Está en la página 1de 108

Un modelo de gestin ambiental para

biorremediar suelos contaminados con 1,1,1-


tricloro-2,2-bis (4-clorofenil)-etano (DDT)
mediante un reactor de lecho esttico

Mara Anglica Prada Vsquez

Universidad Nacional de Colombia


Facultad de Minas, Departamento de Geociencias y Medio Ambiente
Medelln, Colombia
2016
Un modelo de gestin ambiental para
biorremediar suelos contaminados con 1,1,1-
tricloro-2,2-bis (4-clorofenil)-etano (DDT)
mediante un reactor de lecho esttico

Mara Anglica Prada Vsquez

Tesis presentada como requisito parcial para optar al ttulo de:


Magister en Medio Ambiente y Desarrollo

Director

Santiago Alonso Cardona Gallo, PhD, MSc. Ing. Sanitario

Lnea de investigacin
Biorremediacin de suelos

Grupo de Investigacin:
Biorremediacin y desarrollo tecnolgico

Universidad Nacional de Colombia


Facultad de Minas, Departamento de Geociencias y Medio Ambiente
Medelln, Colombia
2016
A mis padres por el gran apoyo que me
brindaron. Por haberme enseado que
con esfuerzo, trabajo y constancia todo
se puede lograr.
Agradecimientos

Agradezco inmensamente mi familia, mis padres y hermanos por su gran impulso durante toda
mi maestra.

Al profesor Santiago Cardona, por su acompaamiento como director de esta tesis y por sus
importantes sugerencias durante el desarrollo de este estudio.

A Santiago Campuzano por su apoyo incondicional.

A Mara Catalina Trejos por compartir sus conocimientos y por sus buenos consejos a lo largo
de esta investigacin.

A ngela Uscategui por todas sus enseanzas en temas microbiolgicos.

A Edison Alexander Agudelo por su gran apoyo y colaboracin.

A Brinton Urina por su apoyo y amistad.

A la Universidad Nacional de Colombia Sede Medelln, especialmente a la Facultad de Minas,


por el apoyo a travs de la infraestructura del Laboratorio de Biorremediacin y Desarrollo
Tecnolgico.

A la Corporacin Autnoma Regional Del Cesar, Corpocesar por el apoyo brindado en la


recoleccin del suelo.

Al departamento administrativo de Ciencia, Tecnologa e InnovacinCOLCIENCIAS por el


apoyo con la beca Jvenes Investigadores de la convocatoria nacional N0 645 de 2014.

A Hermes por la financiacin de este proyecto con cdigo quipu 200000013887.

Y a todas aquellas personas que no alcanzo a mencionar, pero que con su apoyo y cario hicieron
posible la realizacin de este proyecto.
Resumen y Abstract V

Resumen
El DDT (1,1,1-tricloro-2,2-bis (4-clorofenil)-etano) constituye una gran parte de los plaguicidas
en desuso, el cual se caracteriza por su alta resistencia a la degradacin y que an se encuentra
almacenado en muchos pases. Es considerado mundialmente como tema de inters
investigativo debido principalmente a sus efectos colaterales en el medio ambiente y de salud a
los cuales se le asocia.

Medidas biocorrectoras se han empleado en la descontaminacin de suelos hace dcadas


ofreciendo un gran potencial la estrategia de biorremediacin. Esta amigable tecnologa ofrece
ventajas frente a otras tecnologas de carcter qumico o fsico para eliminar y/o reducir los
niveles de concentracin de plaguicidas clorados vertidos al suelo debido a su bajo costo.
En la presente investigacin se propuso un modelo de gestin ambiental para la degradacin de
DDT a travs de estrategias de biorremediacin en condiciones anaerobias. El estudio se realiz
sobre un suelo agrcola perteneciente al municipio de Codazzi, Cesar, el cual contaba con un
amplio historial de contaminacin con DDT.
El estudio const de dos etapas, una primera desarrollada a escala de laboratorio y una segunda
etapa a escala piloto.
Para la primera etapa se evaluaron diferentes tratamientos de biorremediacin en condiciones
anaerobias: atenuacin natural y la aplicacin de estrategias de bioestimulacin con adicin de
un co-sustrato: melaza y un aceptor de electrones, KNO3. Se evalu la degradacin del
contaminante teniendo en cuenta la suplementacin de nutrientes de forma individual y
combinada. Para cada tratamiento se midieron variables de control como humedad, potencial
redox, temperatura y recuento de colonias durante 33 das. As mismo se midi la concentracin
de DDT inicial y final de cada tratamiento por cromatografa de gases.
Se estableci una diferencia significativa en los tratamientos aplicados a escala de laboratorio.
Para el tratamiento de atenuacin natural la concentracin de DDT se redujo en un 38.5% con
respecto a la concentracin inicial del suelo; un 72.3% para el tratamiento con adicin de melaza;
para el tratamiento con adicin nicamente de KNO3 la concentracin de DDT se redujo al 70.2
% y finalmente un porcentaje de remocin de 92.5 %, para el tratamiento con adicin de melaza-
KNO3, siendo este el tratamiento ms efectivo.
La segunda etapa consisti en evaluar la tasa de degradacin de DDT en condiciones anaerobias
aplicando la estrategia de bioestimulacin seleccionada en la etapa 1 en un reactor de lecho
esttico (RLE). En el estudio se conserv el escalado geomtrico de las bandejas, relacin C:N:P
y condiciones anaerobias. Se monitoreo la concentracin de DDT cada 4 das durante un periodo
de 4 semanas.
La concentracin final en el reactor se redujo en un 91.54 % con respecto a la concentracin
inicial. Se obtuvo una velocidad de biodegradacin de 0.077 d-1 y un tiempo de vida media de
8.9 das.
Resumen y Abstract VI
Se lograron aislar e identificar a travs de pruebas bioqumicas y moleculares cepas microbianas
predominantes al inicio y despus del tratamiento de bioestimulacin en el reactor. Como
resultado, se identificaron secuencias para ambas cepas del gnero: Bacillus.

Finalmente, con la informacin obtenida en el estudio investigativo se formul un modelo de


gestin ambiental que permitiera la incorporacin de esta estrategia en la biorremediacin de
suelos contaminados con DDT.
PALABRAS CLAVES: DDT, bioestimulacin, nutrientes, reactor de lecho esttico,
tratamiento anaerobio, modelo ambiental, atenuacin natural.
Resumen y Abstract VII

Abstract

DDT (1,1,1-trichloro-2,2-bis (4-chlorophenyl) ethane) constitutes a large part of obsolete


pesticides characterized by high resistance to degradation and is still stored in many countries. It
is regarded worldwide as a subject of research interest mainly due of its side effects on the
environment and health to which them are associated
Bio-corrective measures have been used in soil decontamination for decades offering a great
potential bioremediation strategy. This friendly technology offers advantages over other
chemical or physical based technologies to eliminate and / or reduce the concentration levels of
chlorinated pesticides discharges to ground due to its low cost.
In this research is proposed an environmental model for the degradation of DDT through
bioremediation strategies under anaerobic conditions. The study used a soil from Codazzi, Cesar
which had a long history of DDT contamination.
The study consists of two stages, the first stage was developed to laboratory scale where
bioremediation treatments were evaluated in microcosm and a second stage to pilot scale where
DDT contaminated soil were treated in a packed- bed reactor.
For the first stage different bioremediation treatments were evaluated under anaerobic
conditions: natural attenuation and implementation of biostimulation strategies with addition of
a co-substrate: molasses and an electron acceptor KNO3. It was evaluated pollutant degradation
considering the combination of both nutrients and individually. For each treatment control
variables such as moisture, redox potential, temperature and colony counts were measured for 4
weeks. Also the initial and final concentration of DDT and end of each treatment by gas
chromatography was measured.
A significant difference was established in the treatments applied to laboratory scale, the
concentration of DDT reduced 38.5% compared to the initial concentration of the soil by
treating natural attenuation, treatment with addition of molasses concentration reduced DDT to
72.3%, for treatment with only adding KNO3 was reduced to 70.2% and finally for the treatment
addition of molasses and KNO3 DDT concentration was reduced by 92.5%, which is the most
effective treatment.
The second stage involved to evaluate the strategy biostimulation selected in step 1 in a fix bed
reactor. It was retained the geometric scaling of the trays, relation C:N:P and the anaerobic
conditions. Similarly, DDT concentration was monitored every 4 days for a period of 4 weeks.
The final concentration in the reactor was reduced by 91.54% compared to the initial
concentration. It was shown that the kinetics of degradation of DDT is set to a first order kinetic
model and daily disappears 0.077 d-1 parts of contaminant and half-life of 8.9 days.
Resumen y Abstract VIII
Predominant microbial strains were isolated and identified through tests biochemical and
molecular tests in contaminated agricultural soil and soil after being applied biostimulation
treatment. As a result, the following microorganisms were identified: Bacillus.
Finally, with the information obtained in the experimentation was formulated a model of
environmental management that allow the incorporation of this strategy in the bioremediation
of soils contaminated with DDT.

KEYWORDS: DDT, biostimulation, nutrients, packed bed reactor, anaerobic treatment,


environmental model, natural attenuation.
Contenido IX
Contenido

Resumen .............................................................................................................................................5
Abstract ...............................................................................................................................................7
INTRODUCCIN ............................................................................................................................1
1. Planteamiento del problema ......................................................................................................4
2. Justificacin ................................................................................................................................5
3. Antecedentes...............................................................................................................................6
4. MARCO REFERENCIAL ........................................................................................................9
4.1 Generalidades del suelo ................................................................................................................ 9
4.2 Dinmica de los plaguicidas en el suelo......................................................................................... 9
4.3 Caractersticas del DDT.............................................................................................................. 10
4.4 Origen y usos del DDT .............................................................................................................. 11
4.5 Existencias de DDT almacenados en Colombia .......................................................................... 12
4.6 Impactos del DDT en el ambiente .............................................................................................. 13
4.6.1 Efectos en la salud ............................................................................................................... 13
4.6.2 Efectos a la fauna................................................................................................................. 14
4.7 Destino y comportamiento del DDT en el suelo......................................................................... 14
4.8 Degradacin del DDT ................................................................................................................ 15
4.8.1 Procesos metablicos en la degradacin anaerobia ............................................................... 16
4.8.2 Ruta de degradacin anaerobia del DDT.............................................................................. 17
4.8.3 Ruta de degradacin aerobia del DDT ................................................................................. 17
4.9 Biorremediacin del DDT .......................................................................................................... 20
4.9.1 Factores que intervienen en la biorremediacin .................................................................... 20
4.10. Estrategias para aumentar la biodegradacin ............................................................................ 24
4.10.1 Surfactantes ....................................................................................................................... 24
4.10.2 Co-sustratos ....................................................................................................................... 24
4.11 Tratamientos de biorremediacin.............................................................................................. 25
4.11.1 Atenuacin natural ............................................................................................................. 25
4.11.2 Bioestimulacin ................................................................................................................. 26
Conenido X

4.12 Reactor anaerobio de lecho esttico .......................................................................................... 27


4.12.1 Requerimientos ambientales ............................................................................................... 27
4.12.2 Evaluacin de la actividad microbiana ................................................................................ 28
4.12.3 Modelo cintico de degradacin ......................................................................................... 28
4.12.4 Tiempo de vida media ........................................................................................................ 30
5. OBJETIVOS .............................................................................................................................31
5.1 Objetivo General ........................................................................................................................ 31
5.2 Objetivos Especficos ................................................................................................................. 31
5.3 Preguntas de investigacin .......................................................................................................... 31
5.4 Hiptesis .................................................................................................................................... 31
6. METODOLOGA ....................................................................................................................32
6.1 Materiales y mtodos .................................................................................................................. 33
6.1.1 Equipos ............................................................................................................................... 33
6.1.2 Reactivos ............................................................................................................................. 33
6.1.3 Recoleccin de la muestra de suelo ...................................................................................... 33
6.1.4 Pretratamiento de la muestra de suelo .................................................................................. 35
6.2 Desarrollo del estudio................................................................................................................. 35
6.2.1 Montaje a escala de laboratorio ............................................................................................ 35
6.2.2 Diseo experimental ............................................................................................................ 35
6.2.3 Ensayos de biodegradacin .................................................................................................. 36
6.3 Caracterizacin fsico-qumica y microbiolgica del suelo ........................................................... 37
6.3.1 Tcnicas de anlisis .............................................................................................................. 37
6.4 Montaje a escala piloto ............................................................................................................... 41
6.4.1 Parmetros de medicin en el reactor................................................................................... 42
6.4.2 Evaluacin de la actividad metanognica .............................................................................. 42
7. RESULTADOS.........................................................................................................................43
7.1 Caracterizacin del suelo ............................................................................................................ 43
7.1.1 Determinacin de parmetros fsicos ................................................................................... 43
7.2 Calculo dosificacin de nutrientes............................................................................................... 45
7.3 Ensayos de biodegradacin a escala de laboratorio ..................................................................... 46
7.3.1 Concentracin de DDT en las bandejas ............................................................................... 46

10
Contenido XI

7.3.2 Anlisis de Datos ................................................................................................................. 47


7.3.3 Comportamiento de los parmetros fsicos en las bandejas .................................................. 49
7.3.3 Recuento de bacterias hetertrofas para los protocolos ........................................................ 53
7.4 Resultados montaje a escala piloto .............................................................................................. 54
7.4.1 Comportamiento de parmetros fsicos y qumicos en el reactor .......................................... 54
7.4.2 Medicin de la actividad metanognica ................................................................................ 56
7.4.3 Cintica de degradacin en el reactor ................................................................................... 57
7.4.4. Recuento de bacterias hetertrofas en el reactor a lo largo del estudio................................. 58
7.4.5 Caracterizacin bioqumica de las bacterias aisladas.............................................................. 59
7.4.6 Identificacin de las bacterias aisladas del tratamiento ms efectivo ..................................... 60
8. DISCUSIN .............................................................................................................................62
8.1 Formulacin de un plan de manejo ambiental para biorremediar suelos contaminados con DDT
mediante bioestimulacin ex situ ...................................................................................................... 68
8.1.1 Revisin ambiental inicial ..................................................................................................... 68
8.1.2 Referentes normativos ......................................................................................................... 69
8.1.3 Participacin comunitaria..................................................................................................... 71
8.1.4 Medida de gestin planteada ................................................................................................ 71
8.1.5 Costos gestin ambiental ..................................................................................................... 72
8.1.6 Implementacin de la medida de gestin.............................................................................. 72
8.1.7 Plan monitoreo y seguimiento .............................................................................................. 73
9. CONCLUSIONES ...................................................................................................................75
10. RECOMENDACIONES ...........................................................................................................77
ANEXOS...........................................................................................................................................78
Anexo 1. Fotografas punto de muestreo. Municipio Codazzi, Cesar ................................................ 78
Anexo 2. Montajes en las bandejas ................................................................................................... 79
Anexo 3. Fotografas aislamiento de las bacterias predominantes en el tratamiento .......................... 80
Anexo 4. rbol filogentico muestras B1 y B2 ................................................................................. 81
Anexo 5. Gel de agarosa con fragmentos amplificados mediante reaccin en cadena de polimerasa
(PCR) de colonias aisladas ................................................................................................................ 82
BIBLIOGRAFA ..............................................................................................................................83
Contenido XII

Lista de figuras
Figura 1. Estructura de DDT, DDE y DDD y sus ismeros correspondientes

Figura 2. Vas alternativas en la degradacin del DDT

Figura 3. Fases de la degradacin anaerobia

Figura 4. Va anaerobia en la degradacin de DDT como sustrato propuesto por la Universidad


de Minnesota

Figura 5. Va aerobia en la degradacin de DDT como sustrato propuesto por la Universidad de


Minnesota

Figura 6. Esquema de la metodologa de trabajo

Figura 7. Puntos de muestreo en el municipio de Codazzi, Cesar

Figura 8. Imagen tridimensional de la zona de muestreo

Figura 9. Parmetros a controlar en cada tratamiento de biorremediacin

Figura 10. Reactor de lecho esttico

Figura 11. Concentracin final de DDT para cada tratamiento en las bandejas

Figura 12. Comparacin de medias usando Test Tukey

Figura 13. Comportamiento del pH para los tratamientos en las bandejas durante los das de
medicin

Figura 14. Comportamiento de la humedad para los protocolos de biorremediacin durante los
das de medicin

Figura 15. Comportamiento de la conductividad en los tratamientos durante el tiempo de


muestreo
Figura 16. Crecimiento bacteriano en los en los protocolos de biorremediacin para cada tiempo
de muestreo

Figura 17. Comportamiento del potencial redox en el reactor para cada tiempo de muestreo

Figura 18. Comportamiento del pH el en el reactor para cada tiempo de muestreo


Contenido XIII

Figura 19. Valores de temperatura en el reactor para cada tiempo de muestreo

Figura 20. Cintica de la concentracin de DDT residual en el reactor

Figura 21. Grfica de Ln (C/Co) vs tiempo en el reactor

Figura 22. Crecimiento bacteriano en el reactor durante el tiempo de muestreo

Figura 23. Microscopia ptica en objetivo 100x. (a) Bacterias suelo contaminado. (b) bacterias
despus del tratamiento de bioestimulacin

Figura 24. Esquema del plan de manejo ambiental para biorremediar suelos contaminados con
DDT
Contenido XIV

Lista de tablas
Tabla 1. Ejemplos de bacterias y hongos degradadoras de DDT en un cultivo puro

Tabla 2. Propiedades fisicoqumicas del DDT

Tabla 3. Cantidades almacenadas de DDT en Colombia hasta 2006

Tabla 4. Suelo contaminado con COP hasta 2006

Tabla 5. Factores que intervienen en la biorremediacin del DDT en suelos

Tabla 6. Composicin de la melaza de caa de azcar

Tabla 7. Tiempos de vida media del DDT

Tabla 8. Tratamientos evaluados a escala de laboratorio.

Tabla 9. Matriz de diseo experimental

Tabla 10. Pruebas experimentales para la caracterizacin fsico-qumica y microbiolgica del


suelo.
Tabla 11. Caracterizacin fsico-qumica del suelo

Tabla 12. ndice de Shannon antes de aplicar el tratamiento.

Tabla 13. Valores medios de la concentracin final de DDT en los tratamientos

Tabla 14. Anlisis de varianza


Tabla 15. Prueba de homogeneidad de varianzas
Tabla 16. Valores de potencial redox para los tratamientos a escala de laboratorio
Tabla 17. Valores de temperatura en los tratamientos para cada tiempo de muestreo
Tabla 18. Valores de la humedad en el reactor

Tabla 19. Resultados de las pruebas de tincin de Gram y catalasa para los dos morfotipos
Tabla 20. Resultados de la identificacin molecular de los aislados B1 y B2
Tabla 21. Normatividad ambiental colombiana en torno a la proteccin del suelo
Tabla 22. Parmetros de influencia en la bioestimulacin
Tabla 23. Etapas a seguir en la fase de implementacin del plan de manejo para biorremediar
suelos contaminados con DDT
Contenido XV

Lista de fotografas
Fotografa 1. Punto de muestreo en el municipio Codazzi, Cesar.

Fotografa 2. Recoleccin de las muestras de suelo en el municipio Codazzi, Cesar.

Fotografa 3. Montaje de los tratamientos de biorremediacin en las bandejas.

Fotografa 4. Montaje del tratamiento de bioestimulacin con melaza y KNO3.

Fotografa 5. Siembra de colonias para el tratamiento de bioestimulacin melaza y KNO3.

Fotografa 6. Aislamiento de colonias para el tratamiento de bioestimulacin melaza y KNO3.


Contenido XVI

Abreviaturas
ATP: trifosfato de adenosina

ATSDR: Agencia para las Sustancias Txicas y el Registro de Enfermedades

C:N:P: Proporcin molar de carbono, nitrgeno y fosforo

COP: Compuestos orgnicos persistentes

CIC: Capacidad de intercambio catinico

DDD: Dicloro difenil dicloroetano

DDE: Dicloro difenildicloro etileno

DDT: Dicloro difenil tricloroetano

ICA: Instituto Colombiano Agropecuario

Koc: Coeficiente de adsorcin

LB: Medio Luria Bertani

LD50: Dosis letal mediana

MAVDT: Ministerio de Ambiente, Vivienda y Desarrollo Territorial

mg: miligramo

PCR: Reaccin en cadena de la polimerasa

PCBs: policlorobifenilos

pH: Potencial de hidrogeno

ppm: Partes por milln

UFC/g: Unidades formadoras de colonias por gramo

16S rRNA: RNA Ribosomico 16S.


INTRODUCCIN
En la actualidad se reconoce que la tierra contaminada es una amenaza potencial para la salud
humana y su continuo descubrimiento en los ltimos aos ha llevado a esfuerzos internacionales
para remediar muchos de estos sitios, ya sea como una respuesta a riesgos ambientales o para
permitir la recuperacin del sitio.

El 1,1,1 - tricloro - 2 ,2-bis (4 - clorofenil) etano (DDT) es un insecticida perteneciente a la


familia de los organoclorados con alta toxicidad, persistencia y capacidad bioacumulativa que fue
ampliamente utilizado para mantener la productividad de los cultivos, controlar plagas y erradicar
vectores transmisores de enfermedades tales como la malaria, tifus y la fiebre amarilla (Snchez
et al., 2006).

Sin embargo, la intencin detrs de la utilizacin de plaguicidas organoclorados fue matar o


ahuyentar la plaga objetivo, investigaciones demostraron que su amplio uso dio lugar a varios
efectos toxicolgicos entre las especies no objetivo, incluidos los seres humanos y el medio
ambiente, asociando su exposicin con enfermedades cancergenas y malformaciones genticas,
motivo por el cual la utilizacin de este compuesto fue prohibido en la mayora de pases desde
1972 (Turusov et al., 2013).

Para el caso colombiano la prohibicin de DDT se estableci con cerca de veinte aos de
diferencia entre pases como Estados Unidos y Colombia para el cual en 1986 el ICA (Instituto
Colombiano Agropecuario) restringi su uso a campaas de salud pblica contra la malaria, hasta
que el ao 1993 el Ministerio de Salud prohibi su importacin, formulacin, comercializacin
y uso debido a su persistencia prolongada y bioacumulabilidad (Defensora del pueblo, 2001).

A pesar de su prohibicin en muchos pases, el DDT an se encuentra almacenado en varias


regiones del mundo. En Colombia se han reportado sitios contaminados por COP (compuestos
orgnicos persistentes) en los departamentos de Cesar, Tolima y Atlntico y se estima un total
de 5000 m3 de suelo contaminado con DDT (MAVD, 2006).

El municipio de Codazzi, Cesar representa uno de los principales lugares afectados por el
remante desuso de diferentes pesticidas y se estima que entre 1974 y principios de la dcada de
los 90 en el municipio de se dio el uso intensivo de pesticidas entre estos el DDT por la aparicin
del gusano bellotero Heliothis virescens, lo cual empez a presentar resistencia conllevando a una
crisis en la produccin de algodn y logrando la acumulacin de plaguicidas obsoletos en la zona
(Rodrguez, 1999).

El DDT adems de presentar una estructura altamente estable es un compuesto hidrfobo lo


que limita su degradacin en el suelo a travs de los procesos fsico-qumicos. Su baja solubilidad
permite que el pesticida sea adsorbido en la superficie del suelo o en la materia orgnica
hacindose menos biodisponible. Como el compuesto objetivo se vuelve menos biodisponible,
la descontaminacin por microorganismos tambin disminuye propiciando que el DDT y sus

1
metabolitos persistan en el ambiente, principalmente en suelos y sedimentos con tiempos de vida
media entre 10-50 aos (ASTDR, 2002).

Las tcnicas convencionales usadas para eliminar contaminantes rgano-persistentes ha sido


realizada mediante la incineracin, tcnicas de contencin y confinamiento. Sin embargo, estas
alternativas de gestin no resultan ser tan eficientes ya que se pueden producir gases y partculas
con un grado de toxicidad incluso mayor al de la sustancia original para el caso de la incineracin.
En cuanto la alternativa de confinamiento de reas contaminadas se da una solucin ligeramente
provisional, pero la contaminacin permanece en el sitio e involucra grandes costos al requerir
vigilancia y barreras de aislamiento (FAO,1996).

De esta manera la eliminacin de DDT en suelos se ha convertido en una prioridad ambiental,


utilizando tanto ms procesos de remediacin fisicoqumicos como biolgicos. Aunque estos
tratamientos fisicoqumicos resulten ser ms rpidos que los tratamientos biolgicos, son
generalmente ms destructivos para los suelos afectados, y a menudo son ms costosos que la
biorremediacin debido a los altos requerimientos de energa (Foght et al., 2001).

En busca de una tecnologa amigable con el medio ambiente y que sea viable tanto tcnica como
econmicamente se propone la biorremediacin de suelos, la cual aprovecha las propiedades de
adaptacin de los microrganismos para resistir ambientes desfavorables, tal como se ve que
sucede en un suelo contaminado, donde la flora microbiana correspondiente adopta una
maquinaria enzimtica y ciertas rutas metablicas especficas que le permiten sobrevivir en
presencia de determinados compuestos.

La biodegradacin de DDT en suelos puede darse en sistemas aerobios y anaerobios, y estudios


reportan que las bacterias anaerobias pueden declorar compuestos ms fcilmente que las
bacterias aerobias, lo cual representa una gran ventaja ya que con este proceso no se requiere la
adicin de oxgeno y hay menor oportunidad de generar compuestos de hierro como
precipitados que puedan contaminar los acuferos (Litchfield, 2005).

Aun no se reportan investigaciones para biorremediar suelos contaminados con DDT en un


reactor de lecho esttico, lo que pretende contribuir de forma significativa a la comunidad
cientfica que trabaja en esta rea de investigacin al ofrecer informacin en la biorremediacin
de suelos contaminados con DDT a escala piloto y la posibilidad de la integracin de estrategias
que permitan finalmente dar solucin a problemas ambientales, asociados al recurso suelo.

Dado al limitado conocimiento de la biodegradacin anaerobia de DDT a escala piloto, esta


investigacin tiene como objetivo proponer un modelo de gestin ambiental que permita
biorremediar suelos contaminados con este pesticida en ausencia de oxigeno mediante un reactor
de lecho esttico empleando la tcnica de bioestimulacin con nutrientes. Para el estudio se
utiliz muestras de suelo proveniente del municipio Codazzi, Cesar el cual se caracterizaba por
presentar contaminacin con DDT.

En el estudio se llev a cabo una primera fase a escala de laboratorio que consisti en la
evaluacin de la biodegradacin de DDT cuando se aplicaban diferentes protocolos de
biorremediacin al suelo contaminado. Se utiliz un diseo estadstico completamente al azar

2
con un factor y 5 niveles correspondientes a los tratamientos en cada bandeja 1) control, 2)
atenuacin natural, bioestimulacin con adicin de nutrientes 3) Melaza, 4) Melaza y KNO3 y 5)
KNO3). La dosificacin de nutrientes fue calculada mediante relaciones estequiomtricas
establecidas por el mtodo de McCarthy entre la concentracin de DDT presente en el suelo y
la cantidad de nitrgeno y fosforo requeridos para producir biomasa.

Una fase posterior permiti estudiar la tasa de biodegradacin de DDT aplicando el mejor
tratamiento de bioestimulacin obtenido en la primera fase y llevada a cabo a escala piloto en un
reactor de lecho esttico. Se tuvo en cuenta un escalado geomtrico de las bandejas, relaciones
de C:N:P y condiciones anaerobias. Para esta etapa se utiliz 60 kilos de suelo contaminado con
una concentracin inicial de DDT conocida y se mantuvo el suelo a la capacidad de campo,con
el fin de conservar condiciones anaerobias.

El tiempo de duracin de los tratamientos de biorremediacin fue de 33 das para ambas fases
de la investigacin. Se cuantific una concentracin de DDT inicial y final a travs de
cromatografa de gases para los tratamientos a escala de laboratorio, a diferencia del estudio a
escala piloto donde se midi la concentracin de DDT cada 4 das. Se realiz la caracterizacin
fsico-qumica del suelo al inicio y final del tratamiento, donde se midieron parmetros de inters
como textura, ndice de Shannon, pH, materia orgnica, conductividad, contenido de nitrgeno
y fosforo, entre otros.

Se realiz adems el recuento de microorganismos hetertrofos cada 4 das durante el tiempo de


experimentacin para ambas etapas de este estudio. Se aislaron y se identificaron colonias
predominantes durante el proceso del mejor protocolo de bioestimulacin a travs de pruebas
bioqumicas y moleculares mediante secuenciacin de fragmentos de la subunidad 16S ADNr.

Finalizado la estrategia de bioestmulo se formul un modelo de gestin ambiental para


biorremediar suelos contaminados con DDT, teniendo en cuenta la tecnologa valorada. Se
plantearon lineamientos para la formulacin del plan de manejo ambiental basados en las
condiciones iniciales del sitio a descontaminar, aspectos normativos y requerimientos tcnicos.

A continuacin, en la segunda seccin se presentan los antecedentes sobre procesos biolgicos


que se han utilizado recientemente en la biodegradacin del DDT y cuales microorganismos se
han identificado como degradadores de este compuesto. En la tercera seccin en el marco
referencial se describe generalidades del DDT, tcnicas de biorremediacin, impactos al medio
ambiente. As mismo se detallan los reactores para biorremediar suelos contaminados con DDT
y el comportamiento de un reactor de lecho esttico. En la cuarta seccin se presentan los
objetivos generales y especficos que se plantearon en esta investigacin. En la quinta seccin se
describe la metodologa, parmetros y mtodos utilizados en el desarrollo de la investigacin. En
la sexta seccin se presentan los resultados obtenidos, anlisis estadsticos y la significancia de
los datos, adems los resultados de identificacin bioqumica y molecular de las bacterias. La
sptima seccin se expone la discusin de los resultados y se propone el plan de manejo
ambiental para biorremediar sitios contaminados con DDT y finalmente en la ltima seccin se
presentan las conclusiones de este estudio.

3
1. Planteamiento del problema
La necesidad de tener un control efectivo, econmico y viable sobre las plagas que afectaron a los
seres humanos o a sus actividades econmicas en los ltimos aos, hizo que el uso de plaguicidas
e insecticidas se expandiera en el mundo gradualmente. No obstante, la inspeccin ambiental en
aquel tiempo, no proporcionaba estudios evidentes que permitieran identificar los posibles efectos
que traera los plaguicidas en un futuro.

El DDT es un plaguicida organoclorado que fue ampliamente usado contra la lucha del paludismo
en la dcada de los 40s y considerado por la EPA (US Environmental Protection Agency) como
un compuesto persistente, bioacumulativo y txico para el medio ambiente. Este compuesto que
puede tardar ms de 15 aos en degradarse naturalmente representa una gran amenaza a la
poblacin, ya que altera la dinmica de la cadena trfica y causa desrdenes genticos en humanos
y animales (Purnomo et al., 2011).
Para el caso de Colombia, desde el ao 2007 el Ministerio de Ambiente, Vivienda y Desarrollo ha
trabajado en la construccin de planes y polticas ambientales que estn en concordancia con lo
firmado en el Convenio de Estocolmo en el 2001 sobre la restriccin total de las sustancias que
se encuentren dentro del grupo COP (Contaminantes Orgnicos Persistentes) y que se
caracterizan por ser molculas orgnicas cloradas, persistentes en el ambiente y de difcil
degradacin. En este grupo se encuentra el DDT (MAVD, 2006).
En la actualidad, se han encontrado suelos contaminados con este compuesto en algunos
departamentos de Colombia entre estos Cesar, Bolvar, Cundinamarca, Tolima y Atlntico; y se
estima que hasta el ao 2006 un total de 5000 m3 de suelo contaminado en todo el territorio
colombiano. Sin embargo, las alternativas de gestin para descontaminar suelos con este pesticida
son limitadas debido a que los procesos fsico-qumicos representan altos costos de tratamiento.
(MAVD, 2006).
La biorremediacin constituye una de las alternativas ms econmicas y sostenible para el
tratamiento de suelos contaminados con DDT, donde los microorganismos son capaces de
degradar estos compuestos o convertirlos a otros menos txicos para el medio ambiente (Atlas
& Bartha ,2002).
Frente a esta panormica y con el propsito de ofrecer un modelo de gestin ambiental eficiente
que permita dar solucin a la problemtica asociada a la contaminacin de suelos con DDT, se
generan algunas preguntas de investigacin:
Cules son los valores de parmetros fisicoqumicos ptimos en el proceso de biorremediacin
que permiten biodegradar el DDT en condiciones anaerobias en un reactor de lecho esttico?
La gestin ambiental aplicada a suelos contaminados con DDT permitir disminuir o atenuar el
impacto generado por este pesticida hacia la salud humana y medio ambiente?

4
2. Justificacin
El DDT adems de considerarse ubicuo, persistente en el ambiente y acumulable en tejidos de
animales y humanos, se ha estudiado que este y sus metabolitos pueden traer serias consecuencias
sobre la salud del ser humano (Turusov et al., 2013). Enfermedades como desarrollo de tumores
estrgenos, problemas en la funcin testicular, defectos congnitos en el feto, son atribuidas a la
exposicin directa o indirecta de los humanos al DDT o por algunos de sus metabolitos (Torres
et al., 2007).

Estudios citados hasta ahora en el departamento del Cesar donde se analiz la incidencia de 6
tipos de cncer, formularon la hiptesis sobre ciertas enfermedades en esas poblaciones tales
como: cncer de vejiga en mujeres, en Agustn Codazzi y El Copey; cncer de vejiga en hombres,
solo en El Copey, y cncer de piel no melanomas en hombres; puedan estar relacionados con la
exposicin ambiental a plaguicidas en desuso (Rojas, 2010).

Por otra parte, si bien el suelo es considerado como un recurso necesario para el desarrollo
industrial, ha sufrido un deterioro considerable debido principalmente a los compuestos qumicos
usados en las diferentes industrias. Algunos de estos compuestos han sido reemplazados con el
desarrollo de otros plaguicidas menos persistentes pero las consecuencias sobre los ecosistemas
permanecen debido a que su efecto txico luego de diez aos conserva el 50% de la cantidad
aplicada, y este el caso del DDT (Fisher, 1989).

Aunque desde 1993 la prohibicin y suspensin del DDT fue impuesta por agencias ambientales
entre estas la EPA, an en Colombia quedaron algunos excedentes de plaguicidas COP, bien sea
porque su fecha de vencimiento haba expirado o porque no se alcanzaron aplicar. Este problema
se agrav como consecuencia de algunas prcticas inadecuadas para eliminar dichas existencias,
que consistan en enterrar los excedentes y/o los materiales de empaque y envase. Por tanto, se
hace necesaria la implementacin de un modelo de gestin ambiental que incorpore nuevas
tecnologas permitiendo disminuir la toxicidad y concentracin de DDT en suelos de una manera
viable tcnica y ambientalmente amigable por medio de la biorremediacin como estrategia de
destoxificacin.

Muchos estudios se han planteado hasta el momento para la recuperacin de suelos contaminados
con este pesticida, donde han aprovechado como fuente de carbono y energa algunos
compuestos policlorados, entre estos el DDT. Sin embargo, an no se reporta en Colombia
estudios para biorremediar suelos contaminados con DDT a escala piloto en condiciones
anaerobias.

De esta forma, en la bsqueda del mejoramiento continuo, se considera necesario realizar estudios
investigativos que implementen un modelo de gestin ambiental aplicables a suelos contaminados
con DDT, con la finalidad de lograr disminuir los efectos txicos que ste plaguicida tiene sobre
ecosistemas terrestres y acuticos y que, hasta la actualidad han sido traducidos en mltiples
impactos.

5
3. Antecedentes
Teniendo en cuenta el potencial de efectos negativos del DDT, se han determinado algunos
mtodos para eliminar este compuesto del medio ambiente. Dentro de estos mtodos se
encuentra la biorremediacin de suelos el cual ha sido utilizado para degradar o transformar el
DDT en compuestos menos txicos a travs del uso intencional de la biodegradacin del
contaminante aprovechando algunas propiedades de los microorganismos del suelo (Odukkathil
& Vasudevan, 2013).

Algunas bacterias y hongos de la pudricin blanca han demostrado mejorar el proceso de


degradacin en el suelo. Recientemente, un enfoque biolgico ha sido utilizado como un
tratamiento respetuoso del medio ambiente y como uso de nuevas fuentes biolgicas para
degradar el DDT (Purnomo et al., 2011).

(Subba-Rao & M., 1977) emplearon cultivos de Pseudomonas putida y sustratos anlogos no
clorados de metabolitos del DDT como el difenilmetano (DPM), benzidrol (BH) y la
benzofenona (BP) con el fin de obtener informacin sobre las posibles rutas metablicas. Sin
embargo, slo propusieron la formacin de intermediarios posibles a travs de tres vas diferentes.
En un trabajo posterior de estos mismos autores (Subba-Rao & M., 1985) incluyeron adems de
bacterias, hongos y usaron el DDT, junto con productos de degradacin de este compuesto como
sustrato y obtuvieron resultados similares, ya que encontraron ms de 20 compuestos diferentes
a los introducidos en el medio de cultivo y sugirieron que el metabolismo del DDT puede ocurrir
por dos rutas; una deshidrocloracin para formar DDE y una decloracin reductiva para formar
DDD una decloracin reductiva de DDT a DDD bajo condiciones aerobias.

Dentro del proceso aerobio se ha identificado la participacin de algunas especies bacterianas


tales como: Alcaligenes sp. DG5 (Gao et al., 2011), Bacillus cereus (Mwangi et al., 2010), Pseudomonas
putida (Barragn-Huerta et al., 2007), Pseudoxanthomonas jiangsuensis ((Wang et al., 2011),
Sphingobacterium sp D6 (Fang et al., 2010). Mientras que en la degradacin anaerobia se han
reportado las especies bacterianas: Alcaligenes sp. (Beunink & Rehm, 1988), Clostridium sp. (Bao et
al., 2012), Eubacterium limosum (Sudharshan et al., 2012)
Se ha reportado que Agrobacterium tumefaciens acumula el 100% de DDT y el 90% de la dieldrina.
Las clulas de levadura tambin han sido reportadas para acumular altas concentraciones de DDT,
con porcentajes que van desde 94% hasta 97%. Un protozoo ciliado, Blepharisma intermedium,
acumula ms de 90% respecto a la concentracin inicial del DDT (Boush & Batterton,
1972).Tambin se ha registrado la degradacin del DDT a travs de hongos marrn mediante la
reaccin Fenton, dentro de los cuales los ms importantes por su capacidad para degradar el
contaminante son G. trabeum, F. pinicola y D. dickinsii (Purnomo et al., 2011).
De esta manera, la mejora del proceso de degradacin o mineralizacin de DDT por
microorganismos ha ido ganando popularidad en las ltimas dcadas y una gran variedad de
bacterias y hongos de pudricin blanca han demostrado mejorar el proceso de degradacin tanto
en cultivos puros como en los suelos naturales (Bo Gao et al., 2011; Purnomo et al., 2011).

6
Una de las ventajas sobre las que prima la biorremediacin es que dado que es un mtodo
biolgico, es superior a mtodos fisicoqumicos en el tratamiento de compuestos clorados, ya que
tienen mayores costos de tratamiento y podran causar contaminacin secundaria (Yang et al.,
2005).Sin embargo, esta tecnologa tambin presenta algunos limitantes como la capacidad de los
microorganismos para degradar el contaminante en campo, la biodisponibilidad del contaminante
a diferentes escalas espaciales y temporales.

Adems, la experiencia del pas en remediacin de suelos contaminados se limita a los derrames
de hidrocarburos. En cuanto a suelos contaminados por COPs, algunas universidades han hecho
investigaciones a nivel de laboratorio, inclusive directamente sobre plaguicidas organoclorados,
como reactivo Fenton (Iones ferrosos en presencia de perxido de hidrgeno), luz ultra violeta y
catalizadores, pero aun carecemos de estudios sobre la remediacin de suelos contaminados por
COPs en cantidades mayores a 1 kg (MAVD, 2006).

Para compuestos como BTEX se han reportado resultados satisfactorios que presentan una alta
eficiencia de eliminacin de estas sustancias bajo condiciones impuestas en el reactor (Gusmo et
al., 2007). Igualmente, para el compuesto 2,4,6 triclorofenol se ha reportado una alta tasa de
degradacin en un reactor de lecho empacado teniendo en cuenta las caractersticas del soporte,
forma, tamao y porosidad, alcanzando altas velocidades de transferencia de oxgeno y la
eliminacin del 99% del 2.4.6 TCP (Jess et al., 2009).

(Feidieker et al., 1995) propusieron el uso de biorreactores para remediacin de suelos


superficiales contaminados con compuestos aromticos clorados debido a las limitaciones que se
encuentran in situ, ya que en este ltimo no se tiene control sobre parmetros como pH,
temperatura, contenido de agua, aireacin y la mejora de nutrientes. El biorreactor construido por
(Beunink & Rehm, 1988) logr decloracin sincrnica reductiva de DDT a DDD y la oxidacin
del metabolito DDM con el uso de un cultivo mixto de Alcaligenes sp. y Enterobacter cloacae co-
inmovilizada en alginato de calcio.

En reactores de lecho esttico se ha empleado biomasa inmovilizada con el fin de degradar


sustancias txicas como clorofenoles; tal es el caso del uso de cubos de madera para inmovilizar
Phanerochaete chrysosporium, estudio en el cual se report la degradacin de 4-clorofenol, en un rango
de 71.1 83 % en condiciones de ausencia de fuente de carbono y nitrgeno adicional (Yum &
Peirce, 1998).

Adems, se ha reportado en la literatura que la presencia de co-sustratos aumenta la degradacin


del DDT, DDE y DDD en suelo, por aumento de la actividad microbiana (Ortz et al., 2013). El
cometabolismo ha demostrado que ocurre bajo condiciones de laboratorio y podra ser un
proceso importante en la eliminacin de estos pesticidas desde el medio ambiente (Aislabie et al.,
2010). Por lo tanto, la justificacin detrs de la utilizacin de co-sustratos biodegradables para
promover la degradacin de molculas persistentes es que estas pueden favorecer el crecimiento
microbiano e inducir la activacin de enzimas que participan en la degradacin del contaminante
(Ortz et al., 2013).

A continuacin, en la tabla 1 se presentan ejemplos de algunas bacterias y hongos degradadores


de DDT que se han identificado en un cultivo puro.

7
Tabla 1. Ejemplos de bacterias y hongos degradadoras de DDT en un cultivo puro.

Mecanismo de Microorganismo Procedencia Referencia


degradacin
Bacteria:
Decloracin Proteus vulgaris Intestino de ratn (Barker et al., 1965)
reductiva de DDT a
DDD
(Mendel & Walton,
Escherichia coli Heces de ratas 1966)
Enterobacter
(anteriormente
Enterobacter) aerogenes

(Kanta Sharma et al.,


Pseudomonas aeruginosa Lodo activado 1987)
Bacillus spp. Sludge
Flavobacterium sp.
(Beunink & Rehm,
Enterobacter cloacae Lodos de depuradora 1988)

Decloracin Pseudomonas aeruginosa Suelo (Golovleva &


reductiva 640X Skryabin, 1981)
del DDT y el anillo
escisin de
metabolitos

(Nadeau et al., 1994)


Desciclizacin meta Ralstonia eutropha Suelo
del DDT

Fungi: Saccharomyces cerevisiae Levadura de cerveza (Bridges et al., 2011)


Decloracin
reductiva de DDT a
DDD

Conversin DDT a Basidiomycete Madera (Katayama et al.,


dicofol 1993)

8
4. MARCO REFERENCIAL
4.1 Generalidades del suelo

El suelo es un cuerpo natural que consiste en capas de suelo (horizontes del suelo) compuestas
de materiales de minerales meteorizados, materia orgnica, aire y agua. Es importante para la
preservacin de la biodiversidad, ya que en l se desarrollan procesos fundamentales para el
sostenimiento de la vida del planeta. Es un sistema estructurado, biolgicamente activo, habitado
por una gamma casi infinita de organismos, y en el cual se dan un sinnmero de interrelaciones
de carcter qumico, fsico y biolgico (Utadeo et al., 2002).

La importancia del suelo radica en que es un elemento natural dinmico y vivo que constituye la
interfaz entre la atmsfera, la litosfera, la biosfera y la hidrosfera, sistemas con los que mantienen
un continuo intercambio de materia y energa. Esto lo convierte en una pieza clave en el desarrollo
de los ciclos biogeoqumicos superficiales, y le confiere la capacidad para desarrollar una serie de
funciones esenciales en la naturaleza de carcter ambiental (Alexander, 1981).

Un suelo contaminado es aquel cuyas caractersticas han sido alteradas negativamente por la
presencia de compuestos qumicos de carcter txico y que representan un riesgo tanto para la
salud como para el medio ambiente. Por lo tanto, es necesario la creacin de modelos de gestin
ambiental que incluyan de forma integrada componentes fsicos, qumicos y biolgicos del suelo
en pro de la recuperacin y restauracin del suelo (Polo & Hernndez, 2002).

4.2 Dinmica de los plaguicidas en el suelo

La dinmica de plaguicidas en los suelos hace referencia a su comportamiento en el mismo,


dependiente de numerosos procesos que se llevan a cabo en la matriz edfica. A su vez, est
relacionada con el tiempo de permanencia del plaguicida en los suelos. La presencia de los
plaguicidas en los suelos produce por diferentes causas. Independientemente del uso especfico
que se haga del mismo, el suelo es el que recibe la mayora de los plaguicidas usados para la
proteccin de los cultivos (Arnold & Briggs, 1990) y dependiendo del mtodo de aplicacin entre
un 30% y 100% del plaguicida llega directamente hasta l (Fernandes, 2004).

El plaguicida, una vez incorporado al suelo, entra en un ecosistema dinmico y empieza a moverse
en el mismo, a degradarse "in situ", a desplazarse del sistema inicial a otros sistemas o a mantenerse
en l con su estructura original o ms o menos degradada durante un perodo de tiempo variable.

Cuando un plaguicida se introduce en el suelo, una parte de l se adhiere a las partculas del suelo
(especialmente a la materia orgnica) a travs de un proceso llamado adsorcin, y otra parte se
disuelve y se mezcla con el agua del suelo. La adsorcin de un plaguicida determinado ser mayor
en suelos con un alto contenido de materia orgnica. Por consiguiente, se considera que la
lixiviacin del plaguicida ser ms lenta en esos suelos que en los suelos con un contenido inferior
de materia orgnica (Bailey et al., 1973).

9
4.3 Caractersticas del DDT

En la literatura ambiental, el trmino DDT se usa para referirse a la mezcla de tres formas de
DDT: p,p-DDT (85%), o,p-DDT (15%) y pequesimas cantidades de o,o-DDT. Sus productos
de degradacin o metabolitos son todava txicos, el DDE (diclorodifenildicloroetileno) y el
DDD (diclorodifenildicloroetano) (Torres et al., 2007).

Figura 1. Estructura de DDT, DDE y DDD y sus ismeros correspondientes. Fuente: (Rogan
et al., 1979)

El DDT es un insecticida clorado que en su forma pura existe a temperatura ambiente y es


incoloro con un ligero olor aromtico. Este compuesto es altamente soluble en lpidos, adems
es muy estable y muy persistente en el medio ambiente (National Toxicology Program, 2011). El
DDT y sus derivados se reconocen como perturbadores endocrinos y son muy persistentes en el
medio ambiente adquiriendo la caracterstica de compuestos recalcitrantes (Turusov et al., 2013).

10
Tabla 2. Propiedades fisicoqumicas del DDT. (National Toxicology Program, 2011)

Propiedad Valor
Peso molecular 354.5
Gravedad especifica 0.98 to 0.99
Punto de fusin 108.5C
Punto de ebullicin 260C
Log KOW 6.91
Solubilidad en agua 5.50 106 g/l at 25C
Presin de vapor 1.6 107 mm Hg at
20C

El coeficiente de particin KOW es el ndice ms apropiado para cuantificar la bioacumulacin de


un plaguicida. Cuanto es mayor es el coeficiente, mayor es la probabilidad de que el compuesto
qumico este unido a la materia orgnica de suelos y sedimentos, y en ultimo termino migre a los
tejidos grasos de organismos vivos (Baird & Cann, 2014). De la tabla 2 se observa que la molcula
del DDT se encuentra en un rango de Log KOW >5, lo que explica la toxicidad, alta persistencia y
carcter no mvil del compuesto.

4.4 Origen y usos del DDT

El insecticida 1,1,1 - tricloro - 2 ,2-bis - ( 4 - clorofenil ) etano ( DDT ) ha sido utilizado


ampliamente para el control de plagas agrcolas, aunque su sntesis inicial fue en 1874 por un
estudiante alemn llamado Othmar Zeidler, las propiedades insecticidas del DDT fueron
explotadas mucho ms tarde, en 1939 (Smith, 1991;Turusov et al., 2013). Se utiliz en la Segunda
Guerra Mundial para combatir la malaria y luego fue empleado por civiles para proteger los
cultivos de algunos insectos. Sin embargo, debido a los impactos que se empezaron a notar en
1970, este compuesto fue prohibido por la EPA en EEUU y en la mayora de pases en 1972.

A pesar de que muchos contaminantes han estado presentes desde tiempos inmemoriales debido
a fenmenos naturales, la industrializacin y el uso intensivo de ciertas sustancias qumicas
contribuyeron a la contaminacin del medio ambiente (Megharaj et al., 2011). A raz de este hecho
en los ltimos aos ha surgido la necesidad de replantear modelos ambientales que permitan la
recuperacin de suelos que han sido contaminados con diferentes compuestos ya sean de origen
qumico o biolgico.

El DDT fue utilizado por el Ministerio de Salud en campaas de salud pblica para el control de
vectores de la malaria; pero debido a su impacto medioambiental se prohibi mediante la
resolucin 10255 de 1993 del entonces Ministerio de Salud. Entre los aos 1994 y 1995 el
Ministerio de Salud recogi el producto que haba quedado en poder de las unidades regionales y
ubic la mayor parte en la sede del municipio de Honda (Departamento del Tolima), quedando
una menor proporcin en las bodegas de Bogot y Cartagena (MAVD, 2006).

Acerca del DDT y de su caracterstica como contaminante orgnico persistente (COP), en el


convenio de Estocolmo se estableci que:

11
Los contaminantes orgnicos persistentes tienen propiedades txicas, son persistentes a la
degradacin, se bioacumulan y son transportados por el aire, el agua y las especies migratorias, a
travs de las fronteras internacionales y depositados lejos del lugar de su liberacin, acumulndose
en ecosistemas terrestres y acuticos

Dicho convenio fue firmado por el Gobierno Nacional en el ao 2001 y en proceso actual de
ratificacin busca proteger a los ecosistemas y a la salud humana de la presencia de doce
compuestos altamente persistentes en el medio ambiente, dentro de los cuales se encuentra el
DDT.

4.5 Existencias de DDT almacenados en Colombia

En Colombia se han encontrado existencias almacenadas hasta el ao 2006 de 159812 kg de DDT


en las ciudades de Bogot, Cartagena, Honda y Puerto Inrida, en su mayora propiedad del
Ministerio de la Proteccin Social, debido a su uso para el control de la malaria. Se estima un total
de 5000 m3 de suelo colombiano contaminado con DDT (MAVD, 2006). En la Tabla 3 se
presentan las cantidades almacenadas en Colombia.

Tabla 3. Cantidades almacenadas de DDT en Colombia hasta 2006, Fuente: (MAVD, 2006)

Departamento Lugar DDT kg


Bolvar Cartagena 1.890
Cundinamarca Bogot 21.920
Tolima Honda 135.402
Guaina Inrida 600
Total kg 159.812

En cuanto a la existencia de sitios contaminados, el estudio realizado por (MAVD, 2006)


confirm la presencia de suelo contaminado en los departamentos de Csar, el cual posee la mayor
cantidad de suelo contaminado, Bolvar, Tolima y Atlntico, tal como se muestra en la tabla 4 .La
ubicacin de estos sitios coincide con las zonas en las que se cultivan productos en los que se hizo
un uso intensivo de estos plaguicidas, principalmente las zonas algodoneras del pas.

Tabla 4. Suelo contaminado con COP hasta 2006, Fuente: (MAVD, 2006)

Departamento Cesar Bolvar Tolima Atlntico


Municipio Codazzi Copey Crdoba Flandes Barranquilla
Cantidad
estimada de 1.983,5 61.2 72 202 60
suelo (m3)

12
4.6 Impactos del DDT en el ambiente

4.6.1 Efectos en la salud

Con el amplio uso de los plaguicidas en el mundo, las preocupaciones sobre sus efectos en la
salud estn creciendo rpidamente. Hay una enorme cantidad de evidencia sobre la relacin entre
la exposicin a los pesticidas y la tasa elevada de enfermedades crnicas tales como diferentes
tipos de cncer, diabetes, enfermedades neurodegenerativas como el Parkinson, el Alzheimer y la
Esclerosis Lateral Amiotrfica (ALS), defectos congnitos y trastornos de la reproduccin;
adems de la evidencia de problemas respiratorios, principalmente asma (Mostafalou & Abdollahi,
2013).

Los efectos txicos de DDT y sus anlogos han sido estudiados ampliamente en animales de
laboratorio, por lo cual la Agencia Internacional de Investigacin del Cncer, IARC, clasifica el
DDT como probablemente cancergeno para los humanos en el Grupo 2A.

La exposicin a una alta dosis de DDT puede ocasionar la muerte. Dentro de sus efectos en
animales se han encontrado aumento en el peso del hgado, dao del citocromo P450, hipertrofia
de clulas hepticas y necrosis (Smith, 1991). Como el efecto insecticida del DDT prima sobre el
sistema nervioso del insecto, se ha observado que, en animales de laboratorio el DDT provoca
hiperactividad, temblores y convulsiones (Rogan & Chen, 2005).Tambin se ha reportado el DDT
como cancergeno en ratas y ratones en los cuales ocasiona principalmente tumores hepticos
(Smith, 1991).

El DDT en el cuerpo humano normalmente da lugar a parestesias, mareos, dolor de cabeza,


temblores, confusin y fatiga (Smith, 1991). La exposicin ocupacional se asoci con una
reduccin de atencin, de respuesta verbal, de velocidad visual, as como el aumento de los
sntomas neuropsicolgicos y psiquitricos (van Wendel de Joode et al., 2001).

Varios estudios han reportado que los contaminantes ambientales, incluyendo los contaminantes
orgnicos persistentes (COP), son factores importantes que pueden afectar la susceptibilidad a las
infecciones y el desarrollo de alergias y asma durante el primero ao de vida (Winans et al., 2011).
Es as como la exposicin infantil a compuestos rgano persistentes implica la interrupcin del
desarrollo adecuado tanto del sistema inmunolgico como del sistema respiratorio disminuyendo
de esta manera la capacidad para combatir enfermedades, generando un mayor riesgo al desarrollo
de manifestaciones alrgicas (Gascon et al., 2013) este efecto es observado principalmente en
exposiciones al DDE.

El DDT y el DDE se han encontrado en muestras de sangre, tejido adiposo y leche materna
(Torres et al., 2007). Esto se debe a que adems de la exposicin de los seres humanos al DDT
por cuestiones ocupacionales las cuales se dan a travs de inhalacin y por contacto drmico, est
se da por ingesta de alimentos contaminados (Snedeker, 2001) y al interior del cuerpo se acumula
en el tejido adiposo por sus propiedades lipoflicas. Es as como la eliminacin de estos
compuestos en el cuerpo humano se da mediante la leche materna y a travs de la va urinaria.

Un estudio en Mxico sobre los daos ocasionados por el DDT en la salud humana, determin
que la relacin de los efectos txicos y de sus metabolitos asociados alteran la reproduccin y el
13
adecuado desarrollo del feto (Torres et al., 2007). Con esto se sugiere la posibilidad de que este
compuesto acte como antagonista del embarazo en la etapa prenatal ocasionando el parto
prematuro, adems se considera fetotxico debido a que altera el sistema nervioso y como
consecuencia el desarrollo neuroconductual. En Amrica Central y Amrica del Sur, adems de
algunos pases en frica y Asia en los cuales el DDT ha sido usado en los ltimos aos para el
control de vectores, las concentraciones en tejidos humanos siguen siendo altas (Rogan et al.,
1979).

4.6.2 Efectos a la fauna

El principal problema del DDT es su caracterstica recalcitrante y su capacidad de bioacumularse


en la cadena alimentaria; es as como en las aves, la exposicin al DDT se produce a travs de la
cadena trfica debido a la depredacin de las especies acuticas y /o terrestres que tienen carga
corporal de DDT, como los peces, lombrices y otras aves. Los efectos sobre las aves se han dado
a nivel de reproduccin, afectacin en la cascara de huevo y muerte de embriones (WHO, 1989).
La reduccin en el espesor de las cascaras de huevo en aves se atribuy a efectos hormonales y
cambios en el metabolismo del calcio ocasionados por la presencia de DDT (Peakall, 1969). Otros
reportes indican la feminizacin de lagartos masculinos en el Lago Apopka en Florida (Guillette
et al., 1994), partos prematuros en conejos (Hart et al, 1971) y en leones marinos con altos niveles
de residuos de DDT (DeLong et al., 1973).

El uso indiscriminado de compuestos organoclorados en el suelo ha ocasionado fuertes impactos


sobre los ecosistemas agrcolas, es as como la presencia del DDT en el suelo causa lesiones en
plantas y reduce la productividad de los cultivos (Perfect et al., 1979). La presencia del DDT y de
sus metabolitos en el suelo conduce a una reduccin en la fertilidad (Mitra & Raghu, 1998).

4.7 Destino y comportamiento del DDT en el suelo

Los productos de degradacin del DDT en el medio ambiente del suelo son DDE y DDD, que
tambin son altamente persistentes y tienen propiedades qumicas y fsicas similares; debido a su
baja solubilidad en agua, el DDT se conservar en un mayor grado en los suelos y las fracciones
de suelo con una mayor proporcin de materia orgnica (WHO, 1989).

En el suelo, el DDT y sus metabolitos permanecen mucho tiempo. La degradacin en el suelo


ocurre por accin de microorganismos autctonos. Como estos compuestos se adhieren
fuertemente al suelo, algunas partculas de tierra pueden llegar hasta ros y lagos por escorrenta,
contaminando adems aguas subterrneas (ASTDR, 2002).

El DDT desaparece ms rpidamente cuando recin ha entrado al suelo. Posteriormente, la


evaporacin se hace ms lenta y cierta cantidad de DDT pasa a espacios en el suelo tan pequeos
que los microorganismos no pueden alcanzar al DDT para degradarlo. En climas tropicales, el
DDT puede desaparecer en mucho menos de un ao. En climas templados, la mitad del DDT
inicialmente presente generalmente desaparece en cerca de 5 aos. Sin embargo, en ciertos casos,
la mitad del DDT inicialmente presente permanecer por 20 o 30 aos o ms (ASTDR, 2002).

14
4.8 Degradacin del DDT

Aunque los compuestos de degradacin del DDT pueden ser generados por reacciones
fotoqumicas, los microorganismos juegan un papel importante en su formacin en centenares de
ecosistemas. Estos microrganismos pueden estar presentes de manera natural o ser inoculados
(Quensen et al., 1998). La degradacin del DDT en el ambiente puede tomar vas diferentes en
funcin de las condiciones a las cuales se someta, como se puede observar en el esquema de la
figura 2.

Figura 2. Vas alternativas en la degradacin del DDT

En lo que concierne la biodegradacin del DDT recientemente ha recibido la atencin de diversos


estudios. La biodegradacin bajo condiciones aerobias se presenta una lenta conversin a DDE,
mientras que bajo condiciones anaerobias la conversin hasta DDD resulta mucho ms rpida
por reacciones de decloracin reductiva(R. M. Atlas & Bartha, 1993). As, se ha reportado que en
suelos inundados el DDT se transforma a DDD, con una degradacin de 31 das en suelos de
rico contenido orgnico. De hecho, el reporte demuestra que la cintica de degradacin en este
ambiente anaerbico se incrementa con el contenido orgnico. Asimismo, el estudio prueba que
la degradacin aerobia es mucho ms lenta (Castro & Yoshida, 2002).

El ambiente anaerbico reducira el potencial oxido-reductivo del suelo, que activara a las
bacterias anaerbicas presentes en el medio, en tanto el mayor contenido orgnico facilitara
actividad de dichas bacterias al actuar como receptores de los electrones o hidrgenos que
resultaran de la funcin bacteriana. Es ms, en condiciones anaerobias el incremento de DDD

15
en el suelo aumenta el contenido bacteriano del suelo, aunque es capaz de inhibir enzimas tan
importantes como la deshidrogenasa (Mitra & Raghu, 1998).

4.8.1 Procesos metablicos en la degradacin anaerobia

La degradacin anaerobia describe diferentes procesos de tratamiento anaerobio. El principio


bsico comn entre ellos es el hecho de que la degradacin de la materia orgnica presente en los
residuos se logra sin requerimientos de oxgeno molecular; es un proceso natural en el cual una
variedad de especies de dos reinos totalmente diferentes trabajan juntos para convertir los
residuos orgnicos a metano, el cual es una excelente fuente de energa (Rittmann & McCarty,
2001).

Los estudios bioqumicos y microbiolgicos realizados hasta ahora, dividen el proceso de


descomposicin anaerobia de la materia orgnica en cuatro fases o procesos: hidrlisis, etapa
fermentativa o acidognica, etapa acetognica y etapa metanognica.

La primera fase es la hidrlisis de partculas y molcula complejas (protenas de carbono y lpidos)


que son hidrolizadas por enzimas extracelulares producidas por los microorganismos
acidognicos o fermentativos. Como resultado se producen compuestos solubles ms sencillos
(aminocidos, azucares y cidos grasos de cadena larga) que son fermentados por las bacterias
acidognicas dando lugar, principalmente, a cidos grasos de cadena cota, alcoholes, hidrogeno,
dixido de carbono y otros productos intermedios. Los cidos grasos de cadena corta son
transformados en cido actico, hidrogeno y dixido de carbono, mediante la accin de los
microorganismos acetognicos. Por ltimo, los microorganismos metanognicos producen
metano a partir de actico, H2 Y CO2.

Acidognesis

cido frmico
cido lctico
Hidrlisis
cido butrico
Polisacrido Azucares, Acetognesis
Protenas aminocidos
Triglicridos Metanognesis

cido actico CH4


CO2 CO2
Acetognesis H2O

Figura 3. Fases de la degradacin anaerobia. Fuente (Nayono, 2009).

16
4.8.2 Ruta de degradacin anaerobia del DDT

La degradacin del DDT bajo condiciones anaerobias sigue la ruta propuesta por (Wedemeyer,
1967), que se muestra en la Figura 4. Se propuso la decloracin reductiva para involucrar la
degradacin anaerobia de DDT. El paso inicial en la ruta de la biodegradacin anaerbica implica
deshalogenacin reductiva de DDT para formar DDD.

En la figura 4 las reacciones A, D, E y F son pasos mltiples cuyos intermediarios no han sido
plenamente identificados, los cuales son catalizados por la enzima dehalogenasa DDT reductiva
para producir DDD. El paso E y sus sucesores degradan DDM aerbicamente. Los pasos B y C
pueden ser reacciones no enzimticas. Synechococcus sp. y Klebsiella pneumoniae subsp., son los
organismos que pueden iniciar esta ruta de degradacin, pero otros microorganismos tambin
pueden llevar a cabo los pasos sucesivos posteriores (Betancur, 2013).

Las condiciones anaerobias optiman la descomposicin de algunos pesticidas clorados o su


conversin a otros compuestos en el suelo, demostrndose que la adicin de residuos de alfalfa
incrementa la conversin de DDT a DDD, ya que provee a los microorganismos de nutrientes
como carbohidratos solubles y aminocidos que ejercen un efecto favorable sobre la
transformacin (Ko & Lockwood, 1968).

4.8.3 Ruta de degradacin aerobia del DDT

La ruta de degradacin aerobia de DDT se presenta en la Figura 5. En condiciones aerobias, el


DDT sufre deshidrocloracin, que implica la eliminacin de HCl y la formacin de un doble
enlace entre los tomos de carbono en la cadena de alquilo de DDT.

En el paso A, el DDE es atacado por una dioxigenasa en las posiciones orto y meta. Este ataque
da como resultado al intermediario 2,3-dihidrodiol-DDE. En los pasos B y D, el 2-(4-clorofenil)-
3,3-dicloropropenoato produce, va decarboxilacion, el 1,1-dicloro-(4-clorofenil) etano, el cual
sufrir oxidacin en el lado aliftico de la cadena para producir 1,1-dicloro-(4-clorofenil) etanol,
que es nuevamente oxidado a 4-cloroacetofenona.

El grupo metilo terminal del 1,1-dicloro-(4-clorofenil) etano, sufrir tambin oxidacin para
producir cido fenilactico. En el paso C, la transformacin de 4-cloroacetofenona a 4-
cloronenzaldehido puede darse mediante oxidacin y subsecuente decarboxilacion del grupo
metilo terminal. En el paso E, el producto resultante del rompimiento del anillo ser degradado a
un cido clorado de 5 o 6 carbonos, dependiendo del sitio donde ocurra el rompimiento
hidroltico (Betancur, 2013).

17
Figura 4. Va anaerobia en la degradacin de DDT como sustrato propuesto por la Universidad
de Minnesota (University of Minnesota Biocatalysis, 1998).

18
Figura 5. Va aerobia en la degradacin de DDT como sustrato propuesto por la Universidad
de Minnesota (University of Minnesota Biocatalysis, 1998).

19
4.9 Biorremediacin del DDT

La biorremediacin es la aplicacin de los procesos biolgicos para el tratamiento de aguas


residuales, suelos y lodos. (Cookson, 1995) propone que la biorremediacin conlleva el uso de
enzimas provenientes de microorganismos, como catalizadores de la destruccin de un
compuesto peligroso especfico, esta sustancia puede o no ser el sustrato. Para que un proceso
de biorremediacin sea exitoso se requiere que los contaminantes sean biodegradables y estn
disponibles para los microorganismos.

Un enfoque mejor que estos mtodos tradicionales es destruir completamente los


contaminantes, o si es posible, al menos transformarlos a sustancias inocuas (Shinde, 2013). Es
as como la biorremediacin implica la capacidad de los microorganismos para eliminar
contaminantes y se ha presentado como la tecnologa ms prometedora, relativamente eficiente
y rentable para llevar a cabo el proceso de eliminacin de contaminantes (Megharaj et al., 2011).

As como en los tratamientos fsico-qumicos, las tcnicas de biorremediacin se pueden


clasificar en in situ o ex situ. En los tratamientos ex situ el suelo es excavado y transportado hasta
la localizacin donde se implementar la tecnologa, mientras que en los tratamientos in situ el
suelo es tratado en su emplazamiento natural. Para la seleccin del sistema de biorremediacin
y su integracin con otras tecnologas, es importante el conocimiento de las propiedades
qumicas y fsicas del xenobitico o contaminante.

La biorremediacin del DDT en los suelos o sedimentos, presenta una complicacin ya que
existe una fuerte unin entre el contaminante y las partculas slidas, de manera que la
disponibilidad de ste para ser degradado por microorganismos no es siempre posible.

4.9.1 Factores que intervienen en la biorremediacin

De acuerdo a sus propiedades y las caractersticas qumicas del plaguicida como en el entorno
en el que se encuentra depositado, la vida media de ellos puede variar de das a meses. Muchos
plaguicidas se degradan rpidamente en el suelo, proceso denominado mineralizacin, en el cual
el plaguicida es transformado en compuestos ms simples, como CO2, NH3 y H2O. El resultado
de este proceso es causado por reacciones de hidrolisis, fotolisis y tambin por procesos de
degradacin metablica mediada por microorganismos, los cuales utilizan los plaguicidas como
fuente de carbono. Segn el tipo de plaguicida del que se trate, su presencia en el suelo puede
generar una seleccin e induccin de microorganismos que pueden descomponer ms
rpidamente producto (Noguera Sols, 2008).

Los factores que influyen en la biodegradacin del DDT suelo est en funcin de varios aspectos,
pero principalmente de: su contenido de nutrientes, del tipo de suelo, de sus caractersticas
fisicoqumicas, materia orgnica, ciclos anaerobios/aerobios, as como, de las precipitaciones
pluviales y de la temperatura ambiental.
Tabla 5. Factores que intervienen en la biorremediacin del DDT en suelos Fuente:
(Sudharshan et al., 2012)

Factor Propiedad Efecto sobre los Efecto sobre el


microorganismos contaminante
Tipo de suelo Textura Diversidad de Biodisponibilidad del
microorganismos contaminante
presentes
Sorcin: incremento
Materia orgnica Actividad microbiana de la materia orgnica
en suelo
Condiciones del Humedad Efectos en Incremento
suelo Hidratacin y biodisponibilidad
metabolismo
Potencial redox Importante en Decloracin
metabolismo
anaerobio

pH Actividad microbiana

Temperatura Actividad metablica Afecta solubilidad,


varia con la sorcin, viscosidad y
temperatura volatilizacin.

A continuacin, se describen detalladamente los factores y su influencia tanto en los


microorganismos como en el contaminante.

4.9.1.1 Tipo de suelo

La textura se refiere a la composicin del mismo en grupos de partculas de diferentes tamaos,


de ah que los suelos puedan clasificarse en arenosos, limosos y arcillosos, dependiendo del grupo
de partculas que predominen en ellos.

Los suelos de textura fina (arcillosos) se compactan con ms facilidad. Esto reduce el espacio
poroso, lo que limita tanto el paso del aire como del agua a travs del suelo, limitndose as el
transporte de nutrientes y proliferacin de microorganismos aerobios (Foundation for
Agronomic Research, 1988).

4.9.1.2 Disponibilidad de nutrientes

Entre los nutrientes de mayor relevancia en el suelo se encuentran, el nitrgeno el fsforo y el


potasio. Diversas citas coinciden en sealar al nitrgeno como el principal limitante por su
intervencin en la formacin de protenas (Foundation for Agronomic Research, 1988).

21
Nitrgeno: es un componente esencial de protenas para las bacterias; la necesidad de nitrgeno
puede afectar la velocidad del crecimiento. Cuando hay poco nitrgeno, la poblacin microbiana
no tendr un desarrollo ptimo. En contraste, demasiado nitrgeno permite el crecimiento
microbiano rpido y acelera la descomposicin, pero ste puede crear problemas serios de olor
en condiciones anaerobias. Se debe considerar que el nitrgeno puede perderse rpidamente en
el suelo debido a la lixiviacin del amonio y el nitrato, y por la desnitrificacin del suelo (Refugio
et al., 2011).

Fosforo: El fsforo es necesario para formar los cidos nucleicos; forma parte de las membranas
celulares y necesario para el ATP (Adenosin trifosfato). En general, los suelos tienen un bajo
contenido de fsforo debido a su baja solubilidad y biodisponibilidad, pues precipita en presencia
de cationes como Ca+2, Mg+2 y Fe+3 en un pH desde neutro, hasta alcalino. El fsforo
orgnico en suelos se encuentra principalmente en los cidos hmicos, mientras que el fsforo
inorgnico se encuentra en combinacin con el Fe, Al, Ca, F. El fsforo es un elemento
deficiente en los suelos contaminados (Refugio et al., 2011).

4.9.1.3 Disponibilidad de donantes y aceptores de electrones

La respiracin microbiana no es ms que la energa que requieren para desarrollar sus funciones
vitales, mediante una secuencia compleja de reacciones oxidacin y reduccin. Mediante la
respiracin, los electrones son transferidos desde un donante a un aceptor a travs de un
transportador biolgico de electrones, produciendo energa qumica, la cual es almacenada en
molculas de trifosfato de adenosina (ATP). Por ende, la oxidacin se refiere a la remocin de
electrones de un tomo o una molcula y la reduccin es el proceso inverso (adicin de
electrones). El tipo de aceptor de electrones utilizado establece el tipo de metabolismo,
determinado las reacciones especificas pueden ocurrir o no ocurrir (Noguera Sols, 2008).

En muchos casos de deshalogenacin reductiva el compuesto halo-orgnico juega el papel de


aceptor final de electrones en respiracin anaerbica, donde la energa liberada en la oxidacin
del donador de electrones se utiliza para formar gradiente de protones y posteriormente para
sintetizar ATP. Este proceso se conoce con el nombre de halorespiracin o deshalorespiracin
y las bacterias implicadas en l normalmente son anaerbicas obligatorias. En este sentido, para
estimular la halorespiracin es necesario asegurar las condiciones anaerbicas y adicionar fuentes
de carbono y un donador de electrones (Arbeli, 2009).
En condiciones anaerobias los aceptores de electrones son con frecuencia el limitante, lo que
significa que existe una competencia entre el aceptor y poblaciones indgenas. Por lo tanto, el
aceptor de electrones en condiciones anaerobias afectar la composicin de la comunidad. As
el aceptor final, con mayor generacin de energa ser preferible al de menor generacin.
Los aceptores de electrones con potenciales de reduccin ms altas que se utilizan
preferentemente: O2> NO3-> halo-orgnicos> SO42-> HCO3-.

22
4.9.1.4 pH

Los microorganismos se desarrollan adecuadamente entre un pH alrededor del neutro (6-7),


debido al hecho que las enzimas (al ser aminocidos) requieren un grado de protonacin para
controlar su actividad, donde est a su vez es controlada por el pH (Alvarado et al., 2003). Es
por esto razn que muchos microorganismos no son capaces de tolerar valores extremos de pH,
debido a que algunos compuestos naturales tienden a hidrolizarse o se desnaturalizan algunas
enzimas (Atlas & Bartha, 2002).

4.9.1.5 Temperatura

La temperatura adecuada es uno de los factores ms importantes en la actividad microbiana o su


metabolismo. El metabolismo suele acelerarse con el aumento de temperatura hasta alcanzar un
valor ptimo, donde el crecimiento es mayor. Segn (Chapelle, 2001), la mayora de las bacterias
presentes en ambientes subsuperficiales son muy bajas.

4.9.1.6 Materia orgnica

La fraccin hmica del suelo proviene del metabolismo de la materia orgnica en el suelo. Se
divide en: cidos hmicos, cidos fulvicos y la fraccin insoluble de humus. La importancia de
la presencia de estos cidos radica en el hecho de que el DDT puede unirse qumicamente a esos
sin modificar considerablemente su estructura y a travs de las variaciones de pH que favorezcan
la solubilizacin de estos cidos el DDT puede verse conjuntamente solubilizado con ellos. Entre
ambos, el DDT presenta mayor afinidad por los cidos hmicos. No se ha reportado interaccin
qumica con la fraccin insoluble del humus (Lichtenstein et al., 2002).

4.9.1.7 Biodisponibilidad

La biodisponibilidad se ver incrementada en suelos inundados como el resultado del arrastre


del DDT unido a la fraccin orgnica transformada. Esto se ve sostenido por resultados que han
arrojado numerosos bioensayos, en los cuales el incremento en la LD50 demuestra una mayor
biodisponibilidad de DDT para ser incorporado en organismos para casos de suelo
inundados(Noguera Sols, 2008).

4.9.1.8 Humedad

La humedad es un factor prioritario en la biodegradacin de contaminantes del suelo, debido a


que la actividad microbiana, como el nmero de microorganismos, puede disminuir cuando el
contenido de la humedad se encuentra por debajo de los niveles ptimos.

Los microorganismos requieren de un medio acuoso para transportar los nutrientes y llevar a
cabo su metabolismo. Debido a que el agua es el mayor componente del citoplasma de las clulas,
una cantidad adecuada permitir el movimiento de nutrientes tanto al interior de las clulas,
como en la matriz del sistema. De acuerdo con ello, la humedad afecta entonces el crecimiento
y actividad microbiana: una baja cantidad de agua dar origen a zonas secas lo cual disminuira
dicha actividad, mientras que una alta cantidad de agua inhibir el intercambio de gases y por lo

23
tanto la transferencia de oxgeno dentro y a travs del suelo (lo cual dar origen a zonas
anaerobias). El contenido de humedad tambin depende de la materia orgnica y de la textura
del suelo: uno con alta cantidad de materia orgnica retiene ms agua y, por el contrario, suelos
arenosos retienen menos agua. El rango ptimo de contenido de agua en un suelo, para la
biodegradacin, suele estar entre el 30 y el 80% de la capacidad de campo (Refugio et al., 2011).
Bajo condiciones de inundacin de suelos, la materia orgnica acelera el consumo de oxigeno
por la flora de del suelo y provee un potencial reductor para la conversin de DDT a DDD. El
papel de la materia orgnica es el de enlazarse al DDT y solubilizarla (Noguera Sols, 2008).

4.10. Estrategias para aumentar la biodegradacin

4.10.1 Surfactantes

Una posible forma de aumentar la biodisponibilidad de compuestos orgnicos hidrofbicos,


como los compuestos organoclorados, en un suelo contaminado es mediante el uso de
surfactantes, que se caracterizan por tener una cabeza hidroflica y una cola hidrofbica.

Es un factor que controla el ataque microbiano de los compuestos xenobiticos. Muchos de


ellos son bastante hidrofbicos y, por tanto, no muy solubles en agua. La adsorcin de esos
compuestos xenobiticos a la materia orgnica y a la arcilla de suelos y sedimentos impide que
los microorganismos accedan a ellos.
La adicin de tensoactivos o emulsionantes suele aumentar la biodisponibilidad, y por ende la
biodegradacin de compuestos xenobiticos (Madigan et al., 2004). Sin embargo, estudios
realizados para biorremediar suelos contaminados con DDT demostraron que el efecto de la
adicin de un surfactante fue inhibitorio, al comparar con la remocin obtenida por tratamientos
de bioestmulo (Betancur, 2013).

4.10.2 Co-sustratos

Un nmero considerable de compuestos (glucosa, melaza, extracto de levadura, etanol, metanol,


piruvato, acetato, etc.) han sido usados en la literatura como co-sustratos en la degradacin de
pesticidas en suelos y sedimentos (Chang et al., 2008; Liang et al., 2007).

Generalmente, la presencia de estos sustratos podra incrementar la presencia de bacterias


hetertrofas en el suelo, as como hongos autctonos, y como consecuencia aumentar la
biodegradacin de compuestos organoclorados. Adems, el co-sustrato puede hacer variar la
relacin C:N en el suelo, favoreciendo el crecimiento microbiano e incrementando la produccin
de enzimas involucrados en la degradacin de compuestos organoclorados y sus intermediarios
(Lu et al., 2011). Sin embargo, el efecto de los co-sustratos tambin puede ser adverso, al
competir como fuente de carbono y energa con el contaminante presente en el suelo (Quantin
et al., 2005).

24
4.10.2.1 Melaza

La melaza es conocida por ser una eficiente fuente de carbono utilizada como co-sustrato para
la remediacin de contaminantes en el suelo. Siendo un subproducto importante de la
produccin de azcar, la melaza contiene acerca del 50% de azcar en forma de sacarosa, glucosa
y fructosa incluido carbono, nitrgeno, fsforo, vitaminas y minerales que pueden favorecer
significativamente un aumento en la actividad bacteriana.

La composicin de las melazas es muy heterognea y puede variar considerablemente


dependiendo de la variedad de caa de azcar, suelo, clima, periodo de cultivo, eficiencia de la
operacin de fbrica, sistema de ebullicin de azcar, tipo y capacidad de los evaporadores entre
otros. Por otro lado, la melaza de caa se caracteriza por tener grados Brix o slidos disueltos
de 68- 75% y un pH de 5.0-6.1 (Castro, 1993). Los valores promedio de la melaza se muestran
en la tabla 6.

Tabla 6. Composicin de la melaza de caa de azcar. Fuente (Vega-Baudrit et al., 2008)

Componente Composicin (%)


Agua 20
Sacarosa 35
Glucosa 7
Levulosa 9
Sustancias reductoras 3
Otros carbohidratos 4
Cenizas 12
Compuestos nitrogenados 4.5
Compuestos no nitrogenados 5
Ceras, esteroides y esterofosfolpidos 0.4

Se han realizados estudios con adicin de melaza para remediar suelos contaminados con PCBs
y explosivos (2,4,6-trinitrotoluene). (In et al., 2008) demostraron buenos resultados con
porcentajes de degradacin de TNT de aproximadamente de 97% con la adicin del co-sustrato.

4.11 Tratamientos de biorremediacin

Dos mtodos llevados a cabo para biorremediar suelos contaminados con DDT o con este tipo
de contaminantes como lo son los PCBs son la atenuacin natural y la bioestimulacin y se
describen a continuacin:

4.11.1 Atenuacin natural

La atenuacin natural es un mtodo de remediacin pasiva que depende de los procesos


naturales para degradar y disminuir los contaminantes en el suelo y el agua subterrnea (Kao et

25
al., 2001). Los resultados de la atenuacin natural dependen de la presencia o ausencia de los
microorganismos degradadores adecuados, oxgeno disuelto y el nivel de nutrientes y de la
biodisponibilidad de los contaminantes (Menendez-Vega et al., 2007).

Los contaminantes durante el proceso de atenuacin natural se transforman en compuestos


menos txicos mediante una serie de procesos que incluyen degradacin debida al metabolismo
microbiano, dispersin, dilucin, sorcin y volatilizacin (Brown et al., 2007).
Es ms frecuente, utilizar la atenuacin natural como una segunda etapa de recuperacin, tras
una primera fase en la que se aplica alguna otra tecnologa y se elimina con ella la mayor parte
de la contaminacin. En general, funciona mejor en los casos en que es posible eliminar la fuente
de contaminacin y, por tanto, dejan de incorporarse contaminantes al terreno.
Existe tambin la atenuacin natural monitoreada la cual consiste en controlar las condiciones
de la biodegradacin para crear un ambiente adecuado y permitir que se d con mayor velocidad
la degradacin del DDT. Katnek et al. (1999) reportaron atenuacin natural en un terreno
industrial contaminado con una mezcla de PCBs; se muestra que en condiciones de campo
ocurren algunos pequeos cambios en la composicin de los PCBs, explicada como algn tipo
de biodegradacin principalmente en las capas superficiales del suelo (Katnek, Demnerov,
Pazlarov, Burkhard, & Malterov, 1999).

4.11.2 Bioestimulacin

La bioestimulacin consiste en estimular a los microorganismos autctonos de un ambiente


natural por medio de la adicin de nutrientes y otros aditivos, de humedad y la aireacin del
sistema para as mejorar la eliminacin de los contaminantes. En lo que se refiere a la adicin de
nutrientes, la biorremediacin requiere que estos entren en contacto con el rea impregnada por
el contaminante y que su concentracin sea suficiente para soportar el crecimiento mximo
previsto de la poblacin degradadora en el transcurso de las operaciones de remediacin.

La degradacin microbiana del DDT en el suelo puede ser mejorada mediante la adicin de
nutrientes, as lo demuestran estudios como el de Bidlan et. al en el que concluyen que el
enriquecimiento del medio permite la degradacin del contaminante por el microorganismo
Serratia marcescens DT-1P (Bidlan & Manonmani, 2002).
La presencia de micronutrientes puede tambin afectar la reaccin de decloracin, como ha sido
demostrado con la presencia de hierro con estado de oxidacin cero, que actuando como agente
reductor y eficiente donador de electrones puede efectivamente ayudar en la decloracin de
DDT y sus metabolitos por parte de microorganismos del suelo (Yao et al., 2006). Caso similar
se observ para Shewanella decolorationis S12, la cual fue capaz de reducir DDT a DDD bajo
condiciones anaerobias, en la que la tasa de transformacin de DDT fue acelerada por la adicin
de -FeOOH, siendo la decloracin reductiva mejorada por el Fe(II) biognico en la superficie
del -FeOOH (Li et al., 2010).
Para determinar la cantidad de nutrientes a suministrar en el suelo se utiliza el modelo conceptual
de McCarty (Rittmann & McCarty, 2005) el cual consiste en proponer la degradacin del

26
contaminante hasta su forma ms oxidada y ajustar el balance estequiomtrico con fuentes de
fosforo y nitrgeno.

4.12 Reactor anaerobio de lecho esttico

El xito de un proceso de biorremediacin a escala piloto depende significativamente de la


compresin de aspectos ingenieriles como la biocintica, transferencia de masa (nutrientes y
oxigeno) y el diseo del biorreactor (Huang et al., 2012).

Un reactor de lecho esttico o fijo consiste bsicamente en una columna de relleno sobre la cual
se desarrollan y fijan las bacterias anaerbicas. El desarrollo de los microorganismos sobre un
medio slido hace que se logren tiempos de retencin celular muy elevados con bajos tiempos
de retencin hidrulica.

Los biorreactores pueden usarse para tratar suelos heterogneos y poco permeables, o cuando
es necesario disminuir el tiempo de tratamiento, ya que es posible combinar controlada y
eficientemente, procesos qumicos, fsicos y biolgicos, que mejoren y aceleren la biodegradacin
(Riser-Roberts, 1998). Es la tecnologa ms adecuada cuando existen peligros potenciales de
descargas y emisiones.

El diseo y el modo de operacin del reactor deber ser tal que permita monitorear estos
parmetros para controlar la degradacin del DDT y mantener activos los microorganismos all
presentes. Un factor importante es el coeficiente de transferencia de masa ya que la
determinacin de este permite conocer la etapa que controla el proceso de degradacin y sirve
para investigar la cintica qumica de la degradacin del producto orgnico contaminante
(Valverde Garcia et al., 1998).

4.12.1 Requerimientos ambientales


Algunos requerimientos de que se deben tener en cuenta en la operacin del reactor:

Nutrientes

Se requiere la presencia de macronutrientes (N, P, S) y micronutrientes (Fe, Zn, etc) en


proporciones adecuadas para atender las necesidades de los microorganismos. Estos elementos
se encuentran presentes en el lquido residual domstico.

Temperatura

La temperatura es una de las variables que ms influyen en el proceso, cuya eficacia decrece por
debajo de 15C ya que la depuracin se debe fundamentalmente a la sedimentacin, mientras
que por encima de 15 C la biodegradacin se incrementa. La temperatura afecta la actividad de
los microorganismos, determina la cantidad de energa neta producida e influye en la relacin
pH-alcalinidad. Los ambientes anaerbicos en relacin con la temperatura pueden subdividirse
en tres categoras: psicroflico (0 a 20C), mesoflico (20 a 40C) y termoflico (45 a 65C). Si el

27
intervalo de temperatura en el reactor cambia, es necesario arrancar el reactor de nuevo. En el
rango mesoflico, la actividad y el crecimiento de las bacterias disminuye a la mitad por cada
10C de descenso por debajo de 35C.

Los cambios de temperatura en el intervalo mesoflico pueden tolerarse normalmente, pero


cuando la temperatura desciende la carga tambin debe disminuirse de acuerdo con el descenso
de la actividad esperada.

pH

La influencia del pH sobre la produccin de metano est relacionada con la concentracin de


AGV (cidos grasos voltiles). Los diferentes grupos bacterianos presentan niveles de actividad
satisfactorios a pH prximos pero un poco diferentes; los hidrolticos entre 7.2 y 7.4, los
acetognicos entre 6.5 y 7.5. Las bacterias metanognicas disminuyen su actividad si el pH
aumenta por encima de 7.8.Cuando la capacidad metanognica est continuamente sobrecargada
y no se aade la base necesaria para neutralizar los AGV presentes, el sistema de tratamiento se
convertir en un reactor de acidificacin, el pH de este efluente estar entre 4.5 y 5.

Ausencia de oxigeno
Ausencia de sustancias txicas, tales como metales pesados, sulfuros.

4.12.2 Evaluacin de la actividad microbiana

Para evaluar la actividad microbiana se utiliza el test de AME (Actividad Metanognica


Especfica).

La AME puede definirse como la mxima capacidad de produccin de metano por un grupo de
microorganismos anaerobios, realizada en condiciones controladas de laboratorio que permita
la mxima actividad bioqumica de conversin del sustrato orgnico a metano (Chernicharo,
2007).
La determinacin de la actividad metanognica es una prueba de biodegradabilidad de gran
utilidad para el control del proceso de un tratamiento en un reactor anaerobio. El ensayo no solo
resulta aplicable para seleccin del inoculo sino tambin para la puesta en marcha y el
seguimiento del proceso.
Para cuantificar la produccin de metano, existen mtodos sofisticados con medicin
manomtrica o cromatografa o tan simples como el uso de mediciones volumtricas. El primero
demanda equipos con especificaciones tcnicas especiales (Ej. Sistema OXITOP para AME) y
el segundo necesita de un montaje sencillo, sin mayores requerimientos (Amaral et al., 2008).

4.12.3 Modelo cintico de degradacin

Las reacciones de degradacin de los pesticidas en suelos pueden seguir cinticas de distinto
orden. Pero de forma general, se pueden describir como modelos cinticos de primer orden que
describe la degradacin del plaguicida en funcin del tiempo.

28
La velocidad de degradacin depender principalmente de parmetros como pH, temperatura y
humedad. El pH generalmente ideal es el neutro, aunque en algunos procesos puede oscilar entre
6 y 9. En cuanto a la temperatura define el tipo de microorganismos presentes en el proceso y la
humedad es el medio de transporte del sustrato; estos parmetros son cruciales en el proceso de
degradacin por lo que deben estimarse de tal manera que se obtenga una velocidad mxima de
conversin del DDT a sus metabolitos y de sus metabolitos a compuestos menos txicos.
Se describen a continuacin las ecuaciones que llevan al modelo cintico de primer orden:
Balance de masa

La ecuacin general para el balance de masa es:


= ( ) (4.1)

Donde:

V: es el volumen del reactor, C: Concentracin del DDT. : Velocidad de reaccin.

Q: Velocidad de flujo.

Por ende, si el sistema opera en modo batch la ecuacin de balance de masa (4.1) se tendr un
trmino de masa acumulada igualada a masa generada o destruida. As:

= ( ) (4.2)

Ecuacin de velocidad

= = (4.3)

La velocidad de reaccin en este caso estar en trminos de la concentracin del DDT que es la
sustancia de inters. En este caso, n es el orden de la reaccin y k es la constante de reaccin.
Para este estudio se puede tomar n igual a uno (reaccin de primer orden) lo que implica que la
velocidad de reaccin depende slo de la concentracin de las especies. Integrando la ecuacin
4.3, se tiene lo siguiente:

= (4.4)
0

= (4.5)
0

Donde:

0 es la concentracin inicial del DDT, o sea la concentracin en el tiempo cero.

C: concentracin en el tiempo t.

29
Por lo tanto, una representacin grfica del logaritmo de las concentraciones en funcin del
tiempo arroja una lnea recta, cuya pendiente se puede relacionar con la constante de degradacin
(k).
Reordenando la ecuacin 4.5, se obtiene la siguiente expresin:

[0 /]
= (4.6)

4.12.4 Tiempo de vida media

El tiempo de vida media (1/2 ) del contaminante, definido como el periodo requerido para
reducir la concentracin del contaminante a la mitad, se puede calcular con la siguiente ecuacin
[2] 0,693
1/2 = = (4.7)

Los valores de (1/2 ) calculados para un determinado plaguicida pueden obtenerse a partir de
las numerosas tablas publicadas. Es de destacar que estos valores corresponden a medidas
realizadas a una temperatura y contenido de humedad especfico y normalmente a una actividad
microbiana ptima. Sin embargo, la biodegradacin tiende a disminuir en suelos secos y cuando
la temperatura disminuye (debido al descenso de la actividad microbiana). Por esta razn, para
un determinado compuesto cabe la posibilidad de poder encontrar un rango de variabilidad de
1/2 importante, que en algunos casos puede llegar a alcanzar varios ordenes de magnitud
(Noguera Sols, 2008).

Tabla 7. Tiempos de vida media del DDT de diferentes investigaciones

Especificaciones Concentracin Tiempo de Referencia


tratamiento DDT vida media
(mg/kg) (das)
Estudio de degradacin de
DDT aplicando lacasa de 4.8 24.75 (Zhao et al., 2010)
hongo de podredumbre
blanca
Biodegradacin anaerobia
y aerobia de DDT por 15.34 14 (Corona, 2000)
fermentacin en medio
slido

Decloracin anaerobia del


DDT en suspensin 80 12 (Liu, Xu, & Fan, 2015)
usando cido ctrico y
antraquinona-2,
6-disulfonato (AQDS)

30
5. OBJETIVOS
5.1 Objetivo General

Formular un modelo de gestin ambiental para biorremediar y/o recuperar suelos


contaminados con 1,1,1-tricloro-2,2-bis(4-clorofenil) etano (DDT).

5.2 Objetivos Especficos

Caracterizar fisicoqumicamente el suelo antes y despus del tratamiento de


biorremediacin mediante diferentes anlisis fsicos y qumicos recopilados de diversos
protocolos.
Evaluar protocolos de biorremediacin en condiciones anaerobias a escala de
laboratorio, permitiendo establecer el tratamiento ms eficiente en la degradacin del
contaminante.
Evaluar la tasa de remocin o degradacin del DDT en el reactor utilizando el proceso
de biorremediacin estimulada ex situ.
Identificar las poblaciones bacterianas presentes en el suelo antes y despus del
tratamiento de biorremediacin mediante tcnicas bioqumicas y moleculares.
Formular un protocolo ambiental que involucre la tecnologa de biorremediacin
estimulada ex situ a escala piloto mediante la incorporacin de un plan de manejo
ambiental para suelos contaminados con DDT.

5.3 Preguntas de investigacin

La problemtica a abordar con esta propuesta es el tratamiento de un suelo contaminado con


DDT aplicando mtodos de biorremediacin, lo cual permitan dar respuesta a los siguientes
interrogantes:

Cules son los valores de parmetros fisicoqumicos ptimos en el proceso de


biorremediacin que permiten degradar el DDT en un reactor anaerobio?

La gestin ambiental aplicada a suelos contaminados con DDT permitir disminuir o


atenuar el impacto generado por este pesticida hacia la salud humana y medio ambiente?

5.4 Hiptesis

La biorremediacin en condiciones anaerobias a travs de bioestimulacin con melaza y nitrato


de potasio mediante un reactor de lecho esttico es un modelo de gestin ambiental til para
tratar suelos contaminados con DDT.

31
6. METODOLOGA
Esta propuesta se llev a cabo en el Laboratorio del grupo de Investigacin de Biorremediacin
y Desarrollo Tecnolgico de la Universidad Nacional de Colombia sede Medelln ubicado en el
bloque M2 de la Facultad de Minas.

Las pruebas analticas para cuantificar concentracin de DDT a travs de cromatografa de gases
fueron determinadas en el laboratorio del Grupo Diagnostico y Control de la Contaminacin
GDCON. La caracterizacin molecular de los microorganismos aislados se identificaron en el
Grupo Centro Nacional Secuenciacin Genmica de la Universidad de Antioquia en la Sede de
Investigacin Universitaria SIU.

Recoleccin de suelo Municipio


Codazzi, Cesar

Caracterizacin fsico, qumica y


microbiolgica del suelo

Evaluacin protocolos de biorremediacin de DDT en condiciones Etapa 1


anaerobias a escala de laboratorio

Evaluacin tasa de degradacin de la estrategia seleccionada en la Etapa 2


etapa 1 mediante un reactor de lecho esttico

Identificacin bioqumica y molecular de cepas predominantes antes


despus del tratamiento de biorremediacin

Formulacin modelo de gestin ambiental para biorremediar suelos


contaminados con DDT, incorporando la estrategia planteada en este
estudio

Figura 6. Esquema de la metodologa de trabajo.

32
6.1 Materiales y mtodos

6.1.1 Equipos

Cromatografo Agilent GC, Medidor multiparmetro porttil Modelo: HQ40d de pH,


conductividad y potencial redox, Ro-tap, Cabina de flujo laminar horizontal, Plancha de
calentamiento, Balanza analtica APX-203, Schott, Horno de secado, espectrofotmetro HACH
termocupla, ultrasonido Branson 2510-DTH, Microscopio NIKON.

6.1.2 Reactivos

Para los ensayos de biodegradacin se us melaza adquirido de Tierragro, nitrato de potasio


Chem. Para el recuento en placa de bacterias hetertrofas Agar Luria Bertani Difco como
medio de cultivo y solucin salina al 0,9%. Para determinar el carbono orgnico se utiliz cido
sulfrico concentrado J.T Baker, dicromato de potasio Carlo Erba y sacarosa J.T Baker. Para la
determinacin de fsforo disponible en el suelo se emplearon molibdato de amonio Merck, cido
clorhdrico Merck, cloruro estannoso dihidratado Merck, fluoruro de amonio Merck y fosfato
monopotsico Merck. Las tinciones de Gram se efectuaron con Safranina Merck, Violeta de
Gram Albor, Etanol cetona MolLabs y Lugol MolLabs. Para la preparacin del gel y de la
electroforesis se utiliz Tert-butil-alcohol Merck y Bioline para la electroforesis. La reaccin en
cadena de polimerasa fue efectuada empleando kit Bioline. Agarosa grado molecular.

6.1.3 Recoleccin de la muestra de suelo

El suelo utilizado para esta investigacin fue recolectado en marzo de 2015 en el municipio
Agustn Codazzi, Cesar en el antiguo Colegio Instituto Tcnico Agropecuario Antonio Galo
Lafaurie Celedn. Se tomaron muestras de 3 puntos diferentes donde se removieron los
primeros 40 cm superficiales del suelo. Las imgenes del sitio de muestreo se encuentran en el
anexo 1.

El predio seleccionado se encuentra dentro del permetro urbano en la parte sur del municipio
y tiene un rea total aproximada de 2.4 Ha. Presenta un suelo de tipo franco y su uso haba sido
dedicado a la produccin de algodn hasta que en 1984 el centro administrativo y operativo de
la Federacin Nacional de Algodoneros dej de operar all. En 1997 CORPOCESAR realiz
estudios donde se detectaron concentraciones de plaguicidas en muestras de suelo tales como
Toxafeno, DDT y Endosulfn.

33
Figura 7. Puntos de muestreo en el municipio de Codazzi, Cesar. (Fuente: Google Earth)

Figura 8. Imagen tridimensional de la zona de muestreo. Fuente: (Realizada en software Grass


Gis)

34
6.1.4 Pretratamiento de la muestra de suelo

Las muestras de suelo recolectadas presentaban terrones de gran tamao y con el fin de mejorar
la homogeneidad de los contaminantes, el suelo fue triturado y posteriormente tamizado en un
equipo mecnico Ro-Tap, donde se redujo a tamaos de partcula de 2 mm.

6.2 Desarrollo del estudio

6.2.1 Montaje a escala de laboratorio

En la primera fase de este estudio se analiz el porcentaje de remocin de DDT utilizando la


melaza como sustrato secundario y nitrato de potasio (KNO3) como aceptor de electrones. El
montaje fue realizado en bandejas o microcosmos donde se deposit 1kg de suelo en cada una.

Tabla 8. Tratamientos evaluados a escala de laboratorio.

Tratamiento Especificaciones
1-Control Suelo estril
2-Atenuacin natural Suelo con DDT.
3-Bioestimulacin con melaza Suelo con DDT + co-sustrato
4-Bioestimulacin con melaza + KNO3 Suelo con DDT +co-sustrato y aceptor
5-Bioestimulacin con KNO3 Suelo con DDT + aceptor de electrones

6.2.2 Diseo experimental

El diseo de experimentos es completamente al azar con un factor (concentracin del DDT en


el suelo) y 5 niveles (correspondientes a los tratamientos en cada bandeja).

Tabla 9. Matriz de diseo experimental

Nivel de tratamiento
Numero de 1 2 3 4 5
experimento
[]0 X01 X01 X01 X01 X01
[] Xf1,Xf2,Xf3 Xf1,Xf2,Xf3 Xf1,Xf2,Xf3 Xf1,Xf2,Xf3 Xf1,Xf2,Xf3

Donde: X: factor medible (Concentracin de DDT en suelo)


0: estado inicial
F: estado final

35
6.2.3 Ensayos de biodegradacin

Cada tratamiento se hizo por triplicado para obtener datos estadsticos confiables. Se mantuvo
el suelo a la capacidad de campo que correspondi una humedad del 30% con el fin de generar
una baja transferencia de oxigeno dentro y a travs del mismo. La dosificacin de nutrientes fue
calculada mediante relaciones estequiomtricas establecidas por el mtodo de McCarthy entre la
concentracin de DDT presente en el suelo y la cantidad de nitrgeno y fosforo requeridos para
producir biomasa. Solo se adicion los nutrientes a los tratamientos 3, 4 y 5. Se cuantific la
concentracin inicial y final de DDT a travs de cromatografa de gases para todos los
tratamientos. En el anexo 2 se encuentran las fotografas del montaje.
Los parmetros de medicin para cada tratamiento son las mostradas en la figura 9. Se
monitorearon cada 4 das durante 1 mes

pH, humedad, potencial redox,


1-Control
temperatura, concentracin
DDT
2-Atenuacin natural
Concentracin de DDT,
3-Bioestimulacin con melaza Unidades Formadoras de Colonia,
conductividad, potencial redox,
temperatura, pH.
4-Bioestimulacin melaza + KNO3

5-Bioestimulacin con KNO3

Figura 9. Parmetros a controlar en cada tratamiento de biorremediacin.

A continuacin se describe las especificaciones de cada estrategia de biorremediacin aplicada.

6.2.3.1 Control

Este tratamiento fue necesario para controlar otras vas de degradacin de DDT diferente a la
biolgica. Se esteriliz 3kg de suelo en un autoclave operando a una temperatura de 121C y una
presin de 1.5 kg/cm3 durante 4 horas para evitar que el suelo se contaminara con
microorganismos. Adicionalmente se agreg una dosis de HCl 2M como inhibidor microbiano.
Para este tratamiento no se realiz recuento de bacterias hetertrofas.

36
6.2.3.2 Atenuacin natural

Este tratamiento mantuvo el suelo contaminado bajo las mismas condiciones ambientales y no
se adiciono ninguna fuente de carbono o energa. La humedad se mantuvo a la capacidad de
campo.

6.2.3.3 Bioestimulacin

Para los tratamientos 3, 4 y 5 se mantuvo una relacin de C:N:P de 100:5:1. La melaza adicionada
en las tratamientos 3 y 4 fue tomada con base a estudios realizados por (In et al., 2008) que
representa el 5% del suelo a tratar. Se adicion un total de 1.5 g de KNO3 como fuente de
nitrgeno y aceptor de electrones. Los nutrientes fueron administrados en el agua empleada para
controlar la humedad.

El clculo de los nutrientes se pudo establecer a travs del mtodo de McCarthy entre la relacin
estequiometrica de nitrgeno y fosforo requeridas para que las bacterias puedan mediante
reacciones anaerobias utilizar el contaminante presente en el suelo como fuente de carbono.

6.3 Caracterizacin fsico-qumica y microbiolgica del suelo

Con el propsito de llevar a cabo un tratamiento de biorremediacin eficaz se deben identificar


parmetros fsicos y qumicos que permitan condicionar el proceso. Esta caracterizacin fsico-
qumica del suelo se realiz en el Laboratorio de suelos de la Universidad Nacional de Colombia-
Medelln y se hizo al inicio y al final del tratamiento de biorremediacin. Se determinaron los
siguientes parmetros fiscos y qumicos:
6.3.1 Tcnicas de anlisis

Tabla 10. Pruebas experimentales para la caracterizacin fsico-qumica y microbiolgica del


suelo

Prueba experimental Tcnica analtica


Textura Mtodo del hidrmetro (Bouyoucos, 1962)
Densidad real Mtodo del picnmetro (Aguilera, 1989)
Potencial hidrgeno, pH Mtodo de dilucin (Jackson, 1964)
Contenido de agua Mtodo del horno (Jackson, 1964)
Carbono orgnico total Mtodo Walkley-Black (Walkley & Black,
1934)
Nitrgeno total Nitrgeno Kjendahl (Jackson, 1964)
Contenido nitrato Sulfato de aluminio
Contenido nitrgeno amoniacal Mtodo de Nessler (Nessler, 1999)
Contenido de fsforo P Mtodo Bray II (Bray & Kurtz, 1945)
Recuento en placa de bacterias (American Society of agronomy, 1982)
Coloracin Gram (Clinical Microbiology Procedures Handbook,
2010)

37
6.3.2 Potencial Redox

Se determin mediante una dilucin de 10 g de muestra de suelo de cada uno de los microcosmos
en 25 ml de agua destilada, en una relacin de 1:2.5. La mezcla se agit en vrtex durante 90
segundos, posteriormente se introdujo el electrodo, verificando que estuviera en contacto directo
con el suelo, se esper a que alcanzara un equilibrio trmico para registrar los milivolts y la
temperatura inicial. Despus de 30 minutos se introdujo el electrodo y se hizo la lectura hasta
que se estabilizara. Para la determinacin de este parmetro se emple una sonda redox (orp =
potencial de xido-reduccin) MTC10101, marca Hach.

6.3.3 Medicin humedad

Se realiz en cada uno de las bandejas, para ello se pesaron 5g de suelo. Posteriormente se pes
el recipiente que contiene la muestra, ste debe estar limpio y seco (Pc). Se pes el recipiente y
la muestra de suelo (Psh). Se sec a 105C por 24 horas hasta obtener peso constante. Luego se
llev al desecador hasta peso constante. Finalmente se pes el recipiente y la muestra de suelo
(Pss). El contenido de agua se calcul con la siguiente ecuacin:

( )
% = ( )
100

6.3.4 Potencial de hidrogeno pH

Se determin mediante el mtodo de dilucin. Se pesaron 10 g de muestra de suelo de cada uno


de los microcosmos en 25 ml de agua destilada, en una relacin de 1:2.5. Se solucin se agit en
vrtex durante 90 segundos, posteriormente se midi el pH con el electrodo de vidrio pre-
calibrado con multiparmetro porttil Modelo HQ40d.

6.3.5 Capacidad de retencin de agua en el suelo

Se realiz en el laboratorio un ensayo que permitira determinar la cantidad mxima de agua


capilar retenida en la muestra de suelo. Para esto se midi la masa del recipiente ms el papel
filtro hmedo ubicndolo en la parte inferior del recipiente. Seguidamente se adicion a la
capsula una masa de suelo seco de manera que no superara una altura de 1.5 cm con respecto a
la base del recipiente se tomaron un vaso con agujeros en la parte inferior y se agreg una
cantidad de suelo que no superara determinando la masa del conjunto cpsula + papel + suelo
seco (Mcp + Mss). Se golpe suavemente la base de la cpsula sobre madera para compactar el
suelo y mantener la continuidad de los poros. Luego, se transfiri el conjunto a una cmara de
humedad, de manera que la base de la cpsula estuviera en contacto con la superficie de la lmina
de agua y se esper hasta que el agua alcanzara la superficie del suelo tapando la cmara de
humedad y se mantuvo en un lugar fresco durante toda la noche. Luego de 12 horas se removi
el agua de la cmara y se coloc nuevamente la tapa, permaneciendo as durante 2 horas.
Finalmente, se determin la masa del conjunto incluyendo la masa del suelo saturado.

La mxima capacidad de retencin de humedad del suelo se calcul empleando la siguiente


ecuacin:

38
MCRH = (((Mcp + Msat) (Mcp + Mss)) / ((Mcp + Mss) Mcp)) * 100
6.3.6 Cuantificacin concentracin de DDT

La metodologa seguida para determinar concentracin de DDT se llev a cabo en 2 fases, una
primera fase de extraccin ultrasnica basada en el mtodo 3550C de la Agencia de Proteccin
Ambiental de Estados Unidos para la extraccin ultrasnica y una fase de limpieza del extracto.

6.3.6.1 Extraccin ultrasnica

Se pes 1g de suelo que fue transferido a un erlenmeyer de 125 ml. Posteriormente se agreg 1
g de sulfato anhidro de sodio para homogenizar la muestra. Luego se adicionaron 10 ml de una
mezcla de hexano y acetona 1:1. Los erlenmeyer fueron llevados dentro del ultrasonido evitando
contacto directo de los recipientes con la superficie del equipo, la extraccin se realiz durante
6 minutos. Luego de la extraccin, se permiti que el suelo sedimentara, y utilizando pipetas
Pasteur se transfiri el solvente de los Erlenmeyer a balones tipo pera. La extraccin con nuevas
fracciones de solvente se repiti dos veces ms y se colect el solvente en balones tipo pera para
posterior realizar la rotaevaporacin. Las muestras fueron rotaevaporadas a 55C hasta obtener
un volumen aproximado de 2 ml de extracto (Betancur, 2013).

6.3.6.2 Limpieza del extracto

La limpieza del extracto se llev a cabo con base en el mtodo 3630 C de la Agencia de
Proteccin Ambiental de Estados Unidos para la limpieza con slica gel (EPA, 1996). El extracto
rotaevaporado se transfiri a una columna cromatogrfica de vidrio provista con 1.5 g de slica
gel (desactivada y activada al 3.3% con agua ultrapura tipo milliQ) y 0.5 g de sulfato anhidro de
sodio. Posteriormente se eluy la columna con tres fracciones de solvente, una primera fraccin
de 8 ml de hexano, la segunda de 6 ml de hexano y una tercera de 1.5 ml de diclorometano. Las
tres fracciones se recolectaron y el solvente fue intercambiado a hexano luego de que el extracto
fuera secado con nitrgeno (EPA, 1996a).

6.3.6.3 Anlisis de cromatografa de gases

Los anlisis fueron realizados en un cromatgrafo de gases de marca Agilent GC con detector
de micro captura de electrones y una columna capilar ZB35HT Inferno Zebron Phenomenex
(30 m x 0.25 mm de dimetro interno y un grosor de pelcula de 0.25). Esta columna fue
seleccionada dada su habilidad de separar DDT. El programa de temperatura fue: empezando a
80C, con un gradiente de 15Cmin-1 hasta 160C y luego a 2.5Cmin-1 hasta 180C, en cuya
temperatura se mantuvo por 7 minutos. El gas de arrastre fue Helio. Los anlisis confirmatorios
se hicieron en un cromatgrafo de gases Agilent Technologies acoplado a un espectrmetro de
masas. El programa de temperatura fue: empezando a 80C, con un gradiente de 15Cmin-1
hasta 160C y luego a 2.5Cmin-1 hasta 180C, en cuya temperatura se mantuvo por 7 minutos.
El volumen de inyeccin fue de 1l de extracto, en modo splitless (Uniliner, Restek). Como
estndar interno se utiliz pentacloronitrobenceno marca Chemservice en tolueno. Se prepar
una solucin de 100 ppm. Los estndares de calibracin y extractos finales de suelo posterior al

39
paso de limpieza e intercambio de solvente eran dopados con 4 l de esta solucin. La
determinacin de los lmites de deteccin y cuantificacin se realiz mediante el mtodo de la
relacin seal/ruido planteado por US EPA. Method 8000B. Este mtodo indica que el lmite
de cuantificacin de un compuesto es aquella concentracin que produzca una seal diez veces
superior a la seal producida por el solvente (EPA, 1996b).

6.3.7 Recuento en placa de bacterias hetertrofas

Se utiliz el mtodo de recuento en placa por siembra en profundidad donde se utiliz el Medio
Luria Bertani, LB. Se prepar una dilucin de 1 gr de suelo en 9 ml de una solucin NaCl al
0.9% previamente esterilizada (10-1). Posteriormente se tom 1ml de la muestra y se transfiri a
un tubo con 9 ml de la solucin salina estril (10-2) y a partir de all se hicieron diluciones sucesivas
hasta llegar a la dilucin 10-4. Se realiz la siembra a partir de la dilucin 10-4 donde se tom 0.1
ml de la dilucin seleccionada y se coloc en la superficie del medio de cultivo. La siembra se
hizo por triplicado. Se incubaron una temperatura de 36C por un periodo de 3 das.

A partir de diluciones seriadas se establece cultivo en superficie en medio Luria-Bertani (LB)


para realizar el posterior conteo en placa mediante la ecuacin:
1
=

6.3.8 Caracterizacin bioqumica de bacterias aisladas

Despus de ser aisladas las bacterias predominantes en el tratamiento se identificaron


bioqumicamente las colonias representativas a travs de pruebas primarias como la tincin de
Gram y la prueba de catalasa.

6.3.8.1 Prueba de Catalasa

Para la deteccin de la catalasa se seleccion una colonia aislada y se coloc sobre un


portaobjetos limpio y seco, y se agreg una gota de perxido (H2O2 al 3%). La lectura se realiz
inmediatamente. Se considera una reaccin positiva la presencia de burbujas inmediatamente
despus de adicionar el perxido.

6.3.8.2 Coloracin Gram

Se fij sobre una placa de vidrio una muestra de la colonia aislada y se dej secar. Posteriormente
se agreg cristal violeta solo el suficiente hasta que cubriera el extendido bacteriano. Se dej
actuar durante 1 minuto y se lav con agua destilada. Seguidamente se agreg lugol y se dej
actuar durante 1 minuto. Se agreg alcohol-acetona por 30 segundos y se lav con abundante
agua. Finalmente se agreg fuscina por un minuto y se lav con agua. La placa fue puesta en un
Microscopio (90x-100x) y se agreg una gota de inmersin.

40
6.3.9 Caracterizacin molecular de los microorganismos

Esta fase de la metodologa se realiz en el Centro Nacional de Secuenciacin Genmica-CNSG


ubicado en la Sede de Investigacin Universitaria, a travs de la tcnica de extraccin de DNA
del suelo y posterior anlisis mediante amplificacin del gen ribosomal 16S (16S ADNr)
mediante reaccin en cadena de la polimerasa (PCR). De esta manera se pretende secuenciar los
microorganismos presentes al inicio y final del tratamiento mediante bsqueda y anlisis de
secuencias en GenBank.

6.3.9.1 Extraccin del DNA a partir del cultivo bacteriano.

La extraccin se realiz usando el kit de Thermo Scientific GeneJet Genomic DNA Purification
siguiendo el protocolo para bacterias Gram negativas. Para hacer la extraccin se tomaron
aproximadamente cinco colonias. Al finalizar el proceso de extraccin, se hizo la cuantificacin
del DNA por el mtodo de absorcin de luz a 260 nm (Nanodrop), adems se observ el DNA
en un gel de agarosa.

6.3.9.2 Amplificacin gen 16

Para la amplificacin del gen 16S ARNr se usaron los primers universales 27F (5
AGAGTTTGATCCTGGCTCAG 3 y 1492R (5 TACGGYTACCTTGTTACGACTT 3) que
aplificaron un fragmento de 1500 pares de bases (pb).

6.3.9.3 Secuenciacin y anlisis de los productos PCR

Las muestras fueron secuenciadas por el mtodo de Sanger/capilar. Para el anlisis de las
secuencias se utiliz el programa Geneious 5.6.5 creado por Biomatters, disponible en
http://www.geneious.com/. Utilizando este programa se editaron las secuencias, eliminando
fragmentos del cromatograma de baja calidad. A partir de la secuencia editada se realiz
bsqueda en la herramienta Basic Local Alignment Search Tool (BLAST), utilizando Standard
Nucleotide BLAST, con la base de datos de secuencias de ARN ribosomal 16S. Esta bsqueda
se optimiz mediante la opcin megablast, que permite la bsqueda de secuencias altamente
similares.

6.4 Montaje a escala piloto

En la segunda fase de esta investigacin se evalu la mejor estrategia de bioestmulo obtenida a


escala de laboratorio un reactor de lecho esttico. La degradacin se llev a cabo por
microorganismos inmovilizados en la fase slida (suelo). En la figura 10, se muestra el montaje
del reactor de lecho esttico usado en la bioestimulacin. El reactor conserv un escalado
geomtrico de las bandejas, relaciones de McCarthy y condiciones anaerobias. Para su diseo se
ampli a una escala 3:1 y se mantuvo a la capacidad de campo del suelo. As mismo, la cantidad
de nutrientes a adicionar se calcul de acuerdo a la relacin de McCarthy utilizada en el ensayo
a escala de laboratorio (relacin de C:N:P de 100:5:1).

41
10a
10b

Figura 10. Reactor de lecho esttico (a). Dosificacin de nutrientes melaza y KNO3. (b). Puesta
en marcha del reactor.
Las dimensiones del reactor fueron, 50 cm de ancho, 77 cm de largo por 27 cm de alto con
volumen total de 0.1 m3. El material del reactor fue elaborado en acrlico con un espesor de 5
mm. La cantidad de suelo que se agreg al reactor fue de 60 kg con un 30% de humedad
correspondiente a la capacidad de campo del suelo. Cada lado del reactor contaba con 4 puertas
de 2 x 2 cm con el fin de verificar parmetros fsicos, qumicos y biolgicos en diferentes puntos
de muestreo. Dentro del reactor se instalaron tuberas con pequeos agujeros para capturar el
metano producido en el proceso anaerobio y calcular la actividad metanognica por
desplazamiento de la solucin NaOH al 5%.

6.4.1 Parmetros de medicin en el reactor

La duracin de la estrategia fue de 33 das. Se monitorean variables de medicin tales como pH,
potencial redox, humedad, conductividad, recuento de bacterias hetertrofas, temperatura. As
mismo se tomaron muestras de suelo cada 4 das para cuantificar concentracin de DDT y de
esta manera determinar la cintica de degradacin del contaminante.

6.4.2 Evaluacin de la actividad metanognica

El mtodo volumtrico se basa en la cuantificacin del volumen de metano producido mediante


el uso de una sustancia desplazante, como el NaOH (Field et al., 1987), por su propiedad de
reaccionar con el CO2 presente en el biogs, permitiendo una medicin ms aproximada del
volumen de metano producido (Chernicharo, 2007).

Para esta prueba se prepar una solucin de NaOH y se verific que el pH fuese mayor a 12 con
el fin de capturar el CO2. El biogs producido en el reactor fue conducido a travs de las tuberas
instaladas hasta llegar a la botella con la solucin alcalina. El CO2 es absorbido y el volumen de
gas metano desplaza un volumen igual de la solucin alcalina. El volumen de solucin alcalina
desplazada fuera de la botella es equivalente al volumen de biogs generado en el sistema. El
NaOH desplazado fue recolectado en una probeta para medir el volumen.

42
7. RESULTADOS
En este captulo se presentan los resultados de la caracterizacin fsico-qumica y microbiolgica
realizada a escala de laboratorio y a escala piloto. Se analiza el porcentaje de remocin de DDT
en las bandejas en presencia del co-sustrato y el aceptor de electrones. As mismo el
comportamiento de la tasa de degradacin de DDT en el reactor a lo largo del tiempo de
experimentacin. Se presenta la identificacin de las bacterias antes y despus del tratamiento de
degradadacin. Finalmente se detalla el plan de manejo ambiental para biorremediar suelos
contaminados con DDT con la informacin obtenida en este estudio.

7.1 Caracterizacin del suelo

7.1.1 Determinacin de parmetros fsicos

A. Caracterizacin fsico-qumica

En la tabla 11 se presentan los resultados de la caracterizacin fsico-qumica del suelo antes y


despus de la aplicacin de estrategias de biorremediacin. La caracterizacin del suelo despus
de aplicar el tratamiento fue determinada para el suelo tratado en el reactor.

Tabla 11. Caracterizacin fsico-qumica del suelo

Suelo Suelo con


Caractersticas contaminado tratamiento
sin tratamiento (Reactor)
Textura
A% 38 40
L% 36 36
Ar% 26 24
Clase Franco Franco
pH 6.6 7.3
Contenido de agua % 1.4 34.5
Conductividad elctrica dSm-1 0.12 1.2
Densidad real g/cm3 2.67 2.68
Materia orgnica % 1.9 1.7
Nitrgeno total % 0.05 0.2
N-NO3 mg kg-1 4 3
N-NH4 mg kg-1 14 23
P mg kg-1 120 127
Capacidad de intercambio catinico 9.7 -
[ ] DDT mg kg-1 (bandejas) 72.35 5.41
[ ] DDT mg kg-1 (reactor) 72.35 6.12

43
Para analizar la caracterizacin fsico-qumica inicial del suelo a tratar es necesario mencionar
algunas propiedades presentes en esta regin, la cual la diversidad en los procesos de formacin
de suelos ha determinado una amplia variabilidad en las caractersticas edficas. En esta regin
existen desde suelos con incipiente desarrollo como es el caso de los Inceptisoles, hasta suelos
con alto grado de meteorizacin como los Oxisoles (Instituto Geogrfico Agustn Codazzi,
1986). Esto se traduce en una amplia variabilidad de sus propiedades qumicas y fsicas y su
caracterizacin lo demuestra. En cuanto al rgimen de humedad son zonas secas y de buen
drenaje, lo que indica que en estos suelos posiblemente han determinado tasas ms altas de
mineralizacin de la materia orgnica. La textura predominante es de tipo franco arenoso y
franco.

De acuerdo a los resultados obtenidos guarda una relacin con la variabilidad en las propiedades
fsico-qumicas de los suelos en esta zona. Se obtuvo que el suelo recolectado es de clase franco,
con textura relativamente suelta y por la caracterstica que se le asocia a este tipo de suelo
presentan una adecuada retencin de humedad por la arcilla presente, lo que indica una ventaja
para la aplicacin del tratamiento anaerobio. Su pH inicial muestra que est en un rango
adecuado para llevar a cabo los tratamientos de biorremediacin. Sin embargo, su contenido de
humedad es muy bajo y es necesario aplicar una humedad entre el 30 - 40 % para poder
proporcionar condiciones anaerobias en el suelo. En cuanto a la cantidad inicial de materia
orgnica, nitrgeno total, N como NO3, y N como NH4 est entre valores medios. El valor inicial
de fosforo disponible indica que tiene un valor alto y es caracterstico de suelos en esta zona. Se
obtuvo un valor de CIC (capacidad de intercambio catinico) medio, lo que implica que la
capacidad de retener nutrientes no es tan buena y esto explica la concentracin inicial de
nutrientes en el suelo.

Posterior a la aplicacin del tratamiento de bioestimulacin en el reactor, se puede comparar con


la caracterizacin inicial del suelo sin tratamiento. El pH aument de 6.6 a 7.3 y esto se debe a
la aplicacin de nutrientes en solucin (nitrato de potasio) con valores de pH que varan en el
rango de 7,5-8. As mismo el nitrgeno total y N como NH4 aumentaron debido a la adicin de
melaza y nitrato de potasio, fuentes constituidas por compuestos nitrogenados.

B. ndice de Shannon

Se determin la diversidad microbiana del suelo expresada con el ndice de Shannon el cual
refleja la heterogeneidad de una comunidad sobre la base de dos factores: el nmero de especies
presentes y su abundancia relativa.
El anlisis microbiolgico arrojo que la muestra de suelo contaminada con DDT contena
1.54x104 unidades formadoras de colonia y un ndice de Shannon de 1.380.22 estimado por
permutaciones. Este ndice es bajo y representa que tiene poca diversidad microbiana.
Tabla 12. ndice de Shannon antes de aplicar el tratamiento

Unidades formadoras de ndice de Shannon Numero de morfotipos


colonia
1.54 x 104 1.380.22 6

44
7.2 Calculo dosificacin de nutrientes

El procedimiento para calcular la dosis de nutrientes a travs de la ecuacin de McCarthy:

Semi-reaccin donador de electrones Rd


1 7 1 7 13
C H Cl + 15 H2 O 12 Cl + 30 CO2 + 12 H + + e (7.1)
60 14 9 5

Semi-reaccin de aceptor de electrn Ra


1 6 1 3
NO3 + 5 H + + e 10 N2 + 5 H2 O (7.2)
5

Semi-reaccin de sntesis de clulas Rc


1 1 1 1 9
CO2 + 20 CO3 + 20 NH4 + + H + + e 20 C5 H7 O2 N + 20 H2 O (7.3)
5

La reaccin de energa es Re = Ra Rd

La reaccin de sntesis es Rs = Rc Rd

Calculando la reaccin de energa Re obtenemos:

1 1 7 1 7 1 2
C H Cl + 5 NO3 + H + 10 N2 + 30 CO2 + 12 Cl + 15 H2 O (7.4)
60 14 9 5 6

Calculando la reaccin de sntesis Rs se obtiene:


1 1 1 1 1 1 1 1
C H Cl + 20 HCO3 + 20 NH4 + + 60 H2 O 20 C5 H7 O2 N + 12 Cl + 30 CO2 + 12 H +
60 14 9 5
(7.5)

La reaccin global se obtiene a travs de la siguiente ecuacin:

R = fe R e + fs R s

Donde fe, fraccin de la oxidacin para energa

fs, fraccin asociada con la generacin de biomasa.

fe + fs = 1, y para este caso se tomar el valor de fe=0,60

Aplicando el mtodo de McCarthy para el DDT, se obtiene la siguiente reaccin global (7.6.)

14 9 5 + 7,23 + 1,2 4 + + 1,2 3 1,2 5 7 2 + 3,6 2 + 9,2 2 +


5 + 4,4 2 + 5 +

45
Los pesos moleculares de las especies que participan son:


14 9 5 = 354,49 , 4 = 14, 3 = 60

Las relaciones moleculares de las especies reactantes son:

60 14 14
1: 7.2 ( ) : 1.2 ( ) : 1/6 1/2 ( )
354.49 354.49 354.49

1: 1.12: 0.0473: 0.79

Por lo tanto, por cada 100 gr de DDT se necesitan 112 gramos de 3 como aceptor de
electrones, 4,73 gramos de nitrgeno y 0,79 gramos de fosforo.

La relacin aproximada de C:N:P es de 100:5:1.

7.3 Ensayos de biodegradacin a escala de laboratorio

7.3.1 Concentracin de DDT en las bandejas

En la figura 11 se presenta una grfica de la concentracin residual de DDT para cada uno de
los tratamientos evaluados. La concentracin final se obtuvo a partir de promedios de cada
replica realizada del tratamiento. Las barras de error positivo y negativo corresponden a las
desviaciones estndar de la medicin.

70
Concentracin DDT residual (mg/kg)

60 Control
Atenuacin
50 Melaza
Melaza-KNO3
40 KNO3

30

20

10

0
Figura 11. Concentracin final de DDT para cada tratamiento en las bandejas

46
Tabla 13. Valores medios de la concentracin final de DDT (mg kg-1) en los tratamientos

Tratamientos Media Desviacin


estndar
Control 50.89 1.87
Atenuacin 44.46 3.25
Melaza 20.02 8.29
Melaza-KNO3 5.41 1.36
KNO3 21.55 1.23

En el tratamiento de atenuacin natural la concentracin de DDT disminuy desde una


concentracin inicial de 72.35 mg/kg a un valor medio de 44.46 3.25 mg/kg indicando un
porcentaje de remocin del 32.85%. Para los tratamientos, 3) bioestimulacin con melaza hubo
una reduccin en la concentracin desde 72,35 mg/kg hasta un valor medio de 20.02 mg/kg
8.29. A diferencia de la estrategia 4) bioestimulacin con melaza-KNO3, la concentracin se
redujo a un valor medio de 5.41 mg/kg 1.36. Para la bioestimulacin nicamente con adicin
de KNO3 la concentracin de DDT logr reducirse hasta 21.55 1.23 mg/kg.

Los porcentajes de remocin para las estrategias aplicadas 3), 4) y 5) fueron de 72.3, 92.5 y 70.2%
respectivamente. El tratamiento de control present una disminucin en la concentracin de
DDT luego de 33 das desde una concentracin inicial de 72.35 mg/kg a un valor medio de 50.4
mg/kg 1.88 (porcentaje de remocin de 30.3 %).

De acuerdo lo anterior el tratamiento ms efectivo fue la estrategia de bioestmulo con adicin


de melaza y KNO3 (tratamiento 4). Esto indica la necesidad de un co-sustrato para mejorar el
metabolismo del contaminante.

7.3.2 Anlisis de Datos

Se determin un anlisis de varianza de un factor (ANOVA) con el propsito de comparar si los


tratamientos de biorremediacin aplicados presentan diferencias significativas en la degradacin
del DDT. El resultado del anlisis fue elaborado en el software Statgraphics Centurion y se muestran
en la tabla 14.

Tabla 14. Anlisis de varianza

Grados de Suma de Cuadrado Valor F Valor p


libertad cuadrados medio
Modelo 4 4227.81 1056.95 62.06 5.05 x 10-7
Error 10 170.31 17.03
Total 14 4398.12

47
De acuerdo a los resultados obtenidos, el valor alto de F es un indicio de que la aplicacin de los
nutrientes en forma individual y combinada produce un efecto en el porcentaje de remocin de
DDT en los diferentes protocolos de biorremediacin, lo que indica que si existe diferencia
significativa entre las medias de los 5 tratamientos.
Para comprobar la homogeneidad de las varianzas se utiliz el test de Brown y Forsythe. El
valor-p es menor que 0.05, lo que indica la igualdad de las varianzas en los tratamientos aplicados.

Tabla 15. Prueba de homogeneidad de varianzas

GL Suma de Cuadrado Valor Valor


cuadrados medio F P
Modelo 4 48.72 12.18 4.27 0.25
Error 10 76.18 7.62

En la figura 12 se muestra una comparacin de todas las posibles combinaciones dos a dos de
los valores medios obtenidos en cada estrategia de biorremediacin.

KNO3 Melaza-KNO3

KNO3 Melaza

KNO3 Atenuacin

KNO3 Control

Melaza-KNO3 Melaza
Diferencia no significativa
Melaza-KNO3 Atenuacin Diferencia significativa
Melaza-KNO3 Control

Melaza Atenuacin

Melaza Control

Atenuacin Control

-60 -40 -20 0 20 40

Figura 12. Comparacin de medias usando Test Tukey

48
En los resultados arrojados demuestra que no hay diferencia significativa al aplicar los
tratamientos 3) melaza, 5) KNO3 y los tratamientos 1) control, 2) atenuacin. Esto indica que el
efecto de suplementar nitrato de potasio (KNO3) y melaza de forma individual producen
relativamente el mismo efecto en la biodegradacin de DDT en el suelo. A diferencia de los
tratamientos 3)-4), 4)-5), 2)-4), 2)-3) que si presentan una diferencia significativa en la
concentracin final del contaminante.

7.3.3 Comportamiento de los parmetros fsicos y qumicos en las bandejas

Potencial redox en las bandejas

En la tabla 16 se muestra los valores de potencial redox para cada tratamiento durante el tiempo
de muestreo. Para los ensayos se observa que las medidas de Eh (mV) fueron significativamente
diferentes en los tratamientos 1, 2 y 5.

Tabla 16. Valores de potencial redox para los tratamientos a escala de laboratorio

Potencial redox( mV)


Tratamientos Tiempo (das)
1 4 8 13 17 21 25 29 33
1.Control 150.7 140.6 120 82.3 70.6 30.5 20.3 8.34 -1.5
2.Atenuacin natural 122 95.9 80.3 50.7 45.3 20 -1.5 -5.1 -18.3
3.Melaza -10.1 -13.6 -63.1 -125.8 -140 -160.2 -176 -180 -185
4.Melaza + KNO3 -89.4 -90.2 -105 -113.9 -119 -124 -163 -231 -265
5.KNO3 73.5 65.8 56.5 34.3 1.5 -35.5 -50.3 -72.2 -80.8

Este parmetro indica una medida cuantitativa del estado de oxidacin de las sustancias en el
sistema, y permite representar el estado de oxidacin de los compuestos susceptibles de ser
empleados como principal aceptor de electrones para los microorganismos.
Un valor Eh positivo (condiciones aerobias) y de alta magnitud es indicativo de un ambiente que
favorece las reacciones de oxidacin. Del otro lado, un valor Eh negativo (condiciones
anaerobias) y de baja magnitud es indicativo de un ambiente altamente reductor.

Variacin del pH en las bandejas


En la figura 13 se muestra la variacin del pH para cada uno de los protocolos. El tratamiento
control descendi a pH 2 debido a la adicin de HCl. Para el tratamiento 3 el pH del suelo
disminuy a valores cercanos a 5 y esto se debi a la aplicacin de melaza el cual tiene un rango
de pH de 5.5-6. Los tratamientos 2 y 5 presentaron un pH neutro.

49
Control
9
Atenuacin
Melaza
8 Melaza + KNO3
KNO3
7

6
pH

2
0 5 10 15 20 25 30 35
Tiempo (Das)

Figura 13. Comportamiento del pH para los tratamientos en las bandejas durante los das de
medicin

Variacin de la humedad en las bandejas


En la figura 14 se muestra la variacin de la humedad para cada da de muestreo. Los rangos de
sus valores iniciales estuvieron comprendidos entre una humedad del 27% y el 31 % para todos
los tratamientos. La humedad nunca estuvo por debajo del 23% ni por encima de su nivel de
saturacin 40%, ya que no se observ lixiviado.
En los primeros das de tratamiento se observa que el protocolo 4 presenta mayor porcentaje de
humedad con un rango de variacin de 31-26%, y se debi a la cantidad de agua presente en la
solucin de melaza-KNO3. En la segunda semana hubo una disminucin de la humedad en
todos los ensayos de biodegradacin asociado posiblemente a procesos fsicos, lo cual fue
necesario la dosificacin de agua a todos los tratamientos el da 12, con el fin de mantener la
humedad requerida. Dentro de este intervalo, se mantuvo una adecuada hidratacin de los
microorganismos, favoreciendo a su vez el mantenimiento de una temperatura optima del suelo.

50
40

38

36

34
% Humedad

32

30
Control
28
Atenuacin
26 Melaza
Melaza+KNO3
24
KNO3
22
0 5 10 15 20 25 30 35
Tiempo (das)

Figura 14. Comportamiento de la humedad para los protocolos de biorremediacin durante


los das de medicin

Variacin de la conductividad en las bandejas

En la figura 15 se presenta la variacin de la conductividad medida en cada tratamiento durante


los 33 das de experimentacin. El tratamiento de control arrojo valores altos comprendidos
entre un rango de (9500 8000) S/cm y esto se debi a la adicin de HCl el cual es un
electrolito fuerte. Los tratamientos 2 y 5 presentaron un comportamiento similar en sus valores.

51
10000

9000

8000

7000
Conductividad (uS/cm)

Control
6000
Atenuacin
5000 Melaza
Melaza + KNO3
4000
KNO3
3000

2000

1000

0
0 5 10 15 20 25 30 35

Tiempo (das)

Figura 15. Comportamiento de la conductividad en los tratamientos durante el tiempo de


muestreo

Variacin de la temperatura en las bandejas

Tabla 17. Valores de temperatura en los tratamientos para cada tiempo de muestreo

Temperatura (C)
Tratamientos Tiempo (das)
1 4 8 13 17 21 25 29 33
1.Control 29 29.2 28.4 28.7 29.1 28.5 28.9 29 29.3
2.Atenuacin natural 28.1 28,4 28.8 28.1 28.3 28 28.7 28.3 28.5
3.Melaza 28.2 28.7 28 28.1 28.6 28.1 28 28.2 28.3
4.Melaza + KNO3 29 28.9 28.7 28.8 28.9 28.8 28.6 28.9 28.8
5.KNO3 28.1 28.4 28.2 28.6 28 28.1 28.3 28.5 28.4

En la tabla 17 se presentan los valores de temperatura para cada tratamiento. Los valores
oscilaron en un rango similar (28C-29C) para cada estrategia de biorremediacin.

52
7.3.3 Recuento de bacterias hetertrofas para los protocolos

La figura 16 se presenta el recuento de bacterias hetertrofas durante el tiempo de seguimiento


de las estrategias. Se realizaron siembras en profundidad cada cuatro das en Agar Luria Bertani.

Se observ un notable incremento de UFC (unidades formadoras de colonias) en la primera


semana de tratamiento que se mantuvo hasta la segunda semana para los tratamientos 3) Melaza,
4) Melaza y KNO3 y 5) KNO3. Para la 3 semana la cantidad de bacterias hetertrofas disminuy
considerablemente. Para el tratamiento de atenuacin natural las UFC presentaron un
comportamiento estable durante el tratamiento debido a que no hubo adicin de fuentes de
carbono.

4
6x10

Atenuacin
4
5x10 Melaza
Recuento de hetertrofos (UFC)

Melaza-KNO3
KNO3
4
4x10

4
3x10

4
2x10

4
1x10

0 5 10 15 20 25 30 35
Tiempo (Das)

Figura 16. Crecimiento bacteriano en los protocolos de biorremediacin para cada tiempo de
muestreo

53
7.4 Resultados montaje a escala piloto

En esta segunda fase de la investigacin se presentan los resultados obtenidos del tratamiento 4
evaluados a una escala mayor. Se detallan la variacin de los parmetros fsicos y microbiolgicos
medidos en 4 puntos del reactor. As mismo se muestran los resultados obtenidos en la
identificacin molecular.

7.4.1 Comportamiento de parmetros fsicos y qumicos en el reactor

En la figura 17 se presenta una grfica sobre el comportamiento de los valores de potencial redox
en el reactor. Se observa que los valores de Eh (mV) en esta escala difieren un poco en los valores
obtenidos a escala de laboratorio. El rango de variacin del potencial estuvo entre -70 mV y
-125 mV.

Potencial redox en el reactor

-40

-60
Punto 1
Punto 2
Punto 3
Potencial redox (mV)

-80
Punto 4

-100

-120

-140

0 5 10 15 20 25 30 35
Tiempo (das)

Figura 17. Comportamiento del potencial redox en el reactor para cada tiempo de muestreo

54
Variacin del pH en el reactor

En la figura 18 se presenta los valores de pH en los 4 puntos de muestreo en el reactor de lecho


esttico. Los valores varan entre un valor inicial de 5-5.5 hasta alcanzar un pH en el suelo de
7.2. Durante la primera semana se presenta un pH acido, incrementndose hasta la tercera
semana con valores neutros. Para las ltimas semanas el pH presenta un notable cambio.

7,5

7,0

6,5
pH

6,0
Punto 1
Punto 2
5,5 Punto 3
Punto 4

5,0

0 5 10 15 20 25 30 35
Tiempo (das)

Figura 18. Comportamiento del pH el en el reactor para cada tiempo de muestreo

Variacin de la humedad en el reactor

Tabla 18. Valores de la humedad en el reactor

Humedad (%)
Puntos de Tiempo (das)
medicin 1 4 8 13 17 21 25 29 33
Punto 1 33 34,5 33,4 32,3 32,1 32,3 32,1 31,3 31,2
Punto 2 34,4 34,2 33,2 33,4 33,2 32,5 31,4 31,2 31,2
Punto 3 35,3 34,6 33,4 33,1 32,3 32,6 32,6 32,2 31,2
Punto 4 34,3 34,2 34,3 32,7 33,2 32,7 31,3 31,2 31,1

55
Variacin de la temperatura en el reactor

Punto 1
29,0 Punto 2
Punto 3
Punto 4
28,5
Temperatura (C)

28,0

27,5

27,0

26,5

0 5 10 15 20 25 30 35
Tiempo (das)

Figura 19. Valores de temperatura en el reactor para cada tiempo de muestreo

En la figura 19 se presentan los valores de temperatura en los 4 puntos de muestreo del reactor.
La temperatura se mantuvo inicialmente en un rango cercano a 28C durante los primeros das
de tratamiento. En la primera semana hubo un descenso en la temperatura en todos los puntos
debido a cambios climticos presentados en el da de medicin. El punto 3 fue el que report
valores ms altos de temperatura y esto se debi a la ubicacin del sitio de muestreo de este
punto en el reactor.

7.4.2 Medicin de la actividad metanognica

La produccin de metano en el reactor fue casi nula. Durante el tiempo de ensayo, solo se pudo
recolectar 5 ml de solucin desplazante (NaOH) los das 13 y 14, esto significa que an bajo
condiciones anaerobias la metanognesis no es dominante en el sistema, indicando la no
presencia significativa de una poblacin de microorganismos metanognicos entre la flora nativa.

56
7.4.3 Cintica de degradacin en el reactor

Con el objeto de estudiar la tasa de biodegradacin de DDT en el reactor de lecho esttico., se


tomaron muestras a diferentes tiempos del tratamiento de bioestimulacin (4, 8, 12, 16, 20, 24,
28, y 32 das).

En la figura 20, se presentan los resultados de la concentracin de DDT residual para cada da
de muestreo

Se observa que la concentracin DDT decrece hasta la segunda semana, sin embargo, para el da
24 se presenta un aumento leve de la concentracin de DDT (14%). En la semana 3 y 4 la
concentracin del contaminante disminuye y permanece constante hasta finalizar el tiempo del
tratamiento.

80

70

60
DDT residual (mg/kg)

50

40

30

20

10

0
0 5 10 15 20 25 30
Tiempo (das)

Figura 20. Grfico de la concentracin de DDT residual en el reactor

En la figura 21 se muestra la grfica Ln (C/C0) vs tiempo de muestreo. Los valores negativos


representan el decaimiento de la concentracin a lo largo del estudio y se observa que la
concentracin de DDT decrece con el incremento del tiempo de tratamiento.

57
Ecuacin Ln (C/Co)=-kt
0,0 Ajus. R-cuadra 0,91134
Valor Error estandar

Intercepto -0,36453 0,16084


--
-0,5 Pendiente -0,07706 0,00845

-1,0
Ln(C/Co)

-1,5

-2,0

-2,5

0 5 10 15 20 25 30
Tiempo (das)

Figura 21. Grfica de Ln (C/Co) vs tiempo en el reactor

De acuerdo a la grfica anterior se observa que la biodegradacin de DDT se ajusta a una cintica
de pseudo-primer orden (r2=0.91). A partir de la ecuacin (4.4) planteada anteriormente se
obtuvo de la pendiente, una constante de degradacin de k=0.077/da y un tiempo de vida media
de t1/2= 8.9 das.

7.4.4. Recuento de bacterias hetertrofas para el tratamiento en el reactor

En la figura 22 se observa el comportamiento del crecimiento bacteriano en el reactor aplicando


la bioestimulacin con melaza-KNO3. Para la primera semana hay un aumento en la cantidad de
unidades formadoras de colonia, mientras que en la tercera semana se observa un descenso. El
punto 3 de muestreo es el de mayor crecimiento bacteriano y es debido al aumento de
temperatura en ese punto. Se observa que el valor mximo de microorganismo es de 3.8 x 104
UFC/g suelo.

58
Recuento de hetertrofos (UFC) 4,0x104
Punto 1
punto 2
3,5x104 punto 3
punto 4
3,0x104

2,5x104

2,0x104

0 5 10 15 20 25 30 35
Tiempo (das)
Figura 22. Crecimiento bacteriano en el reactor durante el tiempo de muestreo

7.4.5 Caracterizacin bioqumica de las bacterias aisladas

Se identificaron bacterias predominantes a travs de pruebas bioqumicas tales como Coloracin


Gram y prueba de la catalasa. En la figura 23a (suelo contaminado con DDT) se puede apreciar
Gram positivos que se encuentran en forma de barra o vara (bacilos) y de color violeta
caracterstico que se les denomina a las bacterias que lo presentan Gram positivas.

Para la figura 23b (suelo despus del tratamiento de bioestimulacin) presenta caractersticas
similares a las de la figura 23b: bacterias bacilos Gram positivos.

59
23a 23b

Figura 23. Microscopia ptica en objetivo 100x. (a) Bacterias suelo contaminado. (b)
bacterias despus del tratamiento de bioestimulacin.

En la tabla 19 se presenta los resultados obtenidos de la tincin de Gram y prueba de la


catalasa para los morfotipos aislados. Para la B1 la prueba de la catalasa arrojo un valor
positivo. A diferencia de B2 negativo indicando que la bacteria no contiene la enzima
catalasa.

Tabla 19. Resultados de las pruebas de tincin de Gram y catalasa para los dos morfotipos
aislados.
B1 B2
Gram + +
Morfologa Bacilo Bacilo
Catalasa + -
B1: Bacterias suelo contaminado
B2: Bacterias suelo despus del tratamiento

7.4.6 Identificacin de las bacterias aisladas

Se logr extraer el DNA y amplificar exitosamente el gen 16S de las muestras en estudio.
Segn la herramienta Blastn, se detectaron secuencias homologas para las muestras B1
(bacteria suelo contaminado) y B2 (bacteria suelo despus del tratamiento) al gnero

60
Bacillus, las cuales se usaron como referencias para el posterior anlisis filogentico para
las muestras.

De acuerdo con la matriz de distancia, la secuencia B1 es muy cercana a la secuencia de


referencia de Bacillus circulans con una distancia de 0,010. Esto fue corroborado en el rbol
filogentico realizado por el mtodo de Neighbor joining, en el cual se observan estas
secuencias formando un grupo hermano con un bootstrap de 50. En el anexo se muestra
el rbol filogentico.
La secuencia B2 es muy cercana a la secuencia de referencia de Bacillus megaterium con una
distancia de 0,002. Esto fue corroborado en el rbol filogentico realizado por el mtodo
de Neighbor joining, en el cual se observan estas secuencias formando un grupo hermano
con un bootstrap de 99. En el anexo se muestra el rbol filogentico de la muestra B1 y
B2.
Tabla 20. Resultados de la identificacin molecular de los aislados B1 y B2

Aislado Descripcin Porcentaje de


identidad
B1: Suelo Bacillus sp. S20403 16S 99%
contaminado ribosomal
RNA gene, partial sequence
B2: Suelo Bacillus sp. strain BPR176 16S 100%
despus del ribosomal RNA gene, partial
tratamiento sequence

Por tanto, se plantea que las bacterias identificadas en el suelo contaminado es Bacillus
circulans y para el suelo despus de la aplicacin del tratamiento de bioestimulacin es
Bacillus megaterium.

61
8. DISCUSIN
El planteamiento de modelos de gestin ambiental enfocados en el tratamiento de suelos
contaminados con plaguicidas es an un tema de investigacin debido a los mltiples factores
que se requieren a la hora de descontaminar suelos. Aunque actualmente en Colombia se ha
avanzado en el establecimiento de normativas de regulacin para la gestin de residuos
peligrosos, entre estos los plaguicidas, las metodologas de tratamiento para este tipo residuos
que integren soluciones econmicas y ambientalmente favorables son relativamente escasas.

Para contribuir a la solucin de esta problemtica, en el presente trabajo se ensayaron


tratamientos de biorremediacin ex situ, a travs de enriquecimiento al suelo con fuentes de
carbono y energa, con el fin de mejorar el metabolismo del contaminante y proporcionar un
crecimiento de las poblaciones nativas presentes en el suelo. Se evaluaron tratamientos a escala
de laboratorio y escala piloto con la adicin de melaza y nitrato de potasio. El suelo empleado
para los tratamientos fue caracterizado a travs de parmetros fsicos, qumicos y
microbiolgicos al inicio y final del tratamiento.

De acuerdo a los resultados obtenidos se estableci la fuerte relacin que existe entre las
propiedades fsico-qumicas y microbiolgicas que tiene el suelo a la hora de plantear
tratamientos de biorremediacin. En la zona donde se recolecto el suelo, present una textura
de clase franco, lo que indic una gran ventaja para aplicar estrategias en condiciones anaerobias
debido a la adecuada retencin de humedad que posee este tipo de suelo. Aunque la
concentracin inicial de los nutrientes presentes en el suelo tales como materia orgnica,
nitrgeno total, N como NO3 y NH4 estuvo en un rango medio, por lo que debi ser
suplementada a travs de una relacin de C:N:P (100:5:1) planteada por el mtodo de McCarthy.
A diferencia de la cantidad de fosforo (P) el cual fue relativamente alta y caracterstica en suelos
de esta zona, no fue necesario la adicin de una fuente de fosforo. Por otra parte, la evaluacin
del ndice de Shannon del suelo contaminado determin un promedio de riqueza observada con
seis morfotipos de colonias, lo que se infiere poca riqueza.

La aplicacin de los protocolos de tratabilidad a escala de laboratorio permiti seleccionar el


mejor tratamiento de biorremediacin. El mejor desempeo en la biodegradacin del DDT fue
evidenciado por el tratamiento 4 con adicin de la solucin melaza-KNO3. Se obtuvo una
disminucin en la concentracin de 72.35 mg DDT/ kg suelo hasta 5.41 mg DDT/ kg suelo lo
que representa un porcentaje de remocin de 92.5%. A diferencias de los tratamientos de
atenuacin natural, adicin de melaza y adicin de KNO3 que reportaron porcentajes de
remocin del 32.8, 72.3% y 70.2% respectivamente.

La degradacin del tratamiento control present una tasa de remocin del 30.2% que se puede
atribuir a factores abiticos como transformaciones qumicas por la adicin de HCl. De igual
forma existe la posibilidad de que algunas comunidades de microorganismos pueden llegar a
tolerar ambientes extremos, como es en este caso donde el suelo presento un pH cido.

La efectividad del tratamiento 4 radica principalmente en que la presencia de un co-sustrato


puede incrementar la presencia de bacterias hetertrofas en el suelo, y como consecuencia

62
aumentar la biodegradacin del DDT. Esta solucin suplementada, melaza-KNO3, produce un
efecto sinrgico ya que la melaza al tener una compleja composicin de azucares, protenas,
minerales, entre otros, contenga una alta carga microbiana y combinado con un aceptor final de
electrones con un alto potencial reductivo (NO3-), hace que el metabolismo del contaminante
se acelere, y se produzcan altas tasas de degradacin, como se obtuvo en este tratamiento 4.

Es de notar que despus de tan solo 33 das de tratamiento el DDT logr degradarse a un
porcentaje de remocin alto (92.5%). Esto verifica estudios previos, donde se comprob que la
decloracin reductiva de DDT en condiciones anaerobias es mucho ms rpida que la
deshidrocloracin en condiciones aerobias (Atlas & Bartha, 1993).

Aunque el alcance de esta investigacin no abarc la cuantificacin de los metabolitos DDD y


DDE. Estudios realizados por (Atlas & Bartha, 1993), demostraron que bajo condiciones
aerobias ocurre la formacin de DDE, mientras que en condiciones anaerobias se forma DDD
y es mucho ms rpida que la transformacin a DDE. El metabolito DDE es un compuesto ms
persistente y txico que el mismo DDT por lo tanto no es deseable que se acumule en el suelo,
lo que justifica la aplicacin de tratamientos anaerobios en el proceso de biodegradacin del
DDT.

En cuanto a los parmetros fsicos, qumicos y microbiolgicos medidos a lo largo de la


experimentacin a escala de laboratorio fueron determinantes para conocer el comportamiento
de la tasa de biodegradacin del DDT. Se monitorearon los parmetros de pH, potencial redox,
temperatura, humedad, conductividad y recuento de biomasa.

Para los tratamientos a escala de laboratorio, el potencial redox desde el inicio fue
significativamente diferente para las estrategias 1), 2) y 5) con valores positivos hasta la tercera
semana. Estos resultados mostraron que la aplicacin de un co-sustrato y un compuesto aceptor
de electrones podran mejorar la capacidad de reduccin del sistema de reaccin. El efecto de
los valores Eh en la solucin de melaza- KNO3 fue mayor que en el tratamiento donde se
adicion solo la melaza. Esto se debe a que la reaccin sinrgica entre estos dos nutrientes
produce la disminucin en los valores de Eh (mV). Por otra parte, teniendo en cuenta la relacin
ya mencionada anteriormente entre el potencial redox y tratamientos en condiciones anaerobias,
se infiere que para el tratamiento 4 donde se obtuvo valores de Eh ms negativos entre un rango
de -89.4 mV y -295 mV, se present un notable aumento en la tasa de decloracin reductiva de
DDT y se explica debido a que este compuesto se degrada ms fcil en ausencia de oxgeno.

El pH es un factor fsico importante que influye en la biodegradacin de compuestos


organoclorados, ya que puede afectar la actividad microbiana y la biodisponibilidad de las fuentes
de carbono y energa (J T Dibble, 1979). En previas investigaciones se ha demostrado que la
degradacin de DDT y metabolitos es ms favorable a pH cercano a 7, que a valores de pH
bsicos cercanos a 9 (Alexander, 1981).

Durante los tratamientos en las bandejas se presentaron variaciones en los valores de pH. Para
el tratamiento control, el pH vari en un rango de 2-2.5 debido a la adicin de una solucin de
HCl. Esta condicin genera toxicidad a los microorganismos y afecta la degradacin de
compuestos organoclorados. Para el tratamiento 3 el pH del suelo disminuy a valores cercanos

63
a 5 y esto fue causado por la aplicacin de una solucin de melaza el cual tiene un rango de pH
de 5.5-6. El tratamiento 2 mantuvo el valor de pH de 7.1 y su comportamiento fue similar a lo
largo del estudio, debido a que no se le adicionaron nutrientes.

El comportamiento del pH para el tratamiento 4 tuvo aumento de pH 5.5 a 7.2, esto se pudo
haber dado por la adicin de los nutrientes. Es de notar que el efecto de una mayor tasa de
degradacin de DDT se pudo asociar al comportamiento del pH ya que el tratamiento 4 se
desarroll en el rango ptimo. Para el tratamiento con adicin de nitrato de potasio (KNO3)
present un rango de variacin de pH entre 7-7.5 y se explica a que este nutriente en una solucin
con agua provoca un efecto prcticamente neutro en el suelo, de aqu porque el rango de
variacin de estos valores.

La temperatura y la humedad son factores fsicos que afectan directamente la biodegradabilidad


de los plaguicidas, puesto que son dos condiciones ambientales indispensables a tener en cuenta
para el desarrollo microbiano (Casellas et al., 1995).
El comportamiento de la temperatura en los protocolos de tratabilidad se mantuvo alrededor de
28C-29C el cual se encuentra en el rango ptimo para que la actividad microbiana, se mantenga
en condiciones ambientales estables y permita llevar a cabo la biodegradacin del DDT.

Para la humedad, los valores iniciales en todos los tratamientos variaron entre un 27% y 31 %
de humedad. Esto pudo proporcionar condiciones anaerobias necesarias en el sistema. Se
observa que los tratamientos 3 y 4 mostraron valores ms altos en el tiempo de degradacin, y
esto se debi a la adicin de soluciones de melaza, el cual contiene cantidades de agua que
aportaron al tratamiento. Para la segunda semana hubo una disminucin en la humedad del suelo
a causa de procesos fsicos, lo cual fue necesario la dosificacin de agua el da 12 a todos los
tratamientos y esto se evidencio en la grfica. Este parmetro influy notablemente en el
potencial redox, debido a que el tratamiento 4, que presento mayor humedad report valores
ms altos en su Eh.

La conductividad elctrica (CE) medida a lo largo del estudio present valores con diferencias
considerables para los tratamientos 1, 3 y 4. Para el control los valores de CE oscilaron entre
(9500-8000) S/cm y se debi a la adicin de una solucin de HCl el cual es un electrolito fuerte.
Para el tratamiento 4, entre la primera y segunda semana el valor de CE se mantuvo en un rango
alto de (2300-2500) S/cm, que se debi principalmente al contenido de sales presentes en la
melaza, provocando consigo un aumento en la conductividad. Este rango clasifica a un suelo
ligeramente salino, el cual no es adecuado ya que la acumulacin de sales solubles puede afectar
la biodisponibilidad del contaminante e inhibir la capacidad de biodegradacin de la microflora
autctona (Kstner et al., 1994). Sin embargo, para la tercera semana y hasta el final del
tratamiento, la CE del suelo disminuy a 1200 S/cm, valor que se encuentra en un rango
adecuado de acuerdo a la clasificacin planteada por (Laboratorio de Salinidad, 1974). El
tratamiento 3 present un comportamiento similar con valores de CE entre un rango de (2500-
2500-2600) S/cm.

A diferencia de los tratamientos 2 y 5, los valores de CE fueron inferiores. Para la estrategia 2,


la conductividad estuvo en un rango de (110-112) S/cm, valor que coincide con la
conductividad inicial del suelo sin la adicin de nutrientes. Para el tratamiento 5, la CE estuvo

64
en un rango ptimo de 500 S/cm. Esto se explica a la fuerte afinidad que existe entre el catin
K+ y anin NO3- que lo hace altamente soluble, por lo que la aplicacin de KNO3 deja muy
pocos iones disueltos en el suelo que puedan generar un aumento de la salinidad.

El recuento de hetertrofos a escala de laboratorio present un aumento en la primera semana


de UFC (unidades formadoras de colonias) y que se mantuvo hasta la segunda semana para los
tratamientos 3) Melaza, 4) Melaza-KNO3 y 5) KNO3. Para la 3 semana la cantidad de bacterias
hetertrofas disminuy considerablemente. Se observ que el tratamiento 4 present una
densidad de poblacin bacteriana mayor en comparacin con las estrategias 3) y 5) con un valor
mximo de 5.4 x 104 UFC/g suelo, este resultado pone de manifiesto una vez ms el porcentaje
de remocin alcanzado para este tratamiento debido a la biomasa generada. Para el tratamiento
de atenuacin natural las UFC presentaron un comportamiento estable durante el tratamiento
debido a que no hubo adicin de fuentes de carbono y energa.

Para la fase dos de este estudio, se evalu el tratamiento 4 a escala piloto mediante un reactor de
lecho esttico durante un periodo de 33 das. Se conserv un escalado geomtrico, la relacin
C:N:P de 100:5:1 y una humedad del 30 %. Se determinaron en 4 puntos de muestreos ubicados
dentro del reactor parmetros fsicos, qumicos y microbiolgicos que fueron medidos a lo largo
del estudio.

Los resultados obtenidos a escala piloto evidencian un comportamiento similar en los valores de
los parmetros fsicos y qumicos medidos a escala de laboratorio.

La concentracin de DDT en el reactor se redujo desde una concentracin inicial de 72.35


mg/kg hasta una concentracin final de 6.12 mg kg-1, lo que representa un porcentaje de
remocin de 91.54%. Este valor es relativamente similar al porcentaje obtenido en el tratamiento
aplicado en la bandeja. Sin embargo, se esperaba que el porcentaje de remocin fuese ms alto
debido a que se mejoraron las condiciones anaerobias.

En cuanto a la cintica de degradacin en el reactor se ajust a una ecuacin cintica de primer


orden, lo que indica concordancia a estudios reportados anteriormente por (Chiu et al., 2004).
La constante de degradacin obtenida indica que diariamente desaparece 0.0784 partes de
contaminante y el tiempo de vida media es de 8,8 das. Este valor pudo determinar que la tasa
de biodegradacin de DDT aumenta con la aplicacin de tratamientos en condiciones anaerobias
y la importancia de adicionar al suelo un co-sustrato y un aceptor de electrones con alto potencial
reductivo, el cual permitan aumentar la actividad enzimtica.

Estos resultados coinciden con estudios recientes realizados por (Liu et al., 2015) para la
descontaminacin de suelos con DDT en condiciones anaerobias, donde se lograron obtener
tiempos de vida de entre 8 y 12 das con la adicin de cido ctrico
y 2,6- disulfonato antraquinona.

Cabe mencionar que algunos estudios de laboratorio muestran que la cintica de la degradacin
calculada a partir de las reacciones normalmente utilizadas en estudios no se puede aplicar
cuando la concentracin de plaguicidas es extremadamente baja o muy alta (Fernandes, 2004),

65
ya que las tasas de biodegradacin dependen tanto de la concentracin de plaguicida en el suelo
como la actividad de los microorganismos o sistemas enzimticos presentes.

Posterior a la aplicacin del protocolo de bioestimulacin las caractersticas fsico-qumicas del


suelo presentaron una variacin. El pH aumento de 6.6 a 7.3 y esto se debe a la aplicacin de
nutrientes en solucin (nitrato de potasio) con valores de pH que varan en el rango de 7.5-8.
As mismo el nitrgeno total y N como NH4 aumentaron debido a la adicin de melaza y nitrato
de potasio, fuentes constituidas por compuestos nitrogenados.

Para los 4 puntos de muestreo la temperatura se mantuvo entre rangos de 27C y 28C. Solo se
report una disminucin en la temperatura la primera semana, debido a cambios climticos
presentados en el da de medicin. As mismo la humedad tuvo un comportamiento similar en
los 4 puntos de muestreo. El valor del pH al inicio del tratamiento presento valores cidos hasta
alcanzar un rango en la primera semana de 6.0- 6,4 hasta estabilizarse con un pH neutro en la
tercera semana. Se not un cambio en los valores para la ltima semana entre un rango de 6.5-
7.0. Sin embargo, permanece en el rango favorable para la degradacin del contaminante.

En cuanto a los valores de potencial redox obtenidos en el reactor, presentaron un cambio


notable, con respecto a los valores de Eh en los tratamientos a escala de laboratorio. Al inicio
los valores presentan un rango de -80 y -100 mV entre la primera y segunda semana
respectivamente. Esto se podra explicar debido a la mayor cantidad de suelo a descontaminar,
donde la actividad anaerobia requiere un tiempo mayor de incubacin de 1-2 semanas para llegar
realmente ser eficaz. Por otra parte, se puede considerar el hecho de que en el proceso entro a
una fase aerobia/anaerobia, donde existe hay una disminucin de los potenciales redox.

En cuanto a la caracterizacin bioqumica y molecular, se pudo aislar 2 colonias representativas


del suelo contaminado con DDT y del suelo despus de haber sido aplicado el tratamiento de
bioestimulacin en el reactor de lecho esttico. Para la prueba de Coloracin de Gram se obtuvo
bacilos Gram positivos en ambas bacterias.

Se logr extraer el DNA y amplificar exitosamente el gen 16S de las muestras en estudio. Segn
la herramienta Blastn, se detectaron secuencias homologas para las muestras B1 (bacteria suelo
contaminado) y B2 (bacteria suelo despus del tratamiento) al gnero Bacillus, las cuales se usaron
como referencias para el posterior anlisis filogentico para las muestras.

Estudios han reportado a partir de tratamientos experimentales en el suelo la habilidad de


bacterias Gram-negativas y Gram-positivas de tener capacidad metablica de atacar el DDT.
(Katayama et al., 1993) demostr que bacterias anaerobias han degradado DDT a travs de
mecanismos de decloracin reductiva tales como: Bacillus sp. Pseudomonas aeuriginosa, Escherichia
Coli ,Proteus vulgaris.

De acuerdo a la matriz de distancia se pudo identificar para la bacteria B1 Bacillus circulans y la


secuencia B2 a la secuencia de referencia de Bacillus megaterium. Lo que indica la gran resistencia
que tiene el gnero Bacillus contra el contaminante presente en el suelo

66
Los microorganismos del gnero Bacillus son bacilos de gran tamao, Gram positivos, aerobios
estrictos o anaerobios facultativos encapsulados. Una caracterstica importante es que forman
esporas extraordinariamente resistentes a condiciones desfavorables. Aunque la mayora de las
especies de Bacillus son inocuas, algunas son patgenas para las personas y los animales. Se
pueden encontrar en ambientes naturales, como el agua y el suelo.

Es de gran relevancia realizar un anlisis cualitativo de la toxicidad del suelo al inicio y despus
del tratamiento de biorremediacin, que permita determinar si el tratamiento aplicado en este
estudio ha sido eficiente puede ser planteado como un modelo de gestin ambiental eficiente en
la descontaminacin de suelos con DDT.

Para ello se tomaron valores de referencia planteados por la (EPA, 2014), donde se tuvo en
cuenta el tipo de suelo residencial, para el cual genera toxicidad crnica por ingesta de suelo a
partir de concentraciones de 39 mg DDT /kg suelo y riesgo cancergeno por contacto drmico
para concentraciones de 19 mg DDT/kg suelo. Esto indica que el suelo contaminado al inicio
del estudio representa un riesgo para la salud, principalmente a las personas que puedan estar
directamente expuestas al sitio contaminado.

Por otra parte, posterior a la aplicacin del protocolo de bioestimulacin demostr que el suelo
es menos txico si se compara con los niveles de concentracin mencionados, y se infiere que la
tecnologa valorada en este estudio puede minimizar el impacto generado por este pesticida a la
salud humana y el medio ambiente.

La investigacin experimental permiti establecer condiciones operacionales para un efectivo


protocolo de biorremediacin en la descontaminacin de suelos con DDT. Los valores ptimos
de los parmetros ms influyentes en el proceso en condiciones anaerobias fueron el potencial
redox, pH, recuento de hetertrofas y humedad. Los valores negativos en los potenciales (-89.4
mV, -295 mV) para los tratamientos en ausencia de oxigeno mejoran considerablemente la tasa
de biodegradacin de DDT. El pH ptimo para la bioestimulacin fue de 6.5-7. El valor de la
capacidad de campo del suelo que correspondi al 30 % de humedad permiti asegurar
condiciones anaerobias.

Esta alternativa de gestin ambiental representa ser til por su viabilidad econmica y ambiental
en el tratamiento de suelos contaminados con DDT, por lo cual a continuacin se formula un
plan de manejo ambiental que permita involucrar los factores normativos y sociales.

67
8.1 Formulacin de un plan de manejo ambiental para biorremediar suelos
contaminados con DDT mediante bioestimulacin ex situ

La gestin ambiental contempla de manera integrada todos los aspectos que componen el medio
humano y el medio natural en cuanto a vectores que introducen modificaciones significativas al
mismo, estas modificaciones denominadas impactos ambientales: identificacin, evaluacin,
prevencin, mitigacin o compensacin constituyen el objeto de la gestin ambiental (Angel et
al., 2010).

El planteamiento de un protocolo ambiental que involucre la tecnologa de biorremediacin


estimulada ex situ a escala piloto para el tratamiento de suelos contaminados con DDT, debe
contener medidas que permitan reducir y controlar riesgos e impactos al ambiente. Este
protocolo contempla elementos normativos, sociales y tcnicos, que se detallan a continuacin:

8.1.1 Revisin ambiental inicial

La primera fase para la formulacin de un plan de manejo ambiental para la descontaminacin


de suelos con DDT es la realizacin de una completa investigacin del medio que se ha afectado.
Esto incluye principalmente el estudio exhaustivo de la caracterizacin del emplazamiento
mediante trabajo de campo. As mismo se deben establecer:

Delimitaciones del lugar contaminado

Este es el primer paso a dar al momento de plantear un plan de gestin ambiental, el cual debe
considerar la totalidad de suelo degradado por el pesticida a travs de muestreos y anlisis
qumicos que permitan identificar la concentracin del organoclorado presente en el sitio. Sin
embargo, existen mltiples factores que dificultaran el xito de esta primera fase, por lo tanto,
delimitar el rea de suelo contaminada requiere de la aplicacin de herramientas de gestin.
De acuerdo a los valores de referencia planteados por la (EPA, 2014), si la concentracin de
DDT en el suelo contaminado es menor a 19 mg/kg el suelo no representa ningn riesgo a la
salud y al medio ambiente. Por lo contrario si la concentracin es mayor a 19 mg/kg es necesario
llevar a cabo el protocolo de gestin ambiental planteado que incluya los aspectos mencionados
a continuacin:

Fuente de contaminacin

Determinar de dnde proviene la contaminacin a travs anlisis de muestras en laboratorio,


perforaciones exploratorias y evaluacin geofsica mediante las tcnicas de geomagnetismo y
georadar. De acuerdo a lo mencionado por (MAVD, 2006) la hiptesis ms probable seria el
enterramiento de canecas con este pesticida.

Receptores

Identificar tanto a los receptores humanos y ecolgicos (suelo, fauna y vegetacin) cercanos a la
zona afectada.

68
Rutas de migracin del contaminante

Plantear rutas de migracin que proporcionen datos precisos sobre el comportamiento del
contamnate. Para el caso del DDT debido a la baja solubilidad en el agua, es poco probable que
se detecten concentraciones en el agua subterrnea y que esta ruta sea de poca importancia. Sin
embargo, la bioacumulacin de este plaguicida organoclorado puede representar una ruta
relevante para las especies que habitan en el rea.

Vas de exposicin

Identificar las vas de exposicin ms relevantes. Para el caso del contaminante las ms probables
seran inhalaciones de vapores y partculas de suelo contaminado, ingestin accidental partculas
de suelo contaminado, contacto drmico, riesgo ecotoxicolgico.

Anlisis de riesgo

Recopilacin de datos para realizar el anlisis cuantitativo de riesgos existentes, donde su objetivo
es alcanzar un diagnostico medioambiental sobre el estado del suelo del emplazamiento que
incluyan la exposicin a la contaminacin de las personas por diferentes vas. Para esto se han
planteado diferentes mtodos para el anlisis de riesgo y para este protocolo se propone el
mtodo holands CSoil (Geossmica y Ambiente, 1997).

Para compuestos cancergenos el riesgo se caracteriza por el parmetro Riesgo Cancergeno


(RC), que es el producto de la dosis de exposicin (mg/kg dia) por el factor cancergeno (Kg
da/mg)

Riesgo Cancergeno (RC)=Dosis Exposicin * Factor Cancergeno

El rango de aceptabilidad del riesgo cancergeno est entre 1x10-4 (un cncer adicional a lo largo
de una vida en una poblacin de 10000 personas) y 1x10-6.

8.1.2 Referentes normativos

La normatividad ambiental proferida a nivel mundial con respecto a la proteccin del recurso
suelo, es relativamente nueva. Hasta los aos 1970 slo se hablaba de la contaminacin del aire
y del agua, y al suelo se le atribua una capacidad de autodepuracin casi infinita (Silva & Correa,
2009). En este sentido, se plantea entonces que, en Colombia, si bien existen normativa e
instituciones ambientales, hay una dbil regulacin ambiental, puesto que el acople entre estos
dos elementos, aunado con el uso de instrumentos econmicos y de comando y control an no
se encuentra plenamente realizado (A. Silva & Correa, 2009).

Para el planteamiento del modelo de gestin ambiental se deben tomar como base las referencias
legales recogidas en los siguientes apartados en torno al control de la contaminacin del suelo:

69
Tabla 21. Normatividad ambiental colombiana en torno a la proteccin del suelo y la
regulacin de sustancias qumicas peligrosas.

Norma Contenido
La Constitucin Nacional en desarrollo de
este principio, consagr: El Estado
Articulo 80 planificar el manejo y aprovechamiento de
Desarrollo sostenible los recursos naturales para garantizar su
desarrollo sostenible, su conservacin o
sustitucin. Adems, deber prevenir y
controlar los factores de deterioro.

El Ministerio de Ambiente, Vivienda y


Desarrollo Territorial debe expedir las
ley 99 de 1993 regulaciones ambientales para la distribucin
y uso de sustancias qumicas utilizadas en
actividades agropecuarias y dictar
regulaciones para impedir la fabricacin,
importacin, posesin y uso de armas
qumicas, biolgicas y nucleares.
Se contempla al ambiente como patrimonio
comn, en este contexto el estado y los
particulares deben participar en su
Decreto 2811 de 1974 preservacin y manejo. As mismo, se regula
el manejo de los recursos naturales renovables
y no renovables, la defensa del ambiente y sus
elementos.
Reglamenta el uso y adecuado manejo de
Decreto 1843 de 1991 plaguicidas a nivel nacional, incluyendo
aproximaciones sobre parmetros tcnicos y
niveles de toxicidad.
Cdigo sanitario nacional. Desarrolla
mltiples temas entre los cules se destacan
Ley 9a de 1979 los residuos slidos, emisiones atmosfricas,
sustancias qumicas peligrosas, sustancias
txicas, plaguicidas, etc

Por lo cual se establecen los parmetros y los


valores mximos permisibles en los
Resolucin 0631 vertimientos puntuales a cuerpos de agua
superficiales, entre estos plaguicidas.

70
8.1.3 Participacin comunitaria

En planes de manejo ambiental para el tratamiento de suelos contaminados con DDT es de


suma importancia involucrar a la comunidad desde su etapa de formulacin, con el fin de dotar
el mismo de pertinencia, de reconocer el saber tradicional relacionado con el manejo del suelo
como recurso natural, y de estimular el trabajo comunitario mediante la capacitacin y la
orientacin con directrices cientficas prcticas. La participacin comunitaria se convierte en un
instrumento clave que viabiliza la continuidad de cualquier plan de manejo.

8.1.4 Medida de gestin planteada

Existen diversas alternativas en el tratamiento de suelos contaminados con DDT; tcnicas fsico-
qumicas para controlar y mitigar este tipo de contaminacin, sin embargo, en los ltimos aos
se ha demostrado que la aplicacin de mtodos biolgicos ha resultado ser eficientes y
adecuados, debido a que causan menor impacto en el sitio del problema. Una de estas
metodologas eficientes es la bioestimulacin con nutrientes, lo cual es una tcnica de tratamiento
que puede realizarse tanto en el sitio (in situ) o fuera del sitio (ex situ), y consiste en la
estimulacin de las poblaciones nativas con la adicin de nutrientes o cualquier otro componente
ajeno capaces de mejorar la degradacin del contaminante.

Si por las condiciones del lugar no se puede realizar remediacin f o si se quiere simplemente
optimizar la tcnica, se puede recurrir a tcnicas ex situ alternativas tales como el compostaje, el
landfarming y las biopilas. Cuando sea posible, los suelos contaminados se suelen tratar de
manera ms eficaz si el tratamiento biolgico se realiza ex-situ, ya que la adicin de nutrientes
necesarios como el nitrgeno y el fsforo, la humedad, los surfactantes , las bacterias, y el
oxgeno, as como la monitorizacin de los parmetros que controlan la evolucin del proceso,
se pueden realizar ms fcilmente que in situ (Alexander M., 1994).

El protocolo propone la biorremediacin a travs del uso de un reactor de lecho esttico. Sin
embargo, las opciones de que se dispone para el diseo de reactores estn determinadas
bsicamente por las propiedades fsicas del sitio contaminado, as como de las propiedades
qumicas y bioqumicas de los contaminantes.

En la tabla 22 se presentan los parmetros ms influyentes que se deben tener en cuenta de plan
y sus rangos adecuados.

Tabla 22. Parmetros de influencia en la bioestimulacin

Parmetro ambiental Rango adecuado


pH 6-8
Temperatura 20C-40C
% Humedad 25%-75% de la capacidad de campo
Biomasa 103-104 UFC/g
Nutrientes 100:10:1 a 100:2:0.2

71
8.1.5 Costos gestin ambiental

Se deben establecer costos en la implementacin de la medida de gestin. Esto depender


bsicamente de varios factores: i) cantidad y fraccin de suelo a tratar, ii) disponibilidad de
agentes de volumen, iii) nutrientes a utilizar, iv) necesidad de tratamientos previos y posteriores
y, v) necesidad de equipos de control para monitorear parmetros.

El mtodo de gestin planteado representa una gran ventaja a la hora de descontaminar suelos
ya sea a travs de tecnologas in situ o ex situ, debido a que los nutrientes aqu mencionados son
fuentes econmicas de carbono que podra ser usada a escalas mayores a bajo costo.

8.1.6 Implementacin de la medida de gestin

Para llevar a cabo un tratamiento de biorremediacin eficaz, se deben cumplir unos requisitos y
se deben identificar con anterioridad los factores especficos que condicionan el proceso para as
conocer las caractersticas microbianas, edafolgicas y fisicoqumicas del terreno.

En primer lugar, se debe realizar una investigacin exhaustiva del emplazamiento en relacin
con los contaminantes y en relacin con el tipo de suelo. En segundo lugar, se deben realizar
unos ensayos de tratabilidad a nivel de laboratorio, seguidos si es factible de la implantacin de
dicha tcnica. Estos ensayos de tratabilidad permiten evaluar el nivel y la actividad de las
poblaciones microbianas presentes, la biodegradabilidad de los contaminantes presentes por
parte de las poblaciones microbianas indgenas y, finalmente, encontrar aquellas condiciones
medioambientales que permitan optimizar la actividad metablica de las poblaciones
microbianas responsables de la eliminacin de los contaminantes.

La comprensin de los diferentes procesos de adsorcin y degradacin natural de contaminantes


en el suelo se constituye en punto de partida dentro del diseo de estrategias para la
biorremediacin con DDT.

Escenarios de afectacin por contaminantes de alta solubilidad en suelos de texturas gruesas y


bajos contenidos de materia orgnica, indican alertas, por la posibilidad de que los contaminantes
alcancen los mantos acuferos subterrneos, incrementando la magnitud del problema. El
potencial gentico que albergan los microorganismos posibilita la biodegradacin de una amplia
gama de sustancias que llegan al suelo mediante su actividad enzimtica, por ello la importancia
de mantener las poblaciones microbianas a travs de la adicin permanente de materia orgnica
fresca.

Por otra parte, se debe tener en cuenta la dosificacin de nutrientes que se aplicara en el
tratamiento de biorremediacin ya que un exceso de nutrientes puede inhibir el crecimiento
bacteriano y provocar una disminucin en el rendimiento en la medida de gestin a utilizar.

72
Tabla 23. Etapas a seguir en la fase de implementacin del plan de manejo para biorremediar
suelos contaminados con DDT

ETAPAS DE IMPLEMENTACIN
Informacin del sitio a descontaminar
Caracterizacin fsico-qumica del suelo
Calculo de la dosificacin de nutrientes
Aplicacin del tratamiento de biorremediacin
Monitoreo de parmetros fsicos y qumicos del sitio descontaminado

8.1.7 Plan monitoreo y seguimiento

En esta fase es necesario monitorear peridicamente los parmetros fsicos y qumicos,


determinando de esta manera un control en el tratamiento de biorremediacin. As mismo se
pueden aplicar pruebas de toxicidad en el suelo, que permita verificar la no presencia de
compuestos txicos en el suelo.

73
Formulacin protocolo ambiental para biorremediar suelos contaminados con DDT

Revisin
Delimitaciones del lugar Pruebas de toxicidad
ambiental
contaminado
inicial

Concentracin de DDT en el No No representa un riesgo


Plan de seguimiento

suelo es mayor a 19 mg/kg para el medio ambiente


Si No
Si
Anlisis cuantitativo de riesgos Concentracin de DDT en el
existentes suelo es mayor a 19 mg/kg

Caracterizacin fsico-qumica del


suelo (textura, humedad, pH,
nutrientes) Monitoreo de parmetros fsicos y
qumicos del sitio descontaminado

pH 6.5-7.2
C:N:P 100:5:1
Calculo de la dosificacin de
Humedad =Capacidad Campo
nutrientes

Participacin
comunitaria
Aplicacin del tratamiento de
Costo gestin bioestimulacin ex situ

Figura 24. Esquema del plan de manejo ambiental para biorremediar suelos contaminados con DDT
9. CONCLUSIONES

Los satisfactorios porcentajes de degradacin obtenidos en la presente investigacin, permiten


formular un modelo de gestin ambiental para biorremediar suelos contaminados con DDT. La
bioestimulacin con melaza-KNO3 constituye un mtodo de gestin alternativo de gran
potencial para el tratamiento de suelos contaminados con este pesticida, y representa una gran
ventaja ya que los nutrientes son fuentes de carbono y energa que podran ser usados a escalas
mayores a bajo costo.

La caracterizacin fsico- qumica del suelo antes y despus del tratamiento de biorremediacin
revelan la importancia de conocer caractersticas iniciales y finales presentes en el suelo ya que
estos condicionan los procesos de biorremediacin. As mismo existe la gran ventaja a la hora
de aplicar estrategias de remediacin que permitan establecer puntos de partida en los mtodos
de gestin ambiental en la descontaminacin de sitios.

Los resultados demostraron una relacin con la variabilidad en las propiedades fsico-qumicas
iniciales con la zona donde se recolecto el suelo. De igual forma caractersticas como textura,
concentracin de nutrientes, pH, conductividad, permitieron plantear parmetros adecuados
para la aplicacin de tratamientos de biorremediacin.

El tratamiento con adicin de melaza - KNO3 represent el mayor porcentaje de remocin con
un 92,5%. Esto demostr que la presencia de un co-sustrato incrementa notablemente la
presencia de bacterias hetertrofas en el suelo, y como consecuencia aumentan la biodegradacin
del contaminante.

Aunque el contaminante acta como fuente de carbono y energa en la mayora de los casos, los
microorganismos presentes en el suelo son incapaces de metabolizar un compuesto como fuente
nica de carbono. Por tanto, la suplementacin de un sustrato secundario aumenta
significativamente la densidad de poblacin microbiana y consigo la produccin de enzimas
degradadoras.

La tasa de degradacin demuestra la eficiencia de la aplicacin de tratamientos en condiciones


anaerobias para biorremediar suelos contaminados con DDT en un reactor de lecho esttico. Se
pudo concluir que diariamente desaparece 0,0784 partes de contaminante durante los 33 das de
estudio, lo cual verifica que es posible llevar a cabo la biorremediacin de DDT a travs de la
bioestimulacin a una mayor escala.

Se pudo determinar que la tasa de biodegradacin de DDT aumenta con la aplicacin de


tratamientos en condiciones anaerobias y la importancia de adicionar al suelo un co-sustrato y
un aceptor de electrones con alto potencial reductivo. Sin embargo, las tasas de biodegradacin
dependen tanto de la concentracin de plaguicida en el sustrato como la actividad de los
microorganismos o sistemas enzimticos presentes, infiriendo que la cintica de la degradacin
calculada a partir de las reacciones normalmente utilizadas en estudios no se puede aplicar
cuando la concentracin de plaguicidas es extremadamente baja o muy alta.

La identificacin bioqumica y molecular de las cepas que predominaron al inicio y final del
tratamiento por bioestmulo con melaza - KNO3 demostraron que la bacteria del genero Bacillus
logro ser resistente al contaminante presente en el suelo. As mismo se comprob con estudios
previos la capacidad que tiene este gnero para degradar DDT.

Se plante un plan de gestin ambiental que integrara la estrategia de bioestimulacin para el


tratamiento de suelos contaminados con DDT. A partir de ensayos experimentales con
biorremediacin ex situ, se establecieron parmetros de operacin que permitieron desarrollar la
estructura enfocada hacia la descontaminacin de suelos. El modelo demuestra que es necesario
conformar un conjunto de componentes que se integren de forma funcional, teniendo en cuenta
bsicamente las caractersticas propias del sitio, el tipo de contaminante, la normativa vigente,
tratamientos aplicados a pesticidas, costos de gestin y control de acciones correctivas.

76
10. RECOMENDACIONES
Los puntos relevantes para futuras investigaciones enfocados en el planteamiento de modelos
ambientales que puedan ayudar a comprender la biodegradacin de suelos contaminados con
DDT se deben considerar los siguientes aspectos:

Sera pertinente realizar investigaciones que vayan encaminadas a la actualizacin y consolidacin


de la informacin relacionada con las existencias de compuestos rgano-persistentes el pas entre
estos el DDT.

Evaluar la biodegradacin de DDT en un reactor de lodos. As mismo analizar el


comportamiento de las variables fsico-qumicas que ocurren en el sistema de reaccin.

Se recomienda realizar un ensayo conjunto de posibles estudios de biodegradacin de DDT ex


situ, bajo condiciones aerobias y anaerobias intercaladas, o bien sea considerado un ambiente
aerobio anaerobio facultativos para evaluar el potencial de degradacin de DDT.

Plantear modelos de gestin ambiental que permitan biorremediar suelos contaminados con
cualquier tipo de compuesto organoclorado.

77
ANEXOS
Anexo 1. Fotografas punto de muestreo. Municipio Codazzi, Cesar

Fotografa 1. Punto de muestreo en el municipio Codazzi, Cesar

Fotografa 2. Recoleccin de las muestras de suelo en el municipio Codazzi, Cesar

78
Anexo 2. Montajes en las bandejas

Fotografa 3. Montaje de los tratamientos de biorremediacin en las bandejas

Fotografa 4. Montaje del tratamiento de bioestimulacin con melaza y KNO3

79
Anexo 3. Fotografas aislamiento de las bacterias predominantes en el tratamiento

Fotografa 5. Siembra de colonias para el tratamiento de bioestimulacin melaza y KNO3

Fotografa 6. Aislamiento de colonias para el tratamiento de bioestimulacin melaza y KNO3

80
Anexo 4. rbol filogentico muestras B1 y B2. Fuente: Identificacin obtenida en el Centro
Nacional Secuenciacin Genmica de la Universidad de Antioquia

81
Anexo 5. Gel de agarosa con fragmentos amplificados mediante reaccin en cadena de
polimerasa (PCR) de colonias aisladas. Fuente: Identificacin obtenida en el Centro Nacional
Secuenciacin Genmica de la Universidad de Antioquia

82
BIBLIOGRAFA
Aguilera, N. (1989). Tratado de Edafologa de Mxico. Facultad de Ciencias Universidad
Nacional Autnoma de Mxico.
Aislabie, J. M., Richards, N. K., & Boul, H. L. (2010). Microbial degradation of DDT and its
residuesA review. http://dx.doi.org/10.1080/00288233.1997.9513247.
Alexander, M. (1981). Biodegradation of chemicals of environmental concern. Science (New York,
N.Y.), 211(4478), 1328. http://doi.org/10.1126/science.7444456
Alexander M. (1994). Biodegradation and Bioremediation. (Academic Press, Ed.). San Diego.

Alvarado, A., Jos, P., Prez, G., & Edilberto. (2003). Biorremediacin y atenuacin natural de acuferos
contaminados por sustancias qumicas peligrosas. Consejo de Desarrollo Cientfico y Humanistico
de la Universidad de Carabobo.
Amaral, M. C. S., Ferreira, C. F. A., Lange, L. C., & Aquino, S. F. de. (2008). Avaliao da
biodegradabilidade anaerbia de lixiviados de aterro sanitrios. Engenharia Sanitaria E
Ambiental, 13(1), 3845. http://doi.org/10.1590/S1413-41522008000100006
American Society of agronomy. (1982). Methods of Analysis part, 2 (2da ed.). USA.
Andersen, H. R., Andersson, A.-M., Arnold, S. F., Autrup, H., Barfoed, M., Beresford, N. A.,
Grandjean, P. (1999). Comparison of Short-Term Estrogenicity Tests for Identification of
Hormone-Disrupting Chemicals. Environmental Health Perspectives, 107, 89.
http://doi.org/10.2307/3434476
Angel, S., Carmona, S., & Villegas, L. (2010). Gestion ambiental en proyectos de desarrollo (4ta ed.).
Medellin,Colombia.
Arbeli, Z. (2009). Biodegradacion de compuestos organicos persistentes (COP): I. El caso de los
bifenilos policlorados (PCB). Acta Biolgica Colombiana, 14(1), 5788.
Arnold, D. J., & Briggs, G. G. (1990). Fate of pesticides in soil: predictive and practical aspects. (D. .
Hutson & T. R. Roberts, Eds.).
ASTDR. (2002). Toxicological profile for DDT, DDE and DDD. Agencia de Sustancias Txicas Y
Registro de Enfermedades.
Atlas, R., & Bartha, R. (2002). Microbial Ecology Fundamentals and Applications. (Four editi). The
Benjamin/Cummings Publishing Company.
Atlas, R. M., & Bartha, R. (1993). Microbial Ecology-Fundamentals and Applications (Benjamin-C).
Redwood City.

83
Bailey, N. J. L., Jobson, A. M., & Rogers, M. A. (1973). Bacterial degradation of crude oil:
Comparison of field and experimental data. Chemical Geology, 11(3), 203221.
http://doi.org/10.1016/0009-2541(73)90017-X

Baird, C., & Cann, M. (2014). Quimica ambiental. Reverte.


Bao, P., Hu, Z. Y., Wang, X. J., Chen, J., Ba, Y. X., Hua, J., Wu, C. Y. (2012). Dechlorination
of p,p-DDTs coupled with sulfate reduction by novel sulfate-reducing bacterium
Clostridium sp. BXM. Environmental Pollution, 162, 303310.
Barker, P. S., Morrison, F. O., & Whitaker, R. S. (1965). Conversion of DDT to DDD by Proteus
vulgaris, a Bacterium isolated from the Intestinal Flora of a Mouse. Nature, 205(4971), 621
622. http://doi.org/10.1038/205621b0
Barragn-Huerta, B. E., Costa-Prez, C., Peralta-Cruz, J., Barrera-Corts, J., Esparza-Garca, F.,
& Rodriguez-Vzquez, R. (2007). Biodegradation of organochlorine pesticides by bacteria
grown in microniches of the porous structure of green bean coffee. International
Biodeterioration and Biodegradation, 59(3 SPEC. ISS.), 239244.
http://doi.org/10.1016/j.ibiod.2006.11.001
Betancur, B. (2013). Biorremediacin De Suelo Contaminado Con El Pesticida 1,1,1-Tricloro 2,2bis(P-
Clorofenil)Etano (Ddt) Mediante Protocolos De Bioestimulacin Y Adicin De Surfactante.
Universidad Nacional de Colombia,sede Medellin.
Beunink, J., & Rehm, H. J. (1988). Synchronous anaerobic and aerobic degradation of DDT by
an immobilized mixed culture system. Applied Microbiology and Biotechnology, 29, 7280.
Bidlan, R., & Manonmani, H. K. (2002). Aerobic degradation of
dichlorodiphenyltrichloroethane (DDT) by Serratia marcescens DT-1P. Process Biochemistry,
38(1), 4956. http://doi.org/10.1016/S0032-9592(02)00066-3
Boush, G. M., & Batterton, J. C. (1972). Ecological aspects of pesticide microbial relationship.
Environmental toxicology of pesticides (Academic P). New York.
Bouyoucos, G. J. (1962). Hydrometer Method Improved for Making Particle Size Analyses of
Soils1. Agronomy Journal, 54(5), 464.
http://doi.org/10.2134/agronj1962.00021962005400050028x
Bray, R., & Kurtz, L. T. (1945). Determination of total, organic and available forms of
phosphorus in soil. Soil Science, 59(1), 3946.
Bridges, W. R., Kallman, B. J., & Andrews, A. K. (2011). Persistence of DDT and its Metabolites
in a Farm Pond. http://dx.doi.org/10.1577/1548-8659(1963)92[421:PODAIM]2.0.CO;2.
Brown, R. A., Wilson, J. T., & Ferrey, M. (2007). Monitored natural attenuation forum: The case
for abiotic MNA. Remediation Journal, 17(2), 127137. http://doi.org/10.1002/rem.20128
Casellas, M., Fernndez, P., Bayona, J. M., & Solanast, A. M. (1995). Bioassay-directed chemical
analysis of genotoxic components in urban airborne particulate matter from Barcelona

84
(Spain). Chemosphere, 30(4), 725740. http://doi.org/10.1016/0045-6535(94)00438-Z
Castro, M. (1993). Estudio de la melaza de caa como sustrato de la fermentacin acetobutilica. Universidad
Nacional de Colombia.
Castro, T. F., & Yoshida, T. (2002). Degradation of organochlorine insecticides in flooded soils
in the Philippines.
Chang, B.-V., Chang, I. T., & Yuan, S. Y. (2008). Anaerobic degradation of phenanthrene and
pyrene in mangrove sediment. Bulletin of Environmental Contamination and Toxicology, 80(2),
1459. http://doi.org/10.1007/s00128-007-9333-1
Chapelle, F. (2001). Ground-water microbiology and geochemistry. Wiley.
Chernicharo, C. (2007). Principios do tratamento biolgico de guas residurias, 5.
Chiu, T.-C., Yen, J.-H., Liu, T.-L., & Wang, Y.-S. (2004). Anaerobic Degradation of the
Organochlorine Pesticides DDT and Heptachlor in River Sediment of Taiwan. Bulletin of
Environmental Contamination and Toxicology, 72(4), 821828. http://doi.org/10.1007/s00128-
004-0318-z
Clinical Microbiology Procedures Handbook. (2010). Clinical Microbiology Procedures Handbook, 3rd
Edition. (L. S. Garcia, Ed.) (3a ed.). American Society of Microbiology.
http://doi.org/10.1128/9781555817435
Cookson, J. T. (1995). Bioremediation engineering:design and application. McGraw-Hill.
Corona, A. (2000). Biodegradacin anaerobia y aerobia de DDT por fermentacin en medio slido.
Universidad Autonoma metropolitana Iztalpa.
Defensora del pueblo. (2001). Uso, almacenamiento y disposicin inadecuado de plaguicidas,
Resolucin(11), 137.
DeLong, R., Gilmartin, W. G., & Simpson, J. G. (1973). Premature births in California sea lions:
association with high organochlorine pollutant residue levels. Science (New York, N.Y.),
181(4105), 116870. http://doi.org/10.1126/science.181.4105.1168
EPA. (1996a). Method 3630C:Silica gel cleanup.
EPA. (1996b). Method 8000B: Determinative chromatographic separations.
EPA. (2014). Regional Screening Levels (RSLs).
Fang, H., Dong, B., Yan, H., Tang, F., & Yu, Y. (2010). Characterization of a bacterial strain
capable of degrading DDT congeners and its use in bioremediation of contaminated soil.
Journal of Hazardous Materials, 184(13), 281289.
FAO. (1996). Eliminacin de grandes cantidades de plaguicidas en desuso en los pases en
desarrollo. Coleccin FAO: Eliminacin de Plaguicidas.

85
Feidieker, D., Kmpfer, P., & Dott, W. (1995). Field-scale investigations on the biodegradation
of chlorinated aromatic compounds and HCH in the subsurface environment. Journal of
Contaminant Hydrology, 19(2), 145169. http://doi.org/10.1016/0169-7722(95)00013-L
Fernandes, M. da C. (2004). Comportamiento de Plaguicidas en Suelos de Andaluca Occidental y Bajo
Alentejo: Efecto de la adicin de enmiendas orgnicos. Universidad de Sevilla.
Field, J., Wageningen, A. U. of, Cauca, C. A. R. del, & Wageningen, A. U. of. (1987). Parmetros
operativos del reactor de manto de lodos anaerbicos de flujo ascendente. Curso Arranque
Y Operacin de Sistemas de Flujo Ascendente Con Manto de Lodo UASB, 135.
Fisher, A. (1989). DDT and DDE: Sources of Exposure and How to Avoid Them. World, (1),
16.
Foght, J., Trevor, A., Kevin, B., & Jackie, A. (2001). Bioremediation of DDT-Contaminated
Soils: A Review. Bioremediation Journal, 225246.
Foundation for Agronomic Research. (1988). Soil Fertility Manual. Potash & Phosphate Institute and
the Potash & Phosphate Institute of Canada.
Gao, B., Liu, W.-B., Jia, L.-Y., Xu, L., & Xie, J. (2011). Isolation and characterization of an
Alcaligenes sp. strain DG-5 capable of degrading DDTs under aerobic conditions. Journal
of Environmental Science and Health. Part. B, Pesticides, Food Contaminants, and Agricultural Wastes,
46(3), 25763. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/21462053
Gao, B., Liu, W.-B., Jia, L.-Y., Xu, L., & Xie, J. (2011). Isolation and characterization of an
Alcaligenes sp. strain DG-5 capable of degrading DDTs under aerobic conditions. Journal
of Environmental Science and Health, 46(3), 257263.
Gascon, M., Morales, E., Sunyer, J., & Vrijheid, M. (2013). Effects of persistent organic
pollutants on the developing respiratory and immune systems: A systematic review.
Environment International, 52, 5165. http://doi.org/10.1016/j.envint.2012.11.005
Geossmica y Ambiente. (1997). Estudio de diagnostico y evaluacin del enterramiento de
plaguicidas en el municipio de Agustn Codazzi y procedimiento de descontaminacin y
disposicin de los mismos.
Golovleva, L. A., & Skryabin, G. K. (1981). Microbial degradation of DDT. Microbial Degradation
of Xenobiotics and Recalcitrant Compounds, 287292.
Guillette, L. J., Gross, T. S., Masson, G. R., Matter, J. M., Percival, H. F., & Woodward, A. R.
(1994). Developmental Abnormalities of the Gonad and Abnormal Sex Hormone
Concentrations in Juvenile Alligators from Contaminated and Control Lakes in Florida.
Environmental Health Perspectives, 102(8), 680. http://doi.org/10.2307/3432198
Gusmo, V. R., Chinalia, F. A., Sakamoto, I. K., & Varesche, M. B. A. (2007). Performance of a
reactor containing denitrifying immobilized biomass in removing ethanol and aromatic
hydrocarbons (BTEX) in a short operating period. Journal of Hazardous Materials, 139(2),
301309. http://doi.org/10.1016/j.jhazmat.2006.06.028

86
Hart, M. M., Adamson, R. H., & Fabro, S. (1971). Prematurity and intrauterine growth
retardation induced by DDT in the rabbit. Archives Internationales de Pharmacodynamie et de
Therapie.
Huang, J., Nemati, M., Hill, G., & Headley, J. (2012). Batch and continuous biodegradation of
three model naphthenic acids in a circulating packed-bed bioreactor. Journal of Hazardous
Materials, 201, 132140. http://doi.org/10.1016/j.jhazmat.2011.11.052
In, B.-H., Park, J.-S., Namkoong, W., Hwang, E.-Y., & Kim, J.-D. (2008). Effect of co-substrate
on anaerobic slurry phase bioremediation of TNT-contaminated soil. Korean Journal of
Chemical Engineering, 25(1), 102107. http://doi.org/10.1007/s11814-008-0018-1
Instituto Geogrfico Agustn Codazzi. (1986). Estudio semidetallado de suelos de los municipios
del sur del departamento del Cesar.
Jackson, M. (1964). Anlisis Qumico del Suelo (Omega). Barcelona-Espaa.
J T Dibble, R. B. (1979). Effect of environmental parameters on the biodegradation of oil sludge.
Applied and Environmental Microbiology, 37(4), 729.
Jess, A. G.-D., Romano-Baez, F. J., Leyva-Amezcua, L., Jurez-Ramrez, C., Ruiz-Ordaz, N.,
& Galndez-Mayer, J. (2009). Biodegradation of 2,4,6-trichlorophenol in a packed-bed
biofilm reactor equipped with an internal net draft tube riser for aeration and liquid
circulation. Journal of Hazardous Materials, 161(23), 11401149.
http://doi.org/10.1016/j.jhazmat.2008.04.077
Kanta Sharma, S., Sadasivam, K. V., & Dave, J. M. (1987). DDT degradation by bacteria from
activated sludge. Environment International, 13(2), 183190. http://doi.org/10.1016/0160-
4120(87)90088-2
Kao, C. ., Chen, S. ., Liu, J. ., & Wang, Y. . (2001). Application of microbial enumeration
technique to evaluate the occurrence of natural bioremediation. Water Research, 35(8), 1951
1960. http://doi.org/10.1016/S0043-1354(00)00482-6
Katnek, F., Demnerov, K., Pazlarov, J., Burkhard, J., & Malterov, Y. (1999).
Biodegradation of polychlorinated biphenyls and volatile chlorinated hydrocarbons in
contaminated soils and ground water in field condition. International Biodeterioration &
Biodegradation, 44(1), 3947. http://doi.org/10.1016/S0964-8305(99)00051-7
Kstner, M., Breuer-Jammali, M., & Mahro, B. (1994). Enumeration and characterization of the
soil microflora from hydrocarbon-contaminated soil sites able to mineralize polycyclic
aromatic hydrocarbons (PAH). Applied Microbiology and Biotechnology, 41(2), 267273.
http://doi.org/10.1007/BF00186971
Katayama, A., Fujimora, Y., & Kuwatsuka, S. (1993). Microbial Degradation of DDT at
Extremely Low Concentrations. Journal of Pesticide Science, 18(4), 353359.
http://doi.org/10.1584/jpestics.18.4_353
Ko, W. H., & Lockwood, J. L. (1968). Accumulation and concentration of chlorinated

87
hydrocarbon pesticides by microorganisms in soil. Canadian Journal of Microbiology, 14(10),
10751078.
Laboratorio de Salinidad. (1974). Suelos salinos y sodicos. Diagnostico y rehabilitacin. (Limusa, Ed.),
United States Department of Agriculture (USDA). Mexico.
Li, F. B., Li, X. M., Zhou, S. G., Zhuang, L., Cao, F., Huang, D. Y., Feng, C. H. (2010).
Enhanced reductive dechlorination of DDT in an anaerobic system of dissimilatory iron-
reducing bacteria and iron oxide. Environmental Pollution, 158(5), 17331740.
http://doi.org/10.1016/j.envpol.2009.11.020
Liang, Y., Britt, D. W., McLean, J. E., Sorensen, D. L., & Sims, R. C. (2007). Humic acid effect
on pyrene degradation: finding an optimal range for pyrene solubility and mineralization
enhancement. Applied Microbiology and Biotechnology, 74(6), 136875.
http://doi.org/10.1007/s00253-006-0769-8
Lichtenstein, E. P., Fuhremann, T. W., & Schulz, K. R. (2002). Persistence and vertical
distribution of DDT, lindane, and aldrin residues, 10 and 15 years after a single soil
application.
Litchfield, C. (2005). Thirty Years and Counting: Bioremediation in Its Prime? BioScience, 273
279.
Liu, C., Xu, X., & Fan, J. (2015). Accelerated anaerobic dechlorination of DDT in slurry with
Hydragric Acrisols using citric acid and anthraquinone-2,6-disulfonate (AQDS). Journal of
Environmental Sciences (China), 38, 8794. http://doi.org/10.1016/j.jes.2015.05.005
Lu, X.-Y., Zhang, T., & Fang, H. H.-P. (2011). Bacteria-mediated PAH degradation in soil and
sediment. Applied Microbiology and Biotechnology, 89(5), 135771.
http://doi.org/10.1007/s00253-010-3072-7
Madigan, M., Martinko, J., & Parker, J. (2004). Brock. Biologia de los microorganismos (10a edici).
MAVD. (2006). Inventario Nacional de Existencias de Plagucidas COP, (Ministerio de
Ambiente, Vivienda y Desarrollo Territorial), 132.
Megharaj, M., Ramakrishnan, B., Venkateswarlu, K., Sethunathan, N., & Naidu, R. (2011).
Bioremediation approaches for organic pollutants: A critical perspective. Environment
International, 37(8), 13621375. http://doi.org/10.1016/j.envint.2011.06.003
Mendel, J. L., & Walton, M. S. (1966). Conversion of p,p -DDT to p,p -DDD by intestinal flora
of the rat. Science (New York, N.Y.), 151(3717), 15278. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/5326183
Menendez-Vega, D., Gallego, J. L. R., Pelaez, A. I., Fernandez de Cordoba, G., Moreno, J.,
Muoz, D., & Sanchez, J. (2007). Engineered in situ bioremediation of soil and
groundwater polluted with weathered hydrocarbons. European Journal of Soil Biology, 43(5),
310321. http://doi.org/10.1016/j.ejsobi.2007.03.005

88
Mitra, J., & Raghu, K. (1998). Long Term DDT Pollution in Tropical Soils: Effect of DDT and
Degradation Products on Soil Microbial Activities Leading to Soil Fertility. Bulletin of
Environmental Contamination and Toxicology, 60(4), 585591.
http://doi.org/10.1007/S001289900665
Mostafalou, S., & Abdollahi, M. (2013). Pesticides and human chronic diseases: Evidences,
mechanisms, and perspectives. Toxicology and Applied Pharmacology, 268(2), 157177.
http://doi.org/10.1016/j.taap.2013.01.025
Mwangi, K., Boga, H., Muigai, A., Kiiyuikia, C., & Tsanuo, M. K. (2010). Degradation of
dichlorodiphenyltrichloroethane (DDT) by bacterial isolate form cultivated and
uncultivated soil. African J Microbiology Research, 4, 184196.
Nadeau, L. J., Menn, F. M., Breen, A., & Sayler, G. S. (1994). Aerobic degradation of 1,1,1-
trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) by Alcaligenes eutrophus A5. Applied and
Environmental Microbiology, 60(1), 515. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/8117093
National Toxicology Program. (2011). Dichlorodiphenyltrichloroethane, Report on
Carcinogens.
Nayono, S. E. (2009). Anaerobic digestion of organic solid waste for energy production. Universitat
Fridericiana zu Karlsruhe.
Nessler. (1999). Determination of ammonia-nitrogen. Standard Methods for the Examination of Water
and Wastewater.
Noguera Sols, C. E. (2008). Potencial de biodegradacin de DDT y sus metabolitos en suelos
agrcolas de fincas pertenecientes al Ingenio Monte Rosa, "Zona Sur Los
Millonarios", Chinandega, 2007.
Odukkathil, G., & Vasudevan, N. (2013). Toxicity and bioremediation of pesticides in
agricultural soil. Reviews in Environmental Science and Bio/Technology, 12(4), 421 444.
Ortz, I., Velasco, A., Le Borgne, S., & Revah, S. (2013). Biodegradation of DDT by stimulation
of indigenous microbial populations in soil with cosubstrates. Biodegradation, 24(2), 21525.
http://doi.org/10.1007/s10532-012-9578-1
Peakall, D. B. (1969). Effect of DDT on Calcium Uptake and Vitamin D Metabolism in Birds.
Nature, 224(5225), 12191220. http://doi.org/10.1038/2241219a0
Perfect, T. J., Cook, A. G., Critchley, B. R., Critchley, U., Davies, A. L., Swift, M. J., Yeadon,
R. (1979). The Effect of DDT Contamination on the Productivity of a Cultivated Forest
Soil in the Sub-Humid Tropics. The Journal of Applied Ecology, 16(3), 705.
http://doi.org/10.2307/2402847
Polo, A., & Hernndez, D. (2002). Contaminacin y restauracin de suelos. Ciencia Y Medio
Ambiente, 110114.

89
Purnomo, A. S., Mori, T., Takagi, K., & Kondo, R. (2011). Bioremediation of DDT
contaminated soil using brown-rot fungi. International Biodeterioration & Biodegradation, 65(5),
691695. http://doi.org/10.1016/j.ibiod.2011.04.004
Quantin, C., Joner, E. J., Portal, J. M., & Berthelin, J. (2005). PAH dissipation in a contaminated
river sediment under oxic and anoxic conditions. Environmental Pollution, 134(2), 315322.
http://doi.org/10.1016/j.envpol.2004.07.022
Quensen, J. F., Mueller, S. A., Jain, M. K., Tiedje, J. M., Niedoroda, A. W., Swift, D. J. P.,
Tiedje, J. M. (1998). Reductive dechlorination of DDE to DDMU in marine sediment
microcosms. Science (New York, N.Y.), 280(5364), 7224.
http://doi.org/10.1126/science.280.5364.722
Refugio, P., Vzquez, R., & Mx, R. (2011). Biorremediacin de suelos con residuos
agroindustriales.

Riser-Roberts, E. (1998). Remediation of petroleum contaminated soils: biological, physical, and chemical
processes. Lewis Publishers.

Rittmann, B. E., & McCarty, P. L. (2001). Environmental biotechnology: principles and applications.
Rittmann, B., & McCarty, P. (2005). Stoichiometry and bacterial energetics. In Environmental
Biotechnology: Principles and Applications (pp. 126158). McGraw Hill editorial.
Rodrguez, H. (1999). La maldicin del oro blanco. Revista CROMOS No 4.217.
Rogan, W. J., & Chen, A. (2005). Health risks and benefits of bis(4-chlorophenyl)-1,1,1-
trichloroethane (DDT). The Lancet, 366(9487), 763773. http://doi.org/10.1016/S0140-
6736(05)67182-6
Rogan, W. J., Chen, A., Organization, W. H., Registry), Atsdr. (Agency for T. S. and D., Turusov,
V., Rakitsky, V., Mutabingwa, T. (1979). Health risks and benefits of bis(4-
chlorophenyl)-1,1,1-trichloroethane (DDT). Lancet (London, England), 366(9487), 76373.
http://doi.org/10.1016/S0140-6736(05)67182-6
Rojas, M. P. (2010). Incidencia y tendencia de seis cnceres en poblaciones expuestas
ambientalmente a plaguicidas en desuso en el departamento del Cesar. Revista Colombiana de
Cancerologa;, 14(2), 88101.
Snchez, N., Rodrguez, M., & Sarria, V. (2006). Pesticidas Obsoletos en Colombia, Situacin
actual y altenativas de tratamiento y disposicin. Revista de Ingenieria de La Universidad de Los
Andes, 23, 1322. Retrieved from http://www.scielo.org.co/pdf/ring/n23/n23a2.pdf
Shinde, S. (2013). Bioremediation. An overview. Recent Research in Science and Technology, 5(5).
Silva, A., & Correa, F. (2009). Anlisis de la contaminacin del suelo: revisin de la normativa y
posibilidades de regulacin econmica. Semestre Ecomoico, 12(23), 1334.
Silva, S. ., & Correa, F. . (2009). Anlisis de La contaminacin del suelo: Revisin de la normativa

90
y posibilidades de regulacin econmica. Artculo publicado en la revista Semestre
Econmico,. Semestre Econmico, 12(23), 1334.
Smith, A. G. (1991). Chlorinated Hydrocarbon Insecticides. Handbook of Pesticides Toxicology, 731
915.
Snedeker, S. M. (2001). Pesticides and Breast Cancer Risk: A Review of DDT, DDE, and
Dieldrin. Environmental Health Perspectives, 109, 35. http://doi.org/10.2307/3434845
Subba-Rao, R., & M., A. (1977). Products formed from analogues of I , 1,l -trichloo-2,2-bis(p-
chlorophenyl) ethane (DDT) metabolites by Pseudomonas putida. Environ Microbiol, 30(1),
:101-10.
Subba-Rao, R., & M., A. (1985). Bacterial and fungal cometabolism of 1 ,I, 1-trichloro-2,2-bis(4-
chlorophenyl) ethane (DDT) and its breakdown products. Environ Microbiol, 49(3), 509516.
Sudharshan, S., Naidu, R., Mallavarapu, M., & Bolan, N. (2012). DDT remediation in
contaminated soils: A review of recent studies. Biodegradation.
Tiemann, U. (2008). In vivo and in vitro effects of the organochlorine pesticides DDT, TCPM,
methoxychlor, and lindane on the female reproductive tract of mammals: A review.
Reproductive Toxicology, 25(3), 316326. http://doi.org/10.1016/j.reprotox.2008.03.002
Torres, S., Luisa, Lopez, C., & Lizbeth. (2007). Efectos a la salud y exposicin a p , p -DDT y
p , p -DDE . El caso de Mxico Human health effects and p , p -DDE and p , p -DDT
exposure . The case of Mexico. Cincia & Sade Coletiva, 12, 5160.
Turusov, V., Rakitsky, V., Tomatis, L., Ubiquity, D. D. D. T., Turusov, V., Rakitsky, V., &
Tomatis, L. (2013). Dichlorodiphenyltrichloroethane (DDT): Ubiquity, Persistence, and
Risks. Environmental Health Perspectives, 110(2), 125128. http://doi.org/10.1289/ehp.9549
University of Minnesota Biocatalysis. (1998). (DDT ) Pathway Map.
Utadeo, W., Edu, L., & Tadeo. (2002). Un refugio de la vida.

Valverde Garcia, A., Instituto de Estudios Almerienses., A., & Universidad de Almeria., R.
(1998). Residuos de plaguicidas96 Pesticide residues96. Residuos de plaguicidas 96 = Pesticide residues
96: IV Seminario International sobre Residuos de Plaguicidas, 1998, ISBN 84-8240-090-8, pgs.
141-155. Instituto de Estudios Almerienses.
van Wendel de Joode, B., Wesseling, C., Kromhout, H., Monge, P., Garcia, M., & Mergler, D.
(2001). Chronic nervous-system effects of long-term occupational exposure to DDT. The
Lancet, 357(9261), 10141016. http://doi.org/10.1016/S0140-6736(00)04249-5
Vega-Baudrit, J., Delgado-Montero, K., Sibaja Ballestero, M., Aguilar, P. A., & Barrientos
Ramrez, S. (2008). Empleo de melaza de caa de azucar para la obtencin y caracterizacin
de poliuretanos potencialmente biodegradables. Revista Iberoamericana de Polmeros Volumen
Iberoamer. Polm, 9(94), 408421.

91
Walkley, A., & Black, I. A. (1934). An examination of the Degtjareff method for determining
soil organic matter and a proposed modification of the chromic acid titration method. Soil
Science, 37(1), 2938.
Wang, G. L., Bi, M., Liang, B., Jiang, J. D., & Li, S. P. (2011). Pseudoxanthomonas jiangsuensis
sp. nov., a DDT-degrading bacterium isolated from a long-term DDT-polluted soil. Current
Microbiology, 62(6), 17601766.
Wedemeyer, G. (1967). Dechlorination of 1,1,1-Trichloro-2,2-bis(p-chloro- phenyl)ethane by
Aerobacter aerogenes I. Metabolic Products. APPLIED MICROBIOLOGY, 15(3), 569
574.
WHO. (1989). DDT and its Derivatives in Drinking-water Background document for
development of WHO Guidelines for Drinking-water Quality. World Health Organization, 1
15.
Winans, B., Humble, M. C., & Lawrence, B. P. (2011). Environmental toxicants and the
developing immune system: A missing link in the global battle against infectious disease?
Reproductive Toxicology, 31(3), 327336. http://doi.org/10.1016/j.reprotox.2010.09.004
Yang, C. F., Lee, C. M., & Wang, C. C. (2005). Degradation of chlorophenols using
pentachlorophenol-degrading bacteria Sphingomonas chlorophenolica in a batch reactor.
Current Microbiology, 51(3), 156160.
Yao, F. X., Jiang, X., Yu, G. F., Wang, F., & Bian, Y. R. (2006). Evaluation of accelerated
dechlorination of p,p-DDT in acidic paddy soil. Chemosphere, 64(4), 628633.
http://doi.org/10.1016/j.chemosphere.2005.10.066
Yum, K.-J., & Peirce, J. J. (1998). Biodegradation kinetics of chlorophenols in immobilized-cell
reactors using a white-rot fungus on wood chips. Water Environment Research, 70(2), 205
213. http://doi.org/10.2175/106143098X127053
Zhao, Y. C., Yi, X. Y., Zhang, M., & Liu, L. (2010). Fundamental study of degradation of
dichlorodiphenyltrichloroethane in soil by laccase from white rot fungi, 7(2), 359366.

92