Está en la página 1de 2

BIOQUÍMICA Y BIOFÍSICA

Curso 2017-2018
Problemas Tema 9

1- Define los siguientes términos:
a- Nucleósido
b- Oligonucleótido
c- Histonas
d- Pares de bases complementarias

2- En dos muestras de DNA aisladas de dos especies de bacterias no identificadas, los
porcentajes de T sobre el total de bases es de 32 y 17% respectivamente. ¿Cuáles son
las proporciones de T, A, G y C que se esperaría encontrar en las dos muestras de DNA y
en qué te basas? Una de estas bacterias se aisló de un manantial termal (65ºC), ¿cuál es
el DNA de esta bacteria termofílica? ¿En qué basas tu elección?

3- ¿Cuáles son las diferencias entre el RNA y el DNA? Ten en cuenta las estructuras
primaria, secundaria y terciaria para responder.

4- Dada la siguiente secuencia correspondiente a una hebra de un oligonucleótido de
doble hebra:

5’-ACCGTAAGGTTAG-3’

a) Escribe la secuencia de la hebra de DNA complementaria.
b) Escribe la secuencia de RNA complementario de la hebra mostrada.

5- Al contrario de la doble hélice de DNA, el RNA se encuentra como una cadena sencilla.
¿Qué efectos tiene esto sobre la estructura del RNA?

6- ¿Cuál de las siguientes características son propias del proceso de transcripción del
DNA?
a- Es conservador
b- Es semiconservador
c- Se forman enlaces fosfodiéster
d- Es catalizado por polimerasas
e- El producto final es RNA
f- Los polímeros de nueva síntesis son complementarios al molde
g- El producto final es un polipéptido

7- ¿Cuál de las siguientes características son propias del proceso de transcripción del
DNA?
a- Es conservador
b- Es semiconservador
c- Se forman enlaces fosfodiéster
d- El producto final es RNA
e- El producto final es DNA

Incorporación de FAD y otros grupos prostéticos a las proteínas c.Los polímeros de nueva síntesis son complementarios al molde g.Supón que el nucleótido 4 (C) se elimina del mRNA.Supón que una molécula de mRNA tiene la siguiente secuencia: 5’ AUGCUCACUUCAGGGAGAAGC 3’ a. f.Diferencia entre los lugares A y P del complejo ribosoma-RNA. ¿Qué secuencia polipeptídica se traduciría de este mRNA modificado? .El producto final es un polipéptido 8.¿Cuáles de los siguientes procesos tienen lugar durante la modificación postraduccional? a.Modificación de residuos de aminoácidos b.Ruptura proteolítica 9 .¿Qué secuencia polipeptídica se traduciría de este mRNA? b. 10.Formación de puentes disulfuro d.