Está en la página 1de 6

CLUSTAL W (1.

83) multiple sequence alignment

L04648.1 -----------------------------------------------------------
---------------------
M65067.1 -----------------------------------------------------------
---------------------
AF085332.1 GGCCAC-----TGTTCCAG----TCATCCAAGCG-------------------------
-CGCCGCAATGGCCGCGCAGC
AF394060.1 CGGCAGAGGGCCGTGCAAGCGTGCCATC-
ACGTGTGTCTCCCGGAGCAGTGCCCTGCAGGACTCGCCATGTCTAGGGAGT

L04648.1 -----------------------------------------------------------
---------------------
M65067.1 -----------------------------------------------------------
---------------------
AF085332.1
TGGAGCAATTTTTGGTGAATGAAGGGCAGGTCGACCAGAGGGCGGTCACGTATATGCTCAAGGGACTGCAGCTCG
AGAGC
AF394060.1
TCGCAGCCTTTTTAACCAACGATGCGAAGCTCGATCCCACGGTTGTCACGTACATGACCAGGGATTTGAAGCTCG
ACAGC

L04648.1 -----------------------------------------------------------
---------------------
M65067.1 -----------------------------------------------------------
---------------------
AF085332.1
CTTTCTGACTTTGCCTCGTTCTGGACGTCCAAGGACTATGAGAACGGTGTTCGGGATGA----------------
-----
AF394060.1
ATTTCCGATTTTGCCAACTATTGGACAACCGGTGATTATGAGAAGGGCGTCCAAGATGATATTGTGCGGAAAGTG
CCGGC

L04648.1 -----------------------------------------------------------
---------------------
M65067.1 -----------------------------------------------------------
---------------------
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1
CTTCCAAGACACATCAAAAGCCGCCTCCAAGGTGCAAGTTGCACGGCTTCGTGCTGCATGGCTATCAGCCCAGCG
AAGCG

L04648.1 ----------------------------------------------CAAGC--------
---------------------
M65067.1 -----------------------------------------------------------
---------------------
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1
AAGCTGTGCCGGCGGCCGTGGCCAGAGCAGTGCCAGCGGTTGCGACCAAGCCTGTCGAGCAAAATGACCTTTGCG
AAAAG

L04648.1 -----------------------------------------------------------
---------------------
M65067.1 -----------------------------------------------------------
---------------------
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1
ACAGGCTTGGAGCTGAGCGGCACGGCGAAGGGTGGGGCATTGAGCGCGGCACACGTGGAACACCTCGATCCTGAA
GCCTT

L04648.1 CCATGG--------------------------------------------------
AGGCTGGGGGCAAGGTCTACTCCA
M65067.1 -----------------------------------------------------------
---------------------
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1
CCGTGAAGGCCTTCATCAGCCCAAGTTCCATTCCGATGGCCTGCACATGCCGCACACTTCCGGCGACAAGACCTA
CGAAA

L04648.1 CTGGGTTTCATTAC-
TGCTGGAGGCCCACGACCTTGGCGGCAAGAACGAGGATGGCGGCTACGGTGGCCCCTTGTGCAAG
M65067.1 --TAATTACA-------------------------------------------------
---------------------
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1
CAGGCTTCCATTACCTCCTCGAGGTGCACGACCTTGGTGGCAAAAACAAGGATGGCGGCTTTGGCGGCCCACTCT
GTTCC

L04648.1
GACCCCTATGGCAAGGAGGTGCAGAGCATGGTGGAGAATCTGCTAGTGCAGGCGAACGTCGACACCACGAACGCA
TTCGA
M65067.1 -----------------------------------------ACTGATACA---------
---------------------
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1
GAGCCATTCAGCCAAAAGATCGCGGACCTCGCTGAGGTCTTGCTCGAGGAGGCCCAAAATGACAAAACTCTGGCC
TACAC

L04648.1 CA-
TTTCAAGCAGCCCTGCCCGCAGCTGACCAAGGAGCAGGTGGCCATGTGCAAGGGCTTCGACTACGGCGACAAGAC
GC
M65067.1 --------------------------TAAACCAACAAAAGGAATAT-----
TATGAAGTTTGG-----------AAATAT
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1
TAATTTCAAGGATCCCGCTCCCACCCTCACCAAGAAACAGGTGGAATTGTGCAAGGGGTTTGATTATGGCGACAA
AACGC

L04648.1
TCAAGCTCCCCTGCGGCCCTCTGCCGTGGCCCGCTGGCCTCCCGGAGCCAGGCTACGTGCCCAAGACCAACCCCC
TTCAC
M65067.1 T--------------------------------------TTCTCATATCAGCCT-----
--CCAGGTGAGTCACATAAAG
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1
TTAAACTGCCTTGCGGCGCGCTCCCGTGGCCAGCCGGCACGCCTGAGCCTGGCTATGTGCCTCAGACGAATCCAT
TGCAT

L04648.1
GGCCGTTGGATCACCGTCTCCGGCGGCCAGGTTGCGTTCATCAAGGAGGCCATCAAATCCGGAATGCTTGGCGCT
GCCGA
M65067.1 AAGTCATGGATCGCTTTGTTCGT------------------------------------
-------TTAGGCGTTG----
AF085332.1 -----------CATCATCTC------CAAGGTCGCGCCCTTCAATTCAGACCTC---
TC---CCTGC---CCGCAGCCAA
AF394060.1
GGGCGCTGGATCACGGTGTCCGGCGGCCAGGCTGCATTCATCAAGAAGGTGATCGAGGAAGGCATGCTAGGTGCC
GCTGA
* * *
* *

L04648.1
GGCCAAGAAGATTATCGCGGACACCGACCACCACCAGACCGGCGGCATGTACCTGCGGATCAACCAGTACGGAGA
GGTGT
M65067.1 -------------------------------
CATCAGAAGAACTAAATTTTGATACTTACTGGCTA--------------
AF085332.1 GCTCCA---------GGTTG-CA-CGGCTACGCGCAGCGTGGCGGAAGGCA--------
----------CAG---G--GT
AF394060.1
GGCGGGAAAGATCATGGCCGACACGGACCACCACCAGACTGGCGGCATGTTCCTGCGCATCAACCAATTTAATGA
GGTTT
*** * *

L04648.1
GCACTGTCGACGCCTCCGTCGCCAAGTTTGCCCGCGCCAAGCGCACCTGGAAGTCCGGGCACTACTTCTACGAGC
CCCTC
M65067.1 --------GAGCATCATTTTACTGAATTTGGAC----------
TAACAGGTAACCTGTTTGTTGCTTGTGCTAAC-----
AF085332.1 AAGCCGTCGG-------------------------------------------------
---------------------
AF394060.1
GCACGGTCGATGCCTCTGTGGCTAAATTTGCACGTGCCAAGCGCACATGGAAGTCTGGCCACTACTTCTATGAGC
CACTA
*

L04648.1
GTGTCCGGCGGAAACCAGCACGGCGTCTGGGTCCTGCCTGAGGAGTACCGCAAGATCGGCTTCTTCTGGGAGAT-
-CCTC
M65067.1 ---------------------------------TTACTTGG-
TCGAACCACCAAACTGAATGTTGGTA------------
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1
GTCTCCGGGGGCAACCTCTTTGGCGTCTGGGTGTTGCCCGAGGAGTACCGCAAGATTGGCTTCTTTTGGGAGATG
GAGTC

L04648.1
AGACCGGCTTGCTTCCGCATTGAGCCGGCGCGGTTCCCTTGTGGTCCGTACATGTTCCTGCGCCAGGCCACCGAG
G---T
M65067.1 ---------------------------------------------
CTATGATTGTTCTTCCAACAGCTCACCCTGCACGT
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1 GGGCAGG--
TGTTTCCGCATCGAACGGCGGGCTTTCGAGCGTGATGGCCTCATGATCATGCGGCAGTCCACTGAGA---T

L04648.1
CGGAGGCAAGATATCCTACGTTTTCTACGTCAAGGTGTCCAACGACCCCGGCTCGAAGCCTATTCCGCTCCAGAG
CCGCG
M65067.1 CAGATGGAAGATTTATTA---CTTTTAGATCAAA-TGTCAA--------------
AAGGCCGTTT-------------TA
AF085332.1 --------------------------------------------------------
CAGCCGTCCCTCTGCAGAGCGCCA
AF394060.1
CGGTGGTAACGTCTCTTTTGTCTTCTACGTTAAGGTGTCCAACGATCCGGAGTCCACGACCATCCCACTTCAAAG
CCGTG

* *

L04648.1
ACTACACGGCCCTGGCTGGCCAGGACAACGCGCCGGACAACCTTGGGAAACCGTACAAGTGCACTGCCAGAGATC
TGGAT
M65067.1 ATTTTGGTGTTGTGCGTGGCTACCACAAAGATTTCCGCGTTTTTG-------------
GTGTAACGATGGAA-----GAT
AF085332.1 AGCCCGTTGCC------------------------------------------------
---------------------
AF394060.1
ACTACACTGCCTTGGCAGGCCACGACAATGTCCCTGACAATTTGGGCAAGCCCTACCCGTGCACCGCCAAAGACC
TCGAC
* *

L04648.1
GCTCCCACGAAGAGGGACGGTTGGCTCGACACCAACAAGGGTGCCATGCTGGACCAGCGTGAAAAGGTTTCCAAG
GCATT
M65067.1 TCTCGTGCTATCACTGAAGATTTTCACACCATGATTATGGATG----------------
---------------------
AF085332.1 ----------------------GGCTCAGTGG-----------TAA--------CAGC-
CACGAAGG---ACACAGGCTT
AF394060.1
TTTCCGGTGAAGCGAGACACCTGGCTGGACACGAACCAGGAAGAGATGAACAAGCAGCGCACCATGGTGAGCGCT
CACTT
*

L04648.1 CGCCAAGGTCTGTGAGAAA---
GGCTTCGAGGCCGGCGATAACAAGCTGGGCGGCGCGCTCAACGCCAAGCATGTGGAGA
M65067.1 --G---------TACAAAAACAGGTCTTCATACTGATGGTAAAAA-----------
CATCGAATTCC---CAGATGTAAA
AF085332.1 CT---------
GCGAGAAAACGGGATTGGAGTCTGGCGGGGTTGCTCATGGAGGCGCTTTGAATGCAGCTCAGGTGGCGC
AF394060.1 TGCTGACGTCTGTGACAAT---
GGCTTCGAAGTCCATGACAATATCAAGGGTGGGCCGGTGAGCGCCGCGCATGTTGAGG
** ** * * * *
* * ** *

L04648.1 AGTATGGTG-----
ACAACTTCAAGAATGGCATGCACAAGCCCGAGTTCCATGAGGACGGCCTGCACAAGCCAATGGAGG
M65067.1 CGTTTACCCAGAGGCGTATTTAGAGA-----------------
AAATTCCAACATGCATGACTGCTGAA-----------
AF085332.1 ACCTCGATG--
AGGATGCGTTCAAGGGTGGGCTGCACAGGCCCAAGTTTGACAGCGAGGGCCTCCACAAGCCGCACACCT
AF394060.1 CGCTGGGCA--
AGGAGCATTTCGAGGACGGGCTGCATAAGCCCAAGTTCCATGATGATGGATTGCACAAGCCCATGGCAG
** ** * ** * *
* * * **

L04648.1
TTGGCGGCAAAAAGTTCGAAAGCGGCTTCCACTACCTCCTCGAGTGCCATGAGCTCGGTGGCAAGAACGCCAGCG
GCGGC
M65067.1 TCAGCAACAACGACT-------TGGCTTGC-------------------TGAGCGTGG-
---------------------
AF085332.1
CCGGCGGCAAGACCTACGAGACCGGCTTCCACTACCTCCTTGAGGCGCATGAGCTTGGAGGCAAGAATGCTGATG
GCGGC
AF394060.1
CCGGCGGCAAAGTGTACGAGACTGGCTTCCACTACCTGCTGGAGGCACACGAGCTTGGGGGCAAAAACGCCGACG
GAGGC
** *** * ***** * **** **

L04648.1 TATGGCGGTCCGCTCTGCGAGGATCCGTACGGCTCAGAG--------------------
---------------------
M65067.1 ------------CTTACCGATGGTTCTTA------------------------------
---------------------
AF085332.1
TTCGGTGGGCCCCTCTGTGCTGACCCATTTAGCCCTGAGATCGAACAGCTCTGCCAGGCGCTTGTCCGCGAGGCA
CAGGA
AF394060.1
TTCGGTGGCCCGCTCTGCGAGGACCCGTATGGGGATGAGGTGCAAAGCATGACAGAAAACTTGCTTGCACAGTCT
GAGAT
** * * * *

L04648.1 -----------------------------------------------------------
---------------------
M65067.1 -----------------------------------------------------------
---------------------
AF085332.1 CGACAAGACGCTGTGCTTCGAGAACTTCACCAAGCCGTGCCCACAGCTGA---------
---------------------
AF394060.1
TGACAACACCCTCGCCTTCCAGAACTTCAAAGCTCCCTGCCCCGCCCTTACCACGAAGCAGGTGGCGATGTGCAA
GGGTT

L04648.1 -----------------------------------------------------------
---------------------
M65067.1 -----------------------------------------------------------
---------G-----------
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1
TTGATTACGGCAACAAGAGGCTGAAACTGCCCTGTGGCCCGCTCCCGTGGCCTGCCGGTCTGCCTGCACCCGGCT
ATGTG

L04648.1 -----------------------------------------------------------
---------------------
M65067.1 -----------------------------------------------------------
---------------------
AF085332.1 -----------------------------------------------------------
---------------------
AF394060.1
CCAAAGACTGACCCCCTTCACGGGCGCTGGATCACAGTCTCCGGCGGCCAGACTGCCTTTATCAAGGAGGCCATC
AAGTC
L04648.1 -----------------------------------------------------------
---------------------
M65067.1 -----------------------------------------------------------
---------------------
AF085332.1 -----------------------CCAAGAAG----------------------------
---------------------
AF394060.1
AGGTATGCTCGGTGCCTCCGAGGCCAAGAAGATCATTGCAGACACCGACCATCACCAGACTGGTGGCATGTACCT
GCGCA

L04648.1 -----------------------------------------------------------
---------------------
M65067.1 -----------------------------------------------------------
---------------------
AF085332.1 --------CAGGTCGAGCTGTG------------------------------------
CAAG------------------
AF394060.1
TCAATCAGCACGGCGATGTGTGCACCGTTGACGCGTCAGTTGCCAAATTTGCTCGCGCCAAGCGCACCTGGAAGT
CTGGC

L04648.1 -----------------------------------------------------------
---------------------
M65067.1 ---------------T-T--------G-GAT---------------------
TATTACAACGAGTGAAAAGAAAGCT-CA
AF085332.1 ------------GGCT-T---------CGAC---------------------TA-----
-------------CGGCGACA
AF394060.1
CACTACTTCTATGAGCCTCTTGTCTCCGGAGGCAATCTCCTTGGTGTCTGGGTACTGCCGGAGGAGTACCGCAAG
A-TCG

L04648.1 -G
M65067.1 AA
AF085332.1 AG
AF394060.1 GC