Está en la página 1de 304

See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/236173090

Estudios sobre la Malacologa y Conquiliologa


en Mxico

Book January 2007

CITATIONS READS

2 7,422

3 authors:

Eduardo Rios-Jara Mara del Carmen Esqueda-Gonzlez


University of Guadalajara University of Guadalajara
78 PUBLICATIONS 402 CITATIONS 9 PUBLICATIONS 41 CITATIONS

SEE PROFILE SEE PROFILE

Cristian Moiss Galvn-Villa


University of Guadalajara
34 PUBLICATIONS 146 CITATIONS

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Inventario de la biota marina (cnidarios, poliquetos, moluscos, crustceos, equinodermos y peces)


del Santuario Islas e Islotes de Baha Chamela, Jalisco, Mxico View project

ESTUDIO DEL FENMENO DE IMPOSEX EN ESPECIES MARINAS Y SU RELACIN CON LA VARIABILIDAD


AMBIENTAL EN ZONAS ASOCIADAS A FORZAMIENTO AMBIENTAL: PUERTO DE MANZANILLO, COLIMA,
CASO DE ESTUDIO. View project

All content following this page was uploaded by Cristian Moiss Galvn-Villa on 18 September 2017.

The user has requested enhancement of the downloaded file.


Estudios sobre
Malacologa
y Conquiliologa
en Mxico
Estudios sobre Malacologa y
Conquiliologa en Mxico

Editores

Eduardo Ros Jara


Mara del Carmen Esqueda Gonzlez
Cristian Moiss Galvn Villa

Universidad SMMAC
de Guadalajara

2007
Primera edicin, 2007
DR Universidad de Guadalajara
Centro Universitario de Ciencias Biolgicas y Agropecuarias.
Divisin de Ciencias Biolgicas y Ambientales
Departamento de Ecologa
Laboratorio de Ecosistemas Marinos y Acuicultura
Km. 15.5 Carretera a Nogales
Las Agujas Nextipac C. P. 45110
Zapopan, Jalisco
Mxico
Tel. (52) (33) 3777-1150

ISBN 978 970 27 1197 1

Queda prohibida la reproduccin total o parcial de este documento con fines de lucro,
por cualquier medio: impreso o electrnico. La persona fsica o moral que sin
autorizacin por escrito de los editores fotocopie, grabe, almacene en algn sistema o
transmita a medios electrnicos, magnticos o mecnicos dicha informacin, quedar
sujeta a las sanciones legales aplicables.
Todos los trabajos que aparecen en esta obra fueron presentados como ponencias orales libres o
en cartel durante la X Reunin Nacional de Malacologa y Conquiliologa que se llev a cabo
en la ciudad de Guadalajara, Jalisco, Mxico, los das 18 al 22 de marzo de 2007.

La Reunin fue organizada por la Universidad de Guadalajara y la Sociedad Mexicana de


Malacologa, A.C. y la impresin de esta obra fue financiada por ambas.

Para obtener copias adicionales de esta obra, dirigirse a:

Laboratorio de Ecosistemas Marinos y Acuicultura,


Departamento de Ecologa,
Centro Universitario de Ciencias Biolgicas y Agropecuarias.
Universidad de Guadalajara.
Km. 15.5 Carretera a Nogales
Las Agujas Nextipac C. P. 45110
Zapopan, Jalisco
Mxico
Tel. (52) (33) 3777-1150 ext. 3164

Diseo de portada:
Cristian Moiss Galvn Villa

Reproduccin:
TRICICLO, diseo editorial
Penitenciaria 316, Centro
Guadalajara, Jalisco, Mxico
Tel. 3825-4866
COMIT ORGANIZADOR DE LA X RENAMAC

- PRESIDENTE-
Dr. Eduardo Ros Jara

-SECRETARIO-
M. en C. Martn Prez Pea

-TESORERO-
M. en C. V. Tefilo Muoz Fernndez

-COORDINADOR DE CURSOS-
M en C Ildefonso Enciso Padilla

-COORDINADOR DE PONENCIAS MAGISTRALES Y EXPOSICIN DE COLECCIONES


MALACOLGICAS-
M en C Eduardo Jurez Carrillo

-COORDINADOR DE PONENCIAS EN CARTEL-


Bil. Cristian M. Galvn Villa

-COORDINADOR EDITORIAL Y CONCURSO DE TESIS-


Dr. Ernesto Lpez Uriarte

-COORDINADOR DE RELACIONES INTERNACIONALES-


Dr. Edgar Heimer De la Cotera

-COORDINACIN DE RELACIONES PBLICAS Y EVENTOS-


M. en C. E. Guadalupe Robles Jarero

-COORDINACIN DE ESTUDIANTES-
Biol. Andrea Zamora

-COORDINADORES REGIONALES-
Noroeste
Dr Esteban Flix Pico
Noreste
Dr Alfonso Correa Sandoval
Occidente
M en C Victor Landa Jaime
Centro
Dra. Blanca E. Buitrn Snchez
Sureste
Biol. Emilia Gonzlez Vallejo
Sur
Dr. Pedro Flores Rodrguez
COMIT EDITORIAL

Dr. Ernesto Lpez Uriarte


Dr. Eduardo Ros Jara
M. en C. Mara del Carmen Esqueda Gonzlez
Bil. Cristian Moises Galvn Villa
COMIT CIENTFICO*

Dr. Eduardo Ros Jara


Departamento de Ecologa, CUCBA, Universidad de Guadalajara

Dr. J. Emilio Michel Morfn


Departamento de Estudios de la Costa, CUCSur, Universidad de Guadalajara

Dr. Ernesto Lpez Uriarte


Departamento de Ecologa, CUCBA, Universidad de Guadalajara

Dr. Esteban Felix Pico


Centro Interdisciplinario de Ciencias del Mar, IPN

Dr. Luis Gmez Gastelum


Departamento de Estudios Mesoamericanos, CUCSH, Universidad de Guadalajara

Dra. Edna Naranjo Garca


Departamento de Zoologa, Instituto de Biologa, UNAM

Dra. Blanca E. Buitrn Snchez


Departamento de Paleontologa, Instituto de Geologia, UNAM

Dr. Luis Jos Rangel Ruz


Divisin Acadmica de Ciencias Biolgicas. Universidad Jurez Autnoma de Tabasco.

Dra. Martha Reguero Reza


Instituto de Ciencias del Mar y Limnologa. Universidad Nacional Autnoma de Mxico.

Dr. Andrs Martn Gngora Gmez


Centro Interdisciplinario de Investigacin para el Desarrollo Integral Regional, IPN

Todos los trabajos que aparecen en esta obra fueron revisados y dictaminados
por uno o dos miembros del Comit Cientfico.
Adems, el Comit Editorial reviso y uniformiz el formato.
INSTITUCIONES PARTICIPANTES EN LA X RENAMAC
Instituciones Nacionales participantes:
Benemrita Universidad Autnoma de Puebla (BUAP)
Centro de Investigacin Biolgica del Noreste (CIBNOR)
Centro de Investigacin Cientfica y de Educacin Superior de Ensenada (CICESE)
Centro de Investigacin en Alimentacin y Desarrollo, A. C.
Centro Interdisciplinario de Ciencias Marinas (CICIMAR)
Centro Interdisciplinario de Investigacin para el Desarrollo Integral Regional (CIIDIR)
Centro Regional de Investigacin Pesquera (CRIP)
El Colegio de la Frontera Sur
Federacin de Cooperativas del Centro y Poniente del Estado de Yucatn
Instituto de Industrias
Instituto Nacional de Antropologa e Historia (INAH)
Instituto Politcnico Nacional (IPN)
Instituto Tecnolgico de Boca del Ro
Instituto Tecnolgico de Ciudad Victoria
Instituto Tecnolgico de Lerma en Campeche
Instituto Tecnolgico de Los Mochis
Instituto Tecnolgico de Mazatln
Instituto Tecnolgico de Mrida
Laboratorio AquaPacific
PRONATURA, Noroeste Direccin de Conservacin en Baja California
Secretara de Marina (Armada de Mxico)
Universidad Autnoma de Baja California (UABC)
Universidad Autnoma de Baja California sur
Universidad Autnoma de Guadalajara (UAG)
Universidad Autnoma de Guerrero (UAG)
Universidad Autnoma de Nuevo Len
Universidad Autnoma de San Lus Potos
Universidad Autnoma de Sinaloa (UAS)
Universidad Autnoma del Carmen
Universidad Autnoma del Estado de Hidalgo (UAEH)
Universidad de Guadalajara (UdeG)
Universidad de Occidente
Universidad de Sonora
Universidad del Mar
Universidad Jurez Autnoma de Tabasco (UJAT)
Universidad Michoacana de San Nicols de Hidalgo (UMSNH)
Universidad Nacional Autnoma de Mxico (UNAM)
Universidad Veracruzana

Instituciones Internacionales participantes:


Angelo State University (EUA)
Arizona State University (EUA)
Centro de Modelao Ecolgica IMAR FCT/UNL (Portugal)
Consejo Nacional para la Cultura y el Arte (El Salvador)
Instituto de Oceanologa (Cuba)
Kilgore Collage (EUA)
Museo de Historia Natural de El Salvador (El Salvador)
Natural History Museum (Alemania)
Natural History Museum of Los Angeles County (EUA)
Universidad de Bretaa Occidental (Francia)
Universidad de Oviedo (Espaa)
Universidad Estatal a Distancia Sabanilla (Costa Rica)
Universidade Lusfona de Humanidades e Tecnologia (Portugal)
CONTENIDO
Pgina

Presentacin... i

I. ARQUEOLOGA

Los ornamentos de concha encontrados en el entierro central del templo de Quetzalcoatl de


Teotihuacan, Mxico
Paz-Bautista, C. y B. Ziga-Arellano.... 3
Los materiales malacolgicos de Xochicalco, Morelos
Melgar-Tsoc, E. R. 6
Conchas y caracoles en el antiguo Occidente de Mxico. Un ensayo de Antropologa Simblica
Gmez-Gastlum, L... 8
Uso de trompetas de caracol marino en el Occidente de Mxico: Pasado y presente
Gmez-Gastlum, L. y M. G. Rivera-Acosta................................................................................................... 11
Moluscos arqueolgicos de Punta Mita, Nayarit, Mxico: Taxonoma y cambios ecolgicos
Lpez-Garrido, P. H............................................................................................................................................ 14
Los moluscos arqueolgicos de Teopantecuanitln, Guerrero
Sols-Ciriaco, R. B.. 17

II. BIODIVERSIDAD

Gastrpodos terrestres de El Salvador


Rivera A. M. 21
La fauna Gastropoda del sistema lagunar Carmen-Pajonal-Machona, Cardenas Tabasco, Mxico
Granados-Berber, A. A., J. L., Ramos-Palma y E. P., Jurez.... 23
Estudio comparativo de tres comunidades malacolgicas en las costas del estado de Oaxaca
Caicedo-Rivas, R. E., R. Len-Pinto, V., Ortega-Chvez, J. S., Hernndez-Zepeda y S. J. Serrano-
Guzmn........ 26
Moluscos dulceacucolas introducidos en Mxico
Naranjo-Garca, E. y M. T., Olivera-Carrasco... 29
Paralarvas de calamares de la costa Occidental de la Pennsula de Baja California, Mxico
Granados-Amores, J., R. de Silva-Dvila, M. E., Hernndez-Rivas y R., Durazo..... 32
Revisin bibliogrfica de moluscos opistobranquios del Golfo de Mxico
Ortigosa-Gutirrez, J. D., G., Calado y N., Simes....... 35
Moluscos de la Isla San Ignacio de la Baha de Navachiste, Sinaloa, Mxico
lvarez-Romo, J. C., M. A., Ortiz-Arellano, L. M., Flores-Campaa y F., Arbola-Gonzlez... 38
Moluscos Margineliformes de Mxico
Magaa-Cubillo, J., J., Espinosa, J., Ortea y J. A., Martnez.... 41
Los quitones de las Islas de la costa de Sinaloa, Mxico
Flores-Campaa, L. M., M. A., Ortiz-Arellano, J. F., Arzola-Gonzlez, F. J., Gonzlez-Medina, E.,
Cortez-Acosta, y D., Rodrguez-Garca...... 43
Catlogo ilustrado de moluscos bivalvos del Golfo de Mxico y mar Caribe: obra pstuma (II) del Dr.
Antonio Garca-Cubas
Reguero, M.. 46
Una revisin preliminar de caracoles terrestres de la sierra Mojada al Occidente de Coahuila
Strenth, N. E., A., Correa-Sandoval y L., McCutchen.... 48
Biocenosis y distribucin de los moluscos de aguas profundas en el Pacfico Mexicano: Una evaluacin
de los avances
Zamorano, P. y M., Hendrickx.. 49
Moluscos en la fauna de acompaamiento del camarn de la costa de Chiapas y Sur de Oaxaca,
Mxico
Ros-Jara, E., C. M., Navarro-Caravantes y S., Sarmiento-Nfate... 51
Moluscos asociados al coral ramoso del gnero Pocillopora Lamarck, 1818, en Playa Mora, Jalisco,
Mxico
Lopez-Uriarte, E. y C. V. Velarde-Nuo..... 54
Pgina
Datos preliminares de la diversidad de moluscos para el consumo humano que se expenden en
Acapulco, Guerrero
Villegas-Maldonado, S., E., Neri-Garca, R., Flores-Garza, S., Garca-Ibez, P., Flores-
Rodrguez, y D. G., Arana-Salvador.... 57
Estudio prospectivo de los moluscos gastrpodos de cinco localidades intermareales del Parque
Nacional Isla Isabel, Mxico
Perez-Pea, M., E., Lopez-Uriarte, E. G., Robles-Jarero, C. M., Galvn-Villa, I., Enciso-Padilla,
V. T. Muoz-Fernndez y E., Ros-Jara... 60
Gua ilustrada para la identificacin de moluscos intermareales y de arrecife en la Baha de Tenacatita,
Jalisco
Landa-Jaime, V., M., De La Cruz-Urzua, E., Michel-Morfin, J., Arciniega-Flores, R., Flores-
Vargas y C., Amescua. 63

III. BIOLOGA Y BIOGEOGRAFA

Moluscos en una rea de crianza de las langostas Panulirus inflatus y P. gracilis (Decapoda:
Palinuridae) en la Baha de Mazatln, Sinaloa
Camacho-Montoya, C., M. C., Valdez-Pineda, R., Prez-Gonzlez y R. E., Rodrguez-Negrete. 67
Identificacin de postlarvas de Mytilus galloprovincialis y Mytilus californianus, utilizando medidas
morfomtricas
Curiel-Ramrez Gtz., S. y J., Cceres-Martnez. 70
Biogeografa alimenticia de los Opistobranquios del Pacfico Noreste
Bertsch, H. y A., Hermosillo.. 73
Resultados preliminares de la distribucin de moluscos Holoplanctonicos (Mollusca:Gastropoda) en el
Golfo de California, durante diciembre 2005
Angulo-Campillo, O. y G., Aceves-Medina. 76
Los moluscos en la dieta de juveniles de las langostas Panulirus inflatus y P. gracilis (Decapoda:
Palinuridae)
Prez-Gonzlez, R., C., Camacho-Montoya y M. C., Valdez-Pineda.... 79
Malacofauna continental del estado de Puebla
Ortega-Chvez, V., J. S., Hernndez-Zepeda y R. E., Caicedo-Rivas... 82

IV. CARACOL MORADO

Estudio sobre la produccin de tinta secretada por el caracol Plicopurpura pansa (Gould, 1853), en
Barra de Potos, Guerrero. Mxico
Montao-Rivera, A., R., Flores-Garza, P., Flores-Rodrguez, S., Garca-Ibez, C. G., Barroso
Caldern.. 87
Descripcin histolgica de la gnada femenina del caracol de tinte Plicopurpura patula (Linn, 1758),
de la laguna de Tamiahua, Veracruz
Muoz-Mancilla, E., M. P., Torres-Garca y D., Velsquez-Guerrero....... 90
Estimacin de la abundancia poblacional del caracol del tinte Plicopurpura pansa a travs de un
mtodo de captura y recaptura
Hernndez-Lambarena, M., M., E., Michel-Morfn, V., Landa-Jaime, J., Arciniega, D., Kosonoy y
R., Flores...... 92
Estudio filogentico del gnero Plicopurpura (Cossman, 1908), Muricidae
Lpez-Chvez, F. J., K., Oyama, P., Ros-Chvez y J. E., Michel-Morfn... 95
Fluctuaciones en la diversidad de comunidades de moluscos asociadas al caracol Plicopurpura pansa
(Gould 1853) en el mesolitoral superior rocoso de Guerrero, Mxico
Flores-Rodrguez, P., R., Flores-Garza, S., Garca-Ibaez y D. G., Arana-Salvador.... 97
Parmetro k de binomial negativa y su aplicacin en el estudio del grado de agregacin de
Plicopurpura pansa (Gould, 1853) en el estado de Guerrero, Mxico
Garca-Ibez, S., P., Flores-Rodrguez, R., Flores-Garza, D. G., Arana-Salvador y A., Valds-
Gonzlez.. 100
Pgina

V. COLECCIONES MALACOLGICAS
Colecciones biolgicas de moluscos de los Archipilagos de Revillagigedo, Col., e Islas Maras, Nay.,
Mxico.
Bautista-Moreno, L. M. y A., Lechuga-Medina. 105

VI. CONTAMINACIN Y TOXICOLOGA

Toxicidad de Agave angustifolia sobre Fossaria viatrix, hospedero intermediario de Fasciola hepatica
en Puebla, Mxico
Chilin-Herrera, O. L., R., Rojas-Garca y J. L., Zumaquero-Ros. 111
Beneficios clnicos en la artritis canina con la administracin oral del mejilln de labios verdes de
Nueva Zelanda (Perna canaliculus)
Corona-Cullar G... 113
Plomo en Crassostrea corteziensis y C. iridescens en dos ecosistemas costeros de Sinaloa
impactados por actividades antropognicas
Osuna-Lpez, I., G., Izaguirre-Fierro, H., Zazueta-Padilla, P., Villegas-Zuno, M. G., Fras-
Espericueta, G., Lpez-Lpez, D., Voltolina y L., Snchez-Osuna.. 115
Induccin experimental de microncleos en hemocitos de individuos adultos del mejilln estuarino
Mytella strigata (Hanley, 1843), por metilparatin
Faras-Snchez, J. A., V., Pelez-Zarate y M. A., Rivero-Lpez... 118
Organismos acuticos macrobentonicos como indicadores de la contaminacin por metales pesados
en ros de la Huasteca Potosina
Wong-Argelles, C., M. C., Alfaro-de la Torre y E., Naranjo-Garca 121
Moluscos bivalvos y gasterpodos de una laguna costera de Sinaloa impactada por descargas
agrcolas e industriales
Snchez-Osuna, L., G., Izaguirre-Fierro, D., Ruizvelazco-Ramrez, P., Alarcn-Garzn, I., Osuna-
Lpez, D., Voltolina, M., Fras-Espericueta, G., Lpez-Lpez y H., Zazueta-Padilla...... 124
Uso de la almeja de agua dulce Lampsilis tampicoensis como biofiltro para la remocin de coliformes
en agua de pozo; estudio de laboratorio
Macdonall-Reyes, P. A., R. M., Padrn-Lpez y L. J., Rangel-Ruiz... 127
Hidroxiprolina y un arreglo de Cistenas semejante al de las O-Conotoxinas en Pptidos del veneno del
caracol trrido polystira albida
Aguilar-Ramrez, M. B., R. A., Chan-de la Rosa, A., Falcn-Alcntara y E. P., Heimer-de la Cotera. 130
Deteccin de microncleos en hemocitos de Mytella strigata (Hanley, 1843): (Mollusca: Bivalvia),
provenientes del estero de Uras, Mazatln, Sinaloa, Mxico
Pelez-Zarate, V. A. y J. A., Faras-Snchez... 132

VII. CULTIVO DE MOLUSCOS


Cultivo experimental de almeja Catarina Argopecten ventricosus (Sowerby II, 1842) en dos reas
naturales protegidas del Golfo de California
Medina-Lpez A. G. y V., Koch 137
Asentamiento y distribucin de Mytilus galloprovincialis y Mytilus californianus a diferentes
profundidades, en la Baha de Todos Santos, Baja California, Mxico
Curiel-Ramrez Gtz, S. y J., Cceres-Martnez... 140
Crecimiento diario de postlarvas de Mytilus galloprovincialis Y Mytilus californianus en laboratorio
Curiel-Ramrez Gtz, S. y J., Cceres-Martnez... 143
Puestas de masas de huevos de Strombus costatus (Gmelin) usando encierros en el Parque Nacional
de Isla Contoy, Isla Mujeres, Q. Roo
Blanqueto-Cordova, D., L. A., Rodrguez-Gil, C. F., Reyes-Sosa, R., Alpizar-Carrillo y I. R.,
Rivas-Ruiz.... 146
Cultivo experimental de la almeja Mano de Len Nodipecten subnodosus (Sowerby, 1835) en la costa
Norte de Sinaloa, Mxico
Diarte-Plata, G., A. M., Gngora-Gmez, J. A., Hernndez-Seplveda, J. M., Mazn-Sustegui, y
L., Espinosa-Carren...... 148
Pgina
Sobrevivencia y crecimiento de Mytella strigata (Hanley, 1843) en un cultivo en Sinaloa
Esparza-Lpez, L. E., A. M., Gngora-Gmez, G., Diarte-Plata, A. L., Domnguez-Orozco, J. A.,
Hernndez-Seplveda y S. M., Abad-Rosales. 151
Desarrollo Intracapsular del caracol Burro Negro Muricantus nigritus (Muricidae) en condiciones de
laboratorio
Gngora-Gmez, A. M., A. A., Zavala-Norzagaray, J. A., Hernndez-Seplveda, G., Diarte-Plata y
J. A., Quintero-Vzquez..... 154
Cultivo del Ostin de Placer Crassostrea corteziensis en un Sistema Long-line en el estero la Curvina,
Ahome, Sinaloa
Gngora-Gmez, A. M., B. P., Villanueva-Fonseca, J. A., Hernndez-Seplveda, G., Diarte-Plata,
y M., Garca Ulloa-Gmez.... 155
Cultivo piloto del Ostin Japons Crassostrea gigas (Bivalvia: Ostreidae) en el Sistema lagunar el
Colorado, Ahome, Sinaloa
Gngora-Gmez, A. M., J. A., Hernndez-Seplveda, G., Diarte-Plata, D. G., Lpez-Alcantar y A.
E., Ulloa-Prez.... 157
Cultivo en Sistema Long-line de la almeja Catarina Argopecten ventricosus en el Sistema Lagunar el
Colorado, Ahome, Sinaloa
Gngora-Gmez, A. M., D. G., Lpez-Alcantar, J. A., Hernndez-Seplveda, G., Diarte-Plata y B.
P., Villanueva-Fonseca.. 159
Cultivo piloto de la almeja Negra Chione fluctifraga (Bivalvia: Veneridae) en el estero La Piedra,
Guasave, Sinaloa
Gngora-Gmez, A. M., M. A., Camacho-Evans, J. A., Hernndez-Seplveda, G., Diarte-Plata y
A., Nolasco-Orta..... 161
Crecimiento y sobrevivencia del ostin del Pacfico Crassostrea gigas (Thunberg, 1851) en el estero La
Piedra, Guasave, Sinaloa, durante el ciclo de cultivo Otoo-Primavera
Gngora-Gmez, A. M., J. A., Hernndez-Seplveda, G., Diarte-Plata, A., Nolasco-Orta y M.,
Garca Ulloa-Gmez...... 163
Crecimiento y sobrevivencia del Callo de Hacha Atrina maura (Bivalvia: Pinnidae) en la ensenada La
Palmita, Navolato, Sinaloa
Gngora-Gmez, A., J. C., Almaraz-Salas, J. A., Hernndez-Seplveda, G., Diarte-Plata y A. L.
Domnguez-Orozco. 165
Primer cultivo experimental del Ostin del Pacfico Crassostrea gigas (Bivalvia: Ostreidae) en la
ensenada La Palmita, Navolato, Sinaloa
Gngora-Gmez, A. M., M. A., Camacho-Evans, J. A., Hernndez-Seplveda, G., Diarte-Plata y
M., Garca Ulloa-Gmez... 167
Cultivo piloto del Ostin Japons Crassostrea gigas en el estero La Pitahaya, Guasave, Sinaloa,
Mxico.
Gngora-Gmez, A. M., N. P., Muoz-Sevilla, I. J., Sandoval-Soto, A. L., Domnguez-Orozco y J.
A., Hernndez-Seplveda... 169
Evaluacin del crecimiento del caracol Tote Pomacea flagellata (Say, 1827) empleando tres diferentes alimentos.
Fragoso-Prez, M. R., N., Brito-Manzano y V., Rivera-Lpez.. 171
Efecto de la densidad sobre el crecimiento y la sobrevivencia de juveniles del caracol Tote Pomacea
flagellata bajo condiciones de laboratorio en Tabasco, Mxico.
Brito-Manzano, N., V., Rivera-Lpez y M. R., Fragoso-Prez. 174

VIII. ECOLOGA, CONSERVACIN Y EDUCACIN AMBIENTAL

Historia natural y ecologa de Tambja abdere Farmer, 1978 (Mollusca: Opisthobranchia) de Baha de
Banderas
Hermosillo, A.. 179
Caractersticas ecolgicas de los moluscos marinos de las costas del estado de Oaxaca, Mxico
Caicedo-Rivas, R. E., V., Ortega-Chvez, J. S., Hernndez-Zepeda y S. J., Serrano-Guzmn.. 181
Agua de lastre: Propuesta de investigacin interdisciplinaria
Garca-Escobar, H. y V. A., Arellano-Peralta. 183
Crecimiento y mortalidad de la madreperla Pinctada mazatlanica (Hanley, 1856) en los stocks
naturales del litoral Oriental de Baja California Sur, Mxico
Wright-Lpez, H., I., Roque-Villada, O. E., Holgun-Quiones y F., Arregun-Snchez..... 186
Moluscos presentes en la dieta de peces del Parque Nacional Sistema Arrecifal Veracruzano, Mxico
Santander-Monsalvo, J.. 189
Pgina
Aspectos poblacionales del calamar dardo Lolliguncula diomedae (Hoyle, 1904) en las costas de
Jalisco y Colima
Arciniega-Flores, J., J. E., Michel-Morfin y V., Landa-Jaime... 191
Estudio de la poblacin del Chiton articulatus Sowerby, 1832 en playa Ventura, Copala, Guerrero,
como un recurso de importancia comercial
Galeana-Rebolledo, L., M. A., Sustegui-Herrera, G., Torales-Gutirrez, C. A., Milln-Romn, S.
Garca-Ibaz, R., Flores-Garza, P., Flores-Rodrguez, y D. G., Salvador-Arana... 193
Moluscos del submareal somero de la localidad La Rosada, Baha Chamela, Jalisco
Lpez-Uriarte, E., I., Enciso-Padilla, M., Prez-Pea, E. G., Robles-Jarero, E., Jurez-Carrillo, C.
M., Galvn-Villa, y E., Ros-Jara....... 196
Herbivoria del caracol dulceacucola Pomacea flagellata (Reeve, 1986) sobre tres plantas flotantes en
condiciones controladas
Amador-del ngel, L. E., B. A., Hernndez-Uribe, P., Rodrguez-Garca, D. A., Palacio-Prez y
P., Cabrera-Rodrguez.... 199
Preferencias alimenticias del caracol dulceacucola Pomacea flagellata (Reeve, 1986) sobre tres
plantas flotantes en condiciones controladas
Amador-del ngel, L. E., P., Rodrguez-Garca, B. A., Hernndez-Uribe, D. A., Palacio-Prez y
P., Cabrera-Rodrguez.... 202
Programa de educacin ambiental para el aprovechamiento y proteccin del recurso almeja en la
Reserva de la Biosfera Pantanos de Centla
Rangel-Ruiz, L. J., J., Gamboa-Aguilar, O. M., Ortiz-Lezama, A., Arvalo-de la Cruz, M., Garca-
Morales y S., Arias-Garca 205
Moluscos depredados por los peces globo (Diodon histrix y D. holocanthus) en las costas de Jalisco y
Colima
Raymundo-Huizar, A. R. y M., Saucedo-Lozano 208
Incorporacin de la proteccin marina a la Isla Isabel: Especial nfasis en la malacofauna.
Lopez-Rivas, C. E., J. M., Blanco-Correa, C., Bentez-Valle, J. M., Ruiz Velasco Arce, L. A.,
Arellano-Ayala, A. L., Avena-Becerra, C. A., Luna-Arangure, H. A., Ochoa-Sainz, J. A., Olvera-
Bentez, U. Rosales-Huerta y B., Salas-Meller...... 211
Importancia del inventario de moluscos marinos para la toma de decisiones en manejo de reas
protegidas
Magaa-Cubillo J., J. A., Martnez, J., Espinosa y J., Ortea 214

IX. PALEONTOLOGA

Pchelinsevia coquandiana (dOrbigny) ndice Paleogeogrfico del Cretcico, en el dominio Tethysiano,


Gastropoda-Nerineidae
Buitrn-Snchez, B. E., C., Gmez-Espinosa y E., Almazn-Vzquez. 219
Paleoambiente y composicin de las asociaciones fsiles de moluscos en una localidad del
Sinemuriano Superior de la regin de Pahuatln, Puebla
Esquivel-Macas, C., K., Flores-Castro y R. G. Len-Olvera.... 222
Moluscos dulceacucolas del Blancano Temprano, pertenecientes a la formacin Atotonilco El Grande
Hgo., Mexico
Flores-Camargo, D. G., M. P., Velasco-de Len y E., Naranjo-Garca...... 225
Estudio Tafonmico del gasterpodo cf. Donaldina robusta (Stevens, 1858) en un yacimiento
Pensilvnico del Noreste de Sonora, Mxico
Gmez-Espinosa, C. y B. E., Buitrn-Snchez.... 228
Aplicacin de los gasterpodos en la Reconstruccin Paleoecolgica
Rivera-Olmos, S. E., C., Gmez-Espinosa y B., Buitrn-Snchez. 231

X. PULPO

Aspectos generales de la pesca del pulpo Octopus hubbsorum en la costa Sur de Jalisco
Espino-Barr, E., M. C., Jimnez-Quiroz, A., Garca-Boa, E. G., Cabral-Sols y M., Puente-Gmez.. 235
Biologa reproductiva del pulpo Octopus hubbsorum Berry 1953 (Mollusca: Cephalopoda) en el Pacfico
Central Mexicano
Lpez-Uriarte, E. y E., Ros-Jara.. 238
Anlisis de contenido estomacal en Octopus hubbsorum Berry, 1953 (Cephalpoda: Octopodidae) en el
Pacfico Central Mexicano
Lpez-Uriarte, E. y M. E. Gonzlez-Rodrguez..... 241
Pgina
Variacin gentica del pulpo rojo en la Pennsula de Yucatn, Mxico
Tello-Cetina, J. A., J. B., Escamilla-Snchez, A. I., Reyna-Rivero y J. L., Carrillo-Galz........ 244
Determinacin de Lpidos totales y clases de Lpidos Neutros, Glucolpidos y Fosfolpidos en tres
especies de moluscos: caracol Strombus gigas, pulpo Octopus maya, y calamar Loligo pealeii
Moo-Puc, J. A., L. A., Rodrguez-Gil, C. F., Reyes-Sosa y J. I., Rivas.... 247
Aspectos reproductivos del pulpo caf Octopus bimaculatus Verrill,1883 en Baha de los ngeles, Baja
California, Mxico
Castellanos-Martnez, S., M., Arellano-Martnez, B. P., Ceballos-Vzquez, F., Garca-Domnguez,
M., Villalejo-Fuerte, G. D., Danemann y E., Torreblanca-Ramrez.... 250
Relaciones morfomtricas de Octopus hubbsorum Berry, 1953 (Cephalpoda: Octopodidae)
Lpez-Uriarte, E. 253

XI. REPRODUCCIN Y PESQUERIAS

Ciclo gondico de la almeja Chiluda Panopea generosa de Baha Magdalena Baja California Sur,
Mxico
Morales-Gmez, A. A., I. H., Salgado-Ugarte, E., Ura-Galicia, M. G., Gluyas-Milln y J. L.,
Gmez-Mrquez.. 259
Comparacin de longitudes sifonales de las especies Turbiella angulata y Busycon carica, capturadas
comercialmente en aos diferentes en la sonda de Campeche para determinar el deterioro de sus
poblaciones
Ancona-Ordaz, A. y R. R., Garca-Torcuato... 262
Aspectos biolgicos pesqueros de la almeja Anadara tuberculosa en Baha Magdalena B. C. S.,
Mxico
Flix-Pico, E. F., B. P., Ceballos-Vazquez y J. A., Lpez-Rocha..... 264
Ciclo reproductivo del ostin de mangle, Crassostrea palmula (Bivalvia: Ostreidae) en el estero El
Conchalito, La Paz, B. C. S.
Flix-Pico, E. F., F. A., Garca-Domnguez, O. E., Holgun-Quines y J., Lpez-Rocha.. 267
Maduracin del ostin Americano Crassostrea virginica en laboratorio
Robles-Hernndez, R., I., Galaviz-Villa, F., Lango-Reynoso, J. E., Chvez-Villalba y M., Le 269
Pennec.
Observaciones recientes sobre los moluscos de importancia comercial en la costa de Jalisco
Landa-Jaime, V., E., Michel-Morfn y M., Saucedo-Lozano. 272

XII. TAXONOMA Y SISTEMTICA

Revisin sistemtica del gnero Navanax Pilsbry, 1895 (Mollusca: Aglajidae)


Zamora-Silva, A.. 277
Actualizacin sistemtica de los gasterpodos de la Coleccin Malacolgica "Dr. Antonio Garca-
Cubas" (COMA), del Instituto de Ciencias del Mar y Limnologa, UNAM
Zamora-Silva, A., T., Islas, M., Reguero.............................. 280
Taxonoma de los moluscos arrecifales de Isla de Enmedio, Isla Sacrificios y Arrecife Hornos
Prez-Nava, J. A. y M., Reguero... 282
Una gua de campo para la identificacin taxonmica de los bivalvos marinos ms comunes de
Tamaulipas, Mxico
Vanote, J. A., A., Correa-Sandoval y N. E. Strenth 284
Central American Pachychilids: preliminary results on their systematic revision (Cerithioidea:
Pachychilidae)
Gmez, M., F., Khler, T., Von-Rintelen y M., Glaubrecht..... 285
Catlogo descriptivo e ilustrado de los moluscos de la zona intermareal de las Islas de la Baha de
Navachiste, Sinaloa. Mxico
Ortiz-Arellano, M. A. y L. M., Flores-Campaa. 288
Filogenia molecular del gnero Humboldtiana (Pulmonata: Humboldtianidae).
Meja, O., G., Ziga y O. J., Polaco.... 291
Moluscos de la zona intermareal de Cacaluta, Bahas de Huatulco, Oaxaca, Mxico
Ramrez-Gonzlez, A. y N. A., Barrientos-Lujn.. 294

ndice de Autores..... 297


PRESENTACIN

En Mxico existe una larga trayectoria de la Malacologa y la Conquiliologa.


Las primeras investigaciones sobre moluscos se remontan quizs a las pocas tempranas de la
Nueva Espaa (1570 1577). Sin embargo, desde antes de la llegada de los europeos, los
moluscos eran parte de las culturas prehispnicas, tal y como se corrobora en los mltiples
hallazgos arqueolgicos y antropolgicos. Las conchas representaron smbolos y fueron uno de
los elementos centrales de las ceremonias religiosas, su poder se prolongaba ms all de la
muerte. Se deca que Quetzalcatl emergi de la concha de un gasterpodo. La mayora de los
templos dedicados a este dios estaban ricamente decorados con conchas y se le represent
sentado en un pedestal con forma de concha en un templo de Teotihuacan. Actualmente se llevan
a cabo un nmero importante de investigaciones sobre las especies mexicanas de moluscos.
Tambin existen muchas colecciones de conchas privadas, en museos e instituciones que
demuestran su gran variedad y belleza.

Desde 1984, la Sociedad Mexicana de Malacologa A. C. ha organizado con


xito nueve Reuniones Nacionales en diferentes ciudades del norte, centro y sur del pas. La
Dcima Reunin Nacional de Malacologa y Conquiliologa se lleva a cabo en marzo del 2007 en
la ciudad de Guadalajara, Jalisco, ubicada en la regin occidente. La presente obra es una
compilacin de los ms de 100 trabajos presentados en esta Reunin y abarca una variedad
importante de temas de la Malacologa y Conquiliologa actual de Mxico. Esta es una gran
oportunidad de revisar el estado del conocimiento de este importante grupo taxonmico y
conocer algunas tendencias actuales de la investigacin malacolgica de nuestro pas. Adems,
permite reconocer a las instituciones, investigadores y estudiantes dedicados al estudio de los
moluscos.

Esta compilacin integra los resultados de investigaciones originales, llevadas a


cabo en 38 instituciones de investigacin y educacin de todo el pas y 13 del extranjero, con
especies de moluscos terrestres, dulceacucolas y de los mares templados y tropicales de Mxico.
Los temas van desde Arqueologa y Paleontologa, hasta aspectos generales y particulares de la
Taxonoma y Sistemtica de estos organismos o de su Biologa, Ecologa y Biogeografa. Otros
temas especficos fueron agrupados para su mejor ordenacin, como en el caso de los trabajos
sobre Reproduccin, Educacin Ambiental y Conservacin o los que se refieren a grupos
taxonmicos de inters como el Caracol Morado o los Cefalpodos. En otro grupo se encuentran
los trabajos sobre Contaminacin y Toxicologa que estudian el uso de moluscos como
bioindicadores o biofiltros de la contaminacin, relacionan problemas de salud veterinaria y
humana con las actividades antropognicas o de uso alimentario de los moluscos o se refieren a
algunos gasterpodos productores de venenos. Por su nmero, destacan los trabajos sobre
Biodiversidad que, junto con las contribuciones sobre Colecciones Malacolgicas, incluyen
listados taxonmicos principalmente de los bivalvos, gastrpodos y poliplacforos de
determinadas localidades o regiones, lo que indica que el inventario de la malacofauna de nuestro
pas no est completo y que an falta informacin sobre las dems clases de moluscos

i
considerados menos frecuentes, inconspicuos o de ambientes poco accesibles. Finalmente, las
investigaciones sobre Pesqueras y Cultivo de especies de inters econmico permiten conocer
algunos avances en el manejo y produccin de estos recursos y sobre la problemtica de las
actividades pesquera y acucola.

Los trabajos fueron seleccionados por los editores y enviados a un grupo de


especialistas que conformaron un Comit Cientfico ex profeso para su revisin y dictamen.
Adems un Comit Editorial revis que se cumplieran las normas editoriales establecidas para
asegurar la mayor calidad y uniformidad de todos los trabajos. Sin embargo, el contenido final de
cada contribucin es responsabilidad de los autores.

El libro es de inters no slo para investigadores, profesores, tcnicos,


coleccionistas, conservacionistas y estudiantes interesados en la Malacologa y Conquiliologa,
sino tambin para pescadores, productores, prestadores de servicios, administradores, polticos y
el pblico en general. Toda esta informacin contribuye a lograr un mejor conocimiento de los
moluscos de nuestro pas, con el propsito de conservarlos y aprovecharlos racionalmente.

Eduardo Ros Jara


Presidente de la Sociedad Mexicana
de Malacologa, A. C.
Marzo de 2007

ii
ARQUEOLOGIA
Paz-Bautista, C. y B. Ziga-Arellano. 2007. Los ornamentos de concha encontrados en el entierro central del templo de Quetzalcoatl de Teotihuacan,
Mxico. pp 3-5. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds).
Universidad de Guadalajara, Mxico. 286 p.

LOS ORNAMENTOS DE CONCHA ENCONTRADOS EN EL ENTIERRO CENTRAL DEL TEMPLO DE


QUETZALCOATL DE TEOTIHUACAN, MXICO

Paz-Bautista, Clara y Ziga-Arellano, Belem


Proyecto Templo de Quetzalcoatl. INAH-Arizona State University. Proyecto Tcnicas de manufactura de
los objetos de concha del Mxico prehispnico. Museo del Templo Mayor. INAH.
clarapazb@hotmail.com.mx, belemzu@yahoo.com.
Palabras clave: Ornamentos, concha, templo, Quetzalcoatl, Teotihuacan.

INTRODUCCIN directamente sobre el tepetate, se cubrieron con


Durante las excavaciones realizadas por el piedras y lodo para dar inicio con la cimentacin
Proyecto Templo de Quetzalcoatl, llevadas a del basamento. Los personajes de este conjunto
cabo en 1998 y 1999, se recuperaron una gran mortuorio portaban una abundante y excepcional
cantidad de entierros, que estaban distribuidos ofrenda, consistente en ornamentos personales
simtricamente al interior y alrededor del edificio que formaron su atuendo, as como objetos
conocido como el Templo de Quetzalcoatl. Estos ceremoniales. Los cuales se manufacturaron con
hallazgos, indican que para la creacin del distintas materias primas como: piedra verde,
edificio se realizaron ceremonias funerarias, con obsidiana y concha, entre otras. Los individuos
la finalidad de conmemorar el inicio de la fueron sacrificados, colocndose con las manos
construccin, as como la inauguracin del atadas por detrs del trax, sobre ellos se
monumento. (Cabrera, et al., 1989). deposit el relleno constructivo, lo que ocasion
Las actividades rituales, la construccin y que adquirieran diversas y complicadas
modificaciones arquitectnicas en torno a este posiciones anatmicas y orientaciones.
Templo, se realizaron entre 150 y 250 d.C., (Sugiyama, 2005).
periodo correspondiente a la fase cronolgica
Miccaotli, del horizonte mesoamericano conocido
como Clsico temprano. (Cabrera, et al., 1990).
Hasta ahora los individuos relacionados
con el edificio alcanzan un total 139 esqueletos
detectados, sin embargo existen hiptesis
sustentadas en la disposicin simtrica y en el
nmero de osamentas contenidas en los
enterramientos, que hacen suponer que la
cantidad de personajes inhumados est
relacionada con el calendario ritual o
Tonalpohualli de 260 das. O bien con Xiupohualli
o calendario solar de 365 das (Cabrera-Castro y Plano General, Entierro 14. Tomado de
Cabrera, 1993) Sugiyama, 2005.
Este sistema fue dedicado al Templo de
la Serpiente Emplumada, deidad teotihuacana, a OBJETIVO
la que se le consider creadora de las divisiones Realizar el estudio tipolgico de los materiales y
calendricas o del tiempo en el mundo de los la identificacin malacolgica de las especies
hombres (Lpez-Austin, et al., 1991). utilizadas en la fabricacin de los objetos
El entierro central, tambin llamado asociados al entierro central del Templo de
entierro 14, conforma un complejo funerario, con Quetzalcoatl.
caractersticas especiales, que hasta ahora no se
han detectado en las prcticas funerarias de la MATERIALES Y MTODOS
antigua ciudad de Teotihuacan. Se localiz al La clasificacin de los objetos de concha se hizo
interior y justo en el centro del basamento, fue con base en la tipologa propuesta por Surez-
una de las primeras inhumaciones que se Diez, (2002). En el anlisis tipolgico se dividen
llevaron a cabo, los personajes que lo componen las piezas segn a la utilidad ornamental y la
fueron depositados al nivel de desplante del funcin votiva.
edificio, para formar parte de su ncleo (Cabrera-
Castro y Serrano, 1999).
El entierro central se compone por veinte
individuos masculinos que se depositaron

3
Estudios sobre Malacologa y Conquiliologa en Mxico

alrededor del esqueleto, quiz usados como


piezas votivas.
De igual manera, el anlisis de las
tcnicas de manufactura ha permitido establecer
algunas de las fases productivas mas utilizadas
por los artesanos teotihuacanos.
En lo que se refiere a las tcnicas de
elaboracin de estos objetos, se conocen
algunas de las fases del proceso de produccin.
El cual y de acuerdo con Lourdes Surez se
divide en dos etapas: Tcnicas de elaboracin y
Tcnicas de acabado. Los objetos de concha
estudiados presentan desgaste, corte y perforado
Entierro 14. Pendientes del Gnero Oliva y para obtener las formas requeridas. Para
objetos sin trabajar de la especie Turbinella terminar definitivamente los ornamentos se
angulata. PTQ-98-99 llevaron a cabo pulidos, bruidos, con estas
tcnicas se obtiene una apariencia llamativa de
En esta presentacin se define cada una las superficies del objeto. Y como parte de la
de las categoras, adems se describen y decoracin de los objetos, se usaron tcnicas de
cuantifican los objetos de concha asociados al esgrafiado y acanalado, en algunos de stos
entierro 14. (Surez-Diez, 1981).
Para la identificacin de las especies se Sin embargo, la discusin de este trabajo
llev a cabo un anlisis macroscpico, en donde se centra en reconocer de forma completa la
se tomaron en cuenta las caractersticas morfologa de los ornamentos, las tcnicas de
biolgicas (tamao, forma, ornamentacin y/o manufactura, las especies ocupadas, as como
coloracin) que aun conservan tanto los los materiales y herramientas usadas en su
materiales modificados culturalmente como los produccin.
no modificados. Igualmente se realiz un estudio Con respecto al aspecto biolgico,
microscpico con lupa de aumentos 10x y 20x, lo encontramos que en la manufactura de los
que nos permiti observar aquellas diferentes ornamentos se utilizaron un total de 13
caractersticas propias de la especie que no eran especies de moluscos, pertenecientes a las
observables a simple vista. clases Gastropoda y Bivalvia, estas especies
La determinacin de las especies se hizo proceden de las provincias malacolgicas
de acuerdo con Abbott (1974) y Keen (1971). Caribea y Panmica. De la primera provincia
En la identificacin malacolgica se tenemos a: Turbinella angulata, Oliva sayana,
incluye una descripcin del hbitat, nicho Oliva reticularis y Oliva scripta; mientras que de
ecolgico y las formas de obtencin de las la provincia Panmica proceden Oliva porphyria,
especies que se utilizaron en la manufactura de Oliva incrassata, Oliva julieta, Oliva spicata,
los objetos. Agaronia testacea, Pinctada mazatlnica,
Spondylus princeps, Spondylus calcifer y Chama
RESULTADOS Y DISCUSIN echinata.
Con el estudio tipolgico y biolgico de los Por otro lado, observamos que todos los
objetos de concha, se pudo determinar las gasterpodos identificados habitan en sustratos
especies ms utilizadas en la elaboracin de arenosos situados en o cerca de la zona de
ciertas categoras de ornamentos. mareas, mientras que los bivalvos (Pinctada
Los objetos estudiados se ordenaron en mazatlnica, Spondylus princeps, Spondylus
stas categoras: cuentas, incrustaciones, calcifer y Chama echinata) viven adheridos a
orejeras, pendientes, y objetos no trabajados. Se sustratos rocosos de aguas ms profundas, por
encontr que los objetos fueron usados de lo que es necesario en el caso del Spondylus
manera indistinta ya sea como ornamentos o bucear para poder obtenerlos.
como objetos ceremoniales. Se encontraron De las 13 especies determinadas, los
individuos con piezas colocadas caracoles del gnero Oliva, Turbinella angulata y
anatmicamente, posiblemente se les dio una Spondylus princeps son los ms utilizados en la
utilidad ornamental. Sin embargo tambin se manufactura de los ornamentos; debindose
detectaron osamentas asociadas con posiblemente a la relativa facilidad con que
concentraciones de objetos distribuidos pueden obtenerse las olivas y la Turbinella, no

4
Estudios sobre Malacologa y Conquiliologa en Mxico

siendo este el caso del Spondylus, ya que


posiblemente su amplio uso se relaciona con el
valor simblico que los teotihuacanos otorgaron a
esta especie.

LITERATURA CITADA
Abbott, R. T. 1974. American Seashells. 2da.
Edition. Van Nostrand Reinhold Company. New
York. 663 p.
Cabrera-Castro R., G. Cowgil, S. Sugiyama y C.
Serrano. 1989. El Proyecto Templo de
Quetzalcoatl. En Arqueologa, Direccin de
Monumentos Prehispnicos. No. 5: 51-79.
Cabrera-Castro R., G. Cowgill y S. Sugiyama.
1990. El Proyecto Templo de Quetzalcoatl y la
prctica a gran escala del sacrificio humano.
En Amalia Cardos de Mndez (codo.), poca
Clsica: Nuevos hallazgos, nuevas ideas,
Museo Nacional de Antropologa. Pp.123-146.
Cabrera-Castro, R. y O. Cabrera. 1993. El
significado calendrico de los entierros del
Templo de Quetzalcoatl. En Ma. Teresa
Cabrero (Coord.), II Coloquio Pedro Bosh
Gimpera, 271-297, Instituto de Investigaciones
Antropolgicas, UNAM, Mxico.
Cabrera-Castro, R. y C. Serrano. 1999. Los
entierros de la Pirmide del Sol y del Templo
de Quetzalcoatl, Teotihuacan. En Prcticas
funerarias en la ciudad de los dioses. Los
enterramientos en la antigua Teotihuacan. Pp.
345-397, IIA-UNAM DGAPA, Mxico.
Keen, M. A. 1971. Sea Shells of Tropical West
America. Marine Mollusca from Baja California
to Peru. 2da. Edition. Stanford University Press,
Stanford, Califonia. 1064 p.
Lpez-Austin, A. L. Lpez-Lujn y S. Sugiyama.
1991. El Templo de Quetzalcoatl en
Teotihuacan, su posible significado ideolgico,
En Anales del Instituto de Investigaciones
Estticas, UNAM, Mxico. Vol. 62: 35-52.
Surez-Dez, L. 1981. Tcnicas prehispnicas en
los objetos de concha. Coleccin Cientfica No.
14, Serie Arqueologa, Instituto Nacional de
Antropologa e Historia, Mxico.
Surez-Dez, L. 2002. Tipologa de los objetos
prehispnicos de concha. Grupo editorial
Miguel A. Porra, CONACULTA-INAH, 2 Ed.,
Mxico.
Sugiyama, S. 2005. Human Sacrifice, Militarism,
and Ruleship. Materialization of State Ideology
at the Feathered Serpent Pyramid,
Teotihuacan. Serie New Studies in
Archaeology. Cambridge University Press.
Cambridge, United Kingdom.

5
Melgar-Tsoc E. R. 2007. Los materiales malacolgicos de Xochicalco, Morelos. pp 6-7. En: Estudios sobre la Malacologa y Conquiliologa en Mxico.
Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

LOS MATERIALES MALACOLGICOS DE XOCHICALCO, MORELOS

Melgar-Tsoc Emiliano Ricardo


Proyecto Tcnicas de Manufactura de los Objetos de Concha del Mxico Prehispnico. Museo del
Templo Mayor, Instituto Nacional de Antropologa e Historia. Seminario 8, Col. Centro, Del. Cuauhtmoc,
Mxico D.F., C.P. 06060. anubismarino@gmail.com
Palabras clave: Arqueologa, moluscos, taxonoma, prestigio, Xochicalco.

INTRODUCCIN malacolgicos correspondientes a las provincias


Una de las materias primas ms apreciadas para malacolgicas en cuestin, la Panmica-Pacfica
la elaboracin de bienes de prestigio en las y el Caribe, por lo cual revisamos los trabajos de
sociedades prehispnicas fue la concha, dado Myra Keen (1971) para el Pacfico y Tucker
que proceda de lugares relativamente distantes Abbott (1982) para el Caribe. Tambin
para el caso de sitios tierra adentro, por lo cual consultamos las colecciones de referencia de
debieron ser adquiridos mediante algn tipo de moluscos de la Subdireccin de Laboratorios y
circulacin. Adems, con esta materia se Apoyo Acadmico del INAH en la Ciudad de
elaboraban objetos ornamentales y piezas Mxico. Y contamos con las asesoras de las
votivas que slo individuos con cierto status bilogas Belem Ziga Arellano, Norma Valentn
podan tener acceso a ellos (Moholy-Nagy, Maldonado y el arquelogo Adrin Velsquez
1995). Castro.
En el caso de Xochicalco, sitio Una vez realizada la identificacin
amurallado del Epiclsico (650-900 d.C.) taxonmica, pasamos a la clasificacin de los
emplazado en varios cerros en la porcin objetos de concha, conocida como anlisis
occidental del Valle de Morelos, debido a su tipolgico, donde sistematizamos todas y cada
lejana del mar y a que el ro Tembembe que una de las piezas modificadas por el hombre que
serpentea al oeste del sitio no tiene conchas de integran esta coleccin, basados en aspectos
agua dulce, los ms de dos mil moluscos morfolgicos y funcionales. Para ello seguimos el
hallados debieron llegar por intercambio de larga esquema propuesto por Surez-Dez (1977) en
distancia con grupos que las explotaban su clsica obra Tipologa de los objetos
asentados en las costas. En este sentido, su prehispnicos de concha, pero con las
posicin estratgica dentro del valle y el control modificaciones hechas por Velsquez-Castro,
que ejerci sobre la ruta de circulacin de (1999), en su libro Tipologa de los objetos de
productos (terrestres o marinos) de Michoacn y concha del Templo Mayor de Tenochtitln.
Guerrero, siguiendo la cuenca del ro Balsas Finalmente se compararon la variedad de
hacia el Altiplano Central (Kolb, 1987), permiti piezas y contextos para apreciar sus patrones de
que este sitio concentrara y restringiera la distribucin y consumo.
distribucin de determinados materiales en la
regin. RESULTADOS Y DISCUSIN
Por ello, en este trabajo nos enfocaremos La identificacin taxonmica de los ms de dos
en el estudio taxonmico y tipolgico de los mil moluscos hallados en Xochicalco dio como
materiales malacolgicos y su relacin con los resultado 38 especies, 37 de ellas procedentes
patrones de distribucin y consumo dentro de de dos provincias malacolgicas: la Panmica y
Xochicalco, considerndolos como bienes de la Caribea. La primera comprende desde el sur
prestigio. del Golfo de California hasta Tumbes en el norte
de Per (Keen, 1971), regin de donde procede
MATERIALES Y MTODOS la gran mayora del material con el 85% del total
La coleccin de moluscos arqueolgicos de de moluscos e identificndose 32 especies. Entre
Xochicalco consta de 2,282 piezas de las clases estos se destacan Pinctada mazatlanica,
Bivalvia y Gastropoda, recuperadas durante Spondylus princeps, S. calcifer, Oliva porphyria,
distintas temporadas de campo y en distintos Chama echinata, Trivia radians, Jenneria
sectores del sitio desde 1960 a la fecha. pustulata y Muricanthus princeps. La segunda
Para analizarlos, como primer paso se abarca parte del Golfo de Mxico y Florida, Las
procedi a la identificacin taxonmica de los Antillas, el Mar Caribe, Venezuela y el norte de
materiales, tratando de llegar en la mayora de Brasil (Abbott, 1982), cuyos moluscos son muy
los casos hasta el nivel de especie. Para ello escasos en el asentamiento con menos del 2%
contamos con el apoyo de los manuales del total, divididos en cinco especies: Strombus

6
Estudios sobre Malacologa y Conquiliologa en Mxico

gigas, Turbinella angulata, Pleuroploca gigantea, Kolb, C. C. 1987. Marine Shell Trade and Classic
Marginella cf. apicina y Oliva sayana. Cabe Teotihuacan. BAR Internacional Series 364.
sealar que tambin se hallaron grandes Mxico.
cantidades de conchas dulceacucolas sin Melgar-Tsoc, E. R. 2004. Las ofrendas de
trabajar procedentes de los ros Amacuzac y concha de la Pirmide de las Serpientes
Balsas, en el sur del Estado de Morelos y el norte Emplumadas de Xochicalco. Ponencia
de Guerrero, que pertenecen a una sola especie presentada en el VIII Congreso Internacional
de valva nacarada, Unio aztecorum con el 13% de Malacologa Mdica y Aplicada. 10 al 13 de
del total. Noviembre. Museo del Templo Mayor. Mxico.
Esta mayor proporcin de las especies Moholy-Nagy, H. 1995. Shells and Society at
provenientes de las costas del Pacfico puede Tikal, Guatemala. Expedition 37 (2):3-12.
deberse a que se ha dicho que Xochicalco tuvo Sorensen, J., K. Hirth y S. Ferguson. 1989. The
afiliaciones culturales muy fuertes con algunas contents of seven obsidian workshops around
porciones del noreste de Guerrero, la Depresin Xochicalco, Morelos. En: Margarita Gaxiola y
del Balsas y el Valle de Toluca (Hirth y Guillen, John Clark (Coords.). La obsidiana en
1988), privilegiando la adquisicin de recursos y Mesoamrica. INAH. Mxico. (Coleccin
productos de las costas de Michoacn y Guerrero Cientfica 176. pp. 269-275.
hacia el Altiplano Central y vinculndose con Surez-Diez, L. 1977. Tipologa de los objetos
grupos del Occidente de Mxico. No en vano el prehispnicos de concha. INAH. Mxico
85 % de la obsidiana de Xochicalco es de tonos (Coleccin Cientfica no. 54).
grisceos y procede de Zinapcuaro, Michoacn Velsquez-Castro, A. 1999. Tipologa de los
(Sorensen, et al., 1989). objetos de concha del Templo Mayor de
Por su parte, el anlisis tipolgico Tenochtitln. INAH. Mxico. (Coleccin
realizado permiti clasificar la gran variedad de Cientfica 392).
objetos elaborados, mayoritariamente
ornamentos, en: 281 incrustaciones, 280
cuentas, 204 pendientes, dos pectorales, dos
trompetas y dos anillos. Al comparar los
contextos de donde provienen estas piezas pudo
apreciarse al menos tres patrones de
distribucin: la primera incluye la mayor
diversidad de especies y objetos concentrados
en las ofrendas y estructuras de la Plaza
Principal; la segunda abarca solamente a un tipo
de artefacto y una sola especie, los pendientes
hechos en Oliva porphyria, los cuales se
distribuyen en distintas plazas del asentamiento;
y la tercera est conformada por unas cuantas
especies y objetos nicos localizados en los
bastiones de una de las entradas del
asentamiento (Garza-Tarazona, 1993; Melgar-
Tsoc, 2004).

LITERATURA CITADA
Abbott, R. T. 1982. Kingdom of the seashell.
Bonanza Books, Nueva York.
Garza-Tarazona, S. 1993. Una de las entradas a
la Ciudad de Xochicalco, Morelos. Cuadernos
de Arquitectura Mesoamericana 23: 9-18.
Hirth, K. y A. C. Guilln. 1988. Tiempo y
Asentamiento en Xochicalco. IIA-UNAM.
Mxico.
Keen, M. A. 1971. Sea shells of tropical West
America. Stanford University Press, Stanford.

7
Gmez-Gastlum, L. 2007. Conchas y caracoles en el antiguo Occidente de Mxico. Un ensayo de antropologa simblica. pp 8-10. En: Estudios sobre
la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico.
286 p.

CONCHAS Y CARACOLES EN EL ANTIGUO OCCIDENTE DE MXICO. UN ENSAYO DE


ANTROPOLOGA SIMBLICA

Gmez-Gastlum, Lus
Departamento de Estudios Mesoamericanos y Mexicanos, Centro Universitario de Ciencias Sociales y
Humanidades, Universidad de Guadalajara. Gregorio Dvila # 68, Col. Artesanos, 44200 Guadalajara,
Jalisco, Mxico. gastelum@cencar.udg.mx
Palabras clave: Arqueologa, simbolismo, occidente de Mxico, conchas, colores.

INTRODUCCIN primero fue la contextualizacin, mediante el cual


Los estudios arqueolgicos realizados en Mxico se estudiaron los materiales observando las
que se ocupan de conchas y caracoles son relaciones que tuvieron en el entorno de su
relativamente recientes. En una disciplina que hallazgo. El segundo, la identificacin biolgica,
pregona ser bicentenaria, la conquiliologa permiti conocer al molusco con sus
arqueolgica tiene apenas 30 aos de existencia. caractersticas naturales (Polaco, 1991). Con el
Se ha interesado principalmente en aspectos tercero se busco un acercamiento a la
econmicos y tecnolgicos (Surez 1974, 1977), percepcin indgena del color, para reconstruir el
dejando de lado otras problemticas. En esta manejo prehispnico de las tonalidades
ocasin se abordarn algunos aspectos no cromticas (Berlin y Kay 1999; MacLaury, 1986).
tratados, como son la funcin y el simbolismo de Los resultados fueron vistos a travs del estudio
las conchas y los objetos manufacturados con de la cosmovisin indgena, prestando principal
stas. atencin a aquellos aspectos relacionados con
Este ejercicio se efectuar con materiales los moluscos y los colores, con lo cual se abre la
procedentes de la subrea cultural conocida puerta para su interpretacin. Aunado a lo
como el occidente de Mxico. Se trata de la anterior, en el terreno terico y para dar sustento
porcin de Mesoamrica que abarca el territorio al anlisis, la principal discusin se dio en torno
de los actuales estados mexicanos de al papel de las conchas como smbolos de
Michoacn, Colima, Jalisco, Nayarit y Sinaloa, cultura material. Aqu se hizo uso de los aportes
as como porciones de Guanajuato y Zacatecas de la arqueologa cognitiva con los depsitos
(Armillas, 1948; Schndube, 1980). En lo que se simblicos externos (Renfrew y Scarre, 1998); de
refiere a la temporalidad, el periodo de inters una rama de la post-procesual interesada en las
corre entre el ao 1500 a. C. y hasta 1530 d. C. metforas materiales (Tilley, 1999) y de la
En estos 3,000 aos se distinguen tres grandes conductual, preocupada por los procesos de
periodos, que coinciden de manera aproximada formacin y transformacin del registro
con los horizontes mesoamericanos. El ms arqueolgico (Schiffer, 1990).
temprano abarca desde 1500 a. C. hasta 300/400
d. C., siendo su principal peculiaridad las RESULTADOS Y DISCUSIN
llamadas tumbas de tiro. El segundo, entre 400 El anlisis efectuado ofreci los siguientes
y 1100 d. C., es momento de diversos desarrollos resultados: Durante toda la poca prehispnica,
culturales regionales. El ltimo, de 1100 a 1530 de acuerdo con la contextualizacin, las conchas
d. C., destaca la presencia dominante de los y caracoles fueron utilizados como ofrendas u
tarascos en la porcin meridional de la regin ornamentos en entierros humanos. Esta
(Schndube, 1982). presencia, as como la informacin procedente
de crnicas del periodo colonial, sugieren que los
MATERIALES Y MTODOS adornos fueron tambin utilizados por los seres
Para cumplir el objetivo de la investigacin, humanos vivos (Alcal, 1988). En trminos
conocer la funcin y el simbolismo de las arqueolgicos, cuando las valvas fueron
conchas entre los pueblos indgenas utilizadas como ofrendas por regla general
prehispnicos del occidente de Mxico, se llev seguan las pautas de colocacin establecidas
una bsqueda bibliogrfica y se efectu el por los dems objetos integrantes de la ddiva
anlisis de algunas colecciones de conchas fnebre. O bien, delimitaban el espacio dedicado
arqueolgicas de la regin. Se busc cubrir la a la sepultura. Si se trataba de adornos, fueron
totalidad de la informacin disponible en torno al colocadas en diversas partes del cuerpo, en
tema. Una vez logrado lo anterior, se efectuaron ocasiones con presencia en toda la anatoma.
varios procedimientos que sistematizaron los Tales usos indican, sin lugar a dudas, que
datos y los hicieron aptos para el anlisis. El formaron parte de diversas relaciones sociales y,

8
Estudios sobre Malacologa y Conquiliologa en Mxico

por lo tanto, sirvieron como smbolos. Esto se afectaron. En cuanto al primero, los trabajos de
sustenta en los siguientes hechos: a) dejaron el Lpez-Austin, (1996), permiten saber de la
mundo natural y se les incorpor al social, pues concepcin que tuvieron los indgenas
su presencia en los contextos arqueolgicos slo prehispnicos de nuestra anatoma. Para ellos,
puede explicarse a travs de un acarreo y hay tres sustancias dadoras de vida el tonalli, el
acomodo ejecutado por seres humanos; b) los teyola y el ihyotl, que tienen su asiento en la
patrones que se configuraron hablan de un cabeza, el corazn y el hgado, respectivamente.
empleo socialmente aceptado, seguramente Adems, existen porciones del cuerpo donde
normado por la ritualidad, prctica que se dichas sustancias se concentran en mayores
mantuvo durante toda la poca prehispnica. proporciones, como las articulaciones, las
La identificacin biolgica permiti pantorrillas y el lado izquierdo. Tales
conocer durante el Posclsico tardo de la observaciones son de importancia, pues
utilizacin en ocho sitios de tres familias de coinciden con los lugares donde se ubicaban los
gasterpodos, seis gneros (tres de pelecpodos ornamentos de concha. En cuanto a los colores,
y tres de gasterpodos) y doce especies de acuerdo con la visin precolombina,
(repartidas en partes iguales). Para el Clsico estuvieron asociados con la estructura del
tardo y Posclsico temprano, en diez sitios, universo. En trminos generales, se visualizaba
cuatro familias (divididas por igual), ocho gneros el cosmos repartido en cinco rumbos, cuatro de
(cuatro de gasterpodos, tres de pelecpodos y los cuales corresponden ampliamente con los
un poliplacforo) y 25 especies (catorce de puntos cardinales y a stos se aada el centro.
gasterpodos y once de pelecpodos). En los En los mitos mesoamericanos de la creacin, a
periodos tempranos, con nueve sitios, dos cada uno de los rumbos corresponde un color,
familias (una y una), ocho gneros (cinco de reconocindose la existencia del rojo, el amarillo,
pelecpodos y tres de gasterpodos) y 19 el blanco, el azul/verde y el negro (Len-Portilla,
especies (doce de gasterpodos y siete de 2001). Es cierto que el orden asignado variaba
pelecpodos). Las conchas de estos moluscos en cada regin, a excepcin del rojo casi siempre
fueron utilizadas tanto sin modificar como en la asociado con el punto de nacimiento del sol.
elaboracin de diversos objetos, entre los cuales Resulta de inters que, en la actualidad,
resaltan los sartales de cuentas, pendientes, aros huicholes y coras reconocen tambin un color
de distintos tamaos as como artculos pinto (Guzmn, 2002; Lumholtz, 1986). Sobre
zoomorfos y antropomorfos. Todos ellos pudieron las formas, como se mencion las valvas fueron
ser ubicados sobre la cabeza como tocados, utilizadas sin modificar o dando lugar a diferentes
collares para el cuello, el trax, la cintura como representaciones. Las primeras suelen asociarse
los pectorales y cinturones, en extremidades al mundo acutico del cual provienen, y por ende
superiores como brazaletes y pulseras y en las con el lado femenino del universo y la fertilidad
inferiores como ajorcas y pulseras de tobillo. (Broda, 1987). Ms cuando se trata de caracoles,
Tambin fueron usados como trompetas o para con el viento por su forma en espiral. En ambos
formar representaciones flicas, en el caso de los casos, el color de la valva modifica su
grandes caracoles. El universo en estudio se simbolismo, llegando a asociarla con aspectos
puede agrupar en conjuntos definidos por el masculinos del cosmos, secos y solares
color. Se detectaron cinco grupos: rojizos (Espinosa-Pineda, 2001). Cuando se habla de
(ejemplificados por especies como Spondylus conchas transformadas, donde resaltan las
princeps, Laevicardium elatum y Chama representaciones antropomorfas y zoomorfas, las
frondosa); blanquecinos (Pinna rugosa, Pinctada simbolizaciones tienen ms que ver con la forma
mazatlanica); amarillentos (Turbinella angulata y adoptada. Si se habla de imgenes humanas, la
Strombus peruvianus); oscuros (Anadara significacin se acerca a la concretizacin del
grandis) y moteados en fondo claro con universo en el cuerpo humano (Lpez-Austin,
decoracin obscura o viceversa (Glycymeris 1996). Si de animales, donde hay aves, ranas y
gigantea, Oliva porphyria y Cypraea arabicula). ardillas representadas, puede hablarse de
Ahora, para conocer el significado que simbolismo repartido entre lo celeste y lo
tuvieron los patrones arriba mencionados, es acutico, lo hmedo y lo solar.
necesario atisbar en la cosmovisin En conclusin, se puede proponer que el
mesoamericana. Son tres los elementos simbolismo de conchas y caracoles en el antiguo
principales en los que se apoyar la occidente de Mxico est vinculado con tres
interpretacin ofrecida: el cuerpo humano, los grandes campos. Primero, en su carcter de
colores de las conchas y las formas que aquellas joyera, sirven para fortalecer las sustancias

9
Estudios sobre Malacologa y Conquiliologa en Mxico

anmicas. Segundo, por el manejo de sus Schiffer, M. B. 1990. Contexto arqueolgico y


colores, es una variante de la representacin del contexto sistmico. Boletn de Antropologa
universo, ya que los tonos de las mismas son Americana 22: 81-93
compatibles con dichas imgenes. Tercero, Schndube, O. 1980. poca prehispnica. En J.
vistas en lo individual, se conectan con los M. Muri (ed.). Historia de Jalisco. I. Desde los
aspectos femeninos y masculinos del cosmos. En tiempos prehistricos hasta fines del siglo XVI.
cualquiera de los casos la idea de fertilidad est Unidad Editorial del Gobierno de Jalisco.
siempre presente. Guadalajara. Pp. 111-130
Schndube, O. 1982. La evolucin cultural en el
LITERATURA CITADA occidente de Mxico: Jalisco, Colima y Nayarit.
Alcal, J. 1988. La Relacin de Michoacn. En J. M. Muri et al. (Recops.). Lecturas
Secretara de Educacin Pblica. Mxico. 372 histricas de Jalisco. Antes de la
p. Independencia. Unidad Editorial del Gobierno
Armillas, P. 1948. Arqueologa central, occidental de Jalisco. Guadalajara. Pp. 51-60
y de Guerrero. En El occidente de Mxico. Surez, L. 1974. Tcnicas prehispnicas en los
Cuarta reunin de Mesa Redonda sobre objetos de concha. INAH. Mxico. 69 p.
problemas antropolgicos de Mxico y Centro Surez, L. 1977. Tipologa de los objetos
Amrica. Sociedad Mexicana de Antropologa. prehispnicos de concha. INAH. Mxico. 209 p.
Mxico. Pp. 211-213 Tilley, C. 1999. Metaphor and material culture.
Berlin, B. y P. Kay. 1999. Basic color terms. Their Blackwell Publishers. Oxford. 298 p.
universality and evolution. CSLI Publications.
Stanford. 196 p.
Broda, J. 1987. The provenience of the offerings:
tribute and cosmovision. En E. Hill Boone (ed.).
The Aztec Templo Mayor. Dumbarton Oaks.
Washington. Pp. 211-256
Espinosa-Pineda, G. 2001. La fauna de Ehcatl.
Propuesta de una taxonoma a partir de las
deidades, o la funcin de la fauna en el orden
csmico. En Y. Gonzlez Torres (coord.).
Animales y plantas en la cosmovisin
mesoamericana. Plaza y Valds e INAH.
Mxico. Pp. 255-303
Guzmn, A. 2002. Mitote y universo cora. INAH y
Universidad de Guadalajara. Mxico. 191 p.
Len-Portilla, M. 2001. La filosofa nhuatl
estudiada en sus fuentes. UNAM. Mxico. 461
p.
Lpez-Austin, A. 1996. Cuerpo humano e
ideologa. Las concepciones de los antiguos
nahuas. UNAM. Mxico. 2 vols.
Lumholtz, C. 1986. El arte simblico y decorativo
de los huicholes. Instituto Nacional Indigenista.
Mxico. 402 p.
MacLaury, R. 1986. Color in Mesoamrica, Vol. I:
A theory of composite categorization. Ph. D.
dissertation. University of California at Berkeley.
435 p.
Polaco, O. J., 1991. La fauna en el Templo
Mayor, una aproximacin metodolgica. En La
fauna en el Templo Mayor. INAH. Mxico. Pp.
15-31.
Renfrew, C. y C. Scarre. 1998. Cognition and
material culture: the archaeology of symbolic
storage. McDonald Institute for Archaeological
Research. Cambridge. 187 p.

10
Gmez-Gastlum, L. y M. G. Rivera-Acosta. 2007. Uso de trompetas de caracol marino en el Occidente de Mxico: Pasado y presente. pp 11-13. En:
Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de
Guadalajara, Mxico. 286 p.

USO DE TROMPETAS DE CARACOL MARINO EN EL OCCIDENTE DE MXICO: PASADO Y


PRESENTE

Gmez-Gastlum, Lus1 y Rivera-Acosta, Ma. Guadalupe2


1
Departamento de Estudios Mesoamericanos y Mexicanos, Centro Universitario de Ciencias Sociales y
Humanidades y Maestra en Ciencias Musicales en el rea de Etnomusicologa. 2Centro Universitario de
Arte, Arquitectura y Diseo, Universidad de Guadalajara. Gregorio Dvila # 68, Col. Artesanos, 44200
Guadalajara, Jalisco y Extremo Norte de la Calzada Independencia s/n, Huentitn El Bajo, 44250
Guadalajara, Jalisco. gastelum@cencar.udg.mx y mgrivera17@hotmail.com
Palabras clave: Arqueologa, etnologa, instrumentos musicales, simbolismo, occidente de Mxico.

INTRODUCCIN fuentes coloniales y de algunos textos


En el mundo social del Mxico prehispnico hubo etnogrficos. En cuanto al presente, la
un instrumento musical, elaborado con caracoles observacin etnogrfica de los rituales religiosos
marinos de gran tamao, cuya vinculacin con el conocidos como danzadas que realizan grupos
cosmos fue de gran importancia. De acuerdo con de danzantes conocidos como concheros,
hallazgos arqueolgicos y la informacin escrita quienes cuentan entre su instrumental simblico
de fuentes coloniales, estas trompetas se con trompetas de caracol marino. Con ellos se
utilizaron tanto en el mundo de los vivos como en utiliz la entrevista, la observacin participante y
el de los muertos. Se sabe de su funcin como los registros grficos, tcnicas que permitieron
ofrendas funerarias, de su vinculacin con las conocer el contexto de utilizacin del instrumento
deidades del viento y de su importancia tanto que nos ocupa, as como su simbolismo e
ritual como militar. Al parecer, ste es uno de los identificacin biolgica.
pocos casos en que el objeto y su contexto no
fueron destruidos por la conquista espaola y el RESULTADOS Y DISCUSIN
proceso de construccin de la nacin mexicana, Las acciones descritas en el apartado previo, dan
ya que existe informacin de que se le contina como resultado la utilizacin de al menos un
utilizando en la actualidad. Ahora, este fenmeno gnero y siete especies en la elaboracin de
ya no es exclusivo de los grupos indgenas, sino trompetas de caracol. El gnero corresponde a
que ha permeado a grupos mestizos que lo Fusinus sp. De las especies, cuatro
recrean en ciertos rituales religiosos. corresponden a la provincia panamea en el
La regin en que se presenta este Pacfico y tres a la caribea en el Golfo de
fenmeno es la que se conoce como el occidente Mxico. Por temporalidad y contexto, iniciando en
de Mxico, regin prehispnica perteneciente al los periodos tempranos, se tienen reportes de
rea cultural mesoamericana, que se conforma hallazgos de dichos instrumentos en los sitios de
con los estados de Michoacn, Colima, Jalisco, El Opeo, en Michoacn, en Huitzilapa y San
Nayarit, Sinaloa y porciones de Guanajuato, Sebastin en Jalisco, as como en Las Cebollas
Zacatecas y Aguascalientes. En la actualidad, se en Nayarit. El ms temprano de stos es el
le identifica como el Centro-Occidente del pas. yacimiento michoacano, donde una Turbinella
En trminos generales, la temporalidad viene angulata form parte de la ofrenda en una tumba
desde la poca prehispnica dividida en tres (Oliveros-Morales 2004). Asociados con las
etapas: Temprano (1500 a. C.- 400 d.C.), Clsico tumbas de tiro, en Jalisco tambin fueron
y Posclsico temprano (400-1100 d.C.) y encontrados como parte de la ofrenda ejemplares
Posclsico tardo (1100-1530 d. C.); la poca de Turbinella angulata, Strombus costatus,
colonial (1530-1821) y Mxico Independiente Strombus peruvianus y Muricanthus nigritus
(1821 a la actualidad). (Long 1966; Lpez-Mestas y Ramos 2000;
Villanueva-Garca et al. 1998). Destaca aqu el
MATERIALES Y MTODOS caso de la formacin de figuras flicas con
La materia prima para la presente descripcin y ejemplares de Fasciolaria princeps y, muy
anlisis fue obtenida mediante dos probablemente, Fusinus irregularis. Durante el
procedimientos. Para el pasado, el principal periodo del Clsico y Posclsico temprano,
procedimiento fue la investigacin bibliogrfica en contina la tradicin de las trompetas de caracol,
dos reas. Por un lado, la revisin sistemtica de pues en Salagua, Colima, se tiene la presencia
los textos disponibles que constituyen el corpus de Strombus galeatus al parecer como ofrenda,
de informacin en torno a la arqueologa del as como elementos que sugieren su elaboracin
occidente de Mxico. Por el otro, la de las en el mencionado yacimiento (Beltrn-Medina

11
Estudios sobre Malacologa y Conquiliologa en Mxico

1991). Otro sitio de esta temporalidad es pueblos de Sayula, Amacueca y Atoyac, los
Tingambato, en Michoacn. All se encontraron indgenas recibieron a Fray Alonso Ponce
ofrendadas en una tumba construida con lajas un visitador franciscano con msica de trompetas y
conjunto de estos instrumentos musicales, chirimas as como bailes a su modo (Ciudad
elaborados con valvas de Turbinella angulata y Real, 1993). Sobre esta referencia, es posible
de Fasciolaria princeps (Pia-Chan y Oi 1982). sealar que si las trompetas y chirimas tambin
Es prudente sealar que esta ltima especie ha son a su modo, las primeras bien pudieron ser
cambiado de nombre, reconocindosele en la elaboradas con caracoles.
actualidad como Pleuroploca princeps (Skoglund, Durante el Mxico independiente se sabe
2002). Tambin en Michoacn se encuentra el de la utilizacin de estos instrumentos musicales
yacimiento de El Otero, en las cercanas del entre los huicholes. Ya desde fines del siglo XIX
poblado de Jiquilpan. Durante las excavaciones se report que servan para llamar a los dioses.
de una construccin prehispnica fueron Eran tocados cinco veces al da y cinco en la
encontradas una serie de ofrendas, entre cuyos noche durante la fiesta denominada de los
elementos estaban conchas marinas. En este tamales de maz crudo (Lumholtz, 1986). Esta
caso las trompetas, identificadas como conchas costumbre se sigue realizando en la actualidad,
del gnero Strombus, de acuerdo con las aunque se seala que queda como
imgenes publicadas al parecer fueron responsabilidad exclusiva del peyotero
manufacturadas con Pleurocopa princeps y con encargado del dios del viento. Adems, se le
Turbinella angulata (Noguera, 1993). En el caso utiliza tambin para acompaar a las procesiones
de la arqueologa, el ltimo periodo prehispnico que se realizan al interior del templo como parte
est ejemplificado por el yacimiento de del rito principal de la celebracin (Neurath,
Huandacareo, asentamiento identificado con los 2002).
tarascos, donde en un entierro fue encontrada En la actualidad, y en un contexto un
una columela de buen tamao, mayor a 18 cm, tanto distinto por ser urbano y mestizo, la
identificada con el gnero Fusinus (Macas- trompeta de caracol sigue siendo utilizada en
Goytia, 1990). Por su tamao y forma, bien ceremonias religiosas de corte catlico. En el
podra corresponder a la especie irregularis, centro-occidente del pas se ha observado en
procedente del Pacfico. fechas como el 3 de mayo, el 12 de octubre y el
Todava con relacin a la poca 12 de diciembre, en donde se celebran
prehispnica, pero derivada de fuentes escritas festividades propias de los grupos de danzantes
coloniales, existe informacin relacionada con los concheros, la romera que acompaa a la virgen
tarascos que nos da luz sobre la utilizacin de las en su retorno al santuario de Zapopan y el
trompetas. La Relacin de Michoacn da cuenta aniversario de la aparicin de la virgen de
que servan, al menos, en ceremonias funerarias Guadalupe. Tambin en fiestas patronales y
especialmente aquellas dedicadas a quienes celebraciones privadas a las que estos grupos
moran en acciones blicas y para llamar a las son invitados.
deidades (Alcal, 1988). Al momento de la La vida ritual de la trompeta de caracol
llegada de los espaoles, formaban parte de las tiene momentos importantes. El primero es su
acciones de guerra, segn se seala en crnicas elaboracin, que corre a cargo del danzante que
escritas por los soldados conquistadores que lo utilizar. Para ello se utilizan conchas a las
formaron parte de las huestes de Nuo de cuales se les haya extrado el molusco,
Guzmn. Se hace referencia que en un pueblo reparndoseles el orificio hecho para ello y
denominado Colombo (o Colomo), ubicado en el cortndoseles el pice. Hasta el momento se han
actual estado de Sinaloa, los conquistadores identificado especimenes del gnero Strombus,
fueron recibidos hostilmente por gente que tena de las especies Strombus gigas y Pleurocopa
una gran grita y taendo atambores bocinas princeps, as como de una concha que los
(Smano, 1963). Durante la poca colonial es propios concheros llaman tritn. El extremo
muy probable que se siguieran utilizando recortado no se deshecha, sino que se utilizar
trompetas de caracol. Aunque no se han para manufacturar un collar que deber llevar
detectados referencias explcitas, existen todo el tiempo sobre su pecho, smbolo de la
descripciones de recibimientos indgenas a promesa efectuada como danzante. Ya en las
dignatarios eclesisticos espaoles donde ceremonias, estas bocinas cumplen varias
pudieran haberse utilizado dichos instrumentos funciones. Sirven para anunciar la llegada del
musicales. Tal es el caso de la cuenca de grupo de danzantes, as como para saludar a la
Sayula, Jalisco, entre 1584 y 1589, donde en los imagen que se va a reverenciar por medio de la

12
Estudios sobre Malacologa y Conquiliologa en Mxico

danza. Igualmente se utilizan para pedir Neurath, J. 2002. Las fiestas de la Casa Grande.
permiso, mediante un saludo a los cuatro puntos Instituto Nacional de Antropologa e Historia y
cardinales. Con ellas tambin se convocan a las Universidad de Guadalajara. 379 p.
nimas de los danzantes ya fallecidos, a las Noguera, E. 1993. Exploraciones en Jiquilpan. En
nimas conquistadoras y a las de los A. Macas Goytia (comp.). La arqueologa en los
antepasados de cada participante en el crculo de Anales del Museo Michoacano (pocas I y II).
danza, mediante cinco toques que son Instituto Nacional de Antropologa e Historia.
distribuidos hacia los puntos cardinales y el Mxico. Pp. 321-365
quinto en el centro y hacia arriba. Al trmino de la Oliveros-Morales, J. A. 2004. Hacedores de
danzada, se agradece a los seres espirituales y tumbas en El Opeo, Jacona, Michoacn. El
se les despide, se saluda de nuevo a los puntos Colegio de Michoacn y H. Ayuntamiento de
cardinales mediante toques de caracol. Con ello Jacona. 281 p.
se cierra el crculo y se agradece el permiso Pia-Chn, R. y K. Oi. 1982. Exploraciones
concedido para efectuar la danza. arqueolgicas en Tingambato, Michoacn.
Como se puede apreciar, a lo largo del Instituto Nacional de Antropologa e Historia.
tiempo la trompeta de caracol ha tenido tres Mxico. 101 p.
funciones bien establecidas en el occidente de Smano, J. 1963. Relacin de la conquista de los
Mxico. Est vinculada con la muerte, pues ha Teules Chichimecas que dio el Capitn de
servido como ofrenda funeraria y se le utiliza Emergencia Juan de Smano. En Crnicas de
para llamar a las nimas de los difuntos. Es la conquista del reino de Nueva Galicia en
objeto de guerra, ya que se le utiliz en el campo territorio de la Nueva Espaa. H. Ayuntamiento
de batalla y para honrar a los guerreros muertos. de la ciudad de Guadalajara e Instituto
Tambin une a los humanos con las deidades, Jalisciense de Antropologa e Historia.
puesto que sirve para llamarles, pedirles permiso Guadalajara. pp 115-152
y agradecerles su participacin en determinados Skoglund, C. 2002. Panamic province Molluscan
rituales. Aunado a lo anterior, tiene claras ligas literatura. Additions and changes from 1971
con la fertilidad, tal como se demuestra en la through 2001. III Gastropoda. The Festivus 32
tumba de Huitzilapa. (Supplement). 286 p.
Villanueva-Garca, G., J. Manrique Eternod y M.
LITERATURA CITADA L. Lpez-Mestas C. 1998. Especies marinas
Alcal, J. 1988. La Relacin de Michoacn. ofrendadas en la tumba de tiro de Huitzilapa. En
Secretara de Educacin Pblica. Mxico. 372 R. vila et al. (Eds.). El occidente de Mxico:
p. arqueologa, historia y medio ambiente.
Beltrn-Medina, J. C. 1991. Los concheros del Perspectivas regionales. Universidad de
puerto de Salagua (Playa del Tesoro). Tesis de Guadalajara y ORSTOM. Guadalajara. Pp. 277-
Licenciatura. Escuela Nacional de Antropologa 286.
e Historia. Mxico
Ciudad Real, A. 1993. Tratado curioso y docto de
las grandezas de la Nueva Espaa. UNAM.
Mxico. 2 vols.
Long, S. V. 1966. Archaeology of the Municipio of
Etzatlan, Jalisco. Ph. D. dissertation. University
of California at Los Angeles. 309 p.
Lpez-Mestas C., L. y J. Ramos. 2000. La
excavacin de la tumba de Huitzilapa. En R. F.
Townsend (ed.). El antiguo occidente de
Mxico. Arte y arqueologa de un pasado
desconocido. The Art Institute of Chicago,
Secretara de Cultura del Gobierno de Jalisco y
Tequila Sauza, S. A. pp. 57-74
Lumholtz, C. 1986. El arte simblico y decorativo
de los huicholes. Instituto Nacional Indigenista.
Mxico. 402 p.
Macas-Goytia, A. 1990. Huandacareo: Lugar de
juicios, tribunal. Instituto Nacional de
Antropologa e Historia. Mxico. 222 p.

13
Lpez-Garrido, P. H. 2007. Moluscos arqueolgicos de Punta Mita, Nayarit, Mxico: Taxonoma y cambios ecolgicos. pp 14-16. En: Estudios sobre la
Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286
p.

MOLUSCOS ARQUEOLGICOS DE PUNTA MITA, NAYARIT, MXICO: TAXONOMA Y CAMBIOS


ECOLGICOS

Lpez-Garrido, Pedro H.
Instituto Nacional de Antropologa e Historia / Subdireccin de Arqueologa Subacutica
Seminario No.8 primer piso colonia Centro C. P. 06060 Mxico, D. F. plopezgarrido@gmail.com
Palabras clave: Moluscos, arqueologa, Punta Mita, Nayarit, Taxonoma, Ecologa.

INTRODUCCIN taxonmica en cada loma y capa. En el caso de


La existencia de concheros o sitios en donde los pelecpodos, todas las valvas se encontraron
hay una gran acumulacin de conchas, se desarticuladas, por lo que se adopt el criterio
explica la mayora de las veces gracias al seguido por Garca-Cubas (1963), en donde se
consumo humano. Como consecuencia, en los considera cada valva como un organismo.
litorales de nuestro pas, se halla una gran
abundancia de concheros de importancia RESULTADOS
arqueolgica producto del consumo humano a Para ambas lomas se identificaron un total de 31
travs del tiempo. Si bien este tipo de materiales especies de moluscos pertenecientes a las
son de origen biolgico, tambin representan clases PELECYPODA Y GASTROPODA
parte de nuestro patrimonio cultural, razn por la agrupadas en 20 familias. La clase
cual, su proteccin, conservacin, investigacin y PELECYPODA con 15 especies (52%) y la case
difusin es importante. GASTROPODA con 16 especies (48%) (Figura
El material arqueozoolgico proviene de 1).
Punta Mita, Nayarit en el occidente de Mxico.
Los trabajos arqueolgicos de excavacin se ABUNDANCIA RELATIVA POR

concentraron en dos zonas, el sitio Loma de GRUPO TAXONMICO

Carreyeros y el rea denominada Los


Ranchos. sta ltima se extiende desde poblado
de Emiliano Zapata hasta Punta Pontoque. Las
conchas de los moluscos identificados en el PELECYPODA PELECYPODA
GASTROPODA
presente estudio provienen del rancho nmero 43%
57% GASTROPODA

siete, el cual presenta un sistema de tres lomas


que para su identificacin fueron numeradas
progresivamente con los nmeros del uno al tres.
Las lomas analizadas fueron la nmero uno y
dos. Figura 1.- Riqueza especfica del material
analizado
MATERIALES Y METODOS Se cuantificaron un total de 238 ejemplares, de
Para fines de este estudio no se pretende definir los cuales 136 corresponden a la clase
la metodologa de la excavacin arqueolgica. La PELECYPODA y representan el 57.1%, mientras
identificacin de los ejemplares se realiz de que los 102 ejemplares de la clase
acuerdo a las claves taxonmicas de Keen, GASTROPODA representan el 42.9% del total
(1971), Abbott, (1974) y Morris, (1996), (Figura 2).
estableciendo para la mayora de los ejemplares
la especie. En los casos en que lo anterior no fue TOTAL DE ESPECIES POR
GRUPO TAXONMICO
posible debido al estado de conservacin del
material, la identificacin se realiz al nivel
taxonmico de gnero.
Como resultado de la identificacin GASTROPODA
PELECYPODA PELECYPODA
52%
taxonmica se obtuvo informacin acerca de la 48% GASTROPODA

distribucin y hbitat de cada una de las


especies. Asimismo, los ejemplares fueron
medidos con vernier de una precisin de 0.1
milmetros y su talla registrada, considerando en
el caso de los gasterpodos la altura y en los
Figura 2.- Abundancia relativa por clase
pelecpodos la longitud. Finalmente, se cuantific taxonmica
el nmero de ejemplares por especie y familia

14
Estudios sobre Malacologa y Conquiliologa en Mxico

La especie ms abundante result ser dicha clase. Es decir, debido a que no es


Argopecten circularis con 55 ejemplares y conveniente articular valvas aisladas, cada una
representa el 23% del total identificado. de las mismas fue considerada como un
Para la loma nmero uno se identificaron organismo, elevndose por consecuencia la
ocho especies, dos de ellas pertenecientes a la proporcin real de los pelecpodos.
clase PELECYPODA y seis a la clase Las especies ms abundantes dentro del
GASTROPODA. En total se cuantificaron doce material en estudio son: Argopecten circularis,
ejemplares. Cabe sealar que en la capa I no se Cardita (Byssomera) affinis y Cerithium
encontraron organismos, por lo que los doce (Thericium) maculosum. stas representan en
ejemplares hallados pertenecen a la capa II conjunto ms del 50 por ciento del total de
(Figura 3). ejemplares analizados. En la actualidad, dichas
Para la loma nmero dos se identificaron especies son consumidas en el rea en primer
32 especies, 19 de ellas pertenecen a la clase trmino como alimento y su concha empleada en
PELECYPODA y trece a la clase la fabricacin de algunos ornamentos como
GASTROPODA. En total se cuantificaron 226 collares.
ejemplares. En la capa I se hallaron 22 Los datos biolgicos por si mismos,
ejemplares, mientras que en la capa II, 204 ofrecen una menor cantidad de informacin para
ejemplares (Figura 3). la interpretacin arqueolgica, por lo cul es
primordial determinar el contexto de su
ABUNDANCIA DE ESPECIES POR LOMA Y CAPA
recuperacin y la asociacin del mismo (Gmez,
1996).
Conforme a lo anterior, se han propuesto
250

225 22
cinco tipos de contextos arqueolgicos a los que
200 se pueden asociar los concheros, stos son, de
175

150
relleno, entierro, rea de cementerio, juego de
Nm ero de
especies
125
204
Capa I pelota y complejo ceremonial (Feldman, 1976).
Capa II
100

75
En este sentido, los restos arqueolgicos de
50 moluscos analizados en el presente estudio,
25 0
12 parecen no tener ninguna asociacin directa con
0
Lom a 1 Lom a 2 los diversos objetos hallados en el rea tales
Lom a
como, navajillas de obsidiana, anzuelos, as
como con los cuatro entierros descubiertos. Por
Figura 3.- Riqueza especfica por loma y capa tal razn, se les relaciona con material de
desecho o de relleno. Es decir, parecen ser los
Anlisis: Los moluscos arqueolgicos restos de moluscos consumidos y su concha
analizados en el presente estudio, continan desechada en los mismos sitios.
siendo objeto de discusin por parte de Por otra parte, las diferencias observadas
arquelogos respecto a la asociacin que en cuanto a la diversidad de especies y
presenta con alguna de las culturas que abundancia entre ambas lomas, as como entre
habitaron el occidente de Mxico. No obstante, las capas estratigrficas reportadas,
los resultados obtenidos en este trabajo, aportan posiblemente esta relacionada con el tiempo de
informacin que puede ser empleada en la permanencia u ocupacin de estas reas, as
investigacin arqueolgica y el conocimiento de como a la intensidad de la actividad humana en
los recursos naturales que fueron aprovechados cada una de ellas. No obstante, hay que
por las poblaciones humanas que habitaron esta considerar que las diferencias observadas en la
rea. El anlisis taxonmico de los restos de abundancia de especies entre las dos capas de
moluscos arqueolgicos procedentes del rancho ambas lomas, tambin puede deberse al proceso
nmero siete, muestra dos clases de moluscos natural de erosin y degradacin de las conchas
que son PELECYPODA y GASTROPODA. de los moluscos.
Al parecer no se encontr un dominio Por lo que se refiere a la distribucin
evidente de alguna de las dos clases geogrfica sealada por Keen, (1971) para los
taxonmicas en cuanto a la diversidad de moluscos identificados en el presente estudio, se
especies. No obstante, la clase PELECYPODA encontr que todas las especies pertenecen a la
presenta un ligero domino en abundancia, provincia malacolgica Panmica y se distribuyen
atribuida al criterio adoptado para la de manera natural en el litoral Pacfico a lo largo
cuantificacin de los ejemplares pertenecientes a de la costa.

15
Estudios sobre Malacologa y Conquiliologa en Mxico

Sin embargo, cabe sealar que la realicen una mayor cantidad de trabajos de este
especie identificada como Noetia sp1 en el tipo y que permitan evidenciar diversos aspectos
presente trabajo, es muy semejante a Noetia como son las variaciones en las tallas de los
magna. A pesar de lo anterior, no pudo ser organismos debido a posibles causas
confirmada su identificacin debido al estado de antropognicas o ambientales. No obstante, la
conservacin del ejemplar encontrado. Lo informacin obtenida nos brinda una primera
anterior es significante, puesto que, si Noetia sp1 aproximacin al estudio de este fenmeno y
resulta ser Noeta magna, sta ltima reportada evidencia un aspecto sobre el cual muy poco se
por Roth (Keen, 1971), como fsil en la zona de ha estudiado en el contexto arqueolgico.
distribucin comprendida de Nicaragua a
Ecuador y su distribucin actual comprende LITERATURA CITADA
desde Ecuador hasta Per; podemos inferir que Abbott R. T. 1974. American sea shells. 2a. Ed.,
el intervalo de distribucin de las especies ha Van Nostrand Reinhold Company. New York.
cambiado, seguramente influenciado en gran 663 p.
parte por las condiciones ambientales y los Feldman, H. L. 1976. Greater Nayarit
cambios climticos que han sucedido a lo largo archaeological molluscs and archaeo-
de la historia de nuestro planeta. molluscan units in Northern Mesoamerica, en
Entre la diversidad de hbitat Clement W. Meighan (Ed.), The archaeology
reconocidos para todas las especies de moluscos Amapa, Nayarit, Col. Monumenta
identificadas en este estudio, se encuentran Archaeologica, nm. 2, University of California
costas rocosas, playas arenosas en la franja de at Los Angeles, Los Angeles, pp.163-181.
marea, fondos arenosos, fangosos o con Garca-Cubas, A. 1963. Sistemtica y
guijarros, arrecifes, ros, manglares y lagunas distribucin de los moluscos de la Laguna de
costeras; desde lugares someros cercanos a la Trminos, Campeche, Mxico. Bol. Inst. Geol.
orilla hasta aguas ms profundas lejanas de la 67(4): 1-55. UNAM / Mxico.
costa. Esto ha permitido definir en repetidas Gmez, G. L. 1996. El valor de la concha en
ocasiones el lugar de origen de las conchas, Mesoamrica Noroccidental. Revista Estudios
propiedad que ha sido empleada en el contexto del Hombre (4): 165-183.
arqueolgico para sugerir zonas de colecta, Keen, M. A. 1971. Sea shells of tropical West
lugares de consumo, rutas hacia la costa, America: mollusk from Baja California to Peru,
etctera. 2a. Ed. Stanford University Press. Stanford
Se midieron los ejemplares de ambas California. 1065 p.
lomas, encontrndose diversas conchas Morris, P. 1996. A field guide to pacific coast
pertenecientes a ocho especies que muestran shells. 2a. Ed. Houghton Mifflin Co. USA. 297
dimensiones mayores en relacin a las p.
sealadas por Keen, (1971). Dichas especies
son: Glycymeris (Axinactis) delessertii,
Argopecten circularis, Cardita (Cardites)
crassicostata, Periglypta multicostata, Collisella
discors, Turritella banksi, Strombus (Strombus)
gracilior y Conus (Conus) princeps.
Con el objeto de tratar de explicar la
presencia de conchas en contextos
arqueolgicos con dimensiones mayores a las
encontradas actualmente, podemos inferir al
respecto, que las diversas poblaciones humanas
precolombinas debieron realizar un
aprovechamiento menos intenso de los recursos
malacolgicos en comparacin con la explotacin
actual. Esto pudo permitir que los individuos
alcanzaran tallas mayores a las que hoy en da
es posible hallar.
A pesar de lo anterior, las dimensiones
de los moluscos que aparecen en el contexto
arqueolgico, es un tema al cual se le ha puesto
muy poca atencin. Por ello, es necesario se

16
Sols-Ciriaco, R. B. 2007. Los moluscos arqueolgicos de Teopantecuanitln, Guerrero. pp 17-19. En: Estudios sobre la Malacologa y Conquiliologa
en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

LOS MOLUSCOS ARQUEOLGICOS DE TEOPANTECUANITLN, GUERRERO

Sols-Ciriaco, Reyna Beatriz


Poyecto Tcnicas de Manufactura de los Objetos de Concha del Mxico Prehispnico Museo del Templo
Mayor, Instituto Nacional de Antropologa e Historia. Seminario 8, Col. Centro, Del. Cuauhtmoc, Mxico
D. F., C. P. 06060. reynabsolis@hotmail.com
Palabras clave: Moluscos, arqueologa, taxonoma, Teopantecuanitln, Formativo.

INTRODUCCIN divididas en 140 completas y 645 fragmentos de


Desde las sociedades del Periodo Formativo las clases Bivalvia y Gastropoda, recuperado de
(1400-600a.C.) en Mesoamrica ya destacaban las diversas temporadas de excavacin, las
la exaltacin personal entre los aspirantes al cuales empezaron en 1983 como un rescate que
prestigio y al poder, el surgimiento de un posteriormente se convirti en un proyecto de
gobierno ms centralizado y una organizacin investigacin (Martnez, 1991).
social menos igualitaria; dichos aspectos se La identificacin taxonmica de los
relacionaban con el parentesco por herencia, lo especimenes biolgicos se llev a cabo mediante
cual conduca hacia una estratificacin social o la consulta de manuales correspondientes a las
de clases (Clark, 1994). provincias malacolgicas Panmica (Keen,
Un factor de gran relevancia para la 1971), Caribe (Abbott, 1982), as como de
justificacin del prestigio y el poder de la moluscos dulceacucolas (Von Martens, 1901) y
jerarqua social en vigor eran los bienes de terrestres (Fischer, 1978). Se cont tambin con
prestigio. Estos en su mayora se caracterizan las valiosas asesoras de las bilogas Belem
por ser materiales exticos o de circulacin Ziga Arellano, Norma Valentn Maldonado y
restringida, aunque podan ser producto de Adrin Velzquez Castro.
comercio externo que funcionaba como smbolos Cabe sealar que las piezas han sido
de estatus para la elite (Druker, 1981). divididas de acuerdo con su morfologa en
Un ejemplo de justificacin de prestigio y trabajadas y no trabajadas; de las cuales 199
poder lo encontramos en uno de los ejemplares no tienen modificacin cultural, (de
asentamientos ms antiguos de Mesoamrica, estos 20 completos y 179 fragmentos). Contamos
Teopantecuanitln, sitio con caractersticas tambin con 429 fragmentos, que al parecer eran
olmecas, ubicado en la regin centro-este del desechos de produccin, estos presentan
estado de Guerrero, al sur de un extenso valle indicios de haber sido desgastados, cortados y/o
intermontano del municipio de Copalillo y cerca perforados y calados. As mismo, hay 24 objetos
de donde los ros Mezcala y Amacuzac automorfos, (18 completos y 6 fragmentos) es
convergen y dan origen al ro Balsas (Martnez- decir, que conservan la forma natural del
Donjuan, 1994). Su ocupacin de acuerdo con espcimen biolgico del que se manufacturaron;
los fechamientos de Carbono 14, abarca desde el y 132 piezas xenomorfas, ya que su figura es
Ao 1400 hasta el 600 a.C. (Martnez-Donjuan, diferente a la de la concha de la que se
1995). obtuvieron (Surez-Diez, 1977), de estas 85
Es de este sitio, donde procede la completos y 47 fragmentos.
coleccin malacolgica ms antigua recuperada Estos objetos pertenecen a diversos
en Mesoamrica, la cual es el objeto principal de contextos; algunos de ellos, especialmente las
esta investigacin, dichos ejemplares fueron evidencias de produccin, se encontraron
encontrados modificados para servir como bienes agrupadas en reas determinadas, mientras que
de prestigio exticos y de acceso restringido. los objetos terminados pertenecieron a tumbas y
En este texto nos enfocaremos al estructuras arquitectnicas.
estudio taxonmico llevado a cabo en el
material, mediante este estudio pudimos conocer RESULTADOS Y DISCUSIN
los gneros, especies y provincias malacolgicas La identificacin taxonmica dio como resultado
de procedencia de los moluscos, as como, las 32 especies, de las cuales, 18 son de
especies mas preciadas para manufacturar los gasterpodos y 14 de pelecpodos. Cabe sealar
bienes de prestigio de Teopantecuanitln. que al ordenar las Familias nos basamos en la
clasificacin de moluscos de Cunningham,
MATERIALES Y MTODOS (1989).
La coleccin de moluscos arqueolgicos de En relacin con estos resultados,
Teopantecuanitln, consta de 785 piezas, pudimos identificar las zonas de obtencin de los

17
Estudios sobre Malacologa y Conquiliologa en Mxico

moluscos. En su mayora pertenecen a la Clark, J. E. 1994. Antecedentes de la cultura


Provincia Panmica, la cual comprende desde el Olmeca. En: Los olmecas en Mesoamrica,
sur del Golfo de California hasta en norte de John E. Clark Coordinador. El equilibrista
Per; en menor cantidad corresponden a la Mxico, Turner Libros Madrid, Citibank, Mxico.
Provincia Caribea, la cual se extiende desde el pp. 31-41.
Golfo de Mxico, Florida, Las Antillas, Mar Cunningham V. K. 1989. A Classification of the
Caribe, Venezuela y Brasil (Velsquez-Castro, et living Mollusca. Edited by R. Tucker Abbott and
al.,, 2004). Tambin se identific una especie Kenneth J. Boss, American Malacologist, Inc.
dulceacucola cuyo hbitat ocupa los ros de la Melbourne, Florida.
Vertiente del Pacfico (Von Martens, 1890-1901, Drucker, P. 1981. On the nature of olmec polity.
Fischer, 1978), por lo cual pudo haber sido En: The Olmec and Their Neighbors, Essays in
recolectado en el ro Balsas y finalmente hay dos Memory of Matthew W. Stirling, Michael D. Coe
ejemplares de hbitat terrestre arbreo. and David Grove, Organizers, Elizabeth P.
As, de los 635 ejemplares de Benson, Editor. Dumbarton Oaks Research
Pelecpodos, 520 pertenecen a la Provincia Library and Collections, Trustees for Harvard
Panmica, 2 a la Provincia Caribea y 110 son University, Washington, D.C. pp. 29-48.
de origen dulceacucola; un ejemplar que Fischer Et H. C. 1978. Etudes Sur Les
corresponde al gnero Mercenaria sp., est Mollusques Terrestres, Et Fluviatiles Du
presente en ambas provincias y 2 ejemplares no Mexique et du Guatemala.
se pudieron identificar, pues slo sabemos que Keen, M. A. 1971. Sea shells of tropical West
pertenecen a las familias Veneridae y Mactridae America. Stanford University Press, Stanford.
respectivamente Martnez Donjuan, G. 1991. Teopantecuanitln.
De los 149 moluscos de Gasterpodos, Consejo de Arqueologa, Boletn.
131 pertenecen a la Provincia Panmica, 10 a la CONACULTA-INAH, Mxico. pp. 185-189.
Caribea y 9 ejemplares no fue posible identificar Martnez-Donjuan, G. 1994. Teopantecuanitln:
su especie. Hallazgos recientes. Memoria III, Congreso
Esta informacin nos permite suponer interno del centro INAH Morelos a los XX aos
que el sitio de Teopantecuanitln tena mayor de su fundacin, en recuerdo de Guillermo
control o ms facilidad para la obtencin de Bonfil Batalla y Juan Dubernard Chauveau.
especies malacolgicas provenientes del Ocano Acapatzingo, Cuernavaca, Morelos, pp. 77-86.
Pacfico, posiblemente de las playas del actual Martnez-Donjun, G. 1995. Teopantecuanitln,
estado de Guerrero. Sin embargo, es importante en Arqueologa Mexicana, Marzo-Abril 1995,
sealar el difcil acceso a estas desde el sitio, Volumen II, Nmero 12, Races, Mxico. Pp 58-
debido a que Teopantecuanitln se encuentra en 62.
la montaa, siendo la ruta para llegar a la costa Surez-Diez, L. 1977. Tipologa de los objetos
sumamente accidentada. La ruta ms viable y prehispnicos de concha. Mxico, INAH
ms corta (180 kilmetros aproximadamente), es (Coleccin Cientfica no. 54).
siguiendo los cauces de los ros Amacuzac y Velsquez-Castro A., Ziga-Arellano, B. y
Mezcala, ambos muy cercanos al sitio, a travs Valentn-Maldonado, N. 2004. Ofrendas de
de los cuales se puede acceder al ro Balsas, el Concha, Tesoros de Fertilidad, CONACULTA,
cual desemboca en el Pacfico, entre Michoacn INAH, MTM, Mxico.
y Guerrero. Von Martens, E. 1890-1901. Biologia Centrali
Al parecer las especies ms abundantes Americana, Land and Freshwater Mollusca.
para la fabricacin de bienes de prestigio en
Teopantecuanitln pertenecen a la Provincia
Panmica, aunque la cantidad de especies del
mar Caribe es bastante reducida (12 ejemplares),
la localizacin de stas en el sitio es muy
interesante, ya que los objetos aparecen en
contextos de produccin, de tumba y asociados a
estructuras arquitectnicas.

LITERATURA CITADA
Abbott, R. T. 1982. Kingdom of the seashell.
Bonanza Books, Nueva York.

18
Estudios sobre Malacologa y Conquiliologa en Mxico

BIODIVERSIDAD

19
Rivera A. M. 2007. Gastrpodos terrestres de El Salvador. pp 21-22. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M.
C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

GASTROPODOS TERRESTRES DE EL SALVADOR

Rivera Ana Mara


Museo de Historia Natural de El Salvador. Consejo Nacional para la Cultura y el Arte CONCULTURA.
Final calle Los viveros, Colonia Nicaragua, San Salvador, El Salvador. C. A. anadararivera@yahoo.com.
Palabras clave: Gastrpodos, El Salvador, moluscos terrestres.

INTRODUCCIN 689 msnm, en suelos con materia orgnica


Los primeros estudios de malacologa, en El abundante, zonas sombreadas. Escultura de la
Salvador, iniciaron en el rea marina, con los concha lisa, la mayora de especies con bandas,
trabajos de Schuster, 1952 y Zilch, 1954 con su oscuras horizontales y algunos con bandas en
trabajo Moluscos Litorales y los que habitan en zigzag transversales, colectado en Parque Nac.
Manglares. En 1957 se registraron las primeras El Imposible (Ahuachapn) vegetacin bosque de
investigaciones hechas en moluscos terrestres Galera, caducifolio, recuperado en un 90%;
realizadas por el Dr. Thompson, en la zona de Montaa de Cinquera vegetacin secundaria en
Montecristo y otras reas en altitudes de 2200 proceso de recuperacin encontrado entre la
mts., en este trabajo se registraron muchas hojarasca de chaparrales y morrales; Parque
nuevas especies entre ellas Amphicyclotus Nac. Walter Thilo Denninger ubicado en la costa
parvus, eucalodium australis. En la dcada de los litoral del pas (La Libertad) bosque de galera,
70s se reinicia la investigacin, con las Ro Sapo (Morazn) vegetacin secundaria en
recolectas que realizara el Lic. Marco Hernndez proceso de recuperacin, Isla Zacatillo,
en varios puntos de la costa salvadorea, con la vegetacin secundaria perturbada y zonas de
colaboracin de investigadores del Cuerpo de cultivo, Isla Martn Prez, vegetacin de
Paz, obteniendo como resultado, la conformacin Chaparral (La Unin) y en zona urbana.
de la coleccin de moluscos que resguarda Subulina, Humboldtiana colectado en
actualmente el Museo de Historia Natural bosques de roble con suelos muy ricos en
(MUHNES), la cual permaneci sin movimiento materia orgnica con poca penetracin de luz y
en los aos 80s a causa del conflicto armado sobre musgo a una altura de 2700 msnm, se
que sufriera el pas, en 1998 de nuevo se caracterizan porque su concha de color oscuro
trabaja en el rea marina, y a partir del 2002 se translucido. Cerro El Pital (Chalatenango)
da la apertura a las recolectas de gasterpodos Euglandina. Concha de color rosado
terrestres; identificando hasta el momento 15 finamente estriada, recolectada sobre rbol en
gneros, con 13 especies. cercana de ro, en reas muy sombreadas de
Descripcin de algunos gneros: Las vegetacin arbustiva, vistos en horas de poca
recolectas se han realizado en varios puntos del exposicin solar.
pas, abarcando las 3 zonas occidente, central y Streptostyla en vegetacin de pino y
oriente, la mayora de sitios se encuentran dentro roble en zonas altas a altitudes de 2600 msnm,
del Sistema de reas Naturales Protegidas. El Cerro El Pital y en Laguna el Jocotal a 600
rango de elevaciones de los sitios de recolecta msnm en la zona central (Chalatenango) y al
oscila entre los 60msnm hasta los 2700 msnm oriente del pas (San Miguel).
aproximadamente, se ha trabajado en la poca Neocyclotus el genero ms comn,
lluviosa, que comprende los meses de julio a encontrado en la mayora de las reas trabajadas
octubre, y otras en poca seca de diciembre a desde los 4 msnm hasta los 800 msnm, en zonas
abril. de poca y abundante penetracin de luz, entre la
Helicina? una protoconcha blanquecina, hojarasca en descomposicin, fue uno de los
con una escultura lisa, color del fondo de la gneros reportados por Dr. Thompson.
concha caf a amarillento. Se le encontr entre Recolectado en Montaa de Cinquera, Ro Sapo,
la hojarasca de un Bosque Hmedo Subtropical, Volcn de Conchagua, Isla Zacatillo, Isla Martn
en Cerro Campana del Parque Nacional El Prez.
Imposible, ubicado al occidente del pas en Otostomus colectado solamente a
departamento de Ahuachapn. alturas de 800 msnm, zonas cubiertas por
Orthalichus, es uno de los gneros abundante vegetacin y poca penetracin de luz.
recolectados hasta el momento que se reportan Bulimulus recolectado en zonas bajas
con longitudes que sobrepasan los 50mm, ya que con alturas aproximadas de 70 msnm, en zonas
la mayora oscilan entre 5mm y 30mm, muy de vegetacin arbustiva, organismos entre 10 y
adaptado a diferentes altitudes entre 66 msnm y

21
Estudios sobre Malacologa y Conquiliologa en Mxico

15 mm de longitud en Laguna El Jocotal, Isla


Zacatillo.
Pachychilus encontrado solamente en
ros de agua limpia, zonas sombreadas, entre
hojas o adheridos al piso arenoso alturas de 843
(Morazn) y (Chalatenango).

Mapa. Ubicacin reas de recolecta.

Listado de Gastropodos recolectados en El


Salvador desde el ao 2002 a la actualidad:

Succinea sp
Euglandina sp
Sonorella sp
Pallifera sp
Bulimulus Umbraticus sp
Subulina octona
Streptostyla sp
Humboldtiana sp
Glandina sowerbyana
Orthalichus ponderosus
Glandina filosa
Otostomus moritonotus
Glandina conularis
Orthalicus princeps
Physella squalida
Neocyclotus diponi
Pachychilus larguillierti
Pachychilus chrisalis
Melanoides tuberculata
Helicina ghiesbregthi?

LITERATURA CONSULTADA
Neil E. F. 2003. Clave de los gneros de
moluscos terrestres mexicanos usando
caracteres conquiolgicos. Rev. Biologa
Tropical 51 (Suppl. 3): 473-482.
Von Martens E. 1890-1901. Land y Freshwater
Mollusca. En. Biologa Centrali-Americana.
Godman & Salvin (Eds.) Taylor & Francis,
London. Pp 1-706.

22
Granados-Andrs, A., J. L., Ramos-Palma y E. P., Jurez. 2007. La fauna Gastropoda del sistema lagunar Carmen-Pajonal-Machona, Cardenas
Tabasco, Mxico. pp 23-25. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-
Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

LA FAUNA GASTROPODA DEL SISTEMA LAGUNAR CARMEN-PAJONAL-MACHONA,


CARDENAS TABASCO, MEXICO.

Granados-Andrs, Arturo1, Ramos-Palma, Jos Lus y Jurez-Ernesto, Pablo


Departamento de Hidrobiologa. Divisin Acadmica de Ciencias Biolgicas. Universidad Jurez
Autnoma de Tabasco.
Palabras clave: Fauna, gastropodos, Cardenas, Pajonal, Machona, Tabasco,

INTRODUCCIN utiliz el modelo o cuadrante de Olmstead y


El Golfo de Mxico tiene 29 lagunas costeras de Tukey (O-T), citado por Steel y Torrie (1988), la
las cuales seis se localizan en el Estado de cual nos permiti establecer cuatro categoras
Tabasco (Contreras, 1985) las cuales son: ecolgicas, y se ubicaron las especies como:
Carmen-Pajonal-Machona, laguna Tupilco, Del dominantes, constantes, ocasionales y raras por
Ostin, Arrastradero y Mecoacn. Estas lagunas su abundancia y distribucin en la laguna.
se caracterizan por contar con una alta Para el anlisis ecolgico de la poblacin
productividad biolgica, que se refleja en la de Gasterpodos la diversidad (H) y la
captura de especies de importancia comercial; y equitatividad (E), se calcul con el programa
cumplen una funcin ecolgica importante al Programs For Ecological Methodology (Krebs,
servir como reas de reproduccin para 2000). Y para la riqueza de especies se utiliz el
diferentes especies marinas, adems son zonas modelo de ndice de Margalef (DMg) (Moreno,
importantes para el reclutamiento y exportacin 2000).
de nutrimientos y materia orgnica hacia la zona
marina adyacente (Gold, 1993). Por lo anterior la RESULTADOS Y DISCUSIN
presente investigacin pretende conocer y Se capturaron un total de 1915 organismos que
determinar la composicin y estructura de la corresponden sistemticamente a 1 clase, 14
comunidad de gasterpodos del sistema lagunar familias, 16 gneros, 15 subgneros y 23
Carmen-Pajonal-Machona. especies.
De acuerdo al modelo estadstico no
MATERIALES Y MTODOS paramtrico de cuadrante de Olmstead Tukey
Se establecieron 16 localidades de muestreo en se determin la distribucin y abundancia de las
el sistema lagunar. Los muestreos se llevo a especies de gasterpodos.
cabo durante un ciclo anual cubriendo la Dominante. Fueron las especies: Nassarius
temporada climtica de la regin norte, seca y (Nassarius) acutus, N. (Nassarius vibex y
lluvia. El traslado a cada una de las localidades Cirithidea (Cerithideopsis) pliculosa, las cuales
se realiz por medio de una lancha de fibra de presentan los valores ms altos de abundancia y
vidrio con motor fuera de borda. distribucin en 14 a 16 localidades.
Se emplearon tres mtodos de colecta Ocasional. Este grupo esta integrado por 8
uno fue el una draga tipo Van Veen, con especies Neritina virginea y Phos candei el se
capacidad de 3 litro .el segundo fue una red de colectaron entre 12 a 13 localidades y las
arrastre tipo camaronera de 12 metros de largo y especies Acteocina canaliculata, Melongena
10 de boca y se arrastr durante 10 minutos , el melongena, N. reclivata, P. unicinctus, Anachis
tercero fue una Red renfro de 60 cm. de semiplicata, Seila adamsi, distribuyeron en 6 a 8
longitud, con boca de 23x48 cm y luz de malla de localidades.
1.25 cm y se arrastro durante 5 minutos y Rara. Este grupo esta formado por 12 especies
posteriormente las muestras fueron colocadas en Cerithiopsis emersoni, Urosalpinx tampaensi,
bolsas de polietileno y debidamente etiquetadas Bulla striata, Odostomia laevigata, O. impressa,
con los datos respectivos (localidad, da, mes y Anachis avara, A. obesa, Turbonilla abrupta,
ao), y se fijaron con formol al 10% neutralizado Thais haemastoma floridiana, Natica pusilla,
con borato de sodio para su posterior anlisis en Olivella nivea y O. minuta que solamente se
el laboratorio de hidrobiologa. presentaron de 1 a 4 localidades.
Anlisis de datos: La relacin de los parmetros Constante. No se present ninguna especie para
fsico-qumicos con la abundancia de los este cuadrante.
gasterpodos se llev a cabo mediante el mtodo Diversidad. La diversidad de especies por
de regresin lineal y mltiple utilizando el localidad fue de 3.3 siendo esta la mayor
programa de STAGRAPHICS 2000. para la representada en la localidad 15, seguidas por la
distribucin y abundancia de los gasterpodos se localidad 10 y 14 con 2.6 bits/individuo. y la

23
Estudios sobre Malacologa y Conquiliologa en Mxico

localidad que presento menor diversidad fue la gasterpodos pueden variar como respuesta por
16 con 0.6 bits/individuo. los cambios de los factores del medio ambiente.
La diversidad en el sistema lagunar se De acuerdo al criterio de Gonzlez
distribuy de 2.7. para la laguna La Machona, (1989) en el presente estudio se registran 3
1.7. para El Pajonal y 1.6 bits/individuo. para la localidades con diversidad baja con un intervalo
laguna El Carmen. de 0.69-1.47 bits/individuo de las cuales 2 de
Riqueza especifica. El valor mnimo fue de 0.5 ellas encontradas en la laguna la Machona, esto
encontrado en la localidad 16 ubicado en el debido a que es la laguna mas cerca del puerto
centro de la laguna La Machona, el valor mximo de Snchez Magallanes pudindose deber esto a
fue de 3.6 bits/individuo en la localidad 15 una alteracin al sistema por medio de una
ubicada en la Boca de Panteones actividad humana o tambin por la contaminacin
En cuanto para las lagunas se distribuyo que ocasionan los habitantes de esa comunidad,
de 2.2 para la El Carmen, 1.3 en El Pajonal y 3.2 impidiendo as que estos organismos puedan
bits/individuo en la laguna La Machona. refugiarse all.
Equitatividad. El valor mximo fue localizado en Se encontraron 9 localidades con
la localidad 7 ubicado por la Boca de Santa Ana diversidad media de 1.47-2.23 bits/individuo y 4
con un valor de 0.7 y la mnima se determin en localidades con diversidad alta con intervalos de
la localidad 6 localizado en el centro de la laguna 2.24-3.01 bits/individuo los cuales son la
El Carmen con un valor de 0.1 bits/individuo. localidad 7 localizado cerca de la Boca de Santa
Para las lagunas fue de 0.1 para El Carmen, 0.3 Ana en la laguna El Carmen, la localidad 10, 14 y
El pajonal y 0.2 bits/individuo para La Machona. 15 en la laguna La Machona las dos ultimas
Estadsticamente los valores de los localizado en la Boca de Panteones donde fluye
parmetros ambientales (temperatura, salinidad, una gran cantidad de agua marina.
Oxgeno disuelto y pH) muestran que no existe De acuerdo a la diversidad por lagunas en el
correlacin con la variable de abundancia. La sistema lagunar Carmen-Pajonal-Machona en el
composicin de la comunidad de gasterpodos estudio actual fue de 1.6 a 2.7, esto concuerda
del sistema lagunar Carmen-Pajonal-Machona, con el estudio realizado por Antol y Garca-
que se registra en el presente estudio es ms Cubas (1985) quien obtuvo una diversidad de 1.7
abundante que en otras lagunas o sistemas a 2.1 y Granados (1994) quien reportan de 1.1 a
lagunares del Golfo de Mxico, tal es el caso de 2.3, determinando de igual forma los valores con
la laguna de Alvarado, Veracruz Reguero y una mnimas variaciones y as mismo tambin
Garca-Cubas (1989) registraron 13 especies; en determinaron que la laguna mas diversa es la
la laguna Mecoacn, Tabasco Garca-Cubas et laguna La Machona, esto debido tal vez a que es
al., (1990) se reportaron 20 especies; en la una de las lagunas mas grande dentro del
laguna Camaronera, Veracruz Reguero y Garca- sistema lagunar y es la que tiene una
Cubas (1991) colectaron 20 especies; en la comunicacin artificial con el mar provocando
laguna Larga-Redonda-Mandinga, Veracruz que en la laguna exista mayor variedad de
Reguero y Garca-Cubas (1993) determinaron 20 especies con respecto a las otras dos lagunas.
especies; en la laguna Sontecomapan, Veracruz
Garca-Cubas y Reguero (1995) en su trabajo LITERATURA CITADA
realizado capturaron 20 especies y Antol F. V. y A. Garca-Cubas. 1985. Sistemtica
posteriormente en la laguna Mecoacn, Tabasco. y ecologa de moluscos en las lagunas
Estrada, (2000), dio a conocer 17 especies en costeras Carmen-Pajonal-Machona, Tabasco,
contraste con el estudio actual el cual se registra Mxico. An. Inst. Cienc. del Mar y Limnol. Univ.
un total de 23 especies de gasterpodos. Nal. Autn. Mxico, 12(1): 145-198.
Algunos factores que pueden influir Estrada Z. M. 2000. Estudio de los Moluscos de
mucho en la discrepancia de los resultados es el la Laguna Mecoacn, Paraso, Tabasco,
tiempo puesto que el primer trabajo se publico en Mxico. Tesis Profesional. Fac. Ciencias Univ.
1981 por Antol y Garca-Cubas, pero los Nal. Autn. de Mxico. 75 p.
muestreos lo realiz en 1979 con una diferencia Garca-Cubas A., 1981. Moluscos de un Sistema
de aproximadamente de 23 aos y el de Lagunar Tropical del Sur del Golfo de Mxico
Granados que sus muestreos los realiz en 1986 (Laguna de Trminos Campeche). Publicacin
presentndose una diferencia de 16 aos con la especial del Inst. de Cienc. del Mar y Limnol.
fechas del trabajo actual; este lapso puede Univ. Nal. Autn. Mxico, 5: 1-182.
propiciar que las especies de la poblacin de Garca-Cubas A., F. Escobar-De la Ll., L. V.
Gonzlez y M. Reguero, 1990. Moluscos de la

24
Estudios sobre Malacologa y Conquiliologa en Mxico

Laguna Mecoacn, Tabasco, Mxico:


Sistemtica y Ecologa. An. Inst. Cienc. del Mar
y LImnol. Univ. Nal. Autn. Mxico. 17(1): 1-30.
Garca-Cubas A. y M. Reguero. 1990. Moluscos
del Sistema Lagunar Tupilco-Ostin, Tabasco,
Mxico: Sistemtica y Ecologa, An. Inst. Cienc.
del Mar y Limnol. Univ. Nal. Autn. Mxico.
17(2): 309-343.
Garca-Cubas A. y M. Reguero. 1995. Moluscos
de Laguna Sontecomapan, Veracruz, Mxico:
Sistemtica y ecologa. An. Inst. Cienc. del Mar
y Limnol. Univ. Nal. Autn. Mxico. 5(1-12): 1-
24.
Gold B. G. 1993. Diagnstico del Estado de la
Poblacin de Ostin en Tres Ecosistemas
Costeros de Tabasco. CINVESTAV-IPN Unidad
Mrida. 75 p.
Krebs C. J., 2000. Programs For Ecological
Methodology, 2nd Ed. Versin 5.2, Dept., of
Zoology, university Of British Columbia.
Moreno C. E., 2000. Manual de Mtodos para
Medir la Biodiversidad, Xalapa, Ver. Mxico:
Universidad Veracruzana (Textos
Universitarios), 49p.
Reguero M. y A. Garca-Cubas. 1993. Moluscos
del Complejo Lagunar Larga-Redonda-
Mandinga, Veracruz, Mxico: Sistemtica y
Ecologa. An. Inst. Cienc. del Mar y Limnol.
Univ. Nal. Autn. Mxico. 3(1-2): 41-70.
Stell, R. G. D. y J. H. Torrie, 1988. Bioestadstica:
Principios y Procedimientos, McGraw-Hill,
Interamericana, Mxico, 622p.

25
Caicedo-Rivas, R. E., R., Len-Pinto, V., Ortega-Chvez, J. S., Hernndez-Zepeda y S. J. Serrano-Guzmn. 2007. Estudio comparativo de tres
comunidades malacolgicas en las costas del estado de Oaxaca. pp 26-28. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara,
E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

ESTUDIO COMPARATIVO DE TRES COMUNIDADES MALACOLOGICAS EN LAS COSTAS DEL


ESTADO DE OAXACA

Caicedo-Rivas, R. E.1, Len-Pinto, R.1, Ortega-Chvez, V.1, Hernndez-Zepeda, J. S.2 y Serrano-


Guzmn, S. J.3
1
Escuela de Biologa. 2Instituto de Ciencias, Benemrita Universidad Autnoma de Puebla, Boulevard
Valsequillo y Ave. San Claudio s/n, Ciudad Universitaria, Edificio No. 76, C. P. 72570. Puebla, Mxico.
3
Instituto de Industrias, Universidad del Mar, Ciudad Universitaria, Puerto ngel, Oaxaca, Mxico. C. P.
70902. ricairi4@hotmail.com
Palabras clave: Comunidad, moluscos, diversidad, Oaxaca.

INTRODUCCION
El estudio de las comunidades acuticas y MATERIALES Y METODOS
terrestres muestra en la actualidad una Ubicacin geogrfica del rea de estudio. Las
tendencia hacia el enfoque ecolgico, utilizando tres playas estudiadas se encuentran dentro del
como elementos de anlisis e interpretacin las litoral de la costa del Pacifico Mexicano
relaciones entre los organismos y el medio. especficamente dentro de las costas del estado
Para ello suele determinarse la de Oaxaca, Mxico. Playa Mazunte se encuentra
composicin y diversidad de especies que en la porcin Suroeste de la lnea costera del
integran una comunidad, evalundose la estado de Oaxaca, dentro del municipio de Santa
importancia relativa de las distintas poblaciones, Maria Tonameca, con coordenadas de 15 39
con base en su distribucin, abundancia, 40 Latitud Norte y 96 33 54 Longitud Oeste.
frecuencia y densidad al interior de un sistema, Playa Extacahuite se encuentra en la porcin
que se caracteriza por poseer tambin centro de la lnea costera del Estado de Oaxaca,
condiciones fisicoqumicas concretas dentro del municipio de Puerto ngel, con
(temperatura, salinidad, profundidad, tipo de coordenadas de 15 3940 Latitud Norte y 96
sedimentos, etc.). 31 11 Longitud Oeste. Playa la Mina se
Los antecedentes sobre estudios encuentra al Sureste de la lnea costera del
cuantitativos de comunidades costeras, en estado de Oaxaca, dentro del municipio de
relacin en las costas de Oaxaca se limitan a puerto ngel, con coordenadas de 15 40 28
los siguientes trabajos: en las bahas de Huatulco Latitud Norte y 96 28 35 Longitud Oeste
y Puerto Angel, estos son de Rodrguez et al. Recolecta. El periodo de investigacin se
(1988) sobre la abundancia y diversidad de los realiz de Abril-2004 a julio del 2006.. Cada
moluscos, Sandoval (1988) sobre invertebrados salida cont con cinco das de muestreo en cada
bnticos del litoral rocoso en Tangolunda y La una de las tres playas (Playa Mazunte, Playa
Entrega, Rodrguez (1989) caracteriz dos Extacahuite, Playa La Mina, Puerto ngel,
comunidades asociadas a sustratos rocosos en Oaxaca),. Las colectas se efectuaron a mano
El Maguey y Puerto Angel y Mitchell (1994) mediante el buceo autnomo y buceo libre, en
sobre el perfil del coral en La Entrega y sus una profundidad que oscila entre los dos a treinta
especies asociadas: Existen varios trabajos y cinco metros (2 a 35 metros de profundidad), se
referente a la fauna en arrecifes de coral ((Palma, hicieron dos inmersiones al da (8-10 am. y 4-6
2003), y de moluscos depredadores en varias pm.). En cada una de las playas muestreadas se
zonas del litoral oaxaqueo (Mendoza 2004). trazaron cuadrantes de 100 m2 donde se realiz
Ambos estudios hacen referencia a la recolecta de los organismos, muestreando en
moluscos depredadores de arrecifes de coral y sustratos arenosos, rocosos y coralinos.
de la fauna acompaante de estos a diferentes Procesamiento de los organismos
profundidades, sin embargo, los estudios obtenidos. El material colectado se rotul en el
realizados no coinciden en cuanto a la campo con los siguientes datos: Fecha de
distribucin y nomenclatura sistemtica El recolecta, lugar, substrato. Todos los organismos
propsito de este trabajo fue aportar informacin se trasportaron vivos en contenedores y fueron
sobre distribucin de los moluscos en sustratos colocados en un acuario artificial.
rocosos en tres diferentes comunidades costeras La identificacin de los organismos
en el Estado de Oaxaca en las Playas Mazunte estuvo basada en la literatura de Keen, (1971) y
dentro del Municipio de Santa Maria Tonameca y Abbott (1974). Los organismos muertos se
las Playas Extacahuite y La Mina dentro del limpiaron y se colocaron en alcohol al 70% para
Municipio de Puerto ngel, Oaxaca, Mxico. su conservacin y posteriormente se depositaron

26
Estudios sobre Malacologa y Conquiliologa en Mxico

en la coleccin malacolgica de la escuela de De igual manera se calcul la Equidad de


biologa de la Universidad Autnoma de Puebla. Pielou, este ndice mide la proporcin de la
Los organismos que llegaron vivos, se diversidad observada, en relacin con la mxima
introdujeron en una pecera con una capacidad de esperada; y cuyos valores van de 0 a 1.0, de
200 litros para su preservacin. manera que al obtener el valor de 1.0 indica que
Composicin taxonmica. Se hizo una todas las especies son igualmente abundantes
lista taxonmica de la comunidad de moluscos de (Magurran 1988).
las Playas Mazunte (municipio), Extacahuite y La H'
Mina, Puerto ngel, Oaxaca, indicando phylum, J = '
'

clase, orden, familia y especie a la que H max


pertenecen basada en la literatura de Keen, Donde:
(1971) y Abbott, (1974). H ' = Valor obtenido del ndice de Shannon-
ndices de importancia ecolgica. El Wiener
aspecto descriptivo de la ecologa se centra
bsicamente en el reconocimiento y exposicin H 'max = In (S)
de la importancia numrica de las diferentes S = Nmero de especies
especies y como se distribuyen, tradicionalmente
este aspecto se ha orientado hacia la
consideraciones de la parte viva del ecosistema o As mismo se obtuvo la dominancia de
de la comunidad, esta comunidad es una reunin Simpson, que es un concepto basado en la
de poblaciones que viven en un rea o hbitat uniformidad o equidad de la comunidad, de
fsico determinado, es una unidad que posee manera que este valor, indica la posibilidad de
caractersticas complementarias de sus que dos individuos de una muestra tomados al
componentes individuales y de poblaciones y azar, pertenezcan a la misma especie; es decir,
funciona como unidad mediante de acuerdo a los valores obtenidos, este ndice
transformaciones metablicas acopladas (Odum, nos muestra cual es la especie dominante dentro
1972). de la comunidad (Magurran 1988).
Dentro de nuestras comunidades de
estudio se utilizaron los siguientes ndices: 1
D=
Diversidad. Para la comunidad de pi 2
moluscos, se calculo el ndice de Shannon-
Wiener (Magurran, 1988), ya que es el ms
empleado y permite comparaciones con otros Donde: Pi = n / N proporcin de individuos de la
estudios. Este ndice asume que todos los especie i , con respecto al total de individuos en
individuos son muestreados aleatoriamente y que la muestra.
todas las especies se encuentran representadas ndice de Similitud. Para estimar el grado
en la muestra obtenida durante el estudio de similitud con respecto a la comunidad de
(Moreno, 2001). moluscos entre las tres zonas de muestreo, se
calcul el coeficiente de similitud de Sorensen
ndice de Shannon-Wiener (H) (Magurran, 1988; Moreno, 2001) para datos
H ' = piInpi cualitativos, que como su nombre lo indica,
relaciona el nmero de especies en comn con
Donde: Pi = n / N proporcin de individuos de la la media aritmtica de las especies en ambos
especie i , con respecto al total de individuos en sitios de muestreo, a partir de datos de ausencia
la muestra. / presencia de las especies.
Para probar si en las diversidades
procedentes de las muestras por sitio de Coeficiente de Similitud de Sorensen
muestreo (Playa Mazunte, Extacahute y La Mina, Cs = 2 j / (a + b )
medidas con el ndice de Shannon-Wiener)
existen diferencias significativas se aplico una
Donde: j = Nmero de especies en comn en
prueba de t-student (Magurran, 1988).
ambos sitios, a = Nmero de especies presentes
en el sitio A y b = Nmero de especies presentes
H1' H 2' en el sitio B.
t=
(VarH1' + VarH 2' )1 / 2 Una vez obtenido los valores de similitud,
se elabor un dendrograma utilizando el

27
Estudios sobre Malacologa y Conquiliologa en Mxico

programa Stadistical Cluster Analisis, para LITERATURA CITADA


analizar la semejanza entre los sitios de Abbott R. T. 1974. American Seashells, Van
muestreo, con respecto al nmero de especies Nostrand Reinhold Company, 2a. ed. New
que comparten. York. 663 p.
Keen A. M. 1971. Seashells of Tropical West
RESULTADOS Y DISCUSION America Marne Mollusks from Baja California
Composicin taxonmica: Se obtuvieron un total to Peru. Stanford University Press, 2a. ed.
de 41 especies diferentes para las tres California.
localidades de muestreo (Playa Mazunte, Playa Magurran, A. E. 1988. Ecological Diversity and Its
Extacahuite y Playa La Mina) distribuidas en 2 Measurement. Croom Helm. Sydney, Australia.
clases, 8 rdenes, 25 familias y 31 gneros. Mendoza, I. 2004, Algunos moluscos
Dentro de los rdenes encontrados, el mejor depredadores de las Costas de Mxico, tesis
representado fue el orden Neogasterpoda con de Licenciatura, BUAP. Mxico.
12 especies que representa el 29% del total, la Mitchell, L. M. 1994. Perfil del coral y especies
orden Pterioida y Veneroida con siete especies asociadas en la Entrega, Bahas de Huatulco,
(17%), le siguen el orden Mesogasterpoda con Oaxaca, Tesis de Licenciatura, UNAM.
seis especies (15%), la orden Palma, R, A. 2003. Determinacin de las
Archeogasterpoda con cuatro especies (10%), especies depredadoras de coral presentes en
orden Arcoida y Nudibranchia con dos especies los arregcifes coralinos del Parque Nacional de
(5%), por ltimo el orden Mytiloida con una Hualtulco, Oaxaca: Estudio de campo. Tesis de
especie que representa tan solo el 2%. licenciatura, BUAP. Mxico.
Odum, P. E. 1972. Ecologa. Editorial
Arcoida (2), 5%
Interamericana. Mxico.
Nudibranchia (2), 5% Rodriguez, P. C.1989. Caracterizacin de las
Mytiloida (1), 2%
comunidades asociadas a facies rocosa, en las
Pterioida (7), 17% Bahas de Huatulco y Pto Angel. Distribucin,
Neogasterpoda (12), 29% diversidad y abundancia. Tesis de licenciatura,
UNAM. Mxico
Rodriguez, P. C., L. M. Mitchell: G. Sandoval; P.
Gmez y G.Green. 1988. Los moluscos de las
Veneroida (7), 17%
Bahas de Huatulco y Pto Angel, Oaxaca.
Mesogasterpoda (6), 15% Archeogasterpoda (4), Distribucin, diversidad y abundancia. Univ.
10% Ciencia 5(9): 85-94.
Sandoval, D. G. 1988. Estudio de las
Figura. 1. Porcentaje de los rdenes de moluscos comunidades benticas de la zona rocosa
ms representativos de las zonas de estudio, litoraly sublitoral de localidades en bahas de
donde se puede observar que el orden ms Huatulco, tesis de Licenciatura, Univ. Nacional
representativo fue el Neogasterpoda. Autnoma de Mxico.

En base a los resultados obtenidos


podemos decir que:
-La diversidad obtenida para la zona de
estudio fue baja. (5.32)
-La localidad con el valor de diversidad
ms alto fue Playa La Mina (2.36) y localidad con
el valor ms bajo fue Playa Extacahuite (1.38).
-La localidad que presento el valor de
equitatividad ms alto fue Playa La Mina (0.73)
-La localidad que presento el valor de
dominancia mas alto fue Playa La Mina
-Playa Mazunte y Playa Extacahuite son
las localidades ms similares de acuerdo al
anlisis de Similitud y la localidad mas dismil del
resto fue Playa Mazunte y Playa La Mina.

28
Naranjo-Garca, E. y M. T., Olivera-Carrasco. 2007. Moluscos dulceacucolas introducidos en Mxico. pp 29-31. En: Estudios sobre la Malacologa y
Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

MOLUSCOS DULCEACUCOLAS INTRODUCIDOS EN MXICO

Naranjo-Garca, Edna1 y Olivera-Carrasco, Mara Teresa2


1
Departamento de Zoologa, Instituto de Biologa, UNAM Apartado Postal 70-153, Mxico, D. F. 04510.
2
Laboratorio de Arqueozoologa M. en C. Ticul lvarez Solrzano, Subdireccin de Laboratorios y
Apoyo Acadmico, INAH. Moneda 16, Col. Centro, Mxico, D.F. 06060. naranjo@servidor.unam.mx.
Palabras clave: Agua dulce, no nativos, caracoles, almejas, continentales.

INTRODUCCIN se distribuye en la vertiente del Golfo de Mxico,


Los moluscos dulceacucolas (bivalvos y del norte de Veracruz a la Pennsula de Yucatn
gasterpodos), son muy diversos tanto como los (Naranjo y Garca-Cubas, 1986), ha sido
medios acuticos que ocupan. Los pulmonados introducida a la vertiente del Pacfico en fecha
dulceacucolas son monoicos (cada individuo desconocida as como la secuencia seguida, los
constituye una poblacin reproductiva potencial); primeros registros en la CNMO datan del 9 de
adems, toleran la desecacin, condiciones agosto de 1990 de la Laguna Potrero Grande,
fsico-qumicas diversas y pueden respirar fuera Colima y del 24 de febrero de 1992 en la Laguna
del agua, lo que facilita la posibilidad de invadir Mezcales, El Ticuis, Michoacn. La especie se ha
nuevos hbitats; en contraparte los moluscos empleado en el Caribe y Sudamrica como
operculados son dioicos y para poblar otro lugar agente de control biolgico ya que consume las
necesitan su pareja, o la hembra llegar cargada; masas ovgeras deBiomphalaria glabrata (Say,
respiran por branquias (su capacidad para 1818) y evita el establecimiento de colonias de
respirar fuera del agua es limitada); sus esta especie, transmisora del esquistosoma
requerimientos ambientales son muy especficos mansoni (Naranjo y Garca Cubas, 1986).
y por tanto son menos susceptibles de ser Se ha registrado crecimiento masivo de
introducidos (Thompson y Hanley, 1982), con sus Pomacea flagellata, en el oeste de Mxico, la
excepciones. cual obstruye conductos de agua. Existen
Las formas dulceacucolas tienen experiencias dramticas con otras especies del
importancia mdica y veterinaria, pues con mismo gnero, por ejemplo, P. canaliculata
frecuencia son hospederos intermediarios de (Lamarck, 1822) nativa de Sudamrica
parsitos (Malek y Cheng, 1974) que afectan (Colombia, las Guayanas, sur de la provincia de
seriamente al hombre, animales silvestres y Buenos Aires, Argentina) (Damborenea y
domsticos. Darrigran, 2002) se introdujo en Asia alrededor
del ao 1980 y se convirti en plaga de la planta
MATERIALES Y MTODOS de arroz provocando grandes prdidas
A partir de la revisin bibliogrfica y ejemplares econmicas. En 1989 fue introducida en Hawai,
depositados en la Coleccin Nacional de en donde se transform en la principal plaga de
Moluscos (CNMO), Instituto de Biologa, UNAM la planta de taro -de consumo humano local
se recopil la lista de moluscos dulceacucolas (Cowie, 2005). Se estima que P. canaliculata,
introducidos en Mxico, su procedencia, efectos puede dispersarse de reas agrcolas a sistemas
causados en las zonas de introduccin y tcnicas dulceacucolas naturales con rapidez, en donde
de control hasta ahora conocidas. puede causar gran impacto, provoca
modificaciones en el ambiente destruyendo la
RESULTADOS Y DISCUSIN vegetacin nativa y compite con la fauna original;
Se conocen cinco especies de moluscos en el sureste de Asia P. canaliculata provoc la
dulceacucolas introducidas en Mxico, tres disminucin de poblaciones nativas del gnero
gasterpodos del orden Prosobranchia: Thiara Pila (Cowie, 2005).
(Melanoides) tuberculata (Mller, 1774), Tarebia Tarebia granifera se distribuye en Timor
granifera (Lamarck, 1822), adems de Pomacea (Pointier y Marquet, 1990), Madagascar, India,
flagellata, especie nativa de la vertiente del Golfo Malasia, las Filipinas, las Islas Sociedad, en el N
de Mxico; el gasterpodo pulmonado, orden de las Islas Ryukyu y Hawai (Pace, 1973).
Basommatophora, Planorbella duryi (Wetherby, Naranjo et al. (en preparacin) registran esta
1879) y el bivalvo Veneroidea Corbicula fluminea especie por primera vez en Mxico, en el lago de
(Mller, 1774). El ser humano ha contribuido con Catemaco y en el Ro Mquinas, Veracruz. Su
sus actividades a transportar organismos vivos presencia en cuerpos de agua dulce puede
(plantas y animales) a regiones fuera de su provocar: 1) el desplazamiento de especies
distribucin nativa. Pomacea flagellata en Mxico nativas del gnero Pachychilus; 2) el

29
Estudios sobre Malacologa y Conquiliologa en Mxico

desplazamiento o regulacin de especies del (Britton y Fuller, 1979), poco sabemos del efecto
gnero Biomphalaria como en otros pases del de su presencia en Mxico.
Caribe y Sudamrica (Pointier y Augustin, 1999, El efecto de los moluscos introducidos
Pointier et al. 1998), 3) siendo partenogentica, sobre la fauna nativa, su forma y grado de
invade rpidamente nuevos cuerpos de agua y afectacin est por ser investigada en Mxico.
cuando es abundante modifica las condiciones Control. Se ha intentado controlar a las
fsicas del medio. poblaciones de moluscos dulceacucolas de
Thiara (Melanoides) tuberculata proviene importancia mdica con substancias obtenidas
de frica, E Mediterrneo, la India, E Asia, de plantas con propiedades molusquicidas. La
Malasia y S China, N islas Ryukyu, muchas islas Phytolacca dodecandra, parece tener mayor
del Pacfico, N Australia y las Nuevas Hbridas actividad y efectividad que otras plantas, contiene
(Pace, 1973). Esta especie est ampliamente un compuesto de saponinas triterpenoides, con
distribuida en Mxico (Contreras-Arquieta et al. muy buenos resultados en Etiopia, su desventaja
1991 y 1995; Contreras-Arquieta y Contreras es el alto costo del cultivo y produccin de la
Balderas, 1999; Contreras-Arquieta, 1998). planta (Marston y Hostettman, 1987). En Mxico
Thiara (Melanoides) tuberculata posee un se ha probado la planta Piqueria trinervia - de ella
potencial reproductivo semejante al deTarebia se obtiene el Piquerol A, compuesto
granifera, crece rpidamente, soporta amplias sesquiterpenoide - con muy buenos resultados
variaciones en el nivel del agua y la desecacin, (60 a 100% de mortalidad en 24 hr; adems,
es filtradora de depsito y alcanza la madurez sobre un amplio espectro de moluscos
sexual a la talla de 3.5 mm. En Hong Kong vive dulceacucolas involucrados en la transmisin de
en cuerpos de agua de corriente lenta o parsitos) (Cruz et al., 1989).
estancada (Dudgeon, 1989). En el mismo cuerpo Control mediante la extraccin de
de agua Tarebia domina sobre Thiara, la cual se moluscos introducidos y utilizados como
encontrar con un nmero escaso de individuos. complemento alimenticio; Bombeo-Tuburan et al.
Planorbella duryi es originaria de Florida, Estados (1995) probaron el cultivo de Peneus monodon
Unidos; hasta donde sabemos, no ha causado con diferentes dietas. La ms redituable tanto
dao a la fauna nativa en Mxico. nutricional como econmicamente fue la mezcla
El bivalvo Corbicula fluminea proviene de yuca (Manihot esculenta) con el caracol
del S de China (Morton, 1986), posiblemente Pomacea canaliculata (plaga en cultivos de
introducido en Canad antes de 1924 (Counts, arroz) o maz y caracol (mezcla menos
1981) y en Estados Unidos en los aos 30s. redituable). La mezcla de alimentos dio mejores
Entre los chinos cantoneses, Corbicula fluminea, resultados que dietas basadas en uno slo de
es un alimento regular de su dieta (Counts, ellos. Estos autores proponen el uso del caracol
1981). La especie se dispers ampliamente por durante la poca de lluvias (cuando son
los Estados Unidos con la intervencin del ser abundantes) como un recurso para el
humano, pues era empleada como carnada para mejoramiento de la dieta, en los sitios en donde
pescar, tal vez haya sido una curiosidad en el caracol es una plaga y recomiendan evitar
acuarios; o haber sido introducido con el agua de cultivarlos para lograr erradicarlos (Bombeo-
lastre (bilge water) o con el transporte de arena Tuburan et al., 1995).
(McMahon, 1982). En Estados Unidos desde En Hawai se ha intentado erradicar la
1956 se han tenido problemas de taponamiento Pomacea canaliculata con el uso de plaguicidas
de tuberas (Isom, 1986). sin xito. El mejor control ha sido la colecta a
En Mxico se ha registrado en el norte mano y la constante destruccin de masa
del pas en las vertientes del Pacfico y del Golfo ovgeras (Cowie, 2005).
de Mxico (Taylor, 1981; Hillis y Madden, 1985,
Morton, 1986), Contreras y Contreras (1999) y LITERATURA CITADA
Torres-Orozco y Revueltas-Valle (1996) la Bombeo-Tuburan, I., S. Fukumoto y E. M.
registran en 1992 en el lago de Catemaco, Rodrguez. Use of the golden apple snail,
Veracruz. En varias regiones del mundo es cassava, and maize as feeds for the tiger
considerada especie plaga (crecen en shrimp, Penaeus monodon, in ponds.
abundancia y obstruyen las tuberas en sistemas Aquaculture 131:9-100.
de enfriamiento de diversos procesos Britton, J. C. & S. L. H. Fuller. 1979. The
industriales); impiden el flujo del agua, destruyen freshwater bivalve Mollusca (Unionidae,
las capas de grava del concreto y compiten por el Sphaeriidae, Corbiculidae) of the Savannah
espacio disponible con almejas Unionidae nativas

30
Estudios sobre Malacologa y Conquiliologa en Mxico

River Plant, South Carolina. The Savannah and industries in the Americas. American
River Plant Publication SRO-NERP-3. Malacological Bull. Special Edition No. 2:1-5.
Contreras-Arquieta, A. 1998. New records of the Malek, E. A. & T. C. Cheng. 1974. Medical and
snail Melanoides tuberculata (Mller, 1774) economic malacology. Academic Press, Nueva
(Gastropoda: Thiaridae) in the Cuatro Cienegas York.
Basin, and its distribution in the state of Marston, A. y K. Hostettman. 1987. Antifungal,
Coahuila, Mexico. The Southwestern Naturalist molluscicidal and cytotoxic compounds from
43(2):283-286. plants used in traditional medicine pp. 65-83.
Contreras-Arquieta, A. & S. Contreras-Balderas. En: Biologically active natural products.
1999. Description, biology, and ecological Proceedings of the Phytochemical Society of
impact of the screw snail, Thiara tuberculata Europe, Vol. 27, K. Hostettman, P.J. Lea (eds.)
(Mller, 1774) (Gastropoda: Thiaridae) in Oxford University Press, Oxford.
Mexico. Pgs. 151-160. En: R. Claudi and J.H. McMahon, R. F. 1982. The occurrence & spread
Leach (eds.) Nonindigenous freshwater of the introduced Asiatic freshwater clam,
organisms: vectors, biology, and impacts. Lewis Corbicula fluminea (Mller), in North America:
Publishers, Boca Ratn. 1924-1982. The Nautilus 96(4):134-141.
Contreras-Arquieta, A., G. Guajardo-Martnez y Morton, B. 1986. Corbicula in Asia an updated
S. Contreras-Balderas. 1991. Thiara synthesis. American Malacological Bulletin,
(Melanoides) tuberculata Mller, 1774 Special Edition No. 2:113-124.
(Gastropoda: Thiaridae) introducida en Mxico Naranjo-Garca, E. y A. Garca-Cubas. 1986
y su probable impacto ecolgico. XI Congreso (1985). Algunas consideraciones sobre el
Nacional de Zoologa, 28 a 31 de octubre, gnero Pomacea (Gastropoda: Pilidae) en
Mrida, Yucatn, Programa y resmenes, Mxico y Centroamrica. Anales del Instituto de
resumen 133. Biologa, UNAM, Serie Zoologa 56(2):603-606.
Contreras-Arquieta, A., G. Guajardo-Martnez y Naranjo-Garca, E., M. E. Diupotex Chong y R.
S. Contreras-Balderas. 1995. Thiara Familiar Gonzlez. Tarebia granifera (Lamarck,
(Melanoides) tuberculata (Mller, 1774) 1822) (Gastropoda: Prosobranchia:
(Gastropoda: Thiaridae) su probable impacto Pachychilidae) in Mexico. En preparacin.
ecolgico en Mxico. Publicaciones Biolgicas Pace, G. L. 1973. The freshwater snails of
F.C.B./U.A.N.L. Mxico 8(1 y 2):17-24. Taiwan (Formosa). Malacological Review (Supl.
Counts, C. L. III. 1981. Corbicula fluminea 1) 118 p.
(Bivalvia: Sphaeriacea) in British Columbia. The Pointier, J. P. y D. Augustin. 1999. Biological
Nautilus 95(1): 12-13. control and invading freshwater snails, A case
Cowie, R. H. 2005. Pomacea canaliculata study. Sciences de la vie/Life Sciences
(mollusc). Issg Database Ecology of Pomacea 322(1999):1093-1098.
canaliculata. Pointier, J. P. & G. Marquet. 1990. Taxonomy
www.issg.org/database/species/ecology.asp and distribution of freshwater mollusks of
Cruz Reyes, A., C. Chavarin, M. P. Campos French Polynesia. Venus 49(3):215-231.
Arias, J. Taboada y M. Jimnez. 1989. Pointier, J. P., S. Samadi, P. Jarne y B. Delay.
Actividad molusquicida del piquerol A aislado 1998. Introduction and spread of Thiara
de Piqueria trinervia (Compositae) sobre ocho granifera (Lamarck, 1822) in Martinique, French
especies de caracoles pulmonados. Memorias West Indies. Biodiversity and Conservation
del Instituto Oswaldo Cruz 84(1):35-40. 7:1277-1290.
Damborenea, M. C. y G. Darrigran. 2002. Un Taylor, D. W. 1981. Freshwater mollusks of
sudamericano invade Asia. Revista Ciencia California: A distributional checklist. California
Hoy en lnea 11(66). Fish and Game 67(3): 140-163.
Dudgeon, D. 1989. Ecological strategies of Hong Thompson, F. G. y R. W. Hanley. 1982. Mollusca.
Kong Thiaridae (Gastropoda: Prosobranchia). Pp. 477-485. En: Aquatic biota of Mexico,
Malacological Review 22:39-53. Central America and West Indies, H. R.
Hillis, D. M. & R. L. Madden. 1985. Spread of the Roberts y C. S. Carbonell (eds.). San Diego
Asiatic clam, Corbicula (Bivalvia: Corbiculacea) State University, 529 p.
into the New World tropics. The Southwestern Torres-Orozco, B. R. y E. Revueltas-Valle. 1996.
Naturalist 30(3):454-456. New southernmost record of the Asiatic clam
Isom, B. G. 1986. Historical review of Asiatic clam Corbicula fluminea (Bivalvia: Corbiculidae), in
(Corbicula) invasion and biofouling of waters Mexico. The Southwestern Naturalist 41(1):60-
98.

31
Granados-Amores, J., R., de Silva-Dvila, M. E., Hernndez-Rivas y R., Durazo. 2007. Paralarvas de calamares de la costa Occidental de la Pennsula
de Baja California, Mxico. pp 32-34. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M,
Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

PARALARVAS DE CALAMARES DE LA COSTA OCCIDENTAL DE LA PENNSULA DE BAJA


CALIFORNIA, MXICO

Granados-Amores, Jasmn1, Silva-Dvila, Roxana De1, Hernndez-Rivas, Martn, E.1, Durazo,


Reginaldo2.
1
Centro Interdisciplinario de Ciencias Marinas (CICIMAR-IPN). Departamento de Plancton y Ecologa
Marina. La Paz, BCS Mxico. 2UABC, Facultad de Ciencias Marinas. Apdo. Postal 453. Ensenada, B. C.,
Mxico. +Becaria PIFI, CONACYT, *Becaria EDI y COFAA. jgranadosa0500@ipn.mx.
Palabras clave: Paralarvas de cefalpodos, Taxonoma, Baja California Sur.

INTRODUCCIN transformaron a 1000 m3 de agua filtrada. La


A nivel mundial, el conocimiento sobre la estructura de la taxocenosis se determin
diversidad de los cefalpodos es limitado. A mediante el ndice de riqueza especfica (S),
pesar de que representan un recurso pesquero diversidad de Shannon-Wiener (H) y equidad de
importante y ecolgicamente juegan un papel Pielou (J). Los taxa se agruparon por afinidad
esencial en la trama trfica marina, esta falta de biogeogrfica y se contrastaron con el registro de
informacin se atribuye a la dificultad que existe las masas de agua presentes en el rea durante
para capturar tanto a los organismos adultos 1998 y 1999.
como a sus estadios tempranos que se
encuentran en el plancton (Okutani y McGowan, 32 30
1969). Por ello, dado el desconocimiento casi 50
45
40
35 ENSENADA

55
total que se tiene sobre el nmero de especies 60
100
MEXICO
de calamares de las costas de Mxico, este

GO
30 103 PUNTA

LF
BANDA

O
trabajo aborda el problema taxonmico, con la 107

DE
110
identificacin de las paralarvas de cefalpodos

CA
119 BAHIA
113

LI
VIZCAINO
28
colectadas en las costas de la pennsula de Baja

FO
R
PUNTA EUGENIA

NI
117
California.

A
PUNTA ABREOJOS
120 123
Los objetivos de este estudio son: a) 26 127
GOLFO DE ULLOA
Integrar el elenco sistemtico de las paralarvas 130

de los calamares epiplanctnicos colectados en IMECOCAL 1997 - 1998


la costa occidental de la pennsula de Baja 24
118 116 114 112
California, durante invierno y verano de 1998 y
1999, b) Evaluar la estructura de la comunidad Figura 1. rea de estudio y red de estaciones de
muestreo.
de cefalpodos con base en las paralarvas, y c)
Describir los cambios estacionales e interanuales
de las especies identificadas. RESULTADOS
Durante invierno y verano de 1998 y 1999 la
MATERIALES Y MTODOS
abundancia total de paralarvas de calamares fue
El material biolgico se obtuvo durante 4
de 918 PL/1000m3, mismas que fueron
cruceros oceanogrficos realizados en enero y
recolectadas en 124 de las 268 estaciones
julio de 1998, y enero y agosto de 1999 dentro
muestreadas. Se identificaron un total de 8
del programa denominado Investigaciones
Familias, 12 gneros y 29 taxa (Figura 2, Tabla
Mexicanas de la Corriente de California
1).
(IMECOCAL), a bordo del B/O Francisco de
Ulloa. Los cruceros cubrieron la zona marina HISTIOTEUTHIDAE
OMMATREPHIDAE
3%
1%
adyacente a la costa occidental de la pennsula PYROTEUTHIDAE
ANCISTROCHEIRIDAE
2%
de Baja California, desde Ensenada, Baja 7% CRANCHIIDAE
28%

California hasta Punta Abreojos, Baja California


Sur, Mxico (Figura 1).
Las muestras fueron recolectadas con
arrastres de red Bongo estndar y preservadas ONYCHOTEUTHIDAE
33% ENOPLOTEUTHIDAE GONATIDAE
en formol al 4%. Las paralarvas se identificaron 3% 23%

al mnimo nivel taxonmico posible siguiendo los


criterios propuestos por Voss (1980), Nesis Figura 2. Abundancia relativa de las familias de
paralarvas de cefalpodos recolectadas durante invierno
(1983), Roper et al. (1984) y Sweeney et al. y verano de 1998 y 1999 en la costa occidental de la
(1992). Los datos de abundancia se pennsula de Baja California.

32
Estudios sobre Malacologa y Conquiliologa en Mxico

En invierno de 1999, en condiciones fras


Durante 1998-1999, se registraron (La Nia 1999-2001), la riqueza fue de
cambios estacionales e interanuales en la nicamente siete taxa todos de afinidad
riqueza, diversidad y afinidad de las paralarvas, templada. Para el verano de 1999, al trmino de
relacionados con las condiciones ambientales. La Nia, la riqueza aument a 11 taxa
incorporndose nuevamente los taxa
Tabla. 1. Listado taxonmico de las paralarvas de cosmopolitas que incrementaron su abundancia
cefalpodos colectadas en la costa occidental de relativa en el rea de estudio (Figura 3).
BCS durante invierno y verano de 1998 y 1999. En verano de 1998, el valor de diversidad
ANCISTROCHEIRIDAE ms alto (1.4 nat/ind) se relacion con la
Ancistrocheirus lesueuri presencia de las masas de agua Subrtica y
CRANCHIIDAE Transicional - Subtropical Superficial, y estuvo
Cranchiidae spp
representado por taxa de la familia Cranchidae,
Cranchia scabra
Helicocranchia beebei mientras que durante invierno de 1998, el valor
Leachia spp mas bajo de diversidad (0.5 nat/ind) se relacion
Leachia danae con la presencia de agua tropical en el rea de
Leachia dislocata estudio y la elevada abundancia de paralarvas de
Nuevo gnero Omastrfidos. Los valores de equidad fueron
ENOPLOTEUTHIDAE altos e indicaron una abundancia uniforme de los
Abraliopsis C taxa a lo largo del periodo de estudio, con
Abraliopsis D excepcin de tres estaciones de muestreo donde
Abraliopsis E
la familia Ommastrephidae fue dominante.
Abraliopsis felis
GONATIDAE
Gonatidae spp LITERATURA CITADA
Gonatopsis borealis Nesis, K. N. 1983. Dosidicus gigas. En: Boyle, P.
Gonatus spp R. (Ed.), Cephalopod Life Cycles. Academic
Gonatus middendorffi Press, London, Vol. 1. pp. 215-231.
HISTIOTEUTHIDAE Roper, C. F. E., M. J. Sweeney & C. E. Nauen.
Histioteuthis heteropsis 1984. Species catalogue. Vol. 3. Cephalopods
ONYCHOTEUTHIDAE of the world. An annotated and illustrated
Onychoteuthidae spp
catalogue of species of interest fisheries. FAO
Onychoteuthis banksi 1
Onychoteuthis banksi 2 Fish. Synop., 125(3):1-277.
Onychoteuthis banksi 3 Okutani T. & J. McGowan. 1969. Systematics
Onychoteuthis borealijaponica distribution, and abundance of the epiplanktonic
OMMASTREPHIDAE squid (Cephalopoda, Decapoda) larvae of the
Ommastrephes bartramii California Current, April, 1954-March, 1957.
Complejo EHO Bull. Scripps Inst. Oceanogr. Univ. Calif. 14:1-
PYROTEUTHIDAE 90.
Pyroteuthidae spp Sweeney, M. J; C. F. E. Roper, K. M. Mangold,
Pyroteuthis 1
M. R. Clarke & S. V. Boletzky. 1992. Larval
Pyroteuthis 2
Pterygioteuthis spp and juvenile cephalopods: A manual for their
identification. Smithsonian. Contrib. to Zool. Pp.
153- 282.
En invierno de 1998, con condiciones Voss, N. A. 1980. A generic revision of the
anmalamente clidas (El Nio 1997-1998), la Cranchiidae (Cephalopoda; Oegopsida). Bull.
riqueza fue de 13 taxa con afinidades tropical Mar. Sci. 30(2):365-412.
(20%), templada (33%) y cosmopolita (47%).
Para verano del ao 1998, considerado como de AGRADECIMIENTOS:
transicin entre El Nio 1997-1998 y La Nia Al Depto. de Plancton y Ecologa Marina del IPN-
1999-2001, la riqueza se increment a 17 y la CICIMAR. Al proyecto CONACyT G0041T y
afinidad de los taxa templados aument (69%) CGPI 2005-0673. Al Programa Institucional de
respecto de las tropicales y cosmopolitas (11% y Formacin de Investigadores (PIFI) del Instituto
20%, respectivamente) que disminuyeron a la Politcnico Nacional y al Consejo Nacional de
mitad respecto del invierno de 1998 (Figura 3). Ciencia y Tecnologa (CONACyT).

33
Estudios sobre Malacologa y Conquiliologa en Mxico

TROPICAL 20% COSMOPOLITA 20% VERANO 1999


COSMOPOLITA 38% TROPICAL 11%

COSMOPOLITA 47% TEMPLADA 62%


TEMPLADA 100% TEMPLADA 33% TEMPLADA 69%

Figura 3. Abundancia relativa de paralarvas de calamar por afinidad de los


adultos durante invierno y verano de 1998 y 1999.

34
Ortigosa-Gutirrez, J. D., G., Calado y N., Simes. 2007. Revisin bibliogrfica de moluscos opistobranquios del Golfo de Mxico. pp 35-37 En:
Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de
Guadalajara, Mxico. 299 p.

REVISIN BIBLIOGRFICA DE MOLUSCOS OPISTOBRANQUIOS DEL GOLFO DE MXICO

Ortigosa-Gutirrez, Jazmn D.1, Calado, Gonzalo,2,3 y Simes, Nuno1.


1
Unidad Multidisciplinaria de Docencia e Investigacin de Sisal, Facultad de Ciencias, UNAM. Puerto de
Abrigo, Sisal, Yucatn, MXICO. 2Universidade Lusfona de Humanidades e Tecnologia, Av. do Campo
Grande, 3761749 - 024 Lisboa; PORTUGAL. 3Centro de Modelao Ecolgica IMAR. FCT/UNL; Quinta
da Torre; 2825-114 Monte da Caparica, PORTUGAL. 09711431@escolar.unam.mx
Palabras clave: Opistobranquios, Golfo de Mxico, riqueza, arrecife, revisin bibliogrfica.

INTRODUCCIN Tabla1. Recopilacin de las especies reportadas para


Actualmente existen 6,000 especies de el golfo de Mxico (+ nuevos registros de
opistobranquios descritas en el mundo opistobranquios realizados por el Dr. Calado datos no
(Hermosillo, et al., 2006). Para Mxico, la publicados).
mayora de los estudios de opistobranquios se Especie
han sido realizados en la costa del ocano Lower Heterobranchia
pacfico, desde Baja California hasta Oaxaca Acteon candens Rehder, 1939
22

(e.g., Behrens, 1991; Bertsch, 1993; Hermosillo, Crenilabium exile (Jeffreys, 1870)
22

2003; Hermosillo y Valds, 2004; Hermosillo y Japonacteon punctostriacus (C. B. Adams, 1840)
6, 17, 19, 22,

Behrens, 2005; Hermosillo et al., 2006). Para la 23

costa oriental del pas, los estudios sobre este Cephalaspidea


2, 3, 20, 22, 23
grupo de organismos han sido menos (e.g., Acteocina bidentata (d'Orbigny, 1841)
22
Tovar et al., 2000; Zamora-Silva et al., 2002; Acteocina bullata (Kiener, 1834)
2, 3, 6, 7, 8, 9, 10, 13, 15, 17, 20, 22
Zamora-Silva, 2003; Ortigosa-Gutirrez, 2005). Acteocina canaliculata (Say, 1826)
3, 16, 20, 21, 22
En el 2003, Zamora-Silva presento una Acteocina candei (d'Orbigny, 1841)
22
recopilacin con 42 especies de opistobranquios Acteocina inconspicua Olsson & McGinty, 1958
22
registradas para el golfo de Mxico. Un adecuado Acteocina lepta Woodring, 1928
22
conocimiento de las especies que habitan enuna Acteocina recta (d'Orbigny, 1841)
22
zona determinada es la base para otras Scaphander bathymophila (Dall, 1881) *
22
Scaphander nobilis A. E. Verrill, 1884
investigaciones. 22
Scaphander watsoni Dall, 1881 *
22
Pyrunculus caelatus (Bush, 1885)
MATERIALES Y METODOS 22
Pyrunculus obesiusculus (Brugnone, 1877) *
Se realizo una revisin bibliogrfica en artculos y 23
Retusa caelata (Bush, 1885)
libros, as como tesis de licenciatura y maestra 22
Retusa sulcata (d'Orbigny, 1841)
de la UNAM para identificar a las especies de 3, 20, 22
Volvulella minuta (Bush, 1885)
opistobranquios reportadas para el golfo de 22
Volvulella paupercula (Watson, 1883)
Mxico, desde Alabama, Estados Unidos, hasta 3, 6, 20, 22
Volvulella persimilis (Mrch, 1875)
la pennsula de Yucatn, Mxico. Se registraron 3, 20, 22
Volvulella texasiana Harry, 1967
las especies reportadas y se revisaron las 3, 20, 22
Atys caribaeus (d'Orbigny, 1841)
sinonimias para evitar repetir especies. 22
Atys macandrewii E. A. Smith, 1872
22
Atys riiseanus Mrch, 1875
RESULTADOS Y DISCUSIN 3, 20, 22
Atys sandersoni Dall, 1881
Se obtuvo una lista con 97 especies de 9, 20, 22
Haminoea antillarum (d'Orbigny, 1841)
opistobranquios registradas para el golfo de 20, 22
Haminoea elegans (Gray, 1825)
Mxico (Tabla 1). De estas, 10 son nuevos 22
Haminoea glabra (A. Adams, 1850)
registros para el golfo de Mxico y fueron Haminoea succinea (Conrad, 1846)
16, 17, 20, 22

observados por el Dr. Calado en la pennsula de Bulla amygdala Linn, 1758


11, 20

Yucatn (datos an no publicados). La mayora Bulla occidentalis A. Adams, 1850


20

de las especies se localizaron en trabajos sobre Bulla solida Gmelin, 1791


22

ecologa y distribucin de moluscos Bulla eburneola (Dall, 1927)


3, 20

gasterpodos. Bulla striata Bruguire, 1792


2, 3, 5, 6, 10, 16, 17, 20, 21, 22

Este listado de especies del golfo de Ringicula nitida A. E. Verrill, 1872


22

Mxico servir como base para realizar Ringicula semistriata d'Orbigny, 1842
3, 20, 22

posteriores anlisis biogeogrficos de este grupo. Chelidonura sp. +


Es necesario continuar con la recopilacin de Chelidonura cf. hirundina (Quoy and Gairmand, 1833)+
trabajos, en especial los no publicados, para Navanax aenigmaticus (Bergh, 1893)
20, 21

aumentar la cantidad de especies reportadas. Sacoglossa

35
Estudios sobre Malacologa y Conquiliologa en Mxico

22 3, 14, 20, 22
Gastropteron chacmol Gosliner, 1989 Diacria danae Leyen & van der Spoel, 1982
22 3, 20, 22
Lobiger souverbii P. Fischer, 1857 Diacria trispinosa (Blainville, 1821)
20, 22 22
Oxynoe antillarum Mrch, 1863 Hyalocylis striata (Rang, 1828)
22
Elysia canguzua Er. Marcus, 1955 + Styliola subula (Quoy & Gaimard, 1827)
Elysia cf. tuca (Ev. Marcus and Ev. Marcus, 1967) +
20, 22
Elysia chlorotica Gould, 1870 (1/ Marcus, Ev., 1972; 2/ Abbott, 1974; 3/ Prez-
11, 20, 21
Elysia crispata (Morch, 1863) Rodrguez, 1977; 4/ Strenth y Blankenship, 1977;
20
Elysia subornata Verrill, 1901 5/ Wiley et al., 1982; 6/ Cruz-brego, 1984; 7/
20
Elysia sp Risso, 1818 Flores-Andolais et al., 1988; 8/ Reguero y Garca-
Costasiella ocellifera (Simroth, 1895) + Cubas, 1989; 9/ Garca-Cubas et al., 1990; 10/
Aplysiomorpha Garca-Cubas y Reguero, 1990; 11/ Pizaa,
4, 5, 6, 20, 22, 23
Aplysia brasiliana Rang, 1828 1990; 12/ Quintana, 1991; 13/ Garca-Cubas et
21, 22
Aplysia cervina (Dall & Simpson, 1901) al., 1992; 14/ Surez y Gasca, 1992; 15/
3, 4, 5, 11, 12, 20, 21, 22
Aplysia dactylomela Rang, 1828 Reguero y Garca-Cubas, 1993; 16/ Cruz-brego
22
Aplysia fasciata Poiret, 1789 et al., 1994; 17/Granados, 1994; 18/ Tucker y
1, 4, 22
Aplysia morio (A. E. Verrill, 1901) Morris, 1995 ; 19/ Escobar de la Llata, 1995; 20/
3, 4, 20, 21, 22
Bursatella leachii pleii Blainville, 1817 Zamora Silva, 2003; 21/ Ortigosa-Gutirrez,
20, 21
Stylocheilus longicauda Quoy and Gairmard, 1824 2005; 22/ Rosenberg, 2005; 23 / Valds et al.,
18, 22
Umbraculum umbraculum (Lightfoot, 1786) 2006).
22
Tylodina americana Dall, 1890
6, 22
Pleurobranchaea inconspicua Bergh, 1897
22
LITERATURA CITADA
Pleurobranchaea obesa (A. E. Verrill, 1882)
Abbott, T. 1974. American Seashells. 2a ed. Van
Nudibranchia
5
Nostrand Reinhold Company. New York. 663 p.
Nudibranquio sp
5
Antoli, V. y A. Garca-Cubas. 1983. Sistemtica y
Nudibranquio sp
22
ecologa de moluscos en las lagunas costeras
Corambe obscura A. E. Verrill, 1870
Carmen y Machona, Tabasco. Mxico. An. Inst.
Chromodoris clenchi (Russell, 1935) +
23 Cienc. del Mar y Limnol. Univ. Nal. Autn.
Hypselodoris bayeri (Ev. Marcus and Er. Marcus, 1967)
Mxico. 12 (1): 145-198.
Hypselodoris picta (Schultz, 1836) +
22 Behrens, D. 1991. Pacific Coast Nudibranch. A
Hypselodoris sycilla (Bergh, 1890)
21 Guide to the Opistobranchs Alaska to Baja
Atagema sp
California. 2a ed. Sea Challengers. Cal. 107 p.
Doris cf. bovena Er. Marcus, 1955 +
Bertsch. H. 1993. Opistobranquios (Mollusca) de
Jorunna spazzola (Marcus, 1955) +
22 la costa occidental de Mxico. Pp. 253-270. In:
Trippa anceps (Bergh, 1890)
22 Biodiversidad Marina y Costera de Mxico. S. I.
Discodoris evelinae Er. Marcus, 1955
Discodoris sp. Bergh, 1877
20 Salazar-Vallejo y N. E. Gonzlez (eds.)
Dendrodoris krebsii (Mrch, 1863) +
Comisin Nacional para el Conocimiento y Uso
Armina muelleri (Ihering, 1886)
22 de la Biodiversidad y CIQRO, Mxico, 856 p.
Armina wattla Ev. Marcus and Er. Marcus, 1967
23 Cruz-brego, F. A. 1984. Sistemtica y algunos
Marionia tedi Ev. Marcus, 1983
23 aspectos ecolgicos de los Moluscos de la
Scyllaea pelagica Linnaeus, 1758
20, 22 Sonda de Campeche, Mx. Tesis de
Cratena pilata (Gould, 1870)
22 licenciatura. Facultad de Ciencias. UNAM.123
Glaucus atlanticus Forster, 1777
20, 22 p.
Cerberilla tanna Ev. Marcus & Er. Marcus, 1960
22 Cruz-brego, F. M., A. Toledano-Granados y F.
Spurilla neapolitana (delle Chiaje, 1844)
18, 21, 22 Flores-Andolais. 1994. Ecologa comunitaria de
Spurilla sp. Bergh, 1864
22 los gasterpodos marinos (Mollusca:
Fiona pinnata (Eschscholtz, 1831)
22 Gastropoda) en Isla Contoy. Rev. de Biol.
Thecosomata Trop., 42:549-556.
Cavolinia inflexa (Lesueur, 1813)
14 Escobar de la Llata, F. 1995. Moluscos de la
Cavolinia gibosa (d'Orbigny, 1834)
3, 20 plataforma y talud continentales de la
Cavolinia tridentata (Forskl, 1775)
3, 20, 22 Pennsula de Yucatn: distribucin y hbitos.
Cavolinia uncinata (Rang, 1829)
3, 14, 20, 22 Tesis de Maestra. Facultad de Ciencias,
Clio pyramidata Linnaeus, 1767
14, 22 UNAM. 70 p.
Creseis acicula (Rang, 1828)
3, 14, 20, 22 Flores-Andolais, F., A. Garca-Cubas y A.
Creseis virgula (Rang, 1828)
14 Toledano-Granados. 1988. Sistemtica y
Cuvierina columnella (Rang, 1827)
22 algunos aspectos ecolgicos de los moluscos
Diacavolinia longirostris (Blainville, 1821)
14, 22 de la Laguna de la Mancha, Veracruz, Mxico.

36
Estudios sobre Malacologa y Conquiliologa en Mxico

An. Inst. Cienc. Del Mar y Limnol. Univ. Nal. Pizaa, A. 1990. Moluscos arrecifales de Antn
Autn. Mxico. 15(2): 235-258. Lizardo, Veracruz. Un enfoque biogoegrfico.
Garca-Cubas, A. y M. Reguero. 1990. Moluscos Tesis de Licenciatura. Facultad de Ciencias,
del sistema Lagunas Tupilco-Ostion, Tabasco, UNAM. 62 p.
Mxico: Sistemtica y ecologa. An. Inst. Cienc. Prez-Rodrguez, R. 1997. Moluscos de la
del Mar y Limnol. Univ. Nal. Autn. Mxico. 17 plataforma continental del Atlntico mexicano.
(2): 309-343. Universidad Autnoma Metropolitana. Mxico.
Garca-Cubas, A. y V. Antoli. 1983. Sistemtica y 260 p.
ecologa de moluscos en las lagunas costeras Quintana, J. 1991. Resultados del Programa de
Carmen y Machona, Tabasco, Mexico. An. Inst. Investigaciones en arrecifes Veracruzanos del
Cienc. Del Mar y Limnol. Univ. Nal. Autn. Laboratorio de Sistemas Bentnicos Litorales.
Mxico. 12 (1): 145-198. Hidrobiologa. 1 (1):73-79.
Garca-Cubas, A., F. Escobar, L. Gonzlez y M. Reguero, M. y Garca-Cubas, A. 1989. Moluscos
Reguero. 1990. Moluscos de la Laguna de de la Laguna de Alvarado, Veracruz:
Mecoacan, Tabasco, Mexico: Sistemtica y Sistemtica y ecologa. An. Inst. Cienc. Del Mar
ecologa. An. Inst. Cienc. del Mar y Limnol. y Limnol. Univ. Nal. Autn. Mxico. 16 (2): 279-
Univ. Nal. Autn. Mxico. 17 (2): 309-343. 306.
Garca-Cubas, A., M. Reguero y R. Elizarraras. Reguero, M. y Garca-Cubas, A. 1993. Moluscos
1992. Moluscos del Sistema Lagunar Chica- de la Laguna Pueblo Viejo, Veracruz, Mxico:
Grande, Veracruz, Mexico: Sistemtica y Sistemtica y ecologa. An. Inst. Cienc. del Mar
ecologa. An. Inst. Cienc. Del Mar y Limnol. y Limnol. Univ. Nal. Autn. Mxico. 20 (1): 77-
Univ. Nal. Autn. Mxico. 19 (1): 71-101. 104.
Granados-Berber, A. A., 1994. Zooplancton, Rosenberg, G. 2005. Malacolog 4.0: A database
moluscos, crustceos y peces del sistema of Western Atlantic marine Mollusca. [WWW
lagunar Carmen-Pajonal, Tabasco, Mxico: database (version 4.1.0)]
composicin, abundancia y distribucin durante URL http://data.acnatsci.org/wasp
un ciclo anual (septiembre de 1986 a agosto de Strenth, N. E. y J. E. Blankenship. 1977. Notes
1987). Tesis de Maestra. Facultad de on Sea Hare of South Texas. Veliger. 20 (2):98-
Ciencias, UNAM. 139 p. 100
Hermosillo, A. 2003. New distributions records for Tovar, E., G. Horta-Puga y G. Acosta 2000.
opistobranch mollusks for Bahia de Banderas, Metales pesados en Aplysia dactylomela en
Mexico. The Festivus. 35 (3): 2003 21-28. dos arrecifes de Veracruz. 1er Congreso
Hermosillo, A. & D. Behrens. 2005. The Nacional sobre Arrecifes de Coral. Veracruz,
opistobranchs fauna (Gastropoda, Mxico
Opisthobranchia) of the Mexico Status of Tucker, A. 1995. A field Guide to shells. Atlantic
Colima, Michoacn and Guerrero: filling in the and Gulf Coasts and the West Indies. 4
faunal Gap. Vila Malacologica 3:11-22. edition. Houghton Miffin Company. New York.
Hermosillo, A., D. Behrens y E. Ros. 2006. 250 p.
Opistobranquios de Mxico. Gua de babosas Valds, A., J. Hamann, D. Behrens & A. DuPont.
marinas del Pacifico, Golfo de California y las 2006. Caribbean Sea Slugs. A field guide to the
islas ocenicas. CONABIO. Mxico. 143 p. opisthobranch molluscs from the tropical
Hermosillo, A. & A. Valdes. 2004. Two new nortwestern Atlantic. Sea Challengers. 1a ed.
species of Dorid Nudibranchs (Mollusca, Washington. 289 p.
Opisthobranchia) from Bahia de Banderas and Wiley, G., R. Circ & J. Tunell. 1982. Mollusca of
La Paz, Mexico. Proceedings of the California the Rocky shores of East Central Veracruz
Academy of Science. 55 (28): 550-560. State, Mexico. The Nautilus. 96:55-61.
Marcus, Ev. 1972. On the Anaspidea Zamora-Silva, B. A. 2003. Opistobranquios
(Gastropoda: Opisthobranchia) of the Warm bnticos de La Gallega, Veracruz, Mxico.
Waters of the Western Atlantic. Bulletin of Tesis de Licenciatura. Facultad de Estudios
Marine Science 22 (4): 841-74 Superiores de Iztacala. 110 p.
Ortigosa-Gutirrez, J. D. 2005. Riqueza y Zamora-Silva, B. A., F. Cruz y M. Reguero. 2002.
distribucin de opistobranquios (Mollusca: Opistobranquios bnticos de Punta Mocambo,
Gastropoda: Opistobranchia) de la laguna Veracruz, Mxico. Abstracts 49 Annual Meeting
arrecifal de Isla Verde, Veracruz. Tesis de of the South Western Association of Naturalist.
Licenciatura. Facultad de Ciencias. UNAM. 54 UAEM, Cuernavaca, Morelos. 25-27 Abril,
p. 2002. 47 p.

37
lvarez-Romo, J. C., M. A., Ortiz-Arellano, L. M. Flores-Campaa y F. Arbola-Gonzlez. 2007. Moluscos de la Isla San Ignacio de la Baha de
Navachiste, Sinaloa, Mxico. pp 38-40. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M,
Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

MOLUSCOS DE LA ISLA SAN IGNACIO DE LA BAHA DE NAVACHISTE, SINALOA. MXICO

lvarez-Romo, Julio Cesar, Ortiz-Arellano, Mnica Anabel, Flores-Campaa, Luis Miguel y Arbola-
Gonzlez, Francisco.
Laboratorio de Invertebrados y Ecologa del Bentos. Facultad de Ciencias del Mar. Universidad Autnoma
de Sinaloa. Paseo Claussen S/N. Apdo. Postal 610. Mazatln, Sinaloa. Mxico.
m_anabell705@hotmail.com
Palabras clave: Moluscos, Baha de Navachiste, Isla San Ignacio.

INTRODUCCIN E-VI) y tres en la zona protegida que presenta


La isla San Ignacio es una barrera arenosa que condiciones de ambiente estuarino-lagunar (E-I,
delimita al Sistema estuarino lagunar conocido E-II y E-III). En la zona protegida el rea de
como baha de Navachiste, cuenta con muestreo se delimit utilizando un transecto en
aproximadamente 23 Km de largo y ancho que banda de 25X1 m colocado en la zona
varia entre 2.9 Km y 200 m; la isla da lugar a dos intermareal de la isla, mientras que para la zona
bocas de comunicacin directa con el Golfo de expuesta se realizaron arrastres por 10 min de
California, Ajoro al norte y Vasiquilla al sur. Su tiempo utilizando una red de 12 m de ancho y
localizacin geogrfica est determinada por las dos de alto (red tipo chango); en ambas zonas
coordenadas 108 52' 51" y 109 01' 53" al este las artes de pesca se colocaron
de Greenwich de los 25 25' 13" y 25 26' 34" al perpendicularmente a la lnea de costa.
norte del Ecuador. Su formacin es de arenas de
grano grueso a fino, depositado en antiguas
lneas de costa, con manglar en su litoral, as
como limos y arcillas (Ecoproyectos, 2000).
La Baha de Navachiste es el cuerpo
costero ms importante del municipio de
Guasave, en el Estado de Sinaloa, con un rea
aproximada de 22,302 ha; est conformado por
esteros, islas e islotes y dos pequeas bahas
llamadas San Ignacio y Macapule; se caracteriza
por su riqueza pesquera y aunque los crustceos
y peces son los grupos de mayor importancia
econmica, los ms notables por su diversidad
son moluscos y crustceos. Sin embargo, los
Figura 1.- Isla San Ignacio del Sistema
moluscos han sido escasamente estudiados en la
lagunar baha de Navachiste, Sinaloa. Ubicacin
regin, no existiendo un inventario completo y
de las estaciones de muestreo.
actualizado de las especies de la fauna
malacolgica. El presente trabajo se realiz con
Los muestreos fueron directos estimando
la finalidad de ampliar la informacin de los
visualmente la abundancia y riqueza de los
moluscos de la zona intermareal de las islas de la
moluscos y se colectaron de cada especie de
baha Navachiste
acuerdo a su abundancia de uno a cinco
organismos, en la zona intermareal se registraron
MATERIALES Y MTODOS
tanto los moluscos epifaunales (localizados en la
El trabajo se realiz en las islas de la baha
superficie del sustrato) como los infaunales
Navachiste, ubicada geogrficamente entre los
(localizados dentro del sustrato), para este ltimo
25 22 y 25 35 de latitud norte y los 108 42 y
se escarb aproximadamente de 10 a 15 cm de
108 56 de longitud oeste (Figura 1).
profundidad. Cada muestra obtenida fue
Se realizaron seis muestreos en la zona
depositada en una bolsa de plstico con su
intermareal de la isla San Ignacio, durante el
respectiva etiqueta con datos de la colecta
periodo anual de enero a noviembre de 2006,
correspondiente (fecha, hora, estacin y
con intervalo de colecta cada dos meses y
observacin) y fueron trasportados al laboratorio
programados durante la bajamar en mareas
donde fueron conservadas en congelacin hasta
vivas, se establecieron seis estaciones de colecta
su identificacin taxonmica.
a lo largo de la isla, en zonas distintas desde el
punto de vista oceanogrfico; tres en la zona
expuesta a las condiciones marinas (E-IV, E-V y

38
Estudios sobre Malacologa y Conquiliologa en Mxico

La identificacin se efectu utilizando literatura La familia ms representativa fue


especializada sobre moluscos (Keen, 1971; Muricidae de la clase Gastropoda, con cinco
Abbott, 1974; Villarroel, 1986; Skoglund, 1991 y gneros y cinco especies, seguida de Buccinidae
1992; Lindner, 2000; Wye, 2000 y FAO, 1995). El con tres gneros y cuatro especies. En Bivalvia
arreglo sistemtico se efectu de acuerdo con el las familias Ostreidae y Veneridae presentaron
sistema de clasificacin propuesto por Skoglund dos gneros y dos especies mientras que el resto
(1991) para bivalvos y Skoglund (1992) para solo registraron un gnero y una especie. Y
gasterpodos y para Cephalopodos FAO (1995). finalmente la clase Cephalopoda estuvo
Las especies identificadas se integraron a la representada por dos familias, dos gneros y dos
Coleccin de Moluscos de las islas del Golfo de especies de las cuales el calamar (Loligo
California de la Universidad Autonoma de Sinaloa opalescens) fue el ms abundante de la clase
(COMUAS), con sede en elLaboratorio de mientras que el Pulpo (Octupus digueti) fue
Invertebrados y Ecologa del Bentos, de la ocasional al registrar un solo individuo.
Facultad de Ciencias del Mar, en Mazatln,
Sinaloa. (COMUAS). Tabla 1.- Listado de las especies registradas.
Clase BIVALVIA
RESULTADOS Y DISCUSIN Grandiarca grandis (Broderip & Sowerby, 1829).
Mytella guyanensis (Lamarck, 1819)
Los resultados preliminares de los moluscos de Mytella strigata (Hanley, 1843)
la isla San Ignacio exponen un registro de 5,245 Atrina maura (Sowerby, 1835)
individuos que se distribuyeron en tres clases Isognomon (Melina) janus Carpenter, 1857
(Gastropoda, Bibalvia y Cephalopoda), con 20 Saccostrea palmula (Carpenter, 1857)
Crassostrea corteziensis (Hertlein, 1951)
familias, 31 gneros y 40 especies (Figura 2 y Carditamera affinis Sowerby, 1833.
Tabla 1). Megapitaria aurantiaca (Sowerby, 1831)
Megapitaria squalida (Sowerby, 1835)
Dosinia (Dosinia) ponderosa (Shumacher, 1817)
Familia Gneros Especies Chione (Chione) californiensis (Broderip, 1835)
23 Chione (Iliochione) subrugosa (Word, 1828)
25 Protothaca (Tropithaca) grata (Say, 1831)
18
Laevicardium elatum (Sowerby, 1833)
20
15
Clase GASTROPODA
15 11
Diodora digueti (Mabille, 1895)
10
Nerita (Ritena) scabricosta Lamarck, 1822
8
Nerita (Theliostyla) funiculata Menke, 1851
10
Neritina sp Lamarck, 1816
2 2 2
Littoraria (Bulimilittorina) aberrans (Philippi, 1846)
5
Cerithium (Thericium) stercusmuscarum Valenciennes,
1833
0 Crepidula incurva (Broderip, 1834)
Gastropoda Bivalvia Cephalopoda
Crepidula onyx Sowerby, 1824
Figura 2.- Distribucin de las familias, gneros y Crucibulum (Crucibulum) lignarium (Broderip, 1834)
Crucibulum (Crucibulum) scutellatum (Wood, 1828)
especies en las tres clases de moluscos. Crucibulum (Crucibulum) spinosum (Sowerby, 1824)
Natica (Naticarius) chemnitzii Pfeiffer, 1840
La clase Gastropoda fue la mas Chicoreus (Phyllonotus) erythrostomus Swainson, 1831)
representativa con el 61.3%, seguido por Bivalvia Hexaplex nigritus (Philippi, 1845).
Eupleura muriciformis (Broderip, 1833)
con 32.8% y por ltimo a los cefalpodos con Stramonita haemastoma biserialis (Blainville, 1832)
5.8%. En gasterpodos los ms abundantes Thais (Thaisella) kiosquiformis (Duclos, 1832)
fueron Nerita funiculata (14.3%), Certhium Cantharus (Solenosteira) gatesi (Berry, 1963)
stercusmuscarum (14.1%), Littoraria aberrans Nassarius gallegosi Strong & Hertlein, 1937
Nassarius luteostomus (Broderip & Sowerby, 1829)
(12.5%) y Nasarius luteustomus (12.5%). Las Fusinus ambustus (Gould, 1853)
dominantes fueron N. funiculata y C. Oliva (Strephona) spicata melchersi Menke, 1851
stercusmuscarum quienes representan el 28.5% Terebra armillata Hinds, 1844
de la comunidad de moluscos. La abundancia por
estacin, la mayor fue la E-II (41.8%), seguida Clase CEPHALOPODA
Octopus (Octopus) digueti Perrier & Rochebrune, 1894.
por E-III (26.3%) y el tercero a E-I (24.2%). Por Loligo opalescens Berry, 1911
su frecuencia de aparicin, N. scambricosta, N.
funiculata, Neritina sp, Eupleura muriciformis,
Natica chemnistzii, L. aberrans y N. luteustomus. El presente estudio presenta una de las
primeras contribuciones al conocimiento

39
Estudios sobre Malacologa y Conquiliologa en Mxico

taxonmico y ecolgico del molusco de la isla Someros De La Baha De Loreto, B.C.S.


San Ignacio de la Baha Navachiste. El elenco Mxico, Ocenides. 15(2):91-115.
taxonmico registrado en el presente trabajo Keen, A.M. 1971. Sea Shells Of Tropical West
tiene un valor relativamente homogneo, si se America Stanford Univ. Press; Ciudad, 2
compara con los registro de otros autores para Edition. 1064 p.
isla y sistema lagunar del Golfo de California. A Lindner G. 2000. Manuales De Identificacin
nivel de grupo, la composicin taxonmica Moluscos Y Caracoles De Los Mares Del
registrada presenta una proporcin similar al de Mundo. Nueva Edicin. Ed. Omega, S.A.
otros cuerpos insulares y ecolgicamente Barcelona. 322 Pp. Infraestructura Pesquera.
lagunares, en los que se presenta un claro Direccin De Estudios Y Proyectos.
predominio de gasterpodos sobre bivalvos con Subsecretara De Pesca. Secretara De Medio
escasa presencia de cefalpodos, inclusive Ambiente, Recursos Naturales Y Pesca.
ocasionales para este ltimo grupo (Gonzlez- Mxico.
Medina et al., 1999; Holgun-Quiones et al., Salgado-Barragan, J. 1993. Caracterizacin De
2000; Gonzlez-Medina, 2004; Salgado- Las Comunidades De Macromoluscos Y
Barragn, 1993; Daz-Gaxiola y Arzola-Gonzlez, Crustceos Decapados Del Sistema Lagunar
2000 y Zayaz-Estrada y Castillo-Fierro, 1998). De Ensenada Del Pabelln, Sinaloa, Mxico:
Composicin, Taxonoma, Diversidad,
LITERATURA CITADA Abundancia Y Distribucin. Tesis De Maestra.
Abbott, R.T. 1974. American Seashells. The Inst. Ciencias Del Mar Y Limnol. Unam.
Marine Mollusca of The Atlantic And Pacific Skoglund, C. 1991. Additions To The Panamic
Coast Of North America. Van Nostrand Province Bivalve (Mollusca) Literature 1971 To
Reinhold Co. 2 Ed., New York. 666 p. 1990. The Festivus 22: 1-74.
Daz-Gaxiola, J.M y J.F. Arzola-Gonzlez. 2000. Skoglund, C. 1992. Additions To The Panamic
Sistema Lagunar Topolobampo: Inventario Province Gastropod (Mollusca) Literature 1971
Faunstico Para El Establecimiento Preliminar To 1992. Festivus 24 (Suppl.): 1-169.
Como rea Natural Protegida. Ambiente Y Villaroel, M. 1986. Caracteres Utilizados Para
Ecologa En Sinaloa. pp 92-96. Determinar Moluscos. Mem. Ii. Reun.
Ecoproyectos (2000). Manifestacin De Impacto Malacologa Y Conquiliologa. Facultad De
Ambiental, Modalidad Particular, Para La Ciencias Del Mar. Unam. 88-110 pp.
Rehabilitacin De La Zona Estuarina De La Wye, K. R. (2000). The Enciclopedia Of Shells.
Baha De Navachiste, Sinaloa. Direccin Publisher By Chartwell Books. Edison, New
General De Infraestructura Pesquera. Direccin Jersey Usa.
De Estudios Y Proyectos. Subsecretara De Zayas-Estrada, R. & A. L Castillo-Fierro. 1998.
Pesca. Secretara De Medio Ambiente, Moluscos De La Baha De Topolobampo Y
Recursos Naturales Y Pesca. Mxico. Costas Adyacentes. Tesis Licenciatura.
Gonzlez-Medina, F.J. 2004. Variacin Espacio Instituto Tecnolgico De Los Mochis. 132 p.
Temporal De Algunos Macroinvertebrados
Bentnicos Del Archipilago Espritu Santo,
B.C.S., Mxico. Tesis Maestra. Centro
Interdisciplinario De Ciencias Marinas. Instituto
Politcnico Nacional. 78 p.
Gonzalez-Medina, F. J; R. Cazarez-Garcia; A.
Zepeda-Canizalez y L. A. Gonzalez-
Magdaleno. 1999. Inventario Faunstico De Los
Moluscos Y Crustceos Decapados De La
Zona Intermareal De La Baha De Mazatln,
Sinaloa. Mxico. Tesis Profesional. Facultad De
Ciencias Del Mar. Uas. 93 p.
Gua Fao Para La Identificacin De Especies
Para Los Fines De La Pesca. Pacfico Centro
Oriental. Vol. I. Plantas E Invertebrados. Fao,
Roma, 1995. 646 p.
Holguin-Quiones, O., H. Wright y E. Felix-Pico.
2000. Moluscos Intermareales Y De Fondos

40
Magaa-Cubillo, J., J., Espinosa, J. Ortea y J. A., Martnez. 2007. Moluscos Margineliformes de Mxico. pp 41-42. En: Estudios sobre la Malacologa y
Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

MOLUSCOS MARGINELIFORMES DE MXICO

Magaa-Cubillo, Julio1, Espinosa, Jos2, Ortea, Jess3, Martnez, Jos Antonio4.


1
Universidad Estatal a Distancia Sabanilla, Costa Rica. 2Instituto de Oceanologa, Ave 1 n 18406, Playa,
La Habana, Cuba. 3Dpto. BOS, Universidad de Oviedo, Espaa. 4Laboratorio de Zoologa. Facultad de
Estudios Superiores Iztacala, UNAM. Av. de los Barrios, s/n, Tlalnepantla, Estado de Mxico. C.P. 54090.
1
eubranchus@yahoo.com; 2espinosa@oceano.inf.cu; 3kankel@teleline.es; 4jamp55@prodigy.net.mx
Palabras Clave: Marginellidae, Cystiscidae, Mxico, Golfo de Mxico, Pacfico.

INTRODUCCIN un asterisco ( * ) para la referencia de la


Los moluscos margineliformes comprenden las coleccin del ICML.
Familias Marginellidae Fleming, 1828 y
Cystiscidae Stimpson, 1865. Ambas fueron SISTEMATICA
consideradas previamente como Marginellidae y I. Costa Pacfica
separadas por Coovert y Coovert (1995),
poniendo a los segundos ms estrechamente Orden Neogastropoda
relacionados con la Superfamilia Olivoidea Familia Marginellidae Fleming, 1828
Latreille, 1825. Gnero Volvarina Hinds, 1844
Los individuos de la familia Marginellidae Subgnero Volvarina s. s.
presentan la caracterstica de poseer desarrollo
larvario directo, por lo que tienen poca capacidad 1. Volvarina (Volvarina) taeniolata taeniolata
de dispersin, lo cual los hace presentar Mrch,1860 2, 3
caracteres de endemismo en reas limitadas por
alguna barrera geogrfica que interrumpa la Familia Cystiscidae Stimpson, 1865
continuidad arrecifal como la desembocadura de Subfamilia Cystiscinae Stimpson, 1865
un ro. Este fenmeno de endemismo se ha Gnero Cystiscus Stimpson, 1865
encontrado en reas estudiadas con detalle: el
Caribe arrecifal costarricense (Espinosa y Ortea 1. Cystiscus jewettii (Carpenter, 1857) 3
2001) y la pennsula de Guanahacabibes en 2. Cystiscus politulus (Dall, 1919) 2, 3
Cuba (Espinosa et al. 2005). Los Cystiscidos no
presentan esta singularidad. Subfamilia Persiculinae Coovert y Coovert, 1995
Gnero Persicula Schumacher, 1817
MATERIALES Y MTODOS
Se tom en cuenta la revisin de las colecciones 3. Persicula bandaera Coan y Roth, 1965 2, 3
de malacologa de la Universidad Autnoma de 4. Persicula hilli (M. Smith, 1950) 2, 3
Mxico UNAM, concretamente en el Instituto de 5. Persicula imbricata (Hinds, 1844) 2, 3, *
Ciencias del Mar y Limnologa ICML (coleccin 6. Persicula phrygia (Sowerby, 1846) 2, *
DR. Antonio Garca Cubas). La coleccin del
Instituto de Biologa no contaba con Gnero Gibberula Swainson, 1840
especimenes de dichas familias y La Coleccin
Biolgica de la Secretaria de Marina y Armada 7. Gibberula polita (Carpenter, 1857) 2, 3
de Mxico no fue considerada por no contar con 8. Gibberula subtrigona (Carpenter, 1864) 2, 3
una clasificacin bsica del Phillum.
Se hizo tambin una revisin exhaustiva de Subfamilia Granulininae Coovert y Coovert, 1995
literatura especializada para el Pacfico: Keen Gnero Granulina Jousseaume, 1888
(1971), Skoglund (2002) y para el Atlntico
mexicano: Garca-Cubas y Reguero (2004). 9. Granulina margaritula (Carpenter, 1857) 2

RESULTADOS Y DISCUSIN II. Costa Atlntica:


Doce especies de la familia Marginellidae (1 para
el Pacfico y 11 en el Atlntico), y 9 Cystiscidos Orden Neogastropoda
(nicamente en el Pacfico) fueron determinadas Familia Marginellidae Fleming, 1828
para las costas mexicanas como estn descritas Gnero Dentimargo Cossmann, 1899
en la sistemtica a continuacin, junto con las
referencias de su reporte para Mxico con el 1. Dentimargo aureocinctus (Sterns, 1872) 1
nmero correspondiente en la lista de literatura y 2. Dentimargo eburneolus Conrad, 1834 1

41
Estudios sobre Malacologa y Conquiliologa en Mxico

LITERATURA CITADA
Gnero Hyalina Schumacher, 1817 Coovert, G. y H. Coovert. 1995. Revision of the
3. Hyalina (Hyalina) pallida (Linn, 1758) Supraspecific Classification of Marginelliform
1, * Gastropods. The Nautilus 109(2&3): 43-110.
Espinosa, J. y J. Ortea. 2001. Moluscos del Mar
Gnero Prunum Hermannsen, 1852 Caribe de Costa Rica: desde Cahuita hasta
Gandoca. Avicennia (Supl. 4): 1-77.
4. Prunum apicinum (Menke, 1828) 1, * Espinosa, J., J. Ortea, M. Caballer, y L. Moro.
5. Prunum carneum (Storer, 1837) 1 2005. Moluscos marinos de la pennsula de
6. Prunum guttatum (Dillwin, 1817) 1, * Guanahacabibes, Pinar del Ro, Cuba, con la
7. Prunum labiatum (Valenciennes, 1841) 1, * descripcin de nuevos taxones
8. Prunum pruniosum (Hinds, 1844) 1 Garca Cubas, A. y M. Reguero. 2004. Catlogo
Ilustrado de moluscos gasterpodos del Golfo
Gnero Volvarina Hinds, 1844 de Mxico y Mar Caribe. UNAM. 1-168.
Keen, A. M. 1971. Sea Shells of Tropical West
9. Volvarina abbreviata (C.B Adams, 1850) 1, * America; Marine Mollusks from Baja California
10. Volvarina albolineata Orbigny, 1842 to Peru, 2nd ed. Stanford Univ. Press, Stanford,
1 California. 1064 p.
11. Volvarina avena (Kiener, 1834) Magaa, J., J. Espinosa y J. Ortea. 2003.
1, * Descripcin de dos nuevas especies del
Gnero Prunum Hermannsen, 1852 (Mollusca:
nicamente 6 especies de las reportadas para Gastropoda. Marginellidae) del Caribe y el
Mxico estn representadas en la coleccin del Pacfico de Costa Rica. Avicennia 16: 121-128.
ICML ( * ), Todas se trataban de conchas. Para Skoglund, C. 2002. Panamic Province Molluscan
un estudio completo se requiere recolectar Literature. Additions and changes from 1971
material vivo considerar dibujo y fotografa de los through 2001. The Festivus vol. XXXLLL.
animales in situ, y estudiar su anatoma, en Supplement: 1-286.
ambas familias.
Solo 1 especie de Marginellidae ha sido
reportada para la costa Pacfica y ningn
Cystiscido en la costa Este, por lo que tambin
es recomendable implementar mtodos de
recolecta ms eficaces como el raspado de
fondos rocosos, y la revisin inmediata de los
dragados de fondos blandos con el objetivo de
poder encontrar animales vivos, esto para ambas
costas. En comparacin con inventarios de
dichas familias realizados en otros pases,
tenemos que para el Pacfico costarricense se
lleg a un total de 7 Marginellidos y 2 Cystiscidos
(Magaa et al. 2003); y en el inventario realizado
en la provincia cubana de Guanahacabibes 14
Marginellidos y 11 Cystiscidos (Espinosa et al,
2005); por lo que un inventario ms detallado
debera ser exitoso en Mxico. Una cantidad de
al menos 3 especies no pudieron ser
determinadas en la coleccin del ICML, por lo
que se espera poder seguir colectando ms
individuos y determinar si se trata de especies
desconocidas para la Ciencia, as como aportar
nuevos datos de anatoma interna de los
animales ya descritos, pues sus descripciones
han sido generalmente basadas nicamente en
la anatoma de la concha.

42
Flores-Campaa, L. M., M. A., Ortiz-Arellano, J. F., Arzola-Gonzlez, F. J., Gonzlez-Medina, E., Cortez-Acosta, y D., Rodrguez-Garca. 2007. Los
quitones de las Islas de la costa de Sinaloa, Mxico. pp 43-45. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C.,
Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

LOS QUITONES DE LAS ISLAS DE LA COSTA DE SINALOA, MXICO

Flores-Campaa, Luis Miguel, Ortiz-Arellano, Mnica Anabel, Arzola-Gonzlez, Juan Francisco,


Gonzlez-Medina, Felipe de Jess, Cortez-Acosta, Eduardo y Rodrguez-Garca, Dagoberto. Laboratorio
de Invertebrados y Ecologa del Bentos, Facultad de Ciencias del Mar, Universidad Autnoma de Sinaloa.
Paseo Claussen s/n Mazatln, Sinaloa. Tel./Fax: (669) 985-02-82. lcampana@uas.uasnet.mx.
Palabras clave: Quitones, islas, costas de Sinaloa, poliplacforos.

INTRODUCCIN archipilago que se localiza entre los 23 13' y


Los quitones son moluscos poliplacoforos que 23 15' de latitud norte y los 106 27' y 106 28'
viven sobre las rocas, principalmente en aguas de longitud oeste al sur del estado de Sinaloa
marinas poco profundas, desde la lnea de frente a la ciudad y puerto de Mazatln. Por su
mareas hasta profundidades moderadas. Se parte, la baha de Navachiste es el sistema
adhieren fuertemente y se arrastran lentamente estuarino lagunar ms importante del municipio
mediante el pie. Estas caractersticas biolgicas de Guasave, al norte de Sinaloa. Se localiza
los hacen muy vulnerables a la depredacin entre los 25 22 y 25 35 de latitud norte y los
antropognica, sobre todo a las especies que 108 42 y 108 56 de longitud oeste, con una
habitan en la zona litoral. Sin embargo, el superficie de 22,302 hectreas y conformado por
conocimiento de los quitones en Mxico es esteros, bahas y 15 cuerpos insulares, entre
limitado, no obstante que algunas especies han ellos las islas Tesobiate, Nescoco, Guasayeye,
sido mencionadas en varias contribuciones e San Lucas, Huitussera, El Metate, La Mapachera
inventarios malacolgicos. y Las Chivas (Figura 1).
El nmero de especies de quitones
reportadas y su distribucin geogrfica en la
regin de las costas mexicanas del Pacfico no
es completamente conocido, particularmente en
aquellas especies que habitan en islas (Reyes-
Gmez, 2003). En las costas de Sinaloa se
localizan un gran nmero de cuerpos insulares
que forman parte del rea de Proteccin de Flora
y Fauna Islas del Golfo de California (DOF,
02/08/1978; DOF, 07/06/2000) y donde los
quitones han sido escasamente estudiados. El
objetivo del presente trabajo es elaborar un
resumen de la informacin registrado en la
literatura acerca de la distribucin de las
especies de quitones y su ocurrencia en la zona Figura 1.- Localizacin geogrfica de las islas de
intermareal de las islas de las costas de Sinaloa. las bahas de Navachiste y Mazatln, Sinaloa.

MATERIALES Y MTODOS RESULTADOS Y DISCUSIN


El presente trabajo se basa principalmente en la Los quitones registrados en las islas de las
revisin de estudios de moluscos realizados en costas de Sinaloa pertenecen a dos familias:
las islas de la baha de Mazatln (Gonzlez- Ischnochitonidae Dall, 1889, con dos especies y
Medina et al., 1998; Cortez-Acosta y Rodrguez- Chitonidae Rafinesque, 1815, con cuatro
Garca, 2005) y en las islas de la baha de especies. Se registraron cinco gneros:
Navachiste (Ortiz-Arellano, 2005). Los quitones Lepidozona Pilsbry, 1892; Radsiella Pilsbry,
identificados estn depositados en la Coleccin 1892; Stenoplax Dall, 1879; Tonicia Gray, 1847 y
de Moluscos de las Islas del Golfo de California Chiton Linnaeus, 1767. En total se han registrado
de la Universidad Autnoma de Sinaloa seis especies de quitones de la zona intermareal
(COMUAS), con sede en el Laboratorio de (Tabla 1).
Invertebrados y Ecologa del Bentos (LIEB) de la
Facultad de Ciencias del Mar, en Mazatln,
Sinaloa.
Las islas Pjaros, Venados y Lobos,
tambin conocidas como las Tres Islas de la
baha de Mazatln, forman un pequeo

43
Estudios sobre Malacologa y Conquiliologa en Mxico

Tabla 1.- Distribucin de las especies de quitones insulares registradas en las costas de Sinaloa, Mxico.

Especie Isla Distribucin


Lepidozona serrata Nescoco, San Lucas, Las Chivas, Cabo San Lucas, Baja California Sur,
(Carpenter, 1864) Huitussera, El Metate, Guasayeye y a Puertecitos y hacia el este de
Tesobiate de la baha de Navachiste Baha Kino, Sonora.
Radsiella muscaria Pjaros de la baha de Mazatln De Mazatln al suroeste de Mxico
Reeve, 1847
Stenoplax limaciformis Pjaros y Venados de la baha de De Puertecitos y La Libertad,
(Sowerby, 1832) Mazatln Mxico, a Per. Golfo de California;
Isla Tiburn e Isla Carmen
Tonicia forbesii Carpenter, Pjaros, Venados y Lobos de la baha De Mazatln a Panam
1857 de Mazatln
Chiton albolineatus Pjaros, Venados y Lobos de la baha De. Mazatln, Sinaloa a Acapulco,
Broderip y Sowerby, 1829 de Mazatln Guerrero, Mxico
Chiton articulatus Pjaros, Venados y Lobos de la baha Mazatln, Sinaloa a Puerto ngel y
Sowerby, 1832 de Mazatln; Guasayeye, Nescoco, Las Salina Cruz, Oaxaca. Islas
Chivas, Huitussera y Tesobiate de la Revillagigedo: Isla Socorro e Isla
baha de Navachiste Clarin

En las costas de Sinaloa se localizan las islas Tiburn y Carmen y Lepidozona serrata
mas de 400 cuerpos insulares de diversos en las islas Espritu Santo y Coronado dentro del
tamaos, orgenes varios y la mayora muy golfo de California, as como Chiton articulatus en
cercanos a la zona costera (Flores-Campaa et las islas Socorro y Clarin del Archipilago
al., 2003). Las islas del norte de Sinaloa, Revillagigedo, tambin fueron registradas en el
localizadas dentro de cuerpos costeros presente trabajo. La presencia de Radsiella
semicerrados como la baha de Navachiste, se muscaria en isla Pjaros y Tonicia forbesii y
encuentran en un ambiente con condiciones Chiton albolineatus en las islas Pjaros, Venados
estuarino-lagunares, donde slo se colectaron y Lobos de la baha de Mazatln, Sinaloa, se
dos especies; Chiton articulatus y Lepidozona considera un nuevo registro en reas insulares.
serrata. En cambio, en las islas de la baha de Los pocos estudios disponibles en las
Mazatln, ubicadas en un ambiente enteramente reas insulares estn enfocados sobre las islas
marino se registraron cinco especies; Stenoplax del Archipilago Revillagigedo (Ferrerira, 1983;
limaciformis, Radsiella muscaria, Tonicia forbesii, Gonzlez-Nakawaga y Snchez-Nava, 1986;
Chiton albolineatus y C. articulatus Holgun-Quionez et al., 1992). De un total de 38
especies registradas en 29 islas del Pacfico
Entre estas especies se tiene que Chiton oriental, se tienen 11 especies en las islas
articulatus se observ tanto en las islas de la Revillagigedo, principalmente en las islas Socorro
baha de Navachiste (Guasayeye, Nescoco, Las y Clarin; en isla Espritu Santo, isla Coronado e
Chivas, Huitussera y Tesobiate) como en las isla San Jos, en el Golfo de California; y en isla
islas de la baha de Mazatln (Pjaros, Venados Guadalupe e isla Cedros, en la costa occidental
y Lobos). Mientras que Lepidozona serrata slo de la Pennsula de Baja California (Reyes-
se present en las islas de la baha de Gmez, 2003). Adems, ahora se incluyen las
Navachiste (Nescoco, San Lucas, Las Chivas islas Nescoco, San Lucas, Las Chivas,
Huitussera, El Metate, Guasayeye y Tesobiate). Huitussera, El Metate, Guasayeye y Tesobiate de
Las cuatro especies restantes (Stenoplax la baha de Navachiste y las islas Pjaros,
limaciformis, Radsiella muscaria, Tonicia forbesii Venados y Lobos de la baha de Mazatln, en las
y Chiton albolineatus) slo se colectaron en las costas de Sinaloa, al sureste del Golfo de
islas de la baha de Mazatln. De todas las California.
especies colectadas, Chiton albolineatus y Chiton La especie insular ms estudiada es
articulatus se consideran especies endmicas de Chiton articulatus. Su estructura poblacional,
la regin del Pacfico oriental. distribucin y situacin actual de su pesquera se
Son escasas las investigaciones sobre han descrito en las costas de Guerrero (Rojas-
los quitones que habitan en las islas de las Herrera, 1988), islas Revillagigedo (Holgun-
costas de Mxico. Reyes-Gmez (2003) Quionez y Michel-Morfin, 2002) y las las islas
menciona 38 especies insulares del Pacfico Pjaros y Venados de la baha de Mazatln
oriental, de las cuales Stenoplax limaciformis en (Flores-Campaa et al., 2005). Por las tallas que

44
Estudios sobre Malacologa y Conquiliologa en Mxico

comnmente alcanza esta especie y su relativa Flores-Campaa, L. M., M. A. Gonzlez-Montoya,


abundancia, se aprovecha su pie ancho y plano M. A. Ortiz-Arellano y J. F. Arzola-Gonzlez,
para consumo humano y sus placas son 2005. Estructura poblacional de Chiton
apreciadas para la fabricacin de artesanas, a lo articulatus Sowerby, 1832 en las islas Pjaros y
largo de las costas de Pacfico de Sinaloa hasta Venados de la baha de Mazatln, Sinaloa,
Oaxaca. La captura de Chiton articulatus es una Mxico. Anales del Instituto de Bioloa,
actividad de subsistencia que diversos grupos de Universidad Nacional Autnoma de Mxico,
habitantes de la zona costera realizan de manera Serie Zoologa 76(1): 1-15.
temporal o complementaria a otras actividades. Gonzlez-Medina, F. J., R. Cazarez-Garca, A.
No existe ningn tipo de normatividad y/o Zepeda-Canizalez y L. A. Gonzlez-
vigilancia sobre su captura y comercializacin. Magdaleno, 1998. Inventario faunstico de los
moluscos y crustceos decpodos de la zona
AGRADECIMIENTOS intermareal de las Tres Islas de la baha de
El apoyo financiero para la realizacin del Mazatln, Sinaloa, Mxico. Tesis profesional.
presente trabajo fue por parte del Fondo Mixto Facultad de Ciencias del Mar, Universidad
Gobierno de Sinaloa-CONACyT, Consejo Estatal Autnoma de Sinaloa. 93 p.
de Ciencia y Tecnologa y la Universidad Gonzlez-Nakawaga, O. y S. Snchez-Nava,
Autnoma de Sinaloa. Se agradece la 1986. Nota de moluscos como fauna de
participacin en las colectas de Efrn Rodrguez acompaamiento de crustceos de la Isla
Yuriar, Alejandra Vzquez-Cervantes, Juan Clarin, Mxico. Direccin General de
Carlos Arce Rodrguez, Felipa Sotelo Lpez, Oceanografa Naval, Investigaciones
Julio Csar lvarez Rubio y Moises Jeydan Oceanogrficas, Secretara de Marina, Baja
Angulo Franco de la Facultad de Ciencias del California, Mxico 3(1): 153-182.
Mar, UAS, as como de Andrs Martn Gngora Holguin-Quionez, O. E., Mill-Pagaza y A.
Gmez del la Unidad Sinaloa del Centro Prez-Chi, 1992. Resultados de las campaas
Interdisciplinario de Investigacin para el de muestreo 1991 para el estudio del bentos
Desarrollo Integral Regional, IPN. marino de la Isla Socorro, Revillagigedo,
Colima, Mxico. Revista Zoologa Informa.
LITERATURA CITADA Escuela Nacional de Ciencias Biolgicas.
Cortez-Acosta, E. y D. Rodrguez-Garca, 2005. Instituto Politcnico Nacional, Mxico (24) 1-20.
Contribucin al conocimiento de los quitones Holguin-Quionez, O. E. y J. E. Michel-Morfin,
Stenoplax limaciformis (Sowerby, 1832), 2002. Distribution, density and length-weigth
Radsiella muscaria (Gould, 1846), Tonicia relationship of Chiton articulatus Sowerby, 1832
forbesii Carpenter, 1857, Chiton albolineatus (Mollusca: Polyplacophora) on isla Socorro,
Broderip y Sowerby, 1829 y Chiton articulatus Revillagigedo Archipilago, Mexico. Journal of
(Sowerby, (1832) de las Tres Islas de la baha Shellfish Research 21(1): 239-241.
de Mazatln, Sinaloa, Mxico. Tesis Ortiz-Arellano, M. A. 2005. Sistemtica y ecologa
profesional. Facultad de Ciencias del Mar, de la malacofauna de la zona intermareal de
Universidad Autnoma de Sinaloa. 53 p. las islas de la baha de Navachiste, Sinaloa,
DOF, 02/08/1978. Decreto que declara la Zona Mxico. Tesis de maestra. Centro
de Reserva y Refugio de Aves Migratorias y de Interdisciplinario de Investigacin para el
Fauna Silvestre Islas del Golfo de California, Desarrollo Integral Regional, Unidad Sinaloa,
Diario Oficial de la Federacin del 2 de agosto Instituto Politcnico Nacional. 174 p.
de 1978, Mxico, D. F. Reyes-Gmez, A. 2003. Chitons in mexican
DOF, 07/06/2000. Acuerdo Secretarial que waters. Bolletino Malacologico (5): 69-82 pp.
actualiza la categora de proteccin de las islas Rojas-Herrera, A., 1988. Anlisis biolgico-
del Golfo de California. Diario Oficial de la pesquero de la cucaracha de mar (Chiton
Federacin del 7 de junio de 2000, Mxico, D. articulatus Sowerby, 1832) de Acapulco,
F. Guerrero, Mxico. En: Memorias del IX Congreso
Ferreira, A. J. 1983. The chiton fauna of the Nacional de Zoologa. Universidad Autnoma de
Revillagigedo Archipilago, Mxico. The Veliger Jurez, Tabasco y Sociedad Mexicana de
25(4): 307-322. Zoologa, Villahermosa, Tabasco. pp 151-156.
Flores-Campaa, L. M., M. A. Ortiz-Arellano y J.
F. Arzola-Gonzlez, 2003. Isla e islotes de
Sinaloa. En: Atlas de los Ecosistemas de
Sinaloa (2): 381-397.

45
Reguero, M. 2007. Catlogo ilustrado de moluscos bivalvos del Golfo de Mxico y mar Caribe: obra pstuma (II) del Dr. Antonio Garca-Cubas. 2007.
pp 46-47. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds).
Universidad de Guadalajara, Mxico. 286 p.

CATLOGO ILUSTRADO DE MOLUSCOS BIVALVOS DEL GOLFO DE MXICO Y MAR CARIBE:


OBRA PSTUMA (II) DEL DR. ANTONIO GARCA-CUBAS

Reguero, Martha
Universidad Nacional Autnoma de Mxico. Instituto de Ciencias del Mar y Limnologa. Apdo. Postal 70-
305, Mxico 04510, D. F. reguero@mar.icmyl.unam.mx.
Palabras clave: Catlogo, bivalvos, Golfo de Mxico, Mar Caribe.

INTRODUCCIN distribuyen en los litorales mexicanos del Golfo


La ltima obra escrita en la que particip el Dr. de Mxico y Mar Caribe, pues incluye la
Antonio Garca-Cubas, fue de catalogacin de sistemtica y diagnosis de 202 especies de la
moluscos y fue concebida para ser publicada en Clase Bivalvia, con algunas notas acerca de su
dos volmenes: uno sobre los gasterpodos distribucin local, formas de vida y hbitos
marinos de la porcin mexicana de la Provincia alimentarios.
Caribea, que sali a la venta en 2006, aunque El gran aporte del Dr. Antonio Garca-
se public en 2004, y otro relativo a los bivalvos Cubas, trabajador incansable tanto en el campo
de esa misma rea, que aqu presentamos. Con como en el laboratorio, fue haber integrado una
la publicacin de este segundo volumen, sobre obra escrita y acadmica siempre comprometido
bivalvos, el Instituto de Ciencias del Mar y con la ciencia, con el pas, con la sociedad y con
Limnologa y la Direccin General de la Universidad Nacional Autnoma de Mxico.
Publicaciones y Fomento Editorial, de la
Universidad Nacional Autnoma de Mxico, MATERIALES Y MTODOS
cumplen el propsito de reunir la Obra Pstuma 1) Recoleccin de material biolgico, datos
del Dr. Antonio Garca-Cubas, a la vez que se faunsticos y taxonmicos, a travs de:
logra el objetivo de los autores de proporcionar a a) Estudios previos de campo y
la comunidad malacolgica nacional y colegas de laboratorio y
Amrica Latina, informacin de fcil acceso sobre b) Investigaciones sobre moluscos en
un inventario de los moluscos bnticos recientes distintos ambientes naturales:
de la costa atlntica de Mxico. - Facies rocosas,
El Laboratorio de Malacologa del - Lagunas costeras,
Instituto de Ciencias del Mar y Limnologa de la - Plataforma continental,
Universidad Nacional Autnoma de Mxico - Talud continental y
(UNAM), bajo la conduccin del Dr. Antonio - Sistemas arrecifales
Garca-Cubas, desarroll durante muchos aos 2) Elaboracin de listas faunsticas
investigaciones faunsticas, taxonmicas, 3) Integracin del catlogo de bivalvos:
zoogeogrficas y ecolgicas sobre moluscos a) Caracteres generales de la Clase
marinos y salobres de los litorales de Mxico, a Bivalvia (Yonge, 1953, 1959, 1960; Stasek, 1963;
travs de proyectos internos y de intercambio Garca-Cubas, 1981; Brusca, 2003)
interinstitucional, con el apoyo de su personal b) Arreglo sistemtico de los bivalvos
acadmico y estudiantes adscritos. (Newell, 1965; Abbott, 1974; Vaugth,1989;
Estas investigaciones han sido la base Ros,1994; Daz y Puyana, 1994)
para producir catlogos completos de las 4) Elaboracin de fichas taxonmicas, que
malacofaunas recientes, con los registros incluyen:
efectuados en distintas campaas, cuencas a) Categoras taxonmicas desde nivel
hidrolgicas y facies sedimentarias de los de clase hasta especie
litorales de Mxico, con el propsito de poner al b) Autora y diagnosis de taxones supra-
alcance de coleccionistas y malaclogos especficos
especializados, guas de campo para la c) Claves de identificacin taxonmica
identificacin de moluscos. d) Nombre de la especie
La informacin generada en los ltimos e) Cita completa de la obra de
15 aos amerit un esfuerzo integrador para descripcin original
ponerla en manos del pblico interesado y evitar f) Diagnosis de la especie
as el riesgo de que quedara dispersa o indita. g) Caracteres del hbitat
As, el catlogo o gua ilustrada que aqu h) Hbitos alimentarios
presentamos servir para la ubicacin e i) Distribucin local
identificacin de moluscos bivalvos que se j) Ilustracin o fotografa de la concha

46
Estudios sobre Malacologa y Conquiliologa en Mxico

LITERATURA CITADA
RESULTADOS Y DISCUSIN Abbott, R. T. 1974. American Seashells. The
Este volumen, que comprende la sistemtica de marine Mollusca of the Atlantic and Pacific
los moluscos bivalvos del Golfo de Mxico y Mar coast of North America. 2nd ed., Van Nostrand
Caribe, es el resultado de la combinacin de Rienhold Co., New York, 666 p.
listas de especies que fueron producto de los Brusca, R. C. & G. J. Brusca, 2003.
estudios de campo realizados por los autores Invertebrates. Sinauer Associates, Inc.,
durante ms de 15 aos y del anlisis de Sunderland, 891 p.
distribucin de material malacolgico extrado de Daz, J. M. y M. Puyana. 1994. Moluscos del
facies rocosas, arrecifes coralinos, lagunas Caribe colombiano. Un catlogo ilustrado.
costeras, plataforma y talud continentales del Colciencias, Fundacin Natura, Invemar, Santa
litoral atlntico mexicano, as como de la revisin F de Bogot, 291 p.
de la literatura disponible sobre la taxonoma de Garca-Cubas, A. 1981. Moluscos de un sistema
esta Clase de moluscos. lagunar tropical en el sur del Golfo de Mxico
El lector encontrar inicialmente una (Laguna de Trminos, Campeche). An. Inst.
seccin que sintetiza los caracteres generales de Cienc. del Mar y Limnol. UNAM. Mxico, Publ.
la Clase Bivalvia, diferenciando hbitos de vida y Esp., 5: 1-182.
organizacin corporal, as como Newell, N. D. 1965. Classification of the Bivalvia.
ornamentaciones de la concha y tipos de cierre o American Museum Novitates, No. 2206: 1-25.
charnela. En un apartado subsiguiente, se listan Ros, E. C. 1994. Seashells of Brazil. Editora da
los taxones de bivalvos registrados en las Furg, Ro Grande, 367 p.
porciones mexicanas del Golfo de Mxico y Mar Stasek, C. R. 1963. Synopsis and discussion of
Caribe, incluyendo caracteres diagnsticos de the association of ctenidia and labial palps in
categoras superiores y especficas, la referencia the bivalved Mollusca. Veliger, 6 (2): 91-97.
de la descripcin original y una ilustracin de Vaugth, K. C. 1989. A classification of the living
cada especie, con notas sobre las caractersticas Mollusca. R. T. Abbott & K. J. Boss (Eds.).
del hbitat, hbitos y lmites de distribucin local. American Malacologists Inc, Melbourne,
Este volumen est integrado con la Florida, 186 p.
informacin correspondiente a una Clase, 3 Yonge, C. M. 1953. The monomyarian condition
Subclases, 5 rdenes, 22 Superfamilias, 39 in the Lamellibranchia. Trans. Roy. Soc.
Familias, 102 Gneros y 202 Especies de Edinburgh, 62: 443-478.
moluscos bivalvos.
Desde el punto de vista biogeogrfico y
ecolgico, la fauna del Atlntico Tropical
Occidental de Mxico posee caractersticas muy
particulares. Distintas especies, tanto de hbitos
costeros como ocenicos confluyen en sus
aguas. Igualmente en esta rea conviven
especies propias de las Provincias Caroliniana y
Caribea, con algunas que extienden su
distribucin hasta la Provincia Argentina. Un
elemento particular del paisaje submarino de esa
regin, en especial frente al litoral de los Estados
de Veracruz y Quintana Roo, lo conforman
extensos y diversos arrecifes coralinos, adems
de los sistemas lagunares que destacan en la
zona costera; en ambas formaciones se ha
documentado la presencia de elementos
faunsticos de distribucin restringida. stas y
otras particularidades hacen del Golfo de Mxico
y Caribe mexicano enclaves ecolgicos de
especial inters cientfico.

47
Strenth, N. E., A., Correa-Sandoval y L., McCutchen. 2007. Una revisin preliminar de caracoles terrestres de la sierra Mojada al Occidente de
Coahuila. pp 48. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds).
Universidad de Guadalajara, Mxico. 286 p.

UNA REVISION PRELIMINAR DE CARACOLES TERRESTRES DE LA SIERRA MOJADA AL


OCCIDENTE DE COAHUILA

Strenth, Ned E.1, Correa-Sandoval, Alfonso2 y McCutchen, Lynn3. 1Department of Biology, Angelo State
University, San Angelo, Texas. 2Laboratorio de Zoologa, Instituto Tecnolgico de Cd. Victoria, A.P. 175,
C.P. 87010, Cd. Victoria, Tamaulipas, Mxico. 3Department of Biology, 1100 Broadway, Kilgore College,
Kilgore, Texas. Ned.Strenth@angelo.edu
Palabras clave: Caracoles terrestres, gasterpodos, Sierra Mojada, Coahuila, revisin faunstica.

INTRODUCCIN Humboldtianidae (una especie). La presencia de


Los estudios de los caracoles terrestres del estas especies de gasterpodos terrestres en
estado de Coahuila estn restringidos a las esta regin de Coahuila es comparada con las
regiones del este y del sureste del estado distribuciones geogrficas conocidas actualmente
(Bartsch, 1906, 1926; Binney, 1865; Pilsbry, de sus congneres tanto de Mxico como del
1948, 1953, 1956). Dado el aislamiento no hay suroeste de los Estados Unidos de Amrica.
suficientes estudios en las regiones del noroeste
y el oeste del estado. Se emprendi este estudio LITERATURA CITADA
para examinar los caracoles de la regin de la Bartsch, P. 1906. The Urocoptid Mollusks from
Sierra Mojada, al occidente de Coahuila, en el the Mainland of America in the Collection of the
norte de Mxico. United States National Museum. No. 1483-
From the Proceedings of the United States
SITIO DEL ESTUDIO National Museum, Vol. XXXI, pages 100-160,
La Sierra Mojada se ubica en el Desierto de with Plates III-V.
Chihuahua (Schmidt 1979) al occidente de Bartsch, P. 1926. Three New Land Shells from
Coahuila (N 27 16 W 103 41) cerca de la Mexico. No. 2694-Proceedings United States
frontera del Estado de Chihuahua. Se eleva a National Museum, Vol. 67, Art. 22.
2450 m con la zona de ms arriba de 1500 m que Binney, W. G. 1865. Descriptions of new
se extiende aproximadamente 28 Km. de longitud species of North American land and fresh water
por 15 Km. de dimetro. Se encuentra algo shells. American Journal of Conchology 1:49-
aislada por zonas desrticas bajas, 51.
especialmente aquellas que pertenecen al Bolsn INEGI. Instituto Nacional de Estadstica,
de Mapim y la Zona del Silencio, al oeste y al sur Geografa e Informtica
(INEGI G13-3 y G13-6). (www.inegi.gob.mx/inegi/default.aspx).
G13-3, Ocampo, Carta Topogrfica, 1:250 000.
MATERIALES Y METODOS G13-6, Tlahualilo de Zaragoza, Carta
Entre 1998 y 2006, se realiz el trabajo de Topogrfica, 1:250 000.
campo. Fueron examinadas tanto la regin Pilsbry, H. A. 1948. Island Mollusks of Northern
montaosa como las zonas desrticas de la Mexico. I. The Genera Humboldtiana,
Sierra Mojada, al occidente de Coahuila. Sonorella, Oreohelix and Ashmunella.
Proceedings of the Academy of National
RESULTADOS Y CONCLUSIONES Science of Philadelphia, 100:185-203, plates
El estudio registra especies de caracoles 12,13,14.
terrestres que habitan la regin montaosa de la Pilsbry, H. A. 1953. Island Mollusks of Northern
Sierra Mojada al occidente de Coahuila, en el Mexico. II. Urocoptidae, Pupillidae,
norte de Mxico. A pesar de su reducido tamao Strobilopsidal, Vallonidae and Cionellidae.
y aparente aislamiento, esta regin del Desierto Proceedings of the Academy of National
de Chihuahua presenta una inusual elevada Science of Philadelphia, 105:133-167, plates 3-
diversidad de moluscos terrestres. Aunque este 10.
estudio se encuentra en una fase preliminar, casi Pilsbry, H. A. 1956. Island Mollusks of Northern
una docena de especies han sido colectadas e Mexico. III. Polygyridae and Potadominae.
identificadas hasta ahora: Pupillidae (una Proceedings of the Academy of National
especie), Valloniidae (una especie), Bulimulidae Science of Philadelphia, 108:19-40, plates 2, 3,
(dos especies), Urocoptidae (tres especies), 4.
Spiraxidae (una especie), Succineidae (una Schmidt, R. H. Jr., 1979. A Climatic Delineation
especie), Zonitidae (una especie), of the real Chihuahuan Desert. Journal of
Thysanophoridae (una especie) y Arid Environments 2: 243-250.

48
Zamorano, P. y M., Hendrickx. 2007. Biocenosis y distribucin de los moluscos de aguas profundas en el Pacfico Mexicano: Una evaluacin de los
avances. pp 49-50. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds).
Universidad de Guadalajara, Mxico. 286 p.

BIOCENOSIS Y DISTRIBUCIN DE LOS MOLUSCOS DE AGUAS PROFUNDAS EN EL PACFICO


MEXICANO: UNA EVALUACIN DE LOS AVANCES

Zamorano, Pablo y Hendrickx, Michel


Laboratorio de Invertebrados Bentnicos, ICML-UNAM, CP 82040 Mazatln, Sinaloa, Mxico.
pazaha@ola.icmyl.unam.mx, michel@ola.icmyl.unam.mx
Palabras clave: Moluscos, Pacfico mexicano, biocenosis.

INTRODUCCIN
Los primeros estudios sobre moluscos en aguas
12 16
profundas dentro del Pacfico Mexicano datan de 17
29 Aplacophora
Monoplacophora
finales del siglo XIX, el material fue obtenido
186 Polyplacophora
durante los muestreos realizados por el buque de Scaphopoda
vapor Albatross de la Comisin de Pesca de los Cephalopoda
Estados Unidos (Dall, 1895). Posteriormente, 137 Pelecypoda

diversas instituciones extranjeras llevaron a cabo Gastropoda

campaas oceanogrficas, a partir de las cuales,


se han publicado trabajos taxonmicos de la
malacofauna presente a profundidades mayores Figura 1. Nmero de especies de moluscos
a 200m (vese trabajos de Dall, Baker, Strong, registradas para las aguas profundas del Pacfico
Hertlein, Emerson y Old); sin embargo, los de Mxico (> 200m) divididas por clase
estudios ecolgicos relacionados con esta fauna taxonmica.
son escasos (Parker, 1964a, 1964b), lo que ha
limitado su conocimiento en el Pacfico Mexicano. De acuerdo con estos registros, se not
que el golfo de California y la costa occidental de
MATERIALES Y METODO la pennsula de Baja California, han sido las
La informacin utilizada para el estudio proviene zonas donde mayor esfuerzo de muestreo se ha
de registros obtenidos en la literatura, de hecho, seguido del golfo de Tehuantepec; a lo
colecciones malacolgicas y durante las largo del Pacfico tropical mexicano, los registros
campaas oceanogrficas Talud IV-IX realizadas son escasos y slo se not un parche
en el sur del golfo de California (2000-2005), considerable a la altura de Michoacn y Guerrero
Mxico. Con esta informacin, se procedi a: (1) (Fig. 2).
relacionar la diversidad de moluscos en la
XX
XXX
endofauna y en al epifauna con variables XX X
XXX
XX
XXX
XXXX
XXX
XXX
XX
XX XXXX
XX X
X
X
X
XXXXXXXXXX
X XX X XX X X X
ambientales (Zamorano et al., 2006); (2) a tratar X
X XX
XX
XX X X
X
XXX X
XX X
X
XXXXX
XXX XX
XXX
X XX
XXXX X
XX
XXX
X X
X
X
X
XXX X
N
X X X X XXXXXXXXXXX
de identificar patrones zoogeogrficos y X XXXXX
XXXXXXX
XX
X XXXX
XX XXXX
X XX
XX XX
X
X
XX XXXX X
XXXX X
XX
X
XX
XX
X XX
XX
X
X
XXX
X
X
XX
XX
W E

X XXX XX S

batimtricos en la distribucin de los moluscos de X XX


X XX X
X XX
X
X
X
X
X
X
X
X
XXXXX
X X
X X X X
XXXX
X
XXX
XX

XXX
X
X
XXX X
XX
XXX
XX
XX
X XX XXX X
aguas profundas en el golfo de California X XXXX
X XXX X XX
XX
XX
X
XXXXXX
XX X
XXXX XXXX
X
X
XX X X XXX
X
X
XX
X
X
XX
X
X
X
XX
X
X XXX
XX
XX
XX
XX
XX
XXXXXX
XXX X XX
XX X
(Zamorano y Hendrickx, manuscrito sometido); X
XX
X
XXXXX
XX
X XXXX
X

(3) a evaluar la similitud que existe en la X


XX
XX

X
X XX X
X

composicin de la comunidad a ambos lados de X


XXX
X
XX
X
XXXX
X X
X
XXX
XXXX
XXXX
XX
la pennsula de Baja California (Zamorano y X
X
X
X
X XXXX
XXXXX
X
XXXXX
XX
XX
XX
X
XX
XX
X

Hendrickx, datos no publicados); (4) a obtener un XX


X
X
listado taxonmico (Zamorano, 2006); y (5) a X
X
X

identificar nuevos registros de moluscos de Figura 2. Ubicacin de los puntos geogrficos en


aguas profundas para el golfo de California los cuales se han registrado especies de
(Zamorano et al., manuscrito sometido). moluscos de aguas profundas (> 200m) en el
Pacfico mexicano.
RESULTADOS Y DISCUSIN
Se lograron recopilar 1085 registros de moluscos A partir del material obtenido durante las
de aguas profundas (> 200m) en el Pacfico campaas oceanogrficas Talud IV-IX, se
mexicano, entre los cuales se documentaron 388 determin que el oxgeno disuelto es la variable
especies (un Aplacophora, dos Monoplacophora, que ms se correlacion con la diversidad en la
16 Polyplacophora, 17 Scaphopoda, 29 endofauna (R = 0.261; p = 0.207; n = 25);
Cephalopoda, 137 Pelecypoda y 185 mientras que en la epifauna, fue la temperatura
Gastropoda) (Fig. 1). (R = 0.668; p = 0.005; n = 16). Durante las

49
Estudios sobre Malacologa y Conquiliologa en Mxico

campaas Talud se registraron 49 especies de Parker, R. H. 1964b. Zoogeography and ecology


moluscos, de las cuales, 18 resultaron nuevos of some macro-invertebrates, particularly mol-
registros geogrficos y/o batimtricos para el lusks, in the Gulf of California and the
golfo de California, incluso para el Pacfico continental slope off Mexico. Videnskabelige
mexicano. Med-deleiser, Dansk Naturhistorisk Forening
Por otro lado, se observ como el 34.5% Copenhagen 126 : 1-178.
de las especies de aguas profundas en el golfo Zamorano, P. 2006. Biocenosis y distribucin de
de California presenta una clara afinidad con la los moluscos asociados al talud continental del
fauna del sur, 20.4% con la fauna del norte, Pacfico mexicano. Tesis de maestra. ICMyL,
21.3% pertenecen a especies conocidas tanto al Universidad Nacional Autnoma de Mxico,
sur como al norte del golfo de California y 23.8% Mazatln, Mxico.
restante ha sido registrado hasta la fecha Zamorano, P. y M. E. Hendrickx (manuscrito
solamente en el golfo de California. sometido, 2006). Anlisis latitudinal y
Batimtricamente, se observ como la batimtrico de la comunidad de moluscos de
riqueza de especies disminuye conforme la mar profundo en el golfo de California, Mxico.
profundidad incrementa, con un mximo en la Ciencias Marinas.
zona de confluencia entre la plataforma Zamorano, P. & M. E. Hendrickx (datos no
continental y el talud continental (152 especies). publicados). A comparative analysis of deep-
Se observaron tres grupos principales de water mollusks from both sides of the Baja
especies, el primero conformado por aquellas California.
(194 especies) distribuidas en la parte superior Zamorano, P., M. E. Hendrickx & A. Toledano-
del talud continental (200-1400m), el segundo (62 Granados. 2006. Distribution and ecology of
especies) distribuidas en la parte inferior del talud deep-water mollusks from the continental slope,
continental y en parte del plano abisal (1400- southeastern Gulf of California, Mexico. Mar.
3200m) y el tercero queda conformado por seis Biol.
especies distribuidas a profundidades superiores Zamorano, P., M. E. Hendrickx & A. Toledano-
a 3200m. Granados (manuscrito sometido, 2006). New
Considerando la presencia-ausencia de geographic and depth records for deep-water
especies de moluscos de aguas profundas en el mollusks in the Gulf of California, Mexico.
rea del golfo de California (GC) y en el rea de Revista Mexicana de Biodiversidad.
influencia de la Corriente de California (CC) se
compar su composicin a ambos lados de la
pennsula de Baja California y se determin que
latitudinalmente, la ms alta similitud se present
en los 23 (12.66%) y verticalmente, la ms alta
similitud se observ en la banda comprendida
entre 200 y 699m de profundidad (20.00%).
El listado taxonmico completo se
encuentra disponible en el trabajo de Zamorano
(2006).

LITERATURA CITADA
Dall, W. H. 1889. Report on the results of
dredning by the U. S. Coast survey steamer
"Blake". XXIX. Report on the Mollusca, part II:
Gastropoda and Scaphopoda. Bulletin of the
Museum of Comparative Zoology at Harvad
University 18: 1-491.
Parker, R. H. 1964a. Zoogeography and ecology
of macro-invertebrates of Gulf of California and
continental slope of western Mexico. 331-376.
En: van Andel, T.H. y G.C. Shor (Eds.). Marine
geology of the Gulf of California, a Symposium.
American Association of Petro-leum Geologists
3.

50
Ros-Jara, E., C. M., Navarro-Caravantes y S. Sarmiento-Nfate. 2007. Moluscos en la fauna de acompaamiento del camarn de la costa de Chiapas
y Sur de Oaxaca, Mxico. pp 51-53. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M,
Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

MOLUSCOS EN LA FAUNA DE ACOMPAAMIENTO DEL CAMARN DE LA COSTA DE CHIAPAS Y


SUR DE OAXACA, MXICO

Ros-Jara, E.1, Navarro-Caravantes, C. M.1 y Sarmiento-Nfate, S.2


1
Laboratorio de Ecosistemas Marinos y Acuicultura, Departamento de Ecologa, CUCBA - Universidad de
Guadalajara. edurios@cucba.udg.mx, cemonaca@yahoo.com. 2 Centro Regional de Investigaciones
Pesqueras de Salina Cruz, Oaxaca. Instituto Nacional de la Pesca.
Palabras clave: Moluscos, gastrpodos, bivalvos, Chiapas, Oaxaca, plataforma continental.

INTRODUCCIN tipo semiportugus con malla de 50.8mm y


La malacofauna del Pacfico tropical mexicano es longitud de la relinga de 80 pies (24.38m). Los
muy abundante y diversa. Sin embargo, existen arrastres se realizaron en 55 estaciones de
relativamente pocas investigaciones en la porcin muestreo a profundidades de entre 14 y 65 m
sur de esta regin; la costa de Chiapas es la desde Puerto Chiapas (antes Puerto Madero)
menos estudiada. (1441'17''N - 9228'74''O) hasta Salina Cruz,
En el litoral de Oaxaca se han realizado Oaxaca (1600'53''N - 957'74''O). El tiempo de
estudios que incluyen inventarios y descripciones arrastre fue de 35-79 min, la velocidad de 20.3-
de la distribucin y abundancia de las especies 99.7 m/min y la distancia recorrida de 1,220-
(Gonzlez-Bulnes, 1981; Gmez-Faras, 1985; 6,580 m por arrastre.
Jay, 1985; Rodrguez et al., 1988; Sandoval, La identificacin y actualizacin
1988; Holgun-Quiones y Gonzlez, 1989; taxonmica correspondiente se realiz utilizando
Rodrguez, 1989; Nava-Nava, 1991; Gil de Len- bibliografa especializada, principalmente Keen
Herrera, 2000); mientras que para Chiapas, (1971), Skoglund (2001, 2002) primeramente en
existe solamente el catlogo de moluscos el Laboratorio de Ecologa de Manglares de El
preparado por Sevilla (1995). Colegio de la Frontera Sur (ECOSUR) Unidad
En esta regin, los moluscos se capturan Tapachula, y posteriormente en el Laboratorio de
de forma artesanal en las lagunas costeras y Ecosistemas Marinos y Acuicultura del
esteros para autoconsumo o su comercializacin Departamento de Ecologa de la Universidad de
local o regional. Otras especies se obtienen de la Guadalajara.
fauna de acompaamiento de los arrastres
camaroneros (FAC). Algunos estudios RESULTADOS Y DISCUSIN
demuestran que los moluscos representan el nicamente en 33 estaciones se registraron
tercer grupo en importancia despus de los moluscos, con un total de 832 individuos y 59
peces y crustceos en la pesquera del camarn especies de los cuales 541 individuos pertenecen
del Pacfico mexicano (Rodrguez-Cajiga, 1996). a la Clase Bivalvia (18 especies) y 291 a la Clase
El presente trabajo describe la Gastropoda (41 especies) (Tabla 1). La mayora
composicin y abundancia de los moluscos se recolectaron vivos: 525 individuos y 10
comnmente recolectados durante la pesca del especies de bivalvos; 266 individuos y 39
camarn en la costa de Chiapas y sur de especies de gastrpodos. Todas estas especies
Oaxaca, Mxico. forman parte de la FAC en la regin, aunque la
mayora no son aprovechadas.
MATERIALES Y MTODO El ndice de valor biolgico (IVB) reconoci
El estado de Chiapas cuenta con una extensin a las especies ms importantes. En el caso de
litoral de 278 km y una plataforma continental de los bivalvos, la de mayor valor del IVB (22) fue
76,390 km2; el estado de Oaxaca con 509 km de Argopecten circularis, representando el 90.75 %
litoral y 41,049 km2 de plataforma continental de los individuos de esta clase. La Clase
(Ruz-Dur, 1993) (Figura 1). La plataforma Gastropoda registr nueve especies con valores
continental de Chiapas es amplia y uniforme (50 - altos de IVB ( 33) que juntas representan el
80 km) y su lnea litoral est formada por vastas 59.45 % de los individuos de la clase: Harpa
reas de marismas, manglares, esteros y crenata, Pleuroploca granosa, Ficus ventricosa,
lagunas, adems de playones de arena. Crepidula excavata, Hexaplex brassica, Malea
La recolecta de moluscos se realiz a ringens, Crucibulum lignarium, Fusinus
bordo del barco camaronero FIPESCO 63 dupetitthouarsi y Tonna sp. Estas son las ms
durante una campaa de evaluacin del recurso abundantes y con la mayor ocurrencia en las
camarn por parte de Secretara de Marina, los estaciones, lo que indica que tienen una
das 16 al 30 de junio de 2004. Se utiliz una red distribucin relativamente amplia en la regin.

51
Estudios sobre Malacologa y Conquiliologa en Mxico

El caracol H. crenata se recolect a 19-21 de junio, 2003). Comisin Nacional de


profundidades de 28-45 m; fue abundante (34 Acuacultura y Pesca-INP. SAGARPA. Mxico.
individuos) y con un alto porcentaje de ocurrencia 33 p.
(45.5%), ya que se encontr en 15 de las 33 Gil de Len-Herrera, M. 2000. Listado
estaciones. Aunque obtuvo el valor ms alto del taxonmico de las especies de moluscos en la
IVB entre los gastrpodos, solo se recolectaron zona central del litoral oaxaqueo. Ciencia y
conchas sin el organismo vivo. El gastrpodo Mar IV (12): 49-51.
ms abundante, F. dupetitthouarsi, solamente se Gmez-Faras, P. 1985. Estudio de las
registr en 8 estaciones (24.2%) por lo que comunidades de moluscos bentnicos en la
obtuvo menor IVB. Se recolectaron 6 costa de Salina Cruz, Oaxaca. Tesis de
especimenes vivos y 31 conchas entre los 14 y licenciatura. Facultad de Ciencias. UNAM.
46 m de profundidad. Mxico, D. F.
Algunas almejas y caracoles son Gonzlez-Bulnes, L. C. 1981. Algunos aspectos
aprovechados cuando se recolectan vivos en los taxonmicos y distribucin de los moluscos del
arrastres camaroneros, los cuales son Golfo de Tehuantepec, Mxico. Tesis de
seleccionados y almacenados en costales en el licenciatura. Facultad de Ciencias. UNAM.
cuarto refrigerador para su posterior Mxico, D. F. 262 p.
comercializacin en Puerto Chiapas o Salina Holgun-Quiones, O. E. y P. Gonzlez. 1989.
Cruz, siempre que la capacidad del barco lo Moluscos de la franja Costera del estado de
permita. Oaxaca, Mxico. Atlas CICIMAR No. 7.
Este es el caso de los caracoles P. CICIMAR-IPN, La Paz, B. C. S. 228 p.
granosa, F. ventricosa, H. brassica, M. ringens, Jay, G. F. P. L. 1985. Estudio de las
F. dupetitthouarsi y Tonna sp., de tallas comunidades de moluscos bentnicos en la
considerables y conchas atractivas. Lo mismo costa de Salina Cruz, Oaxaca. Tesis de
sucede con la almeja catarina A. circularis, licenciatura. Facultad de Ciencias. UNAM.
recolectada en agregaciones de hasta 197 Mxico, D. F.
individuos vivos a profundidades de entre 14 y 43 Keen, A. M. 1971. Seashells of Tropical West
m. La concha ncar o madreperla P. mazatlanica America. Marine molluscs from Baja California
es tambin importante debido a que se encuentra to Peru. Stanford Univ. Press, Stanford. 1065 p.
en la NOM-059-SEMARNAT-2001. Nava Nava, F. 1991. Contribucin al
El impacto de los arrastres camaroneros conocimiento de la fauna malacolgica de las
sobre las comunidades bnticas ha sido costas de Salina Cruz, Oaxaca en dos epocas
evaluado en otras regiones de Mxico y el mundo del ao. Tesis de licenciatura. Facultad de
Es evidente que se requieren este tipo de Ciencias. UNAM. Mxico, D. F.
evaluaciones en la regin. En Mxico se han Rodrguez-Cajiga, S. R. 1996. Contribucin al
realizado muchos intentos para aprovechar la conocimiento de la fauna de acompaamiento
FAC, como por ejemplo disear barcos del camarn frente a la costa de Sinaloa,
camaroneros con una planta de harina a bordo o Mxico. Tesis de licenciatura. Facultad de
reducir el tamao del tnel de la red, Ciencias. UNAM. Mxico, D. F.
manteniendo el mismo tamao de malla ya que Rodrguez-Palacios, C. A., L. M. Michel-Arana, G.
las redes modificadas reducen la captura de FAC Sandoval-Daz, P. Gmez y G. Green. 1988.
un 21% en promedio, con respecto a las redes Los moluscos de las Bahas de Huatulco y
convencionales (CONAPESCA, 2003). Sin Puerto ngel, Oaxaca. Distribucin, diversidad
embargo, no se ha logrado el xito completo y abundancia. Universidad y Ciencia, 5(9): 85-
porque no se cuenta con informacin confiable 94 p.
sobre qu especies forman la FAC, cul es su Rodrguez, P. 1989. Caracterizacin de dos
volumen, cmo cambia en el ao y cmo se comunidades asociadas a facies rocosas en las
caracteriza en las diferentes regiones. Sin estos bahas El Maguey (Huatulco) y Puerto ngel,
datos resulta imposible programar cualquier Oaxaca. Tesis de licenciatura. Facultad de
proyecto para su aprovechamiento. Ciencias. UNAM. Mxico, D. F. 94 p.
Ruz-Dur, M. F. 1993. Recursos pesqueros de
LITERATURA CITADA las costas de Mxico. Su conservacin y
CONAPESCA. 2003. Informe del Taller sobre manejo socio-econmico. Limusa Noriega
Selectividad de Sistemas de Pesca de Arrastre Editores. Mxico. 137-142 p.
para Camarn, Implicaciones para el Sandoval, D. G. 1988. Estudio de las
Ordenamiento Pesquero (Mazatln, Sinaloa, comunidades bnticas de la zona rocosa litoral

52
Estudios sobre Malacologa y Conquiliologa en Mxico

y sublitoral de localidades en bahas de


Huatulco, Oaxaca. Tesis de licenciatura.
Facultad de Ciencias. UNAM. Mxico. 96 p.
Sevilla-Hernndez, M. L. 1995. Moluscos de la
Franja Costera de Chiapas, Mxico. Instituto
Politcnico Nacional. Mxico, D. F. p. 7-145 p.
Skoglund, C. 2001. Panamic Province Molluscan
Literature: Additions and Changes from 1971
through 2000. I. Bivalvia II. Polyplacophora The
Festivus. (Supplement). 140 p.
-2002. Panamic Province Molluscan Literature
Additions and Changes from 1971 through
2001 Gastropoda III. The Festivus
(Supplement). 286 p.

Tabla 1.Especies de bivalvos y gastrpodos con sus valores del ndice de Valor Biolgico y abundancia (IVB = Valor del ndice IVB;
Cal. IVB = Calificacin del IVB; Total Ind. = nmero total de individuos registrados; AR = Abundancia Relativa; ARA = Abundancia
Relativa Acumulada).

Total Total
Especies IVB Ind. AR ARA Especies IVB Ind. AR ARA
BIVALVOS GASTRPODOS

1 Argopecten circularis 22 491 90,75 90,75 12 Conus patricius 29 16 5,49 71,82


2 Dosinia ponderosa 16 13 2,40 93,16 13 Crucibulum personatum 24 27 9,27 81,09
3 Crassostrea prismtica 11 4 0,73 93,90 14 Oliva incrassata 18 4 1,37 82,47
4 Chione pulicaria 10 8 1,47 95,37 15 Muricanthus nigritus 17 4 1,37 83,84
5 Cyclinella saccata 10 2 0,36 95,74 16 Distorsio decussata 13 3 1,03 84,87
6 Periglypta multicostata 10 2 0,36 96,11 17 Muricanthus radix 10 3 1,03 85,91
7 Anadara obesa 8 2 0,36 96,48 18 Oliva polpasta 9 3 1,03 86,94
8 Noetia reversa 8 2 0,36 96,85 19 Phos crassus 7 1 0,34 87,28
9 Chione amathusia 7 1 0,18 97,04 20 Turritella banksi 7 2 0,68 87,97
10 Harvella elegans 7 1 0,184 97,22 21 Turritella leucostoma 7 1 0,34 88,31
11 Macoma lamproleuca 7 1 0,18 97,41 22 Cancellaria solida 6 1 0,34 88,65
12 Pegophysema edentuloides 7 1 0,18 97,59 23 Crucibulum scutellatum 6 1 0,34 89,00
13 Spondylus calcifer 3 3 0,55 98,15 24 Northia northiae 6 2 0,68 89,69
14 Anadara reinhartii 2 1 0,18 98,33 25 Vasum caestus 6 1 0,34 90,03
15 Glycymeris maculata 1 1 0,18 98,52 26 Bursa corrugata 5 1 0,34 90,37
16 Pinctada mazatlanica 1 3 0,55 99,07 27 Conus archon 5 1 0,34 90,72
17 Trachycardium panamense 1 2 0,36 99,44 28 Mitra swainsonni 5 1 0,34 91,06
18 Trachycardium procerum 1 3 0,55 100 29 Conus recurvus 4 1 0,34 91,40
TOTAL BIVALVOS 541 100 30 Conus tornatus 4 1 0,34 91,75
GASTRPODOS 31 Crucibulum spinosum 4 1 0,34 92,09
1 Harpa crenata 62 34 11,68 11,68 32 Marsupina nana 4 1 0,34 92,43
2 Pleuroploca granosa 55 20 6,87 18,55 33 Natica elenae 4 2 0,687 93,12
3 Ficus ventricosa 49 19 6,52 25,08 34 Calyptraea mamillaris 3 1 0,343 93,47
4 Crepidula excavata 45 13 4,46 29,55 35 Cancellaria obesa 3 1 0,343 93,81
5 Hexaplex brassica 44 14 4,81 34,36 36 Conus poormani 3 1 0,34 94,15
6 Malea ringens 43 10 3,43 37,80 37 Cymatium weigmanni 3 8 2,74 96,90
7 Crucibulum lignarium 38 18 6,18 43,98 38 Murex recorvirustris 3 1 0,34 97,25
8 Fusinus dupetitthouarsi 33 37 12,71 56,70 39 Thais kiosquiformis 3 1 0,34 97,59
9 Tonna sp. 33 8 2,74 59,45 40 Crepidula striolata 2 6 2,06 99,65
10 Oliva spendidula 31 7 2,40 61,85 41 Polystira picta 1 1 0,34 100

53
Lpez-Uriarte, E. y C. V. 2007. Moluscos asociados al coral ramoso del gnero Pocillopora, Lamarck, 1818, en Playa Mora, Jalisco, Mxico. pp 54-56.
En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de
Guadalajara, Mxico. 286 p.

MOLUSCOS ASOCIADOS AL CORAL RAMOSO DEL GNERO Pocillopora Lamarck 1818,


EN PLAYA MORA, JALISCO, MXICO.

Lpez-Uriarte, Ernesto1 y Velarde-Nuo, Cinthya V.2


1
Departamento de Ecologa y. del Centro Universitario de Ciencias Biolgicas y Agropecuarias.
Universidad de Guadalajara. Km. 15.5 carretera Guadalajara-Nogales, Las Agujas, Nextipac, Zapopan.
C.P. 45110. ernlopez@cucba.udg.mx.
Palabras clave: Moluscos, coral, Jalisco, Pocillopora.

INTRODUCCIN de moluscos de referencia del Laboratorio de


La ensenada Playa Mora en Baha de Ecosistemas Marinos y Acuicultura (LEMA) de la
Tenacatita presenta una comunidad coralina bien UDG. El listado sistemtico se elabor de
desarrollada poco representada en el Pacfico acuerdo con Keen (1971) por ultimo se efectu
mexicano. Interactan una gran riqueza de una revisin de las sinonimias de las especies de
invertebrados y vertebrados marinos que poco se moluscos utilizando Skoglund (1991,1992, 2001a
conoce (Lpez-Uriarte y Ros-Jara, 2004; y 2001b). El total del material malacolgico
Galvn-Villa, 2006). La fauna malacolgica forma registrado correspondi al 44% de organismos
parte fundamental del ecosistema coralino donde vivos (parte blanda y concha) y 56%
se llevan a cabo una serie de interacciones como correspondi a conchas vacas. Para el presente
competencia, depredacin, parasitismo, trabajo solo se utilizaron en la evaluacin los
reproduccin, alimentacin, entre otras. Algunas moluscos vivos.
de estas interacciones pueden configurar la
RESULTADOS Y DISCUSION
estructura y dinmica del ecosistema coralino
Se determinaron 40 especies, pertenecientes a 4
(Guzmn y Lpez, 1991). Por lo que resulta de
Clases, 10 rdenes, 25 Familias y 30 Gneros. A
especial inters determinar los moluscos
nivel de clase, los gasterpodos registraron el
presentes en el coral ramoso del gnero
mayor nmero de especies (22), seguido de los
Pocillopora en el arrecife de Playa Mora,
bivalvos con once especies, seis para la clase
Tenacatita, Jalisco, durante el ciclo anual 2002-
poliplacofora y una especie de cefalpodo. El 95
2003 (Figura 1).
% de la abundancia acumulada la representaron
25 especies; las 15 especies restantes de las 40,
solo registraron un individuo durante el estudio
(Figura 2). El gasterpodo Quoyula
madreporarum y el bivalvo Lithophaga aristata,
presentaron el mayor porcentaje de abundancia
relativa, con el 26 % cada una; acumulando entre
las dos arriba del 50%. Se encontraron otras
especies tambin abundantes L. plummula con
11%, Acar bailyi, Gastrochaena ovata,
Pseudochama panamensis y Steironepion
melanosticta tuvieron una abundancia del 3%
Figura 1. rea de estudio.
cada una. Las 18 especies restantes presentaron
valores de abundancia por abajo del 2%.
MATERIALES Y MTODOS
Durante cuatro muestreos en un ciclo anual
(noviembre de 2002, marzo, julio y diciembre de
2003) se extrajeron mediante buceo autnomo
29 colonias de coral vivo de la especie
Pocillopora spp. Se eligieron colonias con un
dimetro de entre 20 y 30 cm. Para identificar las
especies de moluscos vivos se tomaron en
cuenta los organismos completos (cuerpo y
concha) encontrados en las colonias de coral.
Para su determinacin se utilizaron las claves
taxonmicas de Keen (1971), Morris (1974) y
Simn y Schusters (1979), Keen y Coan (1974)
y Abbott (1974). Adems se utiliz la coleccin Figura 2.

54
Estudios sobre Malacologa y Conquiliologa en Mxico

Con respecto a su frecuencia de Cerithium maculosum Steironepion melanosticta


aparicin, 12 especies representaron a la Crucibulum lignarium Cantharus elegans
Crucibulum umbrella Muricopsis zetequi
malacofauna presente en el coral ramoso. El Crucibulum monticulus Melanella townsendi
gastrpodo Quoyula madreporarum estuvo Crucibulum serratum Cypraea sp.
presente en el 70% de las cabezas coralinas; dos Rissoina stricta Leucozonia cerata
especies de bivalvos del gnero Lithophaga Mancinella triangularis
Octopus hubbsorum
fueron frecuentes, L. aristata con el 52% y L.
plummula en el 41%, dos especies de bivalvos
Acar bailyi, Pseudochama panamensis, y el De acuerdo al tipo de hbitat en el
gastrpodo Steironepion melanosticta ocurrieron sustrato coralino, los moluscos epifaunales
cada uno con el 24%; el bivalvo Gastrochaena presentaron el mayor porcentaje con el 85%,
ovata, estuvo presente en el 20%, los seguido de organismos infaunales con el 10%, y
gastrpodos Hipponix panamensis el 17%, los seminfaunales solo el 5%. La especie
Crepidula aculeata el 13%, Cantharus elegans, epifaunal con mayor frecuencia y abundancia fue
Hipponix planatus, y el bivalvo Kellia laperousi el Q. madreporarum; en la infauna Lithophaga
10%. aristata, Lithophaga plummula, Gastrochaena
Los moluscos fueron agrupados de ovata.
acuerdo al tipo de alimentacin en grupos
funcionales, como se muestra en el Cuadro 1. Cuadro 2. Grupos funcionales de los moluscos
Las especies herbvoras ramoneadoras presentes en Pocillopora spp. de acuerdo a su
presentaron el valor mas alto con el 32%, las hbitat.
filtradoras en suspensin el 27%, carnvoros
23%, as como las detritvoras el 18% Epifaunal Seminfaunal Infaunal
Quoyula Cerithium Lithophaga
respectivamente. Dentro del grupo filtrador
madreporarum maculosum aristata
suspensvoro, fueron relevantes tres especies Acar bailyi Modiolus rectus Lithophaga
bioerosionadoras (Lithophaga aristata, Pseudochama plummula
Lithophaga plummula, Gastrochaena ovata) que panamensis Gastrochaena
Steironepion ovata
anteriormente fueron mencionadas como
melanosticta Cardites
frecuentes y abundantes. Dentro del grupo de Hipponix laticostata
los carnvoros, Q. madreporarum especie que panamensis
consume coral vivo o coralvora, fue relevante Cantharus elegans
Crepidula aculeata
por su ocurrencia y abundancia en el sustrato
Brachidontes
coralino. Las especies detritivoras restantes semilaevis
podran considerarse como ocasionales ya que Hipponix planatus
presentaron valores menores al 17% de Kellia laperousi
Lima hemphilli
frecuencia y 3% de abundancia.
Plicatula
spondylopsis
Cuadro 1. Grupos funcionales de los moluscos Crucibulum
asociados a Pocillopora spp. de acuerdo a su tipo lignarium
Callistoplax retusa
de alimentacin.
Crucibulum umbrella
Diodora inaequalis
Filtrador suspensvoro Herbvora ramoneadora Muricopsis zetequi
Rissoina stricta
Lithophaga aristata Hipponix panamensis Seila cf. assimilata
Lithophaga plummula Hipponix planatus Melanella townsendi
Acar bailyi Callistoplax retusa Capulus sericeus
Gastrochaena ovata Diodora inaequalis Crucibulum
Pseudochama Seila cf. assimilata monticulus
panamensis Capulus sericeus Crucibulum
Brachidontes semilaevis Hipponix grayanus serratum
Kellia laperousi Hipponix imbricatus Cypraea sp.
Lima hemphilli Chiton articulatus Hipponix grayanus
Plicatula spondylopsis Chiton sp.1 Hipponix imbricatus
Cardites laticostata Ischnochiton petaloides Leucozonia cerata
Modiolus rectus Ischnochiton sp.1 Mancinella
Ischnochiton sp.2 triangularis
Chiton articulatus
Detrtivora Carnvora Chiton sp.1
Ischnochiton
Crepidula aculeata Quoyula madreporarum petaloides

55
Estudios sobre Malacologa y Conquiliologa en Mxico

Radsiella sp.1 continuo uso por turistas que cada ao visitan


Radsiella sp.2 Baha de Tenacatita en Jalisco.
Octopus
hubbsorum LITERATURA CITADA
Abbott T. 1974. American Seashells, The Marine
La riqueza especifica de moluscos asociados al Mollusca of the Atlantic and Pacific Coasts of
coral ramoso Pocillopora spp. de Playa Mora, North America. Second edition. Van Nostrand
esta entre las mas altas para el Pacifico Reinhold Company. USA.
mexicano, solo por debajo del reporte de Barrientos-Lujn, N. A,. Ramrez-Luna, S.,
Barrientos-Lujan et al., (1997) que determina 46 Rubino, N. y Orihuela-Belmonte, E. 1997.
especies en sustrato de coral, sin especificar si Moluscos de las Zonas Coralinas de las Playas
fue coral vivo o muerto; Lpez-Rivas (2000) La Entrega y Chachacual, Bahas de
reporta 39 especies en sustrato de coral vivo y Huatulco, Oaxaca, Mxico. Resmenes III
otros autores refieren valores menores a 12 Congreso Latinoamericano de Malacologa y
especies (Gonzlez-Villarreal, 1977; Salcedo- Reunin Nacional de Malacologa y
Martnez,1984). Conquiliologa. Ensenada B.C. 228 p.
La singularidad del arrecife coralino Galvn-Villa, C. M. 2006. Estructura de la
ofrece amplia gama de opciones de uso, como comunidad de peces asociados al arrecife
resguardo, reproduccin, parasitismo, coralino de Playa Mora, Baha de Tenacatita,
alimentacin, entre otras. Fue evidente la Jalisco. Tesis de Licenciatura. CUCBA.
presencia de estadios juveniles en diversas Universidad de Guadalajara. 70 p.
especies de moluscos, indicando procesos Glynn, P.W. & G.M. Wellington. 1983. Corals and
reproductivos asociados al sustrato coralino, coral reefs of the Galpagos Islands. University
seguramente como proteccin de depredadores, of California Press, Berkeley. 312 p.
as como en procesos de alimentacin Gonzlez-Villarreal, L. M. 1977. Estudio
desarrollandose en lugares protegidos y con taxonmico de los gasterpodos marinos
movimientos de agua donde las partculas en Baha de Tenacatita, Jalisco, Mxico. Tesis de
suspensin son abundantes (Mille-Pagaza et al., Licenciatura. Universidad Autnoma de
1994). Guadalajara. 78 p.
La malacofauna estuvo dominada por Guzmn, H. M. 1988. Distribucin y abundancia
especies carnvoras de acuerdo a sus hbitos de organismos coralivoros en los arrecifes de la
alimenticios (Q. madreporarum) y por especies Isla del Cao, Costa Rica. Revista de Biologa
bioerosionadoras infaunales (Lithophaga Tropical 36: 191-207.
aristata, Lithophaga plummula, Gastrochaena Guzmn. H. M. y J. D. Lpez. 1991. Diet of the
ovata). La dominancia de estos moluscos corallivorous pufferfish Arothron meleagris
coralivoros y bioerosionadores es de vital (Tetraodontidae) at Gorgona Island, Colombia.
impotancia ya que son agentes que tienen Revista de Biologa Tropical 39: 203-206
impacto y modifican la estructura y crecimiento Keen, M.A 1971. Sea shells of Tropical West
de los arrecifes (Glynn y Wellington, 1983; America. Marine molluscan from Baja California
Guzmn y Lpez, 1991). Existen reportes de to Peru. 2nd ed. Stanford University Press.
gastrpodos depredadores capaces de consumir Stanford, California. USA. 1064 p.
en poco tiempo volmenes importantes de coral Keen, M.A & E. Coan. 1974. Marine molluscan
(Guzmn, 1988). genera of Western North America. 2nd. Ed. from
Las especies herbvoras ramoneadoras Baja California to Peru). 2nd. ed. Standford
fue posible encontrarlas en el rea de estudio, University Press. Stanford, California. USA. 208
quizs debido a la presencia de macroalgas de p.
diversos grupos taxonmicos durante el periodo Lpez-Rivas, C. E. 2000. Malacofauna asociada
de estudio, que fue evidente su presencia en a corales en el sur de Nayarit. Tesis de
rea de coral muerto y roca adyacente (obser. Maestra en Ciencias. UNAM. Ciudad
personal, 2003-2004). Universitaria DF., Mxico. 82 p.
A futuro es necesaria una evaluacin del Lpez-Uriarte, E. y Ros-Jara E. 2004. Gua de
impacto de las especies coralivoras y macrofauna marina asociada a comunidades
bioerosionadoras sobre este pequeo arrecife de coral del Pacifico central mexicano: Corales
que ha soportado el embate de fenmenos ptreos y Crustceos. Primera edicin.
naturales como el Nio de 1997-1998 y el Universidad de Guadalajara. Mxico. ISBN
970-27-0644-0, 84 p.

56
7Villegas-Maldonado, S., E., Neri-Garca, R., Flores-Garza, S., Garca-Ibez, P. Flores-Rodrguez, y D. G., Arana-Salvador. 2007. Datos preliminares
de la diversidad de moluscos para el consumo humano que se expenden en Acapulco, Guerrero. pp 57-59. En: Estudios sobre la Malacologa y
Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

DATOS PRELIMINARES DE LA DIVERSIDAD DE MOLUSCOS PARA EL CONSUMO HUMANO QUE


SE EXPENDEN EN ACAPULCO, GUERRERO

Villegas-Maldonado, Sarai1, Neri-Garca, Erendira1, Flores-Garza, Rafael2, Garca-Ibez, Sergio2, Flores-


Rodrguez, Pedro2 y Arana-Salvador, Domingo G.2. 1Estudiante, 2Profesor-Investigador. Cuerpo
Acadmico Ecologa Sistemas Acuticos y Pesca, Unidad Acadmica de Ecologa Marina, Universidad
Autnoma de Guerrero. acua_uag@yahoo.com, rfloresgarza@yahoo.com.
Palabras clave: Diversidad, moluscos, consumo humano, Acapulco, Guerrero.

INTRODUCCION Se llevaron a cabo seis muestreos en los


Los moluscos se han convertido en una fuente de meses de abril, mayo, junio, julio. septiembre y
alimentacin y de recursos de importancia octubre de 2006 en los tres sitios de muestreo.
econmica, y como todo recurso natural, corre el Las muestras colectadas se trasladaron al
riesgo de agotarse. Se debe estar consciente que laboratorio.
la utilizacin irresponsable de los recursos
naturales, en este caso de la pesca y venta de Tabla 1. Listado de especies de moluscos
moluscos para consumo humano, terminar por encontradas en Acapulco, Guerrero que se
causar una baja en la poblacin o la completa expenden para el consumo humano.
erradicacin de las especies. Para evitar que
esto suceda se debe contar con planes de ESPECIES NOMBRE
manejo que permitan la recuperacin de las COMN
GASTERPODOS
especies as como la de su hbitat. En el caso
de Acapulco, Guerrero, no existen estudios sobre 1. Hexaplex radix (Gmelin, 1791) Caracol
las especies que comnmente se comercializan 2. Hexaplex princeps (Broderip, 1833) Caracol
para el consumo humano, de hecho los trabajos 3. Opeatostoma pseudodon (Burrow, Diente de perro
sobre diversidad de moluscos para Guerrero, son 1815)
estudios poblacionales o de comunidad como los 4. Fusinus dupetitthouarsi (Kiener, Caracol chireta
de Villalpando (1986), Salcedo (1988), Delgado 1840)
5. Strombus galeatus Swainson, 1823 Machacan
(1989), Garca (1994), Flores-Rodrguez et al.
(2003, 2005), Valdez-Gonzlez (2004) y Flores 6. Strombus peruvianus Swainson, Caracol patilla
1823
Garza et al. (2005). Por otra parte, los datos de 7. Vasum caestus (Broderip, 1833) Caracol burro
las dependencias oficiales responsables de llevar
8. Chicoreus regius (Swainson 1821) Caracol chino
a cabo el registro y control de este tipo de
productos, son bastante confusos e imprecisos. 9. Neorapana muricata (Broderip, Caracol
1832)
El presente trabajo pretende conocer las 10. Crucibulum cyclopium Berry, 1969 Abulon
especies de moluscos (gasterpodos, bivalvos y
BIVALVOS
poliplacforos) mas comunes que se
comercializan en Acapulco para el consumo 1. Megapitaria aurantiaca (Sowerby, Almeja roja
1831)
humano, as como su lugar de procedencia.
2. Megapitaria squalida (Sowerby, Almeja
1835) chocolate
MATERIALES Y MTODOS 3. Chione undatella (Sowerby, 1835) Almeja roosa
Con la finalidad de colectar muestras de las 4. Anadara adamsi Olsson, 1961 Pata de mula
especies que expenden para el consumo
5. Pinna rugosa (Sowerby 1835) Callo de hacha
humano, se realiz un muestreo piloto en
diferentes expendios de mariscos, adems se 6. Pinctada mazatlanica (Hanley, Madre perla
1856)
realiz una entrevista a los encargados del 7. Striostrea prismatica (Gray, 1825) Ostin de roca
negocio con preguntas libres, con objeto de
8. Periglypta multicostata (Sowerby, Almeja rugosa
explorar su conocimiento acerca de las especies 1835).
de moluscos que comercian y su dedicacin y 9. Hyotissa hyotisi Linnaeus 1758 Ostin
responsabilidad dentro del negocio. 10. Chama buddiana C. B. Adams, Callo margarita
Los resultados del muestreo formal que 1852
se presentan en este trabajo, pertenecen a tres 11 .Chama equinata Broderip, 1835 moco de perro
sitios donde se les consider centros de acopio y POLIPLACOFOROS
distribucin, cuyos responsables son personas
1.Chiton articulatus Sowerby, 1832 Cucaracha
que se dedican a la captura local de moluscos
para comercializar, as como, a la compra venta.

57
Estudios sobre Malacologa y Conquiliologa en Mxico

La adecuada ubicacin taxonmica Oaxaca y la Costa Chica del Estado de Guerrero


requiri de una fase de confirmacin en el (tabla 3).
laboratorio, mediante el uso de claves
especializadas como, Morris (1966), Keen (1971) Tabla 3. Especies de moluscos introducidas a
y Reyes-Gmez y Salcedo-Vargas (2002), y se Acapulco, Guerrero para el consumo humano y
actualiz la nomenclatura de acuerdo con localidades de procedencia.
Skoglund (1991, 1992). Durante los muestreos se
realiz una entrevista, con la finalidad de saber ESPECIES LUGAR DE
entre otras cosas, el lugar de procedencia de la PROCEDENCIA
1. Megapitaria La Paz BC, Sinaloa, Sonora
especie y con respecto a las especies capturadas aurantiaca
fuera de Acapulco, conocer, si sta anteriormente 2. Megapitaria squalida La Paz BC, Sinaloa,
se explotaba en la zona de estudio. 3. Anadara adamsi Sinaloa, Nayarit y B.C.S
4. Striostrea prismatica Marquelia, Gro.
RESULTADOS Y DISCUSIN
Se han identificado hasta el momento 22 5. Chione undatella La Paz BC, Sinaloa
especies de moluscos que se expenden en 6. Periglypta multicostata La Paz BC, Sinaloa
Acapulco, Guerrero para el consumo humano, de 7. Hyotissa hyotisi Mazatln, Sin.
las cuales 10 pertenecen a la clase gastropoda,
8. Strombus galeatus Marquelia, Gro, Oaxaca
11 son bivalvos y solo se ha determinado una
especie de la clase polyplacophora (Tabla 1). 9. Fusinus dupetitthouarsi Oaxaca
De las especies identificadas 14 son 10. Strombus peruvianus Punta Maldonado, Gro.
capturadas en la localidad para su Oaxaca
comercializacin, de las cuales siete son
gasterpodos, siete bivalvos y 1 poliplacoforo. Como resultado de la entrevista se
Entre estas especies el Hyotissa hyotisi y el encontr que el 100% de los entrevistados
Striostrea prismatica, tambin son introducidas coincidi que las almejas, sobre todo, la roosa,
de otras localidades para su venta en Acapulco rugosa y roja, anteriormente se capturaban y
(tabla 2). comercializaban en Acapulco, sin embargo, en la
actualidad, las poblaciones han disminuido y ya
Tabla 2. Especies de moluscos que se capturan no hay suficientes y su explotacin es
en Acapulco, Gro. para su venta como alimento. incosteable.
La informacin existente en las
ESPECIES dependencias oficiales responsables de llevar a
1. Opeatostoma pseudodon cabo el control de la pesca y compra venta de
2. Crucibilum cyclopium los organismos a los que se esta avocando este
3. Vasum caestus estudio, es bastante confusa y su clasificacin es
4. Hexaplex radix muy general, de tal manera que en ella
5. Hexaplex princeps encontramos registro sobre las cantidades de
6. Chicoreus regius captura de ostin o de caracol o de callo y en la
7. Neorapana muricata mayora de las ocasiones no se menciona la
8. Pinna rugosa especie, de ah que, no podamos utilizar esta
9. Pinctada mazatlanica informacin como un referente de este estudio.
10. Striostrea prismatica De las 24 especies identificadas, los bivalvos y
11. Hyotissa hyotisi los gasterpodos son muy similares
12. Chama equinata porcentualmente, sin embargo, el Chiton
13. Chama buddiana articulatus se registr como la nica especie de
14. Chiton articulatus la clase poliplacfora que tiene importancia
comercial en el consumo humano.
Se identificaron 10 especies cuyo lugar de De las 10 especies registradas como
procedencia no corresponde a Acapulco, entre introducidas a Acapulco, el 70% son bivalvos y el
las cuales se encuentran siete bivalvos y tres 30 % gasterpodos. Los bivalvos son los
gasterpodos. Los lugares de donde ms mayormente introducidos. La mayora de de los
frecuentemente se introducen moluscos para el bivalvos que se comercian en Acapulco
consumo humano en Acapulco, se encuentran La provienen de otras localidades. Aunque las
Paz B.C.S., del Estado de Sinaloa, Sonora, entrevistas a los encargados de los expendios de
mariscos revelan que anteriormente la mayora

58
Estudios sobre Malacologa y Conquiliologa en Mxico

de los bivalvos que se expendan en Acapulco se reas rocosas de la regin de Zihuatanejo,


capturaban en este mismo lugar, lo que nos Guerrero, Mxico. An. Inst. Cienc. Del Mar y
indica, que la sobre explotacin de algunos Limnol. Univ. Nal. Autn. Mxico, 15(1): 73-96.
recursos, como las almejas, llev a la Skoglund, K. 1991. Additions to the Panamic
disminucin de las poblaciones a tal grado que Province Bibalve (Mollusca) Literatura 1971 to
es actualmente es incosteable su explotacin 1990. The Festivus, XXII (Suppl.2): 63 p.
debido a sus bajas densidades. Skoglund, K. 1992. Additions to the Panamic
Province Gasteropods (Mollusca) Literature
LITERATURA CITADA 1971 to 1992. The Festivus, XXIV (Suppl.): 169
Delgado B. V. H. 1989. Estudio sistemtico y p.
aspectos ecolgicos de gasterpodos de la Valds-Gonzlez A, S. Garca-Ibez, R. Flores-
facie rocosa de la baha de Acapulco, Gro. Garza & P. Flores-Rodrguez. 2004. Molluscan
Mxico. Tesis de licenciatura. Escuela Superior communities of the rocky intertidal zone at two
de Ecologa Marina. Universidad Autnoma de sites with different wave action on Isla la
Guerrero. Mxico. 97 p. Roqueta, Acapulco, Guerrero, Mxico. Journal
Flores-Rodrguez P., R Flores-Garza, S. Garca- of Shellfish Research, Vol. 23 (3): 875-880.
Ibez y A. Valds-Gonzlez. 2003. Riqueza y Villalpando C. E. 1986. Diversidad y zonacin de
diversidad de la malacofauna del mesolitoral moluscos de facie rocosa isla Roqueta,
rocoso de la Isla la Roqueta, Acapulco, Acapulco Gro. Tesis profesional. Facultad de
Guerrero, Mxico. Ciencia, Revista de Ciencias. Universidad Nacional Autnoma de
Investigacin Cientfica. poca II, No 11, Abril Mxico. Mxico D. F.
2003. Universidad Autnoma de Guerrero. pp
5-14.
Flores-Rodrguez P., R Flores-Garza, S. Garca-
Ibaez y A. Valds Gonzlez. 2005. Diversidad
malacolgica en la costa rocosa del Estado de
Guerrero, Mxico. Disco de resmenes del XIII
Congreso Nacional de Zoologa. Monterrey
N.L. Mxico.
Flores-Garza R., P. Flores-Rodrguez, S. Garca-
Ibez y A. Valds Gonzlez. 2005. Estructura
de la poblacin de Plicopurpura pansa (Gould,
1853) Neotaenioglossa: Muricidae) y
malacofauna asociada en el litoral rocoso del
Estado de Guerrero. Disco de resmenes del
XIII Congreso Nacional de Zoologa. Monterrey
N.L. Mxico.
Garca, L. J. A. 1994. Fauna malacolgica de
acompaamiento del caracol Purpura pansa
(Gould 1853) en la zona mesolitoral de la isla
Roqueta, Acapulco, Gro., Mxico. Tesis
profesional. Escuela Superior de Ecologa
Marina. Universidad Autnoma de Guerrero.
Mxico. 97 p.
Keen, A. M. 1971. Sea shells of Tropical West
America. 2a edicion. Stanford University Press,
Stanford, California. 1067 p.
Morris, P. 1966 Pacific Coast Shells Peterson
Field Guide, USA. 297 p.
Reyes-Gmez, A. & M. A. Salcedo-Vargas. 2002.
The Recent Mexican Chiton (Mollusca:
Polyplacophora) Species. The Festivus,.
XXXIV (2): 17-27.
Salcedo, M. S., G. Green, C. A. Gamboa, y P.
Gmez. 1988. Inventario de microalgas y
macroinvertebrados bntonicos, presentes en

59
Perez-Pea, M., E. Lpez-Uriarte, E. G. Robles-Jarero, C. M. Galvn-Villa, I., Enciso-Padilla, V. T. Muoz-Fernndez y E., Ros-Jara. 2007. Estudio
prospectivo de los moluscos gastrpodos de cinco localidades intermareales del Parque Nacional Isla Isabel, Mxico. pp 60-62. En: Estudios sobre la
Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286
p.

ESTUDIO PROSPECTIVO DE LOS MOLUSCOS GASTROPODOS DE CINCO LOCALIDADES


INTERMAREALES DEL PARQUE NACIONAL ISLA ISABEL, MXICO.

Prez-Pea, Martn, Lpez-Uriarte, Ernesto, Robles-Jarero, Elba Guadalupe, Galvn-Villa, Cristian


Moiss, Enciso-Padilla, Ildefonso, Muoz-Fernandez, Vicente Teofilo y Ros-Jara, Eduardo.
Laboratorio de Ecosistemas Marinos y Acuicultura Departamento de Ecologa. Centro Universitario de
Ciencias Biolgicas y Agropecuarias. Universidad de Guadalajara. mperez@cucba.udg.mx.
Palabras clave: Isla Isabel, gasterpodos, intermareal, Pacfico mexicano.

INTRODUCCIN cabo durante el da, principalmente en las horas


La Isla Isabel cuenta con una superficie de 80.03 de bajamar.
ha y un permetro de 9,571 m. El porcentaje que Se seleccionaron cinco localidades
representa la zona intermareal del total de la distribuidas en el permetro de la isla (Figura 1),
superficie de la isla es de aproximadamente el cada una con caractersticas diferentes: 1) Playa
2%. Las Monas norte (MN), formada de roca
Su lnea de costa presenta tres volcnica con terrazas estrechas y zonas
principales tipos de perfiles: 1) rocas expuestas cubiertas de arena fina; 2) Playa Las Monas Sur
con pendientes abruptas y altitudes variables, 2) (MS), de roca fragmentada y cantos rodados de
playas arenosas semi-protegidas con pendientes distintas dimensiones (mximo 1 m3) y poca
muy inclinadas en las playas mas protegidas y pendiente; 3) Playa El Ocaso (PO), de roca
pendientes moderadas en las playas mas volcnica y con poca pendiente en terrazas
expuestas, y 3) playas rocosas con pendientes escalonadas, 4) Playa Iguanas (PI) de roca con
moderadas y pozas de marea. canales y pozas de marea, adems de reas
Entre los trabajos realizados en otras arenosas, 5) Punta Rocosa (PR), macizo de roca
regiones insulares del Pacfico mexicano, volcnica con poca pendiente .
destacan el de Holgun et al. (1992), Holgun
(1993, 1994) y Llinas-Gutirrez et al., (1993) en
el Archipilago Revillagigedo.
Con respecto a la isla Isabel los estudios
previos sobre la biota marina (vertebrados e
invertebrados) hacen referencia a trabajos
especficos de carcter taxonmico y ecolgico
sobre moluscos como el caracol Plicopurpura
pansa (Becerra, 2000)
El propsito del presente estudio fue
realizar un inventario preliminar de las especies
de moluscos gasterpodos de la zona
intermareal de la isla y evaluar su distribucin en
cinco localidades.

MATERIALES Y MTODOS
Para realizar el inventario de los gasterpodos de
la zona intermareal de la isla, se implement la
tcnica de bsqueda directa (Sutherland, 1996).
Los muestreos se llevaron a cabo los das 12 al 16
de octubre de 2002.
En cinco localidades de playa (rocosa y
arenosa), se realizaron muestreos de forma
cualitativa (presencia de gastrpodos) en las
zonas supralitoral y mesolitoral (intermareal) de Figura 1. Localidades de muestreo en la Isla
acuerdo a la zonacin natural de los organismos y Isabel.
tomando en cuenta las consideraciones de Bakus Se recolectaron algunos ejemplares de
(1968) y Vermeij (1972) adaptadas a la fauna gastrpodos (1 a 5 de cada especie de acuerdo a
intermareal local. Los muestreos se llevaron a su abundancia) para su identificacin taxonmica.
Los organismos recolectados se depositaron en

60
Estudios sobre Malacologa y Conquiliologa en Mxico

bolsas de plstico y se fijaron en formol al 10%


neutralizado con borato de sodio, aadiendo una 18
etiqueta de campo. Para su identificacin en 16
Playa del Ocaso
campo y laboratorio se utilizaron los trabajos de 14

Numero de especies
12
Abbott (1974), Brusca (1980), Keen (1971), Morris 10
Playa las
Monas Norte
(1966) y la actualizacin taxonmica fue de 8
Punta Rocosa
acuerdo con Skoglund (1992), Skoglund (2001). 6
Playa las
4 Playa Monas Sur
Iguanas
2
RESULTADOS Y DISCUSIN 0
En la Tabla I se enlistan las especies de sitios de muestreo

moluscos gasterpodos encontrados en las cinco


localidades estudiadas. La mayora de estos
organismos se recolectaron sobre un sustrato Figura 2. Numero de especies por sitio de
predominantemente rocoso. muestreo.

Tabla I. Especies de gasterpodos registrados en El anlisis de Disimilitud de Jaccard con


cinco localidades del intermareal de Isla Isabel, Playa base a la presencia/ausencia de especies (rango
Las Monas norte (MN), Playa Las Monas Sur (MS), = 0 - 1) indica que los valores mas cercanos a 1
Playa del Ocaso (PO),Playa Iguanas (PI), Punta muestran una mayor diferencia, agrupando as a
Rocosa (PR). Presencia (X) Ausencia (-). las localidades afines (Figura 3). Los sitios con
mayor afinidad conforman un primer grupo
Especies MN MS PO PI PR (localidades Playa Las Monas norte y Playa Las
Acmaea conus X - - - - Monas Sur) con un valor de disimilitud de 0.556.
Un segundo grupo incluye Playa Iguanas y Punta
Astraea unguis - - X - - Rocosa con un valor de 0.667. La playa El ocaso
Cerittium maculosum X X X - X tiene un valor mayor de disimilitud 0.813 que
Collisella discors X - X - - indica un bajo nivel de afinidad con los grupos
anteriores, por lo que se puede considerar como
Collisella mitella - - - - X
muy diferente de acuerdo a la comunidad de
Collisella turveri - - X - - gasterpodos presentes.
Columbella fuscata - - X - -
Conus nux X X X - -
Conus princeps - - X - -
Fisurella gemmata X - - - -
Fisurella virescens - - X - -
Pilosabia planatus - - X - -
Jenneria pustulata X - - - -
Nodilittorina aspera - - X X X
Nerita scabricosta - - X - X
Tectura fascicularis X - - - -
Opeatostoma pseudodon - - X - - Figura 3. Dendrograma de Disimilitud de Jaccard.
Plicopurpura pansa - - X X X Estos distintos niveles de afinidades se
Siphonaria palmata - - X - - dan porque algunos sitios comparten la presencia
Mancinella speciosa X X X - X de algunas especies, pero tambin pondera la
diferencia en la composicin y nmero de
Mancinella triangularis X - - - -
especies presentes en cada localidad, y el
Total de especies 8 3 15 2 6 carcter cualitativo se debe a que solo se toma
en cuenta la presencia o ausencia de especies
En la figura 2. se muestra la distribucin del pues se carece de datos de abundancia.
nmero de especies encontradas en cada sitio de En las localidades con mayor
muestreo. heterogeneidad topogrfica, principalmente con
sustrato rocoso, la riqueza biolgica deber ser
mas alta que en las de sustratos arenosos mas

61
Estudios sobre Malacologa y Conquiliologa en Mxico

inestables y homogneos. El presente estudio es (Mollusca - Gastropoda) en Isla Socorro,


prospectivo y cualitativo, por lo que se reporta Archipilago Revillagigedo, Mxico. Zoologa
solamente la presencia de las especies Informa. 25: 24-33.
conspicuas. El nmero de especies por sitio fue -1994. Comunidades marinas bentnicas. 225-245
muy variable (15 mximo y 2 mnimo), p. En: A. Ortega R, y A. Castellanos V. (Eds). La
relacionado con las caracteristicas de cada Isla Socorro, Reserva de la Bisfera,
localidad: la playa arenosa de Iguanas con 2 Archipilago de Revillagigedo, Mxico. Publ. No.
especies y la playa rocosa El Ocaso con 15. 8. Centro de Investigaciones Biolgicas del
La diferencia en la composicin de Noroeste, S. C. 359 p.
especies entre las localidades de la isla Isabel Holgun, Q. O., S. Mille y A. Prez. 1992.
puede deberse a factores como la exposicin al Resultado de las campaas de muestreo de
oleaje, la conformacin y heterogeneidad del 1991 para el estudio del bentos marino de Isla
sustrato ya sea plano y poco protegido como en Socorro, Revillagigedo. Zool. Inf. 24:1-20.
Punta rocosa o con zonas de arena y cantos Keen, M. A. 1971. Sea Shells of Tropical Western
rodados cmo en Playa las Monas Sur. Ambas America. Standford Univ. Stanford. 1064 p.
localidades se encuentran a sotavento, mientras Morris, P. A. 1966. A field guide to shells of the
que Playa del Ocaso a barlovento y con canales Pacific coast and Hawaii. Houghton Mifflin,
y terrazas que ofrecen proteccin y una mayor Boston. 297 p.
variedad de microhabitats. Llinas-Gutrrez J., D. Lluch-Cota, A. Castellanos
Playa las Monas norte es la segunda y A. Ortega-Rubio. 1993. La Isla Socorro,
localidad por su nmero de especies, esta playa Revillagigedo, Mxico. 520-534 p. En:
presenta tambin terrazas con canales y algunas Biodiversidad Marina y Costera de Mxico. S. I.
pozas de marea. Playa Iguanas es un caso Salazar-Vallejo y N.E. Gonzlez (Eds). Com.
especial pues aunque tiene topografa variada, Nal. Biodiversidad y CIQRO. Mxico. 865 p
pozas, canales, terrazas y en posicin semi- Rosengaus, M. M., Jimnez, E. M. y C. T.
protegida, su riqueza fue muy baja. Vzquez 2002. Atlas climatolgico de ciclones
Se debe considerar tambien que en el tropicales en Mxico. IMTA, CENAPRED,
mes de octubre concluye la temporada de Mxico. 106 p.
tormentas tropicales (Rosengaus et al., 2002), su Ros-Jara, E. y colaboradores. 2003. Estudio
impacto puede influir en la presencia y Previo Justificativo para la declaratoria bajo de
abundancia de organismos en el intermareal. rgimen de proteccin del rea marina
Los resultados del este estudio se adyacente al Parque Nacional Isla Isabel.
incluyen en el reporte tcnico del proyecto Informe Tcnico. World Wildlife Fund-
Estudio Previo Justificativo para la declaratoria Programa Golfo de California. Universidad de
bajo de rgimen de proteccin del rea marina Guadalajara-CUCBA, Mxico. 144 p.
adyacente al Parque Nacional Isla Isabel, Skoglund, C. 1992. Additions to the Panamic
apoyado por la WWFund-Programa Golfo de Province gastropod (Mollusca) literature 1971-
California (Ros Jara et al., 2003). 1992. The Festivus. Volume XXIV
(Supplement). 169 p.
LITERATURA CITADA -2001. Panamic Province Molluscan literture
Abbott, R. T. 1974. American seashells. Van Additions and changes from 1971 through2001.
Nostrand Reinhold, New York. 663 p. 286p.
Bakus, G. J 1968. Defensive mechanisms and Sutherland, W., J. 1999, Ecological Census
ecology of some tropical holothurians. Mar. Techniques A Handbook, Cambridge University
Biol. 23-32. 2: Press.
Becerra, C. D. 2000. Algunos parmetros Vermeij, G. J. 1972. Intraespecific shore-level
poblacionales del caracol prpura Plicopurpura sizegradientsin intertidal mollusks. Ecology,
pansa (Cossman, 1903) y su fauna asociada 53:693-700
en la Isla Isabel, Nayarit, Mxico. Tesis de
Licenciatura, Facultad de Ingeniera Pesquera,
Universidad Autnoma de Nayarit
Brusca, R. C. 1980. Common intertidal
invertebrates of the Gulf of California. 2nd ed.
University of Arizona Press, Tucson. 513 p.
Holgun, Q. O. 1993. Distribucin, abundancia y
composicin peso- talla de Purpura pansa

62
Landa-Jaime, V., M., De La Cruz-Urzua, E., Michel-Morfin, J., Arciniega-Flores, R., Flres-Vargas y C., Amescua. 2007. Guia ilustrada para la
identificacin de moluscos intermareales y de arrecife en la Baha de Tenacatita, Jalisco. pp 63-64. En: Estudios sobre la Malacologa y Conquiliologa
en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

GUIA ILUSTRADA PARA LA IDENTIFICACIN DE MOLUSCOS INTERMAREALES Y DE ARRECIFE


EN LA BAHA DE TENACATITA, JALISCO.

Landa-Jaime, Victor, De La Cruz-Urzua, Mercedes, Michel-Morfin, Emilio, Arciniega-Flores, Judith, Flres-


Vargas, Ramiro y Amescua, Carlos. Departamento de estudios para el Desarrollo sustentable de zonas
costeras. CUCSUR. Universidad de Guadalajara. Gmez Farias 82, San Patricio-Melaque, Jal. Mxico.
C.P. 48980. landav@costera,melaque.udg.mx
Palabras clave: Gua ilustrada, Moluscos, Tenacatita, Jalisco.

INTRODUCCIN el conocimiento de los moluscos por su


Desde siempre, el hombre se ha visto fascinado accesibilidad a todo tipo de pblico.
por los moluscos. El uso que desde tiempos Por ultimo, es importante mencionar que
inmemoriales ha hecho de ellos ha sido esta gua ilustrada constituye una herramienta
ampliamente documentado encontrando una valiosa en el mbito acadmico, como material
gran variedad de aplicaciones. Hoy en da, el didctico de apoyo a prcticas de campo en
inters por este grupo de organismos no se ha materias que forman parte de carreras como
perdido en lo ms mnimo, antes bien se ha visto Biologa o Ingeniera en Recursos Naturales
incrementado y cada vez son mas las personas impartidas en la Universidad de Guadalajara,
que le prestan atencin. De esta manera adems de los diversos usuarios de los sectores
podramos enlistar una serie de razones por las sociales de la regin y ambientalistas.
cuales es de suma importancia contar con
inventarios regionales y globales de este MATERIALES Y METODOS.
importante recurso: Este trabajo tiene como Se tomaron las muestras biolgicas obtenidas a
principal finalidad contribuir al conocimiento de la partir de una serie de muestreos realizados en el
fauna malacolgica en una localidad de la costa arrecife de Playa Mora, encaminados a describir
sur del estado de Jalisco que por sus la fauna de invertebrados caracterstica de la
caractersticas geomorfolgicos, la presencia de zona arrecifal e intermareal rocoso.
arrecifes de coral, su litoral rocoso y su La metodologa utilizada que para este
localizacin geogrfica, presentan una gran fin no considera el aspecto cuantitativo, consisti
relevancia. Se considera que los resultados aqu en la recoleccin directa de los moluscos en la
expuestos, si bien corresponden a un pequeo zona intermareal rocosa y mediante buceo en
punto bien localizado, pueden ser representativos partes profundas con sustrato coralino.
no solo para el rea de estudio, sino para una Adicionalmente, se extrajeron pequeos
regin ms amplia. bloques de coral, los cuales fueron fragmentados
Cabe mencionar que existen para la para obtener aquellas especies de hbitos
regin del Pacfico Occidental mexicano una crpticos. Para lo anterior se seleccionaron
serie de estudios realizados previamente, sin aquellos bloques que ya haban sido
embargo la mayora de ellos solo contienen desprendidos por accin directa del oleaje, para
listados de las especies en algunas ocasiones no evitar un dao al arrecife.
actualizadas. Se puede decir que el estudio El material biolgico recolectado fue
realizado por Rios-Jara, et al., 2001; constituye preservado primero en formol al 10% y
uno de los trabajos mas completos para la regin posteriormente en alcohol al 70%.
de Jalisco y Colima, ya que compila la mayor Para la identificacin de los organismos
diversidad de moluscos hasta ahora registrada. se emplearon claves taxonmicas especializadas
De ah la importancia de generar nuevos trabajos tales como Keen, (1971). Sin embargo, por
que contengan actualizaciones sistemticas y recomendaciones de especialistas en
material fotogrfico como recientemente se ha malacologa y debido a que en las ltimas
iniciado en esta regin. dcadas han ocurrido cambios sustanciales en
De hecho uno de los aportes mas cuanto a los arreglos sistemticos, se realizo una
importantes del presente trabajo es precisamente actualizacin de dicha informacin adoptando los
la elaboracin de un documento que exprese de criterios utilizados por Skoglund, 1991 y 1992.
manera ilustrada (mediante un registro Se integro un registro fotogrfico de cada
fotogrfico) las especies ms comunes del rea una de las especies utilizando para ello una
de estudio, ya sea asociadas al coral y al cmara digital cuyas imgenes fueron
intermareal rocoso, debido a que puede ser de procesadas mediante un programa editor para
gran utilidad para cualquier usuario interesado en obtener una mayor nitidez.

63
Estudios sobre Malacologa y Conquiliologa en Mxico

Una vez identificado el material biolgico Por otra parte, se presenta de manera
se procedi a la elaboracin de fichas tcnicas sintetizada una distribucin de las especies en
para cada especie abordando los siguientes funcin del hbitat en que fueron recolectadas.
aspectos: Ubicacin del organismo dentro de la Finalmente para hacer ms eficiente y accesible
clase y familia correspondiente; nombre genrico; el uso de esta gua en campo se ilustra mediante
nombre comn; nombre especfico; distribucin esquemas generales la morfologa de los cuatro
geogrfica; nuevos registros de distribucin grupos encontrados adems de un glosario de
geogrfica y batimtrica; nuevas tallas trminos.
registradas; descripcin del organismo; hbitat;
observaciones; importancia de la especie. LITERATURA CITADA
Keen, M. A. 1971. Sea Shells of Tropical west
RESULTADOS Y DISCUSIN America. 2nd ed. Stanford Univ. Press, California,
Mediante la revisin del material biolgico 1069 p.
recolectado en el arrecife coralino de Playa Mora Rios-Jara, E. 2001. Moluscos macrobenticos del
y la zona intermareal rocosa aledaa a este, se intermareal y plataforma continental de Jalisco y
logro identificar un total de 75 especies de Colima, Mxico. Informe final del proyecto de
moluscos correspondientes a cuatro clases investigacin S110. CONABIO.
(Bivalvia, Gastropoda, Polyplacophora y Skoglund, K. 1991. Additions to the Panamic
Cephalopoda) y 26 familias. El grupo Province bivalve (Mollusca) literature 1971 to
predominante por el nmero de especies 1990. The festivus XXII (Suppl.2): 63 pp.
registradas fueron los Gasterpodos con 53 Skoglund, K. 1992. Additions to the Panamic
especies, seguida por los bivalvos con 15 province gasteropods (Mollusca) literature 1971 to
especies, los poliplacforos con 5 especies y por 1992. The festivus XXIV (Suppl.): 169 p.
ultimo los cefalpodos con 2 especies.

Moluscos de Tenacatita, Jalisco

Familia Fasciolariidae

Opeatostoma pseudodon (Burrow, 1815)

Distribucin. Desde Cabo San Lucas, Baja California Sur; el Golfo de


California Mxico, hasta Per.
Actualizacin. Se amplia su distribucin a la Isla Gorgona, Colombia. Se
amplia su talla a 62.7 mm de largo.

Hbitat. Habita entre las rocas en


niveles de marea baja y aguas
someras.

Descripcin. La concha es blanca debajo de un periostraco caf amarillento.


Varias aristas espirales lisas de color caf oscuro dan la apariencia de estar
dobladas hacia adentro de un torno. Con una espira larga a manera de diente en la
parte inferior del labio externo. Longitud cerca de 42 mm; dimetro de 31 mm.

Observaciones. Es un depredador activo con adaptabilidad a alimentarse de


carroa. Hacia la regin interior de la columnela se encuentran dos o tres pliegues,
Es una especie no muy frecuente que puede o no ser gregaria y ocasionalmente se
le encuentra asociada a sustratos coralinos.

Importancia. Esta especie a pesar de que no es muy grande ni abundante, en


ocasiones se comercializa en algunas regiones a nivel de consumo local.

64
Estudios sobre Malacologa y Conquiliologa en Mxico

BIOLOGIA Y BIOGEOGRAFIA

65
Camacho-Montoya, C., M. C., Valdez-Pineda, R., Prez-Gonzlez y R. E., Rodrguez-Negrete. 2007. Moluscos en una rea de crianza de las
langostas Panulirus inflatus y P. gracilis (Decapoda: Palinuridae) en la Baha de Mazatln, Sinaloa. pp 67-69. En: Estudios sobre la Malacologa y
Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

MOLUSCOS EN UNA REA DE CRIANZA DE LAS LANGOSTAS Panulirus inflatus y


P. gracilis (DECAPODA: PALINURIDAE) EN LA BAHA DE MAZATLN, SINALOA

Camacho-Montoya, Consuelo, Valdez-Pineda, Mara Candelaria, Prez-Gonzlez, Ral y Rodrguez-


Negrete, Ricardo E.
Facultad de Ciencias del Mar de la Universidad Autnoma de Sinaloa. mcvaldez88@hotmail.com.
Palabras clave: Moluscos, crianza, Mazatln, Sinaloa, Panulirus.

INTRODUCCIN que se encuentran en una zona de crianza de las


La baha de Mazatln, Sinaloa, presenta una langostas P. inflatus y P. gracilis.
relevante e importante biodiversidad marina
debido a que, como parte de la zona sureste del MATERIALES Y MTODOS
golfo de California, se encuentra en una de las Los muestreos se realizaron mensualmente entre
regiones ms diversificadas de Mxico con enero del 2005 y enero del 2006 en una rea
respecto a las especies marinas que viven en limitada de 1200 m2 dentro de la baha de
aguas someras (Hendrickx y van der Heiden, Mazatln, Sinaloa, localizada entre los 2310 y
1983). Esta regin se encuentra dentro de un 2314 N y los 10625 y 10627 O. El rea se
rea ms amplia denominada Pacfico oriental encuentra en la zona de transicin entre el golfo
tropical, en la cual la zona de Mxico que cuenta de California y el ocano Pacfico, por lo que est
con una mayor diversidad de moluscos (Reguero sujeta a las condiciones oceanogrficas de
y Garca-Cubas, 1993). La baha de Mazatln ambas partes. Para facilitar la colecta y anlisis
presenta una gran variedad de microambientes de las muestras, el rea se dividi en tres partes
(pozas de mareas, grietas rocosas, etc.) con iguales de 20x20 m. Se extrajeron tres muestras
diferentes tipos de sustratos (macizos rocosos, de manera manual en cada una de esas partes
rocas sueltas y sustratos arenosos) que permiten durante las mareas ms bajas, utilizando un
el establecimiento de un gran nmero de cuadrante de 25x25 cm lanzado al azar. En los
especies animales y vegetales. Entre los sustratos arenosos se removi la capa superficial
animales se encuentran de manera dominante hasta 3 cm de profundidad, mientras que en los
los del Phylum Mollusca, siendo de los rocosos se utilizaron pinzas y guantes para la
invertebrados ms llamativos y mejor conocidos recolecta de los organismos. Las muestras
e incluyen formas diversas como las almejas, fueron depositadas en bolsas de plstico y
caracoles y poliplacforos y, por la gran cantidad trasladadas al laboratorio para su procesamiento
de especies que comprenden, constituyen el y anlisis. Los moluscos fueron separados de los
mayor filo de invertebrados despus de los dems organismos de la epifauna y se
artrpodos. Las reas que habitan los juveniles clasificaron por grupos taxonmicos. La
de las langostas Panulirus inflatus y P. gracilis se determinacin de cada uno de los ejemplares
caracterizan por constituirse de sustratos rocosos recolectados se realiz con la literatura
y arenosos-rocosos, cubiertos en ciertas pocas especializada correspondiente, principalmente
del ao por macroalgas y otros organismos que con los trabajos de Keen (1971), Keen y Coan
se fijan, ya sea a esos sustratos o son epibiontes (1974), Allen (1977), Brusca (1980), Reyes-
de esos vegetales (Rodrguez-Negrete, 2006), Gmez (1999) y Hendrickx et al. (2005).
entre los que sobresalen los moluscos. Estos
organismos desempean un papel importante RESULTADOS Y DISCUSIN
dentro de la comunidad bentnica y son uno de De las recolectas realizadas se obtuvieron un
los grupos trficos ms importantes dentro de la total de 5755 organismos, de los cuales 3044
dieta da las langostas espinosas (Colinas- correspondieron al grupo de los moluscos,
Snchez y Briones-Fourzn, 1990; Daz- representando una elevada proporcin (52.9%)
Arredondo y Guzmn-del-Pro, 1995; Lozano- en nmero de individuos con respecto a los otros
lvarez y Aramoni-Serrano, 1996; Briones- animales que se encuentran en la comunidad
Fourzn et al., 2003; Castaeda-Fernndez-de- bentnica, entre los que sobresalen los
Lara et al., 2005). Por lo tanto, con la finalidad de crustceos, esponjas, equinodermos, anlidos,
conocer uno de los grupos con mayor sipunclidos y algas (Camacho-Montoya, 2006).
abundancia y que estn representados por una En la tabla 1 se presenta la lista sistemtica de
gran variedad de organismos, en este trabajo se los moluscos encontrados durante el ciclo de
presenta el listado taxonmico de los moluscos muestreo, observndose que se determinaron 45
especies, dentro de 45 gneros y 31 familias.

67
Estudios sobre Malacologa y Conquiliologa en Mxico

Asimismo, se muestra que en 31 de los casos no Briones-Fourzn, P., V. Castaeda-Fernndez de


se determin la especie; sin embargo, se Lara, E. Lozano-lvarez & J. Estrada-Olivo.
clasificaron hasta el nivel de gnero. 2003. Feeding ecology of the three juvenile
De la clasificacin resultaron tres clases, phases of the spiny lobster Panulirus argus in a
siendo la ms abundante y con mayor diversidad tropical reef lagoon. Marine Biology, 142: 855-
Gastropoda con 38 especies, siguindole 865.
Pelecypoda con 5 y Polyplacophora con 2. Las Brusca, R. C. 1980. Common intertidal
especies con mayor abundancia en nmero invertebrates of the Gulf of California. Second
fueron Costoanachis varia y Nerita funiculata Edition. University of Arizona, U.S.A.
pertenecientes a los gasterpodos. De la clase Camacho-Montoya, C. 2006. Alimentacin de
Pelecypoda las especies ms abundantes fueron juveniles de las langostas Panulirus inflatus
Barbatia bailyi e Isognomon janus. (Bouvier, 1895) y P. gracilis Streets 1871, y su
La mayora de las especies de relacin con el bentos en la baha de Mazatln,
gasterpodos se encontraron asociados a la Sinaloa. Tesis de Licenciatura. Facultad de
pradera de Padina durvillae, principalmente Ciencias del Mar, Universidad Autnoma de
Costoanachis varia, C. nigricans, C. nigrofusca, Sinaloa.
Anachis scalarina, Tricolia perforata, Parvanachis Castaeda-Fernndez-de-Lara, V., E. Serviere-
gaskoini, P. pygmaea, Nerita funiculata, Zaragoza, S. Hernndez-Vzquez & M. J.
Cerithium menkei, Tegula corteziana, Mitrella Butler IV. 2005. Feeding ecology of juvenile
delicata, M. bacatta y M. guttata. Snchez- spiny lobster, Panulirus interruptus, on the
Vargas (1984) encontr que las especies ms Pacific coast of Baja California Sur, Mexico.
abundantes fueron Parvanachis pygmaea y New Zealand Journal of Marine and Freshwater
Cerithium menkey en la misma zona de estudio Research, 39: 425-435.
de este trabajo y, adems, tambin seala que Colinas-Snchez, F. y P. Briones-Fourzn. 1990.
las principales especies asociadas a la Alimentacin de las langostas Panulirus argus
macroalga P. durvillae fueron Anachis scalarina, y P. guttatus (Latreille, 1804) en el Caribe
Parvanachis gaskoini, P. pygmaea. mexicano. An. Inst. Cienc. del Mar y Limnol.
Los poliplacforos fueron los organismos Univ. Nal. Autn. Mxico, 17: 89-109.
menos representados con 2 familias y 2 Cortz-Acosta, E. y D. Rodrguez-Garca. 2005.
especies; sin embargo, Cortz-Acosta y Contribucin al conocimiento de los quitones
Rodrguez-Garca (2005) determinaron 5 Stenoplax limaciformis (Sowerby, 1832),
especies en una zona cercana (Tres Islas en la Radsiella mucaria (Gould, 1846), Tonicia
baha de Mazatln) al rea de estudio de esta forbesii (Carpenter, 1857), Chiton albolineatus
investigacin, las cuales fueron Tonicia forbessi, (Broderip y Sowerby, 1829) y Chiton articulatus
Chiton albolineatus, C. articulatus, Radsiella (Sowerby, 1832) de las Tres Islas de la baha
muscaria y Stenoplax limaciformis. de Mazatln, Sinaloa, Mxico. Tesis de
El rea de estudio corresponde a una zona de Licenciatura. Facultad de Ciencias del Mar,
crianza para las langostas Panulirus inflatus y P. Universidad Autnoma de Sinaloa.
gracilis. Lo anterior es importante destacarlo, ya Daz-Arredondo, M. A. y S. A. Guzmn del Pro.
que los juveniles de estos crustceos 1995. Hbitos alimentarios de la langosta roja
posteriormente se reclutarn a la pesquera, por (Panulirus interruptus Randall, 1840) en Baha
lo que es necesario que durante esta etapa Tortugas, Baja California Sur. Ciencias
encuentren lugares adecuados para refugiarse y Marinas, 21(4): 439-462.
alimentarse. Las especies sealadas Hendrickx, M. E. y A. M. van der Heiden. 1983.
anteriormente se alimentan preferencialmente de Estudio de la fauna de invertebrados del sur de
moluscos (Camacho-Montoya, 2006), por lo que Sinaloa, Mxico. En: Ayala-Castaares, A., F.
conociendo reas con abundancia de estos B. Phleger, R. Schartzlose y A. Laguarda-
organismos y principalmente con las especies de Figueras (eds.). Simposio El Golfo de
las que se alimentan las langostas, tambin California. Publ. Esp. Inst. Cienc. del Mar y
sern zonas en las que se podra encontrar Limnol. Univ. Nal. Autn. Mxico.
juveniles de P. inflatus y P. gracilis. Hendrickx, M. E., R. C. Brusca y L. T. Findley.
2005. Listado y distribucin de la macrofauna
LITERATURA CITADA del golfo de California, Mxico. Parte 1.
Allen, R. K. 1977. Common intertidal Invertebrados. Arizona-Sonora Desert
invertebrates of southern California. Revised Museum.
Ed.. Peek Publications. Palo Alto, Cal., U.S.A.

68
Estudios sobre Malacologa y Conquiliologa en Mxico

Keen, A. M. 1971. Sea shells of tropical west Columbellidae Columbella strombiformis


America. Marine mollusks from Baja California C. fuscata
Costoanachis nigrofusca
to Peru. Second Edition. Stanford University C. nigricans
Press, Stanford California, U.S.A. C. varia
Keen, A. M. & E. Coan. 1974. Marine molluscan Parvanachis gaskoini
genera of western north America. An illustrated P. pygmaea
key. Second edition. Stanford University Press. Mitrella delicata
M. bacatta
Stanford, California, U.S.A.
M. guttata
Lozano-lvarez E. y G. Aramoni-Serrano. 1996. M. sp.
Alimentacin y estado nutricional de las Anachis scalarina
langostas Panulirus inflatus y Panulirus gracilis A. sp.
(Decapoda: Palinuridae) en Guerrero, Mxico. Clase Gastropoda (continuacin)
Rev. Biol. Trop., 44(2): 453-461. Familia Especie
Columbellidae Strombina sp.
Reguero, M y A. Garca-Cubas, 1993. Estado Nassarina sp.
actual de la investigacin sobre diversidad de Buccinidae Cantharus sp.
moluscos en Mxico. Revista de la Sociedad Engina sp.
Mexicana de Historia Natural, 44: 191-207. Cerithiidae Cerithium menkei
Reyes-Gmez, A. 1999. Sistemtica de los C. maculosum
C. stercusmuscarum
quitones (Mollusca: Polyplacophora) de la
C. sp.
coleccin nacional de moluscos del Instituto de Seila sp.
Biologa, UNAM. Tesis de Licenciatura. Muricidae Plicopurpura patula pansa
Universidad Nacional Autnoma de Mxico. Muricopsis pauxillus
Rodrguez-Negrete, R. E. 2006. Densidad y Capulidae Capulus sp.
Calyptraeidae Crepidula striolata
descripcin del hbitat de juveniles de las
C. aculeata
langostas Panulirus inflatus (Bouvier, 1895) y C. onyx
P. gracilis Streets 1871 en la baha de C. lessonii
Mazatln, Sinaloa. Tesis de Licenciatura. C. excavata
Facultad de Ciencias del Mar, Universidad C. sp.
Autnoma de Sinaloa. Crucibulum monticulus
C. scutellatum
Snchez-Vargas, D. P. 1984. Ecologa y C. sp.
estructura de las comunidades de moluscos y Littorinidae Nodilittorina aspera
crustceos decpodos en la ensenada de Hipponicidae Hipponix pilosus
Puerto Viejo, Mazatln, Sinaloa. Tesis de H. sp.
Licenciatura. Escuela de Biologa, Universidad Olividae Oliva sp.
Mitridae Mitra tristis
Autnoma de Guadalajara.
M. sp.
Epitoniidae Epitonium sp.
Tabla 1.- Lista de las familias y especies de moluscos
encontrados en una zona de crianza de juveniles de Clase Bivalvia (Pelecypoda)
las langostas Panulirus inflatus y P. gracilis en la Arcidae Barbatia bailyi
baha de Mazatln, Sinaloa. B. reeveana
Mytilidae Brachidontes semilaevis
Clase Gastropoda Ostreidae Ostrea sp.
Familia Especie Spondylidae Spondylus sp.
Thaididae Thais speciosa Isognomonidae Isognomon janus
T. biserialis Pteriidae Pinctada mazatlanica
T. sp. Carditidae Cardita sp.
Buccinidae Nassarius pagodus Mactridae Mactra sp.
Vitrinellidae Teinostoma amplectans Donacidae Donax sp.
Acmaeidae Collisella acutapex Veneridae Chione sp.
C. pediculus Protothaca sp.
C. sp. Tivela sp.
Phasianellidae Tricolia perforata
T. sp. Clase Polyplacophora
Neritidae Nerita funiculata Ischnochitonidae Ischnochiton aethonus
N. scabricosta I. sp.
Fissurellidae Fissurella gammata Lepidozona sp.
F. sp. Chitonidae Chiton albolineatus
Diodora inaequalis C. sp.
Trochidae Tegula corteziana
T. sp.

69
Curiel-Ramrez Gtz., S. y J., Cceres-Martnez. 2007. Identificacin de postlarvas de Mytilus galloprovincialis y Mytilus californianus, utilizando medidas
morfomtricas. pp 70-72. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa
(eds). Universidad de Guadalajara, Mxico. 286 p.

IDENTIFICACIN DE POSTLARVAS DE Mytilus Galloprovincialis Y Mytilus californianus,


UTILIZANDO MEDIDAS MORFOMTRICAS

Curiel-Ramrez Gtz, Sergio1 y Cceres-Martnez, Jorge2


1
Instituto Tecnolgico de Boca del Ro. 2Centro de Investigacin Cientfica y de Educacin Superior de
Ensenada. scuriel73@yahoo.com.mx
Palabras clave: Postlarvas, morfometra, Mytilus galloprovincialis, Mytilus californianus.

INTRODUCCIN correr el gel de almidn en TME (pH 7.8) a una


Para realizar estudios ms detallados sobre el temperatura de 4 C a 80 mV por 24 horas.
asentamiento y la dispersin de estadios Pasado este tiempo se prosigui a cortar el gel
tempranos de especies cercanas de mejillones en secciones de 3mm para proseguir con la
(Mytilus californianus y Mytilus galloprovincialis) tincin con 9 enzimas: glucosa fosfato isomerasa
es necesario contar con una forma de (GPI, 5.3.1.9), leucina aminopeptidasa (LAP,
identificacin rpida, barata y confiable de cada 3.4.11.-), isocitrato deshidrogenasa (IDH,
especie, esto es debido a que en los estadios 1.1.1.42), enzima mlico (ME, 1.1.1.40), malato
tempranos de desarrollo las dos especies deshidrogenasa (MDH, 1.1.1.37), manosa fosfato
presentan caractersticas morfolgicas muy isomeresa (MPI, 5.3.1.8), 6-fosfogluconato
similares (McDonald et al., 1991 y Martel et al., deshidrogenasa (PGD, 1.1.1.44),
1999). fosfoglucomutasa (PGM, 2.7.5.1) y lactato
deshidrogenasa (LDH, 1.1.1.27). La tincin se
MATERIALES Y MTODOS realiz usando el procedimiento estndar (Harris
Para la realizacin de este estudio, se y Hopkinson, 1976), excepto para LAP, el cual
recolectaron racimos de mejillones de la zona fue teido de acuerdo con el procedimiento
rocosa de la Baha de Todos Santos, conocida descrito por Beaumont et al. (1983). Azul de
como playitas. De los racimos de mejillones, se Meldola (0.8%) fue usado en lugar de PMS
extrajeron ejemplares de mitlidos a los cuales se (Turner y Hopkinson, 1979). De las nueve
les tomaron las medidas de la parte posterior de enzimas, slo la enzima GPI y LAP tieron las
la concha al pice (DA) y se dividi entre el largo muestras debido al tamao de los organismos.
total del organismo (L) para sacar la relacin al Una vez identificadas las especies de mejillones
pice dorsal (RAD), con la cual se separan las presentes en el gel, stas se compararon con las
especies de mejillones presentes en la muestra. especies identificadas con las medidas
Adems, tambin se utilizaron ejemplares de morfomtricas.
Mytilus galloprovincialis obtenidos de un desove
en el mes de noviembre de 2002 en el RESULTADOS Y DISCUSIONES
Laboratorio de Biologa y Patologa de La proporcin del asentamiento de Mytilus
Organismos Acuticos del Departamento de galloprovincialis fue mayor de los 2 a 11 m de
Acuicultura del CICESE, a los cuales tambin se profundidad y la de Mytilus californianus fue
les tomaron las mismas medidas. Con el fin de mayor de los 13 a 18 m de profundidad (Tabla I).
comprobar si las identificaciones de los Por otra parte, el asentamiento promedio de M.
mejillones, obtenidas con las medidas galloprovincialis para el mes de enero fue del
morfomtricas eran correctas, se procedi a 93.37 % y el de M. californianus fue del 6.62 %;
realizar un anlisis de alozimas a los mismos mientras que en el mes de febrero el
mejillones medidos, segn la tcnica de asentamiento promedio de M. galloprovincialis
electroforesis de alozimas descrita para el abuln disminuy al 88.13 % y el de M. californianus
amarillo por Del Ro Portilla y Gonzlez Avils aument al 11.87 % (Fig. 1).
(2001). Para este anlisis, los mejillones
completos fueron homogeneizados
individualmente en tubos de micro-centrfuga de
1.5 ml, a los cuales se les aadi 0.5 ml de
amortiguador TME (0.1 M tris, 0.1 M cido
maleico, 0.01M EDTA, y 0.01M MgCl2, pH 7.8),
posteriormente se tom una muestra del
homogeneizado utilizando tiras de papel filtro (2 x
10 mm), las cuales se colocaron en un gel de
almidn (12%). A continuacin se prosigui a

70
Estudios sobre Malacologa y Conquiliologa en Mxico

Tabla I.- Porcentajes de Mytilus galloprovincialis y resultados anteriormente descritos, indicaron que
Mytilus californianus identificados para cada las RAD de las dos especies son diferentes y no
profundidad, estacin y mes de muestreo. existi un traslape entre ellas (Fig. 2). La Figura 2
ENERO FEBRERO
se construy con todos los datos de las
Profundidad M. galloprovincialis
2m 99.205
M. californianus
0.795
N
377
M. galloprovincialis
88.691
M. californianus
11.309
N
336 relaciones al pice dorsal registrados durante el
5m 98.928 1.072 373 87.363 12.637 364
7m 98.360 1.640 366 87.541 12.459 305 estudio; en el caso de Mytilus galloprovincialis,
9m 99.624 0.376 266 79.776 20.224 356
Estacin 1 10m
11m
98.608
99.437
1.392
0.563
359
355
89.058
80.156
10.942
19.944
329
361
15 724 mediciones y en el caso de Mytilus
13m
15m
96.108
92.835
3.892
7.165
334
321
86.119
82.334
13.881
17.666
353
300
californianus, 1 574 mediciones.
18m 84.298 15.702 242 82.131 17.869 291
2m 95.325 4.675 385 84.524 15.476 336
5m 93.067 6.933 375 86.983 13.017 338 0.62
7m 99.724 0.276 362 88.663 11.337 344
9m 99.723 0.277 361 87.500 12.500 312
Estacin 2 10m 96.121 3.878 361 93.333 6.667 300 0.60
11m 93.411 6.589 258 94.760 5.240 229
13m 92.425 7.575 330 95.172 4.828 290
15m 88.525 11.475 305 93.074 6.926 231 0.58
18m 83.334 16.666 246 97.253 2.747 182

Relacin al pice dorsal


2m 93.980 6.020 382 87.671 12.329 365 0.56
5m 90.572 9.428 350 85.286 14.714 367
7m 99.431 0.569 351 85.795 14.205 352
9m 76.667 23.333 330 84.894 15.106 331 0.54
Estacin 3 10m 92.331 7.669 339 86.982 13.018 338
11m 95.427 4.573 328 91.395 8.605 337
13m 89.865 10.135 296 92.157 7.843 306 0.52
15m 86.281 13.719 277 90.604 9.396 298
18m 87.395 12.605 119 90.301 9.699 299
0.50 Promedio+DE
Promedio-DE
Promedio+EE
0.48 Promedio-EE
Promedio
E s tac i n 1 E s tac i n 2 E s tac i n 3
0.46
N= 8 748 N= 8 550 Mg Mc

= 9 3 .3 7 = 8 8 .1 3 Especie
1 00
Figura 2.- Intervalos de las relaciones al pice dorsal
80
de Mytilus galloprovincialis (Mg) y Mytilus californianus
60 (Mc) obtenidos durante la identificacin. Las relaciones
al pice dorsal ms grandes pertenecen a M.
40
californianus y las menores a M. galloprovincialis.
20 = 6 .6 2 = 1 1 .8 7

0 De acuerdo con los resultados obtenidos


M . g a llo p r o v in ci al is
E NER O
M . ca li fo r n i an u s M . g a llo p r o v in ci al is
F EB RER O
M . ca li fo r n i an u s
en el estudio, la utilizacin de las medidas
morfomtricas de las conchas para identificar a
Figura 1.- Histograma del nmero total de mejillones Mytilus californianus y Mytilus galloprovincialis de
identificados de Mytilus galloprovincialis y Mytilus la Baha de Todos Santos, mostr excelentes
californianus. indica los valores promedios de los resultados, ya que se logr identificar a estas dos
porcentajes de los mejillones identificados de las tres especies sin ningn problema. Esto se debi a
estaciones, para cada mes de muestreo. que las diferencias en las relaciones al pice
dorsal de M. galloprovincialis (0.433 a 0.548) y M.
En relacin a la distribucin de tallas y californianus (0.563 a 0.614) registradas en el
los pices dorsales de Mytilus galloprovincialis y estudio, indicaron que no existe posibilidad de
Mytilus californianus por estacin, profundidad y error al diferenciar una especie de la otra, ya que
mes de muestreo, se encontr que en los no existe un traslape entre las relaciones al pice
mejillones asentados en las diferentes dorsal de estas especie. Adems, que las
profundidades, en el mes de enero, se relaciones al pice dorsal de cada una de estas
registraron intervalos de tallas promedios de especies se mantiene en un intervalo de tallas de
longitudes de conchas entre los 0.483 a 1.650 0.483 a 2.950 mm para M. galloprovincialis y de
mm para M. galloprovincialis y entre los 0.450 a 0.450 a 3.660 mm para M. californianus. Estos
1.500 mm para M. californianus, e intervalos de resultados concuerdan parcialmente con los
RAD promedios de entre los 0.433 a 0.548 y descritos por Martel et al. (1999), ya que estos
0.563 a 0.605 para M. galloprovincialis y M. autores encuentran relaciones al pice dorsal de
californianus respectivamente. En el mes de 0.540 a 0.650 mm para M. californianus de la Isla
febrero, se registraron intervalos de tallas de Vancouver, Canad y de 0.540 a 0.630 mm y
promedios de longitudes de conchas entre los 0.360 a 0.540 mm en la Isla Catalina, California,
0.515 a 2.950 mm y 0.536 a 3.660 mm para M. para M. californianus y M. galloprovincialis,
galloprovincialis y M. californianus respectivamente. Tales diferencias en las
respectivamente, e intervalos de RAD promedios relaciones al pice dorsal se pueden deber a que
entre los 0.476 a 0.546 para M. galloprovincialis y las caractersticas morfolgicas de los mejillones
entre los 0.563 a 0.614 para M. californianus. Los varan de acuerdo con las condiciones

71
Estudios sobre Malacologa y Conquiliologa en Mxico

ambientales de cada zona, as como con la


localidad en la que se hace el estudio (Cceres-
Martnez et al., 2003).

LITERATURA CITADA
Beaumont, A. R., C. M. Beveridge & M. D. Budd.
1983. Selection and heterozygosity within
single families of the mussel Mytilus edulis (L.).
Mar. Biol. 4: 151-161.
Cceres-Martnez, J., M. A. Del Ro-Portilla., S.
Curiel-Ramrez Gutirrez & I. Mndez Gmez
Humarn. 2003. Phenotypes of the California
mussel, Mytilus californianus, Conrad 1837. J.
Shell. Fish. Res. 22(1): 135-140.
Del Ro-Portilla, M. A & J. G. Gonzlez-Avils.
2001. Population genetics of the yellow
abalone, Haliotis corrugate, in Cedros and San
Benito islands: a preliminary survey. J. Shell.
Fish. Res. 20(2): 765-770.
Martel, L. A., C. Robles., K. Beckenbach & J. M.
Smith. 1999. Distinguishing early of eastern
Pacific mussels (Mytilus spp.) using
morphology and genomic DNA. Invertebrate
Biology. 118(2): 149-164.
McDonald, J. H., R. Seed & R. K. Koehn. 1991.
Allozymes and morphometric characters of
three species of Mytilus in the Northern and
Southern hemispheres. Mar. Biol. 111: 324-
333.
Turner, V. S & D. A. Hopkinson. 1979. The use of
mendola blue in isozyme stains after
electrophoresis. F. E. B. S. 105: 376-378.

72
Bertsch, H. y A., Hermosillo. 2007. Error! Slo el documento principal.Biogeografa alimenticia de los Opistobranquios del Pacfico Noreste. pp 73-
75. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de
Guadalajara, Mxico. 286 p.

BIOGEOGRAFA ALIMENTICIA DE LOS OPISTOBRANQUIOS DEL PACFICO NORESTE

Bertsch, H.1 y Hermosillo, A.2


1
Research Associate, Natural History Museum of Los Angeles County, 192 Imperial Beach Blvd. # A,
Imperial Beach, CA 91932 USA. 2CUCBA, Universidad de Guadalajara. hansmarvida@sbcglobal.net,
gueri25@hotmail.com.
Palabras clave: Biogeografa, opistobranquios, Pacfico, hbitos alimenticios.

INTRODUCCIN y subtropical (Panmica) segn Briggs (1974) y


Los estudios a largo plazo son reconocidos cada Keen (1971). Las abundancias (un total de
vez ms como medio importante para determinar 35,189 especmenes) se ordenaron y
los cambios en la biodiversidad, extinciones de correlacionaron con sus presas (herbvoros,
poblaciones, degradacin de hbitats y esponjas, cnidarios y briozoos) y se calcularon
prioridades de conservacin. Segn Hendriks et los porcentajes de ocurrencia (Tablas S1-
al., (2006), Debemos mejorar nuestro 4:www.slugsite.us/hans/Hans_Page_01.htm ).
entendimiento del funcionamiento del ecosistema
global del ocano para poder disear redes de RESULTADOS Y DISCUSIN
reas protegidas que preserven efectivamente la Se observaron diferencias en la preferencia de
biodiversidad. presas entre las distintas las localidades (Tabla
Los estudios sobre los moluscos II). El estudio de Nybakken (1974) reporta
opistobranquios del Pacfico oriental templado se nicamente Nudibranchia, por lo que esta
han concentrado principalmente en las seccin del trabajo compara solamente los 4
descripciones taxonmicas y morfolgicas de las sitios en Mxico. Para los 5 rdenes de
especies, observaciones y experimentos Opisthobranchia los herbvoros (36%) y
ocasionales en el campo o laboratorio (por espongvoros (34.7%) dominaron en BLA Punta
ejemplo preferencias alimentarias y la Gringa/Cuevitas [PG/C]) debido a la abundante
oviposiciones), listas de especies de alguna presencia de Elysia diomedea (33% del total de
regin y extensiones de mbito (referimos a especmenes). Los comedores de cnidarios
Behrens, 2004; Camacho-Garca et al., 2005; dominaron en BB, pero los comedores de
Behrens y Hermosillo, 2005; Hermosillo et al., briozoos (dominados por la especie de drido
2006). Tambja abdere) y los espongvoros fueron
segundos en abundancia en los sitios del Grupo
MATERIALES Y MTODOS 1 y Grupo 2 respectivamente. Los comedores de
Tres estudios de largo plazo sobre los briozoos fueron por gran diferencia dominantes
opistobranquios del Pacfico Noreste nos sirven en las islas de BLA, debido principalmente a las
de base para correlacionar las diferencias entre grandes abundancias de T. abdere y T. eliora.
la diversidad de los opistobranquios y las Las preferencias alimentarias tomando
estructuras trficas de los ecosistemas. Estos en cuenta los nudibranquios (Tabla II) indican un
estudios son: Pacific Grove (PG), CA, USA cambio entre BLA y BB: la ausencia total de
(intermareal, Nybakken, 1974 y 1978), Baha de herbvoros en BLA PG/C, sitio en el cual los
los ngeles (BLA), BC, Mexico (submareal, organismos se reemplazan por espongvoros y
Bertsch, 2007), y Baha de Banderas (BB), Jal comedores de cnidarios. En los tres sitios de
Nay, Mxico (submareal, Hermosillo-Gonzlez, islas de BLA, BLA PG/C y BB (Grupo 2), las
2006). Estos estudios utilizan la misma asociaciones alimentarias predominantes (las
metodologa, midiendo la densidad como tiempo cuales componen ms del 60% de los
de bsqueda. Las regiones de BLA y BB especmenes en cada sitio) fueron
consisten cada una de dos reas con distinta respectivamente briozoos, esponjas y cnidarios.
composicin de especies (Bertsch, Miller y Grant, Se observ una mayor uniformidad entre la
1998, y Hermosillo-Gonzlez, 2006), de forma preferencia de presas en PG (43% de
que tenemos cinco zonas a diferente latitud y tipo espongvoros, 36% de comedores de briozoos) y
de hbitat. para el Grupo 1 de BB (46% comedores de
Se utiliz la preferencia alimentaria de cnidarios y 30.6% de comedores de briozoos).
los opistobranquios para comparar la distribucin Las 10 especies ms comunes en los
de las especies en estas cinco localidades del cinco sitios (aclaracin: estos datos no aparecen
Pacfico Noreste (Tabla I), las cuales abarcan 15 en Nybakken, 1974) demuestran un patrn de
de latitud y las provincias templada (Oregoniana), afinidades al nivel de provinciales faunales

73
Estudios sobre Malacologa y Conquiliologa en Mxico

latitudinales (material complementario disponible


en lnea: Tabla S-5). LITERATURA CITADA
La distribucin de las abundancias de las Behrens, D. W. 2004. Pacific Coast
especies basada en las preferencias alimentarias Nudibranchs, supplement II. New species to the
vara entre las localidades, incluso dentro de los Pacific Coast and new information on the oldies.
sitios de BLA y BB. No encontramos evidencia de Proc. Calif. Acad. Sci. 55:1154.
un gradiente latitudinal, excepto en el hecho de Behrens, D. W. & A. Hermosillo. 2005. Eastern
que la preferencia de presas difiere para cada Pacific nudibranchs: A guide to the
hbitat. En contraste, entre las 10 especies ms opisthobranchs from Alaska to Central America.
abundantes en cada sitio, el taxn al nivel de Sea Challengers, Monterey CA. vi + 137 p.
especies presenta afinidades con provincias Bertsch, H. 1993. Opistobranquios (Mollusca) de
faunales (material complementario disponible en la costa occidental de Mxico. In: S. I. Salazar-
lnea: Tabla S-5). Siete especies se comparten Vallejo y N. E. Gonzlez (Eds.), Biodiversidad
entre BB Grupo 1 y Grupo 2; cinco entre BLA marina y costera de Mxico. Comisin Nacional
Islas y BLA PG/C, y 3 entre BLA Islas y BB de Biodiversidad y CIQRO, Mxico. 253270 p.
Grupo 1. Berthellina ilisima ocurre en todos los 4 Bertsch, H. 2007. Ten year baseline study of
sitios mexicanos y Phidiana lascrucensis en 3. annual variation in the opisthobranch (Mollusca:
Tambja abdere es la especie ms comn en Gastropoda) populations at Baha de los
ambos BLA Islas y BB Grupo 1. ngeles, Baja California, Mxico. In: G. D.
Para entender las causas de la evolucin Danemann y E. Ezcurra (eds.), Baha de los
ecolgica de la biodiversidad y biogeografa de ngeles: Recursos naturales y comunidad.
los opistobranquios se requiere de estudios a Pronatura Noroeste.
largo plazo en mltiples regiones. Las Bertsch, H. & M. T. Ghiselin. 1985. A
generalizaciones surgidas de nuestros datos bioeconomic scenario for the evolution of
parecen limitarse a cada sitio o hbitat, por lo que nudibranch gastropods. Ann. Rept. West. Soc.
es necesario llevar a cabo anlisis similares entre Malac. 17:67.
mayor nmero de sitios en otras localidades de Bertsch, H., M. D. Miller & A. Grant. 1998. Notes
las mismas provincias. on opisthobranch community structures at
El conocimiento de las distribuciones Baha de los ngeles, Baja California, Mxico
Norte-Sur es solamente la primera parte para (June 1998). Opist. Newsletter 24:3536.
determinar patrones de densidad y abundancia. Briggs, J.C. 1974. Marine zoogeography. Mc-
La ocurrencia de especies en puntos extremos Graw-Hill, N.Y. 475 pp.
puede tener influencia de fenmenos como El Camacho-Garca, Y., T. M. Gosliner y . Valds.
Nio, los cuales causan un patrn anmalo por 2005. Gua de campo de las babosas marinas
un periodo corto de tiempo (Bertsch, 1993). Es del Pacfico este tropical. California Academy
importante notar que los datos para BLA, of Sciences, San Francisco. 129 p.
colectados en el periodo de 1992-2001 no Hendriks, I. E., C. M. Duarte & C. H. R. Heip.
reflejaron variaciones de abundancia que 2006. Biodiversity research still grounded.
pudieran atribuirse al evento del nio de 1997- Science 312: 1715.
1998 (Bertsch, 2007 y obs. pers.). Hermosillo-Gonzlez, A. 2006. Ecologa de los
Los estudios base de largo plazo se han opistobranquios (Mollusca) de Baha de
hecho regularmente para grupos de organismos Banderas, JaliscoNayarit, Mxico. Ph. D.
populares o altamente visibles, como aves, Tesis. CUCBA. Universidad de Guadalajara,
peces, mariposas, corales, etc. (Bertsch, 2007). Mxico. viii + 151 p.
Sugerimos esfuerzos similares de investigacin Hermosillo, A., D. W. Behrens y E. Ros-Jara.
para moluscos opistobranquios, utilizando al gran 2006. Opistobranquios de Mxico: Gua de
nmero de aficionados en el grupo quienes son babosas marinas del Pacfico, Golfo de
buzos y fotgrafos submarinos. Colectas California y las islas ocenicas. CONABIO.
cuidadosas y a largo plazo son necesarias para 143 p.
poder establecer el verdadero fondo de la pintura Keen, A. M. 1971. Sea shells of tropical west
de la vida (Steinbeck, 1951). America. Marine mollusks from Baja California
Adicionalmente a la biogeografa de to Peru, second edition. Stanford University
dispersin, la biogeografa que responde a la Press. xiv + 1064 p.
preferencia alimentaria es un factor importante en Nybakken, J. 1974. A phenology of the smaller
la seleccin natural de la evolucin de dendronotacean, arminacean and aeolidacean
Opisthobranchia (Bertsch y Ghiselin, 1985). nudibranchs at Asilomar State Beach over a

74
Estudios sobre Malacologa y Conquiliologa en Mxico

twenty-seven month period. Veliger 16:370


373.
Nybakken, J. 1978. Abundance, diversity and
temporal variability in a California intertidal
nudibranch assemblage. Mar. Biol. 45:129146.
Steinbeck, J. 1951. The log from the Sea of
Cortez. Viking Press, NY. Lxiv + 286 p.

TABLA I: Sitios de Estudio y Densidades de Especmenes. Referencias: 1Nybakken, 1974 & 1978;
2
Bertsch, 2007; 3Hermosillo, 2006.

SITIO LON-LAT # ESPECIMENES DENSIDAD


Pacific Grove, CA, USA1 35 7' N; 121 56' W 4719 39.3/hr
BLA Islas, BC, EUM2 29 06'28 58' N; 113 656 12.46/hr
26'32' W
BLA Pta la 29 03' N; 113 32' W 6088 15.08/hr
Gringa/Cuev.2
BB, Grupo 1 (exterior de 20 42'30' N; 105 33' 7021 30.08/hr
la Baha), JalNay3 W
BB, Grupo 2 (interior de 20 43'29' N; 105 14 16705 32.6/hr
la Baha)3 23' W

TABLA II. Distribucin de las abundancias de especies segn su grupo alimenticio (%), para los 5 sitios
de estudio. Clave: Brbriozoios; Cncnidarios; Heherbvoros; Spesponjas.

Nudibranquios
Pacific Grove: Sp 43% Br 36% Cn 19%
BLA Islas: Br 77% Sp 10.4% Cn 8.8%
BLA Sp 61.1% Cn 33.2% Br 4.9%
LaGringa/Cuevitas:
BB, Grupo 1: Cn 46% Br 30.6% Sp 21%
BB, Grupo 2: Cn 63% Sp 31% Br 3.4%

Todos los
opistobranquios
BLA Islas: Br 65.6% Sp 8.8% Cn 7%
BLA He 36% Sp 34.7% Cn 18.9% Br 2.8%
LaGringa/Cuevitas:
BB, Grupo 1: Cn 40% Br 26.5% Sp 23% He 4%
BB, Grupo 2: Cn 51% Sp 30.5% He 5.5% Br 2.8%

75
Angulo-Campillo, O. y G., Aceves-Medina. 2007. Resultados preliminares de la distribucin de moluscos Holoplanctonicos (Mollusca:Gastropoda) en el
Golfo de California, durante diciembre 2005. pp 76-78. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-
Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

RESULTADOS PRELIMINARES DE LA DISTRIBUCION DE MOLUSCOS HOLOPLANCTONICOS


(MOLLUSCA: GASTEROPODA) EN EL GOLFO DE CALIFORNIA, DURANTE DICIEMBRE 2005

Angulo-Campillo, Orso1, Aceves-Medina, Gerardo2


Departamento de Plancton y Ecologa Marina. Centro Interdisciplinario de Ciencias Marinas-IPN. La Paz
B. C. S. Mxico. oangulo@uabcs.mx1, gaceves@ipn.mx2
Palabras Clave: Distribucin, moluscos, holoplancton, Golfo, California.

INTRODUCCIN datos se estandarizaron a 1000m3 con la


El Phyllum Mollusca comprende por lo menos finalidad de realizar mapas de distribucin.
100,000 especies, conformndose como el
segundo grupo animal ms grande despus de RESULTADOS Y DISCUSIN
los artrpodos. Su xito evolutivo no slo es Se obtuvieron un total de 7101 organismos,
evidente en el nmero de especies, sino en la agrupados en 36 especies; de los cuales los
abundancia de las mismas. La plasticidad en su Pterpodos constituyen 92.1%, con 15 especies;
forma anatmica y su variedad de procesos los Heterpodos ocuparon el 6.54% de la
fisiolgicos les ha permitido colonizar casi todos abundancia total, con 11 especies; y los
los ambientes. La mayora de los moluscos llevan Gymnostmidos el 1.25% con 10 especies.
acabo su etapa larval nadando o flotando en la La distribucin de cada uno de los grupos
columna de agua antes de asentarse en el (Heteropoda, Pteropoda y Gymnostomida),
bentos (meroplancton). Sin embargo muy pocos muestra mayores densidades hacia la porcin
han tenido xito en habitar el ambiente centro-sur del golfo, en donde se presentaron las
planctnico durante todo su ciclo de vida mayores temperaturas (22.5 a 24C), mientras
(holoplanctn). que las menores densidades y temperaturas (18
Los gasterpodos holoplantnicos se a 20C) se registraron en la porcin continental
encuentran comprendidos en tres grupos (Figura 1).
principales: Heteropoda, Pteropoda y
Gymnostomata. (Lalli y Gilmer, 1998). Se
distribuyen desde la superficie, hasta
profundidades mayores a 1000 m, pero sus
mayores densidades se registran entre los 50 y
200 m (Richter y Seapy, 1999). El conocimiento
que se tiene sobre este grupo es escaso. Para la
pennsula de Baja California, slo se han
realizado estudios en la regin de Baha
Magdalena (Snchez-Hidalgo, 1989). En el Golfo
de California slo se conoce un estudio que
registra un total de 10 especies de Heterpodos
(Seapy y Skoglund, 2001), y no existe ninguna
investigacin sobre Pterpodos ni
Gymnostmidos.

MATERIALES Y MTODOS
En noviembre del 2005 se efectu un crucero
oceanogrfico en el Golfo de California, donde
se realizaron un total de 24 arrastres oblicuos de
zooplancton con redes tipo Bongo de 505 y 333
m utilizando el mtodo propuesto por Smith y Figura 1. Abundancia de moluscos Holoplanctnicos
e Isotermas de temperatura superficial.
Richardson (1979). Las redes se equiparon con
flujmetros marca General Oceanics para la
estimacin del volumen de agua filtrado. Las La clasificacin de grupos, a partir de la
muestras obtenidas en la red de 505 m se abundancia de los moluscos, se realizo mediante
conservaron en alcohol al 96%. dendrogramas del Similitud de Bray-Curtis, en
En el laboratorio se separaron y donde se delimitan dos regiones, una surea y
contabilizaron los moluscos encontrados. Los una nortea (Figura 2). Los dendrogramas por
grupo muestran la persistencia de una regin

76
Estudios sobre Malacologa y Conquiliologa en Mxico

surea independientemente del grupo analizado.


(Figura 3.) En contraste, la regin nortea, es Figura 3. Representacin grafica de la
variable con respecto a las estaciones que la regionalizacin para cada uno de los grupos. A)
forman y en funcin del grupo analizado, con Heteropoda, B) Pteropoda y C) Gymnostomida.
especies templadas-subarticas.

Figura 4. Imagen de satlite de la temperatura


superficial de mar. (Imagen proporcionada por
CICESE).

La regionalizacin obtenida concuerda


con las observadas por Briton y Townsend
Figura 2. Representacin grafica de la (1980), a partir de la distribucin de eufsidos
regionalizacin, a partir del mtodo de similitud de (norte y sur); de igual manera Aceves et al.
Bray-Curtis. (2004), con larvas de ictioplancton, encuentran
dos regiones principales, pero delimitan una
En contraste, la regin nortea, es tercera que funciona como rea de transicin
variable con respecto a las estaciones que la entre las dos regiones principales. La distribucin
forman y en funcin del grupo analizado, con de los grupos y la regionalizacin observada
especies templadas-subarticas. muestra una estrecha relacin con la temperatura
superficial del mar. Las zonas de menor densidad
concuerdan con las reas de surgencia (Figura
4), que en apariencia representan en gran
A A medida una barrera fsica entre la comunidad
nortea y la surea durante la poca de vientos
dominantes del norte.
As mismo, la distribucin de los grupos
sugiere procesos de adveccin cerca de la costa
peninsular, cuyo principal mecanismo es la
surgencia continental.

LITERATURA CITADA
Aceves-Medina, G., S. P. A. Jimnez-Rosenberg,
B B C C A. Hinojosa-Medina, R. Funes-Rodriguez, R. J.
Saldierna, D. Lluch-Belda, P. E. Smith &
William Watson. 2004. Fish larvae from the Gulf
of California. Journal of Fish Biology, 65:832-
847.

77
Estudios sobre Malacologa y Conquiliologa en Mxico

Brinton, E. & A. W. Townsend. 1980. Euphausiids


in the Gulf of California, the 1957 cruises.
CalCOFI Report 21, 211-236.
Lalli, C. & R. W.Gilmer, 1989.Pelagic Snails. The
biology of holoplanktonic gastropod mollusks.
Standford University Press, Standford
California. 259 p.
Richter, G. & R. Seapy. 1999. Heteropoda. P.
621-647. En: South Atlantic Zooplancton., D.
Boltovskoy (ed), Backhuys Publishers,
Leiden,Holanda.
Snchez-Hidalgo, M. 1989. Gasterpodos
holoplantnicos de la costa occidental de Baja
California Sur, en mayo y junio de 1984. Inv.
Mar. CICIMAR. 4(1):1-14
Seapy, R. & C. Skoglund. 2001. First records of
Atlantids heteropd mollusks from the Golfo de
California. Festivus 33(4):33-44.
Smith, P. E. y S. L. Ricardson 1979. Tcnicas
modelo para prospecciones de huevos y larvas
de peces pelgicos. Roma: FAO Documento
Tcnico de Pesca No. 175.

78
Prez-Gonzlez, R., C., Camacho-Montoya y M. C., Valdez-Pineda. 2007. Los moluscos en la dieta de juveniles de las langostas Panulirus inflatus y P.
gracilis (Decapoda: Palinuridae). pp 79-81. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C.
M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

LOS MOLUSCOS EN LA DIETA DE JUVENILES DE LAS LANGOSTAS Panulirus inflatus y P.


gracilis (DECAPODA: PALINURIDAE)

Prez-Gonzlez, Ral, Camacho-Montoya, Consuelo y Valdez-Pineda, Mara Candelaria


Facultad de Ciencias del Mar de la Universidad Autnoma de Sinaloa. raulp@ola.icmyl.unam.mx;
mcvaldez88@hotmail.com.
Palabras clave: Contenido estomacal, Panulirus inflatus, Panulirus gracilis, moluscos.

INTRODUCCIN Mazatln, Sinaloa, localizada entre los 2310 y


Las langostas espinosas son organismos 2314 N y los 10625 y 10627 O (Figura 1).
importantes dentro de la comunidad en la que
habitan, ya que son depredadores de una gran
variedad de organismos de distintos grupos y Isla Pjaros 0 1 2
sirven de alimento a otros de importancia Km
comercial, destacando los pulpos y algunos
peces. 23 14
Isla
Los estudios sobre la alimentacin y Venados
hbitos alimenticios de las langostas espinosas
resaltan que uno de los grupos trficos Isla Lobos Baha de
Mazatln
preferenciales dentro de su dieta son los
moluscos, tal y como lo destacan Colinas- Ensenada de
Puerto Viejo
23 12
Snchez y Briones-Fourzn (1990) en Panulirus
guttatus y P. Aarhus; Lozano-lvarez y Aramoni-
Serrano (1996) en P. inflatus y P. gracilis;
Briones-Fourzn et al. (2003) en P. Aarhus; y
Daz-Arredondo y Guzmn-del-Pro (1995) y
Castaeda-Fernndez-de-Lara et al. (2005) en P.
interruptus. La baha de Mazatln, Sinaloa, Canal de
navegacin
presenta una importante biodiversidad marina y 106 27 106 25 106 23
como parte del Pacfico oriental tropical tambin
cuenta con una gran diversidad de moluscos
(Reguero y Garca-Cubas, 1993). Se han Figura 1. Localizacin del rea de estudio.
efectuado algunos estudios sobre este tema,
entre los cuales estn los de Hendrickx y Van der Los organismos fueron recolectados
Heiden (1983), Snchez-Vargas (1984) y manualmente durante la noche a travs de buceo
Camacho-Montoya (2006); mientras que otros libre y almacenados en una cubeta de 19 litros de
han sido sobre las poblaciones de moluscos capacidad para su traslado al laboratorio, en
asociadas a la pesca de langosta, extensiones donde se identificaron y sexaron. Despus, los
del mbito geogrfico, epibiontes de ejemplares fueron sacrificados para la diseccin
gasterpodos de fondos arenosos (Olabarria, de los estmagos, los cuales se fijaron en
1999, 2000a y b), cambios espacio-temporales formaldehdo al 10% y posteriormente se
en la estructura trfica de asociaciones de conservaron en alcohol al 70%. La determinacin
moluscos (Olabarria et al., 2001), y algunos y cuantificacin del alimento ingerido se
aspectos biolgicos y ecolgicos de los quitones realizaron con un microscopio estereoscpico y
(Cortz-Acosta y Rodrguez-Garca, 2005). una balanza analtica (0.0001 g),
El presente trabajo describe los moluscos respectivamente. El anlisis cuantitativo se
y su importancia en la dieta de juveniles de las efectu a travs de los mtodos numrico (N=
langostas P. inflatus y P. gracilis como parte de (nee/Nee)x100) y gravimtrico (G= (pe/Pe)x100);
un estudio ms amplio sobre la comunidad donde N= porcentaje numrico de un grupo
bntica en un rea de crianza de stos dado, nee= suma de los elementos de este grupo
crustceos. en todos los estmagos, Nee= suma de los
elementos de los grupos trficos en todos los
MATERIALES Y MTODOS estmagos, G= porcentaje del peso hmedo de
Los muestreos se realizaron mensualmente entre un alimento particular, pe= suma del peso de
enero del 2005 y enero del 2006 en una rea este alimento particular en todos los estmagos y
limitada de 1200 m2 dentro de la baha de Pe= suma del peso del contenido estomacal de

79
Estudios sobre Malacologa y Conquiliologa en Mxico

todos los estmagos. Para la determinacin En otras especies de langostas


especfica de los moluscos se utiliz la literatura espinosas (ejemplos: P. guttatus, P. argus y P.
especializada correspondiente. interruptus) se ha encontrado el mismo patrn del
espectro trfico, con una dominancia de los
RESULTADOS Y DISCUSIN moluscos o de los crustceos, dependiendo del
Para P. inflatus se analizaron un total de 30 rea en la que habiten o de la poca del ao
estmagos, de los cuales 24 presentaron (Colinas-Snchez y Briones-Fourzn, 1990;
contenido estomacal y para P. gracilis se Briones-Fourzn et al., 2003; Daz-Arredondo y
examinaron 9 con alimento de los 17 que se Guzmn-del-Pro, 1995; Castaeda-Fernndez-
obtuvieron. De la materia orgnica no identificada de-Lara et al., 2005). Lozano-lvarez y Aramoni-
(MONI) siempre se obtuvieron elevadas Serrano (1996) coinciden con los resultados de
proporciones, lo cual sugiere una diversidad este estudio para P. inflatus y P. gracilis, aunque
alimentaria mayor a la observada. Los analizaron organismos adultos; los organismos
organismos de cuerpo blando al ser digeridos con mayor abundancia en su dieta fueron los
rpidamente dificultan su identificacin, debido al moluscos (gasterpodos y pelecpodos) y
mecanismo alimenticio de las langostas que crustceos.
primero trituran los alimentos con sus fuertes
mandbulas y despus con el molino gstrico, Tabla 1.- Nmero de organismos, peso (g) y
fragmentando significativamente las partes duras valores calculados por los mtodos nmrico
(Num. %) y gravimtrico (Peso %) de las
y deteriorando las estructuras blandas. especies de moluscos y de los otros grupos
La dieta de P. inflatus y P.gracilis estuvo trficos presentes en el contenido estomacal de
representada principalmente por moluscos y Panulirus inflatus, en la baha de Mazatln,
crustceos, siguindole las algas, esponjas, Sinaloa.
sipunclidos y equinodermos. De los moluscos,
Grupo Trfico Nmero Num. % Peso Peso %
los grupos ms importantes lo constituyeron los Moluscos
gasterpodos y pelecpodos. La predominancia Gasterpodos 47 44.76 1.9497 38.30
de los gasterpodos en la dieta de esta especie Costoanachis varia 9 8.57 0.4631 9.097
se explica por ser este grupo sumamente Parvanachis pygmaea 8 7.61 0.4853 9.533
abundante en el bentos del rea de estudio Restos gasterpodos 7 6.67 0.4981 9.785
(Snchez-Vargas, 1984; Camacho-Montoya, Tricolia perforata 7 6.67 0.0792 1.556
Cerithium menkei 3 2.86 0.0546 1.073
2006).
Anachis scalarina 3 2.86 0.0512 1.006
En las tablas 1 y 2 se muestran las Costoanachis nigricans 3 2.86 0.0469 0.921
especies de moluscos encontradas en los Nerita funiculata 2 1.90 0.0945 1.856
estmagos de juveniles de P. inflatus y P. Crepidulydae 1 0.95 0.1594 3.131
gracilis, respectivamente, as como el nmero de Parvanachis gaskoini 2 1.90 0.0069 0.136
individuos y los valores obtenidos por los Calyptreidae 1 0.95 0.0065 0.128
Mitrella delicata 1 0.95 0.0040 0.079
mtodos numrico y gravimtrico. Tambin se
Pelecpodos 4 3.81 0.0682 1.340
anotan los valores de los otros grupos de Resto bivalvos 3 2.86 0.0098 0.193
organismos. Para la segunda especie se observ cardita sp. 1 0.95 0.0584 1.147
un espectro trfico menos amplio, aunque Poliplacforos 2 1.90 0.0036 0.071
probablemente se debi al menor nmero de Crustceos 1.6 15.24 0.7632 14.995
ejemplares analizado. Sin embargo, es notoria la Esponjas 3 2.86 0.0591 1.161
Algas 7 6.67 0.0601 1.181
dominancia de los moluscos gasterpodos. Por
Sipunclidos 3 2.86 0.0065 0.128
otro lado, para P. inflatus fue posible la Equinodermos 1 0.95 0.0021 0.041
determinacin de un espectro trfico ms amplio, MONI 24 22.86 2.1774 42.77
en el cual sobresalen los gasterpodos
Costoanachis varia, Parvanachis pygmaea y Debido a que los resultados del espectro
Tricolia perforata y en menor proporcin trfico dependen del rea o del perodo, es
Cerithium menkei, Anachis scalarina y necesario continuar con este estudio,
Costoanachis nigricans. Para el rea de estudio, recolectando organismos en varias zonas y en
Camacho-Montoya (2006) seala que los las distintas pocas del ao, ya que posiblemente
gasterpodos ms abundantes en el bentos la dieta de P. inflatus y P. gracilis sea ms
fueron C. varia y Nerita funiculata, mientras que amplia. Por ejemplo, en la misma rea de estudio
Snchez-Vargas (1984) encontr que P. del presente trabajo, Snchez-Vargas (1984)
pygmaea y C. menkei presentaron la mayor determin 117 especies de moluscos y, por otro
abundancia. lado, Olabarra (2001) seala moluscos

80
Estudios sobre Malacologa y Conquiliologa en Mxico

suspensvoros y herbvoros que no fueron Radsiella mucaria (Gould, 1846), Tonicia


obtenidos por Camacho-Montoya (2006), entre forbesii (Carpenter, 1857), Chiton albolineatus
los cuales los principales anotados son Barleeia (Broderip y Sowerby, 1829) y Chiton articulatus
alderi, Siphonaria maura, Eulithidium perforata, (Sowerby, 1832) de las Tres Islas de la baha
Lottia mitella (herbvoros), Pteria sterna, Cardita de Mazatln, Sinaloa, Mxico. Tesis de
laticostata, Lithophaga attenuata rogersi, Barbatia Licenciatura. Facultad de Ciencias del Mar,
bailyi y Chama mexicana (suspensvoros). Universidad Autnoma de Sinaloa.
Daz-Arredondo, M. A. y S. A. Guzmn del Pro.
Tabla 2.- Nmero de organismos, peso (g) y 1995. Hbitos alimentarios de la langosta roja
valores calculados por los mtodos nmrico (Panulirus interruptus Randall, 1840) en Baha
(Num. %) y gravimtrico (Peso %) de las Tortugas, Baja California Sur. Ciencias
especies de moluscos y de los otros grupos Marinas, 21(4): 439-462.
trficos presentes en el contenido estomacal de Hendrickx, M. E. y A. M. van der Heiden. 1983.
Panulirus gracilis, en la baha de Mazatln, Estudio de la fauna de invertebrados del sur de
Sinaloa. Sinaloa, Mxico. En: Ayala-Castaares, A., F.
B. Phleger, R. Schartzlose y A. Laguarda-
Grupo Trfico Nmero Num. % Peso Peso % Figueras (eds.). Simposio El Golfo de
California. Publ. Esp. Inst. Cienc. del Mar y
Moluscos 5 26.32 0.0245 2.74 Limnol. Univ. Nal. Autn. Mxico.
Gasterpodos 2 10.53 0.0072 0.80 Lozano-lvarez E. y G. Aramoni-Serrano. 1996.
Calyptreidae 1 5.26 0.0007 0.08
Alimentacin y estado nutricional de las
Bivalvos 1 5.26 0.0158 1.76
Costoanachis varia 1 5.26 0.0008 0.09
langostas Panulirus inflatus y Panulirus gracilis
Algas 1 5.26 0.0006 0.07 (Decapoda: Palinuridae) en Guerrero, Mxico.
Esponjas 1 5.26 0.0071 0.79 Rev. Biol. Trop., 44(2): 453-461.
Crustceos 3 15.79 0.3041 33.95 Olabarria, C. 1999. Estructura y variacin
MONI 9 47.37 0.5593 62.45 estacional de poblaciones de moluscos
asociadas a la pesca artesanal de langosta en
LITERATURA CITADA el Pacfico tropical. Rev. Biol. Trop., 47(4): 851-
Briones-Fourzn, P., V. Castaeda-Fernndez de 865.
Lara, E. Lozano-lvarez & J. Estrada-Olivo. Olabarria, C. 2000a. Extensin del mbito
2003. Feeding ecology of the three juvenile geogrfico de algunas especies de moluscos
phases of the spiny lobster Panulirus argus in a marinos en el estado de Sinaloa, Mxico.
tropical reef lagoon. Marine Biology, 142: 855- Anales del Instituto de Biologa, Universidad
865. Nacional Autnoma de Mxico, Serie Zoologa,
Camacho-Montoya, C. 2006. Alimentacin de 71(1): 93-98.
juveniles de las langostas Panulirus inflatus Olabarria, C. 2000b. Epibiont molluscs on
(Bouvier, 1895) y P. gracilis Streets 1871, y su neogastropod shells from sandy bottoms,
relacin con el bentos en la baha de Mazatln, Pacific coast of Mexico. J. Mar. Biol. Ass. U. K.,
Sinaloa. Tesis de Licenciatura. Facultad de 80: 291-298.
Ciencias del Mar, Universidad Autnoma de Olabarria, C. 2001. Cambios espaciotemporales
Sinaloa. en la estructura trfica de asociaciones de
Castaeda-Fernndez-de-Lara, V., E. Serviere- moluscos del intermareal rocoso en un sustrato
Zaragoza, S. Hernndez-Vzquez & M. J. tropical. Ciencias Marinas, 27(2): 235-254.
Butler IV. 2005. Feeding ecology of juvenile Reguero, M y A. Garca-Cubas, 1993. Estado
spiny lobster, Panulirus interruptus, on the actual de la investigacin sobre diversidad de
Pacific coast of Baja California Sur, Mexico. moluscos en Mxico. Revista de la Sociedad
New Zealand Journal of Marine and Freshwater Mexicana de Historia Natural, 44: 191-207.
Research, 39: 425-435. Snchez-Vargas, D. P. 1984. Ecologa y
Colinas-Snchez, F. y P. Briones-Fourzn. 1990. estructura de las comunidades de moluscos y
Alimentacin de las langostas Panulirus argus crustceos decpodos en la ensenada de
y P. guttatus (Latreille, 1804) en el Caribe Puerto Viejo, Mazatln, Sinaloa. Tesis de
mexicano. An. Inst. Cienc. el Mar y Limnol. Licenciatura. Escuela de Biologa, Universidad
Univ. Nal. Autn. Mxico, 17: 89-109. Autnoma de Guadalajara.
Cortz-Acosta, E. y D. Rodrguez-Garca. 2005.
Contribucin al conocimiento de los quitones
Stenoplax limaciformis (Sowerby, 1832),

81
Ortega-Chvez, V., J. S., Hernndez-Zepeda y R. E., Caicedo-Rivas. 2007. Malacofauna continental del estado de Puebla. pp 82-84. En: Estudios
sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara,
Mxico. 286 p.

MALACOFAUNA CONTINENTAL DEL ESTADO DE PUEBLA

Ortega-Chvez, Vernica1, Hernndez-Zepeda, J. Santos2 y Caicedo-Rivas, Ricardo E.1


1
Benemrita Universidad Autnoma de Puebla. Blvd. Valsequillo y Av. San Claudio. Escuela de
Biologa. 2Instituto de Ciencias. Edificio #76 C. U. Puebla, Pue. C. P. 72570.
veronik_ortega@hotmail.com, ricairi4@hotmail.com.
Palabras clave: Moluscos, dulceacucola, terrestre, importancia biosanitaria, cercarias.

INTRODUCCION pesar de que la mayora de stos son utilizados


Los caracoles terrestres y dulceacucolas como hospederos intermediarios por parsitos
participan como hospederos intermediarios en el por lo que se quiere contribuir con este trabajo al
ciclo de vida de algunos parsitos invertebrados conocimiento de las especies de moluscos que
que son de importancia mdica y veterinaria se encuentran dentro de algunas zonas del
(Malek y Cheng, 1974), principalmente estado y sealar las que tienen importancia a
trematodos y nemtodos. Los moluscos nivel biosanitario, identificando su hbitat y la
terrestres tambin participan en la transmisin de flora acompaante que utilizan como sustrato o
bacterias como Salmonella y cstodos que alimento.
parasitan animales domsticos principalmente;
algunos incluso transmiten virus y hongos a MATERIALES Y METODOS
plantas cultivadas (Godan, 1983). Las rea de estudio. Se realizaron colectas de
poblaciones de moluscos se han incrementado moluscos terrestres y dulceacucolas en tres
en los ltimos aos por los continuos cambios jagueyes del Municipio de Atlixco: Cabrera
ambientales globales, los cuales estn motivando (185508.2N, 982632.7 O y 1890msnm),
un aumento de enfermedades parasitarias. En Valle Sur (185352.8N, 982633.1O y
consecuencia, el parasitismo afecta la actividad 1834msnm) y Xalpatlalco (18556.2N,
productiva y reproductiva en animales de 982622.7O y 1898msnm); en la Presa de San
importancia econmica en zonas rurales y Felipe en el Municipio de San Juan Epatln
suburbanas. (1837N, 9821O a 1333msnm); en el Parque
En Mxico, se han realizado pocos Nacional Izta-Popo; Cuautinchn; la Laguna de
trabajos sobre la malacofauna dulceacucola y Valsequillo (18 53 y 18 57 N y 9806 con
terrestre de importancia biomdica, 9815O a una altitud de 2100 msnm); la Laguna
principalmente en la zona correspondiente al de C.U. de la BUAP (1900N y 9812 O con
Estado de Puebla; hay registro de 2125msnm); el Parque de los Poetas
investigaciones sobre la fauna malacolgica (190148N, 981444O, 2221msnm) y el
terrestres en lo referente a sistemtica y Parque Jurez (190142N, 981215O y
ubicacin zoogeogrfica realizadas en el sureste 2145msnm) ambos en la Cd. de Puebla.
de Mxico, donde se destacan Rangel y Gamboa Las colectas se realizaron de forma
(2001) y Rangel et al. (2004). En cuanto a manual por medio de la tcnica de cuadrantes de
estudios realizados en el norte del pas tenemos 1m2, dos veces al mes en las diferentes reas de
a los realizados por Correa-Sandoval (1993, estudio. Las especies colectadas se trasladaron
1996-1997, 1999, 2000, 2003), Correa et al. al laboratorio para su identificacin y descripcin
(1998), Correa-Sandoval y Rodrguez (2002) mediante las claves segn Emerson y Jacobson
Correa-Sandoval y Salazar (2005) y Naranjo (1976), Abbott (1989) y Thompson (1984); y se
(2003a y b). Sin embargo aun son mas escasos colocaron en un moluscario. Posteriormente se
los trabajos realizados sobre la malacofauna determinaron las especies que son hospederos
dulceacucola, algunos de ellos estn ms intermediarios de enfermedades zoonticas
enfocados a trabajos sobre enfermedades mediante tcnica de emisin de cercarias
zoonticas de los cuales podemos citar a Cruz et (metodologa modificada de Cruz et al., 2002);
al., (2002), Caicedo et al., (2005), Cruz et al., por otro lado se georreferenci cada zona de
(2005) y Rangel y Gamboa (2005). Por ltimo se colecta con un GPS (Geographical Position
han realizado varios trabajos de investigacin Satellite); por ltimo se colect e identific la flora
sobre la fisiologa, dieta, de moluscos acompaante de los moluscos dulceacucolas
dulceacucolas. misma que les sirve de alimento o sostn.
Hasta el presente, en el Estado de
Puebla, casi no se han efectuado estudios sobre
la fauna malacolgica terrestre y dulceacucola, a

82
Estudios sobre Malacologa y Conquiliologa en Mxico

RESULTADOS Y DISCUSION mientras que 7 especies de moluscos terrestres


Se registraron un total de 12 familias de pertenecen a la provincia del eje Neovolcnico
moluscos, de los cuales 4 pertenecen a familias transversal, 2 a la Sierra Madre del Sur y 1 a
de moluscos dulceacucolas (Tabla 1), y el resto ambas zonas.
(8) a familias de caracoles terrestres (Tabla 2). A En cuanto a la emisin de cercarias, slo
su vez se identificaron 20 especies de caracoles, se realiz a 5 especies de caracoles, 4
de los cuales 10 son dulceacucolas y 10 dulceacucolas y 1 terrestre, mostrando que la
terrestres (Tablas 1 y 2). La familia Planorbidae Fossaria cubensis y la Pseudosuccinea
registr el mayor nmero de especies collumella fueron las especies que emitieron
dulceacucolas (5). mayor nmero de cercarias sobrepasando las
100 cercarias/caracol/3-4h, seguidas muy de
Tabla 1. Especies de moluscos dulceacucolas. cerca por Melanoides tuberculata. Se
identificaron 10 especies de la flora que sirve de
Familia Especie sustrato y alimento a los caracoles
Physidae Physa acuta dulceacucolas.
Fossaria cubensis Los moluscos representan organismos
Lymnaeidae Pseudsuccinea columella
de mucha importancia en medios terrestres y
Lymnaea stagnalis
dulceacucolas, ya que en forma natural muchas
Helisoma duryi
Helisoma escalare
especies son controladores biolgicos de otras
Planorbidae Biomphalaria havanensis especies de invertebrados, sirven de alimento a
Drepanotrema spp otros animales, pueden llegar a causar plagas y
Gyraulus parvus son medidores de contaminacin. Sin embargo
Thiaridae Melanoides (Thiara) tuberculata tambin sirven como hospederos intermediarios
de enfermedades zoonticas, como la fasciolosis,
La familia con mayor nmero de especies schistosomiasis, paragonimiasis entre otras,
terrestres fue la Urocoptidae con 2 especies mismas que en los ltimos aos han ido
(Tabla 2). aumentando debido en gran parte por los
cambios climticos globales.
Tabla 2. Especies de moluscos terrestres En el Estado de Puebla no se tienen
colectadas. registros de trabajos realizados sobre la
malacofauna terrestre y dulceacucola, y an ms
Familia Especie sobre las especies vectores que son un foco de
Helicidae Helix aspersa infeccin para la poblacin y para animales
Subulinidae Rumina decollada principalmente de inters econmico; sin
Succinidae Succinea spp embargo, predominan los estudios realizados en
Holospira hamiltoni el norte, noreste y sureste del Pas. A diferencia
Urocoptidae
Holospira perplexa
Polygyridae
de los trabajos realizados por Correa-Sandoval
Triodopsis tridentata
Streptaxidae Euglandina spp (1999 y 2000), Correa-Sandoval et al. (1998),
Humboldtianidae Humboldtiana montezuma Correa-Sandoval y Rodrguez (2002) y Correa-
Orthalicidae Orthalicus undatus Sandoval y Salazar (2005), en sus diferentes
Limacidae Deroceras reticulatum reas de estudio sobre caracoles terrestres,
registraron que la familia con mayor nmero de
De acuerdo a los lugares de muestreos especies fue la Spiraxidae, no obstante en el
se observo que las especies ampliamente presente estudio fue la familia Urocoptidae, a su
distribuidas son Physa acuta al encontrarse en vez de que el nmero de especies que
todas las reas de muestreo. El lugar de colecta encontraron fue mayor; estas diferencias se debe
con mayor nmero de especies de caracoles en gran medida a la falta de muestreos
dulceacucolas fue la Presa de San Felipe al principalmente en la zona norte del Estado,
presentar 8 especies. La zona de muestreo de adems de que la altitud y los factores climticos
caracoles terrestres que present un mayor difieren entre las reas de estudio. Sin embargo,
nmero de especies fue la Ciudad de Puebla, solo coincidimos con el estudio realizados por
principalmente el Parque de los Poetas y sus Correa, (2003), con una especie terrestre,
alrededores, en donde se registraron 5 especies. Humboldtiana montezuma, aunque sta fue
A su vez se encontr que la mayora de colectada a una altura mucho mayor (3640msnm)
las especies de moluscos dulceacucolas a diferencia de Correa, (2003). No obstante
pertenecen a la provincia de la Sierra Madre; nuestro estudio concuerda slo con los gneros

83
Estudios sobre Malacologa y Conquiliologa en Mxico

del estudio realizado por Rangel y Gamboa, -2003. Gastrpodos terrestres del Noreste de
(2005), los cuales son Triodopsis, Lymnaea, Mxico. Rev. Biol. Trop. 51 (Suppl. 3): 507-522.
Biomphalaria, Succinea y Drepanotrema. Por otro Correa S. A., G. A. Garca-Cubas y M. M.
lado, se puede considerar al Estado de Puebla Reguero R. 1998. Gastrpodos terrestres de la
como uno de los Estados con poca diversidad en regin oriental de San Luis Potos, Mxico.
cuanto al nmero de familias de moluscos Acta Zool. Mex. (n.s.) 73: 1-17.
dulceacucolas al registrar 3 familias de las 16 Cruz M. I., V. F. Ibarra, G. E. Naranjo, M. M. T.
que estn reportadas para Mxico, segn lo Quintero, y L. J. Lecumberri. 2002.
reportado por Naranjo, (2003b), sin tomar en Identificacin taxonmica, estacionalidad y
cuenta a la familia Thiaridae que no esta grado de infeccin con Fasciola hepatica de
mencionada en esa investigacin al ser una moluscos huspedes y no huspedes
especie introducida. Asimismo en este estudio intermediarios del trematodo en el Rancho de
coincide con Naranjo, (2003b), en solo 3 la Universidad Autnoma de Hidalgo, en
especies (Fossaria cubensis, Pseudosuccinea Tulancingo, Hidalgo, Mxico. Vet. Mx. Vol. 33
collumela y Biomphalaria havanensis). Adems (2): 189-200.
las familias de moluscos terrestres que se Cruz M. I., G. E. Naranjo, M. M. T. Quintero, B. D.
identificaron en este estudio slo 5 estn Correa y V. F. Ibarra. 2005. Los miracidios de
mencionadas en el trabajo realizado por Naranjo, Fasciola hepatica y el pH afectan la
(2003a). susceptibilidad a la infeccin del caracol
Por otra parte, todas las especies Lymnaea (Fossaria) humilis. VI Congreso
analizadas emitieron cercarias en mayor o menor Latinoamricano de Malacologa (CLAMA)
proporcin, a diferencia de Cruz et al., (2002), Panam. 78 p.
que slo identificaron a Fossaria humilis como Emerson, W. K. & M. K. Jacobson, 1976. Guide
nico hospedero de Fasciola hepatica en su rea to Shells. Ed. Knopf. New York. 482 p.
de estudio, mientras que en el presente estudio Godan, D. 1983. Pest Slugs and Snails. Springer-
las especies que ms emitieron cercarias fueron Verlag, Berln. 445 p.
Fossaria cubensis y Pseudosuccinea collumella y Malek, E. & T. C. Cheng. 1974. Medical &
Melanoides tuberculata. economic malacology. Academic New York.
398 p.
LITERATURA CITADA Naranjo G. E. 2003(a). Moluscos Continentales
Abbott, R. T. 1989. Compendium of Landshells. de Mxico: Terrestres. Rev. Biol. Trop. 51
American Malacologists. New York. 240 p. (Suppl. 3): 483-493.
Caicedo R. R. E., Ch. V.Ortega, J. L. Zumaquero -2003(b). Moluscos Continentales de Mxico:
R. y P. J. L. Morn. 2005. Moluscos terrestres y Dulceacucolas. Rev. Biol. Trop. 51 (Suppl. 3):
dulceacucolas de importancia Biosanitaria en 495-505.
Mesoamrica. VI Congreso Latinoamricano de Rangel R. L. J. y A. J. Gamboa. 2001. Diversidad
Malacologa (CLAMA) Panam. 77 p. Malacolgica en la Regin Maya. I. Parque
Correa-Sandoval A. y R. M. C. Salazar. 2005. Estatal de la Sierra, Tabasco, Mxico. Acta
Gastrpodos terrestres del sur de Nuevo Len, Zool. Mex. (n.s.) 82:1-12.
Mxico. Acta Zoolgica Mexicana (n. s.) -2005. Estructura de la Comunidad y dinmica
21(2):51-61. Poblacional de Gasterpodos en una zona
Correa-Sandoval, A. y C. A. Rodrguez. 2002. enzotica de fasciolosis en Tabasco, Mxico.
Gastrpodos terrestres del Sur de Tamaulipas, Acta Zoolgica Mexicana (n. s.) 21(2): 79-85.
Mxico. Acta Zool. Mex. (n.s.) 86: 225-238. Rangel R. L. J., A. J. Gamboa y F. R. Alegra.
Correa-Sandoval A. 1993. Caracoles terrestres 2004. Diversidad Malacolgica en la Regin
(Mollusca: Gastropoda) de Santiago, Nuevo Maya. II. Parque Estatal Agua Blanca,
Len, Mxico. Rev. Biol. Trop. 41 (3):683-687. Tabasco, Mxico. Acta Zoolgica Mexicana (n.
-1996-1997. Caracoles terrestres (Mollusca: s.) 20(1):55-62.
Gastropoda) de Iturbide, Nuevo Len, Mxico. Thompson, F. G. 1984. Fiel guide to the
Rev. Biol. Trop., 44(3)/45(1): 137-142. Freshwater Snails of Florida. Florida Museum of
-1999. Zoogeografa de los gasterpodos Natural History.
terrestres de la regin oriental de San Luis
Potos, Mxico. rev. Biol. Trop. v47 n.3 San
Jos set.
-2000. Gastrpodos terrestres del Norte de
Veracruz, Mxico. Acta Zool. Mex. (n.s) 79: 1-9.

84
Estudios sobre Malacologa y Conquiliologa en Mxico

CARACOL MORADO

85
Montao-Rivera, A., R., Flores-Garza, P., Flores-Rodrguez, S., Garca-Ibez, C. G., Barroso Caldern. 2007. Estudio sobre la produccin de tinta
secretada por el caracol Plicopurpura pansa (Gould, 1853), en Barra de Potos, Guerrero. Mx. pp 87-89. En: Estudios sobre la Malacologa y
Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

ESTUDIO SOBRE LA PRODUCCIN DE TINTA SECRETADA POR EL CARACOL Plicopurpura


pansa (Gould, 1853), EN BARRA DE POTOS, GUERRERO. MX.

Montao-Rivera, Alfonso2, Flores-Garza, Rafael1, Flores-Rodrguez, Pedro1, Garca-Ibez, Sergio1,


Barroso Caldern C. Gabriela2
1
Unidad Acadmica de Ecologa Marina Universidad Autnoma de Guerrero. 2Maestra en Ciencias en
Desarrollo Regional. acua_uag@yahoo.com, plicopurpura@hotmail.com.
Palabras Clave: Plicopurpura pansa, colorantes Naturales, Potos, Guerrero.

INTRODUCCIN MATERIALES Y MTODOS


La explotacin de la tinta producida por el caracol La colecta se realiz con luna nueva y marea
se ha llevado a cabo en nuestro pas desde baja los das 27 y 28 de Mayo de 2006. Se
pocas prehispnicas, pero sta no fue a gran determinaron 118 caracoles como tamao de
escala hasta la dcada de los aos 80s cuando muestra, con un 95% de nivel de confianza y
una compaa japonesa realiz ese tipo de error estndar de 25% de acuerdo a Southwood
explotacin, generando consigo daos (1977) citado en Krebs (1999). Se coloc un
ecolgicos a los ecosistemas de la zona transecto paralelo a la lnea de costa en el nivel
intermareal donde este caracol habita. Dentro de mesolitoral superior, con treinta metros de largo y
la industria pesquera en Mxico, existen dos metros de amplitud; el primer cuadrante se
cooperativas dedicadas a la recoleccin de coloc al azar por debajo de la lnea gua y se
moluscos gasterpodos y bivalvos por mencionar colectaron los caracoles. Al terminar se repiti el
algunas. Este tipo de extraccin genera recursos mismo procedimiento por arriba de la lnea. Al
para el sustento de los colectores y sus familias, concluir los cuadrantes, se dejaban dos metros y
sin embargo, toda explotacin necesita un se repeta la operacin hasta completar el total
periodo de veda, para su recuperacin. En este de caracoles requeridos. Se midi la cantidad de
sentido, el mejor proceso de explotacin ser tinta producida con una pipeta de 0.5 y 1 ml
aquel que contribuya a conservar los recursos respectivamente; fueron pesados y medidos a
biticos y abiticos de los ecosistemas costeros, partir del pice hasta la abertura del canal sifonal.
al tiempo que eleve la calidad de vida y satisfaga Tambin fueron sexados. Se calcul la densidad
necesidades bsicas de las comunidades (caracoles/m2), la proporcin Hembra:Macho
humanas (Pastor, 2002). Por lo anterior, se (H:M), talla mnima y mxima, grupos de tallas
concibe la explotacin del recurso prpura como mejor representadas, volumen total de tinta y el
alternativa para el desarrollo econmico-social promedio de produccin por caracol. Se calcul
siempre que este se encuentre dentro de la la relacin talla-volumen de tinta y se estim la
capacidad de carga de explotacin del produccin de tinta en la zona.
ecosistema.
El caracol Plicopurpura pansa secreta un RESULTADOS Y DISCUSIN
fluido producido por la glndula hipobranquial Se present una densidad de 4.21 caracoles/m2,
(Castillo y Garca-Cubas, 1987), cuya estructura una proporcin sexual de 0.96:1 (H:M). La talla
qumica de acuerdo a Cooksey (2001) es 6:6 mnima fue de 18.03 mm y la mxima de 47.14
dibromo ndigo (C16 H18 Br2 N2 O2). El fluido o mm, con 28.44 mm como talla promedio. El
tinta que secreta este caracol se utiliza en la 98.3% de la poblacin se encontr entre los 20.1
actualidad para teir hilos, confeccionndose mm y los 47.14 mm de talla (figura 1). Se obtuvo
prendas de vestir color prpura. En la actualidad, en promedio 0.47 ml de tinta por caracol.
existe gran demanda de los colorantes naturales La relacin talla-volumen de tinta
en el mercado internacional, debido al present una regresin lineal simple, con un r2 =
conocimiento de alergias drmicas provocadas 0.642, con un grado de significancia de 0.0 para
por el uso de colorantes artificiales (Prez y toda la muestra (figura 2). En lo que corresponde
Becerra, 2001). Por lo tanto, se realiz este a las hembras fue notorio un mejor ajuste del
estudio, para conocer el grado de viabilidad de modelo, obtenindose en este caso un r2 = 0.741
explotacin de la tinta producida por el caracol P. con una significancia de 0.0 (figura 3). Al analizar
pansa en la zona conocida como Punta el Potos la misma relacin en machos, se observ una
(Morros de Petatln), Guerrero, Mexico. mayor dispersin en los datos, lo que dio por
resultado un modelo con un r2 = 0.314 y
significancia de 0.0, lo que represent el ajuste
ms bajo obtenido (figura 4).

87
Estudios sobre Malacologa y Conquiliologa en Mxico

Histograma de Lonitud (mm) Plicopurpura pansa Machos


10
y = -0.800 + 0.441x
2.50
R Sq Linear = 0.314
Num. Org. = 59

Mean = 28.4424
8 Std. Dev. = 5.44485
N = 118 2.00
Frecuencia

6 1.50

Tinte (ml)
9

4 8 8 1.00

5 5 5 5
0.50
2 4 4 4 4 4 4

3 3 3 3 3

2 2 2 2

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0.00
0
18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 20.00 30.00 40.00 50.00
largo (mm) Largo (mm)

Figura 1. Histograma de Distribucin de Figura 4. Regresin Lineal de la Relacin Talla-


Frecuencia de Tallas del Plicopurpura pansa, Volumen de Tinta, para Machos del Plicopurpura
Barra de Potos, (Mayo de 2006). pansa, Barra de Potos, (Mayo de 2006).

2.50
y = -1.285+0.619x La zona propuesta para explotacin,
R Sq Lineal = 0.642
Num. Org. = 113 cuenta con 2,982.23 metros (3Km)
aproximadamente de playa rocosa, estimando
por cada 100 m2, una produccin de 197.87 ml
2.00

de tinta. Se proyecta que en 5 das es posible


1.50
ordear 5,265 caracoles/semana por lo que se
Tinte (ml)

podran obtener 2,476 ml de tinta en promedio.


1.00 En total se estima obtener 11,933 caracoles, con
una capacidad de producir 5,611 ml de tinta en
0.50 toda la zona. Esta cantidad de tinta puede ser
incrementada, si se diluye con agua de mar en
0.00
proporcin de 2:1 (Len, 1989), lo que resultara
20.00 30.00 40.00 50.00
en 8,416 ml de tinte. La tinta obtenida podra
Largo (mm)
comercializarse de dos maneras: la primera seria
Figura 2. Regresin Lineal de la Relacin Talla- teir directamente sobre algodn o seda,
Volumen de Tinta, para toda la muestra obtenida pudindose producir hasta 6.8 madejas
del Plicopurpura pansa, Barra de Potos, (Mayo mensuales; la segunda forma sera colectar la
de 2006). tinta en frascos de plstico negro pudiendo
congelarse y ser exportada. Este anlisis
Hembras vislumbra una produccin a baja escala donde
y = -1.44+0.067x
2.50
R sq Linear = 0.741
Num. Org. = 54
solo dos pescadores podran hacer uso del
recurso en esta zona.
2.00
La Densidad de este trabajo, es mayor a
la reportada por Len (1989); Enciso et al.
1.50 (1998); Michel (2000); Ramrez-Rodrguez y
Tinte (ml)

Naegel (2003). Siendo esta similar a la citada por


1.00 Flores Garza (2004), y menor a la obtenida por
Montao (2001). Realizndose estos dos ltimos
0.50 trabajos en la misma zona de investigacin. La
proporcin H:M, es similar a la descrita por
0.00
Michel (2000) y Flores Garza (2004). Se observ
20.00 30.00 40.00 50.00
que el 66.1 % de la poblacin se encuentra
Largo (mm)
dentro del intervalo de talla que abarca de 20.00
Figura 3. Regresin Lineal de la Relacin Talla- a 30.00 mm siendo similar a los reportes Len
Volumen de Tinta, para Hembras del (1989) y Enciso et al., (1998). Difiriendo con
Plicopurpura pansa, Barra de Potos, (Mayo de Flores-Garza (2004), que presenta un intervalo
2006). que va de 12 a 25.5 mm. El promedio de tinta

88
Estudios sobre Malacologa y Conquiliologa en Mxico

que se determin, es menor a lo reportado por Plicopurpura patula pansa (Gould, 1853), en el
Castillo-Rodrguez y Amezcua-Linares, (1992) y litoral rocoso del estado de Guerrero, Mxico.
Michel, (2000). La relacin Talla-Volumen de tinta Tesis de Doctorado, Facultad de Ciencias
presenta una regresin lineal simple Biolgicas, Universidad Autnoma de Nuevo
obtenindose un buen ajuste para el total de la Len. 184 p.
poblacin as como para hembras; los machos Krebs, C. J. (1999). Ecological Methodology. 2a
exhibieron una mayor dispersin de datos en la Ed. Addison Wesley Longman, Menlo Park,
produccin de tinta, que la regresin no puede Califormia USA., 620 p.
explicar satisfactoriamente. Estos resultados Len-lvarez H. 1989. Estructura poblacional,
coinciden con las tendencias presentadas por produccin y tiempo de recuperacin del tinte
Len, (1989), aunque los resultados del r2 que de Purpura pansa Gould, 1853 (Gastropoda:
obtiene en general y por sexos, son menores a Thaididae) en algunas playas rocosas de la
los obtenidos en este trabajo. El modelo descrito Baha de Cuastecomate, San Patricio Melaque,
para la presente investigacin, detalla el aumento Jalisco, Mxico. Tesis de Licenciatura en
de produccin de tinta conforme aumenta de talla Biologa. Facultad de Ciencias. Universidad de
del caracol, presentndose este aumento de Guadalajara. 107 p.
forma ms constante en hembras que en los Michel-Morfn, J. E. 2000. Ecologa y
machos. aprovechamiento del caracol de tinte
En el caso del rendimiento de la tincin Plicopurpura pansa en las costas del Pacfico
por madejas, el nmero de caracoles que se Mexicano. Tesis Doctoral, Instituto Politcnico
utilizaran en la zona propuesta, para teir las Nacional. Centro Interdisciplinario de Ciencias
diferentes cantidades de seda o algodn Marinas. La Paz, B. C. S. (indita). 129 p.
reportadas por Turok (1988); Castillo-Rodrguez y Montao-Rivera A. 2001. Estudio de la densidad
Amezcua-Linares, (1992) y Michel (2000), sera poblacional, proporcin sexual y tallas del
mayor, incrementndose como consecuencia el caracol de tinte Purpura pansa (Gould, 1853),
trabajo por colector. en la facie rocosa mesolitoral del estado de
Guerrero, Mxico. Tesis de Licenciatura.
LITERATURA CITADA Escuela Superior de Ecloga Marina.
Castillo-Rodrguez, Z. G. y A. Garca Cubas. Universidad Autnoma de Guerrero.
1987. Morfologa y Anatoma del caracol Pastor M. E. J. 2002. El impacto de la reforma al
morado Purpura sp. En las costas de Mxico. Articulo 27 Constitucional de 1992 y la
III Reunin Nacional de Malacologa y problemtico ejidal en el municipio de
Conquiliologa. Memorias. Soc. Mexic. de Quechultenango, Guerrero. Tesis de Maestra
Malacologa A. C. Fac. de Ciencia Biol. en Ciencias Sociales. CIPES. Universidad
Universidad Autnoma de Nuevo Len. Pp. Autnoma de Guerrero. 143 p.
311-321. Prez-Sandi M. y Becerra R. 2001. La Cochinilla,
Castillo-Rodrguez, Z. G. y F. Amezcua-Linares. Nocheztli, el insecto del rojo carmn. Revista
1992. Biologa y aprovechamiento del caracol biodiversitas. CONABIO. Ao 6, nm. 36 (5):
morado Plicopurpura pansa (Gould 1853) 15.
(Gastropoda: Neogastropoda) en la costa de Ramrez-Rodrguez, M., y L. C. A. Naegel. 2003.
Oaxaca, Mxico. An. Inst. Cienc. del Mar y Crecimiento del caracol de tinte Plicopurpura
Limnol. UNAM. 19(2): 223-234. pansa en Baja California Sur, Mxico. Ciencias
Cooksey J. C. 2001. Tyrian Purple: 6, 6- Marinas, 29(3):283-290.
Dibromoindigo and Related Compounds. Turok, M., M. A. Sigler, C. E. Hernndez, G. J.
Review Molecules 2001, ISSN 1420-3049., 6: Acevedo, C. R. Lara y V. Turcott. 1988. El
736-769. caracol prpura: Una tradicin milenaria en
Enciso-Enciso, E. C., H. V. M. Ramrez, N. A. R. Oaxaca. Direccin General de Culturas
Tirado y A. Vallarta P. 1998. Evaluacin de la Populares, SEP. Mxico. 166 p.
poblacin y pocas de reproduccin del caracol
Purpura pansa (Gould, 1853) en Mazatln,
Sinaloa, Mxico. Tesis de Licenciatura en
Biologa Pesquera. Facultad de Ciencias del
Mar, Universidad Autnoma de Sinaloa.
(Indito). 56 p.
Flores-Garza R. 2004. Aspectos ecolgicos y
parmetros poblacionales en el caracol de tinte

89
Muoz-Mancilla, E., M. P., Torres-Garca y D., Velsquez-Guerrero. 2007. Descripcin histolgica de la gnada femenina del caracol de tinte Purpura
patula (Linn, 1758), de la laguna de Tamiahua, Veracruz. pp 90-91. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M.
C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

DESCRIPCIN HISTOLGICA DE LA GNADA FEMENINA DEL CARACOL DE TINTE Plicopurpura


patula (LINN, 1758), DE LA LAGUNA DE TAMIAHUA, VERACRUZ

Muoz-Mancilla, Eva, Torres-Garca, Mara del Pilar y Velsquez-Guerrero, Daniel


Laboratorio de Invertebrados, Departamento de Biologa Comparada, Facultad de Ciencias,
Universidad Nacional Autnoma de Mxico. Tel. (55 56-22-49-19-, Fax 56-2248-28.
caracolpurpura23@yahoo.com; mptg@hp.fciencias.unam.mx
Palabras clave: Asincrona, gnada, histologa, maduracin, ovocitos, Tamiahua, Veracruz.

INTRODUCCIN.
Los moluscos constituyen un grupo de animales RESULTADOS Y DISCUSIN
extraordinarios con diversas formas que han La gnada es de color amarillo y se localiza en la
tenido grandes adaptaciones a lo largo de sus parte dorsal del hepatopancreas localizado en las
diferentes modos de vida. ltimas espiras de la concha.
El caracol Plicopurpura patula es uno de
los representantes del grupo mejor conocido
como caracoles productores de tinte. Sin
embargo, esta especie no es utilizada en los
procesos de tincin tradicional que se llevan a
cabo con Plicopurpura pansa en las costas de
Oaxaca. Se distinguen por tener una glndula
hipobranquial que se encuentra en la parte
anterior del caracol y elabora una sustancia
tintrea que, por efectos de foto oxidacin
cambia de color al contacto con la luz solar y el
oxgeno que se encuentra en el aire. En este
proceso pasa del blanco lechoso, al amarillo,
verde, azul y finalmente a un color purpreo. Se
distingue de P. pansa, especie gemela que
habita en el Pacfico, por su menor tamao y su
abertura que no es tan blanca (Keen, 1971). El
objetivo de la investigacin es estructurar el Diagrama general de la anatoma del lado derecho de
marco histolgico de la gnada femenina del Plicopurpura patula: cm, msculo columelar; dg,
caracol P. patula glndula digestiva; e, ojo; f, pie; hg, glndula
hipobranquial; kid, nefridio; man, manto; op, oprculo;
p, pene; pros, prstata; r, recto; ten, tentculo; tes,
MATERIAL Y MTODOS testculo; Barra de escala= 5 mm (Tomado de Voltzow,
La distribucin de P. patula va desde la costa 1994).
occidental del Atlntico, en el sur de Florida, el
Caribe y las Antillas hasta el norte de Venezuela De acuerdo con la clasificacin del
en las Islas La Roque; en nuestro pas se desarrollo gonadal de Webber (1977) y
distribuye desde Tampico hasta Quintana Roo Periwlinkle (1987), se observaron diversos
(Keen, 1971; Prez Rodrguez, 1980). estados de madurez de las gnadas.
Se realizaron dos recolectas en los Las gnadas tienen variaciones
meses de mayo del 2005 y 2006, en la boca Sur citolgicas especficas, que permiten identificar
de la Laguna de Tamiahua, en la regin Norte del las fases de diferenciacin gametognica, como
estado de Veracruz. Se obtuvieron 40 son: la etapa temprana, de crecimiento, madurez,
organismos de diferentes tallas, los cuales al desove y post-desove.
momento de ser capturados, fueron numerados En los resultados preliminares, se
en el oprculo y desconchados para su fijacin pudieron determinar algunas etapas de
con formol al 10%. En el laboratorio de desarrollo: Etapa de crecimiento donde los
invertebrados de la Facultad de Ciencias de la ovocitos se encuentran delimitados por
UNAM se procesaron con la tcnica histolgica trabculas formadas por tejido conjuntivo y la
de inclusin en parafina con un punto de fusin presencia de gran cantidad de microvitelo en la
de 56-58C. Se obtuvieron cortes de 7 regin perinuclear y macrovitelo en el resto del
micrmetros de grosor y se tieron mediante las citoplasma. Existe incremento del tamao nuclear
tcnicas de H-E y Mallory. el cual adquiere una posicin excntrica.

90
Estudios sobre Malacologa y Conquiliologa en Mxico

LITERATURA CITADA.
Graham, A. and V. Fretter. 1976. A. Funtional
anatomy of invertebrates. Academic Press.
U.S.A. 589 p.
Keen, A. M. 1971. Seashells of Tropical West
America. Marine molluscs from Baja California
to Peru. Stanford Univ. Press, Stanford. 1065 p.
Kool, S.P. 1988 Aspects of the anatomy of
Plicopurpura pansa (Prosobranchia:
Muricoidea: Thaidinae) new combination, with
emphasis on the reproductive system.
Malacologa. 29(2):373-382.
Turok, M., A. M. Sigler, E. C. Hernndez, J.G.
Acevedo, R. C. Lara y V. Turcott. 1988 El
Etapa de crecimiento donde se observa al ovocito con caracol prpura. Una tradicin milenaria en
gran cantidad de macro (MV) y microvitelo (mv). N, Oaxaca. Direccin General de Culturas
ncleo; TC, tejido conjuntivo Populares Mxico 164 p.
Periwlinkle. 1987. Age and growth, reproductive
En la etapa de maduracin, se observan cycle, and histochemical test for heavy metals
los ovocitos de gran tamao predominando la in hard clams, Mercenaria mercenaria, from
presencia de macrovitelo con ncleo excntrico, Raritan Bay, 1974-75. Fisheries Bulletin 85(3):
y trabculas de tejido conjuntivo que rodean a los 653-662.
ovocitos, las cuales se tien intensamente con Voltzow, J. 1994. Gastropoda prosobranchia. In:
hematoxilina. Harrison F. W and A. J. Kohn (eds).
Microscopic Anatomy of Invertebrates Vol. 5.
TC Mollusca I. Wiley-Liss, Inc. U.S:A. 111-252.
Webber, H. H. 1977. Gastropoda: Prosobranchia.
OVTE
In: Giese, A.C. and J.S. Pearse (Eds.)
OVM Reproduction of marine in vertebrates. Vol. 4:
Mollusca. Academic Press. N. Y. USA. 366 p.

OVTA

Imagen donde se observan ovocitos asincrnicos.


OVTA, ovocito en etapa tarda; OVTE, ovocito en
etapa temprana; OVM, ovocito maduro; TC, tejido
conjuntivo.

Tambin se observ que muchas de las gnadas


presentan una asincrona en el desarrollo de los
ovocitos, es decir, se observan clulas en
diferentes fases de desarrollo.
Se sugiere continuar con los estudios
histolgicos para terminar la identificacin del
ciclo gondico del caracol P. patula. Adems,
realizar el marco histolgico del resto de los
rganos de esta especie y un estudio
comparativo entre los caracoles P. pansa y P.
patula.

91
Hernndez, M., E., Michel-Morfn, V., Landa-Jaime, J., Arciniega, D., Kosonoy y R., Flores. 2007. Estimacin de la abundancia poblacional del caracol
del tinte Plicopurpura pansa a travs de un mtodo de captura y recaptura. pp 92-94. En: Estudios sobre la Malacologa y Conquiliologa en Mxico.
Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

ESTIMACIN DE LA ABUNDANCIA POBLACIONAL DEL CARACOL DEL TINTE Plicopurpura pansa


A TRAVS DE UN MTODO DE CAPTURA Y RECAPTURA.

Hernndez, Maricela, Michel-Morfn, Emilio, Landa-Jaime, Vctor, Arciniega, Judith, Kosonoy, Daniel y
Flores, Ramiro
Departamento de estudios para el Desarrollo sustentable de zonas costeras. CUCSUR. Universidad de
Guadalajara. Gmez Farias 82, San Patricio-Melaque, Jal. Mxico. C. P. 48980.
michel@costera.melaque.udg.mx
Palabras clave: Caracol prpura, tinte, Plicopurpura pansa, abundancia, captura-recaptura.

INTRODUCCIN georeferenciada es la siguiente: 1917.516 N -


El caracol del tinte Plicopurpura pansa es un 104 50.329 O.
recurso que por sus caractersticas representa Para la etapa del marcado se sigui el
una oportunidad para el aprovechamiento de su siguiente procedimiento: inicialmente fueron
tinte. Sin embargo, previo a cualquier explotacin colocadas una serie de marcas de pintura
es importante contar con una estimacin lo ms permanentes en las rocas cada 25 metros y a lo
precisa posible del tamao de la poblacin. El largo de un transecto de 125 metros lineales. En
caracol prpura se distribuye a lo largo de la cada uno de los puntos se tom la
zona intermareal rocosa y durante una parte del georeferenciacin a travs de un Sistema Global
da, por efecto de las mareas, se encuentra de Posicionamiento GPS. Dentro de cada
inmerso por debajo del nivel de marea mxima. segmento, se realiz una bsqueda directa e
Si bien ha existido consenso entre los diferentes intensiva de los caracoles a un metro a cada lado
grupos de investigadores por utilizar el mtodo del transecto. Todos los organismos encontrados
de conteos simples en transectos lineales para fueron despegados cuidadosamente de la roca
determinar la densidad relativa de la especie tomando las precauciones necesarias para no
(Turok et al., 1988; Acevedo et al., 1990; Reyes- daar los caracoles y estimulando la expulsin
Aguilera, 1993; Michel-Morfn et al., 2000; del tinte de manera tradicional. De todos los
Garca-Ibaez et al., 2004), es posible que por en caracoles se tomaron los datos biomtricos (talla
el nivel de la marea o por los movimientos de los y peso) y de una muestra se determin el sexo
caracoles, ste mtodo subestima la abundancia de manera directa, siguiendo para esto el
poblacional. procedimiento descrito en Michel-Morfn, et al.
Por este motivo, se considera que con el (2000). Los caracoles fueron marcados en la
desarrollo de un experimento de captura y parte dorsal superior con pintura en aerosol tipo
recaptura se obtendra una estimacin ms esmalte. Una vez seca la marca, todos los
confiable del tamao de la poblacin, utilizando caracoles fueron regresados a la zona rocosa en
un mtodo en el que se determina el tamao la misma franja intermareal de la cual fueron
poblacional en momentos sucesivos y que por lo recolectados.
tanto pueda ser menos sensible a los cambios en Los muestreos se realizaron en enero,
la distribucin espacial del caracol. Esto arrojara febrero y marzo de 2002, con una diferencia de
informacin sobre la diferencia en la estimacin 28 das y realizando las recolectas durante la
de la abundancia relativa entre los dos mtodos y bajamar mxima del da. Para fines de este
por ende, un estimado de la certeza del mtodo trabajo se consideraran estas fechas como
hasta la fecha utilizado. captura, primera recaptura y segunda recaptura.
Se escogieron estos meses ya que el mar se
MATERIALES Y MTODOS encuentra en calma y se presentan bajamares
El trabajo de campo se desarroll en una playa adecuadas, lo que asegura que las condiciones
rocosa en la baha de Tenacatita, municipio de del muestreo sean las propicias para el trabajo
La Huerta, en la costa sur del estado de Jalisco. en la zona intermareal.
Se eligi una porcin de la playa rocosa Las Las recapturas se efectuaron uno y dos
Coloradas, limitada a ambos extremos por meses despus de la recolecta inicial. Se utiliz
playas de arena y cantos rodados, ya que se el mismo procedimiento de colecta de los
busc el cumplir con el supuesto de poblacin caracoles ya descrito en la etapa de marcado,
cerrada requerido en los mtodos de captura y solo que se emple un color diferente de pintura
recaptura. Adems, por tratarse de un sitio de para los caracoles encontrados dentro del
difcil acceso se considera que la perturbacin transecto y que no presentaban la marca inicial.
antropognica es virtualmente nula. Su posicin Los clculos para estimar el tamao poblacional

92
Estudios sobre Malacologa y Conquiliologa en Mxico

por el mtodo de captura y recapturas mltiples, la primer recaptura y 210 en la segunda


se basaron en los mtodos de Petersen, recaptura (Tabla I). Por consiguiente, un
Schnabel y Schumacher-Eschmeyer (Begon, adecuado estimador del tamao poblacional
1989; Krebs, 1985, 1989). deber ser igual o mayor que ste nmero. Los
Con estos datos se compararon los mtodos basados en datos de captura y
resultados obtenidos por ambos mtodos (conteo recaptura arrojan estimaciones superiores a los
directo en cuadrantes y captura recaptura) para 745 caracoles que se mencionan en el prrafo
la estimacin de la densidad relativa y la anterior. As, el mtodo de Petersen,
estructura poblacional, entendiendo esta como la considerando solo los datos de captura y
frecuencia de tallas y la proporcin sexual. recaptura (enero y febrero 2002) arroja un
estimado de 945 caracoles. Los otros mtodos
RESULTADOS Y DISCUSIN que consideran recapturas mltiples (enero,
En la Figura 1 se presenta el nmero de febrero y marzo), indican una estimacin
caracoles totales recolectados en cada muestreo. poblacional superior a los 1100 caracoles en el
Es posible observar que, en general, los nmeros tramo de 125 metros lineales de lnea de costa,
totales son similares (329, 316 y 364), pero los considerando un ancho de 2 metros. Esto denota
caracoles que componen la primera y segunda que el mtodo de transectos tiende a subestimar
recaptura son diferentes a los inicialmente el tamao poblacional y por consiguiente la
recolectados. En la captura se recolectaron 329 estimacin de la densidad relativa. Dada la
caracoles mismos que fueron marcados con color importancia histrica, cultural y pesquera de este
rojo. En la primer recaptura se colectaron 110 recurso, es muy importante obtener estimaciones
caracoles marcados en color rojo y 206 caracoles confiables y peridicas del tamao de las
sin marca los cuales fueron tambin marcados poblaciones a fin de determinar cambios
utilizando esta vez pintura blanca. Finalmente a naturales o inducidos
la segunda recaptura, se colectaron 110
caracoles con marca roja, 44 con marca blanca y LITERATURA CITADA
210 sin marca. Es notorio que en la segunda Acevedo, J., M. Escalante y C. Lpez. 1990.
recaptura y contrario a lo que se esperara, el Aspectos poblacionales del caracol del tinte
mayor porcentaje de caracoles corresponde al Purpura pansa Gould, 1853, en las costas de
grupo de los caracoles sin marca (210 de 364). Nayarit. Inter UAS 1(1): 18 -22.
Esto indica que la poblacin esta compuesta por Begon, M. 1989. Ecologa Animal. Ed. Trillas.
un nmero mayor al de los 336 caracoles que se Mxico D. F., 134 p.
colectaron en promedio en los tres muestreos, ya Garca-Ibaez, S., R. Florez-Garza, P. Flores-
que se esperara que el nmero de nuevos Rodrguez, y A. Valdz-Gonzlez. 2004.
caracoles recolectados sin marca disminuyera Densidad y tallas de Plicopurpura patula pansa
sensiblemente en cada una de las recapturas. relacionadas con el sustrato y oleaje en la
La informacin desglosada de la costa rocosa de guerrero, Mxico.
composicin de cada recolecta, las tallas y Hidrobiolgica 2004. 14(2): 127-136.
proporcin sexual se presenta en la Tabla I. Se Krebs, J. C. 1989. Ecological methodology.
observa que si bien la estimacin de la densidad Harper and Row Pub., New York, USA.
relativa es similar en los tres muestreos, es Michel-Morfn, J. E. 2000. Ecologa y
evidente que los caracoles que conforman cada aprovechamiento del caracol del tinte
muestra son diferentes. Plicopurpura pansa en las costas del Pacfico
En la tabla II se presenta la estimacin mexicano. Tesis de doctorado en Ciencias
del nmero total de caracoles y la densidad Marinas. CICIMAR-IPN. 134 p.
relativa de la poblacin del caracol prpura Michel-Morfn, J. E., E. A. Chvez & V. Landa.
obtenidas a travs del mtodo de conteos en 2000. Population parameters and dye yield of
transectos y por medio de varios mtodos the purple snail Plicopurpura pansa (Gould,
basados en datos de captura y recaptura. En 1853) of West central Mxico. Journal of
estos resultados es posible observar como la Shellfish Research 19(2) :919-925.
estimacin del nmero total de caracoles es Reyes-Aguilera, S. 1993. Estimacin poblacional,
mucho menor a travs del mtodo de transectos. produccin, foto-oxidacin y rendimiento del
Esto es evidente dado que a lo largo de los tres tinte del caracol Purpura pansa (Gould, 1853)
muestreos se recolectaron en total 745 caracoles de la zona sur del litoral rocoso de Jalisco.
diferentes que se marcaron por primera vez y Tesis Profesional, Lic. en Biologa. Fac. de
que correspondieron a 329 en la captura, 206 en Ciencias Biolgicas. Univ. de Guad. 115 p.

93
Estudios sobre Malacologa y Conquiliologa en Mxico

Turok, M., A. M. Sigler, E. Hernndez, J.


Acevedo, R. Lara y V. Turcott. 1988. El caracol
Purpura una tradicin milenaria en Oaxaca.
Direccin General de Culturas Populares, SEP.
Mxico. 166 p.

400
350
300
250 210
Nmero de 206 Azules
200
caracoles
329 Blancos
150
44 Rojos
100
50 110 110

0
Captura 1ra Recaptura 2da Recaptura
Periodo

Figura 1. Frecuencia de tallas de los caracoles a la captura, primer recaptura y segunda recaptura.

Tabla I. Resumen de los resultados obtenidos con el mtodo de captura y recapturas para estimar los
parmetros poblacionales del caracol Plicopurpura pansa en la baha de Tenacatita, Jalisco.

Color de Proporcin
Marca Total de Talla sexual
Roj Blanc caracol Densidad promedi Desviacin Hembra Mach
o o Azul es Relativa o Estndar s os
Captura 329 - - 329 1.32 41.16 12.02 1 0.88
1ra Recaptura 110 206 - 316 1.26 40.97 12.72 1 1.87
2da Recaptura 110 44 210 364 1.46 38.41 10.94 1 1.68

Tabla II. Estimacin del nmero total de caracoles y la densidad relativa a partir de mtodos de conteos
en transectos lineales y captura y recaptura.

Estimacin del Densidad


Mtodo Tiempo nmero total de relativa
caracoles Caracoles/m2
Conteo simples en transecto de 50x2 m. Enero 2002 329 1.32
Febrero 2002 316 1.26
Marzo 2002 364 1.46
Estimacin por el mtodo de Petersen Enero-
(Captura-Recaptura) febrero, 2002 945 3.78

Estimacin por el mtodo de Schnabel Enero,


(Triple captura) febrero, 1131 4.52
marzo, 2002
Estimacin por el mtodo de Enero,
Schumacher-Eschmeyer (triple captura) febrero, 1167 4.66
marzo, 2002

94
Lpez-Chvez, F. J., K., Oyama, P., Ros-Chvez y J. E., Michel-Morfn. 2007. Estudio filogentico del gnero Plicopurpura (Cossman, 1908),
Muricidae. pp 95-96. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds).
Universidad de Guadalajara, Mxico. 286 p.

ESTUDIO FILOGENTICO DEL GNERO Plicopurpura (COSSMAN, 1908), MURICIDAE

Lpez-Chvez, Felipe J1., Oyama, Ken2, Ros-Chvez, Patricia1 y Michel-Morfn, J. Emilio3


1
UMSNH. 2CIEco-UNAM. 3DEDSZC-U de G.
Palabras clave: Plicopurpura, filogenia, ADN.

INTRODUCCIN primer utilizados fueron los siguientes 1: 5'-


El gnero Plicopurpura puede ser un grupo de AAAAAGCTTCCTTCTAATCTCTCAGTTTGATG
especies interesantes para probar hiptesis AAA-3' primer 2: 5'-
acerca de los aspectos temporales de la AAAAAGCTTAATTGATCGAAGAATAGCATAGG
especiacin. Este gnero comprende tres CAA-3'. El protocolo de PCR fue el siguiente: 3
especies de caracoles marinos depredadores de minutos a 95C, seguido de 35 cclos de 95C
la zona intermareal rocosa, de las cuales el mas por un minuto, 1.5 minutos a 55C y 1 minuto a
estudiado ha sido Plicopurpura pansa, estos 72C. El producto de la PCR se corri en un gel
estudios han estado enfocados a su biologa, de agarosa al 0.8% y las bandas se purificaron
ecologa y sstemtica (Michel y Chvez, 2000, con un kit de Quiagen. El producto de la PCR se
Michel et al., 2000, Kool, 1998, Castillo, 1992). someti a una reaccin de secuenciacin con kit
Estas especies habitan en el Atlntico (P. patula) de Applied Biosystem (BigDye Terminator v 3.1).
y el Pacfico (P. pansa y P. Columellaris), y han Anlisis filogentico
estado separadas por al menos 3.5 millones de El grupo externo que se utilizar ser
aos, poca en la que se dio el levantamiento del Nucella lapillus, un representante de la
istmo de Panam, para tratar de comprobar esta subfamailia Ocenebrinae. Dentro de la familia
hiptesis proponemos un estudio filogentico Muricidae, La subfamilia Ocenebrinae y la
basado en la comparacin de un fragmento de subfamilia Rapaninae, que incluye al gnero
700 pares de bases (bp), del gen mitocondrial del Plicopurpura, son clados hermanos (Collins et al.,
citocromo b. 1996).
Taxonoma del gnero Plicopurpura. Las El anlisis filogentico se estimar
especies del gnero Plicopurpura estaban utilizando parsimonia y se generaran rboles
consideradas dentro del gnero Purpura (Keen filogenticos con las distancias genticas con el
1971 y Skoglound 1982), posteriormente Kool en algoritmo del vecino ms cercano (Neighbor-
1998 considera que existe evidencia suficiente Joining).
para colocar en un gnero aparte a las tres
especies y propone retomar el gnero RESULTADOS
Plicopurpura. Por otro lado estas especies Hasta el momento tenemos las secuencias de las
tambin han sido objeto de discusin en cuanto a tres especies pero no se ha completado el
su taxonoma, Keen en 1971 ubica a P. pansa anlisis, en una revisin preliminar de los datos
como una subespecie de P. patula, muestran que P. patula es claramente diferente
posteriormente en 1982 Wellintong y Curtis de las otras dos especies, P. pansa y P.
argumentan que P. pansa y P. collumelaris son la columellaris, no siendo tan claro para estas dos
misma especie y finalmente en 1992 Castillo ltimas especies. Estas dos especies han estado
propone ubicar como una especie diferente a P. compartiendo la distribucin y el hbitat desde el
pansa, lo anterior en base a la morfologa de la levantamiento del Istmo de Panam, desde hace
rdula y del tracto digestivo. al menos 3.5 millones de aos, por lo que la
posibilidad de que haya hibridacin entre estas
MATERIALES Y MTODOS esta latente. Hemos observado cpulas entre
Secuencias de ADN. estas dos especies en el campo y hasta este
Se colectaron muestras de las tres especies a lo momento no existe evidencia de que el producto
largo de su distribucin y el tejido obtenido del de la hibridacin es viable.
pie se preserv en buffer SED hasta su
procesamiento en el laboratorio. La extraccin LITERATURA CITADA
del ADN se llev acabo mediante el mtodo de Amos, B. & A. R. Hoelzel. 1991. Long term
Fenol-cloroformo-alcohol. La PCR se realizo en preservation of whale skin for DNA analysis.
un volumen final de 25l, con las siguientes Rept. Intl. Whaling Commission. Special Issue
concentraciones, 10 mM Tris (pH 8.3), 50 mM No. 13:99-103.
KCl, 1.5 mM MgCl2, 0.5 M de cada primer, Castillo-Rodrguez, Z. G. 1992. Combinatio Nova
dNTP 200 M, 10-1000 ng de ADN templete, los de Plicopurpura pansa (Gould 1853)

95
Estudios sobre Malacologa y Conquiliologa en Mxico

(Prosobranchia, Muricoidea). Anales del


Instituto de Ciencias del Mar y Limnologa
Universidad Nacional Autnoma de Mxico 19:
1-12.
Collins T., K. Palmer A. R. Frazer, G. J. Vermeij y
W. M. Brown. 1996. Evolutionary history of
Northern Hemisphere Nucella (Gastropoda:
Muricacea): Molecular, morphological,
ecological and paleontological evidence.
Evolution 50:2287-2304.
Kool S. P. 1988. Aspects of the anatomy of
Plicopurpura patula (Prosobranchia:
Muricoidea: Thaidinae), new combination and
emphasis on the reproductive system.
Malacologa 29:373-382.
Keen, M. 1971. Sea shells of tropical west
America. Stanford University Press. Stanford.
1064 p.
Michel-Morfin, J. E. & E. A. Chavez. 2000. Effect
of repetitive dye extraction over yield and
survival rate of the purple snail Plicopurpura
pansa (Gould, 1853), J. Shellfish Res., 19: 913-
917.
Michel-Morfin, J. E, E. A Chavez & V. Landa.
2000. Population parameters and dye yield of
the purple snail Plicopurpura pansa (Gould,
1853) of west central Mexico. J. Shellfish Res.
19: 919-925.
Skoglund, C. 1992. Additions to the panamic
province gastropod (mollusca) literature 1971 to
1992. The Festivus. Vol. XXIV (Suppl) 169 p.
Wellington, C. M. y A. M. Kurtis. 1983. Growth
and shell variation ij the tropical eastern Pacific
intertidal gastropods genus Purpura. Ecological
Biological Bulletin 164: 518-535.

96
Flores-Rodrguez, P., R., Flores-Garza, S., Garca-Ibaez y D. G., Arana-Salvador. 2007. Fluctuaciones en la diversidad de comunidades de moluscos
asociadas al P. pansa (Gould 1853) en el mesolitoral superior rocoso de Guerrero, Mxico. pp 97-99. En: Estudios sobre la Malacologa y
Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

FLUCTUACIONES EN LA DIVERSIDAD DE COMUNIDADES DE MOLUSCOS ASOCIADAS AL


Plicopurpura pansa (Gould 1853) EN EL MESOLITORAL SUPERIOR ROCOSO DE GUERRERO,
MXICO

Flores-Rodrguez, Pedro, Flores-Garza, Rafael, Garca-Ibaez, Sergio y Arana-Salvador, Domingo


Germn
Laboratorio de Ecologa Costera y Sustentabilidad. Unidad Acadmica de Ecologa Marina. Universidad
Autnoma de Guerrero. pfloresrodriguez@yahoo.com, acua_uag@yahoo.com.
Palabras clave: Diversidad, Moluscos, Plicopurpura, Guerrero

INTRODUCCIN Potos protegido 17 32 12.5 N y 101 26


Hay diversos mtodos para la evaluacin de la 54.6 O, 9) Troncones 17 47 35 N y 101 44
biodiversidad, algunos de ellos son basados en 46.6O) (Figura 1).
la equidad de la comunidad. La importancia de Metodologa de campo. Se realizaron cinco
utilizar ndices radica en que estos resumen la muestreos, tomados en la parte superior del
informacin en un solo valor y nos permite hacer mesolitoral (Stephenson y Stephenson 1949),
comparaciones entre hbitats o la diversidad de uno cada trimestre, empezando en diciembre de
un hbitat a travs del tiempo. 2000 y terminando en diciembre de 2001. El
El Estado de Guerrero incluye a tres rea de muestreo fue de 20 m2, definida por el
regiones marinas prioritarias para la mtodo de especies-rea (Brower et al. 1998).
conservacin de la biodiversidad costera y
ocenica de Mxico y en el que la CONABIO
seala que falta conocimiento de estas regiones.
La mayora de los trabajos publicados
sobre los moluscos del litoral mexicano, han sido
de carcter faunstico o taxonmico, otros pocos
tratan aspectos de diversidad y variacin
estacional (Villarroel et al., 2000; Del Ro y
Villarroel, 2001) y los que han investigado
acerca de la distribucin y abundancia (Romn
et al., 1991; Esqueda et al., 2000) y para
Guerrero (Garca 2004). Para el intermareal
rocoso de Guerrero se tienen estudios de
riqueza y zonacin de moluscos en las
localidades de Acapulco (Villalpando 1986;
Delgado 1989; Garca 1994; Flores et al. 2003,), Figura1. Localidades de muestreo en el litoral
y Zihuatanejo (Salcedo et al. 1988). del Estado de Guerrero, Mxico
Esta investigacin tuvo como objetivos
evaluar la diversidad de moluscos que cohabitan Se emple un transecto de 30 m de
con el caracol P. pansa mediante el ndice de largo por 2 m de ancho paralelo a la costa. La
equidad de Shannon-Wiener (H`) y el de Pielou unidad de muestreo fue un cuadrante de 1 m por
(J) en nueve localidades en un ciclo anual en la lado. El muestreo fue sistemtico (Scheaffer et
zona mesolitoral superior rocosa del litoral del al., 1987). El punto de inicio fue seleccionado al
Estado de Guerrero, Mxico. azar. Los moluscos encontrados dentro de los
cuadrantes fueron identificados y cuantificados.
MATERIALES Y MTODOS La identificacin taxonmica de los moluscos fue
rea de estudio. Se trabaj en 9 sitios de la basada en el anlisis conquiliolgico de acuerdo
costa rocosa del Estado de Guerrero : 1)Punta con Keen (1971).
Maldonado 16 19 26.7 N y 98 34 4.6 O, Anlisis de datos. La diversidad de moluscos
2)Las Peitas 16 33 13.9 N y 98 46 22.4 O, se midi con los ndices de equidad de
3)Playa Ventura 16 32 08.3 N y 98 54 44.6 ShannonWiener (H) y el de Pielou (J). Para
O), 4) Playa Zoolgico 16 49 11.2 N y 99 54 conocer la existencia de diferencias
8.8 O , 5.- Playa Palmitas 16 49 25.9 N y 99 significativas con 95% de confianza entre los
54 40.5 O, 6) Piedra Tlacoyunque 17 15 14.6 valores del ndice H y las localidades de
N y 101 00 46 O, 7)Barra de Potos expuesto muestreo se utiliz el anlisis de varianza de
17 32 17.4 N y 101 27 19.1 O, 8) Barra de una sola va (anova one-way). Despus de

97
Estudios sobre Malacologa y Conquiliologa en Mxico

haber comprobado la homogeneidad de Leven y no se encontraron diferencias


varianzas con la prueba estadstica de Levene, y estadsticamente significativas por lo que se
para discriminar entre cuales localidades de corri la prueba de comparacin mltiple de
muestreo existieron diferencias significativas se Scheff de la cual se formaron dos grupos: el
realiz la prueba de comparacin mltiple de primero incluye a siete localidades excluyendo a
Scheff (Ott 1984). Adems fue aplicada la Potos protegido y Punta Maldonado y el
prueba de Anlisis Jerrquico de conglomerados segundo grupo incluye tambin siete excluyendo
(cluster) por el mtodo de Distancia Euclidiana a Playa Peitas y Playa Ventura (cuadro 3).
Cuadrada. Los datos fueron procesados con el
programa SPSS ver 12. Cuadro 2. ndices de equidad de Shannon-
Wiener y nueve localidades de Guerrero, Mxico
RESULTADOS Y DISCUSIN en un ciclo anual.
Durante el estudio se contabiliz dentro de los _______________________________________
cuadrantes a 105,863 moluscos en el mesolitoral LOCALIDAD DE
SHANNON-WIENER
Bits/ind.
superior del Estado de Guerrero incluyendo MUESTREO (playas)

Dic. 00 Mar. 01 Jun. 01 Sep. 01 Dic. 01


estos a 63 especies, 44 gneros, 27 familias y 3 P. Maldonado 3.50 3.55 3.13 3.76 3.35
2.46 2.64 1.44 2.10 2.26
clases Las Peitas
Ventura 2.75 2.55 2.12 1.67 2.13
Se encontr que el valor global para Zoolgico
Palmitas
2.48
2.71
2.43
2.34
2.61
2.91
2.71
1.97
3.25
2.38
todo el conjunto de localidades en Guerrero fue Tlacoyunque
Barra Potos expuesto
2.62
2.84
2.72
3.57
2.33
2.55
2.81
2.97
2.72
3.14
H= 3.658 bits/individuo y el de J= 0.607. Los Barra Potos protegido 4.09
2.16
3.33
2.97
3.63
1.98
2.94
2.98
3.16
3.22
Troncones
valores resultantes de estos ndices para cada
localidad de muestreo fueron variables (cuadro _________________________________
1) alcanzando Playa Punta Maldonado el valor
mximo H= 3.964 seguida por playa Potos Cuadro 3. Se muestran las medias para los
protegido con H=3.817 y el mnimo para playa grupos en los subconjuntos homogneos
Ventura H= 2.472. mediante la prueba de Scheff con base en
valores del ndice de equidad de Shannon-
Cuadro 1. ndices de equidad de Shannon- Wiener en nueve localidades de Guerrero,
Wiener y Pielou para nueve localidades de Mxico, en un ciclo anual.
Guerrero, Mxico en un ciclo anual.
Subconjunto para alfa =
_______________________________________ .05

sitio N
_ Peitas 5
1
2.1790
2

Shannon- Ventura 5 2.2440


LOCALIDAD DE Abundancia Riqueza Wiener Pielou
Palmitas 5 2.4612 2.4612
MUESTREO relativa. (S) Bits/ind. J
Tlacoyunque 5 2.6396 2.6396
P. Maldonado 3,573 35 3.964 0.658
Troncones 5 2.6608 2.6608
Las Peitas 39,096 36 2.647 0.439
Zoolgico 5 2.6950 2.6950
P. Ventura 23,263 34 2.472 0.411
Potos expuesto 5 3.0126 3.0126
P. Zoolgico 6,421 41 3.165 0.526
Potos protegido 5 3.4306
P. Palmitas 8,808 33 2.863 0.475 Punta Maldonado 5 3.4580
P. Tlacoyunque 7,045 32 3.117 0.518 Sig. .219 .069
Potos expuesto 4,320 39 3.444 0.572
Potos protegido 5,935 45 3.817 0.634
P. Troncones 7,402 42 2.828 0.47
GLOBAL GUERRERO 105,863 63 3.658 0..607
Los resultados del anlisis jerrquico
_______________________________________ (Clusters) indican la formacin de dos grupos,
_ uno integrado por siete localidades excluyendo a
Los valores de diversidad encontrados playa P. Maldonado y a Playa Potos protegida,
en el mesolitoral de Guerrero indican un valor de lo cual coincide con el grupo uno que arroj la
diversidad malacolgica alto; comparable con lo prueba de Scheff (figura 2).
encontrado para Acapulco por Delgado (1989)
con 3.228 bits/ind., Garca (1994) con 3.053 y C A S O S 0 5 10 15 20 25
+---------+---------+---------+---------+---------+

3.817 bits/ind. en dos localidades protegidas y Zoolgico

1.606 bits/ind. en una localidad expuesta, lo cual Tlacoyunque


Troncones
sugiere que la Costa de Guerrero presenta Potos expues
Las Peitas
valores de diversidad que corresponden a Ventura.
Palmitas
valores encontrados para regiones tropicales. P. Maldonado
Se calcul el ndice de diversidad de Potos proteg

Shannon Wiener para cada localidad en cinco


visitas en el ciclo anual (Cuadro 2). Figura 2. Dendrograma con base en el ndice de
A estos valores del ndice se les aplic diversidad de Shannon Wiener en nueve
la prueba de Homogeneidad de varianzas de localidades de Guerrero, Mxico

98
Estudios sobre Malacologa y Conquiliologa en Mxico

Ott, Lyman. 1984. An Introduction to Statistical


Las playas P. Maldonado y Potos Methods and data Analysis, Second Edition,
protegido quedaron excluidas tanto en la prueba PWS Publishers. 755 p.
de Secheff como la de Cluster quiz debido a Romn C. R., F. M. Cruz A. y A. L. Ibez A.
que ambas presentan sustratos mviles, lo cual 1991. Observaciones ecolgicas de los
de acuerdo con Garca (2004) la formacin de moluscos de la zona intermareal de la baha
estos grupos obedece al tipo de sustrato. de Chamela, Jalisco, Mxico. Anales del
Instituto de Biologa Universidad Naciona.
LITERATURA CITADA Autnoma de. Mxico. Ser: Zool, 62(1): 17-32.
Brower, J. E., J. H. Zar &C. N. Von Ende. 1998. Salcedo-Martnez, S., G. Green, A. Gamboa-
Field and Laboratory Methods for General Contreras, y P. Gmez. 1988. Inventario de
Ecology. Fourth Edition. WCB/McGraw-Hill macroalgas y macroinvertebrados bnticos,
Companies. 271 p. presentes en reas rocosas de la regin de
Del Ro-Zaragoza O. y M. Villarroel-Melo. 2001. Zihuatanejo, Guerrero, Mxico. Anales del
Variacin Estacional de Moluscos en las Instituto Ciencias del Mar y Limnologa
Pozas de Marea del Faro de Bruceras, Universidad Nacional Autnoma de Mxico.
Michoacn, Mxico. Facultad de Biologa, 15(1): 73-96.
UMSNH. VIII Reunin Nacional de Scheaffer, R. L., W. Mendenhall y L. Ott. 1987.
Malacologa y Conquiliologa Ciudad Victoria, Elementos de muestreo. 3a edicin. Grupo
Tamps. Mxico. Resmenes, 26-28 p. editorial Iberoamericano S.A. de C. V. 321 p.
Delgado-Blas, V. H. 1989. Estudio sistemtico y Stephenson, T. A. y A. Stephenson. 1949. The
aspectos ecolgicos de gasterpodos de la Universal Features of Zonation Between
facie rocosa de la Baha de Acapulco, Tidemarks a Rocky Coasts. Journal of
Guerrero, Mxico. Tesis profesional. Escuela Ecology, 37: 289-305.
Superior de Ecologa Marina. Universidad Villalpando-Canchola, E. 1986. Diversidad y
Autnoma de Guerrero. 97 p. zonacin de moluscos de facie rocosa Isla
Esqueda, M. C., E. Ros-Jara, J. E. Michel- Roqueta, Acapulco, Guerrero. Tesis. Facultad
Morfn, & V. Landa-Jaime. 2000. The vertical de Ciencias, Universidad Nacional Autnoma
distribution and abundance of gastropods and de Mxico. Mxico D. F.
bivalves from rocky beaches of Cuastecomate Villarroel, M. M., A. Magaa M., B. Gmez C., O.
Bay, Jalisco. Revista Biologa Tropical, 48(4): Del Ro Z., J. Lucio P., y J. Snchez S. 2000.
765-775. Diversidad de moluscos en el litoral rocoso de
Garca-Ibaez S., R. Flores-Garza, P. Flores- Michoacn, Mxico. Mxico, Volumen 2, No.
Rodrguez y A. Valds-Gonzlez. 2004. 1.
Densidad y tallas de Plicopurpura patula
pansa relacionados con el substrato y oleaje
en la costa rocosa de Guerrero, Mxico.
Hidrobiolgica Vol. 14 (2): 127-136.
Garca-Lpez, J. A. 1994. Fauna malacolgica
de acompaamiento del caracol Purpura
pansa Gould 1853 en la zona mesolitoral de la
Isla Roqueta, Acapulco, Guerrero, Mxico.
Tesis profesional. Escuela Superior de
Ecologa Marina. Universidad Autnoma de
Guerrero. 97 p.
Flores-Rodrguez P., R. Flores-Garza, S. Garca-
Ibaz y A. Valds-Gonzlez. 2003. Riqueza y
diversidad de la malacofauna del mesolitoral
rocoso de la Isla la Roqueta, Acapulco,
Guerrero, Mxico. Ciencia, Revista de
Investigacin Cientfica, Universidad
Autnoma de Guerrero. No. 11: 5-14.
Keen, A. M. 1971. Sea Shells of Tropical West
America. 2a. edition. Stanford University
Press, Stanford, California. 1064 p.

99
Garca-Ibez, S., P., Flores-Rodrguez, R., Flores-Garza, D. G., Arana-Salvador y A., Valds-Gonzlez. 2007. Parmetro k de binomial negativa y su
aplicacin en el estudio del grado de agregacin de Plicopurpura patula pansa (Gould, 1853) en el estado de Guerrero, Mxico. pp 100-102. En:
Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de
Guadalajara, Mxico. 286 p.

PARMETRO k DE BINOMIAL NEGATIVA Y SU APLICACIN EN EL ESTUDIO DEL GRADO DE


AGREGACIN DE Plicopurpura pansa (Gould, 1853) EN EL ESTADO DE GUERRERO, MXICO

Garca-Ibez, Sergio1, Flores-Rodrguez, Pedro1, Flores-Garza, Rafael1, Arana-Salvador, Domingo G.1 y


Valds-Gonzlez, Arcadio2.
1
Cuerpo Acadmico Ecologa, Sistemas Acuticos y Pesca. Unidad Acadmica de Ecologa Marina,
Universidad Autnoma de Guerrero. 2Laboratorio de Acuacultura, Facultad de Ciencias Biolgicas,
Universidad Autnoma de Nuevo Len. sergariba@yahoo.com.mx, acua_uag@yahoo.com.
Palabras clave: Binomial negativa, Plicopurpura, Guerrero, agregacin.

INTRODUCCIN cantidad de fisuras y oquedades. Las pendientes


El conocimiento del arreglo espacial, permite promedio son 35.18 (ZO) y 36.4 (PA).
ampliar la visin sobre las relaciones inter e intra Tlacoyunque (TL) ubicada en 171514.6N y
especficas de una especie, as como su 1010046O, es una playa expuesta con
respuesta a factores ambientales. En la zona sustrato fijo, fisuras y tambin superficies sin
intermareal, donde las condiciones son en pliegues, con promedio de playa de 49.6. Barra
extremo adversas, es posible abordar con mayor de Potos 1 (BP1) y Barra de Potos 2 (BP2),
detalle dichas relaciones. Por otra parte, el ambas se ubican en Punta el Potos, en
desconocimiento del gradiente de agregacin 173217.4N y 1012719.1O as como
podra tener efectos adversos en el 173212.5N y 1012654.6O. Playas
planteamiento y ejecucin de un diseo de expuesta y protegida respectivamente. BP1
muestreo, lo que dara por resultado presenta grandes bloques con fisuras as como
infravaloraciones de ciertos parmetros cantos rodados; BP2 est compuesta nicamente
poblacionales. El gasterpodo Plicopurpura por cantos rodados, de superficie lisa y pocas
pansa, tambin conocido como caracol prpura oquedades. Las pendientes de playa son 22.7
o caracol de tinte, es un carnvoro caracterstico (BP1) y 15.3 (BP2). Troncones (TR), ubicada en
de las costas rocosas del Pacfico Mexicano. 174735.0N y 1014446.6O, playa protegida
Adems, secreta un fluido que al contacto con la compuesta por rocas fijas con gran cantidad de
luz solar y el oxgeno, adquiere una coloracin fisuras. El promedio de playa es de 28.4.
prpura, el cual a la fecha sigue siendo utilizado Trabajo de campo. Se realiz en la franja
para la elaboracin de prendas teidas con el mesolitoral superior (Stephenson y Stephenson,
precioso lquido. El presente estudio determin el 1949) durante marea baja. Las fechas fueron
grado de agregacin del caracol de tinte en septiembre y diciembre de 2000, marzo, junio,
nueve sitios rocosos del Estado de Guerrero, septiembre y diciembre 2001. De forma vertical
Mxico, mediante la aplicacin del parmetro k se delimitaron dos niveles, llamando nivel I a
de Binomial Negativa. aqul cuyo lmite inferior colind con la zona
balnida, y nivel II a aqul cuyo lmite superior
MATERIALES Y MTODOS fue la zona litornida. El muestreo fue sistemtico
rea de Estudio. Los sitios de estudio son: Punta y el tamao de muestra en cada sitio y fecha fue
Maldonado (PM), se ubica en 1619`26.7``N y de 20m2, con cuadrante de 1 m2. El cuadrante se
98344.6W y es una playa expuesta, de colocaba de manera alternada entre el nivel I y II,
sustrato frgil y alta complejidad, con pendiente contabilizando todos los individuos de P.p.
promedio de 30. Las Peitas (LP), ubicada en pansa. Al concluir, se dejaba un espacio de 2 m y
163314.4N y 984622.0W, playa protegida se continuaba la operacin. La pendiente de
de sustrato fijo y gran cantidad de grietas y cada cuadrante se registr por medio de un
oquedades, con pendiente de playa de 51.62. clinmetro.
Playa Ventura (PV) se ubica en 16328.3N y Anlisis de datos. El parmetro k se estim de
985444.6W, playa expuesta con sustrato fijo y acuerdo a Rabinovich (1980) y Krebs (1999),
gran cantidad de grietas y oquedades con con la siguiente frmula:
pendiente de 59.6. Playas Zoolgico (ZO) y x 2 (s 2 / n )
Palmitas (PA), que se ubican en la Isla La k =
Roqueta, Acapulco, entre los 164911.2N y
s2 x
99548.8W as como 164925.6N y donde k = parmetro de la distribucin Binomial
995441.2W respectivamente. Playas expuesta Negativa; x = media muestral; s = varianza
2
y protegida, compuestas por sustratos fijos y gran muestral; n = nmero de cuadrantes.

100
Estudios sobre Malacologa y Conquiliologa en Mxico

Posteriormente, para corroborar la pertinencia del oleaje, caracterizan a los dos grupos clasificados
parmetro k como ndice de agregacin en cada de primera intencin: PV, ZO, PA y TL, presentan
conjunto de datos, las frecuencias observadas sustratos fijos con gran cantidad de grietas,
de caracoles de cada playa y fecha de muestreo, pendientes ms pronunciadas y en cuanto al
se ajustaron a la distribucin de probabilidad oleaje, tres son expuestas y una es protegida.
Binomial Negativa, con la siguiente expresin: Por otro lado y con excepcin de LP y TR, las
playas BP1 y BP2 llegan a presentar en parte o
(k + x ) x k k en su totalidad sustratos mviles con superficies
Px =
x!(k ) + k k +
lisas, las pendientes registradas son ms suaves
en tres de los sitios; en cuanto al oleaje, tres son
donde Px = probabilidad de que un cuadrante protegidos y uno expuesto.
contenga x individuos; x = Un contador (0, 1, 2, Krebs (1999), menciona que hay
patrones agregados que no pueden ser descritos
3); = media de la distribucin; k = parmetro por Binomial Negativa, por lo que es diferente
de Binomial Negativa; = funcin Gamma. El mencionar evidencia de agregacin en los
ajuste del modelo fue evaluado con el estadstico datos y adecuada descripcin de una cierta
x2 (chi-cuadrada, P0.05). distribucin, mientras que Cox (2002) comenta
El modelo Binomial Negativa es un indicador de que Binomial Negativa puede ajustar datos
atraccin entre los individuos (Badii et al, 2000). muestrales derivados de patrones agregados. La
En la seccin de resultados, se abordar como presente investigacin concuerda con ambos
primer punto, el ajuste de las frecuencias autores, ya que algunos conjuntos de datos no
observadas a dicho modelo. pudieron ser ajustados, an y cuando los valores
Se elabor un anlisis jerrquico de de k eran pequeos y/o la informacin restante
conglomerados (cluster) con los valores del de la misma localidad si fue ajustada. De manera
parmetro k por cada localidad de estudio, con la general, es posible establecer que el modelo
finalidad de detectar aquellos conjuntos de datos Binomial Negativa puede ajustar una gran
con mayor similitud. proporcin de las frecuencias observadas de P.p.
pansa.
RESULTADOS Y DISCUSIN Los valores del parmetro k fluctuaron entre 0.20
Un total de 42 conjuntos de datos (78%) fueron (BP2) y 20.45 (PM). De 42 conjuntos de datos
ajustados por el modelo Binomial Negativa, entre ajustados por Binomial Negativa, 30 (71%)
ellos, el total de la informacin de los sitios PV, presentan valores iguales o menores a 3.84
ZO, PA y TL en las seis fechas. Los 12 conjuntos (cuadro 2).
restantes (22%), se distribuyeron entre la
informacin de los sitios PM, LP, BP1, BP2 y TR. Cuadro 2. Valores del parmetro k en nueve playas del
Cabe sealar que ningn conjunto de datos de Estado de Guerrero durante seis fechas.
BP2 fue ajustado por el modelo citado, por lo que
SEP-00 DIC-00 MAR-01 JUN-01 SEP-01 DIC-01
dichos valores, se considerarn nicamente para
fines comparativos (cuadro 1). PM 0.85 2.44 3.84 1.75 20.45* 15.80*
LP 1.28 1.35* 1.25 1.76 1.15 1.17

Cuadro 1. Conjuntos de datos de nueve sitios y seis PV 2.13 1.07 1.99 2.75 3.63 1.76
fechas que fueron ajustados por Binomial Negativa ZO 2.07 3.23 7.61 3.09 0.873 7.07
Tabla 1.. PA 10.66 8.69 4.48 2.05 2.18 5.95
SEP-00 DIC-00 MAR-01 JUN-01 SEP-01 DIC-01
TL 8.19 1.66 7.1 9.17* 2.89 1.82
PM BN BN BN BN -- --
BP1 10.19 7.18 3.35 2.49 1.28* 1.50
LP BN -- BN BN BN BN
BP2 0.29* 0.20* 1.97* 1.96* 0.9* 2.32*
PV BN BN BN BN BN BN
TR 11.01* 4.03* 3.12 1.02 1.61 7.11
ZO BN BN BN BN BN BN
* Valores de k en datos no ajustados por Binomial Negativa.
PA BN BN BN BN BN BN

TL BN BN BN BN BN BN El anlisis de conglomerados mostr tres


BP1 BN BN BN BN -- BN grupos de mayor similitud del parmetro k entre
BP2 -- -- -- -- -- -- los conjuntos de datos de los sitios. El primero
TR -- -- BN BN BN BN estuvo conformado por LP y PV, que presentaron
los menores valores de k (1.07 a 3.63); el
Tanto la estructura y complejidad del segundo grupo estuvo conformado por PA y BP1
sustrato, pendiente de playa e intensidad del con un rango de valores ms amplio (2.05 a

101
Estudios sobre Malacologa y Conquiliologa en Mxico

10.19) y posteriormente a este grupo se integr relacionada estrechamente con el sustrato, la


TR (valores entre 1.02 y 11.01); el siguiente pendiente y la exposicin al oleaje de cada playa.
grupo lo formaron ZO y TL (0.873 a 9.17). La En playas de sustratos fijos con gran cantidad de
localidad PM present similaridad con todos lo grietas, superficies speras y pendientes
sitios en lo general (figura 1). promedio grandes (>50), los caracoles
Es posible observar que el orden de los presentaron los valores ms pequeos as como
grupos guarda una estrecha relacin nuevamente la menor fluctuacin en el grado de agregacin.
en primer trmino con la estructura, complejidad Por otro lado, en playas que llegaron a presentar
y pendiente del sustrato; en segundo con la sustratos mviles, que son expuestas y con
intensidad del oleaje. pendiente promedio intermedia o suave, se
presentaron valores de k muy grandes y por lo
C A S O 0 5 10 15 20 25
Playa +---------+---------+---------+---------+---------+ tanto, una mayor fluctuacin del parmetro.
LP LP
PV PV
PA PA LITERATURA CITADA
BP1 BP1
Badii, M. H., A. E. Flores, R. Foroughbakhch y H.
TR TR
ZO ZO Quirz. 2000. Fundamentos de Muestreo. EN:
TL TL Badii, M. H., A. E. Flores y L. J. Galn W. Eds.
PM PM Fundamentos y perspectivas de control
biolgico. Universidad Autnoma de Nuevo
Figura 1. Dendograma de similitud entre los conjuntos Len, Mxico, pp. 129-153.
de datos de ocho sitios de estudio en funcin del Cox, G. W. 2002. Laboratory Manual General
parmetro k. Ecology. 8a Ed. McGraw-Hill. New York, U.S.A,
312 p.
De esta manera, LP y PV son playas con Krebs, C. J. 1999. Ecological Methodology. 2a
pendientes pronunciadas (51.62 y 59.6), Ed. Addison Wesley Longman, Menlo Park,
sustratos fijos y complejos y difieren en California USA. 620 p.
intensidad del oleaje; PA, BP1 y TR presentan Pielou, E. C. 1977. Mathematical Ecology. 2a Ed.
pendientes ms suaves (36.4, 22.7 y 28.4), John Wiley & Sons. U.S.A. 385 p.
dos de las playas estn conformadas por Rabinovich, J. E. 1980. Introduccin a la ecologa
sustratos fijos y complejos y una de ellas de poblaciones animales. Compaa Editorial
presenta tanto sustratos mviles como fijos, Continental, S. A. Mxico, D. F., 313 p.
adems, dos playas son protegidas y una es Stephenson, T. A. y A. Stephenson. 1949. The
expuesta; ZO y TL presentan pendientes Universal Features of Zonation Between
intermedias (35.18 y 49.6). PM es una playa Tidemarks a Rocky Coasts. Journal of Ecology,
con caractersticas muy particulares en cuanto a 37: 289-305.
la estructura y complejidad del sustrato, ms que
en lo que respecta a la pendiente (30) y la
intensidad del oleaje (expuesta).
Cox (2002) menciona que en un buen
ajuste al modelo Binomial Negativa, los valores
de k se encuentran entre 0.5 y 3.0. (Pielou, 1977)
manifiesta que una propiedad del parmetro es
que permanece inalterado cuando una poblacin
disminuye en tamao debido a mortandad
aleatoria, por lo puede considerarse un ndice de
agregacin. Rabinovich (1980) indica que valores
muy grandes de ste parmetro, hacen tender la
dispersin espacial hacia un modelo al azar o
Poisson. Los valores de k obtenidos por la
presente investigacin, indican que Plicopurpura
patula pansa es una especie altamente
agregada, ya que 71% de los conjuntos de
frecuencias ajustadas a la distribucin Binomial
Negativa, presentaron valores pequeos.
La menor y mayor variabilidad del
parmetro k de Binomial Negativa, estuvo

102
Estudios sobre Malacologa y Conquiliologa en Mxico

COLECCIONES
MALACOLGICAS

103
Bautista-Moreno, L. M. y A., Lechuga-Medina. 2007. Colecciones biolgicas de moluscos de los Archipilagos de Revillagigedo, Col., e Islas Maras,
Nay., Mxico. pp 105-107. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa
(eds). Universidad de Guadalajara, Mxico. 286 p.

COLECCIONES BIOLGICAS DE MOLUSCOS DE LOS ARCHIPILAGOS DE REVILLAGIGEDO,


COLIMA, E ISLAS MARAS, NAYARIT, MXICO

Bautista-Moreno, Lus Manuel1 y Lechuga-Medina, Ariosto1


1
Instituto Oceanogrfico del Pacfico. Secretara de Marina Armada de Mxico. lmbm85@hotmail.com,
lmbm85@yahoo.com.mx, bahialobos@hotmail.com.
Palabras clave: Colecciones biolgicas, Revillagigedo, Islas Maras, Nayarit.

INTRODUCCION ingreso de los moluscos al citado Sistema de


A partir de 1963 la Secretara de Marina Informacin.
(SEMAR), a peticin de grupos de investigadores
nacionales, transforma la Corbeta C-3 Marn en MATERIALES Y MTODOS
buque de investigacin y se realiza el primer Se realizaron cinco salidas de campo al
crucero oceanogrfico con un buque e Archipilago de Islas Revillagigedo (Figura 2);
investigadores mexicanos y as se inicia la era de cuatro a la Isla Socorro en abril y julio del 2002,
la investigacin oceanogrfica moderna en febrero y marzo del 2003 y una a la Isla Clarin
Mxico. Las colectas cientficas realizadas enero del 2007. En tanto al Archipilago de las
durante las expediciones oceanogrficas a bordo Islas Maras (Figura 3) se efectuaron tres salidas
de los buques de la Armada, contemplaron los de campo, dos a Isla Mara Madre (junio y
principales grupos florsticos y faunsticos octubre del 2004) y una a isla Mara Magdalena
marinos y de algunos de stos, se crearon (noviembre del 2006). La colecta de los
colecciones cientficas de referencia organismos se llevo a cabo mediante buceo libre
debidamente procesadas hasta el ao de 1985 en las zonas intermareales de las estaciones de
(Fig. 1). muestreo, abarcando desde los cinco metros
sobre el nivel medio del mar hasta una
profundidad de diez metros (Foto 1), as como
caminatas de colecta por las playas del rea de
estudio, en algunos casos los organismos en las
colecciones fueron donaciones por los
pobladores de las islas.
Los organismos colectados con tejido
blando se depositaron en frascos de plstico y se
fijaron en formol al 10% neutralizado con borato
de sodio y se etiquetaron con los datos
correspondientes. Los ejemplares colectados se
trasportaron al laboratorio de Biologa Marina del
Instituto Oceanogrfico del Pacfico, para su
Fig. 1 Colecciones biolgicas de la SEMAR en identificacin hasta especie, utilizando
Mxico, D.F. y Manzanillo, Col. bibliografa taxonmica especializada, como lo
son el Keen, (1971), Morris, (1966) y los
Los Institutos y Estaciones catlogos de Holgun-Quionez y Gonzlez
Oceanogrficas dependientes de la SEMAR (1989).
conservan colecciones biolgicas de referencia
de organismos de inters en su jurisdiccin,
siendo el caso para el Instituto Oceanogrfico del
Pacfico en Manzanillo, Col., la formacin de
colecciones biolgicas de moluscos, peces y
crustceos. Actualmente se tiene un convenio
con la Comisin Nacional para el Manejo y Uso
de la Biodiversidad (CONABIO) en el proyecto de
Actualizacin de la Base de Datos de Crustceos
y el ingreso de la Base de Datos de Peces del
Pacifico al Sistema de Informacin BIOTICA 4.1
mismo que est por liberarse en fecha prxima. Fig. 2 Ubicacin del Archipilago Revillagigedo.
Cuando eso suceda se iniciara la actualizacin e

105
Estudios sobre Malacologa y Conquiliologa en Mxico

Posteriormente, se agregaron a la Chama squamuligera Thais viscerealis


coleccin donde fueron fijados segn el tipo: los Cerithium sp. Cerithidae albonodosa
organismos que presentan tejidos blandos se Thais planospira Barbatia reeveana
preservaron en alcohol al 70% y los organismos
que nicamente presentaron concha se Para el caso del Archipilago de las Islas
colocaron en la estantera de la coleccin. Por Maras se identificaron 99 especies, la mayor
ltimo, se elaboran catlogos fotogrficos de los riqueza correspondi a la clase Gastropoda con
mismos para fcil consulta del pblico en general 80 especies, seguida de la clase Bivalvia con 13
e investigadores del pas. especies, clase Polyplacophora con 5 especies y
la clase Cephalopoda con solo 1 especie, cuatro
de estas especies Plicopurpura pansa, Patella
mexicana, Crucibulum scutellatum y Pinctada
mazatlanica se encuentran clasificadas en la
NOM-059-ECOL-2001 bajo proteccin especial y
las dos primeras como endmicas (Tabla 2).

Tabla 2.- Lista de especies colectadas en el


archipilago de las Islas Maras.

Arca mutabilis Astraea babelis


Fig. 3 Ubicacin del Archipilago de las Islas
Cantharus sanguinolentus Cardita laticostata
Maras, Nay. Chiton articulatus Radsiella muscaria
Lepidozona sp. Chione californiensis
RESULTADOS Y DISCUSIN Scurria mesoleuca Conus dalli
La coleccin biolgica de moluscos para el Conus brunneus Conus diadema
Archipilago Revillagigedo se encuentra Conus princeps Cymatium pileare
conformada por 48 organismos, la mayor riqueza Conus sp. Siphonaria maura
de especies la presento la clase Gastropoda con Fissurella sp. Nerita funiculata
33 especies, seguida de la clase Bivalvia con 11 Patella maxima Latirus ceratus
Littorina modesta Planaxis obsoletus
especies, clase Polyplacophora con 3 especies y
Columbella major Columbella sp
la clase Cephalopoda con solo 1 especies, (Tabla Mitra tristis Muricanthus princes
1) siendo Plicopurpura pansa especie clasificada Nerita scabricosta Plicopurpura pansa
en la NOM-059-ECOL-2001, como sujeta a Purpura columellaris Pinctada mazatlanica
proteccin especial y endmica. Thais planospira Cantharus sp.
Turbo saxosus Ficus sp.
Tabla 1.- Lista de especies colectadas en el Megapitaria squalida Crucibulum umbrella
archipilago de las Islas Revillagigedo. Strombus galeatus Mitra lens
Tegula mariana Octopus sp.
Scurria mesoleuca Brachidontes adamsiana Astraea olivacea Hormomya adamsiana
Conus diadema Plicopurpura columellaris Cerithium maculosum Mopalia muscosa
Columbella socorroensis Nerita scabricosta Stenoplax sp. Barbatia gradata
Chama echinata Nerita funiculata Collisella discors Notoacmea fascicularis
Mopalia muscosa Mitrella bacatta Conus recurvus Conus archon
Trachycardium pristipleura Cerithium maculosum Conus nux Cypraea cervinetta
Thais speciosa Cassis coarctata Cypraea albuginosa Cypraea arabicula
Fusinus ambustus Cypraea sp Cypraea sp. Diodora inaequalis
Barbatia bailyi Serpulorbis euriciformis Fisurella asperella Littorina aspera
Bursa caelata Pinna rugosa Columbella sp. Columbella fuscata
Isognomon janus Ostrea affinis palmula Columbella strombiformis Hexaplex regius
Fisurella sp. Protothaca grata Morum tuberculosum Petaloconchus complicatus
Arca mutabilis Cymatium pileare Pseudochama inermis Thais speciosa
Fisurella affinis obscura Conus brunneus Protothaca grata Thais sp.
Cypraea albuginosa Collisella discors Thais melones Lacuna sp.
Cypraea isabella Octopus sp. Nodipecten sp. Strombus sp.
Cyanoplax hartwegi Murexiella lappa Crucibulum scutellatum Strombus peruvianus
Plicopurpura pansa Turbo fluctuosus Strombus granulatus Opeatostoma pseudodon
Petaloconchus complicatus Mitra tristis Isognomon janus Pleuroploca princeps
Chiton articulatus Littorina aspera Malea ringens Oliva venulata
Olivella dama Terebra ornata Vasum caestus Pteria sterna

106
Estudios sobre Malacologa y Conquiliologa en Mxico

Architectonica nobilis Agaronia testacea


Bulla punctulata Spondylus calcifer Y con lo que respecta a las Colecciones
Chicoreus sp. Turritella sp. Biolgicas de la Ciudad de Mxico, se
Terebra armillata.
encuentran ubicadas en las oficinas de la
Cymatium sp.
Secretaria de Marina Armada de Mxico
edificio B, 1er. Piso en la Direccin General
Las colecciones biolgicas de moluscos
Adjunta de Oceanografa, Hidrografa y
del Instituto Oceanogrfico del Pacfico se
Meteorologa de la Regin Naval Central. Para
encuentran en constante crecimiento, abarcando
Mayor Informacin comunquese al telfono
no solo los mencionados Archipilagos, si no de
56246500 ext. 7274.
toda su jurisdiccin, encontrndose en formacin
colecciones de moluscos de las costas de
LITERATURA CITADA
Colima, Jalisco, Michoacn y Guerrero.
Holguin-Quiones, O. E. y A. C. Gonzlez P.
Asimismo, la participacin de estudiantes de
1989. Atlas CICIMAR No. 7 Moluscos de la
algunas Universidades que desarrollan sus
franja costera del Edo. De Oaxaca, Mxico.
prcticas profesionales en sta Institucin, han
CICIMAR, La Paz, B. C. S. Mxico. 221 p.
colaborado con el enriquecimiento de ejemplares
Keen, A. M. 1971. Sea Shells of Tropical West
a citada coleccin.
America. Marine mollusks from Baja California
Como parte de los trabajos de gabinete,
to Per. 2nd. Ed. Stanford Univ. Press,
los ejemplares han sido enviados al CICIMAR de
Stanford California. 1065 p.
La Paz, B.C.S. y el catlogo fotogrfico al C.U.C.-
Morris, A. P. 1966. A field guide to Pacific coast
SUR de Melaque, Jalisco, para que
shells. Including shells of Hawaii and the Gulf of
investigadores de los citados centros de
California. Second edition. National Audubon
investigacin asesoren, corrijan o aporten
Society and National Wildlife Federation. U.S.A.
diferentes puntos de vista que coadyuven en la
297 p.
mejor formacin de las citadas colecciones,
buscando alcanzar los niveles ptimos de calidad
cientfica que requieren.
A pesar de que Mxico es un pas
megadiverso, a la fecha solo se tienen
inventarios parciales de su biota acutica marina.
De aqu la importancia de difundir y dar a
conocer el material biolgico depositado en las
Colecciones Biolgicas de esta Secretaria de
Marina, contribuyendo con esto al conocimiento
de la diversidad de la biota acutica marina.
Es por esto que la difusin de citadas
colecciones al pblico se realiza durante las
visitas a las instalaciones del Instituto
Oceanogrfico del Pacfico por personal de
estudiantes y profesores de algunas
Universidades del Pas, as como a personal
militar de otros pases (agregados navales y
flotas japonesas) (Fig. 4)

Fig. 4. Difusin de las colecciones biolgicas de


moluscos a personal militar de agregados
navales y flota japonesa.

107
Estudios sobre Malacologa y Conquiliologa en Mxico

CONTAMINACION Y TOXICOLOGIA

109
Chilin-Herrera, O. L., R., Rojas-Garca y J. L., Zumaquero-Ros. 2007. Toxicidad de Agave angustifolia sobre Fossaria viatrix, hospedero intermediario
de Fasciola hepatica en Puebla, Mxico. pp 111-112. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-
Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

TOXICIDAD DE Agave angustifolia SOBRE Fossaria viatrix, HOSPEDERO INTERMEDIARIO DE


Fasciola hepatica EN PUEBLA, MXICO.

Chilin-Herrera, Olivia Lingdao, Rojas-Garca, Ral y Zumaquero-Ros, Jos Lino


Laboratorio de Biologa de Invertebrados, Escuela de Biologa, BUAP. olilingd@yahoo.com.mx,
moroco06@yahoo.com.mx.
Palabras clave: Agave angustifolia, toxicidad, Fossaria viatrrix, Fasciola hepatica, Puebla.

INTRODUCCIN las mismas condiciones ambientales de


La fasciolosis y la esquistosomiasis son dos de temperatura, alimento y humedad controladas en
las enfermedades parasitarias ms importantes un moluscario diseado para tal fin. Se consider
debido a su impacto a escala mundial en el paro total de la actividad cardiaca para
medicina humana y veterinaria. Diversas determinar la muerte de los moluscos. Los
instituciones internacionales como la FAO, OPS y caracoles fueron revisados cada hora durante 24
OMS, estn interesadas en el control de estas horas y posteriormente a las 36 horas. Se
parasitosis con alternativas de bajo impacto en el determinaron las DL50 y DL90 mediante un
equilibrio ecolgico (WHO, 2004). Bajo este anlisis de regresin emprica probit, mediante el
enfoque, los productos vegetales utilizados como programa Sigma Plot 9.0 (Systat Software, Inc.,
molusquicidas biodegradables, son preferibles a 2004).
aquellos productos qumicos tradicionales de alto
impacto txico ambiental a corto, mediano y largo RESULTADOS Y DISCUSIN
plazo. Una buena parte de las especies de la A angustifolia present efectos txicos sobre los
familia agavacea, son buenos candidatos como individuos experimentales de F. viatrix en casi
molusquicidas de uso local (Yong y Rodrguez, todas las concentraciones evaluadas. En la figura
1994; Saviol, et al., 1999). Dicha familia es 1 podemos observar que a las 24 horas las
abundante y diversa en los climas secos de concentraciones 1:1 y 1:2, estn asociadas con
Mxico por lo que los objetivos de este estudio el 98.75% y el 51.25% de mortalidad
fueron observar el efecto txico en un modelo de respectivamente, mientras que en las
especies de distribucin local: Agave angustifolia concentraciones de 1:4 a 1:128, los porcentajes
como tratamiento txico y F. viatrix sensu fueron menores al 50%. Sin embargo, a las 36
Paraense (1965), como objetos de horas se observ una disminucin de caracoles
experimentacin. vivos al registrarse una mortalidad del 100% en
la concentracin 1:2 y de mas del 50% en la
MATERIALES Y MTODOS concentracin 1:4.
Los caracoles se colectaron, en la comunidad de
Huilulco, Puebla a una altitud de 1600 msnm. 25
Fueron transportados al laboratorio e
No. de organismos vivos

1:1
identificados utilizando la informacin ilustrada de 20
1:2
Paraense (1965), las claves de Burch (1982), y 1:4
15 1:8
de Thompson, (2004). Los objetos de 1:16
experimentacin fueron las primeras cras de tres 10 1:32
semanas de eclosin, obtenidas de los moluscos 1:64
1:128
recolectados. Para criar los moluscos en masa, 5
control
se sigui el mtodo de Snchez, Perera y
0
Snchez, (1995). Agave angustifolia, fue 0 10 20 30 40
colectada en Cuauhtinchan, Puebla. Las pencas Tiempo (hrs)
fueron secadas a la sombra y posteriormente
pulverizadas. Se prepar una solucin stock, a Figura 1. Grfica de sobrevivientes de
razn de 1gr de polvo de agave / 20 ml de agua Fossaria viatrix en el tiempo.
destilada que fue diluido a diferentes
concentraciones: 1:2, 1:4, 1:8, 1:16, 1:32, 1:64 y Cruz-Reyes, et al., (1989) registraron el
1:128. Se evalu un total de 560 caracoles, 100% de mortalidad al exponer durante 24 horas
repartidos en siete tratamientos y cuatro a dos poblaciones del complejo F. viatrix-
repeticiones ms 80 caracoles dentro de los cubensis con Piqueria trinervia, pero ellos
grupos testigo. Cada repeticin fue realizada en utilizaron el aislado Piquerol A de la planta en
diferentes fechas de junio a agosto de 2006, con concentraciones de 50 y 25 ppm. A una

111
Estudios sobre Malacologa y Conquiliologa en Mxico

concentracin de 5 ppm, una poblacin poblana LITERATURA CITADA


les sobrevivi en ese mismo lapso de tiempo en Abdel-Gawad, M. M., M. M. U. El-Sayed, & E. S.
un 40%. Debido a las diferencias entre la Abdel-Hameed. 1999. Molluscicidal steroidal
aplicacin de un extracto purificado y una mezcla saponins and lipid content of Agave decipiens.
de polvo vegetal y agua, no es an posible Fitoterapia 70: 371-381.
comparar de manera exacta nuestros resultados Burch, J. B. 1982. Freshwater snails (Mollusca:
con los del tratamiento con P. trinervia. Es notorio Gastropoda) of North America. Bulletin of
sin embargo, que ambas plantas tienen efectos Museum of Zoology, University of Michigan,
molusquicidas en concentraciones altas en Ann Arbor, Michigan, U.S.A.
menos de 24 horas, as como efectos a largo Brackenbury T. D. & C. C. Appleton. 1997. A
plazo y alguna resistencia an no medida en comprehensive evaluation of Agave attenuata,
trminos de la recuperacin de individuos y a candidate plant molluscicide in South Africa.
poblaciones sometidas a concentraciones bajas. Acta Tropica 68: 201213
De acuerdo con el anlisis de regresin emprica Cruz-Reyes A., C., Chavarin, M. P., Campos
probit sobre el conjunto de repeticiones Arias & J. Taboada, 1989. Molluscicide activity
realizadas (fig.2), determinamos que la DL50 of Piquerol A isolated from Piquera Trinervia
corresponde a una dilucin de 0.01508192 gr / (Compositae) on 8 species of pulmonate snails.
20ml SE= 0.00362418 (0.7540959 gr/lt) y en el Mem. Inst. Oswaldo Cruz, Rio de Janeiro, 84
caso de la DL90 corresponde a 0.21490272 (1): 35-40
gr/20ml SE= 0.05611921 (10.7451358 gr/lt) Daz-Garcs, R. y J. R. Ferrer-Lpez, 1996.
Efecto de las dosis letales de plantas de la
familia Agavaceae sobre la actividad cardiaca y
la oviposicin de Biomphalaria havanensis
(Mollusca: Planorbidae). Rev. Cub. Med. Trop.,
48 (1): 15-20.
Kishor, N. 1990. A new molluscicidal spirostanol
gylcoside from Agave cantanala.
Fitoterapia. 61, pp 456457.
Paraense, W. L. 1976. Lymnaea viatrix: a study
of topotypic specimens (Mollusca:
Lymnaeidae). Rev. Bras. Biol. 36 (2): 419-428.
Snchez, R., G. Perera, y J. Snchez, 1995.
Cultivo de Fossaria cubensis (Pfeiffer)
(Pulmonata: Lymnaeidae) hospedero
intermediario de Fasciola heptica (Linnaeus)
en Cuba. Rev. Cub. Med. Trop., 47 (1):71-73.
Figura 2. Mortalidad y error estndar en cada Saviol L., L. L.Chitsulo y A. Montresor, 1999.
concentracin a las 24 hrs. Nuevas posibilidades de la lucha contra la
fasciolosis. Bulletin of the World Healt
Muchas especies de agaves son Organization, 1999. 77 (4):300.
candidatas para ser utilizadas en el control Wall, J. M., M. M. Krider, C. F. Krewson, C. R.
poblacional de moluscos dulceacucolas (Kishor, Eddy, J. J. Willaman, D. S. Corell, & H. S.
1990; Yong y Rodrguez, 1994; Daz-Garcs y Gentry, 1954. Steroidal sapogenins VII. Survey
Ferrer-Lpez, 1996; Brackenbury & Appleton, of plants for steroidal sapogenins and other
1997; Abdel-Gawad et al., 1999) pero en la constituents. J. Am. Pharm. Ass., 63: 17.
preocupacin acerca de las consecuencias WHO, 1965. Molluscicide screening and
ambientales de su implementacin como mtodo evaluation. WHO Bull. 33: 567581.
de aplicacin en campo, es necesario seguir los Yong, M. y M. Rodrguez. 1994. Evolucin de la
estudios de evaluacin de su toxicidad sobre accin molusquicida de Agave legrelliana sobre
diferentes especies de limnidos, sobre otros Fossaria cubensis (Mollusca: Lymnaeidae),
caracoles y sobre la fauna y flora que los principal vector de Fascioliasis en Cuba.
acompaa en el medio dulceacucola. Parasitol. al Dia 18: 4650.

112
Corona-Cullar G. 2007. Beneficios clnicos en la artritis canina con la administracin oral del mejillon de labios verdes de Nueva Zelanda (Perna
canaliculus). pp 113-114. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa
(eds). Universidad de Guadalajara, Mxico. 286 p.

BENEFICIOS CLINICOS EN LA ARTRITIS CANINA CON LA ADMINISTRACION ORAL DEL


MEJILLON DE LABIOS VERDES DE NUEVA ZELANDA ( Perna canaliculus )

Corona-Cullar Gustavo1
Departamento de Medicina Veterinaria. Centro Universitario de Ciencias Biolgicas y Agropecuarias.
Universidad de Guadalajara. 2Centro de Investigaciones en Clnica Veterinaria. gcorona@cucba.udg.mx,
drgustavocorona@hotmail.com.
Palabras clave: Artritis, canina, mejilln, Nueva Zelanda, Perna canaliculus.

INTRODUCCIN cidos grasos esenciales omega 3 (EPA/DHA)


En el perro, el trastorno articular ms comn es (Anderson, 1999; Vaughan-Scott 1997).
la artritis, afeccin evolutiva que est El mejilln de Nueva Zelanda. Perna
caracterizada por la degeneracin del cartlago canaliculus de Nueva Zelanda. El mejilln de
articular y la formacin de osteocitos. El dao Nueva Zelanda o de labio verde es una variedad
estructural debido a la osteoartritis puede estar de mejilln que los pueblos indgenas han
presente antes de la aparicin de sntomas capturado durante siglos en las costas de Nueva
clnicos. El 20% de los perros mayores de un ao Zelanda. Se ha observado que las personas que
padece trastornos articulares. Ms del 95% de consumen con regularidad este marisco tienen
los casos se producen en perros de 5 aos o una baja incidencia de trastornos articulares
ms. La cojera es una causa frecuente de degenerativos e inflamatorios.
consulta al veterinario. El mejilln de Nueva Zelanda contiene
Sntomas clnicos. Los sntomas habituales de glucosaminoglucanos (sulfato de condroitina)
la artritis son: cojera persistente, rigidez al adems de cidos grasos omega 3, que poseen
despertarse, dificultad para levantarse y dolor propiedades antiinflamatorias. El sulfato de
crnico. La cojera, debido a la combinacin del condroitina es un componente de cartlago y
dolor articular y la reduccin de la amplitud de lquido sinovial que contribuye a la lubricacin de
movimiento, puede desarrollarse gradualmente o la articulacin.
aparecer repentinamente a continuacin de un
traumatismo menor o de un ejercicio excesivo.
Pueden tambin surgir una prdida de apetito
y cambios en la conducta como, por ejemplo, que
el perro deje de ladrar. El dueo rara vez
interpreta estos sntomas como signos de dolor.
Factores de riesgo en la artritis:
- Edad. Ms de la mitad de los casos de
artritis se dan en perros de entre 8 y 13 aos de
edad. Aunque el mecanismo de accin no se
- Tamao. El 45% de los perros que padecen conoce bien, la fraccin lpida del polvo de
artritis o son de razas grandes; ms de la mitad mejilln de Nueva Zelanda inhibe la sntesis de
pertenecen a razas gigantes. El 28% son perros leucotrieno B4 y la produccin de prostaglandina
de tamao medio. El 27% son perros pequeos. E2 (Whitehouse, 1997) que son dos mediadores
- Obesidad. Causa sobrecarga en las importantes en el proceso inflamatorio.
articulaciones. Se ha autorizado el consumo humano del
- Traumatismo osteoarticular. La ciruga mejilln de Nueva Zelanda en muchos pases
articular (la ligamentoplastia de la rodilla, por desde los aos 70. Tradicionalmente, la
ejemplo) estimula la aparicin de la artritis. poblacin maor ha consumido este marisco
-Actividad intensa. En especial durante el durante siglos y padece menos de artritis que
crecimiento. otras poblaciones.
- Predisposicin gentica. Labrador retriever, Durante la produccin industrial de las
pastor alemn, etc. dietas, las altas temperaturas empleadas pueden
Tanto en la medicina humana como en la reducir la eficacia de las mismas. Actualmente se
veterinaria, se utilizan una serie de suplementos ha desarrollado un proceso que utiliza bajas
dietticos en el tratamiento de la artritis; entre temperaturas para conservar los componentes
estos se encuentran el sulfato de condroitina, el activos de las dietas.
cloruro de glucosamina, los antioxidantes y los

113
Estudios sobre Malacologa y Conquiliologa en Mxico

En las dietas slo se utiliza la carne del


mejilln de Nueva Zelanda hidrolizado y es
incorporado en la dieta en forma de polvo fino.
Se han realizado muchos estudios
clnicos destinados a valorar la eficacia del
mejilln de Nueva Zelanda. En el perro, el
mejilln de Nueva Zelanda se administra en
forma semiseco, en polvo o como ingrediente
incorporado en una dieta (Bierer, 2002; Bui,
2000).

MATERIALES Y MTODOS
El estudio clnico fue de tipo doble ciego y se
llev a cabo con 31 perros de diferente raza,
sexo y edad (de 4 a 13 aos de edad) con
sntomas clnicos de artritis de distinta intensidad. CONCLUSIN
Se dividi a los animales en 2 grupos aleatorios; Los factores dietticos pueden afectar a algunos
a un grupo (14 perros) se le administr la dieta procesos inflamatorios relacionados con la
de estudio, al otro (17 perros) se le administr la artritis, pueden estimular la reparacin del
dieta de referencia. Se utiliz la misma base para cartlago y proteger las articulaciones del stress
elaborar la dieta de estudio y la de referencia, oxidativo. Cuando es eficaz, se puede combinar
pero se incorpor el polvo de mejilln de Nueva la dieta con frmacos convencionales.
Zelanda mediante el proceso de baja
temperatura para obtener una concentracin final LITERATURA CITADA
del 0,3% de materia seca. Anderson, M. A. 1999a. Oral chondroprotective
Se realiz la valoracin clnica de los agents. Part I. Common compounds.
sntomas de la artritis en la semana 0 y en la Compendium 21: 601-609.
semana 6. Se midieron todos los parmetros en Anderson, M. A. 1999b. Oral chondroprotective
una escala de 0 (asintomtico) a 4 (graves). Se agents. Part II. Evaluation of products.
valor la movilidad de cada perro (media de la Compendium 21: 861-865.
medicin individual en cuanto a cojera al andar, Bauer, J. E. 1994. The potential for dietary
al trotar y al subir escaleras) y se evaluaron polyunsaturated fatty acids in domestic
individualmente las articulaciones de cada animals. Australian Veterinary Journal 71: 342-
miembro (carpiano, codo y hombro o tarso, rodilla 345.
y cadera) para ver el grado de dolor, inflamacin, Bennett, D. 1991. Joint Disease. En: Canine
crepitacin y reduccin de la amplitud de los Medicine and Therapeutics Chandler, E.A.,
movimientos. Se obtuvo el total de la medicin de Thompson, D. J., Sutton, J. B. and Price, C. J.
la artritis mediante la suma de las diferentes (eds) Blackwell Scientific Publications, Oxford.
mediciones de movilidad y las mediciones pp 249-308.
articulares individuales de cada perro. Bierer, T. L. & L. B. Bui. 2002. Improvement of
arthritic signs in dogs fed green-lipped.
RESULTADOS Y DISCUSIN
Los resultados demuestran la eficacia del mejilln
de Nueva Zelanda en la reduccin de los
sntomas de la artritis canina. Las mediciones
totales as como las del dolor articular y la
inflamacin fueron significativamente ms bajas
despus de 6 semanas de someterse a la dieta
con mejilln de Nueva Zelanda en su
composicin.

114
Osuna-Lpez, I., G., Izaguirre-Fierro, H., Zazueta-Padilla, P., Villegas-Zuno, M. G., Fras-Espericueta, G., Lpez-Lpez, D., Voltolina y L., Snchez-
Osuna. 2007. Plomo en Crassostrea corteziensis y C. iridescens en dos ecosistemas costeros de Sinaloa impactados por actividades antropognicas.
pp 115-117. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds).
Universidad de Guadalajara, Mxico. 286 p.

PLOMO EN Crassostrea corteziensis Y C. iridescens EN DOS ECOSISTEMAS COSTEROS DE


SINALOA IMPACTADOS POR ACTIVIDADES ANTROPOGNICAS

Osuna-Lpez, Isidro1, Izaguirre-Fierro, Gildardo1, Zazueta-Padilla, Hctor1, Villegas-Zuno, Procopio2,


Fras-Espericueta, Martn Gabriel1, Lpez-Lpez, Gabriel1, Voltolina, Domenico3, Snchez-Osuna,
Librada1
1
Laboratorio de Estudios Ambientales, Facultad de Ciencias del Mar, Universidad Autnoma de Sinaloa.
2
Laboratorio AquaPacific. 3CIBNOR-UAS. gilofierro@yahoo.com.mx.
Palabras clave: Moluscos, bivalvos, plomo, zona costera.

INTRODUCCIN muestreos en cinco estaciones, cuatro en las


El sistema lagunar Altata-Ensenada del Pabelln, proximidades de las descargas del Emisor
ubicado en la porcin centro-norte de la planicie Submarino y una en una zona ms distal. En
costera de Sinaloa, forma parte del frente cada estacin y muestreo se recolectaban 20
deltico del ro Culiacn y sirve como cuenca ejemplares de tallas similares de los ostiones
receptora de descargas municipales, industriales, Crassostrea cortezienis y C. iridescens, ambas
agrcolas y acucolas (Green-Ruiz, 1996). Por tal especies ssiles y filtradoras. La primera es de
motivo es importante conocer el estado de salud ambiente estuarino y vive sobre las races de los
ambiental con respecto a los metales pesados, mangles; la segunda habita ambientes marinos,
en particular el Pb que es uno de los ms txicos, adherida a fondos rocosos.
tanto para la biota del ecosistema como para los Las muestras se procesaron en el
seres humanos. laboratorio con las tcnicas convencionales para
En el puerto de Mazatln, es importante el anlisis de metales (Pez- Osuna et al., 1995;
conocer los niveles de metales pesados debido a Fras-Espericueta et al., 1999). La cuantificacin
que existen diversos factores que provocan de las concentraciones de Pb en el tejido de los
contaminacin marina, entre los que se puede moluscos se hizo por espectrofotometra de
mencionar los siguientes: (1) la actividad absorcin atmica.
pesquera (flota camaronera, sardinera y atunera)
y las descargas del canal de PEMEX, que RESULTADOS Y DISCUSIN
aportan hidrocarburos al medio; (2) las plantas La contaminacin por metales pesados en las
procesadoras de productos pesqueros, que zonas costeras es un problema ambiental
vierten desechos de materia orgnica; (3) el importante, ya que estos ecosistemas reciben
problema de las aguas servidas municipales de descargas no controladas de diversos residuos
una poblacin urbana de 400 mil habitantes, ms qumicos. Esto es todava ms preocupante
los turistas nacionales y extranjeros que arriban cuando se trata de metales pesados como el Pb,
en la temporada alta, que generan de 1500 a ya que una de las fuentes alimenticias que
2000 litros por segundo; (4) la Termoelctrica II, contienen los ms altos niveles de este elemento
arroja aguas sobrecalentadas con posibles son los productos del mar, como peces,
cargas de metales y otros residuos qumicos; (5) moluscos y crustceos (Hardison, 2002).
los efluentes de una granja camaronera que Diversos estudios han mostrado que los
vierten el agua utilizada en sus cultivos, metales pesados se bioacumulan en los tejidos
generando aportes de materia orgnica, (Rainbow, 1995; Phillips, 1995; Pez-Osuna y
nutrimentos y residuos de antibiticos. Fras-Espericueta, 2001). Uno de los
El principal objetivo del presente trabajo componentes de la biota acutica ms utilizados
es cuantificar el contenido de Pb en el ostin de para evaluar la calidad ambiental son los
mangle Crassostrea corteziensis y en el ostin de bivalvos, ya que han mostrado mayor capacidad
piedra C. iridescens en dos ecosistemas costeros de bioacumulacin de metales. Adems, debido
de Sinaloa impactados por actividades a que son filtradores ssiles, registran los
antropognicas. eventos que ocurren en las reas donde habitan.
La Figura 1 muestra las concentraciones
MATERIAL Y MTODOS (g/g, base seca) de Pb en el tejido blando del
En Altata-Ensenada del Pabelln se ostin C. corteziensis durante los seis muestreos.
hicieron seis muestreos en una estacin con La mxima de 11.2 g/g se registr en el tercer
influencia directa de las descargas agrcolas y muestreo, con un intervalo de 5.4-11.2 g/g.
acucolas; en Mazatln se hicieron ocho Estas concentraciones son muy superiores a las

115
Estudios sobre Malacologa y Conquiliologa en Mxico

reportados por Fras-Espericueta et al. (1994 y metales pesados, con el que concluyen que este
1999) para C. iridescens y C. corteziensis del tipo de sustancias no son removidas hacia el
estero San Cristbal, San Blas Nayarit y para C. Golfo de California, an por las corrientes de
iridescens de la zona costera de Mazatln, marea ms fuertes, de tal modo que se acumulan
Sinaloa; al igual que las obtenidas por Pez- en los sedimentos y se ven reflejados, como en
Osuna y Marmolejo-Rivas (1990) para C. el caso de Pb, en las concentraciones de C.
corteziensis del Estero de Uras, Mazatln, corteziensis.
Sinaloa. En cambio son similares al intervalo de
6.4-19.4 g/g en C. corteziensis del Estero de
12

Concen traciones (g /g)


Uras, Mazatln reportado pos Fras-Espericueta,
10
et al. (2005). Ambas zonas reciben descargas de
8
desechos municipales e industriales. 9.8
6 7.3
8.7
4 5.6

2 3.5
Concentraciones (g/g)

12 0
10 1 2 3 4 5
8 9.1
10.0 11.2 Muestreos
6
4 5.4 5.9
2
0 Figura 2. Concentraciones de plomo (Pb) en el tejido
1 2 3 4 5 blando de Crassostrea iridescens de la Baha de
Muestreos Mazatln durante el periodo de estudio.

Tabla I. Comparacin del Pb en bivalvos de


Figura 1. Concentraciones de plomo (Pb) en el tejido diferentes zonas del mundo.
blando del ostin Crassostrea corteziensis de Altata- Pb
Especies Area Referencia
Ensenada del Pabelln durante el periodo de estudio. (g/g)
Costa Muoz-
M. californianus noroeste B.C. 0.09 Barbosa et al.
En la Figura 2 se muestran las Mxico (2000)
concentraciones de Pb en C. iridescens de la Costa de Veinott et al.
M. edulis 0.5
Baha de Mazatln, las cuales tienen un intervalo Canada (2000)
Costa de Veinott et al.
de 6.12 a 8.57 g/g. Es interesante observar que M. arenaria
Canada
0.1
(2000)
los niveles de Pb son muy similares en las Zona costera
Nicholson y
cuatro primeras estaciones y disminuye en la P. viridis de Hong 3.1-7
szefer (2003)
estacin cinco que es la ms alejada de las Kong
Costa de 1.3- Banaoui et al.
descargas del Emisor Submarino. P. perna
Marruecos 27 (2004)
Las concentraciones de Pb son Schuhmacher
Gerona,
relativamente mayores en Altata-Ensenada del C. angulata
Espaa
5.01 y Domingo
Pabelln, lo cual es de esperarse ya que las (1996)
Halul, Golfo Al-Madfa et
lagunas costeras funcionan como trampas de P. radiata
de Arabia
5.59
al. (1998)
contaminantes, adems este ecosistema ha Altata-
recibido descargas histricas de Pb por M. strigata
Ensenada del 4.54- Castro Cant
transporte atmosfrico de las emanaciones del Pabelln(Mx 6.41 (2006)
ico)
parque vehicular de la ciudad de Culiacn Altata- Fras-
(capital de Sinaloa, con ms de 800 mil Megapictaria Ensenada del 5.1- Espericueta,
habitantes); y de los desechos municipales e squalida Pabelln(Mx 15.2 et al.
industriales que vierte el Ro Culiacn. Se ico (sometiido)
Altata-
consideran descargas histricas porque hasta Ensenada del 5.4-
1997 se elimin el tetraetilo de plomo de las C. corteziensis Este estudio
Pabelln(Mx 11.18
gasolinas de Mxico (Cortez-Lugo et al., 2003). ico)
Otro factor que puede influir en la Mazatln,
C. iridescens 6-8.5 Este estudio
Sin.
acumulacin de Pb en Altata-Ensenada del
Pabelln, es la hidrodinmica del sistema.
Carvajal-Prez y Nuez-Riboni (2002) En la Tabla I se comparan las
desarrollaron un modelo numrico de dispersin concentraciones de Pb en especies de bivalvos
de sustancias qumicas pasivas, como los de diferentes regiones del mundo. En la mayora

116
Estudios sobre Malacologa y Conquiliologa en Mxico

de los casos los niveles de Pb encontrados en C. Tenerife (Islas Canarias), 26 y 27 del


corteziensis de Altata-Ensenada del Pabelln, y septiembre de 2002.
C. iridescens de la Baha de Mazatln, resultaron Fras-Espericueta, M. G, J. I. Osuna-Lpez, S.
ms elevados. Ruiz-Telles, A. Flores-Reyes, G. Lpez-Lpez
La Norma Oficial Mexicana NOM-031- & G. Izaguirre-Fierro. 2006. Heavy Metals in the
SSA1-1993, para los productos de la pesca, Tissues of the Sea Turtle Lepidochelys olivacea
como moluscos bivalvos frescos-refrigerados y from a Nesting Site of the Northwest Coast of
congelados, seala 1 mg/kg de Pb como lmite Mexico. Bull. Environ. Contam. Toxicol., 77: 179-
mximo para el consumo humano. Si se hace la 185.
conversin a las unidades de g/g, se tiene que Fras-Espericueta M. G., J. I. Osuna-Lpez, G.
el lmite mximo permisible es de 1 g/g. Es Sandoval-Salazar & G. Lpez-Lpez. (1999).
evidente que los valores registrados en este Distribution of trace metals in different tissues in
trabajo estn muy por encima de lo sealado en the rock oyster Crassostrea iridescens: seasonal
la legislacin ambiental mexicana. variation. Bull. Environ. Contam. Toxicol., 63 (1):
Se recomienda disear bioensayos con 73-79.
base en las concentraciones de Pb obtenidas en Muoz-Barbosa A., E. Gutierrez-Galindo, G.
las dos especies de ostin y determinar Flores-Muoz. 2000. Mytilus califonianus as a
diferentes ndices fisiolgicos, como por ejemplo: indicador for heavy metals on the northwest
consumo de oxgeno, excrecin de amonio y coast Baja California, Mexico. Mar. Embrin.
protenas totales, para as evaluar el efecto del Res. 49: 123-144.
Pb en C. corteziensis y C. iridescens. Pez-Osuna F. y M. G. Fras-Espericueta. 2001.
Bioacumulacin, Distribucin y Efectos de los
LITERATURA CITADA Metales pesados en los Peneidos. En: La
Banaui, A., J. Chiffoleau, A. Moukrim, T. Camaronicultura y el Medio Ambiente, F. Pez-
Bourgeot, A. Kaaya, D. Auger, y E. Rozuel. Osuna (Editor), Cap. 13: 244-270.
2004. Trace metal distribution in the mussel Pez-Osuna, F., M. G. Fras-Espericueta y J. I.
Perna perna along teh Moroccan coast. Mar. Osuna-Lpez 1995. Trace metal concentrations
Poll. Bull. 48: 385-390. in relation to season and gonadal maturation in
Carvajal-Prez, N. y I. Nez-Riboni. 2002. the oyster Crassostrea corteziensis. Mar.
"Dispersin de contaminantes pasivos en el Environ. Res., 40:19-31.
complejo lagunar de Altata-Ensenada del Phillips, D. J. H. 1995. The chemistries and
Pabelln, Sinaloa". Reportes del IPICYT; environmental fates of trace metals and
1(1):23-38 organochlorines in aquatic ecosystems. Marine
Castro-Cant, W. 2006. Determinacin de Pollution Bulletin, 31: 193-200.
metales pesados (Cd, Cu, Pb y Zn) en el Rainbow, P. S. 1995. Physiology,
mejilln Mytella strigata del sistema lagunas physicochemistry and metal uptake-a
Altata-Ensenada del Pabelln. Tesis de crustacean perspective. Marine Pollution
Licenciatura, FACIMAR, UAS. Sinaloa, Mxico, Bulletin, 31: 55-59.
34 p. Schumacher, M. & J. l. Domingo, 1996.
Cortez-Lugo M, M. Tllez-Rojo, H. Gmez- Concentrations of selected element in oysters
Dants y M. Hernndez-Avila. 2003. Tendencia Crassostrea angulata from the Spanish coast.
de los niveles de plomo en la atmsfera de la Bull. Env. Contam. Toxicol. 56:106-113.
zona metropolitana de la Ciudad de Mxico. Veinott, G., M. Anderson, P. Sylvester & D. Gani.
1988-1998. Salud Publica Mex; 45 supl 2:S196- 2000. Metals concentrations in bivalves living in
S202. and around copper mine tailings released after
Green-Ruiz. C. 1996. Geoqumica de sedimentos tailings dam breach. Bull. Env. Contam.
de la laguna costera subtropical Altata- Toxicol. 67: 282-287.
Ensenada del Pabelln, Sinaloa, Mxico. Tesis
de Maestra en Ciencias del Mar. ICMyL.
UNAM.
Hardisson, A. 2002. Presencia de mercurio,
plomo y cadmio como contaminantes marinos.
Jornadas sobre Contaminacin Marina. Centro
Superior de Nutica y Estudios del Mar de la
Universidad de la Laguna, en Santa Cruz de

117
Faras-Snchez, J. A., V., Pelez-Zarate y M. A., Rivero-Lpez. 2007. Induccin experimental de microncleos en hemocitos de individuos adultos del
mejilln estuarino Mytella strigata (Hanley, 1843), por Metilparatin. pp 118-120. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-
Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

INDUCCIN EXPERIMENTAL DE MICRONCLEOS EN HEMOCITOS DE INDIVIDUOS ADULTOS


DEL MEJILLN ESTUARINO Mytella strigata (Hanley, 1843), POR METILPARATIN

Faras-Snchez, Jos Antonio1, Pelez-Zarate, Vctor y Rivero-Lpez, Mario Alonso2


Instituto Tecnolgico de Mazatln1. Facultad de Ciencias del Mar, UAS2. tonyfar@hotmail.com.
Palabras clave: Microncleos, hepatocitos, mejilln, metilparatin, Mytella strigata.

INTRODUCCIN Uras desprendindolos cuidadosamente de los


Entre los mtodos citogenticos recientemente racimos de organismos adheridos a las races
empleado para el estudio de la contaminacin en areas del mangle rojo Rizophora mangle.
organismos acuticos marinos usados como Con el fin de eliminar los microncleos
biomonitores, destaca la prueba de Microncleos presentes en los hemocitos de los mejillones que
(Majone et al., 1987; Majone et al., 1988), que se fueron empleados para las pruebas de induccin,
caracteriza por ser una prueba rpida, simple y se seleccionaron aquellos que tuvieran una
econmica que evala cualitativamente el longitud total promedio mayor a los 30 mm,
rompimiento de los cromosomas. Su utilidad despus de medir su longitud total empleando un
como biomarcador ha sido propuesta para la calibrador de plstico (+ 0.01 mm) e introdujeron
deteccin de sustancias capaces de inducir en acuarios provistos de agua marina filtrada,
mutaciones (Al-Sabti, 1991 Gmez-Arroyo et al., aireacin y con una salinidad promedio de 28
2000; Pelez-Zrate, 2001) tales como los UPS y una temperatura de 24 C. alimentndose
microncleos que provienen de la condensacin ad libitum con una mezcla de micronizado de la
de fragmentos de cromosomas acntricos o por macroalga Ulva lactuca y harina de arroz, de
cromosomas completos, que no son incluidos en acuerdo con las recomendaciones de Pelez-
la clula principal despus de la anafase debido Zrate ( 2001),
entre otras razones, a la presencia en el medio Durante esta etapa se determin el ICMn
de dichas sustancias como los pesticidas (Al- antes de su introduccin al sistema y a los 15 y
Sabti, 1991). 30 das posteriores a la misma, de acuerdo con
El mtodo general descrito por Al-Sabti la tcnica de Al Sabti (1991) modificada por
(1991), utilizando la tcnica de los microncleos Pelez-Zrate (2001), as como la sobrevivencia
en eritrocitos de peces, fue adaptado por Pelez- y capacidad de refijacin de los organismos
Zrate (2001), para la identificacin y como ndice de vitalidad y salud segn Mersch y
cuantificacin relativa de microncleos en Beauvais (1997).
hemocitos de mejillones (Mytella strigata) La comprobacin estadstica del proceso
recolectados en el Estero de Uras, en Mazatln, gradual de purificacin, se realiz mediante un
Sinaloa. Se realiz una purificacin en anlisis de varianza de una va entre los valores
condiciones de laboratorio de mejillones adultos del ICMn por fecha de muestreo, realizando
y, posteriormente, se llev a cabo exitsamente previamente una transformacin arco seno de los
una induccin de microncleos, introducindolos datos. Cuando hubo diferencias significativas
experimentalmente al mismo ecosistema como resultado del ANAVA, se aplic una prueba
estuarino caracterizado por su alto nivel de de Tukey. Tanto el Anlisis de Varianza como la
contaminacin de diversos tipos (Galindo 2001). prueba de Tukey se realizaron con un de
El objetivo del presente estudio es confianza del 95% (Zar, 1984).
demostrar la posibilidad de inducir Para realizar el experimento preliminar
experimentalmente la formacin de microncleos de induccin de microncleos, un total de 60
en hemocitos de mejillones adultos de la especie organismos seleccionados en base a su
Mytella strigata, mediante el empleo de un purificcion y estado de salud positiva se
compuesto identificado como el pesticida introdujeron equitativamente en 3 acuarios con
metilparatin y consecuentemente ratificar el uso agua marina filtrada, aireacin y con una
del mejilln Mytella strigata como bioindicador salinidad promedio de 35 UPS y temperatura de
para la advertencia temprana de la presencia de 24 C. y con una concentracin de metil-paratin
compuestos organofosforados en ecosistemas de 2X10-2 mg/L.
estuarinos. El ndice de Microncleos (ICMn) se
determin al inicio y a las 24 horas de exposicin
MATERIALES Y MTODOS al compuesto, de acuerdo con la tcnica
Aproximadamente 300 mejillones (M. strigata) propuesta por Pelez-Zrate (2001).
fueron colectados manualmente en el Estero de

118
Estudios sobre Malacologa y Conquiliologa en Mxico

Con estos datos previamente normalizados el ICMn despus de 24 horas de exposicin al


mediante una transformacin ArcoSeno, se pesticida (Fig. 1).
emple un ANAVA de una va con el fin de 25 22.7

encontrar diferencias significativas en el ICMn 20

entre las fechas mencionadas, aplicando segn

)
12.73

ICMn (%
15

el caso para su identificacin, la Prueba de 10

Tukey, todo con un nivel de confianza del 95%. 5

(Zar, 1984). 0
4 5
El material, equipo, procedimientos y
Tiempo (das)
mtodos para realizar la prueba de induccin de
microncleos de los mejillones expuestos por Figura 1. Valor promedio del ICMn (%)
triplicado, durante 12 das a tres concentraciones observado en el lote experimental de mejillones de la
subletales de metilparatin, (1X10-5, 1X10-4 y especie Mytella strigata, al trmino del perodo de
1X10-3 mg/L) fueron similares a los del primer purificacin y a las 24 h de exposicin a una
concentracin de 2X10-2 mg/L de metilparatin,
experimento, con la diferencia de que la
durante la prueba preliminar de induccin de
determinacin del ICMn a partir del inicio del microncleos.
bioensayo se realiz en tres mejillones por
acuario, de acuerdo con la tcnica propuesta por El ICMn registrado al trmino del perodo
Pelez-Zrate (1991). de exposicin en la prueba preliminar fue de
Previa normalizacin mediante una 22.7%, coincidiendo con el ICMn de 20%,
transformacin Arco seno se realiz un Anlisis reportado por Pelez-Zrate (2001), en
de Varianza de Dos Vas y cuando se mejillones trasplantados al sistema de Uras.
encontraron diferencias significativas, se aplic En la figura 2 se observa el
una prueba de Tukey con un intervalo de comportamiento de los valores el ICMn
confianza del 95 % (Zar, 1984). registrados durante la prueba final de induccin,
mostrando un incremento con respecto al tiempo
RESULTADOS Y DISCUSIN de exposicin, as como con el aumento en la
Los resultados de la prueba de sobrevivencia y concentracin del metilparatin utilizado en el
refijacin observadas en los lotes experimentales bioensayo. Se alcanzaron sus mximos valores
de los mejillones empleados en las diferentes para las tres concentraciones en el noveno da
pruebas, mostraron un valor promedio de 96% de de exposicin, con una disminucin a los 12 das.
sobrevivencia y 93% de refijacin, probando su
vitalidad y salud positiva (Mersh y Pihan, 1993; 40
Mersh et al., 1996; Mersh y Beauvais, 1997).
ICMn (%)

30
El proceso de purificacin al que fueron 20
sometidos los mejillones previo a los 10
experimentos de induccin fue exitoso,
0
registrndose una disminucin significativa
1 3 6 9 12
(p<0.05) en la frecuencia promedio del ICMn
desde un 20.6% inicial hasta un 6.6% despus T ie m p o ( d a s )
de un lapso de 30 das. Figura 2. Valores promedio del ICMn (%) por
A este respecto, Pelez-Zrate (2001) concentracin de metilparatin, con respecto al tiempo
seal que un proceso real de purificacin de de exposicin, observados en el lote experimental de
mejillones es evidente cuando el ICMn disminuye mejillones de la especie Mytella strigata, en la prueba
en forma gradual, hasta alcanzar un valor de de induccin de microncleos, donde , y son los
aproximadamente 4% en un periodo menor a los smbolos correspondientes a las concentraciones de
-3 -4 -5
30 das, mismo que ya ha sido reportado como metilparatin de 1X10 , 1X10 y 1X10 mg/l.
lnea base para los bivalvos Mytilus edulis, M.
californiensis, Dreissenia polymorpha y Se determino la existencia de diferencias
Crassostrea gigas (Chvez-Rosas, 1992; significativas (p<0.05) entre las concentraciones
Wrisberg y Rhemreu, 1992; Burgeot et al., 1996; de 1X10-5 y 1X10-4 mg/L, con respecto a la
Mersch y Beauvais, 1997). concentracin de 1X10-3 mg/L as como, en
Como resultado de la prueba preliminar funcin del tiempo a partir del tercer da de
de induccin de los mejillones expuestos a una exposicin al metilparatin.
concentracin de 2X10-2 mg/L de metilparatin, Se determin la existencia de un efecto
se obtuvo un incremento significativo (p<0.05) en de la concentracin de metilparatin en la

119
Estudios sobre Malacologa y Conquiliologa en Mxico

formacin de microncleos (p<0.05) y con group exposed to pesticides. Mutation


relacin al efecto del tiempo de exposicin Research, 466: 117-124.
(p<0.05) en el proceso de induccin de Majone, F; R. Brunetti, I. Gola, & A. G Levis.
microncleos, sin embargo, no se encontr 1987. Persistence of micronuclei in the marine
interaccin de ambos factores (p>0.05). mussel Mytilus galloprovincialis, after treatment
Estos resultados coinciden con lo with mitomycine C. Mutation Research. 191:
reportado por Repetto (1997), quien seal que 157-161.
el efecto de un txico es funcin de la Majone, F; C. Beltrame & R. Brunetti. 1988.
concentracin del txico en el ambiente o en el Frecuencies of micronuclei detected on Mytilus
medio interno y del tiempo de exposicin o galloprovincialis by different staining techniques
permanencia, indicando que la consideracin del after treatment with zinc chloride. Mutation
parmetro tiempo de exposicin es fundamental Research. 209: 131-134.
en el estudio y evolucin de la intoxicacin. Mersch, J. & J. C. Pihan. 1993. Simultaneous
Sobre este comportamiento, Villela- assessment of environmental impact on
Beltrn (2002) seal que ante la exposicin de condition and trace metal availability in zebra
los hemocitos a un agente genotxico, los mussel Dreissena polymorpha transplanted into
valores del ICMn que representan la formacin The Wiltz River, Luxemburg. Comparison with
de ncleos con microncleo asociado, son de the aquatic moss Fontinalis antipyretica.
alrededor del 25%, y que una vez alcanzado este Archive of Environmental Contamination and
valor, la frecuencia de microncleos tender a Toxicology. 25: 353-364.
disminuir debido a la aparicin de otro tipo de Mersch, J., P. Wagner, & J. C. Pihan. 1996.
afectacin asociada con muerte celular conocida Cooper indigenous and transplanted zebra
como apoptsis. mussel in relation to changing water
Por otra parte, en la prueba de induccin concentrations and body weight. Environmental
de microncleos, se encontraron diferencias of Toxicology. Chem. 15: 886-893.
significativas (p<0.05) entre los ICMn con Mersch, J., & M. N. Beauvais. (1997). The
respecto al tiempo de exposicin, lo cual indica micronucleus assay in the zebra mussel,
que durante el perodo de exposicin al pesticida, Dreissena polymorpha, to in situ monitor
hubo cambios en la velocidad de induccin de genotoxicity in freshwater environments.
microncleos, de tal manera que diferencias Mutation Research and Genetic of Toxicology
significativas (p<0.05) entre los das 1 y 3 del of Environmental Mutagenetic. Vol. 393. No.1-
perodo de exposicin indicaron la existencia de 2: 141-149.
un rpido proceso de induccin, mientras que Pelez-Zrate, V. A. 2001. Estudio de Mytella
diferencias significativas (p<0.05) entre los das 3 strigata (Hanley, 1843) como indicador
y 6 con respecto a los das 6 y 9, indicaron que el biolgico de efectos de toxicidad gentica
proceso de induccin tendi a estabilizarse. provocados por efluentes antropognicos
(Mollusca: Bivalvia). Tesis de maestra.
LITERATURA CITADA Facultad de Ciencias del Mar. Universidad
Al-Sabti, K. 1991. Handbook of Genotoxic Efects Autnoma de Sinaloa, Mazatln, Mxico. 59 p.
and Fish Chromosomes. pp. 230. Jozef Stefan Repetto, M. 1997. Toxicologa fundamental.
Institute, Jamova 39,61111 Ljubljana, Slovenia. Ediciones Daz de Santos. Madrid, Espaa.
Burgeot, T. W. & F. Galgani, 1996. Evaluation of 406 p.
the micronucleus test on Mytilus Villela-Beltrn, E. 2002. Induccin experimental
galloprovincialis for monitoring applications de anomalas citogenticas por Metamidofos
along. French Coastal Marine Pollution Bulletin, (Tamarn 600/Bayer), en hemocitos de
32: 39-46. branquias en juveniles de camarn
Chvez-Rosas, L. 1992. Genotoxicidad en (Litopenaeus vannamei). Tesis de licenciatura.
clulas epiteliales del tubo digestivo de Mytilus Facultad de Ciencias del Mar, Universidad
californianus (Conrad, 1983) de la baha de Autnoma de Sinaloa. Mazatln, Mxico.
Todos Santos. Tesis Profesional. UABC. Wrisberg, M. N., Bilbo, C. M. & H. Spliid. 1992.
Facultad de Ciencias. 95 p. Induction of micronulei in the hemocytes of
Gmez-Arroyo, S., Y. Daz-Snchez, M. A. Mytilus edulis and statistical analysis.
Meneses-Prez, R. Villalobos-Pietrini & J. Ecotoxical. Environmental Safety. Vol. 23 (2):
Len-Rodrguez. 2000. Cytogenetic 191-205.
biomonitoring in a Mexican floriculture worker Zar, H. J., 1984. Biostatistical Analysis. USA,
Prentice Hall. 718p.

120
Wong-Argelles, C., M. C., Alfaro-de la Torre y E., Naranjo-Garca. 2007. Organismos acuticos macrobentonicos como indicadores de la
contaminacin por metales pesados en ros de la Huasteca Potosina. pp 121-123. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-
Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

ORGANISMOS ACUTICOS MACROBENTONICOS COMO INDICADORES DE LA CONTAMINACIN


POR METALES PESADOS EN RIOS DE LA HUASTECA POTOSINA

Wong-Argelles, Cynthia1, Alfaro-de la Torre, Ma. Catalina1, Naranjo-Garca, Edna2


1
Laboratorio de Elementos Traza. Facultad de Ciencias Qumicas. Universidad Autonoma de San Luis
Potos. 2Departamento de Zoologa. Instituto de Biologa. UNAM. cwongar@yahoo.com.mx.
Palabras clave: Macrobentos, contaminacin, indicadores, metales pesados, husteca potosina.

INTRODUCCIN zona Huasteca, coordenadas: 9852 de longitud


La importancia de utilizar organismos acuticos oeste y 2126 de latitud norte.
macrobentnicos como indicadores de la -Ro Coy en el municipio de Tamun. Sus
contaminacin es la de evaluar de manera coordenadas geogrficas son: 2146 a 2224 de
directa el impacto biolgico de los metales traza latitud norte; 9824 a 9827 de longitud oeste.
(Cu, Pb, Cd y Zn). El anlisis en organismos -Ro Valles en Cd. Valles localizado en la parte
acuticos ha sido utilizado como un complemento este del estado, coordenadas: 9901 de longitud
para el muestreo tradicional, adaptando a los oeste y 2159 de latitud norte. Estaciones: La
organismos acuticos como biomonitores u Bomba, Lomas del Yuejat, Los Nopales El
organismos centinelas. El biomonitoreo pretende Bancote y Santa Rosa
buscar la relacin entre la concentracin del Las fechas de las campaas de muestreo
contaminante en el organismo y en su ambiente son las siguientes: a) 18-20 de Enero de 2006; b)
(Ravera, 2001). El objetivo de este trabajo es 2-6 de Junio de 2006 y c) 1-4 de Diciembre de
encontrar la relacin entre la concentracin de 2006.
Pb, Zn, Cu, Cd en los organismos identificados y En cada estacin de muestreo se hace
elegidos como biomonitores y la concentracin una colecta manual de bivalvos y gasterpodos
encontrada de estos metales en cuerpos de agua (moluscos). Los organismos se colocan en
superficiales en algunos ros de la Huasteca recipientes de plstico y se mantienen en agua
Potosina. del mismo ro y a temperatura baja para su
En la regin que se hace el estudio transporte al laboratorio. Se realiza una previa
existen varios ros que son la fuente principal de identificacin utilizando como gua de
agua para todos los usos (agrcola, urbano e identificacin el documento Organismos
industrial) pero al mismo tiempo reciben aportes Indicadores de la calidad del agua y de la
directos de aguas residuales, residuos slidos de contaminacin (Bioindicadores) publicado por la
las poblaciones, la industria y la agricultura. Los Secretara de Medio Ambiente Recursos
ambientes acuticos en la Huasteca Potosina Naturales y Pesca (SEMARNAP). La Comisin
sostienen una poblacin muy importante de Nacional del Agua (CNA) y La Universidad
organismos bentnicos entre ellos los moluscos. Nacional Autnoma de Mxico (UNAM). Y se
Estos se han observado a lo largo del ao tanto preservaron varios ejemplares para su completa
en ros con signos visibles de contaminacin identificacin en el Instituto de Biologa de la
como en sistemas que aparentemente estn UNAM.
limpios. A continuacin se lavan los organismos
con agua desionizada y son colocados en una
MATERIALES Y MTODOS solucin de EDTA 0.01M durante 24 horas.
Se han considerado un total de 3 campaas de Transcurrido este tiempo se enjuagan con agua
muestreo a lo largo de un ao. En cada una se desionizada. Y finalmente se colocan en
determinan parmetros de calidad del agua, se recipientes y se preservan a -20 C hasta la
colectan organismos gasterpodos y bivalvos separacin del tejido blando y la concha. Una vez
(moluscos) en los diferentes ros, as como realizado esto se vuelven a preservar a -20C y
muestras de agua, en la regin en estudio. Los despus se secan en un liofilizador a -45C
ros en los que se han realizado las campaas de durante 6 horas, y posteriormente se determina
muestreo son: el peso seco tanto del tejido blando como de la
-Ro Amajac, en el municipio de Tamazunchale. concha.
Localizado en la parte sureste del estado, El tejido blando de los organismos, en
coordenadas: 9848 de longitud oeste y 2116 forma individual se somete a digestin a
de latitud norte. temperatura ambiente en recipientes de plstico
-Ro Axtla, en el municipio de Axtla. Localizado HDPE, aadiendo 100 L de cido ntrico (HNO3)
en la parte oriente de la capital de estado, en la / 2 mg de muestra seca durante 5 das seguido

121
Estudios sobre Malacologa y Conquiliologa en Mxico

de la adicin de 40 L de agua oxigenada (H2O2)


al 30% / 2 mg de muestra durante un da, que Log Y = log + log W
completa la oxidacin de la materia orgnica. Donde Y es el contenido en g/individuo, es
Finalmente, se ajusta la concentracin de HNO3 un parmetro metablico, W es el peso seco del
al 10% diluyendo con agua desionizada. organismo en g y la pendiente de la ecuacin es
Las conchas de cada uno de los .
organismos por separado se digieren en medio Los criterios que se siguieron para la
cido sobre una placa de calentamiento en interpretacin basados en el valor de son los
recipientes de tefln con tapa y empaque de 45 siguientes: (a) Si > 1, los organismos acumulan
mL de capacidad. Se aade 0.1 mL/mg de el metal; (b) Si = 1, los organismos regulan el
muestra de agua regia (1v de HNO3 + 3v HCl) metal y (c) si < 1, los organismos diluyen el
preparada el mismo da de la digestin. Se metal. Los organismos acumuladores de metales
someten a digestin durante un periodo de 4 a 5 son los que son mas interesantes en los
h a una temperatura entre 60 y 70C. Despus se programas biomonitoreo. Finalmente se realiz
dejan enfriar y se contina con la digestin con un anlisis estadstico a un nivel del 95% de
0.2 mL/mg de muestra de HNO3 concentrado, confianza para obtener las correlaciones
durante 12-14 horas a 60C. Posteriormente se significativas (Tabla1).
lleva a sequedad por evaporacin. Y finalmente
el residuo se redisuelve con HNO3 al 5% v/v y se Tabla 1: Parmetros de regresin lineal
completa el volumen a 25 mL. Posteriormente se Genus Metal m r N P
va a determinar la concentracin de Cu, Pb, Cd y Littoridina Cu 1.8429 0,9526 20 <0,0001
Pb 0.5600 0.8605 20 <0,0001
Zn mediante Espectroscopia de Absorcin Cd -0.0277 0.1257 20 0.4859
Zn 2.8184 0.6373 20 0.0002
Atmica con Horno de Grafito. Pachychillus Cu 1.8375 0.8806 20 <0,0001
En las muestras de agua obtenidas en cada Pb 0,7385 0.5347 20 0.0151
Cd 0.6945 0.3825 20 0.008
ro se analiza lo siguiente: Zn 2.1902 0.5409 20 <0,0001
Polymesoda
-Carbn Orgnico Disuelto Cu
Pb
1.6498
0.9590
0.9724
0.6300
20
20
<.0001
0.0029
-Metales Cd 0.3236 0.0903 20 0.0029

-Aniones (F-, Cl-, Br-, NO3- , PO43-, SO42)


Zn 1.0136 1.0136 20 <0,0001

Las recolectas se realizan en campo y los


anlisis en el Laboratorio de Metales Traza de la Los resultados muestran que para Cu,
Facultad de Ciencias Qumicas de la UASLP. >1 indicando que los moluscos acumulan el
metal, mientras que para Pb, <1 por lo que
RESULTADOS Y DISCUSIN organismos lo diluyen. As pues, los organismos
Se determin que los organismos recolectados Pachychillus, Littoridina y Polymesoda son
pertenecen al Phyllum Mollusca. Con base en las interesantes como biomonitores de los ros bajo
caractersticas fisiolgicas de este grupo se estudio. puesto que acumulan algunos metales.
encontraron tres posibles gneros: Pachychillus y En la figura 2 podemos observar que al aumentar
Littoridina, pertenecientes a la familia de los la biomasa, el contenido del metal tambin
Gasterpodos (caracoles) y Polymesoda aumenta (ejemplo: Cu). Mientras que en la figura
perteneciente a la familia de los Bivalvos 3, el contenido de Pb aumenta pero no en la
(conchas), (Figura 1). misma velocidad que la biomasa.
Littoridina-Cu Littoridina-Pb

100 100
log Contenido Pb (g/ind)
log Contenido Cu (g/ind)

10 10

Littoridina Pachychillus
1

Polymesoda
Figura 1: Gneros encontrados en los Ros de la 0.1 0.1
0.001 0.01 0.1 1

Huasteca Potosina. 0.001 0.01

log peso seco (g)


0.1 1
log peso seco (g)

El tratamiento de los datos se realiz mediante la Figura 2 y 3: Relacin entre el peso seco (g) y
transformacin logartmica de la ecuacin contenido de metal (g Cu/Pb respectivamente)
propuesta por Boyden (1977) que nos genera en el genero Littoridina.
una relacin lineal entre el contenido o
concentracin del metal en el organismo y el Las figuras 4 y 5 demuestran que en los
peso seco de este: Ros estudiados existe tambin una relacin

122
Estudios sobre Malacologa y Conquiliologa en Mxico

entre el metal acumulado por los organismos y el


metal disuelto en agua.

16 24

(g/L)
g/L)

14

Pb in Coy River
in Rivers (

12
23
10
Concentration Pb

Concentration of
6
22
0 .7 0 .3 0
4
0 .6
2
Ro Axtla 0 .5
) 0.2 5
0 .2 0

)
0 .4
nd

nd
[1,82 g/L] 0 .1 5
g/i

g/i
0 .3
0 21 0 .1 0
(

(
0 .2
4
Pb

Pb
3 0 .1 1 0.0 5
2 0 .0 0
1 0 .0 0
d ry w 0 dr y w
ei gt h (g e ig ht (g
) )

L ittorid in a P b in C o y R iv e r
P a c hyc hillu s in V alle s R ive r
p s e co -a xtlA v s C o l 5 v s C o n c P b A x tla

Figura 4: Relacin entre peso y concentracin de


Pb (g/L) en el Ro Valles y Axtla.

Figura 5: Relacin entre peso seco y seco y


contenido (g Pb) conteniido de Pb ((g Pb) y
concentracin de Pb (g/L) en el Ro Coy.

Hemos encontrado que los organismos


acumulan ms metal cuando hay un aumento de
concentracin del metal en el agua. (Wong y
Alfaro, 2006). Los organismos bajo estudio son
macroinvertebrados, principalmente filtradores y
caractersticos de las aguas duras, ricas en la
materia orgnica.
Pachychillus, Littoridina y Polymesoda
acumulan Cu y Zn por lo que podran ser
adecuados en el biomonitoreo de estos metales.
El genero Polymesoda regula el contenido de Pb;
mientras que el Cd y el Pb son diluidos por
Littoridina y Pachychillus.

LITERATURA CITADA
Alfaro de la Torre, M. C., B. A. Rivera-Escoto, I.
Acosta-Rodrguez, I. C. Espino, N. A. Pelallo-
Martnez, C. C. lvarez & J. Gonzlez-Zurita
2006. Biomonitores del agua contaminada por
metales pesados. UNIVERSITARIOS
Potosinos, Nm. 10:4-9
Ravera, O., 2001. Monitoring of the aquatic
environment by species accumulation of
pollutans: a review. J. Limnol., 60 (Suppl. 1):
63-78.
SEMARNAP-CNA-UNAM. 2000. Gua de
organismos indicadores de la calidad del agua
y de la contaminacin (Bioindicadores). Pp. 4-
18, 106-138, 190.
Wong, C. y C. Alfaro de la Torre. 2006. Molusks
as biomonitors of trace metals (Cd, Pb, Cu, Zn)
in Mexican Tropical Rivers. Presented as
poster P74 on November 6, 2006 at the Society
of Environmental Toxicology and Chemestry
27th Annual Meeting in Montreal, Canada.

123
Snchez-Osuna, L., G., Izaguirre-Fierro, D., Ruizvelazco-Ramrez, P., Alarcn-Garzn, I., Osuna-Lpez, D., Voltolina, M., Fras-Espericueta, G.,
Lpez-Lpez y H., Zazueta-Padilla. 2007. Moluscos bivalvos y gasterpodos de una laguna costera de Sinaloa impactada por descargas agrcolas e
industriales. pp 124-126. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa
(eds). Universidad de Guadalajara, Mxico. 286 p.

MOLUSCOS BIVALVOS Y GASTERPODOS DE UNA LAGUNA COSTERA DE SINALOA


IMPACTADA POR DESCARGAS AGRCOLAS E INDUSTRIALES

Snchez-Osuna, Librada1, Izaguirre-Fierro, Gildardo1, Ruizvelazco-Ramrez, Dayana1, Alarcn-Garzn,


Paola1, Osuna-Lpez, Isidro1, Voltolina, Domenico2, Fras-Espericueta, Martn1, Lpez-Llpez, Gabriel1 y
Zazueta-Padilla, Hctor1
1
Laboratorio de Estudios Ambientales, Facultad de Ciencias del Mar, Universidad Autnoma de Sinaloa.
2
CIBNOR-UAS. gilofierro@yahoo.com.mx.
Palabras clave: Bivalvos, gasterpodos, contaminacin, laguna costera.

INTRODUCCIN marea no tienen la fuerza suficiente para


Los registros arqueolgicos de la costa de Baja acarrear las partculas de contaminantes hacia la
California han identificado depsitos culturales de boca que da salida al Golfo de California.
conchas de bivalvos y de gasterpodos Trabajo de campo y laboratorio. De
asociados con esqueletos humanos; la edad de febrero a agosto del 2006, se han hecho cuatro
esos depsitos se ha calculado por el mtodo de muestreos en ocho estaciones distribuidas
radio carbono en 3000 150 aos (Reygadas y estratgicamente de tal modo que representen a
Velsquez, 2005). todo el sistema lagunar, en total se han hecho 32
De las especies identificadas en esos depsitos y colectas de bivalvos y gasterpodos. Los
que hoy todava son parte de la dieta de los muestreos se hicieron sobre transectos de 100
habitantes de las costas, se incluyen: Chione m, perpendiculares a la costa, en los cuales,
californiensis, Megapitaria squalida, Chione cada 15m se colocaba un cuadrante de 1m2 y se
gnidie y Dosinia ponderosa. proceda a recolectar los ejemplares, este
Precisamente por la importancia que procedimiento es el ms usual en investigaciones
tienen los moluscos como alimento humano y por de macromoluscos intermareales (Prieto et al.
el creciente e incontrolado proceso de 2003). Las muestras se depositaron en bolsas de
contaminacin de las lagunas costeras de del plstico y se llevaron al laboratorio donde los
Golfo de California, como es el caso de del organismos fueron contados e identificados con
sistema Altata-Ensenada del Pabelln, es el apoyo de la literatura disponible (Keen 1975;
necesario conocer la diversidad y estabilidad de Brusca 1980 y FAO, 1995); adems se realiz la
sus comunidades y en particular la macrofauna actualizacin taxonmica utilizando los trabajos
malacolgica, que es uno de los grupos ms de Skoglund (2001, 2002). La coleccin de
utilizados en programas de seguimiento para referencia se encuentra en el Instituto de
analizar los efectos de la contaminacin y otras Ciencias del Mar y Limnologa de la UNAM, con
perturbaciones sobre las comunidades los especimenes preservados en formol o
bentnicas (Margalef, 1980). alcohol, con sus respectivas etiquetas.

MATERIALES Y MTODOS RESULTADOS Y DISCUSIN.


El sistema Altata-Ensenada del Pabelln, Riqueza de especies y abundancia
ubicado en la parte centro norte de la planicie Se han identificado 17 especies moluscos
costera del Estado de Sinaloa, recibe descargas bivalvos y 23 especies de gasterpodos. Entre
municipales e industriales a travs del ro los bivalvos destaca el grupo de los venridos
Culiacn, adems de los desechos de con las siguientes especies: Chione
agroqumicos (pesticidas y fertilizantes) de la californiensis, Chione subrugosa, Megapitaria
agricultura intensiva del valle, y en los ltimos 15 squalida, Chione undatella, Chione gnidia,
aos se han agregado las descargas de ms de Dosinia ponderosa y Tivela planulata. Los
50 granjas camaroncolas, de tal modo que en ostreidos registraron dos especies Saccostrea
diversas investigaciones (Carvalho et al., 2002, palmula y Crassostrea corteziensis; los rcidos
Green-Ruiz y Pez-Osuna 2001), se ha mostrado con Anadara grandis y Anadara tuberculosa los
que se han alcanzado niveles preocupantes de mitlidos con Mytella strigata y de los pectnidos
contaminacin por sustancias qumicas. El riesgo se identfic Argopecten ventricosus
para el ecosistema, segn Carvajal-Prez y Los venridos son el grupo de moluscos
Nuez-Riboni, (2002) se incrementa, ya que de bivalvos dominante, sobresaliendo tres especies:
acuerdo con el modelo hidrodinmico que Ch. californiensis, Ch. subrugosa, M. squalida,
desarrollaron para el sistema, las corrientes de

124
Estudios sobre Malacologa y Conquiliologa en Mxico

las tres son de importancia para el consumo


humano y se comercializan en el mercado local. 6% 3% 3%
0%

Este resultado coincide con el de Holgun- 11%

Quiones et al., (2000) quienes reportan al grupo


de los venridos como los ms representativos
en la zona intermareal y fondos someros de de la
Baha de Loreto en Baja California Sur,
destacando tambin las especies Ch. 77%
Chione californiensis
Chione subrugosa

californiensis, Ch. subrugosa y M. squalida. Sacostrea palmula


Megapitaria squalida
Chione undatella
Prieto et al., (2005), tambin reportaron Mytella strigata

a los venridos como dominantes en una Figura 1. Porcentajes de abundancia para cada
comunidad sublitoral de Punta Patilla, Venezuela, una de las especies.
las especies ms abundante fueron Chione
cancellata, y Chione granulata. La dominancia del grupo de los venridos
En la Tabla I se presentan las puede estar relacionada con la escasez de limo y
cantidades de ejemplares para cada una de las arcilla en el sustrato, ya que el tamao de estas
especies. fracciones obstruyen los ctenidios Jackson
Es importante sealar que, con excepcin de M. (1973).
strigata, S. Palmula, Crassostrea corteziensis, Para el caso de los gasterpodos, se
Anadara tuberculosa y Anadara grandis, el resto identificaron 23 especies (Tabla II).
de las especies de bivalvos habitan la zona de
mayor influencia marina (Altata), con fondos Tabla II. Nmero de individuos de cada una de
arenosos y mayor circulacin y recambio de las especies de gasterpodos.
agua, por lo cual est menos impactada por las
sustancias contaminantes que se vierten al Especie TOTAL
sistema lagunar. Cerithium
stercusmuscarum 9535
Tabla I. Cantidad de ejemplares de cada una de Littorina modesta 254
las especies de bivalvos. Crepidula rostrata 218
ESPECIE TOTAL Crucibulum persunatum 167
Chione californiensis 4722
Nassarius luteostoma. 159
Chione subrugosa 670
Sacostrea palmula 353 Theodoxus luteofasciatus 150
Megapitaria squalida 177 Natica chemnitzii 92
Chione undatella 171 Turritella leucostoma 30
Mytella strigata 26 Modulus catenulatus 23
Crassostrea corteziensis 20 Eupleura muriciformes 23
Chione gnidia 18 Turritella gonostoma 20
Dosinia ponderosa 16
Bulla gouldiana 14
Mytella guyanensis 12
Nassarius gallegosi 16
Anadara grandis 8
Tivela planulata 7 Calliostoma bonita 14
Argopecten ventricosus 4 Cantharus sp 12
Atrina maura 4 Neritina sp. 11
Laevicardium elatum 4 Calliostoma marshalli 10
Protothaca asperrima 3 Solenosteira gatesi 9
Anadara tuberculosa 2 Hipponix pilosus 7
Phyllonotus brassica 1
En la Figura 1 se muestran los
porcentajes de abundancia para cada una de las Muricanthus radix 1
especies, es evidente la predominancia de Nerita funiculata 1
Chione californiensis con un 77% de abundancia.
La mayor diversidad se registr en la
parte ms estuarina (Ensenada del Pabelln),
pero la especie dominante, Cerithium

125
Estudios sobre Malacologa y Conquiliologa en Mxico

stercusmuscarum, se recolect en las estaciones Holgun-Quiones, O. E., H. Wright. y E. F. Felix-


de la zona de Altata, con mayor influencia Pico. 2000. Moluscos intermareales y de
marina, esta especie es carnvora y afecta los fondos someros de la Baha de Loreto, BCS,
cultivos de ostin de la zona; los granjeros de Mxico. Ocenides, 15(2): 91-155.
ostin la consideran una plaga, ya que perfora Jackson, J. 1972. The ecology of the mollusc of
las conchas de los ostiones. Thalassia communities, Jamaica, West Indies.
Este resultado coincide con Prieto et al., II Moluscan population variability along an
(2003) quienes reportaron a los gasterpodos environmental stress gradient. Mar. Biol. 14:
Cerithium litteratum, y C eburneum, como 304 337.
especies abundantes en las praderas de
Keen, A. M. 1975. Sea Shells of Tropical West
Thalassia testudinum de la baha de Mochima,
America. Marine Mollusks from Baja California
Venezuela.
to Peru. 2nd. Ed. Stanford Univ.Press. 1064 p.
De todas las especies de gasterpodos
recolectados en el sistema lagunar, el 88% de los Margalef, R. 1980. Ecologa. Ediciones Omega S.
ejemplares fueron de C. stercusmuscarum. A. Casanova, Barcelona, Espaa, 961 p.
Prieto, A., L. Ruiz, y N. Garcia. 2005. Diversidad
AGRADECIMIENTO y abundancia de moluscos de la epifauna en la
Este trabajo fue financiado con recursos del comunidad sublitoral de Punta Patilla,
Proyecto Calidad ambiental de la baha de Altata Venezuela. Rev. Biol. Trop., Vol.53 (1-2): 135-
con base en la caracterizacin fisicoqumica del 140.
agua y la abundancia y distribucin de Prieto, A., S. Sant y E. Mendez. 2003. Diversidad
macroalgas y moluscos bivalvos. Clave: y abundancia de moluscos en las praderas de
FOMIX-GOBSIN-CONACYT-SIN-2005-CO1-13. Thalassia testudinum de la Baha de Mochima,
Tambin se agradece al Bilogo Andrs Garca Parque Nacional Mochima, Venezuela. Rev.
Garca de la Cooperativa Pesquera Procopio Biol. Trop., Vol.51 (2): 413-426.
Rubio Medina de Altata, por su colaboracin en Reygadas Dahl, F. & G. Velsquez-Ramrez.
los muestreos. 2005. Archaeology and ethnohistory of shellfish
exploitation in Baja California Sur, Mexico. En:
LITERATURA CITADA Archaeology without limits: papers in honor of
Brusca, C. R. 1980. Common Intertidal Clement W. Meighan, edited by Brian D. Dillon
Invertebrates of the Gulf of California 2nd. Ed. and Matthew A. Boxt, pp. 189-204. Labyrinthos,
Univ. Arizona Press. Tucson, Arizona. 512p. Lancaster, California.
Carvahlo, F. P, S. W. Fowler, F. Gonzlez-Faras,
L. D. Mee & J. W. Readman. 1996.
Agrochemical residues in the Altata-Ensenada
del Pabelln coastal lagoon (Sinaloa, Mexico):
a need for integrated coastal zone
management. International Journal of
Environmental Health Research, 6: 209-220.
Carvalho F. P., F. Gonzalez-Farias, J.
Villeneuve, C. Cattini, M. Hernandez-Garza, L.
D. Mee & S. W. Fowler. 2002. Distribution, Fate
and Effects of Pesticide Residues in Tropical
Coastal Lagoons of Northwestern Mexico.
Volume 23 (11): 1257-1270.
FAO. 1999 Gua FAO para la identificacin de
especies para los fines de la pesca. Pacifico
Centro-Oriental volumen 1: 1-340.
Green-Ruiz, C. y F. Pez-Osuna. 2001. Heavy
metal anomalies in lagoon sediments related to
intensive agricultura in Altata-Ensenada del
Pabelln coastal system (SE Gula of
California). Environment Internacional 26: 265-
273.

126
Macdonall-Reyes, P. A., R. M., Padrn-Lpez y L. J., Rangel-Ruiz. 2007. Uso de la almeja de agua dulce Lampsilis tampicoensis como biofiltro para la
remocin de coliformes en agua de pozo; estudio de laboratorio. pp 127-129. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara,
E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

USO DE LA ALMEJA DE AGUA DULCE Lampsilis tampicoensis COMO BIOFILTRO PARA LA


REMOCIN DE COLIFORMES EN AGUA DE POZO; ESTUDIO DE LABORATORIO

Macdonall-Reyes, Patricia de los Angeles, Padrn-Lpez, Rosa Martha, Rangel-Ruiz, Lus Jos
Laboratorio de Microbiologa. Divisin Acadmica de Ciencias Biolgicas, UJAT, km 0.5 carret.
Villahermosa-Crdenas, entronque a Bosques de Saloya. patymac08@hotmail.com.
Palabras clave: Almeja de agua dulce, Lampsilis tampicoensis, biofiltro, remocin, coliformes.

INTRODUCCIN 1992), coliformes totales (CT) y coliformes


Recientemente se han utilizado organismos fecales (CF) (NOM-112-SSA1-1994) se
como los moluscos (bivalvos) en la filtracin de realizaron cada dos horas.
aguas contaminadas, debido a la importancia que La colecta de almejas fue realizada en el
estos tienen en los sistemas naturales, al ser mes de Mayo del 2005, sobre el ro Naranjo,
organismos eficientes como bombeadores y ubicado en el Ejido Naranjo del municipio de
filtradores (Lara y Encina, 2000). Macuspana, Tabasco. Estas se mantuvieron por
Lampsilis tampicoensis (Lea, 1836) cuatro das, antes del experimento, en tinas
pertenece a la familia Unionidae, es una almeja comerciales con agua declorinada, con
de agua dulce en fondos limosos y arcillosos. temperaturas entre 27 y 30 C, con aireacin
Son larvparas y filtradoras. Se distribuye recirculable y alimentacin contina.
geogrficamente en el ro Pecos, Texas (EUA); El montaje del experimento se estableci
este y noreste de Mxico, ros Tampico y en forma individual durante 12 horas; cada
Medelln, y afluentes de los ros Grijalva y tratamiento consisti en diferentes densidades de
Usumacinta (Garca-Cubas, 1982). almejas: T1 (10 almejas), T2 (20 almejas) y T3 (30
El uso de almejas ha sido estudiado por almejas) y C (Control, agua de pozo sin almejas).
Lara et al. (2002) y Silverman et al. (1995) para la El agua utilizada en este estudio
eliminacin de microorganismos como bacterias provena de un pozo artesiano con
y virus. Se ha reportado diferencias en la concentraciones de coliformes fecales de 24,000
eficiencia de remocin de estos agentes NMP/100ml. El recuento bacteriolgico promedio
microbianos dependiendo de la familia y de la en el agua de los tratamientos se compar con
especie estudiada. Bajo este contexto, este relacin al control (tinas sin almejas) en cada
investigacin se realiz con la finalidad de lapso de tiempo, mediante la prueba de Kruskall-
obtener informacin a cerca de la capacidad de Wallis (p0.05), con el paquete estadstico
filtracin de la almeja de agua dulce (L. Statgraphic Plus.
tampicoensis) bacterias coliformes, presentes en
agua de pozo artesiano, para poder utilizarla RESULTADOS Y DISCUSIN
como una nueva alternativa para la purificacin Coliformes totales (CT). En el T1 la concentracin
de aguas con contaminacin bacteriolgica. inicial de CT al inicio del experimento fue de
Lampsillis tampicoensis puede ser de suma 21,000 CT/100 ml, concentraciones promedio
importancia ecolgica en la filtracin en similares se presentaron hasta la cuarta hora,
ecosistemas acuticos, para tratamientos de incrementndose hasta 117,467 CT/100 ml a las
purificacin o como indicador temporal en 12 hrs (Fig. 1).
programas de monitoreo de calidad ambiental en
sistemas acuticos contaminados con bacterias 1,000,000
coliformes. 100,000
N M P/1 0 0 m l

10,000
MATERIALES Y MTODOS 1,000
Se estableci un diseo experimental con tres 100
tratamientos y un testigo con tres rplicas cada 10
uno. Para ello se utilizaron tinas de plstico con 1
30 litros agua de pozo, las cuales contenan 0 2 4 6 8 10 12
Hrs
almejas en densidades de 10, 20 y 30 individuos
con tamao promedio de 6.3 cm de largo y 4.1 de T1 C1

ancho.
El estudio se desarrollo en un trmino de Fig. 1. Valores de CT en T1 comparado con el control
12 horas y los monitoreos para los parmetros:
pH, slidos totales, turbiedad, color (APHA,

127
Estudios sobre Malacologa y Conquiliologa en Mxico

El tratamiento con 20 almejas (T2), 100,000

mostr un valor de 12,467 CT/100 ml al inicio del 10,000


experimento con un incremento gradual a partir

NM P /100 m l
1,000
de ese momento hasta la hora seis que registro
100
el valor mas alto, 162,133 CT/100 ml. C2
present cargas bacterianas inferiores a T2 y el 10

valor mximo que mostr fue de 46,000 CT/100 1

ml (Fig.2). 0 2 4 6 8 10 12
Hrs
T1 C1
1,000,000
100,000
Fig. 4. Valores de CF en T1 comparado con el control
NM P /100 m l

10,000
1,000
1,000,000
100
100,000
10

NM P /100 m l
10,000
1
0 2 4 6 8 10 12 1,000
Hrs 100
T2 C2 10
1
Fig. 2. Valores de CT en T2 comparado con el control 0 2 4 6 8 10 12
Hrs
La carga inicial de T3 fue de 496,667 T2 C2

CT/100 ml y el valor mas bajo alcanzado fue de Fig. 5. Valores de CF en T1 comparado con el control
6,733 CT/100 ml logrado justamente a las ocho
1,000,000
horas. Posteriormente se hallo un ligero
100,000
incremento de CT para la dcima hora de
N M P /1 0 0 m l

10,000
muestreo, para volver a descender a las doce
1,000
horas a 46,200 CT/100 ml. En C3 se observ un
100
patrn similar al observado en T3, pero con
10
valores de CT inferiores y un incremento en la
1
ltima hora muestreada (Fig. 3).
0 2 4 6 8 10 12
Hrs
1,000,000 T3 C3
100,000
Fig. 6. Valores de CF en T3 comparado con el control
NMP /100 m l

10,000
1,000
100
El T3 registr las mayores
10 concentraciones de CF comparadas con T1 y T2.
1 La concentracin inicial de CF en T3 fue de
0 2 4
Hrs
6 8 10 12 166,667 CF/100 ml para despus disminuir el
contenido a 6,000 CF/100 ml a las 8 horas del
T3 C3
estudio. Sin embargo, en los dos muestreos
Fig. 3. Valores de CT en T3 comparado con el control
posteriores el contenido de CF fue variable, con
Coliformes Fecales (CF). El comportamiento de un incremento en la siguiente hora, para al final
T1 (10 almejas) indic fluctuaciones hasta la disminuir. En C3 siempre mostr cifras de CF
sexta hora, etapa del experimento en la que se inferiores al T3. (Fig. 6).
manifest una reduccin de CF en el agua de La concentracin y el comportamiento de
2,600 CF/100 ml, en las horas posteriores los CF las bacterias CT y CF en T1, T2 y T3 fueron
se incrementaron hasta 74,133 CF/100 ml. Las similares, con un patrn discontinuo que mostro
concentraciones de CF encontradas en C1 en incrementos y reducciones a diferentes tiempos.
general fueron inferiores a las de T1 (Fig. 4). El anlisis estadstico no mostr diferencias entre
Al inicio del experimento el T2 cont con los tres tratamientos ni entre estos y el control (P
un valor inicial de CF de 4,967 CF/100 ml y a las 0.05).
seis horas el nmero de bacterias haba Los parmetros fsico-qumicos (tabla.1)
alcanzado los 154,633 CF/100 ml, con un evaluados para cada tratamiento, no tuvieron
descenso en las horas posteriores a 10,333 CF influencia sobre la capacidad de filtracin de L.
/100 ml. Los valores obtenidos de CF en T2 tampicoensis en el agua de pozo; dado que no
fueron superiores a los registrados en C2 (Fig. 5). presentaron diferencias significativas entre las

128
Estudios sobre Malacologa y Conquiliologa en Mxico

variables de CT y CF con las variables de acceso a excavar en el sustrato, por estar sujetos
turbiedad, color y pH. a alteraciones qumicas o mecnicas (Kryger y
Riisgard, 1988), en donde la temperatura del
Tabla. 1 Correlacin de valores Fsico-Qumicos con agua, el tamao y concentracin de la partcula,
los tratamientos. el rgimen de flujo de agua, el tamao del bivalvo
y la morfologa de las branquias, son
TURBIEDAD pH ST
determinantes en la tasa de filtracin (Vaughn y
CT (T1) -0,620259 0,254402 0,172051
Hakenkamp, 2001).
CF (T1) -0.524774 0,194743 -0,21075
CT (T2) -0,181863 -0,023503 -0,516991 LITERATURA CITADA
CF (T2) -0,21037 -0,047817 -0,547533 APHA, AWWA, WPCF. 1992. Mtodos
CT (T3) 0,25782 -0,201105 0,166393 normalizados para el anlisis de aguas
CF (T3) -0,271182 0,201398 0,569301 potables y residuales. Ed. Daz de Santos.
Madrid. 2:4-85.
Los resultados anteriores demuestran DOF. 1994. NOM-112-SSA1. Bienes y servicios.
que no se obtuvo una remocin bacteriana Determinacin de bacterias coliformes. Tcnica
evidente, esto puede ser consecuencia de que L. del nmero ms probable.
tampicoensis presenta branquias Garca-Cubas, A. 1982. Moluscos de un sistema
eulamelibranquiadas y sus sifones son muy lagunar tropical en el sur del Golfo de Mxico
cortos y no tubulares (Jessop, 1990). Esta (Laguna de Trminos, Campeche). Instituto de
especie se caracteriza por presentar un sifn Ciencias del Mar y Limnologa. Mxico. 181 p.
ventral frecuentemente incompleto (Garca- Jessop, M. N. 1990. Zoologa de Invertebrados.
Cubas, 1982), y al ser incompleto la presencia de Ed. Interamericana McGraw-Hill. 294 pp.
cilios se ve reducida tambin, impidiendo Kryger, J. & H. U. Riisgard. 1988. Filtration rate
probablemente la capacidad para atraer clulas capacities in six species of European
bacterianas, como sucedi en este estudio. freshwater bivalves. Oecologia, 77: 34-38.
Por otra parte, el tamao de las Lara, G., A. Contreras y F. Encina. 2002. La
branquias (Payne et al., 1995) y la complejidad almeja de agua dulce Diplodon chilensis
de los cilios en las branquias (Silverman et al., (Bivalvia:Hyriidae) potencial biofiltro para
1997) son factores que influyen en la capacidad disminuir los niveles de coliformes en pozos.
de filtracin de los bivalvos, esto concuerda con Experimento de laboratorio. Univ. de
lo realizado por Silverman et al., (1995) al Concepcin. Facultad de Ciencias Naturales y
comparar la capacidad de filtracin de E. colli tres Oceanogrficas. Gayana (Concepc.), vol. 66
especies de almejas; Dreissena polymorpha, (2): 107-112.
Corbicula fluminea y Carunculina texasensis, Payne, B. S., J. Lei, A.C. Miller & E. D. Hubertz.
donde se demostr que la habilidad de filtracin 1995. Adaptive variation in palp and gill size of
de estas especies estaba relacionada con la the zebra mussel (Dreissena polymorpha) and
estructura de los cirros en las clulas latero Asian clam (Corbicula fluminea). Canadian
frontales de las branquias. La especie Journal of Fisheries and Aquatic Sciences, 52:
Carunculina texasensis (especie de la familia 1130-1134.
Unionidae) presentaba pocos y pequeos cirros, Silverman, H., E. E. Archberger, J. W. Lynn & T.
cada cirro con placas con 12 o 13 cilios que H. Dietz. 1995. Filtration and utilization of
limitaban la habilidad de capturar E. coli; laboratory-cultured bacteria by Dreissena
comparados con los de Corbicula (familia polymorpha, Corbicula fluminea and
Corbiculidae) que presenta de 32 a 33 cilios Carunculina texasensis. Biological Bulletin,
fusionados en cada cirro y Dreissena (familia 189: 308-319.
Dreissenidae) de 38 a 42 similares en longitud. Silverman, H., S. J. Nichols, J. S. Cherry, E.
En este sentido, los resultados obtenidos Archberger, J. W. Lynn & T. H. Dietz. 1997.
concuerdan con el trabajo anteriormente citado Clearance of laboratory-cultured bacteria by
ya que Lampsilis tampicoensis pertenece a la freshwater bivalves: differences between lentic
misma familia de Carunculina texasensis y and lotic unionids. Canadian Journal of
comparten las mismas caractersticas Zoology, 75: 1857-1866.
branquiales. Vaughn, C. C. & C. C. Hakenkamp. 2001. The
Los ndices de filtracin por los bivalvos functional role of burrowing bivalves in
en experimentos realizados bajo condiciones no freshwater ecosystems. Freshwater Biology,
naturales han sido obstaculizados por no tener 46: 1431-1446.

129
Aguilar-Ramrez, M. B., R. A., Chan-de la Rosa, A., Falcn-Alcntara y E. P., Heimer-de la Cotera. 2007. Hidroxiprolina y un arreglo de Cistenas
semejante al de las O-Conotoxinas en Pptidos del veneno del caracol trrido polystira albida. pp 130-131. En: Estudios sobre la Malacologa y
Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

HIDROXIPROLINA Y UN ARREGLO DE CISTENAS SEMEJANTE AL DE LAS O-CONOTOXINAS EN


PPTIDOS DEL VENENO DEL CARACOL TRRIDO Polystira albida

Aguilar-Ramrez, Manuel B.1, Chan-de la Rosa, Ruby A.2, Falcn-Alcntara, Andrs1 y Heimer-de la
Cotera, Edgar P.1
1
Laboratorio de Neurofarmacologa Marina, Instituto de Neurobiologa, Universidad Nacional
Autnoma de Mxico, Juriquilla, Qro. 2Instituto Tecnolgico de Mrida, Mrida, Yuc.
maguilar@servidor.unam.mx.
Palabras clave: Conoidea, Turridae, Polystira albida, hidroxiprolina, O-conotoxinas.

INTRODUCCIN
La superfamilia Conoidea est formada por ms
de 10,000 especies de caracoles marinos
depredadores venenosos, e incluye a las familias
Conidae, Turridae y Terebridae (Figura 1). Los
miembros de las familias Terebridae y Turridae
se alimentan de gusanos, mientras que los de la
familia Conoidea son cazadores de gusanos,
moluscos y peces. Las toxinas producidas por las
500 especies del gnero Conus (nico de la
familia Conoidea), las conotoxinas, son
generalmente pptidos cortos con varios puentes
disulfuro y diversas modificaciones Figura 1. Superfamilia Conoidea.
postraduccionales. Las conotoxinas son usadas
principalmente para capturar a las presas,
aunque tambin pueden servir para propsitos de Conantoquinas no C
defensa o de competencia. Estos pptidos Contulaquinas no C
afectan canales inicos (de sodio, potasio y
calcio) activados por voltaje o por ligando, Conorfamidas no C
receptores acoplados a protenas G y Conopresinas C-C
transportadores de neurotransmisores. Debido a Contrifanos C-C
la alta afinidad y especificidad por sus blancos Superfamilia A CC-C-C
moleculares, varias conotoxinas estn siendo CC-C-C-CC
usadas como herramientas moleculares, agentes
diagnsticos, frmacos, y modelos para el diseo Superfamilia T CC-CC
de frmacos. Las conotoxinas han sido CC-CPC
clasificadas en superfamilias genticas y en Superfamilia J C-C-C-C
familias farmacolgicas de acuerdo con la Superfamilia O C-C-CC-C-C
secuencia de sus pptidos seal y con sus Superfamilia M CC-C-C-CC Superfamilia
blancos moleculares, respectivamente. Se ha
encontrado una relacin entre las superfamilias P C-C-C-C-C-C Superfamilia I
genticas y los arreglos de cistenas (Figura 2). A C-C-CC-CC-C-C
partir del veneno del terbrido Terebra subulata Superfamilia S C-C-C-C-C-C-C-C-C-C
han sido aisladas tres "augertoxinas" similares a
las O- e I-conotoxinas, sin otras modificaciones Figura 2. Superfamilias genticas y arreglos de
postraduccionales que los puentes disulfuro cistena (C) de conotoxinas y conopptidos. -
(Imperial et al., 2003). En el veneno de los indica uno o ms residuos distintos de C.
trridos Gemmula periscelida y Polystira albida
fueron descubiertas turritoxinas largas con alto MATERIALES Y MTODOS
contenido de metionina (Lpez-Vera et al., 2004). Los conductos venenosos de 10 especmenes de
Dada la relacin filogentica cercana entre los Polystira albida fueron disecados y usados para
trridos, cnidos y terbridos, el objetivo de este preparar un extracto crudo, el cual fue
trabajo fue encontrar pptidos parecidos a las fraccionado por cromatografa de lquidos de alta
conotoxinas en el veneno del trrido Polystira resolucin en fase inversa RP-HPLC (C18). Tres
albida. pptidos fueron repurificados mediante RP-HPLC
(C18 y C8).

130
Estudios sobre Malacologa y Conquiliologa en Mxico

Debido a la pequea cantidad de los Recientemente, mRNAs que codifican


pptidos, fueron sometidos a la degradacin de pptidos parecidos a las O-, P- e I-conotoxinas, y
Edman automtica sin reduccin de los puentes otros pptidos con alto contenido de cistena han
disulfuro y alquilacin de las cistenas. sido encontrados en el trrido Lophiotoma
Para la comparacin de secuencias se us el olangoensis Olivera 2002 (Watkins et al., 2006).
programa CLUSTAL W (V 1.83) con los valores Pa3 es ms similar a algunas O-conotoxinas (-,
estndares. - y -conotoxinas) que a las turritoxinas Lol 6.1 y
Lol 6.2, las cuales son semejantes a las O-
RESULTADOS Y DISCUSIN conotoxinas (Figura 5).
Tres pptidos fueron purificados a partir de tres
picos de absorcin del extracto crudo (Figura 3). -PnVIIA 9
s7a 11
Lol 6.1 11
Lol 6.2 14
O-MrVIA 16
s6a 17
-PVIIA 18
-EVIA 18
-SVIA 29
vx6a 29

Figura 5. Porcentajes de identidad entre Pa3 y O-


conotoxinas y otros pptidos de Conoidea
semejantes a las O-conotoxinas.

AGRADECIMIENTOS
Figura 3. Fraccionamiento del extracto crudo de
A Pilar Galarza, Alberto Lara y Omar Gonzlez.
los conductos venenosos de Polystira albida.
Proyecto apoyado por PAPIIT-UNAM (IN206701
e IX211904) y CONACYT (41477-Q).
La secuenciacin automtica de los
pptidos purificados (Pa1, Pa2 y Pa3) indica que
las tres turritoxinas parecen contener mltiples LITERATURA CITADA
cistenas, como la mayora de las conotoxinas y Imperial, J. S., M. Watkins, P. Chen, D. R.
todas las augertoxinas caracterizadas hasta la Hillyard, L. J. Cruz & B. M. Olivera. 2003. The
fecha (Figura 4). augertoxins: biochemical characterization of
venom components from the toxoglossate
Pa1: YGDSVTSDECQTISCYEAHVGOVCQOGEYD... gastropod Terebra subulata. Toxicon 42: 391-
398.
Pa2: ECTPVHFSCTCTGLE...
Lpez-Vera, E., E. P. Heimer de la Cotera, M.
Pa3: NVCDGDACPDGVCCSGCTTDFNVAQRKDTCFYPQ... Maillo, J. R. Riesgo-Escovar, B. M. Olivera, &
M. B. Aguilar. 2004. A novel structural class of
Figura 4. Secuencias parciales de los tres toxins: the methionine-rich peptides from the
pptidos purificados. C, C probable; O, hidroxi-P. venoms of turrid marine snails (Mollusca,
Conoidea). Toxicon 43: 365-374.
Dentro de Conoidea, Pa1 es el primer Watkins, M., D. R. Hillyard & B. M. Olivera. 2006.
pptido no proveniente de Conus en el que se ha Genes expressed in a turrid venom duct:
demostrado la presencia de hidroxiprolina. Este divergence and similarity to conotoxins. J. Mol.
hallazgo sugiere que la hidroxilacin de prolina Evol. 62: 247-256.
ya ocurra en el veneno del ancestro comn de
las familias Conidae, Turridae y Terebridae.
Pa3 tiene un arreglo de cistenas similar
al de las O-conotoxinas y al de las augertoxinas
s6a y s7a (Figura 2). Este descubrimiento
sugiere que el ancestro comn de las familias
Conidae, Turridae y Terebridae expresaba
toxinas similares a las O-conotoxinas.

131
Pelez-Zarate, V. A. y J. A., Faras-Snchez. 2007. Deteccin de microncleos en hemocitos de mytella strigata (Hanley, 1843): (Mollusca:
Bivalvia), provenientes del estero de Uras, Mazatln, Sinaloa, Mxico. pp 132-134. En: Estudios sobre la Malacologa y Conquiliologa en Mxico.
Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

DETECCIN DE MICRONCLEOS EN HEMOCITOS DE Mytella strigata (HANLEY, 1843):


(MOLLUSCA: BIVALVIA), PROVENIENTES DEL ESTERO DE URAS, MAZATLN, SINALOA,
MXICO

Pelez-Zarate, Vctor Arturo1 y Faras-Snchez, Jos Antonio2


Facultad de Ciencias del Mar, UAS 1. Instituto Tecnolgico de Mazatln 2. victorpelaez@yahoo.com,
tonyfar@hotmail.com.
Palabras clave: Hematocitos, Mytella strigata, Estero de Uras, Sinaloa.

INTRODUCCIN aumento de 400x se hizo de acuerdo al mtodo


El mejilln Mytella strigata y el ostin de Al Sabti (1991) contando el total de los
Crassostrea corteziensis se han empleado para ncleos presentes y luego el nmero de aquellos
el estudio y monitoreo de la contaminacin del con al menos un microncleo asociado sin que
Estero de Uras aplicando tcnicas se contabilizaran el resto, en caso de existir
convencionales para la deteccin de metales mas ubicados perifricamente al ncleo ya
pesados y pesticidas en (Paez-Osuna y considerado. Se calcul en forma de ndice la
Marmolejo-Rivas, 1990). Recientemente se han frecuencia de clulas micronucleadas mediante
aplicado tecnicas citogenticas para determinar la siguiente expresin:
el dao en bivalvos que han sido expuestos a ndice de clulas micronucleadas (ICM)
diferentes contaminantes (Majone et al., 1988; (%) = (nmero de ncleos con microncleo /
Chavez-Rosas, 1992; Burgeot et al., 1996; nmero total de ncleos observados) X 100.
Vernier, et al., 1997; Carvhalo et al., 2003; Para conocer la relacin del tamao relativo
Koukouzika y Dimitriadis , 2005) sin embargo no (Mn/N) de los microncleos (Mn) respecto al de
existe antecedente alguno de su utilizacin en los ncleos celulares (N), se midieron los
mejillones estuarios, por lo tanto el objetivo del dimetros de ambas estructuras con un
presente trabajo fue determinar la viabilidad de microscopio ptico binocular Rossbach integrado
la aplicacin de la prueba de microncleos (MN) con un lente ocular 10X dotado con micrmetro
en hemocitos del mejilln , M. strigata, para la filiar de graduacin de 0-100 y previamente
deteccin de la presencia de genotxicos en el calibrado para su uso con un lente objetivo de
Estero de Uras. 100X.
Para comprobar preliminarmente la
MATERIALES Y MTODOS efectividad del Mtodo de Microncleos
Cada colecta de aproximadamente 300 modificado de Al-Sabti (1991), de un lote de
mejillones (M. strigata) se hizo manualmente y aproximadamente 100 organismos se
desprendiendo cuidadosamente de los racimos seleccionaron aleatoriamente 3 mejillones
de mejillones adheridos a las races areas del peridicamente en intervalos irregulares de 3 a 6
mangle rojo Rizophora mangle Simultneamente das, para la determinacin de su ICMn . Para
durante cada colecta se registr in situ la comprobar la existencia de un proceso de
salinidad y temperatura del agua con un purificacin en los mejillones despus de su
refractmetro ATAGO y un termmetro de introduccin a un sistema con agua limpia, de un
mercurio respectivamente. Del lote colectado, lote de aproximadamente se introdujeron en tres
fueron seleccionados aquellos que tuvieran una acuarios provistos con las caractersticas
longitud total promedio mayor a los 30 mm, la previamente descritas, 30 mejillones por unidad,
cual se determin su longitud total empleando un con longitud entre 38 y 40 mm. El ICMn fue
calibrador de plstico (+ 0.01 mm). determinado cada 6 das a tres organismos por
Posteriormente se introdujeron en acuarios acuario seleccionados aleatoriamente.Este
provistos de agua marina filtrada, aireacin y con experimento fue repetido nuevamente con la
una salinidad promedio de 28 ppm y una diferencia de que el ICMn fue determinado cada
temperatura de 24 C. alimentndose ad libitum tres das por un periodo de 28 das. Se realizaron
con una mezcla de la microalga Chaetoceros dos experimentos de induccin de microncleos
spp. y un micronizado de la macroalga Ulva en mejillones transplantados dentro del Estero de
lactuca. Uras, previamente sometidos al proceso de
La obtencin, tincin con GIEMSA purificacin en condiciones de laboratorio
AZUR-B y conteo de los microncleos de los descrito anteriormente y a una prueba de
hemocitos de M. strigata empleando un refijacin como indicadora de su estado de salud
microscopio ptico binocular Rossbach con un (Mersch y Beauvais, 1997).

132
Estudios sobre Malacologa y Conquiliologa en Mxico

En el primer experimento se llenaron 8 e introduccin en un sistema de mantenimiento


costales de nylon con 80 mejillones cada uno. con agua limpia.
Cuatro de ellos fueron suspendidos de una boya
en el canal de navegacin en la zona intermedia Mn %
20

del estero Estero de Uras, frente a las 15


16.3
14.0
instalaciones del Tecnolgico de Mazatln 10 10.8

(Estacin A) y los cuatro restantes fueron 5


6.5

suspendidos de una cuerda que cortaba 0 5.3

transversalmente de lado a lado el canal de 8/4 10/4 12/4 14/4 16/4 18/4 20/4

llamada dentro de las instalaciones de la granja Fecha ao 2000


camaroncola Don Jorge localizada en el fondo
del estero (Estacin B). El ICMn fue
determinado cada 7 das en organismos de cada Figura 2. Valor promedio del IMn obtenido cada 3 das de los
mejillones M. strigata durante el segundo periodo de
estacin. En el segundo experimento purificacin.
esencialmente se sigui el procedimiento descrito
para el primero, con la nica diferencia de que Con los valores mnimos obtenidos de
los organismos fueron introducidos en jaulas de los experimentos se determin la existencia de
0.25 m3, hechas de varilla y malla galvanizada una lnea base con un valor promedio de 3.4 %,
para gallinero, de luz de 10 mm, de tal manera similar a lo reportado par los bivalvos; Mytilus
que los mejillones estuvieran protegidos de los edulis, Mytilus californianus, Dreissenia
abundantes depredadores existentes como polymorpha y Crassotrea gigas (Chvez Rosas,
jaibas y peces. Previa normalizacin de los 1992; Wrisberg y Van der Gaag, 1992; Burgeot et
valores obtenidos del ICMn mediante una al., 1996; Mersch y Beuavais, 1997).
transformacin ArcoSeno se realizaron las El tamao relativo de los microncleos
comparaciones respectivas mediante una prueba observados en las muestras analizadas fue entre
t de Student con un nivel de confianza del 95% 1/4 y 1/6 del tamao de los ncleos, valores
(Zar, 1986). dentro del rango reportado para peces (Al Sabti
,1991) y compatible con el de 1/5, para el
RESULTADOS Y DISCUSIN mejilln de agua dulce, Dreissenia polymorpha
La primera aplicacin y adaptacin del Mtodo de (Mersch y Beauvais, 1997).
Al Sabti (1991) fue positiva logrndose observar Los organismos empleados en los
en los valores una tendencia a la disminucin de experimentos de induccin presentaron valores
los valores IMn registrados en intervalos de de refinacin superiores al 83% y una
tiempo irregulares. supervivencia mayor del 90%, considerados
Dicha tendencia, se confirm en la como buenos indicadores de vitalidad (Mersh y
segunda corrida experimental, en que los valores Beauvais, 1997).
obtenidos de cada seis das cuyos valores se Los valores registrados de ICMn en los
ajustaron a una curva de tipo exponencial: mejillones M. strigata a partir de su trasplante
y = 25.234e-0.0804x (p<0.05; r= 0.9850). Se en los Experimentos 1 y 2, en las estaciones A y
detect una diferencia significativa (p<0.05) entre B se encuentran resumidos en la Tabla 1.
los valores del IMn registrados entre el primer y Tanto en el caso del primer experimento
sexto da, sugiriendo que el proceso de como el del segundo, se puede observar en la
purificacin ya haba iniciado de manera efectiva Tabla 1 que en ambas localidades se dio un
durante este intervalo de tiempo. incremento significativo (p<0.05) entre los valores
El proceso de purificacin fue confirmado iniciales y los registrados a los 7 das de su
en el tercer experimento como se puede observar introduccin, probando el inicio efectivo del
en el patrn decreciente mostrado por los proceso de induccin de microncleos al
valores del IMn (Fig. 2). El incremento en el introducirlos al medio natural y
ltimo punto (6.5%) se podra atribuir a un error consecuentemente estableciendo la posible
de procesamiento ms que a una razn existencia de genotxicos en el agua del estero y
Fisiolgica. las instalaciones de la granja camaroncola. Los
Se encontr una diferencia significativa valores en el segundo experimento de induccin
entre el valor inicial del IMn y el correspondiente tienden a alcanzar su mximo antes de los 30
al tiempo de colecta por tanto se concluy que das, mostrando un patrn similar al encontrado
ese periodo es el tiempo mximo recomendable para Mytilus galloprovinciallis a las tres semanas
para procesar las muestras a partir de su colecta de haber sido trasplantados a un sitio

133
Estudios sobre Malacologa y Conquiliologa en Mxico

contaminado (Scarpato et al. ,1990). Los datos californianus (Conrad, 1983) de la baha de
obtenidos en el segundo experimento de la Todos Santos. Tesis Profesional. Universidad
estacin B, permitieron nuevamente su ajuste a Autnoma de Baja California. Facultad de
expresin de tipo exponencial ICMn = 4.5647e Ciencias: 95.
0.053 t
(r = 0.9400; p<0.05). Koukouzika , N. & V. K., Dimitriadis. 2005.
Multiple Biomarker Comparison in Mytilus
Tabla 1. Valores de Indice de Microncleos (ICMn) en galloprovincialis from the Greece Coast:
los mejillones M. strigata trasplantados en la zona Lysosomal Membrane Stability, Neutral Red
intermedia del Estero de Uras, frente a las Retention, Micronucleus Frequency and Stress
instalaciones del ITMAZ Estacin A y dentro del on Stress. Ecotoxicology, 14(4): 449 - 463
reservorio de la granja camaroncola Estacin B ,
despus de haber sido previamente purificados en
Majone, F.; Beltrame, C. & R. Brunetti. (1988).
laboratorio. Frecuencies of micronuclei detected on Mytilus
galloprovincialis by different staining techniques
Estacin after treatment with zinc chloride. Mutation
A Estacin B Research. 209: 131-134.
Fecha ICMn% E.S. + ICMn% *E.S. + Marmolejo-Rivas C. R. & O. F. Pez. 1990. Trace
Experimento 1 1-6-00 3.92 0.31 3.90 0.31 metals in tropical coast lagoon bivalves, Mytella
8-6-00 7.6 0.49 8.39 0.93 strigata. Bulletin Environmental Contamination
Fecha ICMn% E.S. + ICMn% *E.S. + and Toxicology. 45: 545-551.
Experimento 2 Mersch, J., & Beauvais, M.N. (1997). The
15-6-00 3.67 0.38 3.67 0.38 micronucleus assay in the zebra mussel,
23-6-00 6.57 0.75 7.85 0.49 Dreissena polymorpha, to in situ monitor
30-6-00 - - 14.2 0.74 genotoxicity in freshwater environments.
7-7-00 - - 13.2 0.68 Mutation Research and Genetic of Toxicology
14-7-00 - - 19.5 0.76 of Environmental Mutagenetic. Vol. 393 (1-2):
141-149.
Los resultados de la presente Paez-Osuna, F. & C. Marmolejo-Rivas, 1990.
investigacin aunados a los obtenidos de la Occurrence and seasonal variation of heavy
realizacin en el futuro, podran ratificar la utilidad metals in the oyster Crassostrea corteziensis.
del empleo de la tcnica de Microncleos, como Bulletin of Environment. and Toxicology., 45:
una herramienta prctica y econmica para 538-544.
identificar de manera preliminar la presencia de Scarpato, R., Migliore, L., Alfinito-Cagnetti, G.
contaminantes tal y como ha sido demostrado &Barale, R. 1990. Induction of micronuclei in
para mejillones y ostiones (Chvez, 1992; gill tissue of Mytilus galloprovincialis to polluted
Mersch y Beuavais, 1997), lo que permitira marine water. Marine Pollution Bulletin. 21: 74-
establecer un programa ms amplio, para la 80.
identificacin preliminar de aquellos ecosistemas Venier P., S., Maron & S., Canova. 1997.
estuarinos contaminados en la zona del Pacfico. Detection of micronuclei in gill cells and
haemocytes of mussels exposed to
benzo[a]pyrene. Mutation Research/Genetic
LITERATURA CITADA
Al-Sabti, K. 1991. Handbook of Genotoxic Efects Toxicology and Environmental Mutagenesis,
and Fish Chromosomes.ISBN86-80023-17-5. 390 (1): 33-44.Wrisberg, M. N., Bilbo, C. M. and
PP. 230. Jozef Stefan Institute, Jamova H. Spliid. 1992b. Induction of micronulei in the
39,61111 Ljubljana, Slovenia. hemocytes of Mytilus edulis and statistical
Burgeot, T. W. y F. Galgani, 1996. Evaluation of analysis. Ecotoxical. Environmental Safety. Vol.
the micronucleus test on Mytilus 23 (2): 191-205.
galloprovincialis for monitoring applications Wrisberg, M. N. & M.A. Vander Gaga. 1992c. In
along. French Coastal Marine Pollution Bulletin, vivo detection of genotoxicity of waste water
32: 39-46. from wheat and rye straw paper pulp factory,
Carvalho Pinto-Silva, C. R., J. F., Ferreira, R. H., Science Total Environmental. 121: 95-108.
Costa, P., Belli Filho, E. E., Creppy & W. G., Zar, H. J., 1984. Biostatistical Analysis. USA,
Matias, 2003. Micronucleus induction in Prentice Hall: 718 p.
mussels exposed to okadaic acid. Toxicon,
41(1):93-7.
Chvez-Rosas, L. 1992.Genotoxicidad en clulas
epiteliales del tubo digestivo de Mytilus

134
Estudios sobre Malacologa y Conquiliologa en Mxico

CULTIVO DE MOLUSCOS

135
Medina-Lpez A. G. y V., Koch. 2007. Cultivo experimental de almeja Catarina Argopecten ventricosus (Sowerby II, 1842) en dos reas naturales
protegidas del Golfo de California. pp 137-139. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez
y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

CULTIVO EXPERIMENTAL DE ALMEJA CATARINA Argopecten ventricosus (SOWERBY II, 1842)


EN DOS REAS NATURALES PROTEGIDAS DEL GOLFO DE CALIFORNIA

Medina-Lpez Alicia G. 1, Koch Volker 1


Departamento de Biologa, rea Interdisciplinaria de Cs. Marinas, Universidad Autnoma de Baja
California Sur. aliciamedinal@gmail.com, vokoch@uabcs.mx.
Palabras clave: Argopecten ventricosus, cultivo de pectinidos, desarrollo sustentable.

INTRODUCCION realizado por pescadores de las zonas de estudio


En Baja California Sur (BCS) el 40% del territorio cada 14 das.
son reas Naturales Protegidas (ANPs). Dentro La supervivencia se determin
de su marco de manejo existen varios programas mensualmente a travs de conteos de
enfocados al desarrollo econmico de las organismos vivos y muertos en cada rplica por
comunidades ribereas. Una de las principales sistema; con el nmero de organismos muertos y
pesqueras en el estado de BCS catarina el total de organismos de cada mes se determin
(Argopecten ventricosus) (Mazn-Sustegui, el porcentaje de supervivencia y supervivencia
1996), representa el 54.5% del total de la acumulada, con las formulas de Taylor et al
pesquera de almejas a nivel nacional. Debido a (2006). Se realizaron biometras mensuales para
la explotacin intensiva, varios bancos determinar el desarrollo gondico y el crecimiento
colapsaron, como los de Baha Concepcin y del msculo aductor callo, El ndice gondico
Baha de La Paz (Flix-Pico et al., 1997), los (IG) y el ndice del rendimiento del msculo
cuales hasta la fecha no se han recuperado. Los aductor (IRM), se obtuvieron dividiendo el peso
cultivos de moluscos representan bajo impacto del msculo y el peso de la gnada, entre el peso
ambiental en comparacin con cultivos de peces total sin concha, multiplicado por 100.
o camarn, en relacin a los nutrientes vertidos al Se estimo la concentracin de seston
mar (Qian et al., 2001), adems se obtiene un orgnico filtrando agua a travs de filtros de fibra
beneficio ecolgico, contribuyendo a la de vidrio (Whatman GF/C), de 47 mm de
recuperacin o al mantenimiento de los bancos dimetro, siguiendo la metodologa de Strickland
naturales de manera conservativa y sustentable y Parson (1972). La concentracin de clorofila a
(Stotz y Mendo, 2001), fomentando as un se determino con muestras de 1L de agua de
desarrollo sustentable en la zona. mar usando la metodologa descrita por
El objetivo principal de este trabajo es Strickland y Parson (1972) mediante
evaluar el crecimiento y supervivencia de A. espectrofotometra con acetona al 90%,
ventricosus en dos ANPs para proponer el utilizando las formulas de Scor/UNESCO. Se
desarrollo de actividades comerciales alternas a instalaron medidores de temperatura (Stowaway
la pesca en estas comunidades, que brinden tidbit, OnsetMR), a nivel superficial y en el fondo,
estabilidad econmica en estas comunidades para obtener la temperatura diaria. La
ribereas. concentracin de O2 se determin mediante el
mtodo de winkler utilizando paquetes de anlisis
MATERIAL Y METODOS para campo (LaMotte, Modelo EDO), y la
La semilla de almeja catarina se produjo bajo salinidad se registr mensualmente con un
condiciones controladas de temperatura y refractmetro porttil.
alimento en el laboratorio de Acuacultura de la
UABCS, siguiendo la metodologa descrita por
Maeda-Martnez et al., (1995). Al alcanzar una
talla aproximada de 2-3mm, se transporto la
semilla a los sitios de cultivo (Figura1) en
ambiente hmedo y fro, Maeda-Martnez et al.,
(2000b). El cultivo se realiz en dos sistemas: en
suspensin con canastas NestierMR y en fondo
con costales ostrcolas. Se mantuvo una
cobertura del 50% con respecto al rea de los
sistemas y el tamao los organismos, se Figura 1. Sitios de cultivo. A) Isla Danzante. B) Islote El
realizaron desdobles para mantener la densidad. Pardito, al sureste de la Isla San Jos.
El mantenimiento y cuidado del cultivo fue

137
Estudios sobre Malacologa y Conquiliologa en Mxico

RESULTADOS Y DISCUSIN tempertaruras al final del cultivo, ocasionaron un


En ambos sitios y sistemas de cultivo se alto ndice de mortalidad (Figura 3).
present el mismo patrn de crecimiento. En los
primeros meses hubo un rpido crecimiento,
seguido de un crecimiento lento e incluso con
cierto detenimiento durante los meses de
verano (Figura 2). Este patrn es similar al que
presentan otras especies de pectnidos. y
bivalvos en general donde se muestra un
acelerado crecimiento en la etapa juvenil con
una reduccin en etapas posteriores (Koch et
al., 2005). En ambas localidades el crecimiento
exponencial se dio durante la etapa juvenil con
temperaturas bajas (18-20C), cerca de la
temperatura ptima de la especie (20C,
Sicard et al., 1999), bajo alta concentracin de
alimento (concentracin de Chl a) en el agua. La
reduccin en las tasas de crecimiento fue en
verano, altas temperaturas (27-30C) y menor
concentracin de alimento. Esta reduccin
tambin ha sido observada en otras especies de
bivalvos y se ha relacionado con el incremento
de temperatura, al desarrollo gondico (Taylor
et al., 2006) y baja concentracin de alimento.
Las diferencias significativas entre las curvas de
crecimiento indican una desigualdad en las Figura 3. Supervivencia acumulada en los sistemas
condiciones abiticas como profundidad, de cultivo con intervalo de confianza en: a) Localidad
temperatura y disponibilidad de alimento, tanto Danzante b) Localidad El Pardito.
entre localidades como entre los sistemas de
cultivo. Esta falta de alimento se observ a
En ambas localidades de cultivo los finales del 2005 y en verano 2006, provocando
valores mas altos de supervivencia se estados de inanicin, limitando el aporte
registraron en el sistema de suspensin (Fig. 3), energtico necesario para el crecimiento
en Isla Danzante 78.4% 11.95 y en el pardito reflejado en la superviviencia. Esto se corrobora
86.6% 5.88, mientras en fondo en el pardito con la baja concentracin de seston orgnico y
clorofila a en estos periodos. A. ventricosus es
fue de 70.2% 9.4, en Danzante fue 3.7%
considerada una especie precoz, ya que llega a
8.4. En el sistema en fondo en Isla Danzante
la madurez sexual a una talla de 3-4 cm
durante los meses de octubre de 2005 a enero
(Villalejo-Fuerte y Ochoa-Bez, 1993), mucho
de 2006 se observ una gran cantidad de arena
antes de haber alcanzado la talla comercial de 6
y sedimentos en el sistema de cultivo, as como
cm, al aumentar su desarrollo gondico se
la mayor presencia de depredadores como
deteniene su desarrollo somtico, retrazando la
pulpos, gasterpodos y nudibranquios dentro de
fecha de cosecha; esto se observ mas en la
los sistemas de cultivo. Es conocido que la
zona de Danzante, localidad en donde la talla y
temperatura es el factor abitico ms importante
la supervivencia fueron menores y el IG
y se considera como factor clave y determinante
presenta mas fluctuaciones. En la columna de
tanto del crecimiento como de la supervivencia;
agua el gradiente de temperatura y la
posee una fuerte influencia sobre la respiracin
concentracin de fitoplancton esta ligada en
y el balance energtico en bivalvos (Villalejo-
gran medida a la profundidad (Chouinard y
Fuerte y Ochoa-Bez, 1993; Flix-Pico et al.,
Swain, 2002); razn por la cual las diferencias
1997; Sicard et al., 1999 Maeda-Martnez et al.,
entre sistemas aun en la misma localidad.
2000; Navarro, 2001). En verano se reportaron
En el presente estudio los organismos
medias en la temperatura diaria, arriba de los
cultivados en suspensin presentaron mayor
30 C afectando la supervivencia, se han
tasa de crecimiento y supervivencia con
reportado mortalidades masivas a temperaturas
respecto a los organismos cultivados en fondo
mayores a los 30 C (Sicard et al. 1999). La poca
en ambas localidades. Finalmente los sitios de
disponibilidad de alimento y las altas

138
Estudios sobre Malacologa y Conquiliologa en Mxico

cultivo de este estudio, no son adecuados para population density and season on juvenile growth
el desarrollo de acuacultura de esta especie, si and mortality. Aquaculture res. 36, 505-512.
se espera obtener tallas de 6 cm, las Meada-Martnez, A. N., P., Monsalvo y T. Reynoso.
condiciones oceanogrficas y biolgicas no son 1995. Sistema para crianza intensiva en su etapa
juvenil de almeja catarina. Instituto Mexicano de la
ptimas para el rpido crecimiento de esta propiedad Industrial. Patente No. 180212.
especie. Se recomienda desarrollar cultivos Maeda-Martnez A. N., P., Ormart, L., Mndez, B. & M.
experimentales con otras especies de bivalvos T. Acosta, Sicard, 2000. Scallop grow out using a
de importancia comercial, para determinar la new bottom-culture system. Aquaculture 189:73-84.
viabilidad de estas zonas para el desarrollo de Maeda-Martnez A. N, M. T. Sicard & T. Reynoso-
acuacultura. Granados. 2000b. Shipment method for scallop
seed. J. Shellfish Res. 19, 765-770.
Suspension Fondo Mazn-Sustegui, J. M. 1996. cultivo de almeja
50 50
a) Danzante c) Danzante catarina Argopecten circularis (Sowerby). En:
40 40
Casas-Valdez M. y G. Ponce-Daz Ponce-Daz
Altura de la Concha (mm)

30 30
(Eds.), Estudio del potencial pesquero y acucola
20 20 del Estado de Baja California Sur, Mxico. Vol II:
Crecimiento mm
10
Curva VB
10 513-544.
0 0 Navarro J.M. 2001. Fisiologa energtica de pectnidos
50 0.0 0.4 0.8 1.2 50 0.0
1.6 0.4 0.8 1.2 1.6
b) El Pardito d) El Pardito
Iberoamricanos. En: Maeda-Martnez, A., (ed.)
40 40 2001 Los moluscos pectnidos de Iberoamrica:
30 30 Ciencia y Acuicutura. Ed. Limusa, Mxico. Cap 3:
20 20 61-76.
10 10 Qian P.Y., Wu, M.C., Ni, I.H., 2001. Comparison of
0 0 nutrient release among some mariculture animals.
0.0 0.4 0.8 1.2 1.6 0.0 0.4 0.8 1.2 1.6
Aquaculture 200:305-316.
Edad relativa (aos)
Sicard, M. T., A. N., Maeda-Martinez, P., Ormart, T.
Figura 2. Crecimiento de almeja catarina en los sistemas de
Reynoso-Granados & L. Carvalho 1999. Optimum
cultivo, cada punto corresponde a la talla promedio de las
almejas en cada localidad. Se ajust el crecimiento al
temperature for growth in the catarina scallop
modelo estacional de von Bertalanffy (valores, en tabla I). a) (Argopecten ventricosus-circularis, Sowerby II,
sistema de suspensin en Isla Danzante b) sistema de 1842). J. Shellfish Res. 18:385-392.
suspensin en El Pardito c) sistema en fondo en Danzante Strickland, J. D. & T. R., Parsons, 1972. A practical
d) sistema en fondo en El Pardito. handbook of seawater analysis. Fish Res. Bd.
Canada, Bull. 311 pp.
LITERATURA CITADA Stotz, W. y Mendo, J. 2001. Pesqueras, repoblamiento
Chouinard G. A. & D. P. Swain. 2002. Depth- y manejo de bancos naturales de pectnidos en
dependent variation in condition and length- at IBEROAMRICA: su interaccin con la acuicultura.
age of Atlantic cod (Gadus morhua) in the En: Maeda-Martnez, A., (ed.) 2001 Los moluscos
sounthern Gulf of St. Lawrence. Can. J. Fish. pectnidos de Iberoamrica: Ciencia y Acuicultura.
Aquat. 59: 1451-1459. Ed. Limusa, Mxico, Cap 18:357-371.
Flix-Pico, E. F., Tripp-Quezada, A., Castro-Ortiz, J. Taylor, M., V., Koch, M., Wolff & F. Sinsel. 2006.
L., Serrano-Casillas, G., Gonzlez-Ramirez, P. G., Evaluation of different shallow water culture
Villalejo-Fuerte, M., Palomares-Garcia, R., Garcia- methods for the scallop Nodipecten subnodosus
Dominguez, J. M. Mazn-Sustegui, G. using biologic and economic modeling. Aquaculture
Bojorquez-Verastica & G. Lpez-Garca. 1997. 254:301-316.
Repopulation and culture of the pacific calico Villalejo-Fuerte, M. y R. I., Ochoa-Baez. 1993. El ciclo
scallops in Baha Concepcin, Baja California Sur, de reproductivo de la Almeja Catarina,
Mxico. Aquaculture inter. 5,551-563 Argopecten circularis (Sowerby, 1835), en
Koch, V., J. M., Mazn-Sustegui, F., Sinsel, M., relacin con temperatura y fotoperodo, en Baha
Robles-Mungaray & D. Duna. 2005. Lions paw Concepcin, B.C.S., Mxico. Cs Marinas 19: 181-
scallop (Nodipecten subnodosus, sowerby 1835) 202.
aquaculture in Baha Magdalena, Mxico: Effects of

Tabla I. Parmetros de la curva de crecimiento de von Bertalanffy (VBGF). K es la constante de crecimiento y L longitud
terica infinita que es el crecimiento mximo de A. ventricosus en este cultivo. C es la oscilacin de crecimiento t0 tiempo
terico en que inician su crecimiento, y ts es el tiempo en que llega a un punto de verano, considerado como tiempo de no
crecimiento, ndice de Munro de eficiencia del crecimiento.
2
K L C t0 tS r N
Costales Pardito 1.34 50.77 0.70 -0.22 0.36 0.94 63 1.23
Canastas Pardito 1.32 51.89 0.54 -0.22 0.43 0.96 73 1.26
Costales Danzante 1.03 50.00 0.88 -0.22 0.23 0.94 59 0.94
Canastas Danzante 1.24 50.63 0.60 -0.22 0.30 0.96 54 1.15

139
Curiel-Ramrez Gtz, S. y J., Cceres-Martnez. 2007. Asentamiento y distribucin de Mytilus galloprovincialis Y Mytilus californianus a diferentes
profundidades, en la Baha de Todos Santos, Baja California, Mxico. pp 140-142. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-
Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa (eds). Universidad de Guadalajara, Mxico. 286 p.

ASENTAMIENTO Y DISTRIBUCIN DE Mytilus galloprovincialis Y Mytilus californianus A


DIFERENTES PROFUNDIDADES, EN LA BAHA DE TODOS SANTOS, BAJA CALIFORNIA, MXICO

Curiel-Ramrez Gtz, Sergio1 y Cceres-Martnez, Jorge2


1
Instituto Tecnolgico de Boca del Ro. 2Centro de Investigacin Cientfica y de Educacin Superior de
Ensenada. scuriel73@yahoo.com.mx.
Palabras clave: Asentamiento, distribucin, Mytilus galloprovincialis, Mytilus californianus.

INTRODUCCIN m y se sec en una estufa a 70 C durante 24 h.


El conocimiento de la poca de asentamiento del Pasado este tiempo se separ la semilla de
mejilln en una localidad presenta una forma manual y el material obtenido se deposit
importancia prctica para los productores, ya que en viales previamente etiquetados. Estas
se puede establecer el momento ms oportuno muestras se separaron con la ayuda de
para introducir los colectores o se puede mejorar diferentes tamices (90, 180, 250, 355, 500 y 710
la oportunidad de captacin de semillas de la m). Este proceso permiti fraccionar la muestra
naturaleza, organismos de 0.25-30 mm, (Curiel- y as facilitar la medicin, identificacin y el
Ramrez, 2000). Por lo tanto, el conocimiento conteo de los organismos, as como establecer
preciso de la ocurrencia del asentamiento en los intervalos de las tallas por tamiz. Los
diferentes zonas y profundidades de la Baha de organismos se contaron y midieron con la ayuda
Todos Santos es importante, ya que se pueden de un microscopio estereoscpico dotado con un
mejorar las prcticas de colecta de semilla de los micrmetro ocular. Para determinar si exista
productores. diferencia en el asentamiento entre
profundidades, estaciones y el muestreo, se
MATERIALES Y MTODOS utiliz un anlisis de varianzas de tres vas con
El estudio del asentamiento de los mejillones, se efectos fijos (Neter et al., 1990), cumpliendo con
realiz en el rea de cultivo de mejilln de la los supuestos de normalidad, independencia y
Baha de Todos Santos, Baja California., Mxico. homogeneidad de varianzas, para esto se utiliz
El rea de cultivo se dividi en tres estaciones. el paquete estadstico Statistica 4.5 software
En cada una de las estaciones se suspendi un para PC con un = 0.05 %.
sistema de colectores, el cual consisti en poner
tres colectores (trozos de 15 cm de largo por 7 RESULTADOS Y DISCUSIONES
cm de ancho 105cm2) de fibra sinttica El mayor asentamiento en el mes de enero se
comercial Scotchbrite sujetos a un tubo de registr en la profundidad de 2 m (20 000
PVC en cada profundidad. Cada uno de los mejillones) de la estacin 1 y el menor
sistemas de colectores se sujet directamente de asentamiento se encontr en la profundidad de
la lnea de flotacin del sistema de cultivo, la cual 18 m (402 mejillones) de la estacin 3. En el mes
se encuentra en la superficie del mar. Adems de de febrero el asentamiento fue menor que los
probar el asentamiento en las diferentes zonas registrados para el mes de enero (< 5 000
de cultivo, tambin se procedi a probar si el mejillones) para todas las estaciones, pero el
asentamiento de los mejillones es la misma en asentamiento en todas las profundidades de las 3
toda la columna de agua, para esto se colocaron estaciones fue ms homogneo (Fig. 1).
colectores a los 2, 5, 7, 9, 10, 11, 13, 15 y 18 m
de profundidad. Los sistemas de colectores se
sustituyeron cada 35 5 das durante los meses
de diciembre de 2001 a enero de 2002 y de
enero a febrero de 2002, ya que son los meses
de mximo asentamiento (Curiel-Ramrez y
Cceres-Martnez, 1999; Curiel-Ramrez, 2000).
Los colectores se transportaron individualmente
en bolsas de polietileno al laboratorio, una vez en
el laboratorio los colectores se sumergieron en
cloro comercial [7%], diluido al 10 % durante 5
minutos para eliminar la materia orgnica y
facilitar con esto el desprendimiento de los
mejillones. Despus de este proceso, cada uno
de los colectores se coloc sobre un tamiz de 90

140
Estudios sobre Malacologa y Conquiliologa en Mxico

A 2m 5m 7m 9m 10m 11m 13m 15m 18m


25000
N 1= 43 013 N 2= 33 772 N 3= 22 533

20000 = 99 318
Ene r o Fe br e r o
N= 9 9 3 18 N= 56 1 1 3
15000
70
10000
60
Nmero de mejillones

5000
50

Frecuencia (%)
0
40
B
25000
N 1= 22 796 N 2= 11 859 N 3= 21 458
30
Dis p e r s i n
20000 = 56 113 20 En er o = 0 .0 5%
Fe br e r o = 3 .3 9 %
15000 10

10000 0
0 .2 5 0 0 .4 7 1 1 .10 6 1 .7 4 1 > 2 .3 7 6
5000 0 .4 7 0 1 .1 0 5 1 .74 0 2 .3 7 5

0
C la s e s d e T a lla ( m m )
E s t a c i n 1 E s t a c i n 2 E s t a c i n 3

Figura 2.- Histograma de la distribucin de tallas de


Figura 1.- Histograma de la sumatoria del nmero de larvas recin asentadas y postlarvas en las
mejillones asentados en los tres colectores de cada profundidades y estaciones estudiadas. La barra negra
estacin y profundidad estudiada. (A) enero y (B) corresponde al mes de enero y la blanca al mes de
febrero. (N) nmero de mejillones registrados en cada febrero. N representa el total de mejillones asentados
estacin. () sumatoria de los mejillones asentados en en los colectores. La flecha indica las clases de tallas
las tres estaciones. de las postlarvas consideradas como asentamientos
producto de una dispersin.
Los resultados del asentamiento
obtenidos durante el estudio indicaron diferencias Los resultados del asentamiento
significativas entre las estaciones (F(2,108)= 5.347, obtenido en los colectores artificiales colocados
p= 0.006), profundidades (F(8,108)= 22.743, p< en la Baha de Todos Santos durante el periodo
0.001) y los meses de muestreo (F(1,108)= 31.132, de estudio, concuerdan con los desoves
p< 0.001). La distribucin de tallas de los importantes de Mytilus californianus (febrero a
mejillones asentados en las estaciones y junio) y de Mytilus galloprovincialis (diciembre y
profundidades del mes de enero y febrero, enero). Estos resultados concuerdan con los
presentaron un patrn de asentamiento similar descritos para la Baha de Todos Santos y el
(Tabla I). Considerando las tallas de las larvas Ejido Erndira por Curiel-Ramrez (2000). En el
pediveliger competentes recin asentadas y su caso de los mayores asentamientos de mejillones
crecimiento terico esperado durante la registrados en los colectores de la estacin 1,
permanencia del colector bajo el agua, ste puede estar relacionado con la direccin de la
indic que el porcentaje de mejillones recin corriente litoral predominante con direccin
asentados en el mes de enero y febrero fue del sureste (Castro, 1987). Estos resultados
99.95 y 96.61 % respectivamente (Fig. 2). concuerdan con los obtenidos para M.
galloprovincialis por Cceres-Martnez y
Tabla I.- Intervalos de las tallas de los mejillones Figueras, (1998b), quienes describen que el
observadas en las diferentes estaciones y mayor asentamiento en colectores artificiales en
profundidades durante el perodo de estudio. En cada la Ra de Vigo lo obtienen en la zona de la boca
estacin se resalta la talla mxima registrada de los de la Ra y mientras ms alejado se encuentren
mejillones en dispersin. los colectores de esta zona menor es el
Enero Febrero
asentamiento, esto es debido a que la boca de la
Profundidad Talla mnima (mm)
Estacin 1 Estacin 2 Estacin 3 Estacin 1 Estacin 2 Estacin 3
Tallas mximas registradas (mm)
Ra es la zona por donde entra la corriente litoral
2m
5m
0.250
0.250
1.666
1.499
1.666
1.499
1.999
1.499
3.831
4.831
3.165
2.832
3.165
3.498
predominante, rica en fitoplancton, larvas
7m
9m
0.250
0.250
1.999
1.999
1.666
2.499
1.666
1.499
6.164
2.999
3.831
3.332
4.998
2.499
competentes y postlarvas de mejillones. Por otro
10 m
11 m
0.250
0.250
1.832
1.499
1.666
1.666
1.499
1.332
2.832
2.499
3.998
8.163
2.832
5.331
lado, los resultados de la distribucin del
13 m
15 m
0.250
0.250
1.499
1.416
1.666
1.499
1.332
1.166
9.998
5.498
2.499
2.998
2.832
3.498
asentamiento de los mejillones por profundidad
18 m 0.250 1.680 1.802 1.166 5.831 1.999 2.832 obtenidos en el mes de enero, indicaron que el
mayor asentamiento se encuentra en las
profundidades por arriba de la termoclina (2 a 7
m), mientras que para las profundidades donde
se encuentra presente la termoclina en la Baha
de Todos Santos (9 y 10 m, Cruz, 1997), el

141
Estudios sobre Malacologa y Conquiliologa en Mxico

asentamiento es muy similar, y para las depth of Mytilus edulis C. Linnaeus, 1758 and
profundidades posteriores a la termoclina (11 a M. trossulus Gould, 1850: I. A. mesocosm study.
18 m) el asentamiento disminuye gradualmente J. Shell. Fish. Res. 21(1): 59-65.
en todas las estaciones. Estos resultados Kenchington, E., K. R. Freeman., B. Vercaemer &
concuerdan con los obtenidos por Cceres- B. MacDonald. 2002. Comparative settlement
Martnez y Figueras, (1997), Freeman et al., depths of Mytilus edulis C. Linnaeus, 1758 and
(2002) y Kenchington et al., (2002), quienes M. trossulus Gould, 1850: II: Field observations.
indican que los mayores asentamientos de J. Shell. Fish. Res. 21(1): 67-73.
mejillones se presentan en la superficie del agua Neter, J., W. Wasserman & M. Kutner. 1990.
y disminuye conforme aumenta la profundidad, Applied linear statistical models. Richard D. Irwin,
estos autores relacionan este patrn de Inc. Tercera edicin. Homewood, Illinois. 1408 p.
asentamiento directamente con la presencia de la
termoclina, la cual influye directamente en
menores asentamientos, as como en la especie
que se asienta por debajo de la termoclina. Sin
embargo, resultados opuestos fueron descritos
por Cceres-Martnez y Figueras, (1998a),
quienes asumen que las condiciones de la
columna de agua en la zona de estudio fueron
homogneas.

LITERATURA CITADA
Cceres-Martnez, J y A. Figueras. 1997. Mussel
(Mytilus galloprovincialis Lamarck) settlement
in the Ria de Vigo (NW Spain) during a tidal
cycle. J. Shell. Fish. Res. 16(1): 83-85.
-1998(a). Mussel (Mytilus galloprovincialis
Lamarck) colonization on artificial substrates in
the Ria de Vigo of NW Spain. J. Shell. Fish.
Res. 17(1): 153-157.
-1998(b). Distribution and abundance of mussel
(Mytilus galloprovincialis Lmk) larvae and post-
larvae in the Ria de Vigo (NW Spain). J. Exp.
Mar. Biol. Ecol. 229: 277-287.
Castro, L. E. 1987. Variacin espacial y temporal
en la biomasa del zooplancton de la Baha de
Todos Santos, B. C; Mxico, octubre 1982 a
septiembre 1983. Tesis profesional. UABC.
Ensenada. Baja California. 58 p.
Cruz, C. M. E. 1997. Variabilidad de la
Temperatura del mar en la Baha de Todos
Santos, B. C., Mxico. Tesis de Maestra. Fac.
Cs. Marinas. UABC. Ensenada. B. C. 98 p.
Curiel-Ramrez, S. y Caceres-Martnez, J. 1999.
Settlement of the blue mussel Mytilus
galloprovincialis Lamarck, in artificial substrates
in the Bahia Todos Santos, B. C., Mxico. J.
Shell. Fish. Res. 18(1):33-39.
Curiel-Ramrez, S. 2000. Ciclo Reproductivo y
Fijacin de Mytilus galloprovincialis y Mytilus
californianus en la Baha de Todos Santos y el
Ejido Erndira, Baja California, Mxico. Tesis de
Maestra. CICESE. Ensenada, Baja California.
80 p.
Freeman, K. R., E. Kenchington & S. P.
MacQuarrier. 2002. Comparative settlement

142
Curiel-Ramrez Gtz, S. y J., Cceres-Martnez. 2007. Crecimiento diario de postlarvas de Mytilus galloprovincialis Y Mytilus californianus en
laboratorio. pp 143-145. En: Estudios sobre la Malacologa y Conquiliologa en Mxico. Ros-Jara, E., M. C., Esqueda-Gonzlez y C. M, Galvn-Villa
(eds). Universidad de Guadalajara, Mxico. 286 p.

CRECIMIENTO DIARIO DE POSTLARVAS DE Mytilus galloprovincialis Y Mytilus californianus EN


LABORATORIO

Curiel-Ramrez Gtz, Sergio1 y Cceres-Martnez, Jorge2


1
Instituto Tecnolgico de Boca del Ro. 2Centro de Investigacin Cientfica y de Educacin Superior de
Ensenada. scuriel73@yahoo.com.mx.
Palabras clave: Crecimiento, postlarvas, Mytilus galloprovincialis, Mytilus californianus.

INTRODUCCIN una temperatura promedio de 17.39 0.83 para


La colonizacin de los sustratos puede ocurrir por M. californianus y 17.51 0.58 C para M.
larvas competentes, listas para asentarse (250 galloprovincialis. A cada cubeta se le suministr
470 m) o por postlarvas (500- 4000 m) que aireacin constante por un periodo de 60 das
flotan en la columna de agua antes de asentarse para cada especie. Los organismos fueron
en un sustrato con condiciones ptimas Para alimentados diariamente en una sola racin de
determinar si un sustrato en particular es 10 ml de la microalga Isochrysis galbana, con
colonizado por larvas competentes o por una concentracin de 20 2 millones de clulas
postlarvas, es necesario saber la talla mxima de por ml, para mantener una concentracin de 400
una larva competente que arrib al sustrato el 000 cel ml-1 (Pechenik et al., 1990; Cron, 2000).
primer da y permaneci por un cierto periodo de Los recambios de agua de los sistemas de cultivo
tiempo en el mar (Cceres-Martnez et al., 1993). se realizaron tres veces por semana, con un
Los mejillones que excedan esta talla recambio de agua del 100%, utilizando agua de
correspondern a una colonizacin por mar filtrada. Se realiz una limpieza total de las
postlarvas. Esto es importante, ya que el clculo cubetas cada dos semanas, con el fin de eliminar
que se realiza para determinar el tamao mximo las microalgas adheridas a las paredes. Las
esperado de los mejillones que se asentaron en longitudes totales de los mejillones de cada
un sustrato artificial, colocado en el mar durante especie se midieron los das 1, 20, 40 y 60 del
un periodo determinado, se ha realizado experimento. Posteriormente se realizaron las
utilizando el crecimiento promedio diario descrito grficas correspondientes del crecimiento diario
por Bayne, (1964), con lo cual se puede estar por talla de cada especie, as como el clculo del
sobreestimando o subestimando esta talla. crecimiento diario promedio utilizando estos
datos.
MATERIALES Y MTODOS
El estudio se realiz en la Baha de Todos RESULTADOS Y DISCUSIN
Santos (paralelos 31 45-31 59 N y los Durante el periodo de estudio, Mytilus
meridianos 116 36-116 45 O) y el Ejido californianus y Mytilus galloprovincialis
Erndira (paralelos 31 18' a 31 19' N y los incrementaron sus tallas. Estos incrementos
meridianos 116 26' a 116 27' O). Para fueron mayores en M. galloprovincialis que en M.
determinar el crecimiento promedio diario de californianus. En el caso de M. galloprovincialis
Mytilus californianus y Mytilus galloprovincialis los mayores incrementos se observaron en las
desde larvas recin asentadas hasta postlarvas, tallas de 1.25 y 3.50 mm, con un incremento de
se prosigui a recolectar en el mes de marzo de 7.175 y 7.362 mm respectivamente; los menores
2004 mejillones de las camas de los mejillones incrementos se registraron en las tallas de 0.50,
adultos de la zona superior del intermareal del 2.00, 1.75, 2.25 y 1.50 mm con incrementos de
Ejido Erndira, con el fin de separar organismos 2.854, 2.947, 2.984, 3.982 y 4.295 mm
de M. californianus y, en el mes de mayo de respectivamente, mientras que en el resto de las
2004, se recolectaron mejillones de las cuerdas tallas se observaron incrementos entre los 5.062
captadoras de semillas de la profundidad de 2 m a 6.750 mm. Por otra parte, en M. californianus el
del rea de cultivo de la Baha de Todos Santos mayor incremento se registr en la talla de 3.50,
para separar los organismos de M. mm con 1.451 mm; los menores incrementos se
galloprovincialis. Posteriormente, los mejillones registraron en las tallas de 0.75, 1.00 y 1.50 mm,
se separaron por tallas y se identificaron bajo un con 0.389, 0.392 y 0.593 mm respectivamente,
microscopio estereoscpico dotado con un mientras que el resto de las tallas registraron un
micrmetro ocular (Martel et al., 1999). Los incremento entre los 0.656 a 0.740 mm. (Fig.1).
mejillones separados e identificados se Considerando los valores finales de cada clase
mantuvieron en cubetas de plstico de 1 l, con un de talla inicial, se calcul la relacin de
volumen de agua de mar de 500 ml (35 ), a crecimiento promedio de M. galloprovincialis y M.

143
Estudios sobre Malacologa y Conquiliologa en Mxico

californianus. La mayor relacin de crecimiento disponibilidad del espacio y reduce el nicho


promedio en M. galloprovincialis se registr en la fundamental de M. californianus en las zonas
clase de talla de 3.50 mm con 122.70 m d-1 y la media y baja del intermareal o en las zonas
menor relacin se registr en clase de talla de protegidas de la baha (zona de cultivo), por lo
0.50 mm con 47.57 m d-1. En el caso de M. que los mejillones de M. californianus se quedan
californianus la menor relacin se registr en la en la parte interior de las camas de los
clase de talla de 0.75 mm con 6.49 m d-1 y la mejillones, donde se acumula el sedimento y las
mayor relacin se registr en la clase de talla de pseudoheces, lo cual provoca que los mejillones
3.50 mm con 24.18 m d-1 (Tabla I). Por lo tanto, mueran aplastados y sofocados por sus
los mayores incrementos de tallas y relaciones congneres. Esto da como resultado que, en la
de crecimiento se registraron en M. zona de cultivo, el nicho fundamental y realizado
galloprovincialis en todas las clases de tallas. de M. galloprovincialis sea el mismo, mientras
que el nicho realizado de M. californianus es
M. californianus
0.50 mm

M. galloprovincialis M. californianus
0.75 mm

M. galloprovincialis
1.00 mm

M. californianus M. galloprovincialis
menor que su nicho fundamental.
14 14 14
= 0.656 mm = 2.854 mm = 0.389 mm = 0.392 mm = 5.062 mm
12 12 12

10 10 10 Tabla I.- Relacin de crecimiento promedio de


8 8 8
Mytilus galloprovincialis y Mytilus californianus en
6 6 6

4 4 4
las diferentes tallas durante el periodo de estudio.
2 2 2

0 0 0
-1
1.25 mm 1.50 mm 1.75 mm
T alla Relacin de crecim iento (m d )
14
= 7.175 mm
14
= 0.593 mm = 4.295 mm
14
= 0.700 mm = 2.984 mm (m m ) M . galloprovincialis M . californianus
12 12 12

10 10 10
0.50 47.57 10.93
8 8 8
0.75 6.49
6 6 6 1.00 84.37 6.54
4 4 4 1.25 119.58
Longitud de concha (m m )

2 2 2
1.5 71.58 9.88
0 0