Está en la página 1de 3

>KF302066.

1 Catharanthus roseus iridoid oxidase (CYP76A26) mRNA, complete cds


ATGGCGACCATCACTTTCGATTCACTAAACCCGGTGACCGTCGCCATCTCAGCCGGTTTTCTTCTCCTCC
TTATCATCTTTGTGAAATCAAGAACTGGTTCATCCAAAAGAAAACCGCCGGGTCCTCCAGGATGGCCGAT
TTTCGGCAATATGTTCGACCTCGGAGATTTACCTCACCAAACGCTGTACAAGCTCAAGTCCAAATACGGG
CCGATCGTATGGCTCCAGCTCGGCTCAATTAATACTATGGTTGTTCAAAATGCAGTTTCCGCCGCCGAGC
TTTTTAAGAAACACGATGTCCCCTTTTGTGACCGAAAAGTCCCTGATACTCTCACTGCCTTCAATTTCAA
CCAGGGCTCCCTGGGTATGAATACTTACGGCGGACATTGGCGAGTGCTTAGACGCCTCTGTTCCATGGAG
TTTTTGGTAAATAAACGTATGAACGAAACTACAGATCTAAGAAGGAGAATTGAGGACAATATGGTCCGTT
GGATTGAAGAAGATTCATTGGCATCTAAAGCACAAGGAGGAACCGGAGCGGTTCAATTGAGCAGGTTTCT
TTTTCTAATGGCGTTTAATTTGGTGGGTAACCTTATGTTATCGAGAGATTTAATGGATAATAAGGATCCA
GAAGGAAGGGAATTTTTTGATTGTATGAATGAGATATTGGAATTGGCTGGTACTCCTAATATTGCTGATT
TTTTGCCTTTGTTGAAGAAATTGGATCCACTTGGAATGAAGAAAAGGATGGTTGATAATATGTCTAGAAC
TATGAAAATTTCTTCAAAGTTTGTTCAAGAAAGACTTGATAATAGAAAAGCTGGAAAGATTAATGAAAAG
AAAGATTTCTTGGATGTTATGCTTGAATACCAAGGTGATGGTAAAGATGGTCCCGATAAATTCACTGAGC
AACATGTCAACATTGTCATCATGGAAATGTTTTTTGCAGGATCAGAGACAACAAGTATCAGCATTGAATG
GGGATTCACAGAACTTCTCCGAAACCCACACGCATTCAAGAAAGTAAGGGAAGAGATCGACAGAGTAGTG
GGAGTAAACAGAATGGTCGAAGAGACCGACATGGAGAATTTGCCGTATTTGCAAGCAGTTGTAAAGGAGA
CGCTTAGATTGCATCCGGCACTTCCAATGCTTCTACCAAGAAACACAATGGAAGACACTGAATACATGGG
ATACCTCATTCCTAAAGGCACACAAGTTTTCGTGAATGCATGGGCAATCGGAAGGGATCCTGAGTACTGG
CAGGACCCTTTGAGTTTCAAACCAGAAAGGTTTATCAATTCCAGTGTTGAATATAAAGGACAACATTTTG
AATTGATTCCTTTTGGTTCTGGAAGAAGAATTTGTGTGGGATTTCCTTTGGCTCATAGAGTTGTTCATCT
CACTTTGGCTACATTAGTCCAGGCTTTTGATTGGGATCTTGGTGCTGGCGTTAAACCACAAGATATTGAT
TTGGAAGAGAGATTGGGATTGACTCTGAGGAAGAAGAATCCATTGAATGTCATCCCTAAGAAGAGAGTTC
ATATCTAA
>KF591590.1 Rauvolfia serpentina CYP76A26-like protein mRNA, complete cds
ATGGAGGGGACTTTTGATTCAGTAAACCCTGTGACCGTCGCCGTCTCCGTTGGTTTTCTCCTTCTGCTAG
TGATCTTTGTGAAGGCAAGGAGGCGTTCTTCCAAACGGACACCGCCAGGGCCTCCGGGATGGCCAATTTT
CGGCAACATGTTCGACCTCGGAGACCTCCCTCACCAGACCCTGTACAAGCTCAGAAGCAAGTACGGACCT
ATCGTCTGGCTTCAACTGGGCTCCATCAACACCATGGTCGTGCAGAATGCTGTTTCCGCAGCTGAGCTTT
TCAAGAAGCACGATGTTCCTTTTTGTGACCGCAAGGTGCCCGATACGCTCACGGCCTTTAATTTCAACCA
GGGTTCACTTGGTATGAACACCTACGGCGGACACTGGCGTGTGCTTAGACGCCTCTGCTCCATGGAGTTC
TTGGTTAACAAAAGGATGAACGAGACTACTGACCTCAGGAGGAGGATTGAGGACAACATGGTGCGCTGGA
TTGAGGAGGATTCTTTGGCATCAAAAGCACAAGGAGGAACGGGGGCTGTGCAGCTTAGTCGTTTCCTTTT
CCTCATGGCATTTAATCTGGTGGGCAACCTTATGTTGTCGAGAGATTTGTTGGATAACAAGGACCCTGAG
GGGAGGGAATTCTTTGACTGCATGAATGAGATCCTGGAATTGGCTGGAACCCCTAATATAGCAGACTTCC
TACCGTTCTTGAAGAAGCTGGACCCGCTGGGAATGAAGAAGAGGATGATAGACAACATGTCTAGAACCAT
GAAAATTTCTTCCAAGTTCGTGCAGGAAAGGCTCGACAACAGGAAATCCGGCAAGTTCAGCGAGAAGAAA
GACTTCTTGGATGTCATGCTCGAGTACCAGGGCGACGGCAAAGATGGACCAGATAAATTCACAGAGAAGC
ATGTCAACATTGTTATCATGGAAATGTTTTTTGCCGGTTCAGAGACAACAAGTATCAGCATTGAATGGGG
TTTCACGGAGCTGCTGCGCAACCCACGAGCATTCAAGAAGGTGAGGGAAGAGCTAGACAGAGTCGTGGGA
GTAAACAGGATGGTCGAAGAGACCGACATGGAGAACTTGCCATATTTGCAGGCTGTTGTGAAGGAAACAC
TGCGATTACATCCTGCACTGCCAATGCTCCTACCAAGAAACACAATGGAAGACACCGAGTACATGGGCTA
CCTCGTACCCAAAGGCACGCAAGTGTTCGTGAATGCTTGGGCAATTGGAAGGGATTCAGAATACTGGGAT
GACCCCTTGACCTTCAAGCCCGAGAGGTTCCTCAACTCCAGCGTTGAATACAAGGGACAGCACTTTGAGT
TGATACCGTTTGGATCTGGAAGAAGAATCTGTGTGGGATTTCCTTTGGCTCACAGAGTGGTGCACCTCAC
TTTGGCCACTCTAGTCCAGGCCTTCGACTGGGATCTTGGTGCTGGTGTCAAACCAGAAGACATTGATCTG
GAAGAACGACTGGGATTAACACTGAGGAAGAAGAATCCACTGAAAGTGATCCCCAAGAAGAGAGTCCATG
TCTAA
>KF591589.1 Amsonia hubrichtii CYP76A26-like protein mRNA, complete cds
ATGGAGTGGACTTTTGATTCAGTAAACCCTGTGACAATCGCTGTCTCAGCTGGTTTTCTTCTTCTGCTAG
TGATCTTTGTGAAGGGAAGGAGTGGTTCTTCTAAAAGCAAACCGCCAGGGCCTCCGGGATGGCCAATCTT
TGGCAACATGTTCGACCTTGGCGACCTGCCTCACCAGACCTTGTACAAGTTCAGAAGTAAGTATGGACCT
GTCGTGTGGCTTAGATTAGGCTCGATTAACACTATGGTCGTGCAGAATGCTGTTTCTGCAGCTGAGCTTT
TCAAGAAACATGATGTTCCATTTTCTGACCGCAAGGTGCCTGATACACTCACGGCCTTCCAGTTCAACCA
GGGTTCACTTGGTATGAACACCTATGGAGGACATTGGCGTGTGCTTAGACGGCTCTGCTCCATGGAGTTC
TTGGTTAACAAACGGATGAATGAGACTACTGACCTCAGGAGGAGGATTGAAGACAACATGGTCCGCTGGA
TTGAGGAGGATTCTTTGGCATCAAAAGCTCAAGGAGGAACAGGAGCGGTCCAGCTCAGCCGTTTCCTTTT
TCTCATGGCATTCAATCTTGTTGGCAACCTTATGTTGTCAAGAGATTTGTTGGATAACAAGGACCCTGAA
GGGCGGGAATTCTTTGACTGCATGAATGAGATCCTGGAGTTGGCTGGAACACCAAATATAGCAGACTTCC
TACCATTGTTGAAGAAGCTGGATCCTCTGGGAATGAAAAAGAGGATGATAGATAACATGTCTAGAACCAT
GAAAATTTCTTCCAAGTTCGTGCAGGAAAGGCTCGACAACAGGAAAACCGGCAAGATCAATGAAAAGAAA
GACTTTTTGGATGTTATGCTCGAGTACCAGGGTGATGGCAAAGATGGGCCTGACAAATTCACAGAGCATC
ATGTCAACATTGTTATCATGGAAATGTTCTTTGCTGGTTCAGAGACAACAAGTATCAGCATTGAATGGGG
TTTCACAGAGCTGCTGCGCAATCCTCGTGCATTCAAAAAGGTGAGGGAAGAGATTGACAGGGTTGTGGGA
GTAAAGAGGATGGTTGAAGAAAGCGACATGGAGAACTTGCCATATTTGCAGGCTGTTGTGAAGGAAACTT
TAAGATTGCATCCTGCACTTCCCATGCTCCTGCCGAGAAATACCATGGAAGACACCGACTACTTGGGCTA
CCTCATTCCCAAAGGCACACAAGTGTTCGTGAATGCTTGGGCAATTGGAAGGGATGCCGATTACTGGGAG
GACCCATTGACCTTCAAGCCTGAGAGATTCCTCAACTCCAGTGTTGAGTACAAGGGACAGCACTTTGAGT
TGATCCCATTTGGATCTGGAAGAAGAATCTGTGTAGGATTTCCTCTGGCTCACAGAGTTGTTCACCTCAC
TTTGGCCACTCTAGTACAGGCCTTCGACTGGGATCTTGGAGCTGGTGTCAAACCAGAAGACATTGATCTG
GAAGAGAGACTGGGATTAACACTGAGGAAGAAGAATCCACTGAAAGTGATTCCCAAGAAGAGAATCCATG
TCTAA
>KP218047.1 Gentiana rigescens CYP1 mRNA, complete cds
ATGGCATTATTAGCCTTGAACACACTCCTCAATTCTCCAATCGCCATTGCTGTATCAGCAGGCCTTCTTC
TCCTCCTAATAATCTTAGTCAAATCAAAATCTGGAGCTTCAAAAAGGAGACCACCAGGTCCTCCAGGATG
GCCGGTTTTCGGCAACATGTTCGATCTTGGTGACCTTCCACACCAGACTTCTTACAAGCTCAGAACAAAA
TACGGCCCACTCATTTGGCTCCAGCTCGGTTCAATCAACACCATGATTGTCCAGAATGCAGCTTGTGCAG
CTGAGCTTTTCAAGAAACATGATGTCCCTTTTTGTGATCGTAAGGTTCCTGATACGCTTACCGCGTTTCA
GTTCAATCAAGGTTCATTAGGGATGAACACTTATGGAGGACATTGGCGCGTGTTGAGACGGTTGTGTTCG
ATGGAGTTTTTGGTGAACAAAAGGATGAATGAAACAACTGAACTCAGGAGGAGGATTGAGGACAATATGG
TCCGTTGGATCGAGGAAGATTCATTGGCATCAAAAGCACAGGGAGGAACAGGGGCGGTTCAATTGAGCCG
GTTCTTGTTTTTAATGGCGTTCAATTTGGTTGGGAATCTTATGTTGTCAAGGGACTTATTGGATAATAAG
GATGCTGAAGGCAGGGAGTTTTTCGACTCTATGAATGAGATTCTTGAATTGGCGGGAACACCGAATATCG
CGGATTTCTTGCCGTTCCTGAAGAGATTCGACCCGCTTGGGATGAAGAAGAGGATGGTGGAGAACATGAC
AAAGACAATGAAGATATCTTCTAGTTTTGTGCAGGAAAGGCTTGATAAGAGGAAAGCTGGTAAATTTGAT
GAGAAGAGAGATTTCTTGGATGTTATGTTGGAGTATAAAGGTGATGGTAAAGATGGACCTGACAGTTTCA
CTGAGCATCAAGTTAACATTGTTATCATGGAAATGTTTTTCGCAGGGTCAGAGACAACAAGTATCAGCAT
AGAATGGGGATTCGCGGAGCTGCTACGCAACCCTCATGCATTCAACAAAGTCAGAGAAGAGATTGATAGA
GTTGTAGGGTTAAGCAGAATGGTTGAAGAAAGTGACATGGAAAAGCTTCCCTATTTGCAGGCAGTTGTGA
AAGAAACGTTGCGTTTGCACCCTGCTCTTCCATTACTCTTACCAAGAAACACAATGGAAGACACAGAGTA
CATGGGATACCTAATCCCGAAAAGCACACAAGTTTTCATCAATGCTTGGGCAATCGGAAGGGATCCGGAT
GCATGGAAAGACCCTTTGGATTTCAAGCCGGAGAGGTTTATCGACTCGAACGTTGAATACAAAGGGCAGC
ATTTTGAGTTGATCCCGTTCGGTTCTGGCAGAAGGATTTGTGTCGGTTTTCCGTTGGCTCACCGTGTGGT
TCATCTCACTATTGCTACTCTGGTTCAGGCTTTTGATTGGGATCTTGGTGCTGGTGTCAAACCAGAAGAT
ATTGATATGGAGGAAAGGCTTGGTTTGACTTTGAGAAAGAAGAATCCTCTTAAAGTCATACCTACTAAGA
AGAGGATCAATATCTAA