Está en la página 1de 13

INFORME N 008 2017 - LACR

A : ALFREDO CASADO CORNEJO


Sub Director de Sanidad Acucola

ASUNTO : Informe de actividades.

Es grato dirigirme a Usted para hacer de su conocimiento las actividades realizadas por el
suscrito, como parte del proyecto de tesis titulado Presencia de IMNV, IHHNV y VPAHPND en
langostinos silvestres del gnero Litopenaeus en Tumbes, en la Divisin de Laboratorios
de la Direccin Sanitaria y de Normatividad Pesquera y Acucola de SANIPES, segn se detalla
a continuacin:

Actividades:

1. Redaccin de informe de resultados del primer monitoreo correspondiente al segundo


muestreo para el diagnstico de patologas en langostino silvestre provenientes de canales
de marea del manglar de Tumbes.
2. Participar en las reuniones de coordinacin para el anlisis y sistematizacin de los
resultados obtenidos durante el segundo semestre de monitoreo de langostino silvestre.
3. Obtencin de la resolucin de aprobacin y ejecucin de proyecto de tesis de proyecto en
la Universidad Nacional de Tumbes.
4. Procesamiento y conservacin de tejido de langostinos Litopenaeus vannamei,
provenientes de muestras positivas.
5. Participacin en ensayos de infeccin experimental en langostinos de Litopenaeus
vannamei con presunta cepa positiva para AHPND.

Sin otro particular, me despido.

Atentamente,

Tumbes, 28 de agosto del 2017

-----------------------------------------------------
Luis Alfredo Caldern Romero
Tesista
DNI: 46972646
RUC: 10469726466
Domicilio: Av. Mariscal Castilla N 115, Zorritos
ACTIVIDADES

1. Redaccin de informe de resultados del segundo muestreo para el diagnstico de


patologas en langostino silvestre provenientes de canales de marea del manglar
de Tumbes.

Ver Informe: Segundo Muestreo (Anexo N 1).

2. Participar en las reuniones de coordinacin para el anlisis y sistematizacin de


los resultados obtenidos durante el segundo semestre de monitoreo de langostino
silvestre.

Participacin activa en las reuniones de coordinacin y planificacin para los siguientes


muestreos (3 y 4) correspondientes al segundo semestre de monitoreo de langostinos
silvestres para el proyecto de tesis Presencia de IMNV, IHHNV y VPAHPND en langostinos
silvestres del gnero Litopenaeus en Tumbes.

3. Obtencin de la resolucin de aprobacin y ejecucin de proyecto de tesis en la


Universidad Nacional de Tumbes.

Ver Anexo N 2.

4. Procesamiento y conservacin de tejido de langostinos Litopenaeus vannamei,


provenientes de muestras positivas.

Participacin activa en el procesamiento y conservacin de tejidos de referencia de


Litopenaeus vannamei de las contramuestras positivas del mes de Julio del presente
ao, correspondiente a los muestreos de Sanidad Acucola de langostino de cultivo. Ver
Anexo N 3.

Procedimiento: mediante el uso de una hoja de bistur estril extraer el hepatopncreas


y plepodos de las contramuestras positivas (segn precinto) y conservarlas a -20 C.

5. Participacin en ensayos de infeccin experimental en langostinos de Litopenaeus


vannamei con presunta cepa positiva para AHPND.

En coordinacin.

-----------------------------------------------------
Luis Alfredo Caldern Romero
Tesista
ANEXOS

ANEXO N 1

INFORME: SEGUNDO MUESTREO

El segundo muestreo se realiz aprovechando la marea baja.

Figura 1. Ubicacin geogrfica de los canales de marea en estudio, en el ecosistema manglar


de la Regin Tumbes, Per.

Se evaluaron siete canales de marea del ecosistema de manglar de la Regin Tumbes (Fig. 1),
ubicados en las provincias de Tumbes y Zarumilla:

1) Boca del ro Tumbes (33028,92S; 80 2949,86W),


2) El Alcalde (33056,22S; 802636,12W),
3) Jel (32943,98S; 802228,98W),
4) El Bendito (32659,76S; 80193,6W),
5) Soledad (32731,86S; 801830,48W),
6) Algarrobo (32813,68S; 801753,34W).
7) Envidia (32718,36S; 801845,42W).
Se obtuvieron los siguientes parmetros (tabla 1):
Tabla N 1: Canales de marea en estudio, en el ecosistema manglar de la Regin Tumbes,
Per y total de ejemplares de peneidos silvestres capturados.

Estacin Ejemplares GPS


Boca del Rio Tumbes 20 33028,92S;
80 2949,86W
Alcalde 20 33056,22S;
802636,12W
Jel 20 32943,98S;
802228,98W
El Bendito 20 32659,76S;
80193,6W
Soledad 20 32731,86S;
801830,48W
Algarrobo 20 32813,68S;
801753,34W
Envidia 20 32718,36S;
801845,42W
Total 140

Los ejemplares se obtuvieron mediante lances de atarraya (1.22 cm de luz) en marea baja,
segn tabla de marea. Las muestras obtenidas fueron etiquetadas y preservadas en fresco con
gel-pack y llevadas al laboratorio donde fueron analizadas: INCABIOTEC S.A.C.

En el laboratorio se obtuvieron datos individuales de los ejemplares extrados como: peso, talla,
especie y alguna caracterstica adicional externa de inters (flacidez, coloracin rojiza, musculo
blanco, deformidad o necrosis cuticular).

Tabla 2. Datos individuales obtenidos en el laboratorio.

Total de L. L. Peso (g) Talla (cm)


Estacin Caractersticas externas
Ejemplares vannamei stylirostris Promedio Promedio

Boca del Rio Tumbes 20 20 0 7.90 9.73 Br sucias, BrAm, UrR

Alcalde 20 20 0 3.93 7.60 Br sucias, BrAm, UrL,

Jel 20 8 12 8.04 10.00 Br sucia, BrAn, UrL, UvL

El Bendito 20 0 20 15.63 12.65 Br sucias, PlR, UrR, UvL

Soledad 20 8 12 2.30 6.33 Br sucias, PlAm

Algarrobo 20 13 7 5.23 8.28 Br sucias, BrAm, UrR

Envidia 20 19 1 5.09 8.38 Br sucias, BrAm, UrL

TOTAL 140 88 52
Procesamiento de las muestras:

1. Obtencin de tejidos de referencia para IHHNV, IMNV y VPAHPND.

Para los anlisis de IHHNV e IMNV, se extrajeron como tejidos de referencia plepodos y
msculo, respectivamente, y se agruparon en pools de 10 langostinos, posteriormente se les
realiz la extraccin de ARN para su amplificacin.

Sin embargo, para el anlisis de VPAHPND se us como tejido de referencia el


hepatopncreas el que fue sembrado como co-cultivo bacteriano para obtener la presunta
cepa de Vibrio parahaemolyticus causante de AHPND; para lo cual se realiz dos pool de 10
hepatopncreas, luego se maceraron y una alcuota de 20 l se sembr en medio liquido
TSB (Tryptic Soy Broth) ajustado al 2 % de NaCl. Luego se incub por 24 horas y
posteriormente se le realiz la extraccin de ADN para su amplificacin.

2. Extraccin de cidos nucleicos (ADN/ARN).

a. Extraccin de ARN

a.1. Para la deteccin de IMNV se utiliz un protocolo adaptado de Poulos et al. 2006,
validado por la OIE. Las secuencias utilizadas son en base a las descritas en la
publicacin, pero mejoradas por Incabiotec SAC optimizando las caractersticas de
amplificacin y sensibilidad basndose sobre el genoma completo del IMNV (nmero de
acceso de GenBank AY570982). La extraccin de cidos nucleicos se realiz a partir de
tejidos del musculo y por medio de Trizol Reagent siguiendo las recomendaciones del
fabricante.
Se colocan aproximadamente 100 L de musculo de langostino. Lavar con 500 L
de agua ultra pura o solucin salina (lavar 5 veces).
Se recomienda centrifugar los tubos para facilitar la eliminacin del agua de los
lavados.
Macerar y colocar 500 L Tri Reagent (TRIZOL), y homogenizar con fuerza
utilizando la pipeta.
Incubar por 5 minutos a 4 C las diferentes muestras mezclando con el Tri Reagent
(TRIZOL).
Aadir 100 L de Cloroformo.
Mezclar vigorosamente invirtiendo los tubos durante 1 minuto y dejar reposar 2 a 15
minutos a temperatura ambiente (sobre hielo).
Centrifugar a 12000 por g 15 minutos a 4 C.
Transferir la fase superior a un nuevo microtubo libre de ARNasa.
Agregar 300 L de Isopropanol helado en el caso.
Mezclar invirtiendo el microtubo varias veces y dejar reposar 10 minutos a
temperatura ambiente (sobre hielo).
Microcentrifugar a 12000 x g por 10 minutos a 4 C.
Eliminar el sobrenadante sin desprender el sedimento de ARN.
Agregar 300 500 L de Etanol 75 % (lavar las paredes del tubo).
Homogenizar invirtiendo varias veces el microtubo.
Microcentrifugar a 7500 x g por 5 minutos a 4 C.
Eliminar el sobrenadante y dejar secar el pellet por 10 minutos a temperatura
ambiente.
Resuspender el sedimento en 20 a 50 L de Agua Ultra pura (mantener sobre hielo).
Tomar 2 L para la reaccin de Retrotranscripcin.

b. Extraccin de ADN

b.1. Para la deteccin de IHHNV se utiliz el protocolo y secuencias publicados por


Motte et al. 2003, la extraccin de cidos nucleicos se realiz a partir de msculos por
medio del protocolo Lysis Buffer de la misma publicacin de referencia.

Tomar entre 50 a 500 mg de muestra (heces, hepatopncreas u otro tejido fresco)


en un microtubo y lavar agregando 500 L de solucin salina al 2 %. Centrifugar a
10 000 rpm por 2 minutos y descartar el sobrenadante. Repetir este proceso por 3
veces teniendo cuidado de no triturar la muestra ni tratar de perderla durante los
lavados.
Macerar la muestra lavada.
Agregar 500 L de Lysis Buffer para tejidos.
Incubar a 95 C por 10 minutos.
Centrifugar a 13 000 rpm por 5 minutos para tejido.
Recuperar 300 L del sobrenadante para tejido.
Colocar el sobrenadante a un nuevo tubo y agregar 600 L de Etanol al 95 %
(helado).
Centrifugar a 13 000 rpm durante 15 minutos.
Descartar el sobrenadante.
Agregar 400 L de Etanol al 75 % (helado).
Centrifugar a 13 000 rpm por 5 minutos.
Descartar el sobrenadante totalmente.
Dejar secar el pellet por 20 a 30 minutos.
Resuspender el pellet totalmente seco con T. E. pH 8.0 (pre-calentado a 50 C); 100
L para tejido (verificar que no haya residuos d etanol en la muestra antes de
agregar el T. E.).

b.2. Para la deteccin de VPAHPND se utiliz el protocolo y secuencias publicados por


Sirikharin et al. 2015, validado por la OIE, la extraccin de cidos nucleicos se realiz a
partir de hepatopncreas usado en cultivo bacteriano por medio del protocolo Lysis
Buffer de la misma publicacin de referencia.
Centrifugar el cultivo bacteriano a 10 000 rpm por 10 minutos, descartar el
sobrenadante.
Agregar 500 L de buffer CTAB (Tris HCl 100 mM pH 8, NaCl 1.4 M, EDTA 20 mM,
CTAB 2%) 2 L de lisozima (50 mg/ml) y L de proteinasa (20 mg/ml). Incubar a 55
C durante 2 horas.
Incorporar 1 L de ARNasa (10 mg/ml) e incubar a 60 C durante 10 minutos.
Agregar 300 Lde Fenol y 300 L de Cloroformo: alcohol isoamil (25:24:1).
Centrifugar a 10 000 rpm por 10 minutos a una temperatura 5 C. transferir entre
250 300 L de la fase superior a un nuevo microtubo.
Agregar cloroformo/alcohol isoamil (24:1) en igual volumen del sobrenadante
recuperado. Centrifugar a 10 000 rpm por 10 minutos a una temperatura de 4 C.
transferir la fase superior a un nuevo microtubo.
Agregar etanol al 96 %, (2 veces el volumen recuperado). Incubar a -20 C por 15
minutos. Centrifugar a 10 000 rpm por 10 minutos a 5 C.
Eliminar cuidadosamente el sobrenadante y enjuagar el precipitado con 1 ml de
Etanol al 75 %, invirtiendo el tubo suavemente. Centrifugar a 10 000 rpm por 5
minutos a temperatura ambiente.
Eliminar el sobrenadante y dejar secar el sedimento (ADN) con el tubo destapado
cerca de un mechero por un mximo de 15 minutos.
Resuspender el precipitado de ADN en 50 L de solucin TE 1X (10 mM/1 mM)
previamente calentada a 65 C y luego conservar a -20 C para su amplificacin.
c. Cebadores especficos para cada agente etiolgico

Se utilizaron cebadores especficos para cada agente etiolgico segn lo establecido


por la OIE. Ver tabla 3.

Tabla 3. Relacin de cebadores especficos para cada agente etiolgico evaluado y productos
de amplificacin de la PCR.

Patgeno Cebador Secuencia Producto Referencia


389F CGGAACACAACCCGACTTTA
IHHNV 389 OIE 2016
389R GGCCAAGACCAAAATACGAA
4587F CGACGCTGCTAACCATACAA 328
4914R ACTCGGCTGTTCGATCAAGT
IMNV OIE 2016
475NF GGCACATGCTCAGAGACA
139
4863NR AGCGCTGAGTCCAGTCTTC
AP4-F1 ATGAGTAACAATATAAAACATGAAAC 1269
AP4-R1 ACGATTTCGACGTTGCCCAA
VPAHPND OIE 2016
AP4-F2 TTGAGAATACGGGACGTGGG
230
AP4-R2 GTTAGTCATGTGACCACCTTC

3. Anlisis de PCR

Las muestras sern analizadas mediante la tcnica que le corresponda, as como se


muestra en la tabla 4; siguiendo las instrucciones recomendadas por el fabricante.

Tabla 4. Tcnicas de amplificacin segn agente etiolgico (PCR y variantes).

RT Semi Nested PCR:

Corresponde a la realizacin de una transcripcin reversa de ARN a ADN


complementario seguida por 2 series de amplificacin (PCR) del ADN del patgeno. La
IMNV primera PCR, va a ser positiva en el caso de una infeccin moderada, fuerte o muy
fuerte. Cuando la primera reaccin de la PCR es negativa, se realiza la segunda reaccin
que permite determinar si la muestra es realmente negativa o si se trata de una
infeccin positiva pero muy leve.

IHHNV Nested PCR:

Y 2 series de amplificacin (PCR) del ADN del patgeno. La primera PCR, va a ser positiva
en el caso de una infeccin moderada, fuerte o muy fuerte. Cuando la primera reaccin
VPAHPND de la PCR es negativa, se realiza la segunda reaccin que permite determinar si la
muestra es realmente negativa o si se trata de una infeccin positiva pero muy leve.
4. Migracin por electroforesis

Los productos de amplificacin sern visualizados en geles de agarosa al 1 %, teidos con 5


l de bromuro de etidio (0,5 g/l) y usando como tampn de migracin buffer TAE 1X.

5. Clculo de prevalencia mediante pools.

La prevalencia se calcular usando la frmula que permite hallar la prevalencia individual de


la poblacin cuando se usa pools de muestras (Kline et al. 1989).


(%) = ( )

Resultados:

Como se explic en el procesamiento de muestras, el anlisis de los ejemplares se realiz


mediante pools de 10 ejemplares, obtenindose 2 pools positivos para IHHNV en el canal Boca
del Ro Tumbes y 2 pools positivos para VPAHPND de los canales de marea El Jel y La Envidia,
respectivamente. Ver tabla 5, 6 y 7.

Las prevalencias del segundo muestreo fueron IHHNV (14.29 %) y VPAHPND (14.29 %) de los
pools positivos obtenidos. La prevalencia individual sera IHHNV (1.53 %) y VPAHPND (1.53 %),
es decir, estimamos que en la poblacin estarn infectados casi el 2 % de los individuos, para
ambos casos. Ver tabla 8.

Segn los resultados obtenidos se afirma la presencia de IHHNV y VPAHPND en Tumbes en las
poblaciones silvestres de peneidos del gnero Litopenaeus y libres de IMNV. Segn el segundo
muestreo, Tumbes 2017.

Vale aadir, que los langostinos silvestres pueden permanecer como infectados latentes, sin
embargo, si ingresan a los sistemas de cultivo podran propagar cualquier tipo de patgeno.

Se podra recomendar, para una mejor obtencin de datos, procesar las muestras de manera
individual y no mediante pools porque surgen problema de interpretacin de datos.

Tabla 5. Pools positivos en el segundo muestreo del anteproyecto de tesis, Tumbes 2017.

Pools positivos a Pools positivos a Pools positivos a


Estacin
IMNV IHHNV VPAHPND
Boca del Rio Tumbes 0 2 0
Alcalde 0 0 1
Jel 0 0 0
El Bendito 0 0 0
Soledad 0 0 0
Algarrobo 0 0 0
Envidia 0 0 1
TOTAL 0 2 2
Tabla 6. Resultado de los anlisis de patgenos de langostinos de origen silvestre, Tumbes
2017.

Deteccin de:
Estacin de N IMNV IHHNV VPAHPND
Muestreo Pools 1era PCR 2da PCR 1era PCR 2da PCR 1era PCR 2da PCR
Boca del 1 NEGATIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
Rio Tumbes 2 NEGATIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
1 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
El Alcalde
2 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO POSITIVO
1 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
El Jel
2 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
1 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
El Bendito
2 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
1 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
La Soledad
2 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
El 1 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
Algarrobo 2 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
1 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO POSITIVO
La Envidia
2 NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO

Tabla 7. Presencia de los agentes etiolgicos en estudio del segundo muestreo del
anteproyecto de tesis, Tumbes 2017.

Estacin Presencia Presencia Presencia


IMNV IHHNV VPAHPND
Boca del Rio Tumbes NEGATIVO POSITIVO NEGATIVO
Alcalde NEGATIVO NEGATIVO POSITIVO
Jel NEGATIVO NEGATIVO NEGATIVO
El Bendito NEGATIVO NEGATIVO NEGATIVO
Soledad NEGATIVO NEGATIVO NEGATIVO
Algarrobo NEGATIVO NEGATIVO NEGATIVO
Envidia MEGATIVO NEGATIVO POSITIVO

Tabla 8. Prevalencia de los agentes etiolgicos en estudio del segundo muestreo del
anteproyecto de tesis, Tumbes 2017.

Prevalencia Total Prevalencia Individual


N Muestreos (%) (%)
IMNV IHHNV VPAHPND IMNV IHHNV VPAHPND

Segundo muestreo (2) 0 14.29 14.29 0 1.53 1.53


ANEXOS N 2
Resolucin de Aprobacin y Ejecucin de proyecto de tesis en la Universidad Nacional de
Tumbes.
ANEXOS N 3
Procesamiento y conservacin de tejidos de referencia de Litopenaeus vannamei de las
contramuestras positivas del mes de Julio del presente ao.

Procedimiento: mediante el uso de una hoja de bistur estril extraer el hepatopncreas y


plepodos de las contramuestras positivas (segn precinto) y conservarlas a -20 C.