Está en la página 1de 12

Artculo de Revisin

Rev Peru Med Exp Salud Publica

TCNICAS MOLECULARES PARA LA DETECCIN E


IDENTIFICACIN DE PATGENOS EN ALIMENTOS:
VENTAJAS Y LIMITACIONES
Carolina Palomino-Camargo1,a,b, Yuniesky Gonzlez-Muoz1,2,c

RESUMEN
Las enfermedades transmitidas por alimentos, ocasionadas por microorganismos patgenos, constituyen un grave
problema de salud pblica a nivel mundial. Los mtodos microbiolgicos utilizados comnmente en la deteccin de estos
patgenos, de origen alimentario, son laboriosos y consume mucho tiempo. Esta situacin, aunada a la demanda por
resultados inmediatos y a los avances tecnolgicos, ha conducido al desarrollo de una amplia gama de mtodos rpidos
en las ltimas dcadas. En base a esto, la presente revisin describe las ventajas y limitaciones de los principales mtodos
moleculares utilizados en la deteccin e identificacin de microorganismos patgenos transmitidos por alimentos. Para
ello, se consider la actualidad de la informacin consultada, el anlisis objetivo de la temtica y su alcance. La literatura
reciente reporta un nmero significativo de tcnicas moleculares, alternativas, sensibles y selectivas para la deteccin,
enumeracin e identificacin de microorganismos patgenos en alimentos, siendo la reaccin en cadena de la polimerasa
(PCR) la plataforma ms popular, mientras que la secuenciacin de alto rendimiento se perfila como una tcnica de gran
aplicabilidad a futuro. Sin embargo, aun con todas las ventajas que ofrecen estas novedosas metodologas, no se deben
pasar por alto sus limitaciones. As, por ejemplo, los mtodos moleculares no constituyen protocolos estandarizados, lo
que dificulta su utilizacin en algunos casos. Por esta razn se debe trabajar arduamente para superar tales limitaciones
y mejorar la aplicacin de estas tcnicas en matrices tan complejas como los sistemas alimenticios.
Palabras clave: Tcnicas de diagnstico molecular; Inocuidad de los alimentos; Enfermedades transmitidas por los
alimentos; Microbiologa de alimentos; Epidemiologa molecular (fuente: DeCS BIREME).

MOLECULAR TECHNIQUES FOR DETECTION AND


IDENTIFICATION OF PATHOGENS IN FOOD: ADVANTAGES AND
LIMITATIONS

ABSTRACT
Foodborne diseases, caused by pathogenic microorganisms, are a major public health problem worldwide. Microbiological
methods commonly used in the detection of these foodborne pathogens are laborious and time consuming. This situation,
coupled with the demand for immediate results and with technological advances, has led to the development of a wide range
of rapid methods in recent decades. On this basis, this review describes the advantages and limitations of the main molecular
methods used in detection and identification of foodborne pathogens. To this end, we considered how recent the information
was published, the objective analysis of the topic and its scope. Recent literature reports a significant number of alternative,
sensitive and selective molecular techniques for detection, enumeration and identification of pathogenic microorganisms in
food. Polymerase chain reaction (PCR) is the most popular platform, while high performance sequencing is emerging as
a technique of wide applicability for the future. However, even with all the advantages of these new methodologies, their
limitations should not be overlooked. For example, molecular methods are not standardized protocols, which hinders its
use in some cases. For this reason, hard work should be done to overcome these limitations and improve the application of
these techniques in complex matrices such as food systems.
Key words: Molecular diagnostic techniques; Food safety; Foodborne diseases; Food microbiology; Molecular
epidemiology (fuente: DeCS BIREME).

1
Instituto de Ciencia y Tecnologa de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela.
2
Ministerio del Poder Popular para la Alimentacin. Caracas, Venezuela.
a
Magster en Ciencia y Tecnologa de los Alimentos; b licenciada en Biologa; c licenciado en Ciencias de los Alimentos.
Recibido: : 11-01-14 Aprobado: 23-07-14

Citar como: Palomino-Camargo C, Gonzlez-Muoz Y. Tcnicas moleculares para la deteccin e identificacin de patgenos en alimentos: ventajas y limita-
ciones. Rev Peru Med Exp Salud Publica. 2014;31(3):535-46.

535
Rev Peru Med Exp Salud Publica. 2014; 31(3):535-46. Palomino-Camargo C & Gonzlez-Muoz Y

INTRODUCCIN al procesamiento al que se sujeta el alimento, lo que


imposibilita el uso de los mtodos de cultivo como
Las enfermedades transmitidas por los alimentos (ETA) herramienta de diagnstico. Una serie de mtodos
son un problema de salud pblica en todo el mundo y una moleculares alternativos, rpidos y sensibles para la
causa importante de morbilidad, lo cual supone una carga deteccin, identificacin y cuantificacin de patgenos
econmica significativa para las naciones, perjuicios para transmitidos por alimentos han sido desarrollados para
los consumidores y un impacto al comercio internacional superar estos inconvenientes (2,6,8,9).
de productos alimenticios (1-4). Ms de 250 enfermedades
conocidas se transmiten a travs de alimentos. Su El objetivo de la revisin es describir los distintos mtodos
incidencia ha aumentado considerablemente durante las moleculares utilizados para la deteccin, e identificacin de
ltimas dcadas por la rpida globalizacin del mercado microorganismos patgenos transmitidos por alimentos,
de alimentos y por los profundos cambios en los hbitos haciendo particular nfasis en sus ventajas y limitaciones.
alimenticios. Adems, este problema se acrecienta con el
surgimiento de nuevas formas de transmisin, la aparicin
de grupos poblacionales vulnerables, y el aumento de METODOLOGA
la resistencia a los compuestos antimicrobianos en los
microorganismos patgenos (2,3). Se realiz una revisin de tipo narrativa, no sistemtica,
referente a las tcnicas moleculares utilizadas actualmente
Se sabe que alrededor de 40 diferentes patgenos de en la deteccin e identificacin de patgenos en alimentos,
origen alimentario causan enfermedades humanas (2). destacando a la vez, sus aplicaciones, ventajas y
Ms del 90% de los casos confirmados y las muertes limitaciones. La recoleccin de la informacin se efectu
causadas por dichos patgenos han sido atribuidos durante noviembre y diciembre de 2013. La bsqueda se
a bacterias (5). Entre las bacterias ms comunes se llev a cabo en las bases de datos Science Direct, Springer
encuentran; Clostridium botulinum, Escherichia coli, Journal y Medline. La estrategia de bsqueda estuvo
Salmonella spp., Listeria monocytogenes, Yersinia caracterizada por los siguientes criterios: actualidad de la
enterocolitica, Staphylococcus aureus, Shigella spp., informacin consultada, anlisis objetivo de la temtica y
Bacillus cereus, y Campylobacter jejuni (3). No obstante, alcance de la misma. Los trminos de bsqueda aplicados
aproximadamente el 98% de los microorganismos fueron: Molecular diagnostic techniques, food safety,
encontrados en los productos alimenticios no son foodborne diseases, molecular epidemiology y advantages
patgenos (6). Por esta razn, se requiere desarrollar and limitations of molecular diagnostic techniques. Se
pruebas de diagnstico que puedan detectar incluyeron artculos en ingls y espaol.
especficamente el microorganismo de inters (6).

La inocuidad de los alimentos es un concepto inherente a MTODOS MOLECULARES PARA LA


la seguridad alimentaria, y est relacionada con muchos DETECCIN E IDENTIFICACIN DE
aspectos de las tecnologas de produccin agraria, a la PATGENOS TRANSMITIDOS POR
manipulacin y elaboracin de alimentos, constituyendo ALIMENTOS
una importante prioridad poltica en todo el mundo (2,4).
Por lo tanto, el desarrollo y la optimizacin de alternativas Los principales avances en los ensayos de deteccin de
novedosas para el seguimiento, caracterizacin y patgenos en alimentos, basados en cidos nucleicos, se
enumeracin de patgenos en alimentos es uno de los produjeron a partir de 1980 (10). Los primeros mtodos de
aspectos clave en la microbiologa de alimentos (7), y se identificacin molecular fueron la hibridacin ADN-ADN,
vuelve cada vez ms importante para la agricultura, la el anlisis de secuencias del ADNr 16S, la hibridacin con
industria alimentaria y los consumidores. una sonda especfica y el anlisis RFLP o ribotipificacin.
En contraste con las caractersticas fisiolgicas y
Los mtodos microbiolgicos clsicos implican, bioqumicas, la identificacin molecular se basa en la
generalmente, el uso de un apropiado cultivo de composicin constitutiva de los cidos nucleicos ms
preenriquecimiento y enriquecimiento, el aislamiento en que en los productos de su expresin. Estos mtodos
medios selectivos y la posterior confirmacin mediante moleculares se utilizan a menudo en asociacin con la
pruebas bioqumicas morfolgicas y/o serolgicas. Todo identificacin microbiolgica convencional (10,11).
esto es laborioso, la obtencin de resultados puede
tomar das o semanas y, adicionalmente, presentan El descubrimiento de la PCR, la clonacin, la secuenciacin
baja sensibilidad. Aunado a ello, se ha demostrado y la tecnologa de deteccin por fluorescencia, as como
que algunas clulas bacterianas pueden entrar en la accesibilidad a una gran cantidad de informacin
un estado viable pero no cultivable (VPNC), debido en la web ayud al desarrollo de nuevas herramientas

536
Rev Peru Med Exp Salud Publica. 2014; 31(3):535-46. Deteccin e identificacin de patgenos en alimentos

moleculares, cuyo uso ha aumentado enormemente la Molde de ADN


habilidad para detectar y cuantificar bacterias patgenas
en agua y alimentos, entre estas, muchas bacterias
emergentes, como por ejemplo; Escherichia coli O157,
Helicobacter pylori, Campylobacter spp., las cuales han
representado una seria amenaza para la salud pblica
mundial. La segunda generacin de mtodos moleculares
para la deteccin e identificacin de gneros y especies
son la reaccin en cadena de la polimerasa (PCR), la
PCR mltiple, la secuenciacin de genes especficos,
el anlisis de restriccin del ADN ribosomal amplificado,
entre otros (11,12).

Recientemente, se ha dado un paso hacia las plataformas


moleculares ms sofisticadas para la identificacin
de microrganismos patgenos, incluyendo sistemas
de amplificacin in vitro en tiempo real, biosensores y
microarreglos (9), los cuales han sido desarrollados o se
estn desarrollando para su uso como mtodos rpidos
en la deteccin de patgenos en alimentos. Algunos de
los actuales mtodos de deteccin molecular pueden ser
empleados, adems, en laboratorios o establecimientos
clnicos, en sitios de observacin, tales como la granja o
el campo, en forma de kit todo en uno.

APLICACIN DE TCNICAS
MOLECULARES EN LA DETECCIN E
IDENTIFICACIN DE PATGENOS
TRANSMITIDOS POR ALIMENTOS

REACCIN EN CADENA DE LA POLIMERASA

La enumeracin de patgenos transmitidos por alimentos Figura 1. Etapas de la PCR*


es un aspecto principal del diagnstico molecular *La tcnica de PCR se basa en el principio de complementariedad de
microbiolgico, especialmente si quiere utilizarse para la bases del ADN y en la participacin de la enzima polimerasa que permite
evaluacin cuantitativa del riesgo. La reaccin en cadena la extensin del fragmento a amplificar, agregando nucletidos en
secuencia complementaria al ADN molde por medio de un proceso cclico
de la polimerasa (PCR) es la tcnica de diagnstico que comprende tres pasos: desnaturalizacin, hibridacin y extensin (20).
molecular ms ampliamente utilizada debido a su
protocolo rpido y de fcil uso (Figura 1). Por lo general, en leche y en muestras de agua (utilizada para el lavado
2-3 h son necesarias para completar una PCR, pero hoy del pollo) fue identificada a travs de la PCR, en conjunto
en da se estn desarrollando sistemas de PCR ms con una tcnica de separacin inmunomagntica (IMS).
avanzados para generar un resultado en cuestin de El tiempo de ensayo fue de 8 h, sin el enriquecimiento
minutos (2). A continuacin se presentan varios ejemplos de de la muestra (14). Una PCR-ELISA fue empleada para
las aplicaciones de los distintos tipos de PCR en alimentos. la deteccin de C. jejuni en muestras de aves de
corral. Este ensayo, dirigido al gen ceuE, fue aplicado
Existen muchas pruebas de PCR que se han descrito directamente sin el paso de enriquecimiento previo,
para patgenos relacionados a alimentos (Salmonella, reportndose un lmite de deteccin de 40 ufc/mL (13).
E. coli O157, L. monocytogenes, Campylobacter y varios
otros). Estas se encuentran disponibles comercialmente Asimismo, se han utilizado pruebas basadas en la PCR
(certificado por la FDA y AOAC). Para Campylobacter para la identificacin de Listeria spp y L. monocytogenes
spp. se han desarrollado distintas investigaciones en en distintas muestras de alimentos, leche y productos
alimentos, utilizando la tcnica PCR dirigida a los genes lcteos. Por ejemplo, Gouws y Liedemann (2005) (15)
flaA, CadF, ceuE y cdt y la regin 16S del ARNr (13). De utilizaron un ensayo de PCR especfico para la deteccin
esta manera, una nica clula de Campylobacter jejuni del gen hly de L. monocytogenes y los mtodos de cultivo

537
Rev Peru Med Exp Salud Publica. 2014; 31(3):535-46. Palomino-Camargo C & Gonzlez-Muoz Y

convencionales para la identificacin de Listeria spp. De estafilococos, por nombrar unos pocos. Muchos de los
los 27 productos analizados, 74% fueron presuntamente mtodos basados en cidos nucleicos utilizan la PCR
positivos para Listeria en agar Oxford (Oxoid) y 44% para detectar toxinas diferentes o genes de virulencia
identificados como L. monocytogenes en agar RAPID L. que permiten que las bacterias se conviertan en
mono agar (Bio-rad). La PCR se utiliz como prueba de patgenos. La Tabla 1 contiene una lista de cebadores
confirmacin e identific a L. monocytogenes en el 37%
de la muestras analizadas. Los autores concluyeron Tabla 1. Primers PCR para la deteccin de genes de
que la PCR fue capaz de eliminar los resultados falsos toxinas bacterianas
positivos que se observaron por los mtodos de cultivo.
SECUENCIA DEL PRIMER
ESPECIES TOXINAS GEN
(5 3)
Para la deteccin e identificacin de Salmonella spp. en
Bacillus cereus Hemolisina BL hblA AAGCAATGGAATACAATGGG
alimentos tambin se han desarrollado varios ensayos AGAATCTAAATCATGCCACTGC
PCR. Un ensayo especfico para la especie Salmonella hblB AAGCAATGGAATACAATGGG
typhimurium, basado en la amplificacin del gen OgdH, AATATGTCCAGTACACCCG
se ha descrito con un lmite de deteccin de 100 UFC hblC GATAC(T/C)AATGTGGCAACTGC
a partir de cultivos puros y de 200 UFC a partir de las TTGAGACTGCTCG(T/C)TAGTTG
muestras positivas de carne de pollo (16). hblD ACCGGTAACACTATTCATGC
AGATCCATATGCTTAGATGC
Para los serogrupos O174 y O177 de E. coli se han
Enterotoxina
nheA GTTAGGATCACAATCACCGC
no hemoltica
desarrollado ensayos de PCR basados en los genes wzx y
ACGAATGTAATTTGAGTCGC
wzy (17). Paton y Paton (1998) (17) desarrollaron dos estrategias nheB TTTAGTAGTGGATCTGTACGC
de PCR mltiple para la deteccin de stx1, stx2, eaeA y hlyA TTAATGTTCGTTAATCCTGC
en un caso y para regiones del opern rfb de E. coli O111 nheC TGGATTCCAAGATGTAAGG
y O157 en el otro. Ambos ensayos fueron efectivos para ATTACGACTTCCTGCTTGTGC
la deteccin directa y caracterizacin de 52 cepas de Enterotoxina T bceT CGTATCGGTCGTTCACTCGG
Escherichia coli Shiga Toxignica (serotipos O), aislados GTTGATTTTCCGTAGCCTGGG
de heces humanas, animales domsticos y alimentos. La Citotoxina K cytK ACAGATATCGG(GT)CAAAATGC
sensibilidad de ambos ensayos fue de 103 UFC. GAACTC(G/C)(A/T)AACTGGGTTGGA
Clostridium
Toxina tipo A BoNT(A) AGCTACGGAGGCAGCTATGTT
botulinum
La PCR mltiple ha sido desarrollada para la deteccin CGTATTTCCAAAGCTGAAAAGG
simultnea de dos o ms agentes patgenos asociados Toxina tipo B BoNT(B) CAGGAGAAGTGGAGCGAAAA
a alimentos. Un ensayo de PCR mltiple para la deteccin CTTGCGCCTTTGTTTTCTTG
simultnea de Salmonella spp., L. monocytogenes y E. coli Toxina tipo E BoNT(E) CCAAGATTTTCATCCGCCTA
O157: H7, luego de un cultivo de enriquecimiento, tuvo GCTATTGATCCAAAAACGGTGA
un lmite de deteccin de 1 UFC/g de carne de cerdo, Toxina tipo F BoNT(F) CGGCTTCATTAGAGAACGGA
en un tiempo total de ensayo de 30 h (18). Meng et al., TAACTCCCCTAGCCCCGTAT
(2007) (19) detectaron la presencia de H. pylori a partir de Clostridium
Enterotoxina cpe TTGTTAATACTTTAAGGATATGTATCC
perfringens
distintas muestras de alimento, utilizando una novedosa
TCCATCACCTAAGGACTG
PCR mltiple. La especificidad del ensayo fue probada E. coli Toxina Shiga 1 stx1 AGTCGTACGGGGATGCAGATAAAT
utilizando 11 especies bacterianas distintas y a H. pylori CCGGACACATAGAAGGAAACTCAT
como control positivo. Los autores sealaron las ventajas Toxina Shiga 2 stx2 TTCCGGAATGCAAATCAGTC
de este mtodo frente a la PCR convencional, indicando CGATACTCCGGAAGCACATTG
que solo se requirieron 6 h para obtener resultados. Staphylococcus Enterotoxi-
entA CCTTTGGAAACGGTTAAAACG
aureus na A
TCTGAACCTTCCCCATCAAAAAC
Muchos microorganismos patgenos, asociados a alimen-
Enterotoxina B entB TCGCATCAAACTGACAAACG
tos son capaces de producir toxinas. Entre ellos se puede
GCAGGTACTCTATAAGTGCCTGC
mencionar a S. aureus, Vibrio cholerae, Clostridium botu-
Enterotoxina C entC CTCAAGACTAGACATAAAAGCTAGG
linum, C. perfringens, Bacillus cereus, y E. coli. En base a TCAAAATCGGATTACATTATCC
esto se han desarrollado diferentes tipos de mtodos diri- Enterotoxina D entD CTAGTTTGGTAATATCTCCTTTAACG
gidos a la deteccin de genes para toxinas. Estos mtodos TTAATGCTATATCTTATAGGGTAAACATC
incluyen; amplificacin e hibridacin con sondas (10). Enterotoxina E entE CAGTACCTATAGATAAAGTTAAAACAAGC
Vibrio cholerae Toxina clera ctxA TAACTTACCGTGGACCCTTC
Los mtodos de PCR dirigidos a la deteccin de toxinas CGGGCAGATTCTAGACCTCCTG
se han desarrollado para varias especies bacterianas CGATGATCTTGGAAGCATTCCCAC
como; V. cholerae, E. coli y algunos aislados de Fuente: Foley y Grant, 2007 (10).

538
Rev Peru Med Exp Salud Publica. 2014; 31(3):535-46. Deteccin e identificacin de patgenos en alimentos

de PCR que se han empleado para la deteccin de previamente cultivadas en caldos de enriquecimiento (22).
genes que codifican toxinas microbianas (10). La deteccin de Salmonella, a partir de 600 g de una
muestra de huevos revueltos, fue reportada por Seo
Muchos ensayos de PCR en tiempo real se han et al., (2004) (22). En este caso, la PCR en tiempo real
desarrollado para patgenos de origen alimentario, suministr resultados en 2 das, mientras que para el
ofreciendo una deteccin rpida, sensible y especfica cultivo convencional se requiri de 5 das.
de una serie de agentes patgenos, tras el cultivo de
enriquecimiento, as como su cuantificacin (10,20). Las Existe un nmero creciente de kits de PCR en tiempo
ventajas de estos ensayos, junto con su facilidad de uso real, disponibles comercialmente para la deteccin de
y la susceptibilidad a la automatizacin los hacen muy patgenos transmitidos por alimentos (Tabla 2).
atractivos para su aplicacin en alimentos, con el fin de
superar la larga etapa de cultivo de enriquecimiento. Entre otras variantes de la PCR se pueden citar: la
Es posible que la investigacin y la evolucin en este RAPD-PCR, la ERIC-PCR y la REP-PCR. El RAPD-
campo crezcan y conduzcan a ensayos de deteccin; PCR ha sido utilizado en la deteccin de especies de
rpidos, especficos y sensibles, que se puedan Listeria en el entorno de procesamiento de aves de
realizar directamente en muestras de alimentos en un corral y en plantas de procesamiento de vegetales
futuro prximo (10). para identificar la fuente de contaminacin y las vas
de difusin (6). Igualmente, se ha empleado para la
Durante los ltimos 5 aos ha habido un nmero creciente tipificacin de E. coli y Salmonella, con resultados
de reportes en la literatura que describe el diseo y satisfactorios (26).
aplicacin de la PCR en tiempo real para las bacterias
patgenas comunes de transmisin alimentaria (9). La ERIC-PCR ha sido utilizada satisfactoriamente para
Por ejemplo, este tipo de prueba (con SYBR Green) la tipificacin de algunos patgenos asociados con
se ha aplicado para la deteccin de Salmonella, con alimentos (Y. enterocoltica y Salmonella) (27). La REP-
tiempos de ensayo de aproximadamente 2 h, sin PCR dirigida a los elementos BOX A1R de E. coli se
preenriquecimiento (21). La PCR en tiempo real (con ha utilizado por una serie de cientficos para distinguir
sondas TaqMan o 5 exonucleasa) se han utilizado para entre cepas bacterianas (28). La bsqueda de secuencias
la confirmacin de los cultivos de Salmonella y para la IS200 tambin se ha utilizado en la metodologa REP-
identificacin de Salmonella en muestras de alimentos PCR para los serotipos de Salmonella (29).

Tabla 2. Ejemplos de kits PCR en tiempo real, disponibles para bacterias patgenas transmitidas por alimentos

Nombre del Kit Bacteria Fabricante Referencia


LightCycler Kit de deteccin del gnero Listeria (para alimentos) Listeria Roche (-9,23)
LightCycler Kit de deteccin para Salmonella (para alimentos) Salmonella Roche (9,23,24)
LightCycler Kit de deteccin de E. coli O157 (para alimentos) E. coli Roche (9,23,24)
LightCycler Kit de deteccin de Campylobacter (para alimentos) Campylobacter Roche (-9,23)
Artus Kit PCR para L. monocytogenes L. monocytogenes Artus (-9)
Artus Kit PCR para Salmonella Salmonella Artus (9)
Artus Kit PCR para Campylobacter Campylobacter Artus (9)
TaqMan Kit de deteccin para Listeria monocytogenes L. monocytogenes Applied BioSystems (9,23)
TaqMan Kit de deteccin para Campylobacter jejuni Campylobacter jejuni Applied BioSystems (9,23)
TaqMan Kit de deteccin para E. coli O157:H7 E. coli Applied BioSystems (9,23,24)
TaqMan Kit de deteccin para Salmonella enterica Salmonella enterica Applied BioSystems (9,23,-24)
SureFood Salmonella Salmonella spp. Congen (9)
Campylobacter jejuni,
SureFood Campylobacter patgena Congen (9)
C. lari, C. coli
SureFood Listeria patgena L. monocytogenes Congen (9)
BAX System para Listeria spp. L. monocytogenes Qualicon y Oxoid (23)
BAX System para E. coli O157 E. coli O157 Qualicon y Oxoid (23,24)
BAX System para Salmonella spp. Salmonella spp. Qualicon y Oxoid (23,24,25)
BAX System para S. aureus S. aureus Qualicon y Oxoid (23,24)
R.A.P.I.D. LT real-time PCR system Salmonella spp. Idahotech (24)
R.A.P.I.D. LT real-time PCR system E. coli Idahotech (23,24)
R.A.P.I.D. LT real-time PCR system Listeria spp. Idahotech (23)

539
Rev Peru Med Exp Salud Publica. 2014; 31(3):535-46. Palomino-Camargo C & Gonzlez-Muoz Y

(35)
AMPLIFICACIN BASADA EN LA SECUENCIA DE epidemiolgicos moleculares de Y. enterocoltica y
CIDOS NUCLEICOS varias especies de Shigella (36).

Aunque menos desarrollada que la PCR, hay una Actualmente, la Pulse-Net EE. UU. ha estandarizado
serie de reportes en la literatura sobre los ensayos de protocolos de PFGE para E. coli O157, S. entrica,
amplificacin basada en la secuencia de cidos nucleicos Shigella spp., L. monocytogenes, Campylobacter spp.
(NASBA), incluyendo algunos que utilizan la metodologa termotolerante y V. cholerae (33).
de tiempo real, para detectar ARNm de patgenos
asociados a alimentos (30). Otros informes sobre el uso BIOSENSORES
de esta tecnologa para la deteccin de patgenos en
alimentos se prevn con mucho inters (10), debido a su Varios mtodos basados en biosensores se han aplicado
capacidad para detectar organismos viables. exitosamente en la deteccin de patgenos alimentarios.
Estos sensores se han desarrollado utilizando ADN,
Sin embargo, en un trabajo realizado por Rodrguez tcnicas inmunolgicas y pptidos de fagos (Tabla 3) (5).
(2004) (31) la sensibilidad del ensayo NASBA a tiempo
real fue pobre, durante la deteccin de Mycobacterium El uso de biosensores en un estudio demostr que E. coli
avium subsp. paratuberculosis (MAP) en muestras de y Salmonella podran detectarse en leche descremada,
leche artificialmente inoculadas. Se requiri ms de con lmites de deteccin de 25 y 23 UFC/mL
5103 clulas, y la reaccin tampoco diferenci el ARN respectivamente (37). El ensayo se llev a cabo en un
del ADN, reduciendo as la ventaja principal del NASBA
para la deteccin de clulas vivas solamente (9).
Tabla 3. Mtodos biosensores para la deteccin de pa-
ELECTROFORESIS EN GEL DE CAMPO PULSADO tgenos en alimentos y otros compuestos relacionados
con alimentos
La electroforesis en gel de campo pulsado (PFGE) se ha
Tcnicas de Compuestos
utilizado para la caracterizacin de Salmonella, Listeria y Organismos
deteccin detectados
otros patgenos de transmisin alimentaria. La base de
datos de estos patgenos se almacenan en Pulse-Net Biosensores Bacillus anthracis,
basados en Patgenos Escherichia coli, Listeria
y Food Net, a las cuales puede accederse a travs del ADN monocytogenes
Centro para el Control y Prevencin de Enfermedades
(CDC), la Administracin de Alimentos y Drogas (FDA) Compuestos
Aflatoxinas, PCB,
y el Departamento de Agricultura de los Estados Unidos pesticidas
(USDA) (6).
Biosensores E. coli O157:H7,
basados en Patgenos Salmonella enterica sv.
Esta tcnica se ha utilizado satisfactoriamente en la enzimas typhimurium
tipificacin de Salmonella, aislada a partir de alimentos
Pesticidas, antibiticos
de origen animal y pacientes humanos (32). La PFGE (leche), cido
tambin ha sido extensamente utilizada a nivel mundial benzoico(bebidas de
Compuestos
para la vigilancia e investigacin de los brotes de E. soda), L lactasa 1 (pasta
de tomate), aminas
coli O157:H7, el trazado de las vas de transmisin y bigenas 1 (sauerkraut)
el rastreo de las fuentes de brotes de restaurantes,
granjas, aguas contaminadas, animales, humanos, y/o Bacillus cereus,
Campylobacter spp., E.
equipos (33). Biosensores coli, L. monocytogenes,
basados en S. enterica sv.
Patgenos
Un ejemplo de la utilidad de las tcnicas moleculares, anticuerpos y enteritidis, S. entrica
receptores 2 sv. typhimurium,
durante la investigacin epidemiolgica, se puede Staphylococcus aureus,
evidenciar en diversos brotes de ETA que por asociacin Yersinia pestis
estadstica llegan a ser significativos cuando se utilizan Pesticidas, antibiticos
estas tcnicas. El brote por consumo de hamburguesas (leche), solventes
en el ao 2000, en EE. UU., solo fue significativo cuando Compuestos orgnicos, alfatoxinas,
enterotoxina B
se emple la electroforesis en campo pulsado (PFGE).
estafilocccica
Mediante la investigacin por mtodos tradicionales
no hubo probabilidad significativa, lo cual gener que
1
Compuestos para indicar frescura en el alimento.
2
Biosensores que combinan tcnicas inmunolgicas y pptidos de fagos.
se descartara el evento como un brote de ETA (34). La Fuente: Hakovirta, 2008 (5)
PFGE tambin ha reportado gran utilidad en los estudios

540
Rev Peru Med Exp Salud Publica. 2014; 31(3):535-46. Deteccin e identificacin de patgenos en alimentos

tiempo menor a 1 h. Los biosensores pticos que utilizan completa pasteurizada adulterada, utilizando este
una seal fluorescente son con frecuencia los ms enfoque.
comunes (38). Sin embargo, los biosensores que utilizan
transductores distintos a los pticos se han desarrollado Un ensayo que incorporaba seales de amplificacin
para la deteccin especfica de Salmonella. Olsen y la tecnologa de microarreglos en suspensin fue
et al., (2006) (39) utilizaron bacterifagos especficos reportado para la identificacin y subtipificacin de
para Salmonella typhimurium. En este biosensor, la L. monocytogenes a partir de ADN genmico (45).
captura de las bacterias por parte de bacterifagos Arreglos de microperlas han sido desarrollados para
adsorbidos a un transductor piezoelctrico dio lugar a la identificacin de Salmonella spp. Una PCR mltiple,
un cambio de frecuencia en la resonancia, la cual fue para E. coli O157: H7 (genes eaeA, hlyA, stx1 y stx2)
medida con un dispositivo de onda acstica Maxtek. y Salmonella (invA), combinada con un sistema de
Su et al., (2005) (40) utilizaron un anticuerpo enlazado microarreglos en suspensin mostr una elevada
a la superficie de un cristal de cuarzo recubierto sensibilidad para ambas especies (49).
con oro, con un electrodo de oro como biosensor.
Despus de la captura de Salmonella, los cambios en Wang et al., (2008) (50) present un ensayo basado
la impedancia de alta frecuencia fueron directamente en arreglos para la identificacin de 23 patgenos
relacionados con el nmero de clulas de Salmonella transmitidos por alimentos. Su arreglo fue diseado para
capturadas. Pathirana et al., (2000) (41) y Kim et al., hibridar al gen 16S del patgeno blanco. Los autores
(2003) (42) tambin utilizaron un anlisis de impedancia encontraron una reactividad cruzada, esperada de
similar para crear biosensores tiles en la deteccin manera terica. Sin embargo, esta reactividad cruzada
de Salmonella typhimurium. Por otro lado Farabullini et no obstaculiz la clasificacin correcta del aislado,
al., (2007) (43) utilizaron sensores electroqumicos para debido a los patrones de hibridacin especfica de los
la deteccin rpida de diferentes bacterias patgenas patgenos.
transmitidas por alimentos (Salmonella spp., Listeria
monocytogenes, Escherichia coli O157:H7, y Wondwossen (2007) (51) desarroll microarreglos
Staphylococcus aureus). de oligonucletidos para la deteccin rpida, el
diagnstico y la caracterizacin de bacterias patgenas
MICROARREGLOS (Campylobacter, Salmonella y Yersinia) y virus
(Norovirus) ms importantes presentes en la carne
Los microarreglos consisten en un gran nmero de sondas de cerdo. Este autor realiz la comparacin entre dos
(clones de ADN, productos de la PCR u oligonucletidos microarreglos, cuyas diferencias se basaron en el diseo
sintticos) inmovilizadas sobre una superficie slida. de la sonda, el montaje y la conformacin de la sonda en
Tras los pasos de hibridacin y lavado, el cido nucleico la lmina de vidrio. Los resultados obtenidos indicaron
enlazado a las sondas genera un patrn de fluorescencia que los microarreglos empleados pueden identificar
que es entonces registrado y analizado utilizando un un amplio rango de bacterias patgenas y ayudar a
escner (8,10). Con el rpido desarrollo de la tecnologa de la caracterizacin de la resistencia antimicrobiana y
microarreglos se ha producido una acumulacin de datos los genes de virulencia presentes, logrndose de esta
sin precedentes, recogidos por instituciones acadmicas forma una gran sensibilidad y especificidad.
y organizaciones industriales (8). Varios microarreglos
se han desarrollado para los patgenos asociados a PIROSECUENCIACIN 454: UNA NUEVA
alimentos. Un microarreglo particular, basado en el gen HERRAMIENTA PARA LA DETECCIN DE
gyrB, fue utilizado para detectar e identificar rpidamente PATOGENOS EN ALIMENTOS Y MEDIOAMBIENTE
a Salmonella y Shigella (44). Las diferentes especies de
Listeria tambin han sido discriminadas por el uso de La tecnologa de secuenciacin de cidos nucleicos
un microarreglo basado en seis genes de virulencia ha dado pasos increbles en los ltimos cinco aos,
determinantes (45). con el desarrollo y comercializacin de microrreactores
para la rpida secuenciacin de alto rendimiento,
Algunos progresos se han hecho con la identificacin tambin conocido como pirosecuenciacin 454 (52). Con
de patgenos de alimentos a partir de ADN genmico estas nuevas tecnologas, los genomas pueden ser
utilizando microarreglos (46). La identificacin molecular completamente secuenciados en semanas (incluso en
por microarreglos se ha demostrado para E. coli horas), en lugar de aos, debido a que esta metodologa
O157: H7 (47) y Yersinia (48) a partir de cultivos, tras la no requiere bibliotecas de ADN, ni clones (53), solo el
amplificacin por PCR de los genes blanco. En el caso cido nucleico aislado. Esta secuenciacin ha ampliado
particular de este ltimo microorganismo, la deteccin el repertorio de los genomas bacterianos secuenciados,
e identificacin fue realizada en muestras de leche incluyendo mltiples cepas patgenas (54), y ha ayudado

541
Rev Peru Med Exp Salud Publica. 2014; 31(3):535-46. Palomino-Camargo C & Gonzlez-Muoz Y

a identificar los agentes potenciales, bacterianos, VENTAJAS DE LAS TCNICAS


protozoarios o virales, asociados con enfermedades de MOLECULARES
etiologa desconocida (55), las cuales constituyen una
tercera parte de las enfermedades transmitidas por los La identificacin de los patgenos de transmisin
alimentos en los Estados Unidos (53,55). alimentaria mediante mtodos moleculares se ha
vuelto cada vez ms popular en aspectos de calidad y
Con el actual ritmo de los avances en la secuenciacin seguridad, y en la produccin de alimentos, debido a que
de alto rendimiento, se espera que el costo asociado a estas tcnicas suelen ofrecer muchas ventajas (Tabla
esta tecnologa se reduzca al mximo (53). Esto significa, 4). La PCR, una de las tcnicas ms utilizadas en la
que dicha secuenciacin ser asequible y podra deteccin e identificacin de bacterias causantes de ETA,
reemplazar algunas de las pruebas de susceptibilidad es fiel exponente de tales alcances; presenta rapidez,
antimicrobiana existente, la serotipificacin y mtodos buen lmite de deteccin, especificidad y sensibilidad,
de caracterizacin de las cepas que se utilizan en los fcil automatizacin y capacidad de procesamiento
laboratorios de diagnstico (55). de grandes cantidades de muestras (2). Para el caso

Tabla 4. Ventajas y desventajas de las tcnicas moleculares ampliamente utilizadas para la identificacin de patgenos en alimentos

TCNICA
VENTAJAS DESVENTAJAS
MOLECULAR
Mayor rapidez que los mtodos basados en cultivos (4-24 Dificultad para distinguir entre clulas vi-
h vs. 5-7 das). vas y muertas.
Alta especificidad y sensibilidad. Tcnicamente puede ser un reto optimizar
PCR mltiple: detecta varios patgenos al mismo tiempo. las condiciones de PCR.
PCR simple y Automatizados. Se requiere enriquecimiento para detectar
mltiple Resultados precisos y exactos a partir de la deteccin ge- clulas visibles.
ntica especfica. Se necesita procesamiento post-PCR de
Diferenciacin de varios serotipos de microorganismos. los productos (electroforesis).
Ejemplo: en el caso de Salmonella se pueden detectar 5-6
en una sola reaccin.
Es ms especfica y sensible que los mtodos de cultivo. Dificultad en ensayos mltiples.
No se encuentra influenciada por la amplificacin no espec- Labilidad del ARNm.
PCR en tiempo real fica; la amplificacin puede ser monitoreada en tiempo real. Posibilidad de contaminacin cruzada.
Confirmacin de amplificacin especfica mediante curvas
de fusin.

Ms rpido que los mtodos basados en cultivo (2-4 h vs. Dificultad para distinguir entre clulas vi-
5-7 das). vas y muertas.
Anlisis mltiple (hasta 100 perlas diferentes disponibles). Requiere kits PCR para marcar los ge-
Alta sensibilidad y especificidad, se pueden caracterizar nes blanco.
cepas.
Microarreglos
Labor efectiva, puede aplicarse a un formato de 96 pocillos
(pueden ensayarse 9600 muestras).
Si debe ser incluido un blanco adicional en el ensayo, pue-
de aadirse fcilmente un nuevo tipo de perla enlazada a
la sonda.
Alta selectividad y sensibilidad. Ciertos biosensores pueden requerir ex-
Automatizables y miniaturizables. tensos pretratamiento de las muestras.
Reproducibilidad, velocidad en el anlisis y ejecucin en Existen pocas plataformas de biosensores
tiempo real. individuales, disponibles comercialmente.
Anlisis mltiple de patgenos en alimentos perecederos y
semiperecederos.
Biosensores
Permite la existencia de varias configuraciones por la diver-
sidad de las propiedades transductoras.
Larga vida til de los dispositivos (materiales estables y re-
sistentes).
En la mayora de los casos es innecesario el pre-tratamien-
to de las muestras.
Sensible, especfica y precisa. No hay deteccin de clulas viables sin
Secuenciacin sin electroforesis. preenriquecimiento.
Rpido (7-10 h). Las muestras necesitan estar preparadas
Pirosecuenciacin Se realiza en tiempo real. y amplificadas.
Costos de reactivos ms bajos en comparacin con otros Bioinformtica compleja.
mtodos de secuenciacin disponibles actualmente.

542
Rev Peru Med Exp Salud Publica. 2014; 31(3):535-46. Deteccin e identificacin de patgenos en alimentos

de algunos microorganismos, la PCR no requiere amplificacin de los cidos nucleicos y, en consecuencia,


condiciones anaerbicas en comparacin con el mtodo puede producir la subestimacin de la carga bacteriana,
de cultivo clsico (11). Adicionalmente, a travs de los as como resultados falsos negativos (2,20). En los mtodos
mtodos moleculares se identifican microorganismos que basados en la PCR, la ADN polimerasa es probablemente
no pueden ser estudiados por tcnicas convencionales o el sitio blanco ms importante de las sustancias
que no pueden cultivarse en substratos artificiales (9). inhibidoras. La generacin de resultados positivos por la
amplificacin in vitro de ADN procedente de organismos
Asimismo, no se puede pasar por alto que los muertos, presentes en muestras de alimentos, es otra
microorganismos transmitidos por alimentos estn limitacin potencial (6,9). No obstante, la utilizacin del
cambiando constantemente, debido a su inherente ARNr como secuencia blanco puede ofrecer una solucin
capacidad de evolucionar y su sorprendente habilidad a este inconveniente (73).
para adaptarse a las diferentes formas de estrs (71).
Por lo tanto, la seguridad alimentaria debe ser vista
como un proceso continuo, influenciado por factores CONCLUSIONES
ambientales, socioeconmicos, polticos y culturales.
En este sentido, los mtodos moleculares, sin duda Las tcnicas de diagnstico molecular representan una
alguna, pueden ayudar en la deteccin de patgenos en alternativa prometedora en el campo de los alimentos,
alimentos (72). Muchas de estas tcnicas son mejoradas debido a su rapidez, elevada sensibilidad y eficiencia
con el fin de subsanar los inconvenientes encontrados, para la deteccin temprana de microorganismos
dando paso a nuevos y variados mtodos. Por ejemplo, patgenos. Por ello, el nmero de mtodos moleculares
la nanotecnologa se est convirtiendo en el estndar con potencial utilidad en el rea de microbiologa de
para los ensayos de diagnstico y su combinacin con alimentos se ha ido incrementando y diversificando,
anticuerpos monoclonales, junto a la tcnica de la PCR, cada uno con sus respectivas fortalezas y debilidades,
ha generado resultados muy especficos y sensibles (6). las cuales deben tomarse en cuenta a la hora de cumplir
con los objetivos planteados. La PCR destaca como
el mtodo de diagnstico molecular ms aplicado en
LIMITACIONES DE LAS TCNICAS el rea de alimentos y, recientemente, variaciones de
MOLECULARES este, como la PCR en tiempo real, han sumado ventajas
adicionales a esta tcnica, entre las que se destaca
Entre las desventajas (Tabla 4) de los mtodos una mayor velocidad en la obtencin de resultados. Sin
moleculares se puede citar, en primer lugar, que an embargo, los equipos y reactivos resultan ms costosos
no estn ampliamente incorporados en los mtodos que aquellos empleados en los mtodos tradicionales de
estandarizados, por lo cual resultan inadecuados cultivo. Esta desventaja es caracterstica en la mayora
en algunos casos. Adicionalmente, requieren, en de las tcnicas moleculares descritas.
comparacin con los mtodos de cultivo, equipos y
reactivos costosos (72). La secuenciacin de alto rendimiento, por su parte, se
vislumbra como una herramienta novedosa con un futuro
Estas tcnicas tambin son relativamente complicadas; prometedor para la industria de los alimentos, debido,
necesitan experticia y utilizan productos qumicos entre otras ventajas, a su rapidez y alta precisin. No
peligrosos, por lo que el anlisis rutinario de muchas obstante, la complejidad de la bioinformtica requerida
muestras resulta poco prctico. Debido a la falta de constituye una de las limitantes ms notorias.
protocolos estandarizados y a la calidad variable de
equipos y reactivos, la metodologa tiene dificultades Por ltimo, se debe acotar que los esfuerzos de
para pasar de expertos a usuarios finales de los estandarizacin y normalizacin de estos mtodos
laboratorios (72). son un requisito indispensable para lograr la aplicacin
prctica y rutinaria de estas tcnicas en la deteccin
Otros factores que limitan la aplicacin de PCR, y de otros e identificacin de microorganismos patgenos
mtodos moleculares, en la deteccin e identificacin de transmitidos por alimentos.
microorganismos patgenos en alimentos, destaca la
presencia de sustancias que pueden ejercer un efecto Conflictos de inters: los autores declaran no tener conflictos
inhibitorio sobre la reaccin. La existencia de tales de inters.
inhibidores en alimentos, muestras clnicas y ambientales
Fuentes de financiamiento: Fondo Nacional de Ciencia,
ha sido reportada por varios autores. Estos pueden actuar Tecnologa e Innovacin (FONACIT) Venezuela - Proyecto N.
a diferentes niveles durante el proceso de extraccin y 2013001876

543
Rev Peru Med Exp Salud Publica. 2014; 31(3):535-46. Palomino-Camargo C & Gonzlez-Muoz Y

Referencias Bibliogrficas
1. Wallace DJ, Van Gilder T, Shallow S, 12. Beneduce L, Fiocco D, Spano G. Deve- monocytogenes. J Food Prot. 2003
Fiorentino T, Segler SD, Smith KE, et lopment of PCR-based molecular tools Nov;66(11):2141-5.
al. Incidence of foodborne illnesses re- for the detection of emerging food- ad 22. Seo KH, Valentin-Bon IE, Brackett RE,
ported by the foodborne diseases active water-borne pathogenic bacteria. Bada- Holt PS. Rapid, specific detection of
surveillance network (FoodNet)-1997. joz: Formatex; 2007. Salmonella Enteritidis in pooled eggs
FoodNet Working Group. J. Food Prot. 13. Hong Y, Berrang M, Liu T, Hofacre by real-time PCR. J Food Prot. 2004
2000 Jun;63:807-9. CL, Snchez S, Wang L. et al. Rapid May;67(5):864-9.
2. Rodrguez-Lzaro D, Hernndez M. detection of Campylobacter coli, C. je- 23. Jasson V, Jacxsens L, Luning P, Ra-
Molecular methodology in food micro- juni and Salmonella enterica on poultry jkovic A, Uyttendaele M. Alternative
biology diagnostics: trends and current carcasses by using PCR-enzyme-linked- microbial methods: An overview and
challenges. IUFoST. 2006:1085-99. doi: immunosorbent assay. Appl Environ selection criteria. Food Microbiol.
10.1051/IUFoST:20060643. Microbiol. 2003 Jun;69(6):3492-9. 2010 Sep;27(6):710-30. doi: 10.1016/j.
3. Gonzlez T, Rojas R. Enfermeda- 14. Waller DF, Ogata SA. Quantitative im- fm.2010.04.008.
des transmitidas por alimentos y munocapture PCR assay for detection of 24. Manguiat L, Fang T. Evaluation of
PCR: prevencin y diagnstico. Campylobacter jejuni in foods. Appl En- DASTM-kits for the detection of food-
Salud Pblica Mexico. 2005 Sep- viron Microbiol. 2000 Sep;66(9):4115- borne pathogens in chicken- and meat-
Oct;47(5):388-90. 8. based street-vended foods. J Food Drug
4. Gonzlez-Muoz Y, Palomino-Ca- 15. Gouws PA, Liedemann L. Evaluation Anal. 2013 Jun;21(2):198-205.
margo C. Acciones para la gestin de of diagnostic PCR for the detection 25. AOAC Inernational. BAX System for
la calidad sanitaria e inocuidad de los of Listeria monocytogenes in food Salmonella Granted First Action Sta-
alimentos en un restaurante con ser- products. Food Technol Biotechmol. tus The First Sole-Source Method
vicio bufet. Rev Gerenc Polit Salud. 2005;43(2):201-5. Approved by an AOAC Expert Review
2012;11(22):123-40. 16. Jin UH, Cho SH, Kim MG, Ha SD, Panel [Internet]. Connecticut: AOAC
5. Hakovirta J. Modern techniques in de- Kim KS, Lee KH, et al. PCR method Inernational; 2011 [citado el 11 de
tection, identification and quantifica- based on the ogdH gene for the de- enero de 2014]. Disponible en: http://
tion of bacteria and peptides from foods. tection of Salmonella spp. from chic- www.aoac.org/imis15_prod/NEWS_
Helsinki: Yliopistopaino; 2008. ken meat samples. J Microbiol. 2004 OLD/NEWS2013/AOAC_OMA-
6. Prasad D, Sharan A. DNA based Sep;42(3):216-22. ERP-05162013.htm
methods used for characterization and 17. Paton AW, Paton JC. Detection and 26. Mar L, Dick LM, van der Walt ML.
detection of food borne bacterial patho- characterization of Shiga toxigenic Es- Characterization of south african iso-
gens with special consideration to recent cherichia coli by using multiplex PCR lates of Salmonella enteritidis by phage
rapid methods. Afr J Biotechnol. 2009 assays for stx1, stx2, eaeA, enterohe- typing, numerical analysis of RAPD-
May;8(9):1768-75. morrhagic E. coli hlyA, rfbO111, and PCR banding patterns and plasmid
7. Stewart GS. Challenging food micro- rfbO157. J Clin. Microbiol. 1998 Feb; profiles. Int J Food Microbiol. 2001 Mar
biology from a molecular perspective. 36(2):598-602. 20;64(3):237-45.
Microbiology. 1997;143:2099-108. 18. Kawasaki S, Horikoshi N, Okada Y, 27. Falco JP, Falco DP, Pitondo-Silva A,
8. Gui J, Patel IR. Recent advances in Takeshita K, Sameshima T, Kawamo- Malaspina AC, Brocchi M. Molecular
molecular technologies and their appli- to S. Multiplex PCR for simultaneous typing and virulence markers of Yersinia
cation in pathogen detection in foods detection of Salmonella spp., Listeria enterocolitica strains from human, ani-
with particular reference to yersinia. monocytogenes, and Escherichia coli mal and food origins isolated between
J Pathog. 2011;2011:310135. doi: O157:H7 in meat samples. J Food Prot. 1968 and 2000 in Brazil. J Med Micro-
10.4061/2011/310135. 2005 Mar;68(3):551-6. biol. 2006 Nov;55(Pt 11):1539-48.
9. Glynn B, Lahiff S, Wernecke M, Barry T, 19. Meng X, Zhang H, Law J, Tsang R, 28. Mohapatra BR, Broersma K, Nordin
Smith T, Maher M. Current and emer- Tsang T. Detection of Helicobacter R, Mazumder A. Evaluation of repeti-
ging molecular diagnostic technologies pylori from food sources by a novel tive extragenic palindromic-PCR for
applicable to bacterial food safety. Int J multiplex PCR assay. J Food Safe. discrimination of fecal Escherichia coli
Dairy Technol. 2006 May;59(2):126- 2008;28(4):609-19. from humans, and different domestic-
39. 20. Eleizalde M, Parra N, Palomino C. La and wild-animals. Microbiol Immunol.
Biotecnologa desde la pedagoga: El 2007;51(8):733-40.
10. Foley S, Grant K. Molecular techniques
of detection and discrimination of foo- aprendizaje por descubrimiento como 29. Amavisit P, Markham PF, Lightfoot D,
dborne pathogens and their toxins. En: una alternativa efectiva. 1era ed. Ca- Whithear KG, Browning GF. Molecular
Simjee S. Foodborne diseases. Totowa, racas: Editorial Acadmica Espaola; epidemiology of Salmonella Heidelberg
NJ: Humana Press; 2007. p. 485-510. 2012. in an equine hospital. Vet Microbiol.
21. Jothikumar N, Wang X, Griffiths MW. 2001 May;80(1):85-98.
11. Ward P, Roy D. Review of molecular
methods for identification, characteri- Real-time multiplex SYBR green I-ba- 30. Gore HM, Wakeman CA, Hull RM,
zation and detection of bifidobacteria. sed PCR assay for simultaneous detec- McKillip JL. Real-time molecular
Lait. 2005;85:23-32. tion of Salmonella serovars and Listeria beacon NASBA reveals hblC expres-

544
Rev Peru Med Exp Salud Publica. 2014; 31(3):535-46. Deteccin e identificacin de patgenos en alimentos

sion from Bacillus spp. in milk. Bio- neous measurements of resonant fre- 51. Wondwossen A. Development of a Mi-
chem Biophys Res Commun. 2003 Nov quency and motional resistance. Biosens croarray for the Rapid and Simultaneous
14;311(2):386-90. Bioelectron. 2005 Dec 15;21(6):840-8. Detection and Tracking of Bacterial and
31. Rodrguez D. Development of molecu- 41. Pathirana ST, Barbaree J, Chin BA, Har- Viral Foodborne Pathogens. Columbus:
lar-based techniques for the detection, tell MG, Neely WC, Vodyanoy V. Rapid The Ohio State University; 2007.
identificaction and quantification of and sensitive biosensor for Salmonella. 52. Margulies M, Egholm M, Altman WE,
food-borne pathogens. Tesis para obtener Biosens Bioelectron. 2000 Jun;15(3- Attiya S, Bader JS, Bemben LA, et al.
el grado de Doctor europeo. Department 4):135-41. Genome sequencing in open microfabri-
of Chemical and Agricultural Enginee- 42. Kim GH, Rand AG, Letcher SV. Impe- cated high density picoliter reactors. Na-
ring and Food Technology. Universitat de dance characterization of a piezoelec- ture. 2005 Sep 15;437(7057):376-80.
Girona. Girona, Espaa, 2004. tric immunosensor part II: Salmonella 53. Schloss JA. How to get genomes at one
32. Nayak R, Stewart T, Wang RF, Lin J, typhimurium detection using magnetic ten-thousandth the cost. Nat Biote-
Cerniglia CE, Kenney PB. Genetic di- enhancement. Biosens Bioelectron. chnol. 2008 Oct;26(10):1113-5. doi:
versity and virulence gene determinants 2003 Jan;18(1):91-9. 10.1038/nbt1008-1113.
of antibiotic-resistant Salmonella isola- 43. Farabullini F, Lucarelli F, Palchetti I, Ma- 54. Gilmour MW, Graham M, Van Dom-
ted from preharvest turkey production rrazza G, Mascini M. Disposable elec- selaar G, Tyler S, Kent H, Trout-Yakel
sources. Int J Food Microbiol. 2004 Feb trochemical genosensor for the simulta- KM, et al. High-throughput genome
15;91(1):51-62. neous analysis of different bacterial food sequencing of two Listeria monocytoge-
33. Gerner-Smidt P, Scheutz F. Standardi- contaminants. Biosens Bioelectron. nes clinical isolates during a large food-
zed pulsed-field gel electrophoresis of 2007 Feb 15;22(7):1544-9. borne outbreak. BMC Genomics. 2010
Shiga toxin-producing Escherichia coli: 44. Kakinuma K, Fukushima M, Kawaguchi Feb 18;11:120. doi: 10.1186/1471-
the PulseNet Europe Feasibility Study. R. Detection and identification of Esche- 2164-11-120.
Foodborne Pathog Dis. 2006;3(1):74- richia coli, Shigella, and Salmonella by 55. Maurer JJ. Rapid detection and limita-
80. microarrays using the gyrB gene. Biotech- tions of molecular techniques. Annu Rev
34. Boric V. Aplicaciones de la Epidemiolo- nol Bioeng. 2003 Sep 20;83(6):721-8. Food Sci Technol. 2011;2:259-79. doi:
ga Molecular en la deteccin de brotes 45. Volokhov D, Rasooly A, Chumakov K, 10.1146/annurev.food.080708.100730.
de enfermedades transmitidas por ali- Chizhikov V. Identification of Listeria 56. Yang Y1, Xu F, Xu H, Aguilar ZP, Niu
mentos. Avances en Latinoamrica. Bio- species by microarray-based assay. J Clin R, Yuan Y, et al. Magnetic nano-beads
farbo. 2008;16:92-7. Microbiol. 2002 Dec;40(12):4720-8. based separation combined with propi-
35. Saken E, Roggenkamp A, Aleksic S, 46. Borucki MK, Reynolds J, Call DR, dium monoazide treatment and multi-
Heesemann J. Characterisation of patho- Ward TJ, Page B, Kadushin J. Suspen- plex PCR assay for simultaneous detec-
genic Yersinia enterocolitica serogroups sion microarray with dendrimer signal tion of viable Salmonella Typhimurium,
by pulsed-field gel electrophoresis of ge- amplification allows direct and high- Escherichia coli O157:H7 and Listeria
nomic NotI restriction fragments. J Med throughput subtyping of Listeria mono- monocytogenes in food products. Food
Microbiol. 1994 Nov;41(5):329-38. cytogenes from genomic DNA. J Clin Microbiol. 2013 Jun;34(2):418-24. doi:
36. Talukder KA, Dutta DK, Albert MJ. Microbiol. 2005 Jul;43(7):3255-9. 10.1016/j.fm.2013.01.004.
Evaluation of pulsed-field gel electro- 47. Wu CF, Valdes JJ, Bentley WE, Sekowski 57. Park SH, Aydin M, Khatiwara A, Do-
phoresis for typing of Shigella dysen- JW. DNA microarray for discrimination lan MC, Gilmore DF, Bouldin JL, et
teriae type 1. J Med Microbiol. 1999 between pathogenic 0157:H7 EDL933 al. Current and emerging technolo-
Aug;48(8):781-4. and non-pathogenic Escherichia coli gies for rapid detection and characte-
37. Waswa JW, Debroy C, Irudayaraj J. Ra- strains. Biosens Bioelectron. 2003 Oct rization of Salmonella in poultry and
pid detection of salmonella enteritidis 30;19(1):1-8. poultry products. Food Microbiol.
and escherichia coli using surface plas- 2014 Apr;38:250-62. doi: 10.1016/j.
48. Myers KM, Gaba J, Al-Khaldi SF. Mo-
mon resonance biosensor. J Food Pro- fm.2013.10.002.
lecular identification of Yersinia en-
cess Eng. 2006 Jul;29(4):373-85. terocolitica isolated from pasteurized 58. Marathe S, Chowdhury R, Bhattacharya
38. Lazcka O, Del Campo FJ, Muoz whole milk using DNA microarray chip R, Nagarajan A, Chakravortty D. Direct
FX. Pathogen detection: a perspecti- hybridization. Mol Cell Probes. 2006 detection of Salmonella without pre-
ve of traditional methods and biosen- Apr;20(2):71-80. enrichment in milk, ice-cream and fruit
sors. Biosens Bioelectron. 2007 Feb juice by PCR against hilA gene. Food
49. Straub TM, Dockendorff BP, Quio-
15;22(7):1205-17. Control. 2012 Feb;23(2):559-63.
nez-Daz MD, Valdez CO, Shuttha-
39. Olsen EV, Sorokulova IB, Petrenko nandan JI, Tarasevich BJ, et al. Au- 59. Fontanot M, Lacumin L, Cecchini F,
VA, Chen IH, Barbaree JM, Vodyanoy tomated methods for multiplexed Comi G, Manzano M. PorA specific pri-
VJ. Affinity-selected filamentous bac- pathogen detection. J Microbiol Meth. mers for the identification of Campylo-
teriophage as a probe for acoustic wave 2005 Sep;62(3):303-16. bacter species in food and clinical sam-
biodetectors of Salmonella typhimu- ples. LWT - Food Science Tech. 2014
50. Wang L, Shi L, Alam MJ, Geng Y, Li L.
rium. Biosens Bioelectron. 2006 Feb Sep;58(1):86-92.
Specific and rapid detection of foodbor-
15;21(8):1434-42. ne Salmonella by loop-mediated isother- 60. Ning P, Guo K, Cheng L, Xu L, Zhang
40. Su XL, Li Y. A QCM immunosensor mal amplification method. Food Res Int. C, Cui H, et al. Pilot survey of raw who-
for Salmonella detection with simulta- 2008;41(1):69-74. le milk in China for Listeria monocyto-

545
Rev Peru Med Exp Salud Publica. 2014; 31(3):535-46. Palomino-Camargo C & Gonzlez-Muoz Y

genes using PCR. Food Control. 2013 in food. Anal Bioanal Chem. 2012 69. Li X, Yang F, Gao W, Song H, Tian H,
May;31(1):176-9. Apr;403(1):75-92. doi: 10.1007/ Xu B. Application of pyrosequencing
61. Ibrahim W, El-Ghany W, Nasef S, Ha- s00216-011-5685-9. for Salmonella enterica rapid identi-
tem ME. A comparative study on the use 65. Arora P, Sindhu A, Dilbaghi N, Chau- fication. J Microbiol Methods. 2012
of real time polymerase chain reaction dhury A. Biosensors as innovative Apr;89(1):49-52. doi: 10.1016/j.mi-
(RT-PCR) and standard isolation tech- tools for the detection of food borne met.2012.01.020.
niques for the detection of Salmonellae pathogens. Biosens Bioelectron. 2011 70. Von Blankenfeld-Enkvist G, Brnnback
in broiler chicks. International Journal Oct 15;28(1):1-12. doi: 10.1016/j. M. Technological Trends and Needs
of Veterinary Science and Medicina. bios.2011.06.002. in Food Diagnostics. Helsinki: Tekes;
2014 Jun;2(1):67-71. 66. Park M, Li S, Chin B. Detection of Sal- 2002.
62. Ma K, Deng Y, Bai Y, Xu D, Chen E, monella typhimurium Grown Directly 71. Jacoby A, Booysen E. Molecular
Wu H, et al. Rapid and simultaneous de- on Tomato Surface Using Phage-Based methods for the detection of food-borne
tection of Salmonella, Shigella, and Sta- Magnetoelastic Biosensors. Food Bio- pathogens an overview. Interim: Inter-
phylococcus aureus in fresh pork using process Tech. 2013 March;6(3):682-9. disciplinary Journal. 2005;4(2):72-82.
a multiplex real-time PCR assay based 67. Amoako KK, Janzen TW, Shields MJ, 72. Pfaller MA. Molecular approaches to
on immunomagnetic separation. Food Hahn KR, Thomas MC, Goji N. Rapid diagnosing and managing infectious
Control. 2014 Aug;42;87-93. detection and identification of Bacillus diseases: practicality and costs. Emerg
63. Kupradit C, Rodtong S, Ketudat-Cairns anthracis in food using pyrosequencing Infect Dis. 2001 Mar-Apr;7(2):312-8.
M. Development of a DNA macroarray technology. Int J Food Microbiol. 2013
for simultaneous detection of multiple Aug 1;165(3):319-25. doi: 10.1016/j.
Correspondencia: Carolina Palomino Camargo.
foodborne pathogenic bacteria in fresh ijfoodmicro.2013.05.028.
Direccin: Instituto de Ciencia y Tecnologa de
chicken meat. World J Microbiol Biote- 68. Fakruddin MD, Chowdhury A, Hos- los Alimentos, Facultad de Ciencias, Universidad
chnol. 2013 Dec;29(12):2281-91. doi: sain N, Bin K, Mohammad R. Pyrose- Central de Venezuela. Urb. Colinas de Bello Mon-
10.1007/s11274-013-1394-1. quencing- principles and applications. te. Calle Suapure, frente al Ramal 2. Caracas.
64. McGrath TF, Elliott CT, Fodey TL. International Journal of Life Scien- Venezuela.
Biosensors for the analysis of micro- ce & Pharma Research. 2012 Apr- Telfono: +19-426-6043052.
biological and chemical contaminants Jun;2(2):65-76. Correo electrnico: carolesth@gmail.com

Consulte la versin electrnica de la


Revista Peruana de Medicina Experimental y Salud Pblica en

www.pubmed.gov

546