF e Botany Point (BP) - 13C e 15N (Bromberg, 2004)
2003 Trs reas em Martel: CF, BP, Ullmann Point (UP), alm de Arctowski, na baa
(ARCT) (Corbisier et al., em preparao)

225 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

2005/2006 Duas reas: CF e UP, no incio e final de vero (Rede 2 - Weber & Montone,
2006 - CNPq)
Mais recentemente, no vero de 2010/2011 Trs reas: CF, UP e Refgio 2 (RF2) (Instituto
Nacional de Cincia e Tecnologia Antrtico de Pesquisas Ambientais- INCT-APA).

Figura 1. Baa do Almirantado, na Ilha Rei George, com a localizao das reas de coleta. Figure 1.
Admiralty Bay, King George Island, with location of the sampling areas.

Objetivos
Analisar a assinatura isotpica de C e N de organismos do bentos selecionados para verificar
se houve variao da influncia antropognica da CF (esgoto e hidrocarbonetos), numa escala
temporal de dez anos, em cinco perodos de vero a partir de 2000/2001. Os dados mais
recentes, do vero de 2010/2011 (INCT-APA) ainda sero includos.

Material e Mtodos
gua para material particulado em suspenso (MPS), uma macroalga (Desmarestia sp),
sedimento e invertebrados de diferentes nveis trficos (o suspensvoro Laternula elliptica,
o depositvoro Sterechinus neumayeri, o patejador Nacella concinna e os carnvoros
Paraserolis polita e Parborlasia corrugatus) foram considerados. A coleta foi realizada na
zona submersa (at 25m) em frente Estao Brasileira Comte Ferraz (CF), na rea sob a
influncia do esgoto, em Dez/2000-Jan/2001, Nov-Dez/2003, Nov/2005 (incio do vero), e
Fev/2006 (final do vero) e Jan-Fev/2011.
As amostras foram coletadas a bordo da embarcao SKUA com um pegador van Veen, uma
draga, ou mergulho. Amostras da gua de superfcie foram coletadas com garrafas para
anlise de material particulado em suspenso (MPS). Os mtodos seguiram os do estudo
anterior de Corbisier et al. (2004), com acrscimo da anlise de 15N (Corbisier et al., 2011).
A medida dos istopos estveis foi realizada no Stable Isotope Facility of the Department of
Agronomy and Range Science, Davis, California, EUA, com um espectrmetro de massa
Europa Hydra 20/20. Razes de istopos estveis so expressas pela notao como partes
por mil () de acordo com a seguinte relao:
X = [(Ramostra/Rpadro) 1] x 103, onde X = 13C ou 15N, e R = 13C/12C ou 15N/14N
(Peterson e Fry, 1987). O padro de referncia para o carbono o Pee Dee Belemnite (PDB)
e o N2 atmosfrico para o nitrognio.
Anlises - Grficos de disperso e retas de regresso linear foram realizados com os valores
mdios de 13C e 15N (ou valores individuais) das fontes e consumidores a fim de verificar
variaes de longo prazo. Anlise de covarincia (ANCOVA) foi empregada para testar
diferenas entre as inclinaes das retas de regresso (15N/13C) entre os veres. Anlise de
regresso linear foi usada para examinar a tendncia geral da relao de 15N com 13C dos

226 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

organismos na teia trfica. 13C foi tratado como covariante, e os veres como uma varivel
independente. Nos casos onde os testes ANCOVA foram significantes, a diferena foi testada
por meio do teste a posteriori de Tukeys honestly significant difference (HSD) com = 0,05.

Resultados
Foram considerados os organismos dos quais se tinham razes isotpicas em todos os veres
considerados. Os valores de R dos dados de regresso linear para 15N/ 13C foram altos para
os perodos de vero amostrados (> 69%) e os dados se adequaram a um modelo linear (Fig.
2, a). As retas dos diferentes veres no foram distintas (declividade). A tendncia geral de
variao dos valores de 15N e 13C nos organismos da trama trfica foi similar. Porm, houve
diferena significativa nos valores de a (intercepto no eixo Y), tanto para 15N, como para
13C nos veres (Fig. 2, b). Houve tendncia de decrscimo dos valores de 15N do incio dos
veres de 2000/2001 para 2005. A reta dos dados do final do vero de 2006 foi intermediria
entre 2000/01 e 2005. Houve tendncia de enriquecimento dos valores de 13C do vero de
2000/01 para o de 2005.

Factor df F p -value
(a) Response variable: 15 N ()

Intercept (a ) 1 83.940 0.000


Summers 3 0.853 0.482
(b) Response variable: 13 C ()
Intercept (a ) 1 298.380 0.000
Summers 3 0.881 0.468

Figura 2. (a) Regresso linear para os dados de 15N e 13C de quatro perodos amostrais de vero e (b)
valores de a (intercepto no eixo Y), tanto para 15N, como para 13C nos veres. Figure 2. (a) Linear
regression for 15N and 13C data from four summer sampling periods, and (b) a value (intercept in the Y
axis), for 15N, and for 13C, in the summers.

Discusso e concluses
As diferenas nas razes isotpicas entre os veres evidenciaram um decrscimo da
contribuio de esgoto para a comunidade bentnica em CF dos veres passados (2000/01)
aos mais recentes (2005), e um leve aumento de sua influncia para o final do vero (2006).
Os resultados sugeriram que mudanas no tratamento do esgoto em anos mais recentes se
refletiram na comunidade bentnica. No vero de 2010/11 uma nova amostragem, incluindo
o esgoto em si e locais a 15 m de profundidade, foi realizada com a finalidade de dar
continuidade ao monitoramento da Baa do Almirantado no escopo do programa INCT-APA.
As anlises esto em andamento.
Espera-se, com a reduo das atividades em CF nos prximos veres, uma reduo ainda
maior da influncia do esgoto na comunidade da zona rasa em frente a CF.

227 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Agradecimentos
Apoio financeiro - Instituto Nacional de Cincia e Tecnologia Antrtico de Pesquisas
Ambientais (CNPq processos 574018/2008-5 e FAPERJ processo E-26/170.023/2008),
Projeto Rede 2 (CNPq processo 550354/2002-6 e MMA) e CNPq (processo 480251/00-2),
Ministrio do Meio Ambiente (MMA), Ministrio de Cincia e Tecnologia (MCT), e
Comisso Interministerial para Recursos do Mar (CIRM).

Referncias
Bicego, M.C.; Zanardi,-Lamardo, E.; Taniguchi, S.; Martins, C.C.; Silva, D.A.M.; Sasaki, S.T.; Albergaria-
Barbosa, A.C.R.; Paolo, F.S.; Weber, R.R.; Montone, R.C. 2009. Results from a 15-year study on hydrocarbon
concentrations in water and sediment from Admiralty Bay, King George Island, Antarctica. Antarctic Sci.,
21(3): 209-220.
Bromberg, S. 2004. A macrofauna bentnica da zona costeira rasa e o seu papel na trama trfica da enseada
Martel, Baa do Almirantado (Ilha Rei George, Antrtica). nfase para o grupo Polychaeta (Annelida). Tese de
Doutoramento, Universidade de So Paulo, Instituto Oceanogrfico.
Cole, M.L.: Kroeger, K.D.; McClelland, J.W.; Valiela, I. 2005. Macrophytes as indicators of land-derived
wastewater: Application of a 15N method in aquatic systems. Water Res., 41:1-9
Conlan, K.E.; Rau, G.H.; Kvitek, R.G. 2006. 13C and 15N shifts in benthic invertebrates exposed to sewage
from McMurdo Station, Antarctica. Mar. Pollut. Bull., 52: 1695-1707.
Corbisier, T.N.; Petti, M.A.V.; Skowronski, R.S.P.; Brito, T.A.S. 2004. Trophic relationships in the nearshore
zone of Martel Inlet (King George Island, Antarctica): 13C stable isotope analysis. Polar Biol., 27: 75-82
Corbisier, T.N.; Bromberg, S.; Gheller, P.F.; Piera, F.; Petti, M.A.V. 2011. Monitoring the impact of human
activities in Admiralty Bay, King George Island, Antarctica: Isotopic analysis of C and N in the summer of
2005/2006. National Institute of Science and Technology Antarctic Environmental Research Annual Activity
Report 2010, p. 182-187
Fry, B. 2006. Stable Isotope Ecology. Springer
Libralato, S.; Pranovi, F.; Stergiou, K.I.; Link, J.S. 2014. Trophodynamics in marine ecology: 70 years after
Lindeman. Mar Ecol Prog Ser 512: 1 -7
Martins, C.C.; Montone, R.C.; Gamba, R.C.; Pellizari, V.H. 2005. Sterols and fecal indicator microorganisms
in sediments from Admiralty Bay, Antarctica. Braz. J. Oceanogr., 53: 1-12
Michener, R.H.; Lajtha, K. (eds) 2007. Stable isotopes in ecology and environmental sciences, 2nd ed.
Blackwell, Oxford, pp 238-282
Peterson, B.J. 1999. Stable isotopes as tracers of organic matter input and transfer in benthic food webs: A
review. Acta Oceanol., 20: 479-487
Rogers, K.M. 2003. Stable carbon and nitrogen isotope signatures indicate recovery of marine biota from
sewage pollution at Moa Point, New Zealand. Mar. Pollut. Bull., 46(7): 821-827
Waldron, S.; Tatner, P.; Jack, I.; Arnott, C. 2001. The impact of sewage discharge in a marine embayment: a
stable isotope reconnaissance. Estuar. Coastal Shelf Sci., 52(1): 111-115
Weber, R. R.; Montone, R. C. (coord.). 2006. Rede-2: Gerenciamento ambiental na Baa do Almirantado, Ilha
Rei George, Antrtica. Relatrio final. Ministrio do Meio Ambiente/ CNPq/SeCIRM/Proantar, Brasil. 255 p.

228 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

REFLECTIVITY AT UNION GLACIER CAMP (ANTARCTICA)


(Reflectividad en el Campamento Glaciar Unin [Antrtica])

Cordero R, 1*, Damiani A. 1,2, Feron S. 1, Llanillo P. 1, Wachter P. 3, Alfonso J.4


1
Universidad de Santiago de Chile, Santiago, Chile. 2Center for Environmental Remote Sensing, Chiba
University, Chiba, Japan. 3Earth Observation Center | German Remote Sensing Data Center, German
Aerospace Center (DLR). 4Instituto Venezolano de Investigaciones Cientficas. * E-mail:
raul.cordero@usach.cl

Abstract
Albedo is an important factor in the energy balance of Antarctica, since changes in prevailing
climatic conditions (triggered for example by a change in temperature) can enhance feedback
mechanisms. Although it seems to be still stable on the Antarctic Plateau, monitoring the
albedo is increasingly becoming of interest, because significant changes in the reflectivity
are expected to occur in Antarctica.
Albedo assessment requires measuring both the upwelling irradiance and the downwelling
irradiance. Satellites cannot measure the upwelling global irradiance but the upwelling
radiance. The latter can be used to produce estimates of the Lambertian Equivalent
Reflectance (LER), which in turn is often taken as a proxy of the albedo. Moreover,
measurements of the broadband albedo may have lower sensitivity to changes in the snow
than measurements of the albedo in the infrared part of the spectrum. These limitations
promote ground-based measurements of the spectral albedo.
We report on ground-based measurements of the spectral reflectivity (i.e. albedo) carried out
during three different spring campaigns (in November-December 2012, 2014-2016) at Union
Glacier Camp. This site is located in the southern Ellsworth Mountains on the broad expanse
of Union Glacier (700 m altitude, 79 46 S; 82 52W), about 800 miles from the South Pole.
Our measurements involved spectroradiometers suitable for spectral measurements of the
snow albedo from the UV range of the spectrum (280 nm) to the near infrared range (1800
nm). We found that the albedo measured at noon was about 0.95 in the UV and the visible
part of the spectrum, while it reduces in the IR. Spectral measurements carried out elsewhere
as well as satellite-derived estimates of the Lambertian Equivalent Reflectance (LER) were
used for further comparisons.

Acknowledgments
The support of INACH (Preis RT_32-15), CONICYT-ANILLO (Preis ACT1410),
FONDECYT (Preis 1161460, 1151034 and 1140239), CORFO (Preis 16BPE2-66227),
CEDENNA, and USACH-Basal USA 1555, is gratefully acknowledged. AD was also
supported by CREST fund.

229 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

CARACTERIZACIN MICROBIOLGICA, GEOMORFOLGICA Y FSICO-


QUMICA DE SIETE LAGUNAS DEL ARCHIPILAGO JAMES ROSS
(Microbiological, geomorphological and physicochemical characterization of
seven ponds of the James Ross Archipelago)

Coria, S.H.1, Colman, D.1, Vignoni, P.2, Lirio, J.M.1, Lecomte, K.3, Kohler, T.4, Ruberto, L.1,5,
Kopalov, K.4, Mac Cormack, W. P.1,5
1 Dpto. Microbiologa Ambiental, Instituto Antrtico Argentino, Argentina. 2 Fac. Cs. Exactas Fsicas y Naturales, Univ.

Nac. Crdoba, Argentina. 3 CICTERRA, CONICET/UNC, Argentina. 4 Charles University, Praga, Rep. Checa. 5 Instituto
NANOBIOTEC, UBA-CONICET, Argentina.

Las lagunas antrticas son valiosos centros de biodiversidad (Laybourn-Parry y Pearce, 2007) y
poseen una gran proporcin de especies endmicas (Kopalov y col. 2013). Estas lagunas presentan
una baja diversidad de macroorganismos, lo cual acenta el rol ecolgico de los microorganismos en
la estabilidad de estos ecosistemas y en el ciclado de nutrientes (Villaescusa y col. 2010). El
archipilago James Ross (ARJ) comprende, entre otras, las islas James Ross, Vega, Cerro Nevado y
Marambio, tiene un clima fro y seco con precipitaciones de 250 mm anuales. Si bien el 80% del AJR
est cubierto por glaciares, hay numerosas lagunas en sus reas libres de hielo. Nedbalov y col. 2013
describe y clasifica en pennsula Ulu (parte occidental de la isla James Ross), un amplio rango de
lagunas de acuerdo a su posicin geogrfica, geomorfologa, estabilidad, caractersticas fsico
qumicas y biota. Las lagunas, mayormente someras, estn sometidas a descongelamiento estival,
permaneciendo sin cubierta superficial de hielo durante 2 a 3 meses. En ellas, los sedimentos
superficiales (compuestos por depsitos inorgnicos y biolgicos) son alterados por las variaciones
ambientales de temperatura, precipitacin, evaporacin, luz ambiental, cubierta de hielo y extensin
de los glaciares (Hodgson, 2012). La gran diversidad de lagunas presentes y la escasa informacin
biolgica detallada ha llevado a considerar al AJR (Fig. 1) como una importante rea de estudio. El
objetivo de este trabajo es caracterizar un conjunto de lagunas del AJR desde el punto de vista
geolgico, de las propiedades fsico-qumicas de la columna de agua y de los ensambles de bacterias
y arqueas de los sedimentos costeros superficiales.
Figura 1. Mapa de ubicacin con las
reas de muestreo. Figure 1. Map
showing the sampling area.

Sitios de muestreo y
caracterizacin del ambiente. Se
estudiaron 7 lagunas, 2 ubicadas
en la zona de cabo Lamb, Isla
Vega (Esmeralda y Pan Negro), y
5 en la zona de Clearwater Mesa,
Isla James Ross (Adriana, Cecilia,
Florencia, Katerina y Soledad),
todas las cuales fueron
georreferenciadas mediante GPS
en modo absoluto, obtenindose
adems el permetro, rea y altura
de las mismas. Se sigui el trabajo
de Nedbalov y col. (2013), que defini 6 tipos de lagunas en base a su origen, geologa del
basamento, geomorfologa, estabilidad hidrolgica y caractersticas fsicas y qumicas. Siguiendo el
mismo trabajo, se determin su origen (erosin glaciaria: EG, deposicin glaciaria: DG), as como su
tipo de basamento (rocas volcnicas negenas: V; rocas volcnicas locales, sedimentarias cretcicas,
gneas y metamrficas de la Pennsula Antrtica: G; Sedimentos glacignicos recientes: M). Tambin

230 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

se evalu la flora y fauna presente en cada laguna y en su cuenca. Se realiz un mapa batimtrico
desde un bote neumtico mediante ecosonda en las lagunas Esmeralda, Katerina y Pan Negro. En el
resto se estim la profundidad mxima desde la costa. La caracterizacin geoqumica se realiz
midiendo in situ los parmetros fsico-qumicos del agua (temperatura, pH, Eh, conductividad
elctrica, STD). La alcalinidad (como CaCO3) se midi en agua sin filtrar, por titulacin con una
solucin de H2SO4 0,16 N hasta pH=4,5. Para las restantes determinaciones, las muestras se filtraron
en el campo por membranas de acetato de celulosa de 0,22 m. Los anlisis de aniones se realizaron
mediante cromatografa de iones por supresin qumica.
Caracterizacin de comunidades bacterianas y arqueanas. Se colectaron muestras de sedimentos
costeros superficiales (5 cm) utilizando un muestreador de acrlico de 7 cm de dimetro. En cada sitio
se tomaron 3 muestras separadas por no ms de 20 cm, las cuales se mezclaron para formar una
muestra compuesta para cada laguna. Se extrajo el ADN total de cada una a partir de 2,5 g de material
segn el mtodo de Vzquez y col. (2009) con modificaciones. El mismo involucr el uso de perlas
de circonio para la ruptura mecnica, 3,6 ml de buffer de extraccin (1 M Tris-HCl pH 8, 0,5 M
EDTA, 1 M buffer fosfato pH 8), 10,8 mg de lisozima, 0,3 mg de proteinasa K y 0,1 mg de ARNsa.
La calidad del ADN obtenido y purificado fue analizada mediante electroforesis en gel de agarosa
teido con GelRed.
A partir del ADN genmico de los sedimentos se amplific por PCR el gen del ARNr 16S. Los
amplicones obtenidos se secuenciaron mediante la plataforma 454-Roche. Los primers utilizados
amplifican la regin V3-V5 del gen del ARNr 16S de bacterias y arqueas: 357F (5'
CCTACGGGAGGCAGCAG 3') y 926R (5' CCGTCAATTCMTTTRAGT 3').
Anlisis bioinformtico. Se obtuvo un total de 212.357 secuencias entre las 7 lagunas. El anlisis
bioinformtico de los amplicones se realiz con QIIME (Quantitative Insights Into Microbial
Ecology, v. 1.9.0) desarrollado por Caporaso y col (2010). Para la construccin de los OTUs se
utilizaron y compararon 2 protocolos frecuentemente citados en la bibliografa. Por un lado, se utiliz
una estrategia de novo, en el cual las lecturas se agruparon entre s sin ninguna coleccin de
secuencias de referencia. En la segunda estrategia, denominada open reference, las lecturas se
agruparon contra una coleccin de secuencias de referencia y las no agrupadas fueron
subsiguientemente analizadas de novo (Navas-Molina y col. 2013). Ambos flujos de anlisis se
caracterizaron por la formacin de OTUs basados en porcentajes de similitud por el mtodo de
agrupamiento UCLUST (Edgar 2010), el cual genera secuencias centroides o representativas de
forma que las secuencias interrogantes (query) que superen un determinado porcentaje de similitud
(97% en este estudio) formen parte del cluster; si la secuencia siguiente no supera este umbral, ser
designada como otra secuencia representativa. Las bases de datos (BD) para las asignaciones
taxonmicas de las secuencias representativas fueron Greengenes para la primera estrategia; y Silva
para la segunda.

Resultados
Segn Nedbalov y col. (2013), las lagunas estudiadas correspondieron a 3 tipos (Tabla 1): A)
Estables y poco profundas, en superficies niveladas de mayor altura (Adriana, Katerina y Soledad),
B) Estables, en morenas antiguas (Cecilia, Esmeralda y Pan Negro) y C) Pequeas e inestables, en
morenas jvenes (Florencia). Las lagunas con efluentes (denominadas abiertas) mostraron valores
bajos de conductividad (Tabla 2), mientras que en las que no presentaron efluentes (lagunas cerradas),
la evaporacin permiti la concentracin de iones (Cl- y Na+ principalmente) aumentando la
conductividad. Florencia, recibe un gran caudal de agua de fusin glaciar y est en contacto con el
hielo, por ello la temperatura del agua fue muy baja y, al ser abierta, su concentracin de sales fue
baja, determinando una conductividad muy baja. Adriana tuvo la mayor conductividad y valores altos
de Cl-, Na+, HCO3- y SO4= lo que sugiere concentracin de sales por evaporacin. Este fenmeno fue
menos marcado en Cecilia y Esmeralda. Esmeralda present eflorescencia de yeso en los alrededores,
probablemente procedentes de los sedimentos marinos cretcicos cercanos, enriqueciendo sus aguas
en SO4= y Ca++. Adems, con un pH 5,5 mostr una gran cantidad de algas filamentosas en el fondo.

231 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

El bajo aporte de material clstico hacia las lagunas permiti el desarrollo de tapetes delgados de
cianobacterias y algas, as como de crustceos como Branchinecta gaini (salvo en Esmeralda y
Florencia) y Boeckella poppei.

Altitud rea Prof. Basamento Alimentacin Cuenca Tipo de


Laguna Origen
(msnm) (m2) (m) Laguna
Esmeralda 72 16.290 6 G nival Cerrada DG B
Pan Negro 22 7.572 2 M nival Cerrada DG B
Adriana 260 18.505 1 V nival Cerrada EG A
Cecilia 64 6.839 1 M nival Abierta DG B
Florencia 29 79.348 >10 M Fusin de hielo Abierta DG C
Katerina 252 138.247 1 V nival Abierta EG A
Soledad 218 5.003 0,5 V nival Abierta EG A
Tabla 1. Caractersticas geomorfolgicas y geolgicas de las lagunas estudiadas. Para descripcin del tipo de laguna,
basamento y origen, ver texto. Table 1. Geomorphological and geological characteristics of the studied ponds. For a
description of the type of ponds, basement and origin, see text.

Alcalinidad
Laguna pH Eh Conductividad OD total Mg Ca Na K HCO 3- Cl- SO4 -2 F- NO 3-
(mV) (S/cm) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)
Esmeralda 5,5 72,8 573 2,58 2,44 12,1 25,7 32,5 2,11 2,44 62,95 114,298 - -
Pan Negro 7,3 65 366 2,38 9,76 8,66 12,3 56,8 1,79 9,76 13,56 3,862 0,047 0,118
Adriana 8,66 102 4490 1,05 156,16 94,9 12,3 178,38 3,62 156,16 455,268 37,429 - -
Cecilia 8.47 162 556 1,08 6,832 8,43 8,8 53,3 2,31 6,832 115,963 8,521 0,123 -
Florencia 7,22 225 152,9 1,3 3,416 0,228 13,003 1,5 0,3 3,416 22,196 2,441 0,137 0,522
Katerina 8,37 133 496 1,02 7,32 25,5 11,9 32,8 1,24 7,32 31,208 5,077 0,093 -
Soledad 8,72 103 263 1,2 13,664 4,92 3,2 17,5 0,75 13,664 27,484 4,188 0,079 0,294

Tabla 2. Parmetros fisicoqumicos de la columna de agua en los sitios de muestreo para cada laguna analizada. NO2-,
PO4= y CO3= estuvieron por debajo del lmite de deteccin. Table 2. Physicochemical parameters of the water column at
the sampling sites for the analyzed ponds. NO2-, PO4= and CO3 = were below the limit of detection.

Se observ que los factores ms influyentes sobre las caractersticas fsico-qumicos de las lagunas
son: su condicin de cerradas o abiertas, el tipo de basamento rocoso y el tipo de aporte de agua. La
altura sobre el nivel del mar, el rea y la profundidad no parecen tener influencia. En cuanto al
tratamiento bioinformtico, luego del filtrado de calidad, se obtuvieron 201.210 secuencias: Adriana
31.876, Cecilia 31.028, Esmeralda 27.123, Florencia 23.548, Katerina 28.794, Pan Negro 31.576 y
Soledad 35.299. A partir de lo obtenido con las 2 estrategias de formacin de OTUs (cuyos resultados
son mostrados en la Fig. 2) se vi que la estrategia de novo gener 36 phyla contra 32 de la
estrategia open reference. Adems, produjo menor proporcin de secuencias no identificadas ("No
asignados"). No obstante, ambas estrategias compartieron los mismos phyla con abundancia relativa
mayor al 1% (Fig. 2) y solo se vieron diferencias para los taxones minoritarios (datos no mostrados).
Con ambas estrategias, predominaron los phyla Proteobacteria y Bacteroidetes, en tanto que el tercer
phylum/grupo ms abundante fue dismil: Chloroflexi (open reference) y "No asignados" (de
novo). Respecto a la presencia de estos taxones en las lagunas estudiadas, Proteobacteria fue el taxn
dominante (ms del 50% de sus abundancias relativas) en Katerina y Adriana (Fig. 2B).
Bacteroidetes, el segundo ms abundante, mostr valores mximos en Adriana y mnimos en
Katerina. Adems, si bien Acidobacteria fue detectada en todas las lagunas, Esmeralda registr la
mayor abundancia, conforme a las caractersticas de sus aguas.

Conclusiones
Las dos estrategias ensayadas evidenciaron la presencia de los mismos grupos mayoritarios a nivel
phylum. Sin embargo, la estrategia open reference, que involucr la BD Silva, provey ms
asignaciones a nivel phylum y arroj el menor porcentaje de secuencias agrupadas como No
asignados, respecto de lo obtenidos con la estrategia de novo (BD Greengenes), por lo que la

232 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

primera estrategia parece ser ms adecuada para el anlisis de muestras ambientales como las
estudiadas. Las lagunas pudieron agruparse desde el punto de vista ambiental en 3 tipos diferentes.
El anlisis preliminar de los phyla y su abundancia relativa mostr diferencias entre todas las lagunas.
Se profundizar el estudio a fin determinar las diferencias concretas en los taxones de menor
categora. No se detectaron secuencias pertenecientes a arqueas (a pesar de utilizarse primers que
tambin identifican este grupo de organismos), lo cual pudo deberse: a la subestimacin de taxones
minoritarios por el protocolo de extraccin de ADN, a un nivel de amplicones de arqueas surgidos de
la PCR que estuviese bajo el nivel de deteccin o a limitaciones inherentes al anlisis bioinformtico.

Figura 2. Asignacin taxonmica a nivel phylum de los OTUs con abundancia relativa igual o mayor a 1%.
A. Estrategia de novo. B. Estrategia open reference. Figure 2. Taxonomic mapping at the phylum level of OTUs with
relative abundance equal to or greater than 1%. A. de novo strategy. B. open reference strategy.

Agradecimientos
Los autores agradecen al Instituto Antrtico Argentino, a los proyectos PICTO 2010-0096, PICTO
2010-0124, UBA 20020100100378 y a la red de investigacin de la UE IMCONet.
Referencias
Caporaso J.G. y col. 2010. QIIME allows analysis of high-throughput community sequencing data. Nature Methods,
7(5):335-336.
Edgar, R. 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics, 26(19):2460-2461.
Hodgson, D.A. Antarctic lakes. 2012. En Encyclopedia of lakes and reservoirs. Lars Bengtsson y col. (Eds). Springer, pp
26-31.
Kopalov K. y col. 2013. Diversity, ecology and biogeography of the freshwater diatom communities from Ulu Peninsula
(James Ross Island, NE Antarctic Peninsula). Polar Biol., 36(7):933948.
Laybourn-Parry J. y Pearce D.A. 2007. The biodiversity and ecology of Antarctic lakes-models for evolution. Phil. Trans.
R. Soc. B. 362:22732289.
Navas-Molina, J. y col. 2013. Advancing our understanding of the human microbiome using QIIME. Met. Enzymol.,
53:371-444.
Nedbalov, L. y col. 2013. Freshwater lakes of Ulu Peninsula, James Ross Island, north-east Antarctic Peninsula: origin,
geomorphology and physical and chemical limnology. Antarctic Sci, 25(3):358372.
Vzquez, S. y col. 2009. Bacterial community dynamics during bioremediation of diesel oil-contaminated Antarctic soil.
Microb. Ecol. 57(4):598-610.
Villaescusa, J.A. y col. 2010. A close link between bacterial community composition and environmental heterogeneity. Int.
Microbiol., 13:67-77.

233 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

FIRST IONOSPHERIC DISTURBANCES OBSERVED AT EACF BY MEANS OF


DEMOGRAPE ACTIVITIES
(Primeras alteraciones ionosfricas observadas en la EACF mediante actividades
demoGRAPE)

Correia E.1,2, Alfonsi L.3, Spogli L.3, De Franceschi G.3, Romano V.3, Linty N.4, Hunstad
I.3, Cilliers, P.5, Terzo O.6 and F. Dovis 4
1
Instituto Nacional de Pesquisas Espaciais, Brazil. 2 CRAAM, Universidade Presbiteriana Mackenzie, Rua da
Consolao 930, SP, Brazil. 3 Istituto Nazionale di Geofisica e Vulcanologia, Italy. 4 Politecnico di Torino,
Italy. 5 South African National Space Agency, South Africa. 6 Istituto Superiore Mario Boella, Italy.
Contact E-mail: ecorreia@craam.mackenzie.br

Demonstrator for Global Navigation Satellite System (GNSS) Research and Application for
Polar Environment (DemoGRAPE) (Alfonsi, 2016) is an international project funded by the
Italian National Program for Antarctic Research, which is leaded by the Istituto Nazionale di
Geofisica e Vulcanologia (INGV), in partnership with Politecnico di Torino, Istituto
Superiore Mario Boella, and with South African National Space Agency (SANSA) and the
Brazilian National Institute of Space Physics (INPE), as collaborators. The aim of this project
is to improve satellite navigation in Antarctica. The accuracy of satellite navigation in
Antarctica is of paramount importance because there is the danger that people and vehicles
can fall into a crevasse during a snowstorm, when the visibility is limited, and they must
travel following defined routes using satellite navigation systems.The accuracy of the
satellite navigation is strongly affected by atmospheric disturbances, which produce
variability of ionospheric delay and ionospheric scintillation.
The project objective was to build a demonstrator of cutting edge technology for the
empirical assessment of the ionospheric delay and ionospheric scintillations in the polar
regions. It also included new equipment for the recording and dissemination of GNSS data
and products installed at the South African and Brazilian bases in Antarctica. Inside
DemoGRAPE project it was designed and implemented a GNSS dual-band data aquisition
system and an ionospheric monitoring station based on GNSS software radio receivers (Linty
et al., 2016). On November 2015 the first system was installed at Brazilian Antarctic Station
Comandante Ferraz (EACF, 62o 05'07"S, 58o23'29" W) located in the King George Island,
and on December 2015 a second system was installed at South African Antarctic base
SANAE (714022S, 25026W) (Figure 1).
The new equipment will facilitate the exchange of software and derived products via the
Cloud computing technology infrastructure. The data acquired in Antarctica, the related
applications, and derived products are managed via an innovative method for data
management based on Docker containers and Cloud computing technology infrastructure
(Mossucca et al., 2012). The project portal is accessible at www.demogrape.net
Here we present GNSS scintillations from DemoGRAPE observed at EACF during a
moderate geomagnetic storms occurred on 6 March 2016 (Figure 2).

234 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figure 1. The antennas of the GNSS receivers installed at the Brazilian Antarctic Station
EACF during NovemberDecember 2015. Figura 1. Las antenas de los receptores GNSS
instalados en la Estacin Antrtica Brasilea EACF durante noviembre-diciembre de 2015.

The geomagnetic storm occurred on 6 March 2016 was caused by the impact of a
High Speed Solar Wind Stream (http://www.solen.info/solar/). The ionospheric
scintillations were observed by the American satellite navigation system GPS as
well by the Russian GLONASS and European GALILEO.

Figure 2. AE (red) and Sym-H (black) indices variation observed on 6 March 2016 during
main phase geomagnetic. Figura 2. Variacin de los ndices AE (rojo) y Sym-H (negro)
observada el 6 de marzo de 2016 durante la fase geomagntica principal.

235 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figure 3 shows the rate of TEC (ROT), amplitude (vS4) and phase (Phi60)
scintillations occurred in the evening of 6 March, presenting moderate
scintillation intensity that maximize between 21 and 22 UT (17 and 18 LT) at the
maximum of the storm main phase.

Figure 3. GPS, GLONASS, and Galileo Rate of TEC (ROT), vertical amplitude scintillation
(vS4) and phase scintillation (Phi60) recorded at EACF on 6 March 2016. Different colors
identify the satellites. Figura 3. GPS, GLONASS y Galileo Tasa de TEC (ROT), centelleo de
amplitud vertical (vS4) y centelleo de fase (Phi60) registrado en EACF el 6 de marzo de
2016. Diferentes colores identifican los satlites.

Since the installation, both stations has been continuously collecting data. From
a first analysis, the receivers detected mostly phase scintillation rather than
amplitude scintillations, as expected for polar regions (Doherty et al., 2000).
Furthermore, it is evident that the ionospheric activity is much more intense at
SANAE than at EACF (Alfonsi et al., 2016, Cilliers et al., 2016), because of the
more poleward geomagnetic position of the SANAE (geomagnetic dipole latitude
of SANAE is 6645S and of EACF is 52 95S).

Acknowledgements
This study was carried out with financial support from the Italian Ministry of
Education, Universities and Research (Ministero dellIstruzione, dellUniversit
e della Ricerca, MIUR), the Italian National Research Programme for Antarctica
(Programma Nazionale di Ricerche in Antartide, PNRA), in the framework of the
DemoGRAPE project, under contract 2013/C3.01. This work is also based on
research supported by the South African National Research Foundation through
grant 93084 to the South African National Space Agency. The DemoGRAPE
equipment at SANAE IV was installed and is maintained by the Engineering and
Data Acquisition Unit of SANSA Space Science under the leadership of Gert
Lamprecht. The DemoGRAPE equipment at EACF is maintained by INPE under
the leadership of Emilia Correia with financial support from Conselho Nacional
de Desenvolvimento Cientfico e Tecnolgico (CNPq/PROANTAR - contract
406690/2013-8). The authors thank the GRAPE Expert Group funded by SCAR
(http://www.grape.scar. org/). The authors thank the Joint Research Center of the

236 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

European Commission at ISPRA for their support to the DemoGRAPE project,


providing assistance and hardware support.
Dst data are provided by the World Data Center of Kyoto. The DemoGRAPE
elaborated data, as the examples shown in this paper, will be available at
prototype level by becoming a registered user through the project portal
(www.demogrape.net). DemoGRAPE raw data are available upon request to the
single institution owner or contacting the project coordinator
(lucilla.alfonsi@ingv.it).

References
Alfonsi, L. 2016. DemoGRAPE: Demonstrator for GNSS Research and Application for Polar Environment.
19th International Beacon Satellite Symposium 27 June1 July, 2016. The Abdus Salam International Centre
for Theoretical Physics Trieste, Italy. [Available at http://t-ict4d.ictp.it/beacon2016/downloads/program_pdf.]
Alfonsi, L., Cilliers, P.J., Romano, V., Hunstad, I., Correia, E., Linty, N., Dovis, F., Terzo, O., Ruiu, P., Ward,
J. and Riley, P. 2016. First Observations of GNSS Ionospheric Scintillations From DemoGRAPE Project. Space
Weather, 14(10), pp.704-709.
Cilliers, P. J., Alfonsi, L., Spogli, L., Franceschi, G. De, Romano, V., Hunstad, I., Linty, N., Terzo, O. and
Dovis, F. 2016. DemoGRAPE: First phase scintillations on GNSS signals from Galileo satellites as observed
from SANAE and EACF. Abstract book, Scientific Committee on Antarctic Research: Biennial meetings and
Open Science Conference 2016, Kuala Lumpur, 2030 Aug.
Doherty, P. H., Delay, S. H., Valladares, C. E. and Klobuchar, J. A. 2000. Ionospheric scintillation effects in
the equatorial and auroral regions. In: Proceedings of the 13th International Technical Meeting of the Satellite
Division of the Institute of Navigation ION GPS 2000, pp. 662671, Salt Lake, Utah, 1922 Sept.
Linty, N. , Rodrigo R., Calogero C., Fabio, D., Michele, B., James T. C., Joaquim, F-G., Jonathan, W., Gert,
L., Padraig, R., Cilliers, P., Correia, E., Lucilla, A. 2016. Ionospheric scintillation threats to GNSS in polar
regions: The DemoGRAPE case study in Antarctica. In: European Navigation Conference ENC-2016, Helsinki,
Finland, IEEE, June 2016, pp. 17.
Mossucca, L., Terzo, O., Goga, K., Acquaviva, A., Abate, F. and Provenzano, R. 2012. NGS workflow
optimization using a Hybrid Cloud Infrastructure. Int. J. Adv. Networks Serv., 5(3 & 4), 324332.

237 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

PERMAFROST RESEARCH IN SITES CALM AND PAPAGAL NEAR


BULGARIAN ANTARCTIC BASE, HURD PENINSULA, LIVINGSTON ISLAND,
ANTARCTICA
(Investigacin del permafrost en los sitios CALM y PAPAGAL cerca de la base bulgra en
la pennsula de Hurd, isla Livingston, Antrtica)

Correia, A.1, Yanakieva, N.2 and G. Vieira3


1
Institute of Earth Sciences and Department of Physics, University of Evora, Portuguese, email:
correia@uevora.pt, 2Bulgarian Antarctic Institute and Department of Geology, Sofia University St. Kliment
Ohridski, Bulgaria, email: nadya.yanakieva@gmail.com, 3Center for Geographical Studies, University of
Lisbon, Lisbon, Portugal, vieira@campus.ul.pt

During 2009, 2012, 2013 and 2017 several electrical resistivity tomographies (ERTs) were
done in a CALM (Circumpolar Active Layer Monitoring) site and Papagal area near the
Bulgarian Antarctic Base St. Kliment Ohridski, Hurd Peninsula, Livingston Island
(Maritime Antarctica), South Shetland Islands. The aim is identifying permafrost zones and
their extension and evolution in time and space. Electrical resistivity tomographies are very
useful for permafrost studies. Partially or totally frozen ground has significant increase of the
electrical resistivity and also when temperatures are lower than 0o C. ERTs measurements
were mathematically inverted to obtain two-dimensional geoelectrical models for each of
them.

Introduction
Under the framework of the projects PERMANTAR (Permafrost and Climate Change in the
Maritime Antarctic), PERMANTAR-2 (Permafrost and Climate Change in the Maritime
Antarctic-2) and PERMATOMO, several tomographic profiles of electrical resistivity were
performed in 2009, 2012, 2013 and 2017 on the Circumpolar Active Layer Monitoring
(CALM) site and the site PAPAGAL, located on the Hurd Peninsula, Livingston Island,
South Shetland Islands Archipelago, along the Antarctic Peninsula. The electrical resistivity
tomography (ERT) profiles were designed to study the spatial and temporal variation of
permafrost suspected to exist in the area of CALM site and PAPAGAL, located near the
Bulgarian Antarctic Base St. Kliment Ohridski at an altitude of 150 m above sea level. In
the area of CALM site are profiles 7, 8 and 9 (only 7 hadn't been repeated) and in the area of
PAPAGAL is profile 10. /Fig. 1/

Methods and instruments


Geoelectrical methods are very good for studying the spatial distribution of permafrost
because of its high electrical resistivity in comparison with that of soil and rocks above 0o C.
The ERTs that were repeated are two in CALM site (profiles 8 and 9 /Fig.2/; because of the
accumulated snow profile 7 couldnt been repeated) and one in the area of PAPAGAL
(profile 10). Each profile is 78 m long. For their tomography were used 40 stainless electrodes
in a Wenner configuration, spaced by 2 m, each one with an active electrode.

238 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Fig. 1. Profiles 8 and 9 from CALM Site, and 10 near the Papagal area. Only profiles 9 and 8 were repeated in
2012, 2013 and 2017. After 2009 the profile 7 was always almost completely covered by a thick layer of
snow. New map made during Bulgarian Antarctic Campaign 2016 2017. Fig. 1. Perfiles 8 y 9 del sitio
CALM, y 10 cerca del rea de Papagal. Slo los perfiles 9 y 8 se repitieron en 2012, 2013 y 2017. Despus de
2009, el perfil 7 siempre estuvo casi completamente cubierto por una gruesa capa de nieve. Nuevo mapa
realizado durante la campaa blgara antrtica 2016 - 2017.

Fig. 2. View of the CALM site with the relative orientation of profile 9 repeated in 2017. Fig. 2. Vista del
sitio CALM con la orientacin relativa del perfil 9 repetida en 2017.

An earth resistivity meter ABEM Terrameter SAS 300 C was used to control the
measuring process and was connected with a computer to record the field data. During the
acquisition state a few problems related with high electrical contact resistance between the
ground and the stainless electrodes had to be solved. Those problems were solved by watering
with sea water the zone of the electrodes affected by high electrical contact resistance. The
apparent electrical resistivity measurements were mathematically inverted to obtain two-
dimensional geoelectrical models for each of them. All models show electrical resistivities
(tens of thousands of m) probably correspond to patches of frozen ground. With a special

239 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

software RES2DIN (Loke and Baker, 1995, 1996) inverted the apparent electrical resistivity
values into two-dimensional models of electrical resistivity of the ground. The models are a
representation of the distribution of the electrical resistivity of the ground to depths of about
13 m.

Discussion of results
Fig. 3, 4 and 5 show the geoelectrical models of the ground as a result of the electrical
resistivity tomographies along profiles 8, 9 and 10 from Hurd peninsula, Livingston Island,
Antarctica. The electrical resistivity values of the several models vary from a few hundred of
m to 104 m. The reddish colors correspond to high electrical resistivity values and the
bluish to low. Most of the high electrical resistivity values are located at the surface of the
ground.

Fig. 3. Electrical resistivity tomographies along profile 8. From top to the bottom profiles were made in 2009,
2012, and 2013. Fig. 3. Tomografas elctricas de resistividad a lo largo del perfil 8. Los perfiles de arriba a
abajo se hicieron en 2009, 2012 y 2013.

Fig. 4. Electrical resistivity tomographies along profile 9. From top to the bottom profiles were made in 2009,
2012, and 2013. Fig. 4. Tomografas de resistividad elctrica a lo largo del perfil 9. Los perfiles de arriba a
abajo se hicieron en 2009, 2012 y 2013.

240 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Fig. 5 Electrical resistivity tomographies along profile 10. From top to the bottom profiles were made in
2012, 2013 and 2017. Fig. 5 Tomografas de resistividad elctrica a lo largo del perfil 10. Los perfiles de
arriba a abajo se hicieron en 2012, 2013 y 2017.

It is typical that in all profiles /Fig. 3, 4 and 5/ the high electrical resistivity values at the
surface appear in the same location for the three years of the survey. At the same time it is
only possible to say that the high electrical resistivity values correspond to patches of frozen
ground or sporadic permafrost. In profile 10, the most resistive zones to the right of the three
tomographies correspond to ice with soil and stones that were observed by excavation.
Interesting observation is that the high electrical resistivity zone at the ground surface appears
to decrease its electrical resistivity value in time. This can be indication that the size of the
frozen patch (or sporadic permafrost) is decreasing as time.

Conclusions
Repeating of the electrical resistivity measurements in the CALM and PAPAGAL site near
the Bulgarian Antarctic Base St. Kliment Ohridski were made two-dimensional geoelectrical
models. They were conducted using the inversion code RES2DINV (Loke and Baker, 1995,
1996). All models show high electrical resistivity values in some zones (around 104 m)
interpreted as patches of frozen ground or sporadic permafrost and most of the patches persist
in time.

Acknowledgments
The authors thank the financial support of Fundacao para a Ciencia e a Tecnologia (FCT),
financial and logistic support on the field of the Bulgarian Antarctic Institute and for the
marine logistic of Spanish Antarctic Expedition. This work could not have been done without
their support.

References
Loke, M. H. and Baker, R. D. 1995. Least-squares deconvolution of apparent resistivity. Geophysics, 60: 1682
1690.
Loke, M. H. and Baker, R. D. 1996. Rapid least-squares inversion of apparent resistivity pseudo sections using
a quasi-Newton method. Geophysical Prospecting, 44: 131- 152.

241 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

FUNGAL COMMUNITIES ASSOCIATED WITH RHIZOME AND


RHIZOSPHERE OF ANTARCTIC ANGIOSPERMS COLOBANTHUS QUITENSIS
AND DESCHAMPSIA ANTARCTICA
(Aislamiento e identificacin de hongos endofticos asociados con angiospermas nativas de
la Antrtida: colobanthus quitensis [kunth] bartl. [caryophyllaceae] y deschampsia
antarctica desv. [poaceae])

Costa, L. C.1, Carvalho, C. R. 1, Rosa, L. H.1


1
Department of Microbiology, Federal University of Minas Gerais, Belo Horizonte, MG, Brazil. E-mail:
liviacostabio@yahoo.com.br

All plants in natural ecosystems around the world appear to be symbiotic with fungal
endophytes (Rodriguez et al., 2008) or associated fungi. These microorganisms can help the
plant community, conferring biotic and abiotic stress tolerance such as protection against
dehydration (Malinowski & Belesky, 2000) and cold (Snider et al., 2000). The most part of
the Antarctic continent is permanently covered by ice or snow leaving only 1% of the territory
available for the plants colonization (Bas, 2017). So, those whose are capable to colonize that
extreme environment have some adaptations, mainly against those harsh conditions (Cowan
& Tow, 2004). Thus, the objective of this study was to isolate and identify endophytic and
associated fungi of the only two Antarctics angiosperms Colobanthus quitensis e
Deschampsia Antarctica.

Methods
The plants were collected in six points of Antarctica Peninsula (Table 1), in the austral
Summer season, November to December of 2016.Were collected 4 plants from D. antarctica
of each site and 3 plants from C. quitensis of the King George and Penguin Island. The
rhizome past through a superficial disinfestation process following Upson et al. (2009) with
some modifications: The root fragments were submerged in a solution of Sodium
Hypochlorite 1% v/v for 1,5 min, followed by two washes of 2 min in sterile distilled water.
After this process, 5 fragments were plated in the medias: (1) Potato Dextrose Agar (PDA);
(2) Dichloran-Glycerol (DG-18); (3) Hagems Agar; (4) Modified Melin- Norkrans e (5)
PGK containing 200 g mL-1 of chloramphenicol (Sigma, USA) and incubated at 15C
between 15- 60 days. The Rhizosphere samples were obtained cleaning the maximum of soil
which were possible and weighting the roots with the associated soil until reach 1g. After
this process, those samples were putted into 1mL of sterile saline 0.85 % m/v and sonicated
for 30 s.100 L of this solution was serially diluted and plated at the concentration of 10-2
and10-3 using the same media of the rhizome. Fungi was purified in new Petri dishes
containing the culture medium which were isolated and deposited in the Collection of
Microorganisms and Cells of the Universidade Federal de Minas Gerais, Brazil. After, the
mycelium of each fungus was used to: I) extraction of the total DNA; II) macromorphological
grouping of colonies in morphotypes; III) grouping by fingerprint DNA technique using
the primer (GTG)5 and IV) amplification of Internal Transcribed regions (ITS), gene which
were sequenced and the sequences obtained were compared with the database GenBank
through Basic Local Alignment Search Tool (BLAST).

242 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Results and Discussion


Sixty-six fungal isolates were obtained from both plants, 44 isolated from D. Antarctica (41
from rhizosphere samples and 3 from rhizome) and 22 from C. quitensis (21 from rhizosphere
samples and 1 from rhizome). Using the molecular approach, were found 14 taxa representing
one family (Incertae sedis) and 7 genera: Penicillium Link, Cladosporium Link, Alpinaria
Jaklitsch & Voglmayr, Antarctomyces Stchigel & Guarro, Mortierella Coem, Microdochium
Syd. & P. Syd and Thelebolus Tode. Among those representatives, we identify the taxa:
Incertae sedis, Penicillium sp.1, Cladosporium ruguloflabelliforme, Alpinaria rhododendri,
Antarctomyces pellizariae, Penicillium sp. 2, Mortierella turficola, Penicillium sp. 3,
Microdochium lycopodinum, Thelebolus globosus, Penicillium sp. 4, Penicillium sp. 5,
Cladosporium versiforme and Mortierella sp. 1 (Table 1). The genera mostly founded in D.
Antarctica and C. quitensis was respectively Penicillium (38%) and Cladosporium (37.5%).
The Penicillium genus has a cosmopolitan distribution and were already described in
Antarctica at many substrates such as plants (Tosi et al., 2002), macroalgae (Godinho et al.,
2013), lakes water (Gonalves et al., 2012), soils (Godinho et al., 2015), permafrost
(Zucconi et al., 2012), glacial ice (Sonjak et al., 2006) and even in marine sediments
(Gonalves et al., 2013). According to McRae et al. (1999), that genus was the mostly
founded in the Antarctic ecosystem. The Cladosporium genus has cosmopolitan distribution
too, as the genus Penicillium, and is commonly found at all kinds of plants and soils (Bensch
et al., 2012). They have many species that were described as phytopathogens (Rivas &
Thomas, 2005), as well as the genus Microdochium. Because of that, they have a large
economic importance, but many species from this group are endophytic, does not causing
any harm to the plant (El-Morsy, 2000). In Antarctica, they were already isolated from
mosses (Tosi et al., 2002), rocks and soils (Onofri et al., 2000) and waters lake (Gonalves
et al., 2012). The genus Mortierella and Microdochium were widespread and were
respectively isolated in Antarctica from mosses (Melo et al., 2014) and vascular plants (Rosa,
2010). Some of the genera isolated such as Antarctomyces and Thelebolus are considered
cold-environment-specific genera (De Hoog et al., 2005) because they are psychrophilic. The
genus Antarctomyces besides being psychrophilic, it is an endemic genus from Antarctica.
The specie Alpinaria rhododendri belongs to a new genus recently revised and described by
Jaklitsch & Voglmayr (2017). It was only isolated from North America, Europe and Asia
(Himalaya) and had not been reported yet in Antarctica. Thus, this specie is a new citation
for the Antarctica environment.

Conclusion
According to the results obtained, we believe that D. antarctica and C. quitensis are a good
resource of endophytic and associated fungus, once the specie Alpinaria rhododendri, which
had not been reported yet in Antarctica, were isolated from this substrate. Those plants may
represent a microhabitat, which can possibly protect the endophytic fungi from the extreme
conditions of Antarctica (Rosa, 2010). Beyond that, those plants are a target for finding
interesting extremophile fungal endophytes (Rosa, 2009), which could be a rich source of
bioactive compounds, justifying the conduction of studies of identification and diversity of
those fungi in Antarctica and the protection of this continent.

Acknowledgments
We acknowledge the financial support from CNPq, FAPEMIG, CAPES, INCT Criosfera,
PROANTAR and Brazilian Navy.

243 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Table 1. Fungi obtained from Antarctic plants Colobanthus quitensis and Deschampsia antarctica and identified by sequence comparison with the BLASTn match with the NCBI GenBank database.
Tabla 1. Hongos obtenidos de Colobanthus quitensis and Deschampsia antarctica e identificados por comparacin de secuencias utilizando el BLASTn pareado con la base de datos del NCBI.

CF UFMGCB Top BLAST search results Query Identity N of bpb


a
Island/Region Substract Plants U (GenBank accession number) cover (%) (%) analyzed Proposed taxa
King George Rhizosphere 1 13234 Rhynchosporium agropyri [NR121480] 100 94 463 Incertae sedis
D. antarctica
(S 62 04 ,894; W 58 23,658")
Half moon Rhizome D. antarctica 3 13215 Penicillium biforme [NR138325] 100 99 454 Penicillium sp.1
(S 62 35 43,8"; W595505,9") Rhizosphere 1 13238 Cladosporium ruguloflabelliforme 100 100 391 Cladosporium ruguloflabelliforme
D. antarctica
[KT600458]
Rhizome D. antarctica 1 13278 Alpinaria rhododendri [NR147686] 100 99 444 Alpinaria rhododendri
Hannequin
(S 62 07 22,9; W 58 23 46,1) 16 13284 Antarctomyces pellizariae [KX576510] 100 100 443 Antarctomyces pellizariae
Rhizosphere D. antarctica
2 13327 Penicillium tularense [NR121251] 97 98 425 Penicillium sp.2

Elephant Rhizosphere 3 13349 Mortierella turficola [NR111583] 98 98 520 Mortierella sp.1


(S 611318,2"; W 5521 54,3") D. antarctica

Rhizome D. antarctica 9 13443 Penicillium swiecickii [NR121254] 97 98 466 Penicillium sp.3


Rhizosphere D. antarctica 12 13455 Microdochium lycopodinum [NR145223] 100 100 397 Microdochium lycopodinum
3 13457 Thelebolus globosus [NR138367] 97 100 445 Thelebolus sp.1
4 13470 Penicillium raistrickii [NR119493] 100 99 475 Penicillium sp.4
Penguin 25 13474 Penicillium swiecickii [NR121254] 98 99 418 Penicillium sp.3
(S 62 0604,7"; W 575513,0")
6 13480 Penicillium jamesonlandense [NR119570] 100 100 385 Penicillium sp.5

1 13496 Microdochium lycopodinum [NR145223] 100 100 407 Microdochium lycopodinum

C. quitensis 72 13501 Penicillium swiecickii [NR121254] 99 99 462 Penicillium sp.3


1 13502 Cladosporium versiforme [KT600417] 100 100 430 Cladosporium versiforme

Rhizosphere 2 13551 Mortierella parvispora [JX976076] 98 100 394 Mortierella sp.2


1 13552 Penicillium jamesonlandense [NR119570] 99 100 414 Penicillium sp.5
Pennsula Continental
Primavera D. antarctica 17 13569 Cladosporium versiforme [KT600417] 100 100 429 Cladosporium versiforme
(S 64 0918,6"; W 605720,1")
44 13583 Penicillium swiecickii [NR121254] 98 99 463 Penicillium sp.3
22 13602 Microdochium lycopodinum [NR145223] 100 100 429 Microdochium lycopodinum
aUFMGCB = Culture of Microorganisms and Cells from the Federal University of Minas Gerais. Taxa subjected to BLAST analysis based on the ITS region for elucidation of taxonomic positions. bBase pairs analyzed

244 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

References
Bas. Plants of Antarctica. Natural Environment Research Council-British Antarctic Survey. Retrieved from
https://www.bas.ac.uk/about/antarctica/wildlife/plants/ on 2017.06.16.
Bensch, K., Braun, U., Groenewald, J. Z., & Crous, P. W. (2012). The genus Cladosporium. Studies in
Mycology, 72(1), 1401. http://doi.org/10.3114/sim0003
Cowan, D. A., & Tow, L. (2004). Endangered antarctic environments. Annual Review of Microbiology, pp. 649
De Hoog GS, Gttlich E, Platas G, Genilloud O, Leotta G, van Brum- melen J (2005) Evolution, taxonomy and
ecology of the genus Thelebolus in Antarctica. Stud Mycol 51:3376
El-Morsy EM (2000). Fungi isolated from the endorhizosphere of halophytic plants from the Red Sea Coast of
Egypt. Fungal Diversity 5: 4354
Godinho, V. M., Furbino, L. E., Santiago, I. F., Pellizzari, F. M., Yokoya, N. S., Pupo, D., Cantrell, C. L., Rosa,
C. A., Rosa L. H. 2013. Diversity and bioprospecting of fungal communities associated with endemic and cold-
adapted macroalgae in Antarctica. The ISME Journaul, 7 (7): 1434-1451.
Godinho, V., Gonalves, V., Santiago, I., Figueiredo, H., Vitoreli, G., Schaefer, C., Rosa, L. H. (2015).
Diversity and bioprospectionof fungal community present in oligothrophic soil of continental Antarctica.
Extremophiles, 19, 585-596.
Gonalves, V. N., Vaz, A. B., Rosa, C. A., L. H. 2012. Diversity and distribution of fungal communities in
lakes of Antarctica. FEMS microbiology ecology, 82 (2): 459-471.
Gonalves, V., Campos, L., Melo, I., Pellizari, V., Rosa, C., & Rosa, L. (2013). Penicillium solitum: a
mesophilic, psychrotolerant fungus present in marine sediments from Antarctica. Polar Biology, 36, pp 1823
1831.
Malinowski DP, Belesky DP. (2000). Adaptations of endophtye-infected cool-season grasses to environmental
stresses: mechanisms of drought and mineral stress tolerance. Crop Science 40: 923940
Melo, I.S, Santos, S.N, Rosa, L.H, Parma, M.M, Silva, L.J, Queiroz, S. C. N., & Pellizari, V. H. (2014). Isolation
and biological activities of an endophytic Mortierella alpina strain from the Antarctic moss Schistidium
antarctici,1523
McRae, C., Seppelt, R., & Hocking, A. (1999). Penicillium species from terrestrial habitats in the Windmill
Islands, East Antarctica, including a new species, Penicillium antarcticum. Polar Biology, pp. 97-111
Onofri S, Fenice M, Cicalini AR, Tosi S, Magrino A, Pagano S, Selbmann L, Zucconi L, Vishniac HS, Ocampo-
Friedmann R, Friedmann EI (2000) Ecology and biology of microfungi from Antarctic rocks and soils. Ital J
Zool 67:163167
Rivas, S., & Thomas, C. M. (2005). AND THE L EAF M OLD P ATHOGEN, (59), 395436.
Rodriguez RJ, White JF, Arnold AE, Redman RS (2009) Fungal endophytes: diversity and functional roles.
New Phytol 182 314330
Rosa, L. H., Vaz, A. B. M., Caligiorne, R. B., Campolina, S., & Rosa, C. A. (2009). Endophytic fungi associated
with the Antarctic grass Deschampsia antarctica Desv. (Poaceae). Polar Biology, 32(2), 161167.
Rosa, L.H, Vieira, M.L.A, Santiago, I.F, Rosa, C.A; Endophytic fungi community associated with the
dicotyledonous plant Colobanthus quitensis (Kunth) Bartl. (Caryophyllaceae) in Antarctica. FEMS Microbiol
Ecol 2010; 73 (1): 178-189. doi: 10.1111/j.1574-6941.2010. 00872.x
Snider, C. S., Hsiang, T., Zhao, G., and Griffith, M. 2000. Role of ice nu- cleation and antifreeze activities in
pathogenesis and growth of snow molds. Phytopathology 90:354-361.
Sonjak, S., Uri, V., Frisvad, J. C., Gunde-Cimerman, N. 2007. Penicillium svalbardense, a new species from
Arctic glacial ice. Antonie van Leeuwenhoek, 92 (1): 43-51.
Tosi, S., Casado, B., Gerdol, R., Caretta, G. 2002. Fungi isolated from Antarctic mosses. Polar Biology, 25 (4):
262-268.
Upson, R., Newsham, K. K., Bridge, P. D., Pearce, D. A., Read, D. J., & Crittenden, P. (2009). Taxonomic
affinities of dark septate root endophytes of Colobanthus quitensis and Deschampsia antarctica , the two native
Antarctic vascular plant species. Fungal Ecology, 2(4), 184196. https://doi.org/10.1016/j.funeco.2009.02.004
Voglmayr, H., Jaklitsch, W. M., & Voglmayr, H. (2017). Three former taxa of Cucurbitaria and considerations
on Petrakia in the Melanommataceae Three former taxa of Cucurbitaria and considerations on Petrakia in the
Melanommataceae, (January). https://doi.org/10.12905/0380.sydowia69-2017-0081
Zucconi, L., Selbmann, L., Buzzini, P., Turchetti, B., Guglielmin, M., Frisvad, J., & Onofri, S. (2012).
Searching for eukaryotic life preserved in Antarctic permafrost. Polar Biology, pp. 749-757.

245 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

GEOMORFOLOGA Y SEDIMENTOLOGA DEL GLACIAR UNION,


MONTAAS ELLSWORTH, ANTRTICA OCCIDENTAL
(Geomorphology and sedimentology of Union Glacier area, Ellsworth Mountains,
Occidental Antarctica)

Costa V.C.S 1; Vieira, R.

POSGEO - LAPSA /Universidade Federal Fluminense (UFF)

Entender as interaes entre a Antrtica e o clima fundamental para a compreenso das


mudanas climticas e ambientais globais (Siegert e Florindo, 2008). As dinmicas ocorridas
a partir do ltimo Mximo Glacial (20.000 - 18.000 anos AP) advindas das mudanas
climticas, transformaram a paisagem dos ambientes glaciais em todas as regies. O interior
da Antrtica no foi to investigado quanto suas regies perifricas, por considerar que a
deglaciao e o fluxo de gelo so relativamente lentos. Entretanto, parte do manto de gelo se
encontra a aproximadamente 900m abaixo do nvel do mar e em contato direto com o oceano,
onde participa de trocas diretas de temperatura, embora no se tenha certeza da magnitude, a
base do manto de gelo vulnervel e muito suscetvel a transformaes a partir das mudanas
de temperaturas martimas (Rivera et al., 2010; Ross et al., 2014). A regio da Geleira Union,
localizada nas montanhas Ellsworth, manto de gelo da Antrtica Ocidental, (7946S ,
8324W) uma das regies sensveis s mudanas e carecem de estudos mais detalhados
quanto aos processos geomorfolgicos localizados.

Materiais e Mtodos
Anlises de formas glacialmente modificadas na geleira Union foram feitas a partir dos
trabalhos de campo e materiais coletados durante a expedio Criosfera, realizada no vero
de 2011-12. Foram realizadas observaes e mensuraes das feies erosivas e
deposicionais, em especial, identificao e classificao de morainas. Imagens ASTER
(2007), LANDSAT ETM (2010) e COSMO (2011) foram empregadas para a localizao e
identificao das reas de amostragem e de feies. com o uso do software ArcGis 10.1 para
confeco de uma mapa geomorfolgico. As amostras foram coletadas com uma p, em
pequenas cavidades, a fim de evitar o material meteorizado da superfcie, na quantidade de
100 gramas e postas em sacos plsticos identificados. Em cada local de coleta foram
realizados pontos de controle de GPS, fotografia com escala e observao do ambiente de
entorno (orientao, tamanho do depsito, matriz). Foram coletados 50 clastos por amostra,
com eixo maior > 15 mm para anlise morfomtrica.
A distribuio do tamanho das partculas de cada amostra foi determinada em laboratrio por
peneiramento a seco com intervalos em phi, de -3 a 4 (8 mm a 0,063 mm). A anlise da
forma dos clastos (arredondamento) e a descrio das caractersticas superficiais (estrias e
polimentos) foram feitas em lupa binocular a fim de analisar as fcies dos depsitos. 50
clastos de cada amostra foram mensurados manualmente usando caliper digital para
determinar visualmente o tamanho relativo dos trs eixos ortogonais: a (maior), b
(intermedirio) e c (menor). Os valores de arredondamento dos clastos (de 2 a 8 mm) foram
assignados usando o critrio descritivo de Benn e Ballantine (1994), modificado de Powers
(1953). Em adio, a anlise de co-varincia do ndice C40 (% de clastos com eixo c/a = 0,4)

246 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

e ndice RA (% de clastos muito angulosos e angulosos) foi conduzida de acordo com o


mtodo proposto por Benn e Balllantyne (1994) e Evans e Benn (2004).

Resultados e Discusses
Feies Geomorfolgicas
Duas feies erosionais nas reas livre de gelo ao norte da regio de Rossman Cove se
destacam por revelar a abraso por parte das geleiras em diferentes perodos, foram
identificados sulcos e estrias bem definidas. As estrias mais claras podem ter sido produzidas
por atividade glaciais mais recentes. As feies esto situadas em uma regio entre 40-50
metros acima da superfcie de gelo atual. Foram identificadas feies periglaciais bem
preservadas, incluindo morainas com ncleo de gelo e feies erosivas em mesoescala e
microescala (estrias e feies stoss and lee gigantes). A feio de stoss and lee gigante
entalhada na rocha de origem a maior feio erosiva que representa a ao e direo do gelo
na topografia local. Os stoss and lee podem indicar um perodo passado em que a camada de
gelo cobria parte topografia exposta da rea estando aproximadamente 200 metros acima da
superfcie atual. Por meio da interpretao visual de imagens ASTER e atividades de campo,
foi confeccionado um mapa geomorfolgico e glaciolgico (Figura. 1).

Figura 1 - Mapa geomorfolgico y glaciolgico (la imagen de fondo Aster color composite 321 adquirida el
27/01/2010). El flujo de los glaciares es inferido por las caractersticas geomrficas y Rivera et al. (2014).
Figure 1 - Geomorphological and glaciological map (the background image Aster color composite 321
acquired on 27/01/2010). The glacier flow is inferred by the geomorphic features and Rivera et al. (2014).

247 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Granulometria e Morfometria. Os diagramas ternrios e de Zingg indicam que a forma dos


clastos variada, porm com predomnio de placas. Os histogramas apresentam assimetria
negativa, com exceo de uma amostra, indicando uma baixa proporo de clastos angulosos
e muito angulosos. Predominam-se clastos subarredondados e subangulosos. Esta facie pode
ser interpretada como till basal com incorporao de sedimentos previamente meteorizados
pertencentes a geleiras j cobertas pelo manto de gelo. A justificativa dos elevados
percentuais de clastos arredondados podem se dar as modificaes pela abraso do vento. Os
sucessivos cordes apontam para as posies em um processo de recuo da geleira, que
proporcionaram a deposio do material.
O grfico representado na Figura 2, conhecido como diagrama de co-varincia, analisa como
dois aspectos dos clastos (forma e arredondamento) podem variar com a procedncia e a
histria do transporte dos depsitos glaciais (Evans e Benn, 2004). Segundo a classificao
de localizao de reas de controle sobre os sedimentos (supraglacial, subglacial e fluvial)
de Luka et al. (2013), as amostras sedimentares da regio da geleira Union se encontram no
grupo de reas de alta montanha, com aporte supraglacial, representados pelos valores
elevados de RA e baixos de RWR.

Figura 2 - Grfico de covarianza con todas las muestras analizadas: C40 (% De clastos con radio axial c / a
0.4) contra RA (% de clastos muy angulares y angulares) y RWR (% de clastos redondeados y bien
redondeados) de los sitios analizados. Cada smbolo representa una muestra de 50 clastos. (MO) Glaciar
Union; BMO Morainas Rossman Cove; RC Rossman Cove Hill); EH Valle Elephant Head; EMO
(Morainas Elephant Head). Figure 2 - Covariant plots of sediment samples: C40 (% of clasts which axis c / a
0.4), RA (% of angular and very angular clasts) and RWR (% rounded and well-rounded clasts). Each
symbol represents one sample with 50 clasts: UG (Union Glacier); RC (Rossman Cove); EH (Elephant Head);
EMO (Elephant Head Supraglacial Moraine).

Consideraes Finais
As feies erosivas e deposicionais, tais como os cordes morinicos e depsitos
supraglaciais identificadas fizeram parte dos processos de deglaciao que modificaram o
tamanho e a espessura do manto de gelo da Antrtica Ocidental, na rea da geleira Union,
em perodos passados. Morainas supraglaciais inferem antigos fluxos das geleiras, quando
estas com maior volume, depositaram espessos depsitos em suas zonas marginais. Estas
feies ainda foram afetadas pela ao constante dos ventos catabticos advindos do interior
do continente e podem ter sofrido processos de retrabalhamento do material detrtico por
intemperismo. Neste trabalho foram identificadas algumas feies que identificam abraso

248 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

por parte das geleiras, tanto em microescala atravs de estrias quanto em macroescala pela
feio stoss and lee, as quais adicionalmente indicam a direo de paleo fluxo da geleira.
Porm, no foram encontradas provas suficientes de materiais transportados pela geleira
subglacialmente. Anlises futuras de datao radiomtrica, da composio qumica e
mineralgica dos sedimentos e da direo do fluxo das geleiras so importantes para
identificar a procedncia do material e afirmar se houve ou no a participao de material
subglacial, alm do papel de diferentes litologias sobre a forma dos clastos.

Agradecimentos
CNPq, PROANTAR, FAPERJ, CPC (UFRGS), Jorge Arigony Neto, Thairiny Fonseca e
Livia Aguiar.

References
Benn D.I.; Ballantyne C.K. 1994.Reconstructing the transport history of glaciogenic sediments a new
approach based on the covariance of clast form indices. Sedimentary Geology, 91(14), p. 215-227.
Evans, D.J.A.; Benn, D.I. 2004. Facies description and the logging of sedimentary exposures. In: Evans, D.J.A.
and Benn, D.I. (Eds.). A Practical Guide to the Study of Glacial Sediments. Arnold, p. 11-51.
Florindo, F.; Siegert, F. (Ed.). 2008. Antarctic climate evolution. Vol. 8.(3-11).Elsevier.
Powers, M. C. 1953. A new roundness scale for sedimentary particles. Journal of Sedimentary Research, v. 23,
n. 2.
Rivera, A.; Zamora, R.; RADA, C.; WALTON, J.; PROCTOR, S. 2010. Glaciological investigations on Union
Glacier, Ellsworth Mountains, West Antarctica. Annals of Glaciology, 51(55), 91-96.
Ross, N.; Jordan, T. A.; Bingham, R. G.; Corr, H. F.J.; Ferraccioli, F.; Brocq A.; Rippin, Andrew, P.; Siegert,
W. M. J. 2014. The Ellsworth subglacial highlands: inception and retreat of the West Antarctic Ice Sheet.
Geological Society of America Bulletin, 126(1-2), 3-15.
Vieira, R., Simes, J.C. 2011. Geomorfologia Glacial dos Montes Patriot e Independence, Montanhas
Ellsworth, Manto de Gelo da Antrtica Ocidental. Revista Brasileira de Geomorfologia, 12, p. 45-58.

249 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

EFECTO DEL CAMBIO CLIMTICO SOBRE LA FLORA NATIVA Y NO- NATIVA DE


LA ANTRTICA MARTIMA DESDE UNA PERSPECTIVA MORFOFISIOLGICA
(Effect of climate change on native and non-native flora of the maritime Antarctica from a
morphophysiological perspective)

Cuba-Daz, M1,2., Fuentes-Lillo, E3., Contreras, P1,2., Vsquez, D1,2., Rivera, C1,2., Navarrete, E2.,
Rifo, S4.
1Laboratorio de Biotecnologa y Estudios Ambientales. 2Departamento de Ciencias y Tecnologa Vegetal, 4 Departamento
de Gestin Empresarial, Escuela de Ciencias y Tecnologa, Universidad de Concepcin, Campus Los ngeles.
3Laboratorio de Invasiones Biolgicas, Universidad de Concepcin, Facultad de Ciencias Forestales, Concepcin. E-mail.

mcuba@udec.cl, mcubaster@gmail.com.

El cambio climtico plantea una de las mayores amenazas para la biodiversidad a nivel mundial
(Urban, 2015). La pennsula Antrtica ha experimentado uno de los aumentos de temperaturas ms
rpidos de todo el hemisferio Sur (Lee et al. 2017). Durante los prximos 50 aos se espera que las
temperaturas aumenten en promedio 2C (Turner et al. 2016), esto resultar en una transformacin
completa del ambiente fsico, con la aparicin de nuevos hbitats disponibles dando nuevas
oportunidades para la dispersin y la colonizacin de la biota de la regin y posibles especies no-
nativas (Fuentes-Lillo et al. 2017). Estudiar como respondern las especies nativas y no-nativas en
cuanto a su crecimiento y su respuesta fisiolgica nos brinda la oportunidad de comprender como
sern los patrones de abundancia de estas especies y como esto podra jugar un papel en las
interacciones interespecficas entre las especies nativas y no- nativas presentes en la pennsula
Antrtica (Molina-Montenegro et al. 2016). Bajo este contexto, el objetivo de este trabajo fue
determinar los patrones de crecimiento y la respuesta fisiolgica de especies vegetales nativas y no-
nativas en la pennsula antrtica bajo distintos escenarios de cambio climtico.

Materiales y Mtodos
Para evaluar la respuesta en el crecimiento y la respuesta fisiolgica de las especies vegetales nativas
Colobanthus quitensis y Deschampsia antarctica y las no-nativas Poa annua (especie descrita en
sitios antropognicos y con expansin a zonas no antrpicas) y Juncus bufonius (especie detectada a
partir de muestras colectadas desde Antrtica), frente a escenarios de cambio climtico se realizaron
dos grandes experimentos:
Respuesta morfofisiolgica de Colobanthus quitensis y Juncus bufonius frente a diferentes
escenarios climticos. En este experimento se evalu el efecto combinado del aumento de la
temperatura y la disponibilidad hdrica en C. quitensis y J. bufonius. Los tratamientos consistieron en
6 tratamientos: 4C H2O, 4C+H2O, 14CH2O, 14C+H2O, 20CH2O y 20C+H2O. Las condiciones
H2O corresponde a un riego a capacidad de campo y +H2O corresponde a una condicin de la adicin
de un 40% ms de agua en base a lo pronosticado para la Antrtica (IPCC, 2007). Los individuos de
cada especie fueron mantenidos en condiciones experimentales por 60 das, posterior a este tiempo
se midieron la altura de la planta, nmero de hojas, largo de hoja, ancho de hoja, largo de raz y ancho
del cuello. Complementariamente se midieron parmetros fotosintticos (Fv/Fm), Contenido de
clorofila y la tasa de crecimiento relativo.

Respuesta morfolgica de individuos de C. quitensis, Deschampsia antarctica, J. bufonius y Poa


annua frente a diferentes escenarios climticos. Individuos de las especies C. quitensis, D.
antarctica, J. bufonius y P. annua, fueron sometidas a un periodo de aclimatacin-irrigacin de 30
das bajo tratamientos conjuntos de aumento de temperatura y disponibilidad hdrica. Se utilizaron
dos temperaturas; 6C (temperatura mxima alcanzada en verano) y 8C (temperatura pronosticada
segn los modelos climticos). Luego de los 30 das se comenz un periodo de deshidratacin por 14
das hasta el da 44, simulando la prdida de agua por congelamiento del suelo. Finalmente se restaur

250 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

el sistema de riego inicial hasta el da 74 (periodo de recuperacin). Al final de cada periodo se


estimaron los siguientes cocientes a partir de variables morfolgicas: largo raz/largo foliar, ancho de
hoja/largo de hoja, nmero de hojas, brotes y flores.

Resultados
Respuesta morfofisiolgica de C. quitensis y J. bufonius frente a diferentes escenarios climticos.
Los promedios ms altos en crecimiento para C. quitensis fueron obtenidos en el tratamiento de
20C+H2O (Tabla 1). Se observ cmo tendencia general que para el crecimiento de C. quitensis la
disponibilidad hdrica era un factor determinante, ya que los mejores promedios de crecimiento fueron
obtenidos bajo estos tratamientos sin importar la temperatura aplicada (Tabla 1.). J. bufonius present
un comportamiento distinto al presentado por C. quitensis, en donde el factor determinante en el
crecimiento fue la temperatura (Tabla 2). La disponibilidad hdrica no present efectos significativos
sobre las variables morfolgicas analizadas (Tabla 2). Se observ una respuesta similar en ambas
especies respecto del rendimiento fotosinttico (Fv/Fm), donde los tratamientos con menor
disponibilidad hdrica, mostraron los menores valores (Fig. 1A). Misma tendencia, con valores ms
bajos de Fv/Fm, se observ a 4C respecto de las otras temperaturas evaluadas presentaron los valores
ms bajos (Fig. 1A). Para ambas especies el contenido de clorofila se mantuvo bajo cuando los
tratamientos presentaban menor disponibilidad hdrica, por el contrario, los tratamientos con mayor
disponibilidad hdrica independiente de la temperatura mostraron los promedios ms altos de
contenido de clorofila (Fig. 1B). Para obtener una descripcin ms detallada de los resultados de
biomasa ver en profundidad Fuentes et al. (2017).

Tabla 1. Variables morfolgicas analizadas para C. quitensis


Table 1. Morphological variables analyzed for C. quitensis.

Tratamientos Largo de Nmero de Largo de Ancho de Nmero de Ancho de Largo de


planta hojas hoja hoja inflorescencias cuello raz
por planta
4CH2O 16,143,2d 9,501,9d 30,985,8a 0,640,4b 0,100,2c 0,460,1c 9,852,1b

4C+H2O 24,055,6bc 15,613,9ab 21,864,9b 1,770,9a 0,910,8a 0,460,3c 5,161,9b

14CH2O 22,646,1c 12,852,8b 21,493,9b 0,620,2b 0,850,3b 0,590,6b 12,534,9a

14C+H2O 27,504,9ab 17,612,7a 22,234,1b 1,321,0a 1,361,2a 0,650,2a 12,575,1a

20CH2O 24,612,1bc 15,052,1a 22,886,1b 0,760,5b 0,950,9b 0,460,2c 12,533,9a

20C+H2O 29,463,0a 17,613,9a 23,623,8b 1,440,8a 1,461,1a 0,580,4b 14,884,5a

*Letras distintas muestras diferencias significativas con un p<0,05/ Different letters showed significant differences with p <0.05.

Tabla 2. Variables morfolgicas analizadas para J. bufonius


Table 2. Morphological variables analyzed for J. bufonius.

Tratamientos Largo de Nmero de Largo de Ancho de Nmero de Ancho de Largo de


planta hojas hoja hoja inflorescencias cuello raz
por planta
4CH2O 33,404,3b 4,901,2b 28,035,6ab 0,310,2d 0,760,1ab 1,301,9a 10,721,2a

4C+H2O 33,755,2b 4,903,1b 23,166,9b 0,730,5c 0,580,3b 1,311,2a 10,722,3a

14CH2O 30,313,2b 9,302,5a 32,483,4a 1,161,2ab 1,111,8a 0,640,2b 10,422,1a


14C+H2O 35,829,0b 9,204,7a 24,655,6b 0,860,1b 1,051,2a 0,650,1b 10,401,9a
20CH2O 42,907,1a 9,003,7a 31,244,3a 1,231,1a 1,111,2a 0,620,4b 10,502,0a
20C+H2O 38,266,5b 9,204,2a 22,753,9b 0,820,8b 1,071,0a 0,620,1b 10,532,6a

*Letras distintas muestras diferencias significativas con un p<0,05/ Different letters showed significant differences with p <0.05.

251 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

A B

Figura 1. Efecto conjunto de la temperatura y disponibilidad hdrica sobre el rendimiento fotosinttico y el contenido de
clorofila en C. quitensis y J. bufonius. Figure 1. Combined effect of temperature and water availability on photosynthetic
performance and chlorophyll content in C. quitensis and J. bufonius.

Respuesta morfolgica de individuos de C. quitensis, D. antartica, J. bufonius y P. annua frente


a diferentes escenarios climticos. Existe una tendencia general que indica que todas las especies
presentan un mayor crecimiento en las temperaturas de 8C, el cual disminuye cuando existe una baja
disponibilidad hdrica. En un contexto general todas las especies presentaron una disminucin en el
crecimiento y floracin en el periodo de deshidratacin, pero este present un aumento en el periodo
de recuperacin, siendo siempre ms significo para el tratamiento de 8C+H2O. Para ms detalles de
todas las variables analizadas ver resumen Contreras y colaboradores.
Tabla 3. Variables morfolgicas evaluadas para las cuatro especies nativas y no-nativas bajo diferentes escenarios
climticos. Table 3. Morphological variables evaluated for the four native and non-native species under different climatic
scenarios.
C. quitensis D. antartica J. bufonius P. annua
Periodo Tratamiento Raiz/Brote N de flores Raiz/Brote N de Raiz/Brote N de flores Raiz/Brote N de flores
flores
b a df
Irrigacin 6C H2O 2,380,67 0,250,46 0,470,167 0a 0,860,36 bc
0,250,55 a
0,720,18 ef
0a
b a d a bc a f
6C+H2O 2,330,52 0,120,35 0.420,10 0 0,860,36 0,120,35 0,590,13 0a
8C H2O 3,990,74a 0a 0,720,21cef 0a 0,940,27bc 0a 1,410,30abc 0a
ab a cef a abc a a
8C+H2O 3,551,02 0 0,690,19 0 0,890,43 0 1,670,24 0a

Deshidratacin 6C H2O 2,240,85b 0,380,52a 0,520,17def 0a 0,720,39abc 0,120,35a 0,830,17def 0a


b a df a abc a ef
6C+H2O 2,290,59 0,120,35 0,450,10 0 0,720,49 0,250,44 0,680,14 0a
8C H2O 2,441,10b 0a 0,560,15def 0a 0,570,08abc 0a 1,131,16bcd 0a
ab a bcde a a a abcd
8C+H2O 3,131,36 0 0,760,10 0 0,440,12 0 1,220,32 0a

Recuperacin 6C H2O 2,610,88ab 0,870,83a 0,700,17cef 0a 0,590,20abc 0a 0,980,17cde 0a


6C+H2O 2,751,66ab 0,250,46a 0,870,11abc 0a 0,690,20abc 0a 1,520,29ab 0a
ab a ab a abc a ab
8C H2O 3,460,54 0,120,35 0,870,14 0 0,850,34 0 1,500,29 0,870,83a
8C+H2O 3,361,01ab 0,120,35a 1,120,14a 0a 0,500,25ab 0a 1,470,52ab 0,650,52a

*Letras distintas muestras diferencias significativas con un p<0,05/Different letters showed significant differences with p <0.05

Discusin
Los resultados de la respuesta de C. quitensis confirman la respuesta generalizada de esta especie a
los aumentos de temperatura y la disponibilidad hdrica, en donde varios son los estudios que indican
aumentos en el crecimiento, capacidad reproductiva y rendimiento fisiolgicos frente a los escenarios
de cambio climtico (Fuentes-Lillo et al. 2017). Estos mismos patrones de respuesta ya han sido
evaluados en campo en el caso de D. antartica, en donde mediante el uso de OTC se determin que

252 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

existir un aumento en la abundancia de esta especie atribuidos principalmente a los aumentos de


temperatura que experimentar la pennsula Antrtica (Torres-Mellado et al. 2011). Por otro lado,
simulaciones climticas realizadas en D. antartica indicaron que la el aumento de temperatura y la
disponibilidad hdrica aumenta significativamente la biomasa total. En cuanto a la respuesta de P.
annua ya haba sido informado resultados similares en donde se presenta un incremento de la biomasa
total de la planta, en el nmero de hojas y brotes frente a aumentos de temperatura, adems de no ser
afectada por las condiciones hdricas del suelo (Molina-Montenegro et al. 2015). Estudios previos
han indicado que J. bufonius es intolerante a la baja disponibilidad hdrica, este efecto no fue
observado en este estudio donde la temperatura fue el factor con mayor influencia. Se ha informado
en la literatura que la temperatura juega un rol importante en el crecimiento y especficamente en la
respuesta fotosinttica de esta especie y su tasa reproductiva (Cope y Stace, 1978).
Conclusiones
Los resultados obtenidos indicaron una respuesta similar en cuanto a las especies estudiadas,
indicando que el aumento de la temperatura y la disponibilidad hdrica jugarn un papel fundamental
en la expansin geogrfica tanto de las especies nativas como no-nativas, ya que mejora
significativamente los rendimientos morfolgicos, fisiolgicos y reproductivos, factores que son
determinantes en el xito de estas especies en la pennsula Antrtica. Tomando en cuenta los
pronsticos de aumento de temperatura para la pennsula Antrtica, es necesario colocar atencin en
cules sern los efectos de las especies no nativas que fueron utilizadas en este estudio. Considerando
que J. bufonius y P. annua se encuentran clasificadas dentro del grupo de invasoras, es sumamente
importante generar estudios que evalen el efecto directo que podra tener la expansin geogrfica de
estas especies en la pennsula Antrtica, sobre la flora nativa, especficamente estudios de
competencia, seran pertinentes para evaluar estos puntos.

Agradecimientos
Los autores agradecen al proyecto INACH RG_02-13 y Fondecyt 1140441 (INACH FR_03-14).

Referencias
Cope, T.A., Stace, C.A., 1978. The Juncus bufonius L. aggregate in Western Europe.
Watsonia 12, 113e128
Fuentes-Lillo, E., Cuba-Daz, M., & Rifo, S. (2017). Morpho-physiological response of Colobanthus quitensis and Juncus
bufonius under different simulations of climate change. Polar Science, 11, 11-18.
Lee, J. R., Raymond, B., Bracegirdle, T. J., Chads, I., Fuller, R. A., Shaw, J. D., & Terauds, A. (2017). Climate change drives
expansion of Antarctic ice-free habitat. Nature.
Molina-Montenegro, M. A., Galleguillos, C., Oses, R., Acua-Rodrguez, I. S., Lavn, P., Gallardo-Cerda, J., ... & Atala, C.
(2016). Adaptive phenotypic plasticity and competitive ability deployed under a climate change scenario may promote the
invasion of Poa annua in Antarctica. Biological invasions, 18(3), 603-618.
Molina-Montenegro, M. A., Pertierra, L. R., Razeto-Barry, P., Daz, J., Finot, V. L., & Torres-Daz, C. (2015). A recolonization
record of the invasive Poa annua in Paradise Bay, Antarctic Peninsula: modeling of the potential spreading risk. Polar
Biology, 38(7), 1091-1096.
Torres-Mellado, G. A., Jana, R., & Casanova-Katny, M. A. (2011). Antarctic hairgrass expansion in the South Shetland
archipelago and Antarctic Peninsula revisited. Polar Biology, 34(11), 1679.
Turner, J. et al. Absence of 21st century warming on Antarctic Peninsula consistent with natural variability. Nature 535,
411415 (2016).
Urban, M. C. Climate change. Accelerating extinction risk from climate change. Science 348, 571573 (2015).

253 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

GERMOPLASMA ACTIVO DE PLANTAS VASCULARES ANTRTICAS:


INICIATIVA AL SERVICIO DE LA BIOLOGA VEGETAL ANTRTICA.
(Active germplasm of antarctic vascular plants: initiative in the service of Antartic plant
biology)

Cuba-Daz M.1

Laboratorio de Biotecnologa y Estudios Ambientales, Departamento de Ciencias y Tecnologa Vegetal,


Universidad de Concepcin, Campus Los ngeles, Juan Antonio Coloma 0201, Los ngeles, Chile. E-mail.
mcuba@udec.cl, mcubaster@gmail.com.

La Antrtica es an considerada un sistema prstino debido a la poca intervencin antrpica


pero con el rpido incremento de la actividad humana en la zona, las comunidades de plantas
terrestres podran presentar problemas de conservacin, debido principalmente a daos
producidos por el pisoteo, el transporte terrestre, la construccin de infraestructura y el
impacto de las especies introducidas por el hombre, as como por los efectos del cambio
climtico el cual tiende a incrementar la cobertura vegetal y la diversidad de especies (Torres-
Mellado et al. 2011; Cannone et al. 2015). La vegetacin antrtica se encuentra distribuida
sobre suelo libre de hielo y est presente en distintas comunidades vegetales en cada una de
las 15 Regiones Biogeogrficas de Conservacin Antrtica (RBCA) (Hughes et al. 2016).
Por razones logsticas, las locaciones costeras son favorables para la llegada de los turistas y
las actividades de investigacin, incluyendo la construccin de estaciones de investigacin,
el funcionamiento continuo de las instalaciones y otras habilitaciones logsticas de los
programas antrticos nacionales. Estos procesos de perturbacin generan daos directos e
indirectos como son la destruccin de hbitat y la introduccin de especies no-nativas (Frenot
et al. 2005; Tin et al. 2009; Hughes & Convey 2011; Chown et al. 2012).
Recientemente, Hughes et al. (2016) encontraron grandes omisiones en la proteccin de la
diversidad botnica de la Antrtida en seis RBCA y en otras seis <0.4% del rea de la RBCA
estuvo dentro de una ZAEP (reas Especialmente Protegidas) que protege la vegetacin
nativa. Concluyendo que la diversidad botnica de la Antrtida est claramente mal protegida
y requiere de una designacin sistemtica de ZAEP que protejan las comunidades vegetales
por parte de las Partes Consultivas del Tratado Antrtico, los miembros del cuerpo de
gobierno del continente (ver Hughes et al. 2016). Otros autores han considerado igualmente
que el nivel de proteccin actual es inadecuado y que una vasta regin en la Antrtica est
desprovista de reas especialmente protegidas (Shaw et al. 2014; Terauds et al. 2016).
No solo el desarrollo de reas Especialmente Protegidas y otros resguardos de conservacin
y proteccin in situ son medidas de proteccin para el patrimonio gentico presente en la
Antrtica. Muchas actividades de investigacin relacionadas con las especies vegetales se
pueden realizar a partir de material propagado y conservado en condiciones controladas en
el laboratorio. A finales del ao 2009 y con material vegetal colectado en actividades de
terreno del Proyecto INACH T_03-09, se comenz una pequea coleccin de plantas nativas
antrticas en el Laboratorio de Biotecnologa y Estudios Ambientales (BEA) del Campus Los
ngeles de la Universidad de Concepcin. En la actualidad la coleccin se ha enriquecido
con material vegetal proveniente de diferentes poblaciones antrticas y de otras reas
geogrficas a partir del desarrollo de otros proyectos y colaboraciones nacionales e
internacionales.

254 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

La conservacin de los recursos genticos vegetales de plantas tiles o potencialmente tiles


al ser humano, se puede practicar bajo dos modalidades: in situ, es decir en el lugar donde
crecen en estado silvestre, o ex situ, o sea fuera del lugar donde crecen en estado silvestre
(Salazar et al, 2006). Los bancos de germoplasma son instalaciones o centros para conservar
recursos genticos bajo condiciones favorables para prolongar su sobrevivencia cuyo
objetivo final corresponde a la conservacin ex situ de diversidad gentica. Las ventajas de
la conservacin ex situ es que son mtodos confiables y seguros y aplicables a un alto rango
de especies y adems facilita el acceso al material vegetal que se conserva. La conservacin
sostenible de estos recursos fitogenticos depende de una gestin eficaz y eficiente de los
bancos de germoplasma mediante la aplicacin de normas y procedimientos que aseguren la
continua supervivencia y disponibilidad de los recursos fitogenticos (FAO 2014). En las
Normas para bancos de germoplasma de recursos fitogenticos se proporcionan directrices
internacionales para la conservacin ex situ en bancos de semillas, en bancos de germoplasma
de campo y en bancos de conservacin in vitro y de criopreservacin. En el mbito cientfico,
los progresos en la tecnologa de almacenamiento de semillas, la biotecnologa y la
tecnologa de la informacin y la comunicacin han aadido una nueva dimensin a la
conservacin del germoplasma vegetal (FAO 2014; MINAGRI, Chile 2014).
En esta propuesta se pretende dar a conocer las posibilidades de colaboracin a partir de la
experiencia de trabajo lograda en la mantencin y propagacin de este material vegetal. Con
la intencin de propiciar el inters para realizar esfuerzos conjuntos con instituciones y/o
investigadores para conservar, propagar e intercambiar este material y obtener fondos
conjuntos que permitan mejorar a travs de investigacin especfica las condiciones del
Banco y lograr establecer la conservacin en condiciones idneas para el apoyo en
investigacin antrtica.
De acuerdo a la experiencia de trabajo y disponibilidad del material del germoplasma
Antrtico, una de las prioridades del laboratorio es la multiplicacin tanto en jardn comn
como in vitro, la caracterizacin (morfolgica, fisiolgica y molecular), el mejoramiento de
las condiciones de conservacin y desarrollo de protocolos de monitoreo y finalmente la
disponibilidad de material para colaboracin en investigacin y/o facilitacin del material
vegetal disponible. Se dispone adems de un stock de semillas conservadas a bajas
temperaturas a corto plazo.
Especie Nombre Localizacin geogrfica In vitro Ejemplares
poblacin en Banco
Colobanthus Pen. Bayers Is. Livingston, Shetlands del Sur, Antrtica No > 20
quitensis Arctowski Is. Rey Jorge, Shetlands del Sur, Antrtica Si > 300
Punta Hannah Is. Livingston, Shetlands del Sur, Antrtica Si > 20
Omora Parque Omora, Puerto Willians No > 200
La Marisma Punta Santa Mara, Punta Arenas Si > 50
Laredo Baha Laredo, Punta Arenas Si > 100
La Vega INIA Kampenaike, Punta Arenas Si > 50
Conguillo PN Conguillo, Regin de La Araucana Si > 300
La Parva Cerro La Parva, Regin Metropolitana Si > 10
Deschampsia Pen. Bayer Is. Livingston, Shetlands del Sur, Antrtica Si > 100
antarctica Punta Hannah Is. Livingston, Shetlands del Sur, Antrtica Si > 20
Arctowski Is. Rey Jorge, Shetlands del Sur, Antrtica Si > 50
Ecology Is. Rey Jorge, Shetlands del Sur, Antrtica Si > 20
Juncus Antrtica Is. Rey Jorge, Shetlands del Sur, Antrtica Si > 100
bufonius Angol PN Nahuelbuta, Regin de La Araucana Si 5

255 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Polonia Cercanas de Varsovia Si > 10

Tabla 1: Especies y poblaciones representadas en el Germoplasma Antrtico del Laboratorio de


Biotecnologa y Estudios Ambientales, UdeC.
Table 1: Species and populations represented in the Antarctic Germplasm of the Laboratory of Biotechnology
and Environmental Studies

La coleccin actualmente cuenta (Tabla 1) con las especies nativas Colobanthus quitensis y
Deschampsia antarctica y las no nativas Juncus bufonius y Poa annua (slo semillas) (Olech
& Chwedorzewska 2011, Cuba-Daz et al. 2013; 2015b; Molina-Montenegro et al. 2016).
No se tiene conocimiento de la existencia de otra coleccin de plantas vasculares antrticas
similar a esta y hemos propuesto que la coleccin podra considerarse como un Banco Activo.
Los bancos activos tienen como objetivo recolectar e intercambiar material, regenerar,
caracterizar, documentar y finalmente conservar los recursos fitogenticos con el fin de
disponer del germoplasma e informacin de calidad en forma oportuna para otros usuarios
(MINAGRI, Chile 2014). El material vegetal obtenido a partir del desarrollo de esta
iniciativa, ha permitido establecer colaboraciones con varios grupos nacionales e
internacionales, contribuyendo al incremento de indicadores del laboratorio BEA (Fig. 1).
Una iniciativa similar ha sido informado recientemente por Wilmotte et al. (2014), ellos
disponen de una coleccin de 102 cepas de cianobacterias Antrticas para las cuales han
desarrollado un sistema de manejo de calidad certificado para la posible distribucin de las
diferentes cepas que se caracterizan por su diversidad de acuerdo a sus orgenes ecolgicos
(Ver Wilmotte et al. 2014).

Figura 1: Indicadores y actividades desarrolladas en el Laboratorio de Biotecnologa y Estudios Ambientales,


U. de Concepcin entre los aos 2013-2016, a partir del material propagado y mantenido en el Germoplasma
Activo de plantas vasculares Antrticas tanto en Jardn comn como in vitro.
Figure 1: Indicators and activities developed in the Laboratory of Biotechnology and Environmental Studies,
U. de Concepcin betweens 2013-2016, from propagated and maintained material in the Active Germplasm
of Antarctic vascular plants in both common gardens and in vitro.

Conclusiones
Iniciativas como estas permiten el desarrollo de investigacin de primer nivel y el
establecimiento de colaboraciones, sin necesidad de asistir regularmente a los sitios naturales
donde se desarrollan las distintas poblaciones de estas especies. Se puede, adems, obtener

256 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

una gran cantidad de material para realizar las investigaciones que as lo requieran, incluso
en condiciones de asepcia a travs del cultivo in vitro.

Perspectivas
Establecer vnculos con grupos interesados con el propsito de ampliar las poblaciones
representadas, para la mejora de los protocolos de conservacin y propagacin y para la
obtencin de fondos de apoyos basales y concursables para mantener esta iniciativa, as cmo
su disponibilidad para la comunidad Antrtica.
Agradecimientos
Proyectos INACH: RT_03-09 y RG_02-13, VRID: 213.418.004-1.0 y 217.418.009-1.0.

Referencias
Cannone, N. Guglielmin, M. Convey, P. Worland, MR. Favero Longo, SE. 2016. Trends in higher plant populations over
the last half century on Signy Island, maritime Antarctic. Climatic Change. 134: 651-665.
Chown, SL. Huiskes, AHL. Gremmen. NJ. Lee, JE. Terauds, A. Crosbie, K. Frenot, Y. Hughes, KA. Imura, S. Kiefer, K.
Lebouvier, M. Raymond, B. Tsujimoto, M. Ware, C. Van de Vijver, B. Bergstrom, DM. 2012. Continent wide risk
assessment for the establishment of non-indigenous species in Antarctica. Proceedings of the National Academy of Sciences.
109: 49384943.
Cuba-Daz, M. Troncoso, J.M. Cordero, C. Finot, VL. Rondanelli-Reyes, M. 2013. Juncus bufonius, a new non-native
vascular plant in King George Island, South Shetland Islands. Antarctic Science. 25: 285-286.
Cuba-Daz, M. Fuentes, E. Rondanelli-Reyes, M. Machuca, . 2015. Experimental culture of non-indigenous Juncus
bufonius from King George Island, South Shetland Island, Antarctica. Advances Polar Science. 26: 24-29.
FAO 2014 Normas para bancos de germoplasma de recursos fitogenticos para la alimentacin y la agricultura. Edicin
Revisada. Roma. E-ISBN 978-92-5-308262-9. 182 pp.
Frenot, Y. Chown, SL. Whinam, J. Selkirk, PM. Convey, P. Skotnicki, M. Bergstrom, DM. 2005. Biological invasions in
the Antarctic: extent, impacts and implications. Biological Reviews. 80: 45-72.
Hughes, KA. Convey, P. 2011. Determining the native/non-native status of newly discovered terrestrial and freshwater
species in AntarcticaCurrent knowledge, methodology and management action. Journal Environmental Management. 93:
52-66.
Hughes, KA. Ireland, LC. Convey, P. Fleming, AH. 2016 Assessing the effectiveness of specially protected areas for
conservation of Antarcticas botanical diversity. Conservation Biology 30: 113120.
MINAGRI 2014 Conservacin, acceso y valorizacion del patrimonio fitogentico: Acciones y mejoras de los Bancos de
Germoplasma en Chile. QuadGraphics Chile S.A. 56 pp.
Molina-Montenegro, MA. Galleguillos, C. Oses, R. Acua-Rodrguez, IS. Lavn, P. Gallardo-Cerda, J. Torres-Daz, C.
Diez, B. Pizarro, GE. Atala, A. 2016. Adaptive phenotypic plasticity and competitive ability deployed under a climate
change scenario may promote the invasion of Poa annua in Antarctica. Biol Inv. 18: 603-618.
Olech, M. Chwedorzewska, JA. 2011 .The first appearance and establishment of an alien vascular plant in natural habitats
on the fore field of a retreating glacier in Antarctica. Antarct Sci. 23: 153154.
Salazar, E. Len, P. Rosas, M. Muoz, C. 2006. Estado de la conservacin ex situ de los recursos fitogenticos cultivados
y silvestres en Chile. Boletn INIA n156. Santiago.
Shaw, JD. Terauds, A. Riddle, MJ. Possingham, HP. Chown, SL. 2014 Antarcticas protected areas are inadequate,
unrepresentative, at risk. PLoS Biology. 12: e1001888, doi: 10.1371/journal.pbio.1001888.
Terauds, A. Lee, JR. 2016 Antarctic biogeography revisited: updating the Antarctic Conservation Biogeographic Regions.
Diversity and Distributions 22, 836840
Tin, T. Fleming, ZL. Hughes, KA. Ainley, DG. Convey, P. Moreno, CA. Pfeiffer, S. Scott, J. Snape, I. 2009. Impacts of
local human activities on the Antarctic environment. Antarctic Science 21:333.
Torres-Mellado, G. Jaa, R. Casanova-Katny, M.A. 2011. Antarctic hairgrass expansion in the South Shetland Archipelago
and Antarctic Peninsula revisited. Polar Biol. 34: 1679-1688.
Wilmotte, A. Renard, M. Kleinteich, J. Laughinghouse, HD. Haywood, D. De Carvalho Maalouf, P. Mano, MJ. Calusinska,
M. Waleron, K. Waleron, M. Silva-Stenico, ME. Fiore, M. Elster, J. 2014. Ex-situ conservation of Antarctic cyanobacteria
: a culture collection to explore diversity and bioactivity. XXX111 SCAR Biennial Meetings and Open Science Conference
2014. http://hdl.handle.net/2268/180552

257 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

ANLISIS ESTADSTICO DE LOS SUELOS DE LAS ISLAS SHETLAND DEL


SUR, ANTRTICA
(Statistical Analysis of Soils from South Shetland Islands, Antarctica)

Daher, M. P.1, Schaefer, C. E. G. R. 1, Fernandes Filho, E. I. 1, Cser, M. M.1


1
Departamento de Solos, Universidade Federal de Viosa, Viosa - MG, Brasil. E-mail: elpidio@ufv.br

O arquiplago das Shetland do Sul est situado na Antrtica Martima, formado por 11 ilhas
principais e diversas ilhas menores, com uma rea total de 4.700 km, deste total
aproximadamente 10% est livre de gelo, destacando-se a Pennsula Byers na Ilha
Livingston, como a maior rea livre de gelo desta regio. Os solos das Ilhas Shetland do Sul
so muito diferentes dos de outras zonas climticas da Antrtica (Campbell e Claridge, 1987;
Bockheim e Ugolini, 1990; Simas et al., 2006). As temperaturas mais elevadas e a presena
de gua lquida no solo durante o vero favorecem o intemperismo qumico, o incio de uma
srie de processos pedogenticos e consequentemente o aparecimento de cobertura vegetal
(Campbell e Claridge, 1987). Alm da gua, a matria orgnica acumulada e a entrada de
nitrognio e fsforo oriundos de dejetos de aves marinhas, favorecem o desenvolvimento dos
solos (Simas et al., 2007).
Desde 2002 pesquisadores brasileiros (Francelino, 2004; Michel, 2005; Simas, 2006;
Bremer, 2008; Moura, 2010; Resk 2011; Delpupo, 2012; Daher, 2015), atravs do Ncleo
Terrantar, tm contribudo efetivamente para a caracterizao fsico-qumica dos solos e
permafrost, monitoramento e mapeamento da camada ativa e do permafrost nas Ilhas
Shetland do Sul e Pennsula Antrtica. No entanto, apesar do crescente nmero de estudos
dos ltimos anos, esta rea ainda uma das partes menos conhecidas da Antrtica, em termos
de estudos dos solos e permafrost (Tatur, 1989; Bockheim e Ugolini, 1990; Blume et al.,
2004). Neste contexto, o objetivo deste trabalho compilar os principais trabalhos realizados
nas Ilhas Shetland do Sul e sintetizar as caractersticas dos solos deste arquiplago atravs de
uma anlise estatstica descritiva.
O arquiplago das Shetland do Sul est localizado a noroeste da Pennsula Antrtica. O clima
martimo subantrtico com temperatura mdia do ar anual entre -2 e -4 C e precipitao
mdia anual de 400-700 mm equivalente de gua (Bockheim, 2014). O permafrost
descontnuo, possui espessura menor que 100 m e temperatura no topo do permafrost que
varia de 0 a -2,5 C (Bockheim, 1995). Os 71 perfis de solo utilizados neste estudo foram
coletados entre os veres austrais de 2003 a 2014 (Francelino, 2004; Simas, 2006; Moura,
2010; Resck, 2011; Almeida, 2012, Daher, 2015) e esto distribudos em seis ilhas:
Barrientos, Deception, Rei George, Livingston, Penguin e Robert (Figura 1). As anlises
fsicas e qumicas de rotina obtidas atravs de procedimentos padres de acordo com
EMBRAPA (1997) e SSS (2014) foram tabuladas para o estudo. Com a finalidade de
padronizar os dados para a realizao da anlise estatstica, as profundidades de todos os
perfis foram interpolados para 0-10, 10-20 e 20-30 cm.

258 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Figura 1. Localizao das Ilhas Shetland do Sul. Figura 1. Ubicacin de las Islas Shetland del Sur.

A estatstica descritiva das anlises fsicas e qumicas dos solos das ilhas em estudo,
considerando as trs camadas (0-10, 10-20 e 20-30) so apresentadas na Tabela 1. A partir
dos resultados estatsticos destas anlises, observa-se que os valores de mdia e mediana so
muito prximos na maior parte das variveis, com exceo de Mg, P, Al e COT. Isto indica
que, de forma geral, dentro destes conjuntos de dados, estes resultados no fogem da
tendncia central, sendo representativo de todo o conjunto e que estas medidas podem ser
consideradas como valores tpicos do conjunto de observaes.
Os solos das Ilhas Shetland do Sul apresentaram, de maneira geral, textura com maior
contribuio de areia grossa (mdia = 47,4) (Tabela 1), o que est condizente com o
pedoambiente pouco transformador, em que o intemperismo fsico dominante. No entanto,
os maiores teores de argila do arquiplago das Shetland do Sul esto na Ilha Livingston, onde
os valores chegam a 40 % de argila, valores estes relacionados ao material de origem, que
so argilitos marinhos.
Os valores de pH apresentam mdia de 6,4 (Tabela 1), porm h valores de pH fortemente
cidos, com valores abaixo de 4,0, acidez esta relacionada tanto influncia ornitognica
(Ilhas Livingston e King George) devido ao processo de mineralizao do guano (Myrcha e
Tatur, 1988; Tatur, 1989), quanto a presena de sedimentos ricos em sulfetos (Ilha King
George, Baa do Almirantado) que sofreram processo de oxidao (Tatur et al., 1993).
Os valores de Ca, Mg e K so bastante elevados, com mdia de 12,79 cmolc/dm, 11,46
cmolc/dm e 155,5 mg/dm, respectivamente (Tabela 1). Entretanto, importante observar
que o valor da mediana do Mg (8,90 cmolc/dm) o que mais difere da mdia, isso acontece
porque h teores acima de 30 cmolc/dm deste ction na Ilha Robert, influenciando o valor
da mdia mais alto que o valor da mediana. Os altos valores deste ction nesta ilha esto
relacionados principalmente ao material de origem olivina-basltico (Daher, 2015). O teor
mdio de Na nas Ilhas Shetland do Sul de 379,50 mg/dm, este teor elevado atribudo aos
sprays salinos devido proximidade com o mar, como j reportado em outros trabalhos
(Simas et al., 2006; Bremer, 2008; Resk, 2011).

259 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Tabela 1. Anlise estatstica descritiva das variveis fsicas e qumicas dos solos na profundidade de 0-30 cm
das Ilhas Shetland do Sul. Tabla 1. Anlisis estadstico descriptivo de las variables fsicas y qumicas del suelo
en la profundidad de 0-30 cm de las Islas Shetland del Sur.

1
AG: Areia Grossa; 2AF: Areia Fina.

Os valores de mdia e mediana dos teores de P disponvel extraveis por Mehlich-1 foram os
que mais se distanciaram, resultando em 404, 99 mg/dm e 134,43 mg/dm, respectivamente
(Tabela 1). Esta diferena est associada aos altos valores de P encontrados nos solos
ornitognicos, principalmente os da Ilha King George, que esto acima de 4000 mg/dm de
P.
Os valores de Al3+ variaram desde nulo at 19,5 cmolc/dm (Ilha King George, Lions Rump),
sendo a mediana de 0,03 cmolc/dm, e a mdia de 2,10 cmolc/dm (Tabela 1), esta ltima
influenciada pelos altos valores encontrados. Os valores mais elevados tambm encontram-
se associados ornitognese e aos materiais sulfetados, como j discutido.
Os valores de COT apresentaram mdia de 1,90 % e mediana de 1,00 %
(Tabela 1), com destaque para as Ilhas Livingston e Penguin, com os valores mais altos de
COT (33,06 e 14,34 %, respectivamente), segundo Resk (2011), este valor est relacionado
forte influncia de nidificao, em que o aporte superficial de guano favorece o
estabelecimento de uma cobertura vegetal mais densa.
Os resultados apresentados neste trabalho demonstraram que os solos das Ilhas Shetland do
Sul apresentaram, de forma geral, altos teores de areia, teores neutros de pH e altos teores de
ctions trocveis, destacando-se as reas sob material de origem olivina-basalto (Ilhas Robert
e Barrientos) e sob influncia ornitognica. Os altos teores de P tambm esto associados s
reas sob influncia ornitognica, bem como os elevados teores de COT.

Agradecimentos
Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq) e Ministrio da
Cincia, Tecnologia e Inovao (MCTI).

Referencias
Blume, H.P.; Chen, J.; Kalk, E.; Kunh, D. 2004. Mineralogy and Weathering of Antarctic Cryosols. In: Kimble,
J.M. Ed. Cryosols: Permafrost-affected Soils. Berlin/Heidelberg/New York: Springer-Verlag. 415-426.

260 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Bockheim, J. 2014. Cryopedology. Springer, NY (173 pp.).


Bockheim, J.G.; Ugolini, F.C. 1990. A Review of Pedogenic Zonation in Welldrainedsoils of the Southern
Circumpolar Region. Quaternary Research 34:47-66.
Bremer, U.F. 2008. Solos e Geomorfologia da Parte Leste da Pennsula Warsawa, Ilha Rei George, Antrtica
Martima. Tese de Doutorado. Universidade Federal de Viosa.
Campbell, I.B.; Claridge, G.G.C. 1987. Antarctica: Soils, Weathering Processes and Environment. Elsevier,
Amsterdam (368 pp.).
Daher, M.P. 2015. Gnese e Classificao de solos na Pennsula Coppermine (Ilha Robert) e Ilha Barrientos,
Antrtica Martima. Dissertao de Mestrado. Universidade Federal de Viosa.
Delpupo, K.K.D. 2012. Gnese e Classificao de Solos Desenvolvidos em Semideserto Polar - Ilha Seymour,
Antrtica. Dissertao de Mestrado. Universidade Federal de Viosa.
EMBRAPA (Centro Nacional de Pesquisa de Solos). 1997. Manual de Mtodos de Anlise de Solo. Centro
Nacional de Pesquisa de Solos, Rio de Janeiro.
Francelino, M.R. 2004. Geoprocessamento Aplicado ao Monitoramento Ambiental da Antrtica Martima:
solos, geomorfologia e cobertura vegetal da Pennsula Keller. Tese de Doutorado. Universidade Federal de
Viosa.
Michel, R.F.M. 2005. Solos Criognicos e Ornitognicos da rea de entorno da Ponta Llano, Antrtica
Martima. Tese de Doutorado. Universidade Federal de Viosa.
Myrcha, A.; Tatur, A. 1988. Abandoned breeding places of penguins and their role in functioning of land
ecosystem in maritime Antarctic. Polar Biology, 29.
Myrcha, A.; Tatur, A. 1991. Ecological role of current and abandoned penguin rookeries in the land
environment of the maritime Antarctic. Polish Polar Research, 12:3-24.
Moura, P.Q. 2010. Solos da Poro Norte da Pennsula Byers, Ilha Livingston, Antrtica Martima:
Contribuies ao Monitoramento Ambiental. Dissertao de Mestrado. Universidade Federal do Rio de Janeiro.
Resk, B.C. 2011. Qumica e Mineralogia de Solos Vulcnicos das Ilhas Deception e Penguin, Antrtica
Martima. Dissertao de Mestrado. Universidade Federal de Viosa.
Simas, F.N.B. 2006. Solos da Baa do Almirantado, Antrtica Martima: Mineralogia, Gnese, Classificao e
Biogeoqumica. Tese de Doutorado. Universidade Federal de Viosa.
Simas, F.N.B.; Schaefer, C.E.G.R.; Melo, V.F.; Albuquerque-Filho, M.R.; Michel, R.F.M.; Pereira, V.V. 2007.
Ornithogenic Cryosols from Maritime Antarctica: Phosphatization as a soil forming process. Geoderma,
138:191-203.
Simas, F.N.B.; Schaefer, C.E.G.R.; Melo, V.F.; Albuquerque-Filho, M.R.; Michel, R.F.M.; Pereira, V.V.;
Gomes, M.R.M.; Costa, L.M. 2007. Ornithogenic Cryosols from Maritime Antarctica: Phosphatization as a Soil
Forming Process. Geoderma,
138:191-203.
Soil Survey Staff. 2014. Kellogg Soil Survey Laboratory Methods Manual. Soil Survey Investigations Report
No. 42, Version 5.0. R. Burt and Soil Survey Staff (ed.). U.S. Department of Agriculture, Natural Resources
Conservation Service.
Tatur, A. 1989. Ornithogenic Soils of the Maritime Antarctic. Polish Polar Research, 4:481-532.
Tatur, A.; Myrcha, A. 1989. Soils and vegetation in abandoned penguin rookeries. Proc. NIPR Symp. Polar
Biol., 2:181-189.
Tatur, A.; Myrcha, A. 1993. Ornithogenic soils. In: Rakusa-Suszczewski, S. Ed. The Antarctic Coastal
Ecosystem of Admiralty Bay. Polish Academy of Sciences, Warsaw, 161-165.

261 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

GNESIS Y CLASIFICACIN DE SUELOS DE LA ISLA ROBERT, ANTRTICA


MARTIMA
(Genesis and classification of soils from Robert Island, Maritime Antarctica)

Daher, M. P.1, Schaefer, C. E. G. R.1, Francelino, M. R.1, Thomazini, A.1, Delpupo, C. S.1,
Lima Neto, E.1

1
Departamento de Solos, Universidade Federal de Viosa, Viosa - MG, Brasil. E-mail:
marcio.francelino@ufv.br

Nos ltimos 15 anos o Ncleo Terrantar da Universidade Federal de Viosa (Brasil),


vinculado ao Instituto Nacional de Cincia e Tecnologia da Criosfera, realizou coletas de
amostras de solos em mais de 250 perfis de solos. Os estudos de solos nesta regio se
concentram em reas onde predominam basalto andestico. Na Antrtica Martima, os
substratos vulcnicos ricos em olivina-basalto esto restritos Ilha Robert e pequenas ilhas
adjacentes, as quais esto entre as rochas mais antigas dessa regio, do Cretceo Superior, e
foram nomeadas de Formao Coppermine (Smellie et al., 1984). Considerando essa
particularidade litolgica, este o primeiro trabalho pedolgico realizado na Formao
Coppermine. Desta forma, os objetivos do presente trabalho foram a caracterizao fsica,
qumica e mineralgica dos solos da Ilha Robert, Antrtica Martima, bem como a
classificao de tais solos.
A Ilha Robert (360460 E, 3080694 S) est situada entre a Ilha Nelson, a leste, e a Ilha
Greenwich, a oeste, ao longo do arquiplago das Shetland do Sul. A rea livre de gelo
(Pennsula Coppermine) apresenta dimenses aproximadas de 1,7 km no sentido SE-NO e
0,6 km no sentido NE-SO. A temperatura mdia no vero varia entre -2 e +2 C, com
precipitao mdia anual de 600 mm (IAATO, 2011). A rea formada por terraos marinhos
e rochas gneas vulcnicas, compostas principalmente por basalto escuro, rico em olivina.
Dataes realizadas com K-Ar sugerem idade do Cretceo Superior (83-78 2 Ma) (Smellie
et al., 1984).
As amostras de solo foram coletadas no ms de fevereiro de 2014. Foram descritos e
amostrados oito perfis de solo, seguindo recomendaes de Bockheim et al. (2006). Foram
realizadas coletas desde o terrao marinho, ao nvel do mar, at a cota de 123 metros de
altitude, na parte mais elevada da pennsula. Os solos foram classificados de acordo com a
Soil Taxonomy (Soil Survey Staff, 2010). As amostras foram destorroadas, secas ao ar e
passadas em peneira de 2 mm de abertura de malha para a confeco da terra fina seca ao ar
(TFSA) para as determinaes laboratoriais. Todas as anlises fsicas e qumicas de rotina
foram obtidas usando procedimentos padres de acordo com EMBRAPA (1997) e SSS
(2014). A identificao dos minerais presentes foi realizada na linha de Difrao de Raios X
em Policristais (XPD), no Laboratrio Nacional de Luz Sncrotron (LNLS), em Campinas.
Dos oito perfis coletados, apenas um (Perfil 2) possui permafrost dentro dos 100 cm, sendo
enquadrado como Gelisols pela Soil Taxonomy (SSS, 2010). Os demais perfis no possuem
permafrost dentro da seo de controle, sendo classificados como Entisols e Inceptisols (Soil
Taxonomy). As feies criotrbicas foram encontradas na maioria dos perfis descritos, sendo
evidenciado, principalmente, pela presena de horizontes irregulares ou quebrados, bem
como fragmentos de rochas orientados. Apesar da crioturbao ser comum em toda a
pennsula, no h formao de solos com padres, quando comparado com outras reas da

262 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Antrtica descritas por Bockheim e Tarnocai (1998), Michel et al. (2006), Simas et al. (2008),
Souza et al. (2012) e Michel et al. (2014). Este resultado sugere uma maior influncia do
material de origem para esse comportamento, j que o basalto, rico em olivina, possui
colorao muito escuro, o que influencia diretamente o seu albedo e as taxas de aquecimento
da superfcie. Resultados similares foram observados por Campbell e Claridge (1987), em
solos de Taylor Valley, na regio dos Vales Secos da Antrtica.
O contedo da frao fina variou pouco dentre os perfis. A frao areia correspondeu 70%
em mdia do contedo de partculas <2 mm (Tabela 1), assim como observado para outras
regies da Antrtica Martima (Simas et al., 2008; Michel et al., 2006; Michel et al., 2014).
Todos os perfis descritos apresentaram alta porcentagem de cascalho, sendo superior a 40%
em sua maioria, resultando em um carter esqueltico (IUSS, 2006).
Os teores de fsforo extravel por Mehlich-1 no ultrapassam 700 mg kg-1 nos locais com
influncia atual de animais (Tabela 1). Os valores encontrados neste trabalho so
considerados baixos quando comparados com outras reas sob influncia de pinguins na
Antrtica Martima (Tatur, 1990; Michel et al., 2006; Simas et al., 2008). Desta forma, os
resultados sugerem que a influncia da nidificao, proveniente principalmente de aves como
skuas (Stercorarius antarcticus) e petris (Thalassoica antarctica) apesar de fornecer um
importante incremento de nutrientes para os solos, no provocam alteraes marcantes na
gnese da maioria dos solos da Ilha Robert devido ao baixo aporte de guano. Os teores de
carbono orgnico total (COT) tambm so baixos na maior parte dos solos estudados, no
ultrapassando 1,0 dag kg-1.
A saturao por bases elevada na maioria dos perfis (>50 %), devido principalmente ao
prprio material de origem, com teores de Mg mais elevados que os de Ca. O K ocorre em
menores concentraes, entretanto pode atingir teores de at 300 mg kg-1. Os resultados
indicam teores de Na de at 1700 mg kg-1 nas reas mais prximas ao mar, bem como 1596
mg kg-1 a 76 metros de altitude acima do nvel do mar, no topo do felsenmeer. Esses
resultados ocorrem devido aos elevados teores de Na e K proveniente dos sprays salinos,
associados s feies geomrficas e aos ventos predominantes.
Os atributos qumicos destes solos evidenciam a ocorrncia de alguns solos cidos (pH 5,0-
5,9) num contexto geral de solos de carter alcalino (pH 7,0-7,8). De maneira geral, os solos
que possuem maior influncia ornitognica so os mais cidos, j que o material orgnico
aportado pelas aves est sendo constantemente decomposto e consequentemente gerando
acidez no ambiente. Os horizontes de reao cida apresentam caractersticas de maior
desenvolvimento pedogentico, como menor soma de bases e saturao por bases, e maior
saturao por alumnio e acidez potencial.
Os altos valores de CTC observados nestes solos se devem principalmente mineralogia,
com abundncia de minerais silicatados 2:1 e plagioclsios, alm de minerais de baixa
cristalinidade (como indicado pelos valores de pH em NaF) tpicos de pedossistemas pouco
transformados.
Os resultados apresentados nesse trabalho reportam um levantamento pedolgico detalhado
de solos formados em ambientes periglaciais da Antrtica Martima sob material de origem
at ento no estudado. Os processos de intemperismo fsico e de crioturbao so os
principais responsveis pela gnese dos solos na Ilha Robert. As propriedades fsicas,
qumicas e mineralgicas dos solos mostraram-se bem homogneas entre os perfis, o que est
fortemente relacionado com as caractersticas do material de origem. A variao de algumas
caractersticas dos solos pode ser atribuda principalmente como um produto do relevo e da
forma como este condiciona a relao pedognese versus morfognese, associado ou no

263 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

influncia ornitognica. Embora substratos mais mficos (basalto rico em olivina) sejam mais
suscetveis ao intemperismo do que substratos mais flsicos (basalto andestico) como os
encontrados na ilha Rei George, obsevou-se que os solos da Ilha Robert possuem menor
alterao do material de origem e menor intemperismo qumico se comparado a essas reas.
O que demonstra maior importncia de processos como sulfurizao e fosfatizao para a
evoluo pedogentica dos solos da Antrtica Martima.

Tabela 1. Anlises fsicas e qumicas dos solos da Ilha Robert, Antrtica Martima. Tabla 1. Anlisis fsico y
qumico de los suelos de la Isla Robert, Antrtida Martima.

Ar Ar
Hor Prof. Casc. Silte pH P K Na Ca2+ Mg2+ H+Al SB (t) T V m COT
eia g

______
cm % ____________________ H2 O NaF ______
mg/kg ______ ________________
cmolc/kg ________________ ___
% ___ dag/kg

Perfil 1 - "Ornithogenic" Typic Haplocryepts

A 0-8 7 81 11 8 6,0 9,4 123,3 192,0 872,6 10,4 15,6 9,7 30,3 33,2 40,0 75,7 8,7 0,9

Bw 8-15 44 64 29 7 6,1 10,5 428,1 154,0 389,8 10,0 13,1 9,6 25,3 28,8 34,9 72,5 12,2 0,4

BC 15-40 81 69 24 7 6,1 10,4 460,7 156,0 510,5 11,8 11,2 15,2 25,6 30,6 40,8 62,8 16,3 0,2

C 40-70 62 90 5 5 7,0 9,1 148,5 186,0 792,1 22,9 21,2 5,8 48,0 48,0 53,8 89,2 0,0 0,2

Cr 70-80+ 0,0 78 15 7 7,1 8,5 132,9 318,0 631,2 25,9 23,8 2,8 53,3 53,3 56,1 95,0 0,0 0,2

Perfil 2 - Ornithogenic Aquic Haploturbel

A 0-7 32 72 18 10 6,7 9,2 106,2 170,0 470,3 12,6 19,5 4,6 34,5 34,9 39,1 88,2 1,1 0,5

AB 7-17 7 74 16 10 7,0 9,3 99,3 180,0 550,8 13,7 20,9 3,8 37,5 37,5 41,3 90,8 0,0 0,7

B 17-35 2 57 35 8 7,1 9,7 251,5 192,0 530,7 16,1 21,4 4,6 40,3 40,3 44,9 89,8 0,0 0,7

C/Rf 35-70 35 55 34 11 7,3 8,8 135,7 190,0 631,2 17,4 22,4 1,8 43,0 43,0 44,8 96,0 0,0 0,2

Perfil 3 - "Ornithogenic" Lithic Cryorthents

O 0-5 0,0 68 20 12 5,1 9,5 497,9 174,0 530,7 5,7 6,2 22,6 14,6 19,3 37,2 39,3 24,3 7,0

A1 5-8 4 80 12 8 5,1 9,7 513,1 158,0 470,3 5,2 4,8 20,5 12,4 15,8 32,9 37,7 21,5 7,0

A2 8-14 22 76 16 8 5,1 9,9 629,2 116,0 430,1 5,1 4,2 22,9 11,5 15,2 34,4 33,4 24,4 8,8

AC 14-20 73 75 15 10 5,0 10,3 526,5 122,0 309,4 4,0 2,8 26,4 8,5 13,0 34,9 24,3 34,7 8,8

Cr 20-30 67 66 24 10 5,2 9,6 707,0 158,0 349,6 2,6 0,5 11,4 5,0 7,8 16,4 30,6 35,8 1,7

Perfil 4 - Lithic Cryorthents

A1 0-5 52 73 15 12 7,0 8,6 57,3 172,0 1536,4 13,6 18,5 2,3 39,2 39,2 41,5 94,5 0,0 0,3

A2 5-20 41 65 22 13 7,5 8,6 28,3 132,0 1194,4 16,3 21,5 1,5 43,3 43,3 44,8 96,6 0,0 0,6

15/20-
C/R 56 66 33 1 7,8 8,4 30,9 148,0 1596,7 19,9 24,1 1,5 51,3 51,3 52,8 97,2 0,0 0,6
35/40

Perfil 5 - Aquic Cryorthents

A 0-5 59 52 34 14 7,0 8,6 60,0 318,0 1415,7 17,6 24,0 4,0 48,5 48,6 52,5 92,4 0,2 0,8

264 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

AC 5-25 25 48 38 14 7,2 8,6 85,6 158,0 1516,3 18,5 22,4 3,5 47,9 47,9 51,4 93,2 0,0 0,5

C 25-45+ 37 65 25 10 7,7 8,5 84,3 318,0 1073,8 16 19,0 1,8 40,6 40,7 42,5 95,8 0,0 0,2

Perfil 6 - "Ornithogenic" Lithic Cryorthents

A1 0-5 30 77 13 10 5,1 8,8 492,2 158,0 570,9 9,0 13,9 15,5 25,7 34,6 41,2 62,4 25,7 1,0

A2 5-20 18 75 17 8 5,1 8,9 680,5 152,0 490,4 10,2 15,4 19,0 28,2 40,6 47,2 59,7 30,6 0,7

15/20-
CR 22 70 19 11 5,9 9,0 391,1 158,0 852,5 15,3 23,6 8,7 43,0 48,7 51,7 83,2 11,7 0,2
35/40

Perfil 7 - "Ornithogenic" Aquic Cryorthents

A1 0-10 42 79 9 12 5,9 9,7 158,6 112,0 269,2 6,5 5,4 9,9 13,3 14,4 23,2 57,3 7,7 2,4

A2 10-20 69 82 9 9 6,0 10,5 563,8 188,0 168,6 6,1 4,5 13,7 11,8 12,9 25,5 46,3 8,5 3,1

AC 20- 25 53 79 9 12 5,8 10,7 635,5 166,0 188,7 6,5 5,0 15,5 12,8 14,2 28,3 45,2 9,9 3,3

Perfil 8 - "Ornithogenic" Typic Haplocryepts

A 0-5 40 61 24 15 5,8 8,9 116,0 186,0 349,6 10,8 16,3 13,7 29,1 30,5 42,8 68,0 4,6 2,4

AB 5-15 56 65 19 16 6,3 10,0 157,2 158,0 329,5 12,2 17,9 10,2 31,9 32,8 42,1 75,8 2,7 1,5

Bw 15-25 60 46 39 15 6,8 10,1 331,7 218,0 349,6 21,6 29,0 9,7 52,7 52,8 62,4 84,4 0,2 0,7

BC 25-50 53 43 41 16 7,1 9,4 210,2 172,0 430,1 22,1 28,5 6,3 52,9 53,1 59,2 89,4 0,4 0,3

Cr 50-65 + 47 48 30 22 7,3 7,8 84,3 188,0 430,1 23,3 33,0 3,5 58,7 58,9 62,2 94,4 0,3 0,2

Agradecimentos
Ao CNPq, Ministrio da Cincia, Tec. e Inovao e Marinha do Brasil.

Referencias
Bockheim, J.G.; Balks, M.R.; McLeod, M. 2006. "ANTPAS Guide for Describing, Sampling, Analyzing, and
Classifying Soils of the Antarctic Region, ANTPAS", 1-12.
Bockheim, J.G.; Tarnocai, C. 1998. Recognition of Cryoturbation for Classifying Permafrost-affected Soils.
Geoderma, 81:281-293.
Campbell, I.B.; Claridge, G.G.C. 1987. Antarctica: Soils, Weathering Processes and Environment. Elsevier,
Amsterdam (368 pp.).
EMBRAPA (Centro Nacional de Pesquisa de Solos). 1997. Manual de Mtodos de Anlise de Solo. Centro
Nacional de Pesquisa de Solos, Rio de Janeiro.
IAATO (International Association of Antarctica Tour Operators), 2011. Tourism statistics. Disponvel em:
<http://iaato.org/tourism-statistics on 19 November 2012>. Acesso em: 29 mai. 2017
Michel, R.F.M., Schaefer, C.E.G.R., Dias, L.E., Simas, F.N.B., Benites, V. M. Benites, Mendona, E.S. 2006.
Ornithogenic Gelisols (Cryosols) from maritime Antarctica: Pedogenesis, vegetation, and carbon studies. Soil
Sci. Soc. Am. J., 70:1370-1376.
Michel, R.F.M.; Schaefer, C.E.G.R.; Lpez-Matnez, J.; Simas, F.N.B. ; Haus, N.W.; Serrano, E.; Bockheim,
J.G. 2014. Soils and landforms from Fildes Peninsula and Ardley Island, Maritime Antarctica.
Geomorphology, 225:76-86.
Moura, P.A.; Francelino, M.R.; Schaefer, C.E.R.G.; Simas, F.N.B.; Mendona. B.A.F. 2012. Distribution and
characterization of soils and landform relationships in Byers Peninsula, Livingston Island, Maritime
Antarctica. Geomorphology. 155: 45-54
Myrcha, A.; Tatur, A. 1991. Ecological role of current and abandoned penguin rookeries in the land
environment of the maritime Antarctic. Polish Polar Research, 12:3-24.

265 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

Navas, A.; Lpez-Martnez, J.; Casas, J.; Machn, J.; Durn, J.J.; Serrano, E.; Cuchi, J.A.; Mink. 2008. Soil
characteristics on varying lithological substrates in the South Shetland Islands, Maritime Antarctica. Geoderma,
144:123-139.
Simas, F.N.B.; Schaefer, C.E.G.R.; Melo, V.F.; Albuquerque-Filho, M.R.; Michel, R.F.M.; Pereira, V.V. 2007.
Ornithogenic Cryosols from Maritime Antarctica: Phosphatization as a soil forming process. Geoderma,
138:191-203.
Smellie, J.L.; Pankhurst, R.J.; Thomson, M.R.A.; Davies, R.E.S. 1984. The geology of the South Shetland
Islands: VI. Stratigraphy, geochemistry and evolution. Brit. Antarct. Surv. Sci. Repts., 87:I-85.
Soil Survey Staff. 2010. Keys to Soil Taxonomy. 11 ed. Washington, DC, USDA-Natural Resources
Conservation Service.
Tatur, A., Keck, A. 1990. Phosphates in ornithogenic soils of the maritime Antarctic. Proc. NIPR Symp. Polar
Biol., 3:133-150.
Tatur, A., Myrcha, A. 1984. Ornithogenic soils on King George Island, South Shetlands (Maritime Antarctic
Zone). Pol. Polar Res., 5:31-60.

266 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

CONTRIBUTION OF ENERGETIC PARTICLE PRECIPITATION TO THE


NATURAL VARIABILITY OF ANTARCTIC OZONE (Contribucin de la
precipitacin de partculas energticas a la variabilidad natural del ozono antrtico)

Damiani, A.1,2, Funke, B.3, Lpez-Puertas, M.3, Arsenovic, P.4, Rozanov, E.4,5, Cordero,
R.2
1
Center for Environmental Remote Sensing (CEReS), Chiba University, 1-33 Yayoicho, Inage-ku, Chiba 263-
8522, Japan. E-mail: alecarlo.damiani@gmail.com. 2Departamento de Fsica, Universidad de Santiago de
Chile, Av Libertador Bernardo O'Higgins 3363, Estacin Central, Regin Metropolitana, Chile. E-mail:
alecarlo.damiani@gmail.com; raul.cordero@usach.cl. 3Instituto de Astrofisica de Andalucia, Consejo
Superior de Investigaciones Cientficas (CSIC), Glorieta de la Astronoma, s/n 18008, Granada, Spain. E-
mail: bernd@iaa.es; puertas@iaa.es. 4Institute for Atmospheric and Climate Science, ETH, CHN L 12.1
Universittstrasse 16, 8092 Zrich, Switzerland. E-mail: pavle.arsenovic@env.ethz.ch;
Eugene.Rozanov@pmodwrc.ch. 5Physikalisch-Meteorologisches Observatorium, World Radiation Center,
Dorfstrasse 33, 7260 Davos Dorf, Switzerland. E-mail: Eugene.Rozanov@pmodwrc.ch.

Energetic particle precipitation (EPP) events commonly refer to particles of different energy
and origin which, depending on solar activity, impact and ionize the polar atmosphere (Fig.
1). Their occurrence rate is anti-correlated to their energy, so intense energetic events able to
affect the stratosphere are sporadic. On the other hand, low energy electrons continuously
precipitate into the upper atmosphere but their effects can propagate downwards. In the polar
regions EPP is supposed to be one of the main drivers of the natural variability of the upper
atmospheric ozone because it enhances the abundance of odd nitrogen (NOx) and odd
hydrogen (HOx) species which efficiently destroy ozone (Fig. 1). Besides the direct
(instantaneous and local) impact that EPP can produce on a designated atmospheric, a further
indirect EPP long lasting effect can also take place under nighttime conditions. Indeed, since
EPP-induced NOx is chemically long lived in the absence of solar radiation, during winter it
can be transported downward inside the polar vortex by the residual circulation from the
upper atmosphere where it is mainly produced and thus influence stratospheric O3 (lower
yellow box in Fig. 1).
Due to the boost in number and quality of the satellite instruments during the last decade,
EPP-induced effects on the atmospheric chemistry have been frequently measured and have
become one of the main scientific topics of the international working group SOLARIS-
HEPPA (http://solarisheppa.geomar.de/) of the SPARC/World Climate Research
Programme. Nevertheless, an accurate assessment of its impact on long time scales is still
lacking. To fill this gap, we investigated the ozone variability in response to EPP forcing by
exploiting satellite observations from Solar Backscatter Ultraviolet Radiometer (SBUV) and
Microwave Limb Sounder (MLS) as well as an EPP-induced NOx parameterization based on
MIPAS/Envisat. The significant stratospheric and mesospheric ozone depletion found
suggests the need of taking the EPP forcing into account in climate models. This has been
confirmed by simulations performed with the coupled chemistry-climate model SOCOL3-
MPIOM.

267 | P g i n a
V i s i o n e s s o b r e C i e n c i a A n t r t i c a | IX Congreso Latinoamericano de Ciencia Antrtica

O3

EPP-HOx

EPP-NOx

0 2 4 6 8 10
O3 (ppmv)

Figure 1. Ionization rate induced by different types of the energetic particles precipitation (EPP) in the middle
atmosphere. The black line represents the ozone profile; yellow areas show the atmospheric layers dominated
by EPP-HOx and EPP-NOx.
Figura 1. Tasa de ionizacin inducida por diferentes tipos de precipitacin de partculas energticas (EPP) en
la atmsfera media. La lnea negra representa el perfil de ozono; las reas amarillas muestran las capas
atmosfricas dominadas por EPP-HOx y EPP-NOx.

Materials and Methods


Ozone profiles from MLS and SBUV datasets have been used to assess the impact of EPP
on the stratospheric ozone in the southern polar regions. As in some recent studies, we applied
a Multiple linear regression (MLR) analysis to the monthly zonal means of ozone but, in
addition to the usual predictors, we included also a geomagnetic/EPP term (i.e., the Ap
geomagnetic index, see Fig. 2) to the regression (Damiani e