Está en la página 1de 232

-

Cardell Hernandez
r.
Prlogo
a bioqumica es una ciencia que se ha desarrollado con un ritmo muy

TJ acelerado en el presente siglo. Los logros alcanzados en los ltimos aos


en el conocimiento de esta ciencia iian influido decisivaniente en el
progreso de numerosas ramas cientficas afines, en particular en las hiomdicas.
Muchos hallazgos de la bioqumica han incidido directa o indirectamente en la
teora y la prctica mdica; por ello resulta imprescindible el dominio de los
aspectos fundamentales de esta disciplina por parte de mdicos, estomatlogos,
licenciados en enfermera, y en general por todo el personal profesional relaciona-
do con la asistencia, docencia e investigacin en el campo de las ciencias mdi-
cas.

El texto fue elaborado teniendo en cuenta los intereses de las diferentes especia-
lidades de las ciencias mdicas. De igual modo, ste puede ser de utilidad a estu-
diantes d e cualquier otra carrera biolgica. En el Tomo IV se tratan, adems,
algunos aspectos especializados de la bioqiimica de inters clnico actiial, lo que
permite a estudiantes de aos superiores y graduados de las diferentes ramas de las
ciencias mdicas complementar y aplicar conocimientos adquiridos al cursar las
ciencias bsicas.

Nuestros propsitos son contribuir a mejorar la comprensin de la disciplina


Bioqiimica y destacar su importancia en la formacin de profesionales de las
especialidades mdicas. Corresponde principalmente a nuestros estudiantes eva-
luar en qu medida ello se ha logrado.

Las autores
CONTENIDO

Relaciones del sistema de endomembranas 398


Resumen 398
Ejercicios 400

CAP~TULO
22. Citoesqueleto 401
Citoplasma soluble 401
Microfilamentos 402
CApfiULo20. Membranas biol6gieas 373 Principales funciones de los microfilamentos 404
Componentesmoleculares de las membranas 373 Microtbulos 405
Lpidos de membrana 373
Protenas de membrana 375 Principalesfunciones de los microtbulos 406
Glcidos de membrana 376 Filamentos intermedios 406
Modelo del mosaico fluido 376 Inclusiones citoplasmticas 407
Membrana plasmtica 378 Glbulos de grasa 407
Funciones de la membrana plasmtica 381 Grnulos de glucgeno 408
Transportedesustanciasatravs de las membranas 381 Resumen 409
Difusin y smosis 381 Ejercicios 410
Transporte mediante protenas 382
Potencial de membrana en reposo 385
Diferenciacinde la membrana plasmtica 385
Resumen 386 C~pfrvLo23. Ndeo celular 411
Ejercicios 386 Componentesestructurales del ncleo 411
Envoltura nuclear 412
Nuclolo 415
CAPf'm.0 21. Organelmmembranosusin-ulares 389 Nucleoplasma 415
Tipos de organelos membranosos internos 389 Par cromatina-cromosoma 416
Estmctura general de las endomembranas 390 Cromatina 416
Funciones generalesde los organelos membranosos 390 Cromosomas 416
Relaciones entre los organelos membranosos 391 Cariotipo humano normal 417
Retculo endoplasmtico 391 Mitosis 419
Aparato de Golgi 394 Resumen 420
Lisosomas 395
Ejercicios 421
Peroxisomas 397
Terminacin 480
Eventos posterminacin 483
Transcripcin en eucariontes 485
Sntesis y maduracin de los ARNr 486
Sntesis y maduracin de los ARNt 487
Unidades de transcripcin 487
Sntesis y maduracin de los ARNm 490
CmTin.024.Flujo celular de informacin 427 Inhibidores de la transcripcin 493
Informacin molecular 427 Resumen 494
Formas de la informacin niolecnlar 428 Ejercicios 495
Transferencia de informacin 429
Ciclo celular 429 CmTin.028. Cdigo
- gen6co
- 497
Actividad biosinttica durante el ciclo celular 431 Primeros pasos 497
Regulacin del ciclo celular 434 Descifrado del cdigo 498
Resumen 437 Codones de terminacin 501
Ejercicios 437 Codon de iniciacin 502
Universalidad del cdigo 503
CAPTin.025. Replicacin de los ADN 439 Estructura del cdigo 503
Historia del problema 439 Descodificacin 505
Aspectos generales 441 Resumen 506
Requerimientos de la replicacin 442 Ejercicios 507
Etapas de la replicacin 444
Replicacin en procariontes 444 CAPTUL0 29. Ribosomas 509
Replicacin en E. coli 444 Primeros indicios 510
Origen de la replicacin 445 Composicin molecular 510
Eventos previos a la iniciacin(preiniciacio)445 Estructura tridimensional512
Iniciacin 447 1,ocalizacin de los componentes 512
Elongacin 449 Dominios funcionales 515
Terminacin 452 Riognesis de los ribosomas 516
Modificacin del ADN (posterminacin) 453 Ribosomas eucariontes 517
Replicacin en eucariontes 453 Polirribosomas 518
Complejidad del proceso 453 Resumen 518
Replicacin en eucariontes pluricelolares 455 Ejercicios 519
Fidelidad del proceso 456
Inhibidores de la replicacin 457 CAPTULo 30. 'ihduccin 521
A manera de conclusiones 458 Primeros aportes 521
Resumen 459
Caractersticas generales 522
Ejercicios 460 Eventos previos a la iniciacin 522
Iniciacin 525
CAPTUL0 26.Op@zacin del genoma eucarionte 461 Formacin del complejo de preiniciacin 525
Genes y cromosomas 461 Incorporacin del fmet-ARNt,526
Genes y ADN 465 Incorporacin del ARNm 526
Estructura del gen 466 Formacin del complejo de iniciacin 70s 526
Familias gnicas 468 Elongacin 527
Genoma humano 47 1 Incorporacin del aminoacil-ARNt 527
Resumen 472 Formacin del enlace peptdico 529
E,jercicios 473 Translocacin 529
Terminacin 530
CAPfTUL0 27. Transcripcin del ADN 475 Traduccin en eucariontes 530
Aspectos generales 475 Posterminacin 532
Etapas de la transcripcin 476 Distribucin de protenas 533
Eventos previos a la iniciacin (preiniciacin) 477 Consideraciones energticas 534
Iniciacin 479 Inhibidores de la traduccin 535
Elongacin 480 Resumen 536
Ejercicios 536
c m 0 31. Reeombinari6n gentica 537 Reparacin por recombinacin 567
Historia del problema 537 Sistemas SOS 569
Tipos de recombinacin gentica 538 Reparacin de otros daos 569
Modelo de Holliday 539 Alteraciones de la reparacin 569
Comprobacin del modelo 541 Resumen 571
Formacin del intermediario de Holliday 542 Ejercicios 571
Enzimologa de la recombinacin 542
Significadobiolgico de la recombinacin 545 CAPfiur,~
34.Regulaci6n de la expresi6n genetiea 573
Resumen 546 Aspectos generales 573
Ejercicios 546 Regulacin transcripcional 574
Induccin enzimtica 574
32. Mutadones
CAPfirrr.0 549 Mecanismo de atenuacin 581 .-
Definicionesy nomenclatura 549 Eficiencia del promotor 582
Concepto de mutacin 549 Regulacin postranscripcional 582
Tipos de mutaciones 550 Regulacin en encariontes 583
Mutaciones gnicas 550 Regulacin pretranscripcional 584
Mutagnesis 551 Regulacin transcripcional 585
Mutgenos anlogos de bases 551 Regulacin postranscripcional 585
Mutgenos qumicos 552 Resumen 586
Sustancias intercalantes 553 Ejercicios 587
Radiaciones 553
Consecuenciasde las mutaciones 553 CAPfiULo35. k o l o g l a del ADN reeombiinante 589
Mutaciones mayores 555 Procedimiento general 589
Supresin 556 Obtencin de genes especficos 591
Mutaciones en humanos 557 Recombinacin in vitro 591
Resumen 558 Vectores 593
Ejercicios 559 Identificacin del gen recombinado 595
P m b l e m en la produccin de pmtenas eucariontes 596
CAPnno 33. Comervaei6nde la informaci6n genetiea 561 Expresin de genes clonados 596
Modificacin-restriccin 561 Experiencia tpica 596
Daos al ADN 564 Empleo diagnstico 598
Bases mal apareadas 564 Perspectivas 599
Bases perdidas 564 Resumen 600
Alteraciones de bases 564 Ejercicios 601
Rotura de una hebra 564
Rotura en las 2 hebras 565
Enlaces entrecruzados 565
Sistema de reparacin 566
Fotorreactivacin 566
Reparacin por escisin 566
Introduccin a la seccin

r; omo fue considerado en el captulo 4, la clula es la forma fundan~entalde


.:
organizacin de la materia viva; de aquse deduce que la comprensin del
\ -/ funcionamiento celular constituye un elemento fundamental para el conoci-
miento de los fenmenos biolgicos en su conjunto.

La primeraaproximacin del hombre al estudio de la clula se produjo a travs desu


morfologa, auxiliado en sus inicios por instrumentos pticos de amplificacin de
imgenes. Desde los primeros momentos se hizo evidente que las clulas eran estructu-
ras complejas con elevado nivel de organizacin interna.

El desarrollo de los estudios bioqumicos, que demostraron la posibilidad de analizar


algunas funciones celulares en preparados libres de clulas -especialmente algunas
actividades enzimticas-, abri un perodo importante de adquisicin de nuevos co-
nocimientos acerca del funcionamiento de estas clulas. Se descubrieron las vas y
ciclos metablicosy avanz de manera extraordinaria el conocimientosobre la estruc-
tnra y funcin de las enzimas, as como su funcin reguladora en el metabolismo.

En una etapa pareci que el conocimiento bastante completo de la funcin celular


estaba relativamente cerca y que consistira en identificar todas y cada una de las
enzimas celulares, as como las reacciones que ellas catalizaban; de este modo, una
imagen reduccionista de la clula, como un pequeo saco donde las enzimas llevaban
a cabo su funcin, cobr algn valor ein el pensamiento de los bioqumicos. Pronto esta
imagen afront dificultadesal ponerse en evidencia que muchas funciones metahlicas
requeran, no solo los catalizadoresenzimticoscorrespondientes, sino de determina-
das estructuras con un elevado grado de organizacin; tal fue el caso de la sntesis de
protenas en relacin con los rihosomas o de la respiracin celular con las mitocondrias.

De manera simultnea el desarrollode los mtodos de estudio de la morfologa celular-


especialmente la microscopia electrnica-fue revelando la extraordinaria compleji-
dad de la citoarquitectura,a ello se uni el cmulo de informacin obtenida mediante
mtodos como la histoqnmica y la inmunohistoqumica, los cuales permitieron hacer
un anlisis que integraba la estructura y la funcin de diversos componentes.

Hoy resulta evidenteque si queremos comprender adecuadamente a la clula,la visin


del pequeOo saco repleto de enzimas tiene que ser desplazada por la de un complejo
estmctural y funcional, donde tan importantes son las caractersticascinticas de una
enzima como su ubicacin intracelular y sus atributos topolgicos.

De este modo se justifica plenamente la inclusin de esta seccin "componentes celu-


lares" en un texto de bioqumica; desde luego, el lector deber tener presente que el
contenido es eminentemente funcionaly los detalles morfolgicos son considerados
en la medida quecontribuyen a este objetivo. El estudio cada vez ms complejo sobre
la morfologa celular sigue siendo objeto de estudio primordial en disciplinas de
carcter morfolgico como la Histologa. Sin dudas nos vamos acercando a una snte-
sis de conocimientos que muchos reconocen como una disciplina independiente, la
Biologa Molecular, en nuestro caso se considera como una parte de la propia
Bioqumica.

El enfoque eminentemente funcional nos ha decidido tratar los aspectos estmcturales


de algunos componentes celulares (mitocondriasy ribosomas) en captulos de otras
secciones donde se estudian sus funciones.

En esta seccin se tratan aspectos estructurales y funcionales de los componentes


celulares,cnies son lamembranaplasmtica y losorganelosmembi.anau>sinhamlulares,
el ncleo celular y el citoesqueleto.

En este texto podr comprobarse cmo estos conocimientos son retomados necesaria-
mente para lograr mejor comprensin del funcionamiento y regulacin del metabolis-
mo celular, cobrandofuerza una concepcin de la relacin estmctnra-funcin a todos
los niveles de organizacin de la materia viva.

Sin embargo, debe quedar claro que una clula es un objeto muy complejo, con un
elevadsimo grado de organizacin cuya comprensin requiere an de intensas inves-
tigaciones.
Las membranas biolgicas son organizaciones supramacromolecularesflexibles
y fluidas que delimitan las clulas del medio circundante (membrana plasmtica), o
constituyen el sistema de endomembranas caracterstico de las clulas eucariotas y
que condicionala compartimentacin de stas; adems, las membranas delimitan a
muchos organelos citoplasmticos.
Aunque la composicin molecular de las membranas biolgicas varia segn el
tipo de clula del cual forme parte, e incluso de su localizacin intracelular, todas ellas
presentan un conjunto decaracteristicascomunes tantoen relacin con su composicin
molecular y su organizacinestructural general como con sus funciones bsicas.
En este captulo se estudiarn estas caracteristicas comunes a todas las membranas
biolgicas y adems, se tratarn las especificidades estructurales generales de la
membrana plasmtica, haciendo nfasis en algunas de sus funciones,particularmente
las relacionadas con el paso de sustancias a travs de ella.

Componentes moleculares de les membranas


Las distintas membranas biolgicas estn constituidasfundamentalmente por
Lpidos y protenas, poseen adems, glcidosen pequeas cantidades. Los Lpidos y las
protenas son los componentes fundamentales que se encuentran en proporciones
variables segn el tipo de membrana; en las membranas mielnicas los Ipidos
constituyencerca de180 % de su masa y las protenas alrededor de120 %,en tanto que
en lamembranainternade las mitocondrias la proporcin de ambos constituyenteses
inversa,-20 % de Ipidos y 80 % de protenas. Entre estos lmites existe una gama de
proporciones diversas de dichos componentes; analizaremos algunos aspectos
particulares de cada uno de los componentesmoleculares de las membranas.

Lpidm de membrana

Losopid~s<lwxenwnbranfonnandopartedelasmembrana~presentanlapropiedad
deser aniptieascomose mrdar, stase - ed
una pomn polar y otra apolar (captulo 13).Dichos Ipidosde membranas son fdtidos
de glicerina y esngolpidos;los triacilglicridos se encuenhan en cantidadesnfimas.
Algunos tipos de membrana poseen colesterol y stem de colesterol.
La caracterstica anfiptica de los principales Ipidos de las membranas condiciona
la organizacin estructural destos en forma de micela o bicapa (Fig. 20.1),en la cual
los grupos polares se disponen hacia el exterior de sta e interactan con el medio
acuoso a travs de puentes de hidrgeno y de interaccioneselectrostticas.Las cadenas
apolares, a su vez, se dirigen hacia el interior, entreellas se establecen atracciones por
uniones bidmfbicas y por fuerzas de Van der Waals.

Fie. 20.1. Reuresentacin esriaeial de un seemento de bieaiia liudica. En negro. tomos de carbono;

En la Fig. 20.2 puede apreciarse la forma en que el colesterol se relaciona con los
fosfolpidos;como se ha dicho, la bicapa, estructura fundamental de las membranas, es
fluida; ello depende de su composicin. La longitud de lacadena y el grado de insatu-
racin de los cidos grasos, -que constituyen los fosftidos de glicerina y
esfingolpidosinfluyen deformadeterminante en esta propiedad; de esta manera los
cidos grasos de cadena corta y los insaturados limitan el "empaquetaniiento" de las
cadenas hidrfobas y por tanto contribuyen a la fluidez. La presencia de colesterol en
la membrana eierce
" efectos sobre su fluidez.
La bicapa lipdica es asimtrica, ya que la disposicin de sus componentes difiere
en cada una de las capas. La mayora de las molculas de fosfatidil serina y fosfatidil
etanolamina se encuentran en la capa interna, en tanto que, en la externa predominan
las defosfatidil colina y esfingomielina; el difosfatidil glicerol se encuentra slo en la
membrana interna de la mitocondria y en algunas membranas bacterianas. El inositol
en el fosfatidilinositol, as como el 4,s-difosfoinositol fosfoglicrido (PIP,) forman
parte tambin de la membrana plasmtica y en el caso del PiP2esfuente de 2 segundos
mensajeros.
Los plasmalgenos forman parte tambin de algunas membranas como el tejido
nervioso y el corazn. Como veremos ms adelante,algunos glcidos se unen a Ipidos
formando los glucolpidos.
El espesor de la bicapa lipdica mide aproximadamente entre 6 y 9 nm para la
mayora de lasmembranas; esta bicapase comporta como una barrera permeablepara
las sustancias lipdicas, e impermeables a los iones y compuestos polares con la
excepcin del agua (Fig. 20.3).
SLE q m q o m 83- suippI$a3sa)uaUodu1o~
'(2861 'u?!qpa epunaas
i i a k q '7 .eqqnha!g ap opeuioL)
W l
-?"he ap apgmdns e1 ua o lo!lai
-u! la ua uppe>!qn ns un% '( p )
seqqj!~ado semsuuixa 6 ( 2 d q 'e)
sa@Pa>u!a semsryu! las uapand
seuequiaui m1 ap seu!aiold se1 'VOZ %
ou!s 'lein)anilsa u?pezpea~oel e uahnquluoa anbiod 019s ou sapqanasa sauopuy
xoyiu! la epeq u e q e m l d
uepduiasap anb 'sewquiaui se1ap sa@luauiep!nyquauoduiw uos s z u p p ~ m?
as sa~elodes e p se1 anb oiuq ua
'szlru~aixasa!qpadni se1 e!xq uau
-ods!p as saxelod sezaqm se1 ten>
el "a edexq eun ueuiasq anh [a>
waueui ap uauodqp as soJ!iedgue
sop!dg s o 7 .seJ!3ola!q seu
-wqmaui se[ ap eqseq e l n p n i l q 'COZ 'a!,#
Fig. 20.5. Disposicin en la membrana plasmtica de la gliroforina, protena intrnseca de las
glbulos rojos humanos.
(Tomado de Bioqumica. L. Stryer. Segunda edicin, 1982).

Las protenas perifricas se disponen en lasuperficie interna o externa de la bicapa


y se unen, por interacciones dbiles de tipo electrosttico, a la cabeza polar de los
Ipidos de la membrana, por lo cual son fcilmenteseparadas con el uso de soluciones
salinas. Estas protenas son solublesen solventes polares. Entre las protenas perifri-
cas hay algunas con actividad enzimtica.
Las porciones de las protenas de membrana que se incluyen en la bicapa lipdica
poseen elevado contenido de aminocidosapolares, con predominio de la estrnctura
en hlice u de conformadn P; como fue estudiado en el capitulo 12, la estructura en
hlice u de las protenas minimiza el carcter hidrofnico.de1enlace pepidico.

Gleidos de membrana

En todas las clulas eucariotasse encuentra una cantidad de glcidos, formando


partede las membranas, particularmentede la plasmiica. Los gludosse hallanunidos
de forma covalente a Ipidos o protenas para formar glicolpidos o glicoprotenas,
respectivamente. La fraccin glucdica constituye entre 2 y 10 %;desde el punto de
vista estructural son oligosacridos,que en su mayoraestn unidos a protenas y en
menor cantidad a los Ipidos. Los oligosacridosde las membranas estn dispuestos
hacia la cara no citoplasmtica (Fig. 20.6), stos cumplen las funciones siguientes:

1. Contribuyen a la orientacin de las protenas en la membrana.


2. Participan en la interaccin entre membranasde clulas distintas.
3. Tienen una funcin fundamental en las propiedades inmunolgicas
de las membranas.

Los azricares que se encuentran formando parte de estos glicolpidos y


glicoprotenas son: glucosa, galactosa, manosa, fucosa, N acetil galactosamina y el
cido silico. La asimetra se mantiene debido a que el paso espontneo de molculas
de una capa a la otra es casi nulo.

Modelo del mosaico fluido


El modelo de membrana del mosaico fluidofue propuesto por Singer y Nicolson
en 1972,ste es capaz de explicar numerosas propiedades fsicas, qumicasy biolgicas
Fig. 20.6. Reprcsentacih de la capa lipidies externa de una rnemhrana plasrntira Iiipottiea. Les
oligosaeridos integrantes de los ganglisidos estn constituidos por diversos monosac-
ridos indicadas con Ictras.
('romado de Moleeular Biulog? af thc crll. R. Albci-ts et al., 1983).

de las membranas; se acepta universalmente como la organizacin estructural ms


probable de los componentes de las membranas biolgicas.
El modelo se propuso sobre la hase del estudio de la composicin qumica y
propiedades fsicas de las membranas biolgicas, as como de resultados experimen-
tales en los cuales se compar el comportamiento de membranas sintticas preparada5
en el laboratorio, a partir de una mezcla de fosfolpidos y algunas protenas, con el
comportamiento de las memhranas naturales.
En la figura 20.7 puede apreciarse una representacin esquemtica del modelo. Se
considera que las protenas forman un mosaico dentro de la hicapa lipdica, que
constituye la estructura bsica; adems, las proteinas experimentan movimientos
laterales. En estemodelo puede observarse la disposicin de los glcidos en la cara no
citoplasmtica; las protenas perifricas se localizan hacia ambos lados, y el conjunto
adopta una estructura tridimensional compacta y flexible.

N
, Bicapa
lipdica
. '

Fig. 20.7. Modelo del mosaico fluida.


(Tomado de Bioqumies. L. Strper.
Segunda edicin, 1982).

El grado de fluidez de una membrana influye en sus funciones, si aumenta su


fluidez seincrementa su permeabilidad al agua y a otras molculas e iones, en tanto

1. Los Ipidos y protenas organizados en forma de mosaico.


2. Las membranas son estructuras fluidas donde los Lpidos y proteinas pueden efec-
tuar movimientos de traslacin dentro de la misma capa.
3. A s h e t i a en la disposicin de los Ipidos, las protenas y especialmentelas glcidos.
Membrana plasmtica
La membrana plasmtica se organiza como una doble capa continua, delgada, de
4 a 5 nni de espesor. En algunas clulas, por fuera de la membrana, existe una cubierta
celular que la cubre y protege. La membrana plasmtica individualiza a la clula y
permite que sta se relxione con el medio; su desarrollo constituy un evento cruiial
en el proceso de evolucibn de la materia viva (captulo 3).
La membrana plasintica est constituida deforma siniilar a la descrita para las
membranas hinlgicas, por lo cual aqu trataremos slo las particularidades ms
relevantes.
En un niisiii~~tipo de nieinbrana plasmticase han podido aislar e identificar unas
100 protenas diferentes, y teniendo en cuenta los distintos tipos de membranas plasm-
ticas estudiadas se Iia determinado la presencia de numerosas enzimas, algunas de ellas
exhiben una Ion~alizacinbistica especifica,como las disacaridasas -localizadas en las
n~icrovellosidadesdc la niucosa intestinal-, en tanto otras presentan una ubicacin
ms universal -iVl'l'asa dependiente de Na' y K'.
Las protenas transportadorai, la$que forniancanales y los receptoresdemembrana
tienen una especial relevancia, ya que desempea una funcin vital en el intercambio
de sustancia, energa e inti)rniacin de la clula con su entorno (Fig. 20.8). Las protena?
de membrana pueden presentar adenis funcin estructiiral,constituir antgenos o
alguna otra funcibn especifica.
Ligando

1
Protena
l
Protena
l
Bomba
~ e c e i t ode
membrana
r
canales transpoitadora

Fig. 20.8. 'Tipos de protenas d e menihranas. Ohs6rvesc Wmu todas rllas son protenac integrales.

La membrana plasmtica del eritrocito (figura 20.9) ha sido muy estudiada


dehido a la relativa facilidad de su aislamiento y purificacin, contiene 52 90de
protenas, 40 % de lpidos y 8 % de glcidos en forma de oligosacridos. La
distribucibn de las protenas en la bicapa es tambin asimtric-,las perifricaq queson
ms solubles se encuentran en la cara citoplasmtica, las externas estn ms asociadas
a los lpidos. Las glicoprotenas se disponen en la cara externa o lnminal. En el captulo
63 el lector puede ampliar detalles al respecto.
Las protenas transportadoras son protenas integrales de membrana, tienen
especificidad y se unen a la sustancia que se debe transportar. Los canales o poros son
protenas intrnsecas que crean un ambiente "acuoso" en su interior debido a la
conformacin adoptada por sus niveles terciarios y cuaternarios, lo que permite la
difusin de sustancias en ambos sentidos a travs de la muiihrana; las sustancias se
mueven a favor del gradiente. Aunque estas protenas canales muestran cierta
especificidad,nose unen a lasustancia quese debe trausportar y laselectividad parece
ms binestar relacionada al tamaio y carga elctrica de la sustancia transportada. El
flujo a travs del canal secontrola por la regulacin de su apertura y cierre.
Las protenas receptoras son protenas transmembrauales cuya funcin
especializada es constituir un eslabn fundamental en la comunicacin intercelnlar,
Bicapa
lipdica
-
-
.

...
.
-gH~
'1;
-. l

r,

HOOC
.
l.

*Y .i
-.

.< .., <


Banda 111

<
~. exiracelular
, Espacio

Citoplasma

Fig. 20.9. Disposiri6n de la banda 111 y de


la glicoforina (GP) en la mcnilirn-
na del critracito.
NHZ (Tomado de Moleeular Bh>logy of
thc cell. R. Alhcrts el al., 1983).

ellas captan alguna? seales quniicas del exterior y trasmiten una informacin Iiacia
el interior de la clula. No todos los receptores son proteinas de membrana, pues en
algunoscasosla protena receptora se encuentra localizadaen el interior de la clula y
no forma parfe de la nienilnma plasnitica. Se hace referencia slo a los receptores de
membrana. Estos de acuerdo con sus respuestas ante las seales pueden:

1.Regular el paso de determinadas sustancias o iones a travs de canales.


2. Modificar la actividad de algunas enzimas.
3. Provocar cambios de conformacin y fiincin de determinadas proteinas.
4. Facilitar procesos de endocitosis.
5. Inducir la transcripcin de algn segmento del ADN.

La estructura de los receptores es muy variada, pueden estar formados por una
cadena polipeptdica o cnnstituir oligmerus ms o menos complejos. En muchos
casos se pueden distinguir 3 dominios: uno extracelular, glicosilado, relacionado cnn
el reconocimiento molerular de la seal quniica; otro que atraviesa la membrana, y un
tercero, intracclular relacionado con la trasinisii,n de la informacin (Fig. 20.10).

Bicapa
lipdica

Fk. 20.10. Estriirtiira dc un receptor de nirriitiran~.(a) I>ifcrentesdominios: DE dominio cxtraiclular


Por donde S r unic el lizande, 1Yl' diiniinio transineniliranal y DC dominio citoplasmtico por
dondc se expresa o lrasmitc la respuesla a la scel. (1,) Al unirse el ligando sc produce una
transi<informacin que provoca la aclivacim dcl centro cataltico inactivo (CCl) y se
conviene en centro cairllico activo (CCA), lo que pcrmile que ocurra la reaccin cniinitica.
El reconocimiento y unin de la seal al dominio externo de la protena receptora
provoca un cambio conformacional en sta, el que se trasmite al dominio intracelular
y desencadena el tipo de respuesta correspondiente. En el captulo 59, en ocasin del
estudio de la comunicacin celular, el lector podr ampliar este aspecto.
Las membranas plasmtieas de clulas animales poseen colesterol en cantidades
elevadas, hasta una relacin de 1:l con los fosfolpidos. De igual forma el contenido
de oligosacridos es relativamente elevado, al compararlo con el de otro tipo de
membranas como se puede comprobar en la tabla 20.1.

n b l a 20.1. Con~posiCinaproximada de IIpidos en distintas membranas celulares

Tipo de lipido MFH MPE MIE MlT RE

Colaterol 17 23 22 3 6

Glicolipidos 7 3 28 hz hz

1.0s \dores se dan en por cientos del peso total de lipidos.


Leyendas: MPH: membrana plasmtiea heptica. MPE: membrana plasmtica del eritrocito. MIE:
niieliim 5117: mitocandria. RE: rrtiriilo cn<loplsniiro.trr: trazas.

Los glcidos presentes en la membrana parecen tener importancia en las


interacciones de las clulas, especficamente en el reconocimiento entre ellas.
A la zona externa de la membrana plasmtica, abundante en glcidos, se le
conoce con el nombre de glicocalix (Fig. 20.11). Con frecuencia se adsorben
glicoprotenas y proteoglicanos, secretados por la propia clula, a esta cara externa de
la membrana plasmtica.

Fig. 20.11. Mierofotngrafia electr6nicii dc


la superficie de un linfocito. La
linein especfica permite ver la
cubierta celular o gliioelix.
(Tomado de Mulerular Biology of
tlie ccll. B. Alherts el al., 1983).
La cubierta celular est formada por polisacridos. En las clulas vegetales la
pared celular est constituida por celulosa y pectina. En algunas clnlas animales est
presente una capa de heteropolisacrido que rodea a la membrana y forma la cubierta
externa; sta, aunque no tiene funcin relacionadacon la permeabilidad de lamembrana,
puede sin embargo, actuar como filtro, por ejemplo, el cido hialurnico presente en el
tejido conectivo puede, en cierta medida, modificar la velocidad de difusin a travs
de la membrana.

Funcione8 de la membrana piasm4tica

Las membranas plasmticas presentan un conjunto de funciones como:

1.Delimitan la clula y la interrelacionan con otras.


2. Presentan permeabilidad selectiva, permiten el paso libre de algunas sustancias e
impiden el de otras segn el tamao y solubilidad de stas.
3. Participan en los mecanismos mediante los cuales la clula secreta y expulsa
sustancias al exterior.
4. Contribuyen al mantenimiento del balance hidromiueral de las clulas.
5. Trasmiten ondas excitatorias a las clulas vecinasen respuesta de algunas seales.
6. Reciben seales del medio a travs de las protenas receptoras de membranas.
7. Participan en el transporte selectivode sustancias entre la clula y el medio.
8. Incorporan grandes molculas mediante el mecanismo de fagocitosis.
9. Confieren especificidad antignica a la clula.

Transporte de sustancias a travs de las membranas


Por su naturaleza apolar la bicapa lipdica de la membrana plasmtica acta como
barrera impermeable para los iones y las molculas polares con la excepcin del agua.
El transporte de molculas pequeas a travs de la bicapa lipdica se realiza mediante
protenas transmembranales especializadas;estas molculas transportadoras son muy
especficas y cada una acepta una determinada molcula o un grupo de ellas muy
relacionadas. El paso de molculasmayores, como las macromolculas, a travs de las apolares - F;
membranas se produce por los mecanismos de endo y exocitosis,que sern estudiados
en el captulo 21. Algunas molculas apolares s son capaces de atravesar libremente la Molculas H20

bicapa lipdica, ello depende de su solubilidad y tamao. (Fig. 20.12).


Existen mecanismos diferentes relacionados con el transporte de sustancias a
travs de las membranas: en algunos casos el paso se produce sin la intervencin de
transportador alguno ( difusin simple y smosis ), en otros, el paso ocurre con la Molculas glucosa
participacin de alguna protena transportadora (transporte pasivo y activo ) o que polares mayores s a c a r o s a E &
delimita un espacio por donde pasa la sustancia ( poros o canales ); y en otra$ocasiones
el paso ocurre por movimientos de la membrana que incluye a la sustancia que se debe
transportar (endocitosiso exocitosis).

Bicapa lipdica
En el primer caso se trata de molculas para las cuales la membrana plasmtica es
permeable, lo que le permite difundir, esto depender nicamente de la diferencia de
Fig. 20.12. Pcrrnealiilidatl selcitiv" de la
concentracin de dicho soluto fuera y dentro de la clula, o sea, de su gradiente de hieapa lipdiea.
concentracin. La velocidad de difusin en este caso es directamente proporcional a la
diferencia de concentracin del soluto.
Este tipo de transporte se realiza a favor del gradiente y no requiere de energa ni
de transportador, aunque en algunos casos, participan aly n a s protenas que forman
canales y permiten el paso de determinadas sustancias mediante el mecanismo de
difusin simple (Fig. 20.13). Al igualarse las concentraciones de la sustancia
transportada, fuera y dentro de la clula el flujo neto se hace cero.
1 1 canal La smosis es un caso particular de la difusin simple, pues lo que atraviesa la
membrana es el lquido. Si en ambos lados de una membrana semipermeable existen 2
Bicapa soluciones con concentraciones diferentes de un soluto que no puede atravesarla, se
produce el paso del solvente acuoso desde el ladodonde seencuentra la solucin ms
diluida hacia la ms concentrada, hasta que ambas concentraciones se igualen. Se
conoce como presin osmtica a la fuena que hay que ejercer en el lado de la solucin
mq concentrada ( C, en la figura 20.14) para impedir el paso del agua desde el lado de
la solucin ms diluida (C, en la figura).

Fig. 20.13. Mecanismo de difusi6n simple.


ste ocurre a ti-a& dc la bicapa
lipdira ti cn alguna caros, a tra-
vs dc proteiias que funcionan
cm10 canales.
(Tomado de Mi>lecula~. Biolegy
of thc cell. 1%.Alberts et al.. 19113).

Membrana semipermeable
Fig. 20.14. s) Des disi>liieiirnesdc ceiicen-
traciancs d i f ~ r ~ n t cdcl s niisnio
soluto, sepanidas por una " I C ~ I -
hrana simipcrnieal>leqw pcrmilf
cl pasa dcl disolvente pcro ni, del
snlutii. E l disulventc pasara del
ienipartinicnlii de menor eoiircri-
traciii IC,) al de i i i q i i i . cnnien-
trariiin IC,) hasta que se igualen
las conccntrecion~sen ambos la-
dui, h) ta eoluiiinn del lquido sube
en C. y hoja en C,. A la presin
que se ilrlw e j e r c r r en C' para
evitar el ascenso dc la rolumma dc
liquido sc denomina preiiiin
osnitira.

Transporte mediante pmteias

Poros o canales

El transporte con la participacin de proteia puede ser por poros o canales y en este
caso el mecanismo es similar alde difusinsimple,comose ha sealado. Los canales y los
poros son protenas transniembranales que delimitan espacios a travs de los cuales se
realiza el paso de algunas sustancias; los poros son menos selectivos y dejan espacios
mayores, un ejemplo lo constiiuyenlos p o m de la membrana nuclear. Los canales poseen
mayor selectividad en cuanto a la sustancia que los atraviesa, esta selectividad parece
estar relacionadacon su tamao y carga, pues no presentan sitios de unin paraellas. A
diferencia de los poros, que siempre se mantienen abiertos, la apertura y cierre de los
canales estn regulados por determinados ligandos u otras seales, un ejemplo 10
constituyen los canales del Na'.
En el transporte pasivo participan protenas transmembranales conocidas como
permeasas o "translocasas" ,este tipo de transporte se realiza tambin a favor del
gradiente y se lellama pasivo porque no requiere deenerga.
Las protenas transportadoras reconocen a la o las sustancias especficas
transportadas por ellas; tienen un wmportamiento similara las enzimas en cuanto a su
capacidad para saturarse, as como para experimentar inhibicin de tipo competitiva.
La diferencia fundamental con las enzimas es que no transforman su ligando.
Cuando la protena transportadora es capaz de transportar slo una molcula, se
dice que el proceso es uniporte; cuando el paso de una determinada sustancia depende
del trasporte simultneo de otra, el proceso se denomina cotransporte. ste se designa
como simporte si el paso de ambas sustancias se produce en el mismo sentido, en caso
contrario se conoce como antiporte.
En la figura 20.15 se observa la forma de actuar de una protena transportadora en
el caso de uniporte, sta presenta 2 conformaciones; tambin se aprecia como el paso
de una a otra resulta esencial para la realizacin de su funcin. En la figura 20.16 se
puede apreciar la diferencia que existe en el comportamiento en la velocidad de
transporte en el caso de la difusin simple y la facilitada (transporte pasivo).

Bicapa
n
Gradiente de
lipdica concentracin
Fig. 20.35. Mecanismo de transporte pasi-
vo. El cirmhio de conformacibn
resulta esencial para la funcin de
, la protena transportadora.
Protena (Tomado de Molecular Uiology
transportadora of the cdl. U. Alberts et al., 1983).

.....--a!:
3 _--- -
.e
'
,,--

/, Difusin
facilitada

/ i Fig. 20.16. Cintica del transporte en el caso


de la difusin simple p la difusin
facilitada. Obsrvese que el com-
Km Concentracin de la portamiento cintico cn el segun-
, da caso resulta similar al de las
molcula transportada enzimas.

Las protenas que intervienen en el transporte activo se conocen con el nombre de


bombas y son protenas transmembranales. La concentracin de iones y otros solutos
en el interior y exterior d e las clulas es diferente (tabla 20.2); esta diferencia es
esencial en el mantenimiento de un potencial energtico,debido a la existencia de un

componentes cePulares y anetica molecdar 383


gradiente deconcentracin y a la diferencia de cargas elctricas, lo que condiciona el
potencial electroqumico, este ltimo est ligado a procesos fundamentales como la
generacin del impulso nervioso, la contraccin muscular y la sntesis de ATP. El
mantenimiento de la concentracin inica diferente dentro y fuera de la clula se
garantiza por la existencia del transporte activo.

Tabla20.2 Concentracin inica (ml3q.C')dentro y fuera dela rnenibrana celular, en


mamferas

Componente Concentracin intracelular Concentracin extracelular

Cations
Nn*
K*
Mg2*
ea:*
H+

Aniones
L1-

Nota: Tanihin mnstituycn animes numerosas los cidos nucleicos y otras sustancias

El transporte activo se realiza en contra del gradiente de concentracin, por lo


cual requiere de energa, un ejemplo tpico y muy estudiado lo constituye la enzima
adenosn hifcsfatasa dependiente de Na' y K*(ATPasaN*-Kidependiente), esta enzima
constituye una bombaque utilizala energa de hidrlisis del ATPpara extraer 3 iones
Na'hacia el espacio extracelular e incorporar 2 iones K'hacia el interior de la misma
clula (Fig. 20.17). Puede comprobarse cmo se le une un grupo fosfato del ATP, lo
cual condiciona el cambio conformacional que le permite realizar so funcin.
La bomba de Na+-K'contribuye a regular el volumen celular, ya que coopera para
mantener la concentracin de solutos dentro y fuera de la clula donde las
macromolculas y otros compuestos cumplen funciones importantes.
2

Fig. 20.17. La honiha de Na+-K*reqiiierr energa en furnia de ATP para su accin. La protena se
fosforila y experimenta una traaisri,i>forniaein,la cual resulta necesaria para realizar su
funcin. Al deefusfurilarse la I>ainl>iirecupera su conformaein inicial.
(Tomado de Maleeular Bielogy of the r d . R. i\lbcrts et al., 1983).

384
Potencial de membrana en reposo
La diferencia del contenido inico dentro y fuera de las cliilas condiciona una
diferencia de potencial elctrico, donde el interior de la clula es ms negativo que el
exterior; esta diferenciase debe en gran medida al funciouamiento de las bombas,en
especial a la ATPasa Na--K' dependiente, ya que provoca en so accin un deshalance
instantneo de cargas por la salidade 3 iones de sodio y la entrada de 2 de potasio. A
esta diferencia contribuye, adeins, la presencia de protenas aninicas de forma
predominante en el interior de la clula.
Ladiferencia de potencial entre el exterior y el interior de lai ctlulas oscilade -20 a
-200 mv y el valor en muchos tejidos, como el riervioso, es de -70 mv.
Si por alguna causa, como pudiera ser la entrada de iones de sodio al interior de la
clula, la diferencia de potencial se hace menor, se producira una despolarizaciii.Por
el contrario,si la entrada de ionescloruro (CI-)ola salida de K+provoca unincremento
de la diferencia de potencial con respecto al wlor de reposo, en ese caso se produce
una hiperpolarizacin. Estos cambios de los valores de potencial en las clulas
excitables estn relacioiiados con la trasniisin del impulso nervioso (rapitulo 64) y
otros procesos fisiolgicos.

Diferenciacin de la membrana plasmtiea


La membrana plasintica de algunas clulas experimentan diferenciaciones
relacionadas con su especializacin, ello permite que cumplan mejor su funcin; de
esia manera se puede encontrar la structura en forma de reborde "en cepi1lo"presente
en los tbulos renales; o las diferenciaciones que hacen posible la unin o adherencia
con otras clulas como los desmosomas o nexus, o la disposicin caracterstica de la
membrana plasmtica de las clulas de la mucosa intestinal; en este ltimo caso se
compmeba la presencia de abundantes proyecciones finas del citoplasma cubiertas
p>r la membrana plasmtica denominadas microvellosidad6 (Fig. 22.18), que aumentan

viy. 21J.18. En la niiri-ofotoprafia puede


ohserrarse el rihorde e n cepillo
d e la inuiess intestinal. l.%
m i r r o i e l l o ~ i d . d e si n e r r r n r n t m
iiotahleiiicnle la superficie de ah-
coreih
('l'omado de Histalogia. D. Frrrer.
Cuarta edicin, 19751.
considerablemente la superficie de absorcin efectiva, aspecto fundamental en la
funcin de dichas clulas.

Resumen
Las membranas biol6giras son organizaaones supramacromoleeulares flexi-
bles y fluidas, formadas fundamentalmente por Ipidos y protenas en proporciones
variables segn el tipo de clula y la loeazaan intracelular de la membrana
Adems de pidos y protenas, las membranas animales suelen tener determi-
nados tipos de gludos en su composicin, los pidos presentes en estas estructuras
se caracterizan por ser anfiphtieos y se organizan formando bicapas que confor-
man la estructura bsica de las membranas.
Las protenas pueden ser exhecas o intrnsecas de acuerdo con su ubicacin
en las supercies o en el interior de la bicapa, respectivamente. Las intrnsecas son
ms abundantes y entre ellas se encuentran numerosas enzimas, las protenas trans-
portadoras y los receptores de membranas.
Los gbcidos se encuenban unidos a protenas o Ipidos formando glicoprotenas
o glicolpidos, se loealizan hacia la cara externa o luminal de las membranas y
contribuyen a la orientacin de las protenas.
La membrana plasm6tica est formada por una doble capa continua y delga-
da, que delimita a la clula y permite que sta se relacione con el medio; por fuera
de la membrana plasmhtica existe una cubierta celular que la cubre y protege. Las
funciones de esta membrana son variadas, pero el paso selectivo de sustancias es
una de las funaones ms importantes.
La bicapa Lipdica resulta permeable a las molculas apolares, e impermeable
a los iones y molculas polares con la excepan del agua. La incorporacin de
maeromolculas a travs de las membranas se produce por el mecanismo de
endocitosis que ser4 objeto de estudio en el capitulo 21.
Los mecanismos de transporte de sustancia a travs de la membrana son de 3
tipos: difusin simple, transporte pasivo y transporte activo. En el primer caso no
se requiere de transportador ni de energa y el paso del soluto se realiza a favor del
gradiente. El transporte pasivo se realiza tambihn a favor del gradiente de concen-
tracin, pero se requiere la presencia de una protena transportadora aunque no se
precisa de energa. El transporte activo requiere la participacin de algunas pro-
t e h conocidas como bombas, que funcionan con consumo de energa; el paso de
sustancia en este caso se reaiiza en contra del gradiente de concentracin, un ejem-
plo tpico de ese tipo de transportador lo constituye la ATPasa Na'-K+ dependiente.
Las membranas plasm5ticas experimentan diferenciaciones relacionadas con
la especializacin celular, que le permiten a la clula realizar de manera ms
eficientesu funcin.

Ejercicios
1. ;Por qu las menibranas biolgicas constihiyen estruciuras supraii~acromoleculares?
2. Enumere los componentes fundan~eiitales de las membranas biolgicas y explique
las proporciones en que ellos sc encuentran.
3. ;Cul es la propiedad comn que tienen los lpidos presentes en las membranas
biolgicas y diga por qu esta propiedad es fundamentalpara constituir la estructu-
ra bsica de las membrana?
4. Enumere los distintos tipos de Ipidos y explique cmo se disponen en las membra-
nas.
5. Cite losdistintos tipos de protenas presentes en las membranas biolgicas y expli-
que las diferencias entre ellas.
6. Mencione las distintas funciones que cumplen las protenas en la membrana
plasmtica.
7. Explique la importancia del carcter informacional en la realizacin de las funcio-
nes de las protenas de membrana.
8. Expliquela disposicin de los glcidos en la membrana plasmtica.
9. Cite las funcionesde la membrana plasmtica.
10. Establezca una comparacin entre la difusin simple y el transporte pasivo en
relacin con requerimientos energticos, necesidad de protena transportadora y
direccin del flujo de sustancia.
11.Establezca una comparacin entre el transporte activo y pasivo. Refirase a los 3
aspectos indicados en el ejercicio numero 10.
Entre las caracterktim que distinguen a una clula eucariota tpica, junto con la
presencia de un ncleo bien delimitado, se encuentra el hecho de que estas clulas
poseen, adems de la membrana plasmlica, un complejo sistema de membranas inter-
nas denominados sistema de endomembranas
Este complejo sistema parece ser imprescindible para el mantenimiento de la
actividad vital de las clulas que tienen un volumen relativamente grande. El sistema
de endomembranas est ausente en las pequeas clulas procanatas.
La extensin del sistema de endomembranas se deduce cuando se conoce que, en
las clulas eucariotas tpicas, estas endomembranas representan del 95 al 98 % de
todaslas membranas celulares,de modo que la membrana plasmtica que rodea a la
clula slo es una pequea fraccin del total de ellas.
Las endomembranas no son homogneas, presentan un definido grado de
diferenciaciny especializacin que conduce a la formacinde organelos subcelulares
distinguiblesdesdelos puntos devista estmctural y funcional, por lo que resulta muy
vlido estudiar estos componentes celulares bajo la denominacin de organelos
membranosos internos (Fig.21.1).

Tipos de organelos membranm internos


Los organelos membranosos internos de las clulas eucariotas son: retculo
endoplasmtico,aparato de Golgi, lisosomas,peroxisomas, mitocondrias, membrana
nucleary cloroplastos.
El retculo endoplasmtico constituye la mayor fraccin del sistema de
endomembranas, representa del 50 al 70 % de las membranas internas, posee 2
variedades: el retculo endoplasmtico liso y el retculo endoplasmtico rugoso.
El aparato de Golgi representa entre 5 y 10 % del total de las endomembranas,
mientras que los lisosomas y peroxisomas representan menos del 1 %.
Estos 4 organelos membranosos se estudian detalladamente en este captulo, las
mitocondrias y la membrana nuclear se tratarn en otros captulos las primeras se
estudiarn en la respiracin celular (seccin VI) y la segunda cuando se estudie el
ncleo celular (captulo 23).
Los cloroplastos son organelos membranosos tpicos de las clulas vegetales
(capitulo 45).
Retculo
endoplasmti
rugoso

Lisosoma

Peroxisoma

Aparato de
Golgi

Nuclolo

Mitocoodrias
Fig. 21.1. Imagen de una clula eucariontf
vista por medio del rniiroarapio Ncleo
electrnico. Ohsrvesc la prcsen-
ria en el interior celular de nume-
rosas estruettiras de aspecto Membrana
mernbranoao. plasmtica
(Tomado de Priniipes de Biochimie.
AL. Lehninger, 1985).

Estructura general de las endomembranas


Si bien la composicin exacta de cada una de las membranas que integran los
organelos membranosos intracelulares difiere de uno a otro, todos ellos presentan una
estructura general comn que responde al modelo de mosaico fluido. Esto significa
que las membranas intracelulares presentan una doble capa de lpidos donde se
encuentran diferentes protenas; estos constituyentes se mantienen unidos mediante
interacciones dbiles. Las diferencias de composicin se refieren al tipo y proporcin
de los diferentes lpidos de la bicapa y a las protenas que estn asociadas.
Los organelos membranosos internos de la clula se distinguen adems por la
forma de organizarse en el espacio intracelular.
Algunosorganelos membranosos,como las mitocondrias,presentanen su estructnra
una doble membrana pero la mayora posee una sola. Todas estas diferencias de los
organelos membranososse relacionancon la funcin que desempean en el metahlismo
celular.

Funciones generaies de los organelos membranosos


Cada organelo membranoso realiza funcionespropias, que en conjunto posibilitan
funciones como:

1.Compartimentacin. El sistema de endomembranas divide el espacio celular en


compartimientos, a su vez mantiene separadas diferentes sustancias que participan
en el metabolismo, como las enzimas, los sustratos y los cofactores; esto hace que
cada organelo membranoso constituya un reducto metablico casi independiente
del resto de la clula, lo que posibilita que en una clula puedan ocurrir, de manera
simultnea, procesos metablicos incompatibles de producirse en un mismo
comparmiento.
2. Establecimiento de gradientes de concentracin. El carcter semipermeable de las
membranas biolgicas posibilita que a travs de ellas se establezcan gradientes de
concentracin de diferentes sustancias, estos gradientes de concentracin repre-
sentan determinada energa potencial que puede manifestarse durante varias fun-
ciones celulares.
3. Disponibilidad de reas de superficie. Muchas funciones celulares slo pueden
realizarse en las membranas o a travs de ellas. Los organelos membranosos pro-
veen extensas superficiesdonde se producen diferentes reacciones metablicas, y a
travs deestas reasseUeva a cabo el intercambio de sustancia entre compartimien-
tos.
4. Incremento de las velocidades de los procesos metablicos. En relacin con los 2
aspectos anteriores se encuentra la funcin general de las endomembranas de ace-
lerar la velocidad con que pueden ocurrir, en el interior de las clulas, determinados
procesos dependientes de la difusin de sustancias. La compartimentacin reduce
los espacios intracelulares, donde los sustratos deben difundir para interaccionar
con las enzimas que los transforman; por otra parte, muchos sustratos difunden en
las 2 dimensionesdeterminadas por las membranas, lo cual incrementa demanera
extraordinaria la velocidad para tener acceso a los sitios activos de enzimas locali-
zadas en la propia membrana.
5. Generacin de nuevas membranas. Hasta donde se conoce, las membranas biolgi-
cas slo se forman por crecimiento de membranas preexistentes. El sistema de
endomembranas provee un soporte que posibilita el crecimiento de las propias
membranas, lo cual resulta imprescindible para el ciecimiento y la multiplicacin
celulares.

Relaciones entre los organelos membranosos


La diferenciacin de los organelos membranosos y su delin~itacinde
compartimentos celulares separados, no implican que los organelos son totalmente
independientes. Los organelos membranosos establecen importantes relaciones
estructurales y funcionales entre s; stas son un rea de intensa investigacin en la
actualidad.

El retculo endoplasmtico es el organelo membranoso ms abundante en la


mayora de las clulas eucariotm, gran parte del interior celular se encuentra ocupado
por el conjunto de membranas que componen este organelo.
En las secciones celulares preparadas para obtener imgenes de microscopia
electrnica, el retculo endoplasmtico aparece como un conjunto de espacios muy
aplanados rodeados por una membrana; se considera que este organelo es un enorme
saco membranoso nico, muy replegado y comprimido, conectado tambin por una
serie de finos tubos (fig. 21.2).
El espacio encerrado dentro del retculo endoplasmtico constituye un
compartimento intracelular independiente y suele denominarse lumen o espacio Fig. 21.2. Esquema del retculo
cisternal. La separacin entre las membranas del retculo endoplasmtico es de endoplasmtico. Ntese que se
distinguen porciones con aspecto
20 a 30 nm, ste tambin presenta continuidad con la membrana nuclear externa de sacos aplanadas, micntras en
Y en l se distinguen 2 porciones diferentes, tanto desde los puntos de vista otras nons existen tubos
estructural como funcional (fig. 21.3). inembranosos finos qrre iirterco-
El retculo endoplasmtico rugoso se caracteriza por presentar gran cantidad de neitan los anteriores.
(Tomado de Moleeular Biology
nbosomas unidos a la cara externa desus membranas, que le da el aspecto que origina of the cell. B. Alberts et al., 198.1).
RE rugoso RE liso

IFig. 21.3. Imagen al niicn,sropiii rleelrni-


co dc una seceiijn de clula. don-
de se obserraii porciones del ret-
culo endoplasnitico: reticulo
endoplasmYieo liso (RE lisni y re-
tculo endoplasnitiw rugoso (RE
rugoso). Puede iipreciarsc el asper-
to diferente de anihas porciones
del retculu.
(Tomado de Molerular Biulogy of
thc ccll. B. Alherts et al., 1983).

su denominacin; su organizacin es en forma de sacos aplanados y apilados llamados


cisternas (fig. 21.4).
El retculo endoplasmtico rugoso est presente en todas las clulas nucleadas,
pero es mucho ms abundante en clulas secretoras que sintetizan protenas las que
luego son exportadas al exterior de la clula.
El retculo endoplasmticolisoes continuacin del mgoso y representa porciones
del retculo endoplasmtico desprovistas de ribosomas; se organiza en forma de finos
tubos interconectados con las cisternas del retculo endoplasmtico rugoso; adems es
muy abundante en las clulas que sintetizan Ipidos de forma activa, aunque en general
representa slo una pequea fraccin del retculo endoplasmtico (Fig. 21.3).

Fig. 21.4. Relculo endopla~mticurugoso


(RErugosa) en un corte de clula
observado al microscopio electr-
nico. Las membranas del retculo
endoplasmtico rugoso forman
cisternas con aspecto de sacos ma)
aplanados y apiladus.
(Tomado de Molecula~.Biology uf
the cell. B. Alberts et al., 1983).
El trmino "microsoma", que aparece con frecuencia en textos de bioqnmica,
se utiliza para denominar pequeas vesculas que se originan por fragmentacin y
sellaje del retculo endoplasmtico, al someter las clulas bajo tcnicas de
homogeneizacin. Segn la porcin del retculo endoplasmtico donde se originan,
se formarn microsomas rugosos o lisos que pueden ser separados mediante
centrifugacin; aunque estos microsomas no conservan toda la estructura del
retculo endoplasmtico, han resultado muy tiles en el estudio de algunas
caractersticas de este organelo membranoso.
La funcin del retculo endoplasmtico rugoso es fundamentalmente la sntesis
de proteinas -en especial glicoproteuas. Las prnteinas se sintetizan en los
ribosomas que tapizan la superficie externa del retculo endoplasmtico rugoso;
hoy se sabe que estos ribosomas unidos a este retculo son idnticos a los que se
encuentran libres en la clula.
En la actualidad seconsidera qnela mayora o todas las protenas sintetizada en
el retculo endoplasmtico rugoso comienzan su sntesis en los ribosomas libres pero,
una vez formado el pptido seal (captulo 46), una "partcula reconocedora de seal"
se unea stee impide la continuacin de la sntesis. Esta partcula interviene tambin
en el reconocimiento de receptores especficos en la superficie externa del retculo
endoplasmticorugoso. Una vez unido el ribosoma a la membrana, la unin se estahiliza
y la sntesis protenica contina.
Esta sntesis de protenas se produce de modo que la cadena polipeptdica en
crecimiento surge hacia el espacio del lumen o bien queda incorporada a la membrana
(incorporacin cotraduccional) (Fig. 21.5).
Adems del proceso biosinttico descrito,se sabe que algunas protenas sintetizadas
en los ribosomas libres pueden ser incorporadas a las membranas del retculo
endoplasmtico rugoso y a otros organelos membranosos (incorporacin pos-
traduccional); para estos casos hay evidencias muy claras de que existen secuencias
seales especficas y de que, al menos en algunos de ellos, el proceso requiere el
consumo de energa.
Se plantea que posiblemente todas las protenas sintetizadas en el retculo
endoplasmtico rugoso experimentan un proceso de glicosilacin; no existe acuerdo
de que este proceso de glicosilacin se inicie en el retculo endoplasmtico mgoso o
sea privativo del aparato de Golgi.
Se ha postulado que la glicosilacin de las protenas sintetizadas en el retculo
endoplasmtico rugoso puede ocurrir simultnea al crecimiento de la cadena poli-

Fig. 21.5. Sntesis de protenas en el retcu-


lo endoplacmtico nigoso. La sin-
tesiseomienzaen ribosomas libres,
pero una vez formado el pptido
seal el complejo se une a la su-
perficie externa del retculo
endoplasmtico, y la unin se
estabiliza por protenas especficas,
postcriormcnte la sntesis de pro-
Cadena poli&ptidica terminada tenas contina.
Eliminacin del pptido seal (Tomado de Molecular Biology of
con pptido seal eliminado the rcll. B. Alberts et al., 19113).

Componentes celulares y Oui&ica mkcular 393


procesamiento de glicosilaciones -sobre todo en residuos de serina y treonina-,
modificacin de los oligosacridos unidos a radicales de asparagina, protelisis parcial,
sulfatacin y adicin de cidos grasos. Todos estos cambios son cataii7ados por enzimas
localizadas en el sistema de cisternas del Golgi.
Las biomolculas que maduran en el aparato de Golgi emergen a travs de su
regin trans -aunque tambin de algunas cisternas intermedia$- en forma de vesculas
que siguen diferentes destinos dentro de la clula (fig. 21.7).

Fig. 21.7. I'roceso d c maduracin d e


biumolliulas en el aparato de
Golgi. Las hiomelbcuias ingresan
al aparato de Golgi por su regin
iis y se van trasladando hacia la
regin trans, en c u y trinsita ru-
frcn modifieaeionrs de distinto
tipo. Las Ihiamoleulas maduras
emergen en forma de vesculas que
.. siguen diferentes destinos en la
Membrana plasmtica basal clula.
(Tomado de Molecular Biologs of
the ecll. B. Alherts et al., 1983).
El aparato de Golgi tiene uiia participacin destacada en la preparacibn y
concentracin de protenas que son secretadas por la clula; de hecho el aparato de
Golgi est muy desarrollado en las clulas que realizan esta funcin secretora.
Los productos de secrecin uiia vez maduros y concentradosseseparan del aparato
de Golgi en forma de yesictila\. donde ruele ocurrir una concentracin ulterior. Las
vesculas de secrecibii se adoiaii a la iiirinhrana plasmtica y se fusionan con sta y
vierten su contenido al exterior de la celula, en un proceso denominado exocitosis,
que se produce ante estmulos especficos.

Los lisosomas son yesculas 'meinbranosas de tamao y forma diversos, cuya


heterogeneidad obedece a las distintas etapas evolutivas de su ciclo funcional;
constituyen orgaiielos que estn implicados en la degradacin de diferentes
biomoiculas, por lo cual se les compara con un aparato digestivo intracelular. Esta

-
Componentes celulares y Gentica molec~phr 395
funcin tpica de los lisosomas se realiza gracias a las enzimas hidroltieas que suman
varias decenas de diferentes hidrolasas, capaces de actuar sobre los distintos sustratos.
Las enzimas lisosomales se sintetizan en el retculo endoplasmtico, de donde
pasan al aparatode Golgi. Las enzimas lisosomales se caracterizan por ser glicoproteinas
y poseen un pH ptimo en la regin cida. El lisosoma, como organeloindependiente,
se origina por evaginaciones del aparato de Golgi en forma de pequeas vesculas de
0 5 pm de dimetro, que se denominan lisosomasprimarios(fig. 21.8).
La membrana de los lisosomas posee una bomba de protones (H') dependiente de
ATP, que mantiene el interior de este organelo en un valor de pH cercano a 5,0, en
correspondenciaconel valor pthode pH para la accin de las hidrofasasque contiene.
Lascaraeterscw de permeabilidadde esta membrana son tales que, mienhas mantienen
separadas sus potentes hidrolasas del resto de la clula, permiten la salida de los
Fig. 21.8. Aspecto de los lisosomas prima- productos de degradacin de las biomolculas que son digeridas.
rios y secundarios en una imagen Los mecanismos, mediante los cuales las enzimas lisosomales son dirigidas hacia
de microseopia electrnica.
Lisosoma primario (LP) y lisosoma la formacin de este organelo, no estn del todo aclarados, pero se les ha atribuido un
secundario (LS). elevado significado a la presencia en las enzimas lisosomales de un oligosacrido que
(Tomado de Molccular Biologv of contiene manos 6 fosfato,lo cual se considera un marcador especfico de estas enzimas
the eell. B. Alberts et al., 1983). y que pudiera participar en interacciones con receptores vinculados a su transporte
intracelular.
Los sosomas participan en el recambio normal de los componentescelulares y en
la digestin de materiales provenientes del exterior celular; tambin intervienen en la
remodelacin de tejidos durante la embriognesis y el desarrollo, e incluso en
mecanismos emergentes de supervivenciacelular ante un inadecuado suministrode
nuhientes.
En su funcionamiento los lisosomas primarios dan origen a diversos tipos de
lisosomas secundariosde variada morfologa, cuya nomenclatura diverge de un autor
a otro. Resulta de inters referirse a 2 tipos de lisosomas secundarios, ya que sus
denominaciones se basan en el origen del material en proceso de digestin localizado
en su interior, los autofagosomas (lisosoma secundario autofgico) y los
heterofagosomas(lisosoma secundarioheterofgico).
Los heterofagosomas son vesculas digestivas que se forman por la fusin de
lisosomas primarios con vesculas heterofgicas, constituidas por invaginacionesde
la membrana plasmtica que incluyen en su interior material proveniente del exterior
celular (fagocitocis y pinocitocis).
La fagocitocis y la pinocitocis son 2 variantes de un proceso general denominado
endocitocis; como su nombre indica, la endocitocis consiste en la incorporacin al
interior celular de material proveniente del exterior. En el caso de la fagocitocis el
material incorporado es relativamentevoluminoso (virus, bacterias, fragmentos de
otras clulasy complejossupramacromoleculares),mientras que la pinocitd se refiere
a la incorporacin de molculas o pequeas porciones del medio extracelular.
El mecanismo general de la endocitocis consiste en la invaginacinde la membrana
plasmtica, con formacin de una vescula donde queda incluidoel material endocitado;
por tanto, la membrana que rodea este material tiene su origen en la membrana
plasmtica. Al menos, en algunos casos el mecanismo de endocitocis se desencadena
por la unin del material que ser endocitadoen los receptores especficoslocalizados
en la propia membrana plasmtica.
Los autofagosomas se forman por la fusin de lisosomas primarios con vesculas
autofgicas, que contienen en su interior material procedente de la propia clula. El
origen y formacin de las vesculas autofgicas se desconoce. En la figura 21.9 se
representan estos procesos de autofagia y beterofagia.Al lisosoma secundario que
contiene en su interior material que noes digerible se te denomina cuerpo residual.
Se ha descrito un numeroso grupo de enfermedades hereditarias debidas a
deficiencias de algunas de las enzimas lisosomales; estas enfermedades de
"ates0ramiento"con frecuencia afectan el normal desuroUo del sistema nervioso central
y de otros rganos. Es comn observar en clulas de pacientes con estas afecciones un
gran nmero de lisosomas distendidos y "abarrotados", con el sustrato no digeridode
la enzima que est en dficit (fig. 21.10).
Membrana plasmtica

Fagocitosis

Fig. 21.9. Esquema representativo de los


evenloa que ocurren durante la
autofagia ( a ) y d u r a n t e la
Iieterofagia (b).Lisosuma primario
(LP). Autafagosoma y hcternfago-
sonis. En ambas casos, una vez
englobado en una vescula el ma-
terial a digerir, sc produce la fu-
sin ron lisosomas primarios y se
inicia la degradacin de las biomo-
Iculas secuestradas.
(Tomado de Maleeular Biolugy of
thc iell. B. Alberts el al., 1983).

Los lisosomas tambin estn implicados en otro tipo de alteraciones, como los
procesos iniamatorios y degenerativos. En otras partes del texto se har referencia a
algunas de estas enfermedades.

Los peroxisomas son pequeos organelos membranosos de forma esfrica, que en


los cortes estudiados al microscopio electrnico, suelen presentar en su interior zonas
de aspecto cristalino (fig. 21.11).
En la mayora de las clulas los peroxisomas no rebasan los 025 pm de d i i e t r o ,
pero en algunas, como las del hgado y el rin, alcanzan 0,s pm.
Los peroxisomas se originan por vesiculacin del retculo endoplasmtico que,
en ocasiones,se les observa unidos por porciones tubulares. No obstante, la mayora de Fig. 21.10. Imagen de niieruscopin clertr-
las protenas de los peroxisomas son importadas desde el citoplasma. nira de clulas provenientes dc uii
Si bien el contenido enzimtico de los peroxisomas es variable de un tipo celular paciente afectado con la enferme-
dad de Ta! -Sacfis. Lisosomas sc-
a otro, en todos los casos parecen estar presentes enzimas que intervienen en el metabo-
tundarios (1.S): Obsrreiise los
del perxido de hidrgeno (H,O,). En efecto, la catalaia participa en la oxidacin lisosonias secundarios dilatados
dealgunassnstancias, utilizandod&ectamenteel oxgeno molecular segn la reaccin: por inateri:il de tipo iipdiro
(ganglisidos) no digerido.
(Tomadode Prinripcs de Riocliimie.
1 . . I.dininger, 1982).
Por su parte la peroxidasa tiene a su cargo la descomposicin del H,O,, una
sustancia potencialmente daina para la clula:

Los peroxisomas intervienen en procesos de detoxificacin, y en algunos tejidos


pneden participar en la degradacin de cidos grasos. En las plantas estos organelos
cumplen diversas funciones que incluyen procesos metablicos que permiten a sus
clulas convertir cidos grasos en glcidos, lo cual es imposible en las clulas animales.

Fig. 21.11. Peroxisomas vistos por medio


Relaciones del sistema de endomembranas
del microscopio electrnico.
Peroxisomas (P) Obsrvense lar Como se seal inicialmente el sistema de endomembranas se encuentra
zonas centrales de aspecto crirta- relacionado de maneras estructural y funcional; ejemplo de estas relaciones son
lino earaiteristieas de estos
nrganelos.
las que se establecen entre el retculo endoplasmtico y el aparato de Golgi, as
(Tomado de hlolecular Biology of como entre los peroxisomas y los lisosomas. Sin embargo, hoy da se atribuye
the rell. B. Alherts et al.. 19831. una funcin vital en las relaciones entre membranas y vesculas membranosas
que establecen conexiones no slo entre los organelos del sistema de
endomembranas, sino de stos con la propia membrana plasmtica; estas
vesculas constituiran verdaderas unidades para transportar componentes de
membranas y protenas especficas entre las diferentes membranas celulares.
Cuando las vesculas de secrecin se fusionan con la membrana plasmtica no
slo vierten su secrecin al exterior, sino que su membrana se integra a la plasmtica.
Tambin se ha observado que los componentes de estas vesculasson reciclados, de
modo que tambin se forman vesculas porinvaginacin de la membranaplasmtica,
las cuales se integran de nuevo al sistema de endomembranas; esto explica que no se
produce un crecimiento imitado de la membrana plasmtica en las clulas secretoras,
adems, tiene un sentido econmico dado por la reutilizacin de algunos
componentes de las propias vesculas secretoras. Relaciones similaresparecen estable-
cerse entre otros organelos membranosos, aunque el retculo endoplasmtico y el
aparato de Golgi se encuentran en el centro de estos vnculos.
Las vesculas transportadoras explican el crecimiento de otras membranas a
partir de la incorporacin de algunos componentes al retculo endoplasmtico. Con
frecuencia estas vesculas se observan envueltas por una capa de aspecto polidrico,
a las cualesseles hadenominado vesculas cubiertas, y el componente fundamental
de su envoltura es una protena denominada clatrna (fig.21.12). Probablemente la
formacin y separacin de la cubierta de clatrina guarde relacin con la orientacin
de estas vesculas hacia diferentes compartimientos celulares.
Adems de estas vesculas de transporte, en el interior de las clulas existe una
llamada protena transferidora de fosfolpidos,que traslada molculas de este tipo de
Ipidos entre diferentes organelos membranosos como pudieran ser el retculo
endoplasmtico y las mitocondrias. Sin dudas, el conocimiento sobre las
complejidades estructural y funcional del sistema de endomembranas se encuentra
en su inicio.
Fig. 21.12. Vesiculas cubiertas ohserradas
por medio del microscopio elec-
trnica. V&culas cubiertas (VC).
Estas estnicturas participan en el
Resumen
"trasiego" de distintos eomponen-
tes entre diferentes membranas de Las c6lulas eueariotas presentan en su interior un complejo sistema de mem-
las clulas. La cubierta de aspccto branas, las cuales componen un diverso coqjunto de organelos membranmm
polidrico est formada funda-
mentalmente por la proteina
intraeelulares.
clatrina.
fTomadu de Molecular Biology Of
the eell. B. Alberts ct al., 19831.
Los organelos membranow intracelularrs son: el reticulo endoplasmtico, el
aparato de Golgi, los lismmas, los peroxisomas, las mitoeondrias, la membrana
nuclear y los elomplastos.
Los cloroplsstos d o se encuentran en clulas que llevan a cabo el proceso de
fotosntesis, el resto est praente con mayor o menor desarrollo en la mayora de
las clulas eucariotas.
La estructura general de las endomembranasse correspondecon el modelo de
mosaico fluido, cada organelo membranoso se diferencia de los dems por las
composiciones tipdica y proteica de m membranas y el modo de organizarse
&as.
Las funciones generales que reazan los organelos membranasos son las si-
guientes:

-
2. Establecimiento de gradientes de concentracin.
3. Disponibilidad de reas de supercie.
4. Incremento de la velocidad de los procesos metabtim.
5. Generacin de nuevas membranas.

El retlculo endoplasmtico es el organelo membranoso ms extenso; sus fun-


ciones se relacionan con la sntesis de protenas que han de ser exportadas al exte-
rior de la clula, la modificacin estmctural de estas protenas y la sntesis de
tipidos. En algunas clulas tambin realiza funciones de detoxicacin.
En el retculo eudoplasmco se distinguen 2 porciones denominadas reticulos
endoplasmaticos liso y mgoso, cuya diferencia fundamental es la presencia de
ribosomas asociados a la superficie externa del segundo.
El aparato de Golgi es un centro procesador y distribuidor de macromolculas
en el interior de las clulas. Este aparato intervieneen la modificacin pastradufon
de numerosas protenas. Estas modificaciones son glimilaciones y modicaciones
de los oligosacridos unidos a las protenas, pmtelisis parcial, sulfatacin y adi-
cin de dcidos grasos.
El aparato de Golgi adopta una estructura peculiar formada por una serie de
sacos aplanados de superf~cielisa, cuyos coqjuntos se les denomina dictiosomas.
Los productos madurados en el aparato de Golgi salen al exterior de las clulas o
son distribuidos a otros compartimientos intracelulam a travs de vesculas de
transporte.
Los lisosomas constituyen centros de la digestin intracelular de numerosas
biomolcuias; ellos se caracterizan por poseer numerosas bidrolasas cuyo pH p-
timo se encuentra en la zona cida. Se originan en el aparato de Golgi en forma de
pequeas vesculas denominadas tisosomas primarios; estos lisosomas primarios,
por fusin con otras membranas, dan lugar a lisosomas secundarios de tipo
autofspicoo beterofgico segn el origen del material que se digiere en su interior.
La deficiencia hereditaria de enzimas lisosomales ocasiona diversas enfermeda-
des. Los peroxisomas son pequeos organelos membranosos en forma de vesculas
que suelen presentar en su interior un contenido de aspecto cristalino; debido a sus
h a s , intervienen en reacciones de oxidacin de diferentessustancias y, en espe-
cial, en la descomposicin del 50, el cual se forma en estas reacciones y puede
daino para la clula.
Todos los organelos membranosos intracelulam presentan relaciones estnic-
-ales y funcionalesentre s; estas relaciones pueden ser por connuidad Fsica de
membranas o, lo que es ms comn, por la comunicacin que se establece entre

Componentes celulares y Gedtica molecular 399


ellos y con la membrana p l d i i c a por medio de las vesculas de transporte.
'Igmbin una protena transferidora de fosfolpidos eontnbuye al intercambio de
componentes entre los diferentes organelos membranosos.

Ejercicios
1. Enumere todos los organelos intracelulares que estn formados por membranas.
2. Cul es la estructura general de las membranas que constituyen a los organelos
membranosos intracelulares? ;Cules caractersticas las distinguen?
3. Explique las funciones generales de los organelos membranosos.
4. Cules son las caractersticas estructurales y funcionales de las 2 porciones del
retculo endoplasmtico?
5. Explique cules son los mecanismos que intervienen en la unin de los ribosomas
con el retculo endoplasmtico rugoso.
6. Cul esla participacin del retculoendoplasmticoenla formacin de membra-
nas intracelulares?
7. Cules son las caractersticas estructurales y funcionales del aparato de Golgi?
8. :Mediante cul mecanismo los productos madurados en el aparato de Golgi alcan-
zan otras localizaciones?
9. Cules son las funciones generales de los lisosomas y cmo se asegurael cumpli-
miento de estas funciones?
10. Cules son las diferencias entre un lisosoma primario, un autofagosoma y un
-
heterofaeosoma?
11.Cules son las caractersticas estructurales y funcionales de los peroxisomas?
12. ;,Cmo se establecen las relaciones estructurales y funcionales entre los diferentes
organelos membranosos?
El citoplasma se consideraba una fasesoluble amorfa, y aunque desde hace un siglo
se plante por algunos investigadoresla presencia deesiructurastravecularesen &,estas
estrnctnmsediemn por artefactosh&qne,apohdamente2dca&ah;is,mmediante
tcnica$ especiales de microscopia electrnica, qued establecida la existencia de tal
esqueleto celular. Entonces hoy, citosol es el trmino ms usado para designar el medio
interno acuoso,donde se hallan losorganelos y las molculas disueltasintracelularmente,
lo que equivaldraa la antigua concepcin del citoplasma amorfo.
El citoesqneleto es una compleja red de filamentosy microhibulos que atraviesa
el citoplasma y determina la forma de cada clula, ascomo su organizacin estmctural
interna. Diversos tipos de movimientos celulares estn asociados con esta fina red
tridimensional de estructuras protenicas que conforman el citoesqueleto.
Los principales avances logradosen el conocimientode esta dinmica estructura
subcelular derivan de estudios realizados en msculos y en tejidos, cuyas clulas
presentan cilios o flagelos, los cuales poseen funciones evidentemente asociadas al
movimiento mecnico. Los componentes moleculares presentes en estas estructuras,
estn tambin en aqullas que conforman el citoesqueleto de todas las clulas. Los
filamentosy microtbnlos que participan en los movimientos del msculo y de los
cilios presentan propiedades muy semejantes a las observadas en el citoesqneleto,
pero difieren en estabilidad. Los movimientos del citoesqueleto son muy Ibiles y
cambiantes, mientras que los del msculo y delos cilios son ms estables.
En este captulo trataremos las caractersticasde los diferentes componentes del
citoesqneleto: los microfilamentos, los filamentos intermedios y los microtbnlos.
Para ello se estudiarnlas interacciones que algunas drogas mtablecen con algunos d e
sus componentes moleculares, las cuales han servido de insustituible instmmentopara
conocer su dinmica, y naturalmente se referirn las funcionesque se hallan asociadas
a estas organizaciones subcelulares.
Por ltimo se tratar de los grnulos bien definidos que permanecen en el interior
de algunos tipos de clulas especializadas y a los cuales se les conoce como inclusiones
citoplasmticas.

Citoplasma soluble
A la luz del microscopio ptico se denomin citoplasma al contenido delimitado
Por la membrana plasmtica; algunos distinguieron una zona perifrica que llamaron
exoplasma o plasmagel y una ms fluida en el interior,el endoplasma oplasmasol. No
hay dudas de que el endoplasmaes unafaseacuosa,peroeshidiosposteriores permitieron
descubrir la trama defamentos y microtbulosque le proporcionan una armazn, por
lo cual pas a la historia la idea del citoplasma como un contenido amorfo. Ello no
niega que, a pesar de la existencia de los organelos y el reconocido citoesqueleto, hay
un medio interno representado por el citosol. El trmino, surgido del fraccionamiento
celular por medio dela centrifugacin, se aplica a la fraccin soluble que se obtiene
despus de centrifugar un homogeneizado de tejido a elevadsimas velocidades. Este
citosol es particularmente abundante en las clulas poco diferenciadas; en ste se
hallan las proteinas y enzimas solubles de la matriz citoplasmtica, entre estas ltimas
se encuentran las de la gluclisis y las encargadas dela activacin delos aminocidos,
previo a la biosntesis de las protenas. Por supuesto que en esta fase acuosa tambin se
hallan los distintos metaholitos que intervienen en las transformaciones qumicas del
metabolismo intermediario.

Los microfilamentos son estructuras que resultan de la polimerizacin de un tipo


fundamental de protena: la actina;existen, por lo menos,6 tipos diferentes deactina
en las clulas delos vertebrados. Estas proteinas homlogas son codificadas por genes
diferentes, que determinan cadenas polipeptdicas con secuenciasy propiedades muy
semejantes. El lector debe remitirse al captulo 66 para profundizar en los aspectos de
estas protenas descubiertas y estudiadas en detalle en el tejido muscular.
Por debajo de la membrana plasmtica hay haces de filamentos que se continan
con una trama similar la cual atraviesa el citoplasma. ~stos'microfilamentosse
relacionan durante su recorrido con vesculas del retculo endoplasmtico, con
microtbulos y otros organitos (Fig. 22.1).

Fig. 22.1. Esquema de la trama del


citoesqueleto. Se representan los
microfilamentos, los microlbu.
los, la membrana y otras estructu
ras del citoplasma.
(Tomadode Prineipes de Biochimie.
AL. Ldininger, 1982).

Estos microfilamentos tienen una existencia muy dinmica, su polimerizacin y


despolimerizacin permiten los movimientos de los organelos del citoesqueleto. Los
microfilamentos de otras clulas que no sean las musculares son menos fciles de
localizar, tanto por su dinmica como por aparecer de ordinario menos agregados;
existen excepciones como el caso de las microvellosidades de las clulas intestinales
donde forman haces compactos (Fig. 22.2).
La actina globular o actina G, que se obtiene de los microfilamentos de las clulas
musculares, tiene un peso molecular de 41 000 D y se asncia a un Caz*y a una molcula
de ATP. El calcio contribuye a mantener la estructura globular de la molcula. La
funcin del ATPes curiosa, ya que la polimerizacin de la actina en la formacin de los
F i g . 22.1. Miciofot<igi-afids de clula5
c p i t c l l n l c \ del icitestina. Las i i i i ~
i r o v c l l w i d a d e r se iihscivaii coniii
exteiiiioiiss digiialer de l a inciii-
br;in;i p l i i s i n i r i c a . Ciidii i n i c i o -
vcllosidiid contiene aproximada-
~nieiitr40 iiiicrufilametitos.
(Tnnindo dz M o l r c i i l n i Biolngy o f
ihc c z i l B. Alberts ct al.. 1983).

filamentos es un proceso espontneo, pero resulta acelerado por la hidrlisis de aqul.


Los CTP, GTP y TTP pueden sustituir al ATP in virro sin afectar el proceso de
polimerizacin. Los microfilamentos o filamentos de actina, observados al microscopio
electrnico, presentan una doble hlice que se forma por la polimerizaciii de molculas
de esta protena con unas 13.5 molculas por vuelta (Fig. 22.3).
En estos estudios se Iia puesto de manifiesto que la velocidad de polimerizacin
no es constante. La formacin del ncleo de polimerizacin inicial es muy lenta y k
'

e
requiere de la participacin de otras protenas.
En el citoplasma existe una reserva de molculas de actina libre en equilibrio con -- .
la actina polimerizada (actina F) y este equilibrio depende del control de factores ,'
36 n m
celulares que permite la coordinacin de los movimientos; por ejemplo, uno de estos
factores es la protena profilina, la cual se une a la actina e interfiere con la
polimerizacin; se desconoce a travs de qu mecanismos reguladom se debilita esta
asociacin.
- 1
Cada molcula de profilina se une a una molcula de actina y de este modo
interfiere con la polimerizacin. Hay algunas evidencias aisladas que sugieren la
existencia d e mecanismos reguladores, los cuales inodulan la interaccin
actina-profilina, afortunadamente se establece un dispositivo de control capaz de
disparar una rpida polimerizacin.
La mayor parte del conocimiento acerca del equilibrio dinmico entre la , -

polimerizacin y la despolimerizacin de la actina, as coiiio de los movimientos en


10s que participan los microfilainentos, proviene de estudios realizados con un tipo de
Fig. 22.3. D i b u j o e s q u e i u i t i c o de u n fi-
drogas: las citocalasinas, obtenidas de algunas especies de moho (Fig. 22.4). ~a~iiciito dc iictinii. Se scfialan los
Estas sustancias interactan con las molculas de actina por uno de los extreinos 3h nin de loii$tud y las 13,) uiiib
del filamento e impiden su poliinerizaciii. Se ha comprobado que el uso de estas dades de a c l i i i i i que correspon-
d c n ii iiiia v u c l t i i de l a disposi-
drogas inhibe varios movimientos celulares, como la locomocin celular, la Iagocitosis,
c i n hclicoid;il eii 1;~ \iicssiii de
la citocinesis y otros. Sin embargo. ellas no interfieren la mitosis ni la contraccin iiioiiincroi.

C o m ~ n t e ~~~~s
s y -tia mIecPar 403
muscular, en la cual no intervienen la polimerizacin ni la despolimerizacin de
filamentos Ibiles.
Contrario a la accin de las citocalasinas,existeotrotipo de drogas del grupo de
los alcaloides: la faloidina, que estabiliza los filamentos de actina, de manera que
impide su desorganizacin; cuando esta sustancia se le inyecta a los protozoos,como
la ameba (la faloidinano atraviesa la membrana), impidelos movimientos ameboides.
Parece claro que la dinmica de la formacin y desagregacin de los microfilamentos
es esencial para la consecucin de los diferentes movimientos que dependen de estas
estructuras
Cabe destacar que tos famentos de actina son estnicturas que presentan polatidad,
es decir, que sus extremos son diferentes, porque sta es una propiedad que permite
explicar cmo ocurren algunos de los movimientos en los que ellos participan.
La afinidad de las molculas de actina para asociarse es diferenteen cada extremo.
La concentracincrticade actina brees aqulla a la cual la velocidad de incorporacin
es igual a la de disociacin del polmero. Parece que la hidrlisis del ATP provoca un
Fig. 22.4. Estructura qumica de la cambio conformacional, de manera que la concentracin crtica se hace menor en uno
ritoealasina B. de los extremos que en el otro; por tanto, en determinadas concentraciones intermedias,
el tilamento se puede mantener en un estado estacionario, segn el hecho de que las
molculas se separan predominantemente de un extremo (-) y se aaden de manera
predominante al otro (+). En el estado estacionario la velocidad neta de incorporacin
al extremo (+) es igual a la de desagregacin del extremo (-).La consecuencia deesto
(Fig. 22.5)es que la longitud del filamento permanece constante,perose va desplazando
en el espacio desde el extremo (-) al (+).

Fig. 22.5. Dlbiijo esquemtico que repre-


senta la pro~resinde un filames-
lo por la einticr polimeriza-
cin-despolimcr?zaein en extre-
mos apuestos. Los monmeros de
artina-G sc representan por un eo-
lor diferente. a) A partir de un ins-
tante arbitrario O. b) Se comienza
a alargar el extremo (+) en la mis-
ma medida que ls estructura de-
crece por el extremo (-). e ) Trans-
currido un intervalo determinado
se aprecia cn la figura el desplaza-
miento del filamento.

' desplazamiento'

Existen numerosos ejemplos donde la actina se polimeriza rpidamente; en los


seres humanos tenemos el caso de las plaquetas; cuando stas responden ante la lesin
de un vaso sanguneo se desarrollan mltiples prolongaciones finas que intervienen
en la formacin y contraccin del cogulo. Estas proyecciones contienen grandes
cantidades de iamentos que se han estnicturado a partir del pwlde actina G. Adems
de la profilina, ya mencionada, que une una buena proporcin de la actina
despolimerizada, otras protenas capaces de unirse a la actina se han descrito en la
mayora de las clulas de vertebrados e invertebrados.

Principales funciones de las microlamentos

Existen 2 tipos clsicos de movimientos celulares en que estas estructuras


constituyen la fuerza motriz: las corrientes citoplasmticas, conocidas como ciclosis,
y el movimiento ameboide, caracterstico de las amebas y de muchas clulas libres;
juntocon los demscomponentes del citoesqueleto contribuyenalas transformaciones
sol-gel que experimentanlas clulas. Los microfilamentos,mediante los mecanismos
de su dinmica que hemos estudiado, participan en las funciones de endocitosis y
exocitosis.

Son estructuras tubulares presentes en el citoplasma de las clulas eucariotas, se


distribuyen preferentemente alrededor del ncleo y aparecen en el microscopio
electrnicocomo si sus extremos se fijaran en la membrana o en formaciones cercanas
a ella.
Como los microfilamentos,los microtbulos son muy Ibiles, sobre todo los que
forman parte del citoesqueleto, pues los que se hallan en cilios y flagelos son ms
estables.
Los microtbulosson el resultado de la polimerizacin de un tipo fundamental de
protena globular: la tubnlina; esta protena constituye un dmero formado por 2
monmeros que presentan estructuras primarias muy semejantes y peso molecular de
55 000 cada uno. Se distinguen como alfa-tubulina y beta-tubulina.
Un alcaloide,la colchicina,se une al dmero de tubulina e inbibe su polimerizacin,
mientras que otra droga, el taxol, estabiliza la estructura de los microtbulos, ya que
favorece el proceso inverso.

Colchicina

El corte transversalde un microtbulo permite observar 13unidades dispuestasen


forma circular alrededor de un ejeimaginario central (Fig. 22.6), cada una de estas
unidades corresponde a un componente de los 13 protofilamentos que integran el
microtbulo.
En cada orotofilamentolas unidadesde alfav beta tubulinase alternan alo largo -
deste,de modo que cada subunidad queda entre 2 subunidades distintas; adems,
cuando se estudia la disposicin de los protofilamentosa lo largo del microtbulo, las
subunidadesalfa y beta se disponen en forma escalonada e integran un retculo regular
definido.
En la dinmica de la polimerizacin-despolimerizacinde los microtbulos
interviene el GTP. como lo baca el ATP en los filamentos de actina: ~articiaan2
molculasde GTPen la adicin de cada dmero, una deetlas est unida reversiblemente
Y se bidroliza de manera simultnea con el ensamblaje;la otra molcula de GTP se une
de forma irreversible y no es hidrolizada. Fig. 22.6. Organiraeiii molecular d e los
Los microtbulos tambin presentan polaridad y sus extremos se denotan por (+) niierotbulos. a) Dihu,ja esqueni-
tiro de uii mierotbirlo en vista
Y (-); ellos se van "ensamblando" desde los denominados centros organizadores, los luiigitudiiial. bl Microfatografa
cuales protegen su extremo (-) como si estuviera encapsulado, presumiblemente d e u n corte transversal d c u n
estableciendo interacciones con protenas especficas que inhibeo el crecimientode microtbule.
ese extremo. Este extremo encapsulado se encuentra en la regin adyacente al ncleo (Tomado d e Prineipes d e
Biochimie. AL. Lehninger, 1982).
(centrocelular o citocentro)durante la interfase y la mitosis.
A partir de estos sitios precisamente es que se iniciar la organizacin de los
microtbulos, razn por la que estos centros se denominan centrosorganizadores,los
cuales estn relacionados con los centrolos.
De estas interacciones depender tambin la unin de los microtbulos a los
componentes membranales y a algunas protenasenzimticasque antes se crean libres
en la fraccin solubledel citoplasma. Se han descrito 2 tipos principales de protenas
accesorias: las tau y las MAP (microtubulesassociatedproteins). Las primeras, de
peso molecular entre 60 y 70 mil, se enlazan a la tubulina e incrementan la
polimenzacin. Las MAP de peso molecular entre 200 y 300 mil parecen poseer 2
dominios, uno se enlaza al microtbulo, mientras que el otro queda libre y puede estar
involucrado en la unin a otros componentes celulares: las mejores conocidas son la
dinena y lanexina. Para lacomprensin del sentidode algunas de estasinteracciones,
es preciso antes esbozar las principales funciones en que intervienen los microhbulos.

F'rinapales funciones de IOB micmtibuios

La adopcin de las formas caractersticas de algunos tipos celulares, as como de


sus prolongaciones tienen que ver con la orientacin y distribucin delos microhbulos.
Los axones de las clulas nerviosas son un ejemplo tpico de esta funcin.
Numerosos cambios que tienen lugar en la morfognesisestn relacionados con la
fundnmecnica delos microtbulos. La induccin de la placoda en la diferenciacin
del cristalino se acompaa de la aparicin de numerosos microhbulos, por citar solo
un caso.
Todas las clulas eucariotastienen una geometra es~acialdistintiva. dada nor la
u

posicin de sus organelos; esta polaridad celular depende de la integridad de los


microtbulos. Cuando son destruidos, el desplazamiento celular se torna azaroso y
pierde su carcter direccional.
No cabe duda que los microhbulos se pueden constituir en una especie de sistema
de transporte interno, lo que permitira la circulacin de macromolculas, al delimitar
\
canales en el citoolasma.
Se conoce que en algunos receptores sensoriales se hallan presentes conjuntos de
microtbulos,lo cual presume que intervengan de alguna manera en la transduccin
de diferentes formasde energa en esos neurorreceptores.
En el captulo 23 se expone la participacin en la mitosis de los microtbulos.
Por ltimo, los cilios,flagelos y centrolos son derivados de los microtbulos.
De todo lo dicho, se comprende que los microtbulos intervienen en muchos
movimientos celulares guiando algunas corrientes citoplasmticas, que pueden
transportar grnulos de secrecin hacia la superficie celular, donde descargan su
contenido por exocitosis: movimientos que agrupan en un polo de la clula a las
protenas integrales de la membrana plasmtica; movimiento de los cromosomas
durante la divisin celular y otros.
Se considera como muy probable la intervencin directa de los microtbulos en la
generacin de fuerzas en el caso de los movimientos ciliares o flagelares; estos
movimientos provocan un desplazamiento del lquido extracelular respecto a las
clulas, si ellas estn fijadas, o de la propia clula, si es libre y suficientementepequea.

Filamentos intermedias
Si bien los 2 tipos ms importantes de componentes del citoesqueleto son los
microfilamentos y los microtbulos, caracterizadospor su dinmica labidad, existe
otro tipo de filamento, de dimetrointermedio entre aqullos y que resulta ser mucho
ms estable. Esta propiedad sedebe aquesus constiiuyentesmolecularessonprotenas
de naturaleza fibrosa y no globular, que los hace muy resistentes a la extraccin con
soluciones de variadas concentraciones salinas y con detergentes no inicos; sin
embargo, esta insolubilidad hace posible su observacin microscpica mucho ms
fcil que la de los restantes componentes del citoesqueleto.En la figura 22.7se presentan
microfotografas correspondientes a 2 tipos celulares diferentes.
Los filamentos intermedios tienen una disposicin que tambin parece partir del
centro de la clula, pero con recorridos menos sinuosos; se hallan relacionados con las
zonas de las clulas que estn bajo grandes tensiones.
Varios tipos de protenas estn presentes en los filamentos intermedios, tienen
pesos moleculares que varan de 40 000 a 200 000 D y se polimerizan sin dar lugar a
estructuras tan regulares como las de los microtbulos y microfilamentos; el nmero
de estas protenas fibrosas vara segn el tipo de clula y la especie.
Cada lamento parece presentar un hmero como unidad de polimerizacin,aunque
ello no est confirmado, y todava los factores que controlan estas estructuras y sus
funciones son objeto de especulacin. Lo que sise puede afirmar es que cada tipo de
clula presenta filamentos intermedios caractersticos, que estn constituidos por
~rotenasdiferentes que se asocian; ejemplo de ello son los filamentos de queratina en
las clulas epiteliales, los de vimentina en los fibroblastos y los neurofilamentos de las
neuronas.
precisa mente,^^ diversidad hacemucho msdificil su estudio y el desus protenas
constituyentes.Laasociacinde estas protenasfibrw parece presentar caractersticas
estructurales semejantes a la de la colgena (captulo 68).
Deacuerdo con lo expresado se comprende que lapolimerizacin de los filamentos
intermedios, hasta el momento, parece ser un proceso irreversible; de ello no deben
deducirse que el nmero, tamao y disposicin de estas estructuras han de mantenerse
constantes a lolargo de toda la vida celular. Se han descubierto enzimas proteolticas
que degradan especficamente un tipo u otro de filamentos intermedios, y se desconoce Fig. 22.7. MicrofotograBas de filanientos
cmo es regulada la actividad de estas enzimas NI vivo; in vitro, muchas de ellas son interrncdios. a) Por tcnicas de
activadas por el Caz'; lo cierto es que la nica forma conocida en que pueden ser inmuiionuoreseeneia se visualizan
filamentos intermedias de
desagregados los filamentos de esta clase es, mediante la hidrlisis de sus protenas, en
vimeiitina. h) Neurafilamentas
pptidos ms pequeos. presentes en un sector de
En tanto no se demuestre lo contrario, la funcin de los filamentos intermedios axoplasnia cn el axn gigante de
parece restringida a soporte mecnicode la estructura celular. una lombriz marina.
('hmsdo de Molecular Biolagy of
the cell. B. Albere et al., 1983).

Se denominan inclusiones a las estructuras que existen en el citoplasma, y no son


ms que verdaderos almacenesde sustancias especficasque se hallan disponibles para
ser utilizadas en la clula o por el organismo. Estas sustancias incluyen desde
compuestos de reserva energtica -como la grasa y el glucgeno- hasta elementos
simples -como el hierro y pigmentos como la melanina.

Glbulos de grasa

E s t a inclusiones se encuentran en las clulas del tejido adiposo de losmamferos,


son cmulos de Ipidos del tipo de los triacilgliceroles (captulo 13). Ellos son una
reserva de energa muy eficiente, debido al elevado contenido calrico que posee esta
clase de Ipidos; en los adipocitos pueden llegar a ocupar ms del 90 % del volumen
celular (Fig. 22.8).
No obstante, estas inclusiones aparecen en otras clulas del organismo, como las
musculares y en los hepatocitos; en estos ltimos pueden acumularse excesivamentey
causar dao heptico bajo determinadas circunstancias, es el denominado hgado
graso que en algunos casos puede evolucionar hacia la cirrosis heptica. En la figura
22.9aparece una niicrofotografia electrnica de un adipocito.
Fig. 22.8. Mierofotagrafia de un adipocito.
Se observa el citoplwma reducido
a un fino borde perifrico y el
ncleo prominente, desplazados
por un gran glhulo de grasa.
(Tomado de Bioqumiea. L. Stryer.
Segunda edicin, 1982).

Fig. 22.9. Mirrofotografia de barrido de un


adipoeita.
(Tomada de Bioqumiea. L. Stryer.
Segunda edicin, 1982).

El glucgeno es un polisacrido formado por unidades de glucosa, lo que le


permite constitnir,igual que los triacilgliceroles,una reserva energtica para la clula
o el organismo (captulo 10). Los grnulos de glucgeno ofrecen un aspecto bien
- -
denso en las microfotografias (Fiz.
, 22.10).
En el grnulo, adems se encuentran las enzimas que participan en las sntesis y
degradacin del polisacrido, y otro conjunto de enzimas que tienen una funcin
reguladora del metabolismo del glucgeno. Tanto el peso molecular del glucgeno,
como la proporcin en que se hallan las protenas enzimticas en el grnulo, son
variables, de modo que estas inclusiones poseen dimetros que van desde los 1000 a
los 4 000 nm.

408
Monocapa de enzimas especficas
que recubren la molcula de glucgeno

Fig. 22.10, Microfotagrafia dc los grnulos de glucgeno. a) Las inclusiones citaplssmtieas, en este
casa grnulos de glucgena, sc ubscrvan corno mltiplrs zonas densamente oscurecidas. h)
Kepresentacih csqueiiiitira de un grnulo de glucgcno.
(Tomado de Molceular Binlogy af the ccll. B. Alherts et al., 1983).

Resumen
La fase soluble que se obtiene como sobrenadante en una centrifugacin de
muy elevada velocidad se conoce como citosol. Las tenicas avanzadas de
micmsmpia electrnica no niegan que el medio interno celular, donde se encuen-
tran los organelos y el citoesqueleto,se halla baado por una fase acuosa, el citosol.
En ste se encuentran disueltos metabolitos, protenas y enzimas solubles. El
dtoesqueleto es una compleja red de lamentos y microtbulos que atraviesan el
dto~lasma . -
,v determina la forma celular. ascomo la oreanizaa6n del hialonlasma
Los microlamentosson el resultadode la polimerizacin de monmeros de la
-
protena acna, una de las 2 protenas fuodamentales que participan en la propie
dad conrcl de Las fibras muxulares. Estos pomeros, en el caso de los lamen-
tos del citoesqueleto de una clula cualquiera, se agregan y despolimerizan de
forma continua, lo cual les confere una dinmica en su loealizaci6n, iamaio y
estabidad, adems, les permite intervenir en funciones relacionadas con algunos
movimientos celulares.
Eata dinmica y su importancia en algunas propiedades celulareshan podido
ser estudiadas con la ayuda de drogas que, como la citocalasina, impiden la
polimerizaci6n de las molculas de actina. La profia es una protena que pareee
tener una funci6n parecida en el control fisiol6gico del equilibrio
polimerizacin-despolimerizaci6nde los microfilamentos.
Si se interfiere la mecnica normal de los microlamentns se impide la loco-
moci6n wlular, la f a g d h i s , la citocinesis y el desarroiio de las digitaciones que
ocurre en la respuesta fiiol6gica de las plaquetas, entre otros procesos.
Los micmtbulos poseen una dinmica similar, pero estn constituidos de otra
pmteiaa, la tubuna
Las 2 estnictur~scitadas presentan polaridad y generalmente en un extremo
Predomina la desagregacin de los monmeros, y en el opuesto la polimerizacin,
m c t e r s o c a que hace posible la movilidad de ambos.
Los mkmtbulos del citoesqueleto tienen una dimmica semejante a la de los
microlamentos, pero como los pdaeros estables de acna se hallaron en los
msculos, existen tambin micmtbulos ms duraderos y menos cambiantes en los
d i o s y melos.
Los mieroffibulos se originan de ordinario en regiones adyacentes al niideo
celular, denominadas centros organizadores, stos estn relacionados con los
centrfolos.
Las protenas accesorias establecen nexos entre las molculas de tubulina y de
stas con otros componentes celulares.
Los microtbulos son determinantes en la especioadad de la forma de los
diferentes tipos de clulas, intervienen en la morfognesis,en la formacin del huso
mittico, confieren polaridad a las c6lulas que la poseen, parece que desempean
una funcin en algunos nenmrreeeptores y, por mipuesto, forman parte importante
del sistema eirnilatorio intraeelular.
Por Ultimo, los filamentos intermedios los forman diferentes protenas en las
disntas clulas: y son ms estables que los mimamentos y microhbulos. Tam-
bin se diferencian de aquJlos en que Las protenas que los integran son fibmsas en
vez de globulares. Su diversidad ha hecho ms d i d el estudio y comprensin de
sns estnictnras y funciones: en las clulas epitealesexisten filamentosde querana;
en los fibmblastos y la mayora de otras clulas suele estar presente la vimentina,
entre las protenas componentes de los filamentos intermedios.
Se presume que estos filamentos se destniyan por pmtelisis y se han aislado
enzimas especicas para sns diversas proteias constituyentes.
Las 3 estructnras esindiadas conforman el citoesqueleto, que como su nombre
indica constiuye el soporte meesnico del coqjunto de la arquitectura celular.
Las inclusiones citoplasmticasson acumulaciones de sustancias que se alma-
cenan durante algn tiempo en la clula Los exponentes ms comunes son los
glbulos de grasa y los grnulos de glucgeno, ambos tienen funcin de reserva
energ6tica para la clula o el organismo.

Ejercicios
1.Realice una comparacin entre las protenas que integran los microfilamentosy los
microthulos.
2. Qu caractersticaespecial presentan las protenas de los filamentosintermedios
que no la poseen las de los microfilamentosy microtbulos?
3. Cul es el sentido del gran dinamismo que presentan las estructuras polimricas
fundamentalesdel citoesqueleto?
4. Trate de deslindar las funciones de los microfilamentos, los microtbulos y los
filamentos intermedios que les son propias y las que lesson comunes a los3.
5. La divisin celular no se afecta por la droga citocalasina,pero s por la colchicina.
Qu conclusin puede usted inferir en cuanto a las estructuras del citoesqueleto
que intervienen en la mitosis y las que no lo hacen?
6. De acuerdo con lo estudiado en el captulo 18 y en ste, jcree usted que los
grnulos de glucgeno constituyen sistemas multienzimticos?
7. ;,Son los glbulos de grasa inclusiones exclusivas del adipocito?
La diferenciafundamentalentre las clulas procariotas y eucariotas es la presencia
en estas ltimas de la envoltura nuclear que separa al ADN; tambin existen diferen-
cias entre los procesos relacionados con el ADN y los procesos que ocurren en el
citoplasma. En las clulas procariotas, la sntesis de ARN (transcripcin)y la sntesis
de protena (traduccin)se llevan a cabo casi de manera simultnea,sin haberse sepa-
rados an los ARNm del ADN. La aparicin, durante el proceso evolutivo,de la envol-
turanuclear posibilit la separacin entre los procesos de transcripcin y traduccin,
lo que permiti el desarrollo de ambos.
En este captulo describiremoslas diferentesestructuras del ncleo: la envoltura
nuclear, el nuclolo, la cromatina-cromosomasy el jugo nuclear, adems, haremos
referencia a la relacin entre estas estructuras y su funcin.
El estudio del ncleo celular constituye un ejemplo fehaciente del principio de
laoiganizacinde las macromolculas, ya que podemos observar duranteel desarrouo
de la mitosis cmo diferentes estructuras nucleares desaparecen bajo determinados
mecanismos de regulacin, no del todo conocidos, y vuelven a formarse, entre otras
causas, por el mnocimiento molecular entre suscomponentes.La propiedad del m n e
cimientomolecularligado a lasdiferentesestruchuas fuetratada en el captulo9.
Cuando la clula se encuentra en interfase podemos ver todas las estructuras
nucleares: el material gentico se encuentra estructurado en forma de cromatina, la
envoltura nuclear est presente y podemos observar al menos un nuclolo. Cuando en
la clula comienza la divisin mittica, ocurren cambios que conducen a la desapari-
cin de la envoltura nuclear, a la conversin de la cromatina en cromosomas y a la
desaparicin del nuclolo. Una vez terminada la separacin del material gentico
en 2 partes iguales, entre lasclulas hijas, se producen loscambios que le devuelven
a la clula la estructnra que tena en la interfase.

Componentes estmcturaies del ~IWX


Podemos dividir al ncleo en los componentesestructuralessiguientes(Fig. 23.1):

l.Envoltura nuclear.
2. CromaOna
3. Nuclolo.
4. Nncleoplasma o jugo nuclear.
Fig. 23.1. Componentes del ncleo. a) La
membrana nuclear. (b) El nuelolo.
(e) La eromatina. (d) El
nueleoplasma (a carialinfa). Se
observan ambas membranas de la
envallura nuclear y los ribosomas
unidos a la membrana externa;
tambin se observan (e) Las poros
de la membrana.

Envoltura nudear

La envolturanuclear es lo que fundamentalmentedistinguea la clula como organis-


moeucarionte, puesto que los pmcariontesnola tienen. La aparicin de estecomponente
celular introdujo cambios celdares como la separacinde la clula en 2 comparimwntos:
el citoplasma y el ncleo. Esto result ventajoso al limitar el paso de sustancias entre
ambas compartimentosy, por ende,pudiemn evolucionar mecanismosde regulacin; as
como suceder el paso de sustancia entre ambos espacios celulares. La aparicin de la
membrana tambin permiti que evoluaonarala organizacinestruciwalde los ADN en
el ncieo, y quesedes~17ollarantambin los mecanismos desntesis del ADN y ARN, as
como las de sus resnectiv~~~remilaciones.

~ ~~

.~~~~
. ~ ~~~~

que unenlos gpaciosintranuclear(nucleoplasma)y ciioPlasntim


~

m.
23.1).A &delos
p o m slo pueden pasardetenninadoscompuestos,tienen paso selectiva
Si observamos una de las 2 cara de la membrana, notamw que los poros presentan
una distribucih hexagonal (Fig. 232); stos constituyen del 10 al 36 % del rea total
de la membrana, y hay entre 40 y 145poros por micrmeiro cuadrado.
Poros

P m m

Fig. 23.2. Disposicin de los poros. Tienen


una disposicin hexagonal y en el
micrmetro representada hay 45
poros que ocupan aproximada-
mente el 10 % de esta brea.
Cada una de las membranas que forman la envoltura nuclear tiene estructura
semejantea la membrana descrita en el captulo 20, sin embargo,cadauna tiene sus
particularidades. Delas 2 membranas, la que est en contacto con el citoplasma es una
continuacinde las membranas del retculo endoplasmticomgoso; sus composicio-
nes lipdica y protenicason casi las mismas, y contiene las protenas que intervienen
en el reconocimiento de los ribosomas y del pptido seal, por Lo que se observan al
microscopio electrnicolos ribosomas funcionalesadosados a ella.
La membrana interna que est en contacto con el jugo nuclear tiene adosado a su
cara nuclear un "emjado" de protenas, Uamado Iminanuciear,oiganizacinpmtenica
especial formada por 2 protenas diferentes (lamininasA y B), que parecen intervenir
en los mecanismos de desagregaciny reagregacin de laenvoltura nuclear durante la
mitosis, y que, a su vez, se regulan por modificacin covalente (fosfo-
nlacin-desfosforilacin).Por una parte, esta lmina se une a la cara nuclear de la
membrana interna de la envoltura nuclear, y por otra parte, se relaciona en algunos
puntos con la cromatina, que une a sta con la membrana (Fig. 23.3).

Membrana interna de la
membrana nuclear

- Cromatina

Fig. 23.3. Protenas de la lmina nuclear. Una


de eUas se ssoeia ntimamente a la
membrana y otra a la emmatina.
Protenas de la Imina nuclear

Los poros pueden observarse muy bien en una fotograa al microscopio electrni-
co;parecen ser canales abiertosqueconectan ambos compariimentos,estn bordeados
por protenas especiales, tanto por su superficie citoplasmtica como nuclear y el
propio conductoparece estar ocupado por ellas.

Camplejo del poro nuclear

Ocupando y formando el canal se encuentra el complejo del poro nuclear, que


tiene un peso de partcula de 125megadalton; est formado por aproximadamente100
polipptidos diferentes que reciben el nombre de nucleoporinas. Muchas de las
nucleoporinastienen unidas de forma covalente molculas de N-acetil glucosamina,
adems, poseen pequeas secuenciasde aminocidos (degeneradasy repetidas) como
fen-X-fen-gli.
An no se conocen todos los detalles de la estmctura de este complejo. Dos aros,
formadoscada uno por 8 subunidades(aproximadamente20 protenas porcada una),
bordean el poro porcada ladode la envoltura nudear,uno por la cara nuclear y otro por
la citoplasmtica; lo que queda entre los aros, llamado cintura, se une al espesor de la Fig. 23.4. Complejo del poro nuclear. (a) El
membrana donde se funden las membranas externa e interna de la envoltura nuclear. anillo de la cara citoplasmea for-
Hacia la superficie citoplasmtica, y partiendo de cada una de las subunidades, se mada por las S subunidades. (b) la
encuentran fdamentos; a veces estos filamentosson continuacin de los filamentosde cintura. (e) La envoltura nuclear y
los POms vecinos. Por la cara nuclear del poro tambin parten filamentos,pero stos el espacio perinuclear. (d) Filamen
tos de la cara citopasm8tica. (e)
f ~ r m a como
n una cesta de baloncesto (Fig. 23.4). Filamentos de la cara nuclear, far-
Por el poro pasan molculas del ncleo hacia el citoplasma, y viceversa. El dime- mando una estructura parecida a
tro del poro es de 80 nm, sin el complejo nuclear, y con ste es de 9 nm; sin embargo, un cesto. (0Tapn de proteinas
Por el poro pasan partculas de ms del doble de este dimetro, mediante la difusin que ocupan el canal.
simple, ejemplo de este paso son las molculas protenicas pequeas: el citocromo c
(13 kD) difunde Libremente, la ovalbmina (43 kD) demora en pasar y la seralbmina
bovina (66 kD) no pasa. Ms all de este tamao el paso se realiza por transporte
activo: requiere energa, depende de seales y tiene saturabilidad. Por este tipo de
transporte pueden pasar partculas basta de 25 nm dedimetro.
Las seales dependen de secuencias de aminocidos que pueden estar repetidas;
existen seales para las sustancias que entran, seales diferentes para las que salen y
otras para las sustancias que entran y salen rpido. Una seal bien conocida para la
salida es la estructura CAP de los ARN transcriptos primarios (captulo 271, que se une
alas protenas de transporte.
Uno de los mecanismos descritos utiliza al menos 2 protenas para la salida de
algunos ARN, una de ellas se une a protenas del complejo del poro, la segunda se une
a aqulla y al ARN que va a pasar (Fig. 23.5).

I Fig 23.5. Mecanismo de transporte a travs


del iiom nuclear. (a) Se observa el
complejo del pom nuclear. (b! Las Lado nuclear
envoltura y espacia perinuclear
(c). El ARN que ser transportado
se une a Is protena de transporte
(0,que a su vez es reconocida por (b)
una secunda ~rotensde transpor-
te (g). (d) El complejo se une a los
filamentos nucleares, se desliza con
-easto de enereia a travs del canal,
y se libera del lado citoplasmtico
lu-o de desprenderse de los fila-
me& del otro lado (0.

Por el poro deben pasar al interior las protehassintetizadas en el citoplasma,que


se requieren para la sntesis de los ADN y ARN, y para el resto de los procesos que
o e m n en el ncleo; por ejemp10,las bistonas quese requierenal formarsela cromatina,
durante la sntesis de ADN, provienen del citoplasma (por cada poro entran 106mol-
culas de historias en un minuto).
Adems de actuar como paso selectivo de sustancias, otra de las funciones del
poro es servir como tampnde volumen, pues por el corrimientoentre las membranas
internas externa de la envoltura nuclear, el ncleo puede aumentar o disminuir de

Fig. 23.6. Cambios de volumen del ncleo.


Se produce a expensas del corri-
miento de sus membranas: interna
(ami! y extersa (roja).
En el nnclolo ocurre la sntesis de los ARNr de 5,s; 18 y 28 S; adems se lleva a
cabo el "ensamblaje" de stos con protenas ribosomales, formando las subunidades
de los ribosomas.
Los nuclolos se encuentran localizados en algunas porciones del genoma, los
llamados organizadores nucleolares, que contienen la informacin para la sntesis de
los ARNr. Durante la interfase, estas porciones del genoma se encuentran desenrolla-
das y localizadas en un sitio del ncleo sobre ellas y de forma ininterrumpida se
produce la transcripcin de estos genes. Conocemosque los ribosomas de eucanontes
poseen diferentes clases de ARN, y que su sntesis trae como resultado, no slo la
transcripcin, sino tambin el procesamiento de los transcriptos primarios que final-
mentequedan transformadosen los ARN definitivos (captulo 32). En esta porcin del
ncleo, donde se transcribe la informacin de los transcriptos primarios del ARNr,
tambin ocurre parte de laorganizacin snpramacromolecnlar de los ribosomas (agre-
gados de ARNr y protenas de diverso tipo).
Las protenas que forman parte de los ribosomas se sintetizan en el citoplasma,
pero pasan por los poros al ncleo y all, de acuerdo con un determinado orden, y
debido al reconocimiento molecular, se van agregando en partculas cada vez mayores
y ms complejas para conformar las 2 subunidades ribosomales (captulo 81).
De tal forma se van conformando los ribosomas en el nuclolo, que si se hiciera un
corte del nuclolo se vera como hacia sus porciones centrales se encuentran los trans-
criptos primarios en proceso de sntesis; a medida que avanzamos hacia la superficie se
observan los ARN ribosomales acoplndose con las protenas ribosomales, y en las
capas ms externa veremos partculas completas o casi completas (Fig. 23.7). Debido a
esta distribucin funcional, se pueden distinguir en la estructura de este organelo 2
porciones: una central, fibrilar, donde ocurre la transcripcin, directamente en las
cadenas del ADN, y otra perifrica, granular, donde ocurre el "ensamblaje" de las
unidades de nucleoprotenas del ribosoma.
En los ncleos diploides existe el doble de organizadores nucleares que en las
clulas haploides.

Fig. 23.7. Una seccin del nuilalo. En la


porcin central se observa la trans-
cripcin de los transeriptas prima-
rios de los RNA ribosomales (ro-
jos); las ADN en azul. A medida
que se avanza al exterior se pro-
duce la maduracin de aqullos, y
su unin con las protenas
ribosomales (verde). Ya en el bor-
de se observan algunas partculas
ribosomales mayores y menores.

Este componente nuclear es una continuacin del citoplasma; contiene, como


este ltimo. un citoesaneleto -el carioesaneleto- v en los esuacios de la trama se en-
cuentran suluhilizado* t ~ d 10%~ scomponentes requwidns cn la sntesis !.p n w s a -
miento de los .ADN, de los ARN y de tudas aquellas reacciones que ocurren en 1.1
ncleo: las enzimas, los snstratos, los cofactores y los productos.
Par cmmatina-cromosoma
El par cromatina-cromosomarepresenta las 2 formas de organizacin del material
gentico; ambas se caracterizanpor la diferentedisposicin estnictural de La dmxirribo-
nucleoorotena en distintas etauas del ciclo celular. La cromatina es la forma de orga-
-
nizacin un tanto desenrollada de este tipo de supramacromolcula,se encuentra en el
ncleo en interfase y se transcribe deforma continua. El cromosoma es su forma de
organizacin compacta durante la fase de mitosis, y en esta forma de organizacin no
se transcribe. Se describir primero la estructura de la cromatina, que es la menos
compacta.

Cromah

I:n i I iapitulo II,dmdt*sedeicrihii, Iaeslrurturadr loa Jcido5 nuileicus,cnnu-


cimos de la estructura sivund~riadel.\L).esp~citicanirnte. la del mwJrlod' \\ alson
y Crick.
Cuando el ncleo est en interfase, el ADN se encuentra organizado fo,mando
complejos supramacromoleculares con protenas bsicas llamadas histonas. Esta es la
cromatina, que al observarla al microscopio electrnico parece conformada como un
collar, cuyas cuentas se encuentran algo separadas entre s (Fig. 23.8). Estas cuentas
estn formadas por los nucleosomas, y las porciones entre las cuentas estn formadas
por la estructura del ADN de doble banda.
El nucleosoma est formado por el ADN de doble banda, enrollado sobre un
octmero de protenas bsicas, lashistonas. Estas protenas estn muy conservadas
Fig. 23.8. La eslructura de la rromatina. Se (casi no hay diferencia entrelas del frijol y las de la vaca), y hay 5 tipos diferentes. Se
observan los nucleosomas como
cuentas de un collar (aclmero de
diferencian, entre otras cosas, en su peso molecular y su contenido de aminocidos
Iiistonas, enrolladas por el ADN) bsicos. Adems, estas protenas estn muy modificadas, pues presentan metilaciones,
y separadas par el ADN espaciadar. fosforilaciones y adenilaciones.

Tipo de histona Y % % Y H 4
Peso molecular (kD) 21 14,s 13,7 15,3 11,3
Relacin lidarg 20 1,2 2,s 0,7 0,s

El octmero est formado por (H,),(H,,),(H,),I,)2, tiene 110 nm de largo por 55


nm de ancho; en el centro del octmero se encuentra el tetrmero (H,),(H,), y a cada
lado de ste se encuentran los dmeros (H,JH,,). El ADN se enrolla 1213 veces sobre
el octmero; esta porcin enrollada se corresponde con 146pb (Fig. 23.9a).
La porcin de ADN que queda entre 2 nucleosomas adyacentes vara en longitud,
puede ser entre 8 y 114 pb (promedio 55 pb); a esta porcin del ADN se le llama
espaciador. La H, parece quedar unida a los 2 extremos de la porcin enrollada del
ADN sobre el nucleosoma (el extremo que comienza el enrollamiento y el que lo
termina)? la H, queda en el espacio entre ellos (Fig. 23.9b). La H, contribuye al
aempaquetamiento, posterior de la cromatina al formarse el solenoide.
La organizacin de los nucleosomasen la cromatina no es siempre la misma, vana
en los genes activos donde se produce el desenrollamiento del ADN.
Durante la replicacin deben formarse nucleosomas nuevos mientras se duplica el
ADN. Parece que los nucleosomas viejos a veces quedan en una banda, y otras veces en
la otra banda; en la formacin de los nuevos nucleosomas, adems de las histonas y el
ADN, intervienen la nucleoplasmina y la topoisomerasa 1(captulo 25). La primera es
una protena chaperona que pone en contacto al ADN con las histonas, e impide
Fig. 23.9. Estructura del nueleosoma. (al asociaciones errneas. La topoisomerasa 1 es necesaria para proporcionar el nivel re-
En el esquema que representa la querido de superenrollado al ADN sobre el octmero.
estmctura dcl nucleosoma, se ob-
servan las8 histonas; sta7 re apre-
cian separadas para mostrar la re-
lacin entre ellas y con el ADN
que las rodea. (b) Se observa la
relacin que mantiene la histana 1 En la formacin del cromosoma,la cadena de nucieosomas se enrolla y forma una
con el nueleasoma. f?stNctura en solenoide. En la figura 23.10 se puede observar cmose va compactandn
la cromatina hasta la formacin del cromosoma. Cada cromosoma est formado por
una molcula de ADN, y como ejemplo de este "empaquetamiento" podemos referir-
nos al cromosoma del primer par humano (ver los pares humanos en el cariotipo). Este
ADN se compacta unas 7 000 veces, cuando se encuentra desenrollado tiene una
longitud de 7J cm y compactado en el cromosoma su largo es de 10 pm.

Cromosomas: Forma y tamGo


Existen mtodos que permiten de forma experimental,en el laboratorio, fotogra-
fiar todos los cromosomas que pertenecen a una misma clula. Como todas las clulas
-
de un mismo organismo (en la es~ecieanimal o vegetal) tienen igual dotacin gentica,
se puede tomar para este estudio cualquier clula de cualquie; tejido;
este estudio se lleva a cabo en los leucocitos. Una fotografa ampliada de los cromosomas
en mitosis nos muestra que todos los cromosomas no son iguales y que difieren en su
tamao y forma
Podemos distinguir en cada cromosoma estructuras caractersticas. En la figura
23.11 hemos esquematizadoun cromosoma tpico, se observa que est formadopor 4
brazos (largos o cortos), que se unen al centrmero. A veces los brazos presentan
constricciones, y cmo a la constriccin que se forma al nivel del centrmero se le
Uama primaria, a stas que se forman en los brazos se les Uaman secundarias. Al peque-
ofragmento de brazo que queda terminal a la constriccin secundariasele denomina
satlite (Fig. 23.11).

Fig. 23.10. La erornatina al eompaetarse


forma los cromosamas. (a) La
eromatina se compacta en una fi-
gura que recuerda un solenoide.
(b) El solenoide parece compac-
tarse an ms en lazos muy uni-
dos. (e) Un enrollamiento mayor
pudiera formar el cromosoma.

Fig. 23.11. Partes de un cromosoma. Se repraentan 2 cromosomas, en ellos podemos observar las
partes que lo forman: (a) Brazos. (b) Centrmero (constriccin primaria). (c) Constriccin
secundaria. (d) Satlite.

Si de la fotomafa ampliada recortamos cada cromosoma y luego los ordenamos


segn su tamao,de may& a menor sobre un papel, observaremos que siemprenbten-
dremos la misma distribucin de los cromosomas paracada especie; a esta distribucin
caracterstica se le ha llamado cariotipo.

Canotipo humano normal


Cada especie animal posee un nmero constante de cromosomas: el hombre posee
46 (23 pares incluyendo el sexual), el gato 38, el maz 20 y la Escherichia colipnsee
1. Para el hombre el cariotipo normal se compone de 7 tipos de cromosomas que
difieren por su tamao y la posicin del centrmero,como caractersticasms relevan-
tes (Fig. 23.12).

Gmpo A: metacntricos (1,2 y 3), tienen los brazos del mismo largo.
Gmpo B: submetacntricos(4 y S), sus brazos tienen tamaos diferentes.
Grupo C: submetacntricos(6,7,8,9,10,11,12 y X), iguales al grupo anterior,
pero de menor tamao.
Gmpo D: acrocntricos con satlite (13,14 y 15), uno de sus pares de brazos
son muy cortos.
Gmpo E: metacntricosy submetacntricos(16,17 y 181,de menor tamaio.
Gmpo F: metacntricos (19 y 20), de menor tamao.
Gmpo G: acrocntricosconsatlites y sin ellos (21,22 y Y),de menor tamao.
Fig. 23.12. Cariotipo humano normal.
Grupo A: Metacntricos.
Grupo B: Submetacntricos.
Grupa C: Submetacntricos.
Grupa D: Aeroentrieos con satlite.
Gnrpo E: Metacntricos y submetacntricos.
Grupo F: Metacntricos.
Grupo G: Aeroentrieos con satlite y sin l.
(Tornado de Molecular Biology
of the cell. B. Albe- el al., 1983).

Al estudiar el cariotipo se tienen en cuenta el tipo de cromosoma, su tamao


relativo y la posicin del centrmero; se determinan el sexo y las alteraciones que
existan en el nmero y estructura de ellos.

Alteraciones del carioOpo

Los cambios en el nmero o en la estructura de los cromosomas producen graves


enfermedades,cuando falta una copia de los cromosomas no sexuales (autosomas)la
consecuencia es letal. Si se tienen 3 copias de un cromosoma la supervivencia es
escasa, pero la trisoma del cromosoma 21 es viable, esta anormalidad se conoce como
sndrome de Down (antesllamado mongolismo);es el ms frecuente de los trastornos
cromosmicos del hombre y depende mucho de la edad en que la mujer se embaraza.
Enmujeresmenoresde 29 aosla posibiidad de queun hijo padezca esta anormalidad
cromosmica es del Y2 000, pero en mujeres mayores de 45 aosla frecuencia de tener
un hijo con sndrome de Dowu es de 1/50.
En los individuos afectados,la simple observacin los descubre, entre otros sig-
nos se observa la estatura baja, el perfil facial plano, fisuras palpebrales oblicuas,
lengua voluminosa y manos anchas y cortas, El retraso mental generalmentees inten-
so, pero tienen un carcter tmido y apacible.
Existen otras muchas enfermedadescon alteracionesde los cromosomas. En el
sndromedeKnefelter,el trastorno se presentaen los cmmosomassexuales; el Canotipo
anormal es 4na;Y, pero tambin puede ser 47XXXY 47XXXXY.Estos enfermosson
estriles y con ligera disminucin de la inteligencia.
Mitosis:
Se le llama mitosis al proceso medianteel cual se produce la duplicacin de las
clulas eucariotas, este proceso ocurre en la fase M del ciclo celular (captulo24). Al
llegar a la mitosis los componentescelulares se encuentranduplicados. La mitosis es el
proceso de separacin de los componentes celulares entre las 2 clulas hijas.
Por su complejidad y para facilitar su descripcin se suele dividir en 4 etapas:

1.Profase.
2. Metafase.
3. Anafase.
J. Telofase.

Aiites de la primera etapa, ya han estado ocurriendo cambios en la clula, pues la


croiiiatiiia ha comenzado a condensarse y el nuclolo a desaparecer.En el citoesqueleto
ocurren eariibios tambin, pues aunquelos filamentosintermediosnoexperimentan
cambios,los filamentosde actina, miosina y los microtbulos se desensamblan.

1. Profase. Fnnnaci6n del huso d l k o y ia desintegraa6n de la envoltura


nuclear. Los 2 centrolos, cuya divisin ya haba comenzado en la fase S, se en-
cuentran en uno de los polos de la clula, ocupando, uno con respecto al otro, una
posicin perpendicular. Se encuentran rodeados de una zona opaca que se tie
poco y que a partir de ella se "ensamblan" los microhbulos,formando los 2 steres
(ster significa estrella).
Los iiiicrotbulos (captulo 22) se ensamblano desensamblan*>por sus extre-
nios. pero por uno de esos extremos estos procesos son ms rpidos; a este ltimo se
le denomina el extremo positivo, y al otro el negativo. En losmicrotbulos que se
forman a partir de los centrolos, los extremos negativos quedan inhibidos y situa-
dos en la zona que rodea a los centrolos; el extremo positivoes el msalejado de
los centrolos y al crecer va alejando a los centnolos cada vez ms hasta colocarlos
en extremos opuestos del ncleo; en esta posicin, el ncleo se observa rodeado ,'.~ ~ .
por los filamentosque quedan tendidos entre ellos como rayos que unen a 2 soles,
y en el centro sus extremos positivos se interdigitan (Fig. 23.13).
En el ncleo tambin han ido ocurriendo cambios. La cromatina se ha ido conden- o" ~ ~4. .
sando y aproximando a la envoltura nuclear y en el centro del ncleo aparece un ~ ~

vaco; la condensacin de la cromatina es cada vez mayor y se llega a notar en el


-
microscopio ptico, que cada uno de ellos est formado por las cromtidas herma- ~

.,-

nas unidas por el centrmero.


La lmina nuclear se hiperfosforilay se disgrega. La laminina A se hace soluble, y Fig. 23,13, El huso rodea
laB permanece unida a las vesculas quese forman al fragmentarse la envoltura
nuclear; esto es probable que las marque, y que sin dudas sea el sitio de reconoci-
miento cuandoen etapas posteriores de la mitosis se reconstruya la euvoltura nu-
clear.
La desintegracin de la membrana marca el finalde la profase.
2. Metaiase. La orientacin diredonal de los cromosomas en el plano ecuato-
rial. Una vez desensamblada la envoltura nuclear, los microtbulos polares se
introducen en la zona que ocupaba el ncleo, y quedan entre ambos polos inva-
diendo esta zona con sus extremos positivos interdigitados (Fig. 23.13). Los
cromosomasse mueven durante la metafase hasta que ocupan un plano que queda
perpendicular entre los 2 polos, a este plano se le denomina placa ecuatorial. En
este movimiento parece intervenir el ensamblajey desensamblajede los mi-
crotbulos, y llegan a ocupar la placa ecuatorial cuando se establece un equilibrio
entre el ensamblaje>* y desensamblaje por ambos lados del cromosoma. El
"desensamblaje" atrae a los cromosomas hacia los steres,pero con mayor iutensi-
dad, mientras ms alejados se encuentran de los polos; en cambio es menor cuando
estn ms cercanos. La situacin de equilibrio puede durar algn tiempo, y la
mitosis por ello puede durar un tiempo mientras queda detenida en esta fase (Fig.
23.14a).
3. Anafe. La separacin de las cmmBOdas. La separacin de las cromtidas co-
mienza de forma simultnea en todos los cromosomas y contina con el movi-
miento de aqullas hacia los polos (Fig. 23.14b).
Aunque el mecanismo es desconocido, una hiptesis que intenta explicar la sepa-
racin brusca y simultnea de las cromtidas es la siguiente: por un proceso de
regulacin desconocido,los centrmeros terminan de duplicarse y como aqullas
permanecan unidos por stos, al terminar de dividirse en 2 se separan. La migra-
cin de cada cromtida a su polo se realiza a una velocidad aproximada de 1pm
por minuto y aparentemente responde a 2 tipos de fuerzas (Fig. 23.14~).Una de
Microtbulos polares estasfuenases ladel continuo desensamblajede los microtbulos del cinetocoro
en la zona que rodea a los steres y que provoca el acortamiento de los filamentos,
c) y la aproximacin cada vez ms de la cromtida a los polos. La otra fuerza, que
,, . aleja los polos entre s y que alarga al huso, depende, parece ser, del deslizamiento
1 ....,
entre los extremos de los microhbulospolares. La disminucin de la interdigitacin
entre ellos disminuye por un movimiento de deslizamiento; en este movimiento
parece intervenir una protena parecida a la dineina de los cilios y flagelos; se ha
demostrado que no intervienen la actina y la mimina.
En esta fase se observa el progresivo movimiento de los cromosomas hacia los
polos de la clula, molimiento en el cul los centrmeros parecen arrastrar a los
cromosomas tras de s. Los filamentosde los cinetocoros se acortan hasta un quinto
~icrotbul&del cioetocoro de su longitud original.
4. Telofase. Reaparicin del ncleo. Al terminar la migracin de los cromosomas,
desaparecen los microtbulos; comienza la descondensacin de los cromosomasy
se adosan a ellos las vesculas de la envoltura nuclear, que casi rodean a cada
Fig. 23.14. Etapa? de la mitosis. (a) Solo se cromosoma antes de fusionarseentre s. Las protenas desfosforiiadasde la lmina
representa a uno de los Cromo-
samas. La orientacin se logra al
nuclear p m n que orientan el ensamblaje>dela membrana, quizsal pomerizaise
contactar los microtliulos de cada ellas. Las protenas de los poros reaparecen,tenninael ensamblajede la membra-
rinetoeuro, a ambos lados del na, tambin finaliza la descondensacin de la cromatina y comienza la sntesis de
cromosuma, con la zona que ro- ARN, as como la formacin del nuclolo.
dea a las eentriolos. (b) Separa- En esos mismos instantes est ocurriendo la citocinesis, que no es ms que la
cin de las cromtidm. (e)Fuerzas divisin del propio citoplasma celular que resulta de la formacin de las 2 clulas
que al parecer producen la separa-
cin de las cromtidas. Iro. Una hijas (Fig. 23.15).
de ellas parece ser la separacin de Durante la anafaseseformapor debajo de la membrana citoplasmticaunanillo de
los eentrolas y se observa una fibrasde actina y miosina, cuya localizacin se corresponde con la placa ecuatorial
menor interdigitacin de los del huso. El mecanismo regulador que controla su formacin es desconocido, as
mierotbulos polares. Zdo. La otra
como tambin lo son los cambios que ocurren al nivel de este anillo, el cual con el
pudiera ser el acortamiento de los
microtbulos del einetororo. tiempo se va cerrando cada vez ms. En el exterior de la clula se observa la
formacinde uncanal circular queva profundizndosehasta Uegar a individuali-
zar a las 2 clulas hijas. Debajo de la membrana plasmtica, el grosor del anillo no
vara a pesar de ser cada vez menor su circunferencia, por lo que se presume que de
alguna forma se eliminan molculas de actina y miosina.
Al final desaparecen estas protenas por completo, y entre ambas clulas queda un
puente formado de membrana plasmtica, los filamentos interdigitados muy
compactados entre s y una sustancia muy condensada; despus las clulas se
separan. Como los organelos de la clula se encontraban en cantidad suficientey
distribuidos por todo el citoplasma, al producirse la citocinesis quedan repartidos
entre las 2 clulas hijas.

Fig. 23.15. La citocincsis. En el ecua-


dor de la clula en divisin se El ncleo, orgaaelo propio de los orgauismos eucariontes, est formado por
forma un anillo de aetina que una membrana o envoltura nuclear, la uomaOna, al menas un nuclolo y el jugo
se va eonstriendo. nuclear o nucieoplasma
La envoltura nuclear est constihiida por 2 membranas con un espacio
intermembranoso entre eUas y la atraviesan poros, a iravs de los cnaies se ponen
en comunicacin el nueleoplasma con el citoplasma, pero por los cules s610 pasan
algunas sustancias @aso selectivo). La membrana externa nuclear se parece mu-
cho al r e t i d o endoplasmticorugoso, y de hecho, es una connuacin de sie. Por
el contrario, la membrana interna nuclear no contiene ribwmas en su superficie
y adems, se relaciona por su parte ms interna con una orgadzaci6n especial
protefniea: la Imina nuclear, formada por 3 protenas. Esta estnidura es impor-
tante, pues regula la desagregacin y la agregacin de la envoltura nuclear duran-
telamitosis.
El nuclolo es el sitio de formacin de los ARN ribosomales, pero adems all
se aensamblanm &cm con las protenas ribosomales, sintetizadas en el citoplasma,
y se forman Las 2 subunidades del ribosoma que luego salen por los poros hacia
dicho espacio celular.
La cmmatina es la forma de organizacin del material gentico durante la
interfase; en esta fase del ciclo celular se Ueva a cabo, de forma intensa, la sntesis
de ARNm y del propio ADN;estos procesos se fadlitan, ya que la cromatina est en
forma descondensada.
Al comenzar la mitosis, la cromatina se condensa miles de verm y se forman
los cromosomas que ya contienen al material gentico duplicado, en forma de
cmmtidas. La mitosis se ha dividido en 4 etapas para su estudio; en ellas se obser-
van la condensacin de la cromatina hasta la formacin de los cromosomas, la
desaparicin de la envoltura nuclear, la formacin del huso mit6tico, la migracin
de Las cmmtidas hacia el ecuador del huso, la separacin de las cmmtidas hacia
los polos del huso, la formacin de 2 ncleos y finalmente, la divisin del citoplas-
ma celular entre Las 2 clulas hijas; todas estas etapas garantizan que estas nuevas
05Ilnlas posean el mismo material gentico, as como el resto de los componentes
celoleres.

1.Haga un esquema del ncleo, en el que aparezcan el mximo de detalles posibles


representativosde su estructura.
2. Confeccione2 listas de compuestos. En una de ellas mencione aqullos que deben
atravesar los poros de la envoltura nuclear del ncleo al citoplasma y en la otra
lista,los compuestos que atraviesan los poros en el sentido contrario.
3. Haga un esquema de lo que ocurre:
a) En el centro del nuclolo y descrbalo.
b) En un lugar intermedio entre el centro del nuclolo y Lascapas ms externas.
c) En la superficie.
4. Compare los procesos de profase y anafase.
5. Busque en algn libro de Medicina Interna 2 enfermedades relacionadas con
alteraciones del cariotipo. Diga cul es la alteracin cromosmica existente y cu-
les son sus cousecuencias.
Resumen de la d n

Terminado el estudio de esta seccin, el lector habr podido percatarse de la


complejidad de la organizacin celular. Este tema se completarcuando, en captulos
posteriores, se consideren la estructura y funcin de otros organelos, los cuales se
tratan en forma muy vinculada a las funciones metablicas y de otra ndole que ellos
realizan; tal es el caso de las mitocondrias y los ribosomas.
Durante toda la seccin se puso de manifiesto la importancia general del& mem-
branas en la organizacin del sistema celular. Tres de los captulos de esta seccin
estndian diferentesmembranas, de modo exclusivo, o vinculadas con otras estmcturas
("Membranasbiolgicas", "Organelos membranosos intracelnlares" y "El ncleo ce-
lular").
Resulta de gran inters que el lector haya comprendido la funcin de las diferentes
biomolculas y las interaccionesque establecen unas con otras en la organizacin y
funcin de los componentes celulares. Sin embargo, tambin debe resultar claro que
las propiedades de los diferentes organelos no son una simple suma de las de sus
constituyentesmoleculares, sino que stos integran sistemas que manifiestan propieda-
des y funciones que les son caractersticas y cualitativamente nuevas.
La membrana plasmtica se estndi como prototipo demembrana biolgica y a
ella se refiri, en primer lugar, el modelo de mosaico fluido,aceptado universalmente
en la actualidad para explicar las estructura y funciones, no slo de la membrana
plasmtica, sino de las membranas biolgicas en general.
La membrana plasmtica, como se expres,no es una simple barrera que Limita a la
clula de su entorno, sino que se trata de un organelo muy activo y dinmico que
participa en el paso selectivo de sustancias a travs de ella y en ambas direcciones,
sobre todo en virtud de las protenas transportadoras especficasen ella localizadas.
Los organelos membranosos intraceinlares cumplen importantes funcionesgene-
rales relacionadas con la compartimentacin del espacio intracelnlar, el estableci-
miento de gradientes de concentracin, la disponibilidad de reas de superficie, el
incremento de las velocidades de los procesos metablicos y la propia generacin de
nuevas membranas.
En particular el retculo endoplasmticoy el aparato de Golgi se vinculan con la
sntesis y procesamiento de biomolculas, especialmente protenas y Ipidos. El lti-
mo de los organelos citados participa en la orientacin del material sintetizado hacia
distintos lugares de la clula o incluso hacia su exterior.
Los lisosomas por su parte intervienen enia degradacin de biomolculas que
Pueden provenir del exterior o ser material de la propia clula. Por ltimo, los
peroxisomas intervienen en reacciones de descomposicin del H,O, y de detoxifkacin.
El citoesqueletoconstituye un elemento fundamental de la arquitectura celular,
ya que posee una dinmica notable, dada sobre todo por la continua formacin y
desintegracin de los diferentes filamentos y tbulos que lo constituyen. En estos
procesos participan,adems, diferentesenzimas y otros tipos de protenas reguladoras.
El ncleo celular es un organelo de elevada complejidad y sus constituyentes
fundamentalesson las molculas de ADN donde se conserva la informacin gentica
de las clulas. Este material adopta diversas formas organizativas durante el ciclo de
reproduccin de la clula y la ms organizada son los cromosomas,que intervienen en
el proceso de la mitosis.
Para concluir este resumen seiiataremos que si bien la organizacin didctica del
contenido obliga a estudiar los diferentes organelos de manera separada, stos no
deben ser considerados como entes totalmente independientes, sino que ellos funcio-
nan como un sistema muy coordinado, lo cual ha sido puesto en evidencia en esta
misma seccin y ser reiterado a lo largo de todo el texto.
\ n esta seccin se tratar el estudio de la gentica molecular, lo que equivale a

E decir, que se estudiarn los fenmenos relacionados con la herencia de las


caractersticas propias de los seres vivos, desde el punto de vista de los anli-
sis de las estructuras, propiedades y funcionesde las molculas que en estos procesos
intervienen.

Todas las macromolculas que participan en estos procesos se caracterizan por presen-
tar propiedades informativas, por lo que en el primer captulo se discuten brevemente
algunos aspectosfundamentalesde la informacin molecular y de su transferencia, as
como su momento de expresin durante el ciclo de vida de la clula. Toda la seccin
est prcticamente encaminada al estudio de las 3 grandes vertientes que tienen que
ver con la informacin gentica, o sea, su trasmisin, conservacin y expresin.

Laseccin comienza con el breve anlisis en el captulo 24 del complejo proceso dela
transferencia de informacin en los seres vivos, sus formas de expresin, as como los
momentos del ciclo celular donde se hacen ms evidentes estos mecanismos; en este
mismo capitulo se hace un hreve estudio del ciclo celular y su regulacin.

El fenmeno de la trasmisin de la informacingentica se refiere al hecho comproba-


do de que los seres vivos pueden trasmitir sus caractersticas a sus descendientes,
haciendo que stos sean esencialmente iguales a aqullos, pero dentro de un amplio
margen de variabilidad. El fundamentomolecular de estos 2 aspectos se discute en el .

Tornado de Biochernistry. Lubert Stryer. Cuarta edicin. 1995


captulo 25, dedicado a la replicacin del ADN que garantiza la estabilidad de la
informacin que se trasmite,en tanto en el captulo31, dedicado a la recombinacin
gentica y el 32 a las mutaciones, se analizan las diferentes fuentes de diversificacin.

La conservacin de la informacin gentica implica varias faceta: en primer lugar la


organizacin en cada organismo de las molculas que la portan, que es contenido del
captulo 26 "Organizacin del Genoma Eucariunte"; en segundo lugar los mecanismos
que mantienen y reparan las molculas que han sufrido algn daio, esto se trata en el
captulo 33 "Conservacin de la informacin gentica".

Cada organismo, para ser cual es, debe expresar la informacin que contiene en su
material gentico; este aspecto es uno de los ms complejos, pues esa informacin
debe ser copiada primero en una molcula especfica de ARNm, como se ver en el
captulo 27 "Transcripcin del ADN", y despus en la secuencia de aminocidas de las
protenas como se estudia en el captulo 30 "Traduccin". Para ello es necesaria la
existencia de una relacin entre estos 2 tipos de molculas y por eso se dedica el
captulo 28 al estudio del cdigo gentico, en tanto en el 29 se trata el estudio de los
ribosomas, que son los orgauelos dondeocurre la sntesis de protenas. Una eficiente
expresin de la informacin gentica requiere de mecanismos de control que sern
estudiados en el captulo 34 "Regulacin de la Expresin Gentica".

Para terminar la seccin se ha considerado conveniente incluir en el Captulo 35


"Tecnologa del ADN Recombiante" algunas aplicaciones de los conocimientosde la
gentica molecular, sobre todo aqullus relacionados con la prctica mdica.

El campo de conocimientos de la gentica molecular se ha desarrollado extraordiiia-


riamente en los ltimos 30 aos y en esta seccin no se pretende hacer un anlisis de
todos los procesos relacionados con ella, ni siquiera hacer un estudio por~iieiiorizado
de los mecanismos que aquse exponen. Ha sido necesario hacer una seleccin cuida-
dosa del contenido, teniendo en cuenta que este texto est dedicado principalulente a
estudiantes de ciencias mdicas, y de ah la constante referencia a aqullos aspectos
que ms o menos de forma directa pueden estar vinculados con esa esfera de conoci-
~iiieiitos.
Una de las caractersticas ms sobresalientes de los seres vivos es la de poseer,
conservar y trasmitir a sus descendientes un elevado grado de organizacin, que cons-
tituye a su vez un requisito indispensable para su funcionamiento. El tipo, el nmero
y la composicin de sus molculas, la forma de disponerse en las clulas, sus
intemlaciones mutuas, la especializacin y diferenciacin en la formacin de rganos
y sistemas, etctera, estn determinados desde el momento en que un ser comienza a
existir. De la intemlacin entre el organismo y el medio depender que esas caracters-
ticas se manifiesten en toda su intensidad. En este captulo se tratarn los aspectos ms
generales que estn relacionados con la forma en que esa elevada organizacin se
deriva de propiedades especficas de molculas concretas.

En los captulos anteriores se ha hecho referencia a un trmino que tiene gran


significado biolgico, que en este momento es necesario profundizar para lograr una
mejor comprensin del contenidodelas pginas siguientes; ese trmino es el de infor-
macin molecular.
La informacin molecular es el fenmeno por medio del cual las estructuras hiol-
gicas adquieren,mantienen y trasmitenun elevado grado de organizacin, a pesar de
la tendencia natural al desorden. Existen definiciones ms o menos complejas del
trmino, incluso hasta con formulaciones matemticas, que a este nivel de interpreta-
cin no resulta necesario discutir.
En todos los casos el trmino est caracterizado por 2 rasgos bsicos generales. Por
una parte, su asociacin con la disminucin de la entropa, que caracteriza el funciona-
miento general de los sistemas vivos y, por otra, su indisoluble vinculacin con lo
variado, lo diverso y lo diferente.
Lo ms caracterstico en la composicin qumica de los seres vivos es la existencia
de las macromolculas, a partir delas cuales se forman todas las estructuras celulares,
cuyas funciones son en ltima instancia las resultantes de las propiedades, las funcio-
nes !. las forma3 especficas de organizarse las macromolculas que las constituyen. Es
precisamente la organizacin estructural de esas macromolculas la que condiciona la
aparicin de la informacin molecular.
Formas de la infonnaci6n molecular
Es necesario precisar que al nivel molecular podemos distinguir2 tipos principa-
les de informacin: la informacin por secuencia o secuencial, y la informacin por
conformacin o conformacional.
La secuencial corresponde a macromolculas donde se da en un todo armnico la
unidad de lo montono y lo diverso,pero donde lo diverso desempea una funcinde
codificacin, la de constituir un conjunto de signos sucesivos con un ordenamiento
lineal y con una significacinprecisa. Esta forma de organizarse la informacin es la
ms adecuada para su conservacin porque puede existir en macromolculasde eleva-
da estabilidad, tanto qumica como metablica, con lo cual puede mantenerse inalte-
rable durante un tiempo prolongado. Del mismo modo esta forma es la ms adecuada
para su trasmisin, ya que por mecanismos ms o menossencillos de codificacin se
puede reproducir esa informacin organizada de forma lineal como la sucesin de
elementos diversos a lo largo del eje covalente de la macromolcula y distribuirlade
manera equitativa en los organismos descendientes.
Pero este tipo de informacin, debido principalmente a estos factores, no es todo
lo funcional quese requiere para dar cuentade las mltiples y diversas actividadesde
un organismo, aunque se trate del ms simple o el ms complejo. Esto significaque no
puede expresarse directamente mediante la realizacin de otras funciones especficas
que no sean conservar y trasmitir su contenido.
La informacin conformacional est contenida tambin en macromolculas,don-
de existe la unidad de lo montono y lo diverso, pero este ltimo se distribuye en las
3 dimensiones del espacio, ocupando posiciones precisas que hacen posible la realiza-
cin de funciones especficas,determinadas por esa disposicin espacial.
Esta distribucin permite, por un mecanismo de complementaridad espacial, el
reconocimiento de molculas especficasde igual o diferente naturaleza. Esta forma de
organizarse la informacin presenta serias dificultades para su conservacin, pues
estas estructuras tridimensionales se mantienen generalmente por interacciones dbi-
les y porello no presentan gran estabilidad. Su utilidaden la trasmisinesan menor,
puesse tratara de duplicar y despus distribuir equitativamente todas y cada una de
las molculas con funciones especficas en las clulas, de manera que las clulas hijas
contengan la misma informacin que aqulla que ledio origen.
El fenmeno de la identificacin o reconocimiento molecular es el nivel bsico de
manifestacin de la informacin conformacional, pues mientras una molcula no po-
sea la propiedad de reconocer o idenoficar a otra, no podr la primera realizar ninguna
accin especfica sobre la segunda,^ lo que es lo mismo no podr realizar funciones
definidas.
Para que este reconocimiento se produzca las molculas deben tener determinadas
caractersticas estructurales, debe existir un sitio ubicado en la ~ u p e ~ cde
i ela molcu-
la, construido a expensas de la estructura tridimensional. Estesitio debe poseer una
conformacin complementaria a la sustancia que va a reconocer y presentar grupos
qumicos en posiciones precisas que permitan una interaccin atractiva, generalmente
no covalente, entre las 2 molculas.
Una vez realizada la identificacinse produce una reaccin de inmovilizacin de
la sustancia reconocida, formndose complejos que segn el caso pueden tener dife-
rentes destinos. La identificacin puede ser seguida de acciones diferentes, segn las
propiedades de la macromolcula dada, unas veces ocurre la transformacin de la
sustancia reconocida, otras, suceden modificaciones de la actividad especfica de
alguno o todos los componentes del complejo, y en determinadas ocasiones se dan las
2 situaciones anteriores. En muchos casos el destino de este complejo y los mecanis-
mos por los cuales se realiza no han sido esclarecidos suficientemente, como sucede
con el complejo antgeno-anticuerpo, como veremos en el captulo SO. En resumen,
los 4 estratos bsicos de manifestacin de la informacin conformacional seran:

1. Reconocimiento-inmovilizacin-hirnsconfon.
2. Reeonocimiento-inmovilizacin-transeonformacin-modulacin.
3. Reconocimiento-inmovilizacin-transconformacin-translocalizacin.
4. Reconocimiento-inmovilizacin-transconformacin- ?

Ntese que en las 4 casas la idenaficacin representa la primera etapa del proceso.
A diferencia de la informacin secnencial, la informacin conformacional presen-
ta diferentes grados de actividad funcional. Para que un grupo de molculas pueda
realizar funciones diversas y especficas debe poseer informacin conformacional.

li.ansferencia de informacin
En captulos anteriores ha quedado demostrado que en las macromolculas fun-
cionales, la conformacin depende de su estructura primaria, de su secuencia, por lo
que en stas se funden los 2 tipos de informacin: la secuencial y laconformacional.
Puede decirse que en estas molculas la informacin contenida en la secuencia es
precisamente la de cmo construir la estructura iridimensional. En ellas se produce la
transicin de lo secuencial a lo conformacional.
Pero la informacin secuencial,como hemos visto, es la adecuada para la trasmi-
sin, por lo tanto, sta debe provenir de otra molcula que slo contena este tipo de
informacin y la de esta ltima, provino a su vez de otra macromolcula con informa-
cin tambin de tipo secnencial.
En esto consiste una de las principales regularidades que se observa en los orga-
nismos vivos y que se refiere a la forma en que fluye lainformacin en las clulas. No
importa el nmero de etapas en que el proceso se desarrolle, ni los mecanismos
moleculares implicados en cada una de ellas, ni las formas especficas en que lo realiza
cada organismo particular: la informacin molecular se trasmite siempre desde una
molcula con informacin secuencial hacia otra molcula con informacin
conformacional; esto es lo que hemos denominado principio de transferencia de infor-
macin.
Esa transferencia de informacin se manifiesta en los organismos vivos mediante
3mecanismos bsicos. El primero -la conservacin-tiende a mantener la informacin
lo ms invariable posible, utilizando estmcturas de elevada estabilidad y procesos de
rectificacin y reparacin. El segundo -la trasmisin- garantiza el paso de la informa-
cin de un organismo a sus descendientes con el ms elevado grado de fidelidad, de
modo que todos los descendientes posean en esencia la misma informacin. El tercero
-la expresin- consiste fundamentalmente en la direccin de la sntesis de molculas,
dondese produzca la transicin hacia la informacin conformacional,y sta se exprese
en funciones especficas que permitan el mantenimiento, desarrollo y reproduccin
del organismo que la posee.
Estos 3 procesos se llevan a cabo en diferentes momentos de la vida celular, por lo
cual a continuacin se har un estudio somero de las caractersticas de los principales
estados o fases por los que atraviesa una clula durante su vida.

Todas las clulas al pasar de una generacin a la siguiente experimentan una


secuencia peridica de eventos que recibe el nombre de ciclo celular.
En muchos microorganismos y en clulas cultivadas de organismossuperiores, tie-

Componentes celulares y Gentica molecuiar 429


nen lugar, previo a cada divisin, la duplicacin casi exacta del tamao de la clula y del
nmerode suscomponentesmoleculares. Enmuchos huevosfertizados, por oha parte,
no se produce incremento del tamao y, aparte del ADN, slo un nmero reducido de
molculas se duplican durante las primeras divisiones celulares, esto se conoce como
clivaje. La mayora de las clulas que forman parte de los animales y las plantas caen
dentro de una categora intermedia, en la que existe generalmente una duplicacin del
tamao celular, pero sin una duplicacin exacta de todas sus molculas.
La sntesis de los componentes celulares a lo largo del ciclo puede realizarse de
forma continua o discreta. En este ltimo caso su perodo de sntesis puede ser largo o
corto y pudiera ocurrir en cualquiera de las etapas del ciclo.
El perodo o etapa que presenta cambios fcilmenteobservables al microscopio
es, sin lugar a dudas, la divisin celular, que ya fue estndiada en el captulo23. Como
el mecanismo bsico general de la divisin celular es la mitosis, este perodo se desig-
na como M. En un principio el ciclo celular se describa como formado slo por 2
etapas: la mitosis (M)y el resto denominado interfase por encontrarse entre la telofase
(ltima fase de una mitosis) y la profase (primera fase de la siguiente).
Otro evento de singular significacin dentro del ciclo celular es el proceso de
duplicacin de la informacin gentica, o sea, la sntesis del ADN, ste se conoce como
replicacin o autoduplicacin y es el que hace posible que durante la mitosis cada
clula formada contenga la misma informacin gentica,haciendo que ambas sean de
la misma estirpe celular.
Para determinar si la sntesisdel ADN se produca de forma continua o discreta se
realiz un experimento sencillo, pero concluyente. Se cultivaron clulas en un medio
adecuadohasta obtener una poblacin celular grande. En un momento determinado se
le aade al medio ['4C]-timidma,a los pocos momentos el cultivo se lava para eliminar
el exceso de reactivo, las clulas se fijan y la preparacin se recubre de una pelcula
fotogrfica -procedimiento conocido como autorradiografa-y despus de un tiempo
prudencial se revela la pelcula.
Este experimento se basa en una idea muy simple. Si la sntesis del ADN se produ-
ce de forma continua durante todo el ciclo celular todas las clulas incorporarn
[l4C1-timidina,pero si se realiza deformadiscreta,sloincorporarn ['TI- timidinalas
que en el momento de la exposicin estn en el perodo de sntesis. Como puede
apreciarse en la figura 24.1 los resultados fueron concluyentes: la sntesis del ADN se
realiza de forma discreta en un momento determinado del ciclo.
Este proceso define otra de las etapas que, debido a estar caracterizada por la
actividad de sntesis del ADN, se le ha denominado perodo o etapa S. Este proceso
ocurre en un perodo que est separadode la divisin por 2 etapas conocidascomo G,
(entre M y S) y G, (entre S y M). La denominacin de estos perodos proviene de la
inicial de la palabra inglesa gap que significa brecha, hueco o hendidura.
Esta situacin ha sido comprobada en mltiples organismos eucariontes, por lo
que se considera que tiene carcter casi universal.
Para calcularla duracin de las diferentes etapas del ciclo celular se procedi de la
forma siguiente: mediante control visual se estableci que la fase M (mitosis)duraba
aproximadamente 1hora. El ciclo celular deM a M era de 26 horas. A un cultivo de
clulas HeLa se aadi [3H]-timidinadurante un breve tiempo y se fueron obteniendo
Fig. 24.1. Estudio de la replicaein del ADN muestras del cultivo en intervalos regulares de tiempo, para analizar el nmero de
durante el cielo celular. (a) El eon- clulas que aparecan marcadas durante el perodo de mitosis. Las primeras clulas
tenido celular de ADN aumenta de
manera brusca en un momento de- mitticas no estaban marcadas y lo mismo suceda con las siguientes, hasta unas 6 7
terminado del cielo celular y defi- horas despus de la exposicin a la ['HI-timidina; en ese momento el nmero de
ne el periodo S. (b) La ineorpora- clulas marcadas creca extraordinariamente. Era razonable pensar que estas primeras
ein de [Y]-timidina durante el clulas mareadas eran las que estaban en la parte final del perodo S cuando se produjo
ciclo celular presenta un incremen-
to que se corresponde con el pe-
la exposicin; de esta manera pudo establecerse que la duracin del perodo G, era de
rodo S y despus desciende. Am- 6 horas. El mismo razonamiento condujo a dilucidar la duracin de las dems etapas
bas experiencias demuestran el del ciclo. Unas 17 horas despus de la exposicin, el nmero de clulas mitticas
carcter discreto de la sntesis del marcadas deseenda abmptamente,de ahquela duracin del perodo S seestableciera
ADN.
-
en 17 (6+1)= 10 horas, y el perodo G, durara 26 - 17= 9 horas (Fig. 24.2).
En las clulas de los organismos adultos, la duracin de los perodos M y S son
prcticamenteconstantes, de abque las variaciones en la duracin del cid0 dependen
fundamentalmente de la duracin de los perodos G, y G,, en especial del primero.
En organismos superiores es frecuente encontrar clulas especializadasque no se
dividen o lo hacen raras veces. En estos casos, despus de la divisin celular (M), la
clula pasa a un estado metablico particular que se diferencia esencialmente del
perodo G,. Hace algunos aos paracaraeterizar este estado se introdujo el concepto de
perodo Go;para que una clula en este estado pueda llegar a dividirse tiene que
introducirse primero en el perodoG,,en el cual se producen las condicionesnecesa-
rias para la replicacin del ADN primero y la divisin celular despus. En las clulas
embrionarias de los primeros estados G, y G, casi no existen y an se produce un
acortamientodel perodo S, por un mecanismo que se estndiaren el captulo prximo,
haciendo que el ciclo celular ocurra a gran velocidad.
Fig. 24.2. Duracin del ciclo celular en una
clula animal tpica. Los perodos
de divisin celular (M) y de snte-
Actividad biosinttica durante el cielo celular sis del ADN (S) estn separados
par 2 fases de duracin variable
U, y G,. El perodo Gu se utiliza
Para el estudio de la sntesis de los diferentes componentes celulares y sus varia- para tipificar la situacin de elu-
ciones durante el ciclo es necesario contar con clulas de crecimiento sincronizado, las que no se dividen o lo hacen
aue todas se encuentren en el mismo oerodo del ciclo celular. raras veces, como las clulas espc-
Todos los mtodos descritos para la obtencin de cultivos de clulas de creci- cidiradas de les organismos supe-
riores. Aunque ubicados en igual
miento sincronizado pueden dividirse en 2 grupos:- - los de seleccin y los de induc- posicin en el esquema hay dife-
cin. Generalmentelos de seleccin tienen un rendimiento mucho menor que los de rencias esenciales entre los pero-
induccin. dos G.,.Y G". Los nmeros dentro
Los mtodos de seleccin consisten en aprovechar alguna propiedad especial de del crculo representan la duracin
en horas de cada una de las pero-
las clulas en algunas de las etapas del ciclo y, haciendo uso de ella, separarlas del dos en una clula animal tpica.
resto. Por ejemplo, las clulas en G, son mucho ms grandes que en G, y por ello es
posible separarlas por centrifugacinen gradiente de densidad (Fig. 24.3).
Los mtodos de induccin qumica tienen un uso ms generalizado y dependen

Fig. 24.3. Sincranizacin por seleccin. (a) Las clulas cultivadas se colocan en tubos de centrfuga
que contienen ficol en una concentracin que va desde S % en la boca hssta 10 % en el
fondo, creando as un gradiente de densidad.(b) Al ser eentrifugadas las clulas se desplazan
hacia abajo, acumulndaae en una zona donde su densidad corresponde con la del medio de
centrihgacin. (t) Como las clulas en U, son muy grandes se desplazan mucho ms hacia
el fondo. El tubo se perfora par el fonda y se obtiene Is fraccin que contiene las clulas en
penada G,, y se cultivan nuevamente.

Componentes celulares y Gentica molecular 431


de la accin selectiva de un inhihidor. Inhibidores de la sntesis del ADN como la
fluordesoxiuridina,la hidroxiurea o elevadas concentraciones de timidina (2 mM)
bloquean el crecimiento celular en el perodo S, mientras que inhihidoresde la mitosis
como la colchicina, lo hacen en metafase. Despus de retirar el inhibidor, las clulas
acumuladasen la fasedel ciclo anterior donde actu el inhibidor empleado,continan
el ciclo sincronizadamente. Se puede aumentar el rendimiento si el procedimientose
reaite ms de una vez mic.
. -
24.4).
Utilizando clulas de crecimiento sincronizadose han podido estudiar los proce-
sos de sntesis de los principales componentes moleculares de las clulas.
Para determinar el momento del ciclo, cuando se produce la sntesis de un compo-
nente especfico, pueden seguirse 2 procedimientos: medir durante todo el ciclo el
contenido celular de ese componente,o medir la actividad hiosinttica por la incorpo-
racin de precursores marcados de forma radiactiva.
En contraste con la replicacin, la sntesisde los ARN estudiada por la incorpora-
cin de [3H]-uridina,parece ser continua durante todo el ciclo, con excepcin de la
mitosis, tanto en animales y plantas como en microorganismos.
La intensidad de este proceso, conocido tambin como transcripcin,va aumen-
tando en la medida que avanza el ciclo y comienza a disminuir en G, para llegar
prcticamente a cero durante la mitosis. Los estudios realizados indican que al menos
en la mayora de las clulas esta situacin ocurre con los 3 tipos principales de ARN
(mensajero,rihosomal y de transferencia) (Fig. 245).

Fig. 24.4. Sincronizacin por induccin. Un


cultivo de clulas se incorpora a
un medio que contiene timidina
suficiente para alcanzar una con-
centracin final de 2 mM durante
un tiempo igual a G, + M + G, (A).
Como la timidina en esa concen-
tracin inhibe la sntesis del ADN,
las clulas van acumulndose al
final de G,. El inhihidor se retira
(B)y despus de algunas ciclos de
divisin celular el proeedimifnto

[jp/
se repite (C), con la cual se logra
un rendimiento considerablemente
mayor.

.r:

Fig. 24.5. Estudio de la transcripcin durante el ciclo celular. (a) El contenida


celular de ARN total aumenta de forma continua durante el cielo
celular y slo comienza a disminuir al final del perodo G,. (b) La
incorporacin de un precursor de los ARN como la ['HI-uridina
-2=
durante el cielo celular, va inirementndose hasta la parte final del U
periodo G,, donde desciende lentamente. Estas 2 experimentos evi-
dencian que la sntesis de los ARN, la transcripcin, se produce do
manera ininterrumpida durante el cielo de vida de la clula, con
excepcin de la mitosis. (b)
Las protenas en general tienen una sntesis continua a lo largo de todo el ciclo,
con una marcada disminucin durante la mitosis, como se evidencia por la incorpora-
cin de ['HI-prolina. Esto concuerda con lo expresado para los ARN mensajeros, como
se ver ms adelante. No obstante, existen grupos de protenas especficas cuya sn-
tesis es discreta, esto es slo en un perodo determinado del ciclo. Tal es el caso de las
histonas cuya sntesis selimita al perodo S, simultneo con la duplicacin del ADN.
El proceso de sntesis de protenas recibe el nombre de traduccin (Fig. 24.6).
El estudio de la sntesis de los lpidos de membrana se hace mucho ms difcil por
la heterogeneidad estructural de estos compuestos. Sin embargo, las experiencias
midiendo la incorporacin de ["HI-colina o ["]-inositol permiten afirmar que estos
componentes celnlares tambin se sintetizan de forma continua durante el ciclo celu-
lar (Figura 24.7).
Estndios similares demuestran que tambin es continua la sntesis de polisacridos
complejos y otros componentes celulares.
Si se estudia la velocidad de sntesis de muchos de estos componentes y se calcula
el incremento de concentracin que deba producirse en un perodo determinado, y se
compara con el incremento que realmente se ha producido, determinado de manera
experimental, se comprueba que el incremento observado es siempre menor que el
esperado.
Esto significa que los componentes celulares esin sometidos a un recambio cons-
tante, o sea, que son degradados constantemente. Los incrementos de concentracin
que se prodncenson entoncesla resultantedela intensidad con que transcurren los 2
procesos contrarios: la sntesis y la degradacin. Estos resultados constituyen una
evidencia ms del principio del recambio continuo.
Los fenmenosde conservacin. trasmisin v exnresin de la informacin gentica
u .

esin ubicados de forma continua o discreta a lo largo del ciclo celular; su ubicacin y
los mecanismos moleculares de esos procesos, son los aspectos que sern abordados en
los captulos siguientes.

Fig. 24.6. Estudio de la traduccin durante


cl cielo celular. (a) El contenido
total d e prnirinas celulares se
incremcnta de forma continua dii-
rante el ciclo celular. (0) La incor-
poracin deaminocidos a las pro-
tenas, medida con PHI-prolina sc
producc con intensidad variahle
durante todo el ciclo. Los resulta-
dos de estos experimentos confir-
man que la sntesis de protenas se
produce de forma continua.

fig. 24.7. Estudio de la sntesis de lpidos de membrana durante el cielo celular. (a) La figura muestra
que el contenido celular de fusfolipidos aumenta de forma continua durante el ciclo celular.
(b) Resultado del estudio de incorporacin de ['HI-colina (precursor de la sntesia de
fosfatidil-colina y esfingomielinas) muestra que sta es continua durante el ciclo. Los 2
experimentos dcmucstran que al igual que otros componentes moleiulares, la sintesis de las
lpidos de las membranas es un proceso continua.

Componentes celulares y Gentica molecuiar 433


Reguiacih del cielo celular
Era de esperar que un proceso tan importante como el ciclo celular estuviera bajo
un preciso sistema de regulacin, pera hasta la segunda mitad de la dcada de los aos
80 estos mecanismos eran casi desconocidos. Debido a los progresos alcanzados en el
estudio de la transformacin cancerosa se ha logrado comenzar a penetrar en las carac-
tersticas moleculares de esos mecanismos. Quedan aspectos esencialespor resolver,
pero existe en el momento actual una visin bastante aproximada de los mecanismos
moleculares bsicos que controlan el ciclo celular.
En este procesa existen mecanismos positivos que estimulanla proliferacin celular,
y los negativos, que la inhiben. En ambos casos, al menos en las clulas en cultivos y las
de los individuos adultos,las seales estmulos quedesencadenanLas respwstas,provie-
nen del exterior de la clula. El grupo mejor conocido de seales positivas est constitui-
do por un gmpo de polipptidos conocidos como factores decrecimiento,los cuales son
especicospara tipos particulares de clulas. Estos factoresseunen con receptores espe-
cicos localizadosen la superficiecelular; a partir de esa unin se produce la activacin
de un gmpo de protenas quinasas, que en forma de cascada enzimtica,van transriendo
lainformacin mibidadel exterior hacia el ncleo celular, donde se activa la replicacin
del ADN primero y la divisin celular despus.
Las seales negativas son menos conocidas, pero su existencia no se discute. Esta
certeza nace de la observacin de la inhibicin del crecimiento por contacto, o sea,
cuando se cultivan clulas stas crecen y van cubriendo la superficie del soporte
donde fueron sembradas, hasta que entran en contacto unas con otras, cuando el creci-
miento se detiene.
Sin embargo, a pesar del gran nmero de seales ambientalesque iduyen sobre la
progresin del ciclo celular, las molculas participantesen la ltima etapa del proceso
de regulacin se reducen a unas pocas familias de protenas, algunas de las cuales
presentan actividad enzimtica.
Los estudiosmsintensos se han &do en levaduras,un eucariontemonocelular,
en las cuales es mucho ms Ecil la obtencin de mutantes que en clulas de organimos
superiores. Los mutantes que exhiben alguna alteracin del ciclo celular han sido
denominados CDC (cell division cycle) y se han ido numerando de acuerdo con el
orden de aparicin. Se ha comprobadoque cada uno de ellos presenta alteracionesen
un gen nico. Genes homlogos a los CDC de levaduras han sido identificados en
otrasespecies, incluyendo al hombre, y casi siempre se refieren con la mismanomen-
clatura que los delevaduras.
Entre las familias protenicas implicadas en este proceso se incluyen las siguien-
tes: las ciclinas, las proteinas quinasas dependientes de ciclinas Cdk (cyclin-dependent
kinases), los inhibidores de las Cdk (CDI),las fosfoprotenas fosfatasas y otras prote-
nas con diversas funciones, casi todassustratos de las quinasas. A estos grnpos deben
agregarse todas las especies moleculares que intervienen en la replicacin del ADN y
que sern estudiadas en el captulo siguiente.
Las ciclinas son un grupo de protenas con relativo bajo peso molecular, que
pueden ser consideradascomo el componente principal de estos mecanismos regula-
dores. Su nombre deriva del hecho de que su concentracin vara en forma cclica
durante el ciclo celular. En un momento determinado su sntesis es estimulada y su
concentracin aumenta de manera brusca en la clula, pero momentos despus son
degradadas a gran velocidad y su concentracin intracelulardisminuye. Por ejemplo,
la ciclina B comienza a sintetizarse al final de la interfase y su concentracin se
incrementa notablemente, mientras el ciclo progresa hacia la mitosis, pero una vez
alcanzada la metafase se degrada de forma que al final de la mitosis su concentracin
intracelular es casi cero. Las ciclinas funcionan como las subunidades reguladoras de
las Cdk (Fig. 24.8).

434 lhqwmcu MiCdk4


-
Fie. 24.8. Variacin de la concentracin de ciclinas durante el cielo celular. Se muestra como la
concentracin de eada una de las principales cidina flucta durante el ciclo celular. En todos
los casos la concentracin aumenta rpidamente en un momento, debido al incremento de
la sntesis, Se alcanza un nivel mximo cuya duracin es diferente para eada una, y despus
se produce un rpido descenso debido a 1s degradacin de estas protenas. Sin embargo, la
concentracin de las quinasas dependientes de ciciinas (Cdks) se mantiene invariable duran-
te todo el ciclo. Como las auinasas son inactivas en ausencia de eiclinas en cada etapa del
ciclo su especificidad ser diferente en dependencia de la cielina a la cual est unida.

Las protenas quinasas dependientesde ciclinas (Cdk) son enzimas que transfie-
ren un grupo fosfatodel ATPhacia residuos de serina o treonina de protenas sustratos.
Las Cdk resultan a su vez reguladas por ciclos de fosforilacin -desfosforilacin.
La enzima mejor estudiada es la Cdk2 que contiene 3sitios de fosforilacin: uno en la
treonina 14(T14),otro en la tirosina 15 W15) y el tercero en la treonina 161 (T161). La
fosforilacin de los 2 primeros sitios tiene un efecto inhibitorio, mientras que la del
tercero es activante. Existen quinasas especficas para la fosforilacinen TI4 y Y15.
La fosforilacin en TI61 se realiza por la quinasa activadora de la Cdk2 (CAK),cuya
subunidad cataltica es la Cdk7 y la reguladora es la ciclina H. Si la Cdk2 est
fosforilada, pero no est unida a ciclinas, puede ser desfosforilada por la fosfatasa
asociada a las quinasas (KAP), pero en presencia de la ciclina esta desfosforilacin
no es posible (Fig. 24.9).

ATP ADP

Fig. 24.9. Activacin de las quinasas de-


pendientes de eiclinas. La estruc-
@$i, T161\@ tura de las Cdks contienen 3 sitios

c'
de fosforilacin y uno de unin a
8 las eielinas. En ausencia de las
cielinas y de la FosForilaein son
inactivas. La fosforilacin de los 3
sitios las mantiene inactivas aun
.- . @ cuando estn unidas a las eiclinas.
El estado totalmente activo se al-
$
\; cama cuando la quinasa unida a la
-O5 T161\@ eiclina est fosforilada slo en la
~ ~

treonina 161.

A diferenciade las ciclinasllas Cdk se sintetizan de forma constitutiva durante


todo el ciclo celular, pero son inactivas a menos que estn unidas a un tipo particular
de ciclinas y de ah so nombre. Las ciclinas no poseen actividad cataltica, pero son 1%
que determinan la especificidad de sustrato de las quinasas.

Componentes celulares y Gedtica molccular 435


Entrelas fosfoprotenasfosfatasas que participan en el ciclo la ms conocida es la
-
Cdc25.. aue cataliza la hidrlisis de los enlaces ster fosfricos de la Cdk2 en T14 v
Y15. Otras fosfatasasmenos especfia tambien i n t e ~ e n e n .
Los inhibidores de las quinasas dependientes de ciclina (CDI) son un grupo de
protenas cuyas masas moleculares estn en el rango de 15a 30 kD, y los hay con un
elevado grado de especificidady otros mucho menos especficos.
Una vez conocidos los componentes moleculares que intervienen en la regula-
cin del ciclo, es conveniente dar al menos una idea de cmo transcurre el proceso,
aunque es bueno recordar que todava no se conocen todos sus aspectos.
Al comenzar la etapa G, comienza a incrementarse la sntesis de la ciclinaD, la
cual al unirse a la Cdk4 dirige la actividad de esta enzima hacia ciertos sustratos
especficos, cuya actividad promueve la progresin del ciclo por esta etapa. En la
transicin entre G, y S, la ciclina D es degradada. Al final de G, haba comenzado la
sntesis de la ciclina E que alcanza su concentracin mxima precisamenteal comien-
zo de S. El complejo EICdk2 fosforila protenas relacionadas con el comienzo de la
replicacin del ADN. La progresin de la etapa S depende de la actividad del complejo
NCdk2 La relacin entre las concentracionesdelas ciclinas E y A modula la activi-
dad de la protena E2F, que es un factor que activa la expresin de los genes relacio-
nados con la fase S. Al inicio de esta fase, cuando predomina la ciclina E, el
complejo EICdk2 activa a E2F, pero en la medida que la fase progresa la concen-
tracin de la ciclina E disminuye y aumenta la de la ciclina A, que al formar el
complejo NCdk2 provoca la inhibicin de E2F. En el trnsito de S a G,comienza
a incrementarse la concentracin de la ciclina B. Los complejos formadospor la Cdkl
con la ciclina B son conocidos como factor promotor de la mitosis (MPF).
Al llegar a la metafase el MPF estimula la degradacin de las ciclinas con la cual
se produce la inactivacin del propio MPF, y se induce la anafase. Las ciclinasA son
degradas antes que las B. Esta inactivacin del MPF y la degradacin de las ciclinas
son necesarias para la culminacin de la mitosis (Fig. 24.10).

ATP

F i s 24.10. Las Minas v la oroeresin del

ten& de un compleja especfico


ciclinaK!dk. En G , el papel predo-
minante lo tiene el complejo ciclina
DICdk-4. En el resto de las fases In
actividad de la Cdk-2 unida a di-
ferentes eiclinas es la responsable
de hacer progresar el cielo hasta
ATJ ADP

alcanzar la divisin celular.


ADP

Falta an mucho por descubrir sobrelas molculasy mecanismos implicados en el


control del ciclo celular, pero cada da el conocimiento cientfico refleja con mayor
grado de aproximacin la realidad de este proceso. Su conocimiento cabal no es slo
un problema interesante desde el punto de vista biolgico, es tambin importante para
.
la ~rcticamdica cotidiana. Se ha demostrado ane aleunos de los comnonentes de
este sistema estn relacionados con la gnesis del cncer. De hecho fueron las investi-
gaciones acerca de los mecanismos moleculares del cncer las que dieron el impulso
necesario para la investigacin en este campo. Es necesario tener presente que mien-
trasmayor y ms profundo sea el conocimiento sobre la gnesis de esta enfermedad,
mayores sern las posibilidades de encontrar un tratamiento eficiente para combatirla.

Resumen
El elevado grado de organizaci6n que caracteriza a los seres vivos se mantiene
gradas a la informaci6n moleeular, ata puede ser de tipo seeueneial, adecuada
para la conse~1sci6ny la trawiisi611, y de tipo oonformaconal, apropiada para la
expresi6n. El principio de transierencia de iniormaein establece que la informa-
d6n m o l e d a r Buye desde la seniencid hacia la conformacional.
El ciclo celular comprende todas las transformaciones que las clulas experi-
mentan durante su vida En l se &Onguen 4 etapas: la M o de divisin celular, la
S o de shteala del ADN, asZ como las etapas G, y G, que separan las 2 etapas
anteriores. Los principales componentes maeromoleeularesde las clulas se sinte-
tizan de forma discreta, corno el ADN y las hiptolfas; y de forma continua,comolos
ARNs,las proteinas y los pidos componentes de las membranas. Para el estudiode
estos asoectos se utilizan las tcnicas de cultivos de clulas de crecimiento
sincron&ado y de captad611de precursores radhcvos, entre otres.
Los meeaatsnios moleculares de regulacin del dclo celular no estn total-
mente conocidos. Se sabe que exbten factores reguladores positivos y negativos, asZ
como un grupo de familias protelaicas implicadas en el proceso. Las cielines ac-
tan sobre las Cdk y determinan su especWiddad de aeei6n, con lo cnai resultan
fosforllados determinados sustratos en momentos claves del ciclo celular. Las
fcdntasas y los inbibidores de las quinasas contribuyen a la modulsd6n na de
estos mecanismos. El conodmiento del ciclo celular tiene importancia en la prc-
ca mdica por su vinculad6n con la gnesis del cncer.

Ejercicios
1.&Qurelacin existe entre la desaparicin del nuclolo durante la profase y los
datos conocidos sobre las caractersticas de la sntesis de ARN durante el ciclo
celular?
2. Se dice que la existencia de las cromtides es la expresin citogentica de la
duplicacin del ADN Por qu?
3. cules son las caractersticasestructurales que debe reunir una macromolcula
para presentar informacin secuencial y cules para la conformacional?
4. Un cultivo de clulas no sincronizadose expone a "C- inositol durante un breve
perodo, despus se lavan las clulas para eliminar el exceso, se someten las clulas
a un proceso de autorradiografa y al revelar la placa se encuentran que todas las
clulas incorporaron el 14C-inositolcon igual intensidad &Culesseran las conclu-
siones del experimento?Cul de los componentescelularesse estaba estudiando?
5. Si el experimento de La pregunta anterior se hubiera realizado con clulas de
crecimiento sincronizado,sena igual la interpretacin de los resultados?
6. Algunos autores sugieren que cuando se trata de clulas eucariontes, sera ms
correcto decir la duplicacin de la cromatina que la duplicacin del ADN &Enqu
se fundamenta esta afirmacin?
1.a transferencia de la iuforinacin gentica de padres a Iiijos constituye el fen-
inenn mis iinportantc de la materia viva,esto no slo garantiza la sucesin deba vida,
sino i1dei116s.constituye el inecanismo bsico de conservacin de las especies, pues
los drscendientes siemprc poseen caractersticas estructurales y funcionales similares
a los progcnitorcs. I'.n los orjianisinos monocelulares esta transferencia es directa,
pues se prndiicc por el iiiccanis~node divisin celular ya estudiado (captulo 23). En
los or~iiiisiiiospliiriceliilarcs, sin embargo, existen clulas especializadas en esta
fuiicii>nque son Lis ci.luliis scxii;iles. [.as clulas sexuales niasculina (espermatozoide)
y f~iiieiii~ias
(i,viilo).portando cada una la informacin gentica de la especie, se unen
en la fecundacii,~~ y mediante procesos coiiiplejos, ms o menos prolongados, dan
origen al or~aiiisiiioionipleto. Al ser los ganietos haploides en la fecundacin se
rcstituyc el nnier diploide caracterstico de la especie. Como la fecundacin es
especifica. todos los seres vivos darn descendientes iguales a s, o sea, de la misma
especie; esa transferencia de informacin de una clula o un organismo a sus des-
cendientestiene su fundamento molecular precisaniente en la duplicacin o replicacin
de los cidos desoxirribnnucleicos.
La replicacin de los ADN de doble cadena es un proceso comple.jo que no est
conipletainente esclarecido. Esta complejidad se deriva de diferentes factores como
son: la estructura tridimensional de los ADN y su grado de superenrollamiento, la
especificidad de las protenas replicativas, la necesidad de una fuente energtica y la
elevada fidelidad que requiere el proceso.
Las dificultades para su comprensin aumentan al no existir una forma nica de
replicacin para todos los organismos que contienen ADN de doble cadena.
En este textose examinarn alguna caractersticas comunes a la replicacin de los
ADN de doble hebra. Despus se estudiar de forma ms detallada cada aspecto del
proceso, se comenzar por los organismos procariontes y se concluye con los aspectos
conncidosdel pmceso en los organismeucariontes. Cada etapa se esiudiar de acuerdo
con los conncimientosactuales. El aspecto ms desarrollado ser el sistema replicativo de
la bacteria E. coli, por ser el mejor conucido de todos y porque a partir de lasinvestigacio-
nes en este organismose han podido comprenden muchosde los mecanismosimplicados,
y establecer los modelos, tanto tericos como experimentales,para el esclarecimientode
un fenmeno tan trascendental en los seres vivos.

Historia del problema


Unas semanasdespus de dar a la publicidad el modelo molecular del ADN en 1953,
JamesD. Watson y Fm~cisH.Cndipmpu~ieronun modelo general para la mplicacin, eJ
cual consista en que cada una de las cadenas de polidesoxinucletidos servademoldeo
pahn para la formacin de unanuevacadena complementaria alaoriginal. Esta hipte-
sis ofree'a 2 posibidadesfundamentales:la conservativa, en la cual una vez sintetizadas
las nuevas cadenas,stas se separaban del molde y se apareaban entre sdando lugar a una
nueva molcula de doble banda, y la semiconservativa,en la que las nuevas molculas
estan'an formadas por unacadenadelmolde y otra recin sintetizada.
En 1957,MathewS. M&n y Franklin U!Stahldiseamnuneleganteexperimen-
topara dilucidar cul de las modalidades era la que realmente ocum'a en la naturaieza
EUos uolizaron cultivosde E. colideloscuales extraan el ADN y locentrifugabanen un
gradiente de densidad de CsCI, observando que dicho ADN se concentraba en una
estrecha banda en el tubodela centrfuga,dondela densidad dela muestra coincidacon
la del mediode centrifugaun;cultivaronentonceslas bacterias enun medio cuya nica
fuente de nitrgenoeraNH,CI marcado con 15N;este ltimo no es radiactivo,pero sms
pesado que el istopo habitual I4N.Al extraer el ADN y centrifugarlo, se obtena igual-
mente una banda, pero localizada ms hacia el fondo del tubo. Si las clulas se hacan
crecer en un medioligero (con "N) durante un tiempo prolongado, despus se transferan
a un medio pesado (con '=N) y se dejaban el tiempo necesario para que ocurriera un solo
ciclo replicativo,seexhaa el ADN, secentrifugaba y seobtena de nuevo unasola banda,
pero su localuacinera intermediaentre las 2 anteriores. Estas resultadosse interpretan
de la forma siguiente: si la replicacin fuera conservativa al pasar al medio pesado, se
encontraran 2 tipos demolculas,lasligerasque sirvieron de molde y las pesadas recin
formadas.Alaparxerunasola banda,secompnieba qnesloexisteunaespeeiemolecular
y,como su posicin en el tubo dela centrfugaes intermedia entrela pesada y la ligera, se
concluye que est formada por una cadena pesada y otra Ligera, o sea, la replicacin es
semiconservativa (Fig. 25.1).

Fig. 25.1. Experiencia de Messelson y Stalh.


Esta experiencia demostr que al
menos en la E col la replicacin
tenia carcter semiconservativo.
(a) Se muestra cmo las bacterias
al crecer en un medio can "N, su
ADN, al ser centrifugado en
gradiente de CsCI, se agrupa en
una fina banda donde su densidad
corresponde con la del medio de
eentrifugacin. Si crecen en ''N
forman tambin una banda, pero
desplazada haeiael fonda del tubo,
pues su densidad es mayor. Si se
les hace crecer primero en ''N y se
pasan al medio con "N, slo se
mantienen en ese media el tiempo
necesario para un ciclo replicativo,
aparece una sola banda cuya den-
sidad es intermedia entre las 2 an-
teriores, lo cual significa que ta-
das las molculas tienen la misma
densidad y esta slo es posible si
cada una de ellas contiene una ban-
d a con "N y otra can "N, que la
repltaein es semiconservativa.
(b) Se observa que el ADN de hac-
terias quc crecieron en 'N y des-
pus fueron transferidas a un me-
dio con nitrgeno ligero forma una
sola banda, pero que al dejarlas
crecer despus en un medio can
nitrgeno ligero en cada ciclo
replicativo,la bandaque representa
al ADN hibrida se hace cada vez
m i s tenua, en tanto la del ADN
con nitrgeno ligero se hace cada
vez ms intensa.
Los intentos por llevar a cabo la replicacin in vitro comienzan a tener sus
primeros xitos cuando, en 1955, Arthur Kornbergdescubre una enzima capaz de
formar polidesoxinucletidos a la que llam ADN polimerasa (hoy ADN polime-
rasa 1 o pol 1); despus de mltiples esfuerzos infructuosos por utilizar sistemas de
clulas animales se decidi utilizar extractos libres de clulas de E. coli y, como
ADN a replicar, el del virus $X174; para ello se sigui el procedimiento siguiente:
el ADN molde se obtuvo del $X174 y se marc con tritio, el istopo radiactivo del
hidrgeno, el tritio servira despus continuamente como seal para identificar el
molde. Se ariadieron al molde junto con dATP, dTTP, dCTP y dGTP, la
ADN-polimerasa, ADN-ligasa (descubierta por aquel entonces) y NAD+. Uno de
los dNTP estaba marcado con fsforo radiactivo que servira para identificar el
material sinttico, al igual que el tritio para el molde. La interaccin entre los
reactivos tuvo lugar hasta que el nmero de unidades nucleotdicas polimerizadas
fue exactamente igual al nmero de nucletidos del molde, lo cual poda determi-
narse fcilmente comoarando la radiactividad del tritio en el molde con la del
fsforo en el material sinttico. Varios medios fsicos, incluidos el microscopio
electrnico, demostraron que la replicacin haba ocurrido de forma completa.
Experimentos posteriores pusieron de manifiesto el carcter infectivo del ADN
sintetizado in vitro, con lo cual se comprobaba que era igual al molde utilizado,
es decir, que tenan la misma estructura y funcin. Todo este trabajo se extendi
durante 14 aos hasta que se pudieron anunciar los resultados. A partir de ese
momento comenz, ya sobre bases firmes, el trabajo para desentraar el mecanis-
mo de la replicacin.

Aspectos generales
Toda la informacin gentica contenida en el ADN reside en su secuencia de
bases, por lo tanto la funcin primordial de cualquier modo de replicacin es duplicar
la secuencia de bases de la molcula progenitora. La especicidad de los apareamientos
de bases -adenina con timina y citosina con guanina- provee el mecanismo usado por
todos los sistemas replicativos.
Otro aspecto comn es que los nucletidos son aadidos uno a uno al extremo
3 ' - 0 H de una cadena en crecimiento por enzimas llamadas ADN-polimerasas. La
secuencia de bases de cada una de las cadenas del ADN es copiada en forma
complementaria, as cuando en la hebra que sirve de molde aparece la timina, en la
hebra nueva se incorporar adenina y lo mismo sucede al aparecer cualquiera de las
bases.
En los ADN de doble hebra el proceso de replicacin se produce copindose
ambas cadenas de manera simultnea, por lo que las molculas formadas conten-
drn una banda que proviene del ADN, que sirve de molde o patrn y una banda
neoformada. Como la molcula de ADN que se est copiando est formada por 2
bandas complementarias, y cada una de ellas sirve de molde para la sntesis de una
cadena nueva, resultar que gracias a este mecanismo las molculas nuevas no
slo sern iguales al molde en su secuencia de bases, sino que sern iguales entre
s. De acuerdo con el mecanismo explicado, las molculas de ADN de doble hebra Fig. 25.2. Carcter semiconservativo. El
modelo general de la replieaein
que se obtienen como resultado del proceso contienen una cadena del ADN que acorde con la experiencia dc
sirvi de molde y una cadena nueva, lo que significa que durante la replicacin se Mcsselson y Stahl consiste en que
conserva la mitad de la molcula original, por lo que se dice que este proceso es una molcula duplohelicoidal de
semiconservativo (Fig. 25.2). ADN (a) se separa en sus 2 eadc-
nas y cada una dc ellas sirve dc
La reaccin bsica de la polimerizacin consiste en la adicin de un molde para la sntois de la cadena
desoxinuclesido trifosfatado al extremo 3 ' - 0 H del desoxinucletido precedente, complementaria. Cada molcula
eon la liberacin de pirofosfato, la cual conduce a la formacin del enlace fosfodister; nuera h) est formada por una
esto quiere decir que la cadena se va formando del extremo 5 ' -P al 3 ' -OH, luego el banda parental (en azul) y una
neoformada (en rojo). Luego to-
crecimiento de la cadena es unidireccional. das ellas san iguales entre s.
Esta reaccin es muy reversible,pero el acoplamientoa la hidrlisisdel pirofosfato
favorece el crecimiento de la cadena -la reaccin global de polimerizacin (Fig. 25.3).

Fig. 25.3. Reaccin de polimerizacin. To-


das las ADN polimerasas eatalizan
la misma reaccin. Tomando coma
sustratas nuclesidos trifosfatados
(NTP), los unen mediante la far-
macin de un enlace fosfodister.

can liberacin de P-P, cuya


hidrlisis impulsa la reaccin ha-
cia la derecha. El ion MP* es im-
prescindible.

Las cadenas de las molculas de ADN son antiparalelas (de polaridad opues-
ta); esta disposicin es la que- permite
- me,jor apareamiento de las bases. En el
proceso de sntesis, las polimerasas se van desplazando sobre la cadena de ADN
en la direccin 3 ' -t 5 ' a la vez que forman la nueva cadena en sentido 5 ' + 3 ' ,
lo une significa uue el uroceso Dresenta tambin carcter antiuaralelo: esto hace
que la doble hebra que se va formando tenga ya una estructura en doble hlice como
las molculas originales, lo cual le confiere una elevada estabilidad (Fig. 25.4).
En resumen, la replicacin se produce por complementaridadde bases, aadidas
una a una en forma unidireccional y antiparalela, tiene carcter semiconservativo y
est acoplada a la hidrlisis del pirofosfato.

Requerimientos de la replicaci6n
Para que la replicacin tenga lugar hace falta un nmero considerable de molcn-
las, en especial de macromolcnlas,entre ellas se encuentran los 4 tipos de nuclesidos
.
trifosfaiados v los 4 desoxinuclesidostrifosfaiados. as como iones divalentes.. esDe-
cialmente el Mg2+que siempre acompaa a los nncletidos en sus reacciones. El total
de protenas que participa en la replicacin es desconocido, pero se sabe que constitn-
ye un nmero considerable,entre ellas se encuentran las protenas estabilizadorasdel
Etapas de la repiicaun
El estudio de la replicacin ha sido dividido de forma tradicional en 5 grandes
etapas, cuyo conocimiento no es uniforme, pues la complejidad de cada una es diferen-
te. La preiniciacin consiste en el ensamblaje del sistema replicativo; la iniciacin, en
la colocacin adecuada del primer precursor: la elongacin, en el crecimiento de la
cadena y la terminacin, en el final del proceso, as como la posterminacin se refiere
a modificaciones que experimenta la molcula recin formada hasta ser totalmente
funcional.
Estas mismas etapas, aunque con contenidos diferentes, sern consideradas en los
dems procesos -transcripcin y traduccin- relacionados con los mecanismos de
transferencia de la informacin gentica y se resaltar la similitud formal que existe
entre ellos.

Como sucede casi siempre en la ciencia, los estudios experimentales sobre la


replicacin comenzaron por los organismos ms sencillos y, a partir de ellos,se esta-
blecieron no slo los modelos tericos, sino tambin los procedimientos experimentales
para los estudios en organismos ms complejos.
Este estudio comenz por los organismos procariontes y especialmente por los
virus que los infectan que, como utilizan una parte considerable del sistema replicativo
del hospedero, pueden considerarse, teniendo presente las diferencias de complejidad,
como una buena aproximacin al estudio del proceso en las clulas bacterianas.

De todos los sistemas replicativos estudiados el mejor conocido es el de la bacte-


ria E. coli, un procarionte, cuyo cromosoma contiene una molcula nica de ADN
circular dedoble hebra,de aproximadamente4x 106pb.Si se representa esa molcula
como un crculo en el cual se va sealando la localizacin relativa de los genes, se
obtiene el mapa gentico de E. coli; este crculo ha sido dividido en 100 unidades
denominadas minutos. Siguiendo el smil con el reloj, el punto O del mapa se corres-
ponde con las 12, el 25 con las 3, el 50 con las 6 y el 75 con las 9, de esta manera la
posicin de un gen o una regin del ADN queda definida por el minuto o los minutos
que le corresponden en el mapa. Para dilucidar el mecanismo replicativo se han utili-
zado tanto tcnicas bioqumicas,por ejemplo la extraccin y purificacin de los com-
ponentes del sistema, como procedimientos genticos que consisten en la produccin
de organismos mutantes,en loscuales se detecta la falta de algunos delos componen-
tes y se correlaciona con los defectos producidos en el proceso; esto hace que el
sistema replicativo sea estudiado con ms detalle y que pueda servir de punto de
referencia para el estudio de los dems sistemas.
Es conveniente esclarecer la nomenclatura. En la gentica de la E. coli, los genes
se designan por 3 letras minsculas y, cuando hay varios relacionados, se aade una
letra mayscula por orden alfahtico; los relacionados con el metabolismo del ADNse
nombran dnaA,dnaB,dnaC,etctera.Por su parte, el productodel gen se escribecon
los mismos smbolos, pero con la inicial mayscula; de esta forma DnaB es la protena
productodel gen dnaB. Es costumbre utilizar las abreviaturas del nombre en ingls,
pues es el idioma preferido en las revistas cientficas de circulacin internacional. En
todos los casos se mencionar la palabra inglesa de donde proviene la abreviatura
empleada.
Origen de la replicaci6n

El ADN de la E. coli se presenta en la clula con determinado grado de


"empaquetamiento" y superenrolladode forma negativa. Para que la replicacin pueda
producirse es necesario aumentar el grado de superenrollamiento negativo y adems
producirla separacin delas 2 cadenas, de forma quelas bases nitrogenadas queden
expuestas y puedan servir de molde o patrn para el ordenamiento de las bases
nitrogenadas de la cadena que debe sintetizarse.
En la E. coli esto ocurre siempre en un punto fijo del ADN, que se conoce como
origen de la replicacin, oriC localizado en los 84 minutos del mapa gentico. En el
ciclo celular bacteriano se llama Cal perodo de replicacin del ADN, es aproximada-
mente de 40 minutos, y el tiempo necesario para la segregacin del citoplasma y la
formacin del septumllamado D es constante e igual a 20 minutos, despus de terminar
la replicacin del cromosoma. Por lo tanto, el ciclo vital de E. colitiene una duracin
aproximada de 60 minutos. Mucho se ha investigadosobre las caractersticas del ADN
en esta regin; se ha llegado al convencimiento de que se trata de una secuencia de
bases especficasque sirve como seal molecular para indicar dnde debe comenzar la
replicacin.
Para localizar laseal se tomaron fragmentosde ADN, seincorporaron aplsmidos
que se replican de forma autnoma y se insertaron en la zona donde habitualmente
comienza la replicacin de plsmido. Si este ADN lograba replicarse, la secuencia
introducida funcionaba como seal de iniciacin, de lo contrario se probaba con otra
secuencia. Por medio de estos estudios se ha podido determinar el origen mnimo de
replicacin, o sea,la secuencia de ADN ms corta que puede cumplir eficientemente
esa funcin. Se trata de una secuencia de 245 pb, muy conservada entre las
enterobacterias y que contiene 3 regiones caractersticas:

1.Cuatro copias de la secuencia 5' -TTAT(C/A)CA(C/A)C-3', 2 en un sentido y otras


2 en sentido contrario en posiciones muy conservadas, designadas R l a R4, que
sirven para la unin de DnaA.
2 . h z o n a s d e 13uucletidos,cada una rica en p a r e AT (5 '-GATCTNTlWTTTC3'),
se localizan a la izquierda de las anteriores y favorecen la desnaturalizacin local del
ADN. En lasecuenciasealaday en todas de aquen adelante N representa acualquier
nucletido.
3. Once copias de la secuencia 5 -GATC3', que es el sitio de reconocimiento de la
metilasa codificada por el gen dam. La Dam metilasa reconoce esta secuencia y
metila la citosina. Al parecer el grado de metilacin es importante para la unin del
ADN a la membrana de la bacteria.

Eventos previos a la iniciad611(preiniciaci6n)

El primer evento es tener acceso al sitio oriC, lo cual se logra por la accin de las
topoisomerasasde tipo U, que por su modode actuar, como se muestra en la figura 25.5,
favorecen la formacin de topoismeros negativos que son los adecuados para la
repcacin. La preiniciacibn consiste en la separacin de las 2 cadenas en el oriC, de
Inanera que las protenas replicativas puedan acceder a la secuencia de bases del ADN.
Como esta separacin origina superenrollamientos positivos hacia a ambos lados
de oriC, son necesarias las topoisomerasas tipo 1 y tipo 11 para mantener el
superenrrollado negativo requerido para la replicacin.
Los eventos queocurrenen oriC tienen el orden siguiente: la protena DnaA se va
uniendo a las secuencias de 9 nucletidos R1-R4 de forma cooperativa, y adems,
favoreciendointeraccionesentre ellas, de manera que al oriC pueden quedar unidas de

Compoaentes celulares y Genticu md& 445


liig. 25.5. Accin de la topoisomfrasa 11. El
ADN circular de la E. col existe
superenrollado negativamente y es
la topoisomerasa 11 la que se une
al AUN, y corta la molcula cn sus
2 bandas (a) luego cruza la banda
intacta por la abertura y vuelve a
sellar (b) haciendo cada v e z el
topoismero ms negativo que es
la forma que favorece la
replieacin. En la figura se rcpre-
sentan las 2 mitades de la molcu-
la en calores diferentes para difc-
rcneiar su recorrido.

10 a 20 molculas de DnaA. Este proceso requiere la hidrlisis del ATP y es muy


estimulado por la HU,una protena parecida a las histonas,la cual provoca dobleces de
hasta 90" en el ADN y hace pensar que su funcin es cooperar con DnaA en el plega-
mientodel ADN. De esta forma. el ADN se enrolla alrededor del multmero de DnaA
provocando la separacin de las 2 cadenas en la zona de 13nucletidos ricos en AT
que se abren de manera secuencial, primero, la ms cercana a R1 y despuslas otras. En
esas condiciones DnaA gua la translocacin hacia la zona abierta de un complejo
formado por DnaB y DnaC, formando el llamadocomplejo de preiniciacin.
En presencia de la ADN girasa (topoisomerasa 11) y de SSB,la DnaB que posee
actividad de helicasa 5 ' 3 3 ' procede a alargar la abertura del ADN, para lo cual
requiere la hidrlisis del ATP, de estamanera queda formada una estructura en forma
de burbuja u ojal, donde las hebras estn recubiertas por SSB. Los extremos del ojal
forman las horquillas de replicacin y obviamenteson 2; en cada una delas horquillas
se produce la replicacin y, como en la medida que avanza el proceso ellas se van
separando, la replicacin toma carcter bidireccional (Fig. 25.6).

Dna A + HU

Fig. 25.6. Formacin de la horquilla de


replican. Las regiones R1 a R4
sirven de sitio de unin a DnaA
que, con Is cooperacin de HU y DnaB
Dna B: DnaC
Dna C
el ATP, forman agregados que van
+ ATP
eurvando al AUN hasta que ste
queda enrollado a su alrededor.
Esto crca tensiones que se alivian
cuando las 3 secuencias ricas en
pares AT se separan, originando
pequefios sectores de hebras sim-
ples. La accin combinada del
compleja DnaBIDnaC y las SSB
estabilizan esta estructura en for-
ma de ojal sobre la cual sf forma-
rn las horquillas de replicaein.
En resumen, la preiniciacin consiste en la separacin de las 2 hebras del ADN en
oriC, para formar 2 horquillas de replicacin. Para su formacin son necesarias las
protenas DnaA, DnaB, DnaC, HU, ADN @rasay SSB, as como la hidrlisis del ATP.

Iniciaun

Pdiahacerp~lahorq31aeswcesaiwotro~pode pmteiasAlquedarsepaiwi;s
las 2 hebras del ADN quedaexpuestaunasecuenciadeunos70 nuclebodos,denomnadasitio
deensamblajedel Uii&doroPAS@~earsambly~~).ElsiooPASsmnocidoporla
protena PriA,quese une a l y permite la unin posterior dePriB; entoncesse une DnaT y
pmmuevehaciaeesitiolatranslocaandeun~mplejo~nstituidoporDnaB:DnaC:PnC El
complejo de 6 protanas formado se mueve sobre el ADN en las 2 direcciones gracias a la
actividad de helifasa 5 ' 7 3 ' de DnaB y la 3 ' +S ' de%.
En lugares especficosel complejo reconoce alguna serial y a l se une la DnaG que
tiene actividad iniciadoray forma polirribonncletidosde aproximadamente 10unida-
des de largo, el ARN iniciador. La accin iniciadora deDnaG dependede la presencia de
DnaB; esta acciGn c-mhinada de iniciadorasy helicasas esuntemaque se repite en todos,
o casi todos los sistemas replicativos estudiados. Al conjunto de todas estas protenas,
incluyendo a DnaG se le denomina complejo iniciador (Fig. 25.7).

-9As
~-...
5' 3'

3' I I I I I I I I I I 5'
1 PAS
Pri A. P B: Dna t

5'

3' 5'

O Pri C: Dna B: Dna C


1 l I I W I I I I I I l I I I I l 1 I
I I I I 1 1 I I I I I I l I ~ l l l I I 5'

5'
t &/+SD
n Dna
I I I I I I I I I Y - I / R W I I I I I l l l
3' l l l l l l l I I I I I I I I I
5'
-+
NTP

Fig. 25.7. Formacin del corpsculo iniciador. Al pmgresar la abertura del ojal se descubre el PAS al
cual se unen en forma sucesiva PriA, PriB y DnaT, y estos a su vez promueven la incarpa-

polimerasa iniciadora y se forma el ARN iniciador.


En estas circunstancias se une al sistema la holoenzima de la ADN polimerasa 111
en un proceso dependientede ATP. La enzima utiliza el C3 ' - 0 H de los ARN iniciado-
res para alargarlos, por la sucesiva adicin de desoxinucletidos uno a uno segn la
secuencia de las hases nitrogenadas del ADN molde. Este complejo protenico recibe
cl noinhre de replisoma.
La ADN polimerasa 111 de E. colies una enzima muy compleja formada por al
incnos 10 suhunidadcs diferentes. Cada clula contiene de 10 a 20 copias de la
Iioloeii~iina.por lo cual. para purificar 1mg se deben utilizar de 2 a 3 kg de clulas.
I'ma dcscriliir sil organizacin se emplean diferentes niveles de ensamblaje. El ms
sciicillo es cl ncleo de la poliinerasa formado por las subunidades a,E, 8; la subunidad
tx posw actividad de polinicrasa, en tanto, la E es una exonucleasa 3 ' 4 ' que parti-
cipa en el ineranis~nodeedicin descritoal final del captulo, y la subunidad R estinw-
1..i 1..I .dctividad
. de la c. 111segundo nivel de organizacin llamado Pol III'contieni ?
iirlcos y un dincii~de r. Para la forniacin del nivel siguiente, llamado PolllI':: sc
riqiiieri~121 incorporaii6~1del roniplejo y que est formado por las subunidades y, 6,s , ,
x 9 VI. por lo tanto, en la formacin del Pol III* intervienen 14 polipptidos
reprewnitadosen la frmula subunitaria c ( ~ E ~ ~ , T' xyr. J , La
~ ~ holoenzima se completa
roii la adicin de la subunidad P.
I 3 h general la "procesividad" de la polimerasa se incrementa en la medida que se

incorporan las subunidades al ncleo, pero tanto la procesividad como su alta veloci-
dad tienen un requerimiento ahsoluto de la subunidad P; esto se debe a la forma en que
la poliinerasa se ensambla sobre el ADN. Una vez formado el ARN iniciador,el comple-
jo y se asocia al Iihrido ADN ) ARN y promueve la incorporacin de la subunidad 8;
esta protena est formada realmente por 2 subunidades que presentan una forma circu-
lar hueca. El complejo y produce la abertura del anillo que despus se cierra con el
hbrido ADN ARN en su interior. Este proceso requiere ATP y es el nicomomento
que la ADN polimerasa 111necesita ATPpara funcionar. La estructura particular de la
subunidad P le permite deslizarse sobre el ADN de doble hebra hasta localizar en una
de ellas un extremo 3 ' - 0 H . En cualquier momento, el ncleo de la polimerasa despla-
za al complejo y y se une al anillo deslizante formado por la subunidad 8; al ncleo se
incorporan sucesivamente el restode lassubunidades. La importancia de que el com-
plejo Pol 111* contenga 2 copias del ncleo (a&@)se ver inmediatamente cuando se
trate la elongacin. La incorporacin de la ADN polimerasa 111al ADN preiniciado se
muestra en la figura 25.8.

Fig. 25.8. Inrorpuraein de la ADN


polinicrasa 111 al ADN preiniciado
y formacin del rcplisoma. El hi-
brido ADNlARN iniciador cs re-
conocido por cl compleja y y el
.
complejo r El complejo y pro-
mueve la incorporacin del anillo
deslizante que forma la subunidad
B, para la cual requiere la hidrlisis
del ATP. Despus el nrlco de la
polimerasa del que slo sc repre-
renta la subunidad a desplaza al
complejo y; de esta forma la
polimerasa se desliia por cl hioride
hasta encontrar el extrema 3'-OH
del ARN iniciador, al cual roniien-
l a a aadir los desoxinucletidos
complementarias a las de la hibra
molde.
Resumiendo, el hecho clave de la iniciacin es la formacin del ARN iniciador
realizado por la DnaG; para que eso ocurra se requiere la participacin de varias prote-
nas (PriA,PriB,PriC, DnaB,DnaC y DnaT) que forman el complejo iniciador. Con la
incorporacin de la ADN polimerasa IDy la formacin del replisoma puede darse por
terminada la fase de iniciacin.

La elongacin comprende la serie secuencia1de eventos que iniplican el alarga-


miento de las cadenas del ADN y donde interviene otro grupo de protenas eiizimticas.
Es bueno destacar la diferencia entre 2 aspectosque pueden confundirse. Al tratar
los aspectos generales se seal que el crecimiento de las cadenas nuevas (hijas) es
unidireccional, porque las enzimas provocan el crecimiento de la cadena del extremo
.
5 ' al 3 ' Sin embargo, la replicacin en las 2 cadenas cs hidireccional. II sea. la
burbuja de replicacin se mueve en las 2 direcciones a partir del punto de origcii.
llegandoa formarse, en la medida que el proceso transcurre, 2 horquillas que se mue-
ven en direcciones opuestas sobre la doble banda del ADN; por eso se veri lo que
ocurre en una horquilla, pues igual sucede en la otra.
Una vez incorporado el primer desoxinucletido,la pol 111-utilizando la suhuiiidad
para deslizarse- contina incorporando uno a uno los desoxinucletidossiguientcs.
cuyas bases son complementarias a la queocupa el lugar correspondiente en el ADU:
luego se trata de un proceso repetitivo. En la otra hebra, la horquilla se mueve en
direccin contraria a la sntesis, o sea, en direccin 3 ' +5 ' .Como la ADN polimcr;i;i
111 slo sintetiza en direccin 5 ' -13 ' ,el movimiento de la horquilla detendrii su
funcionamiento, pero se sabe que esto no ocurre asi; en esta banda la sntesis sr pindu-
cepor fragmentos, a los cuales se les conoce como fragmentos de Okasaki. en Iiont~r;I
su descubridor el japons Reiji Okasaki.
La holoenzimadela ADN polimerasaIIIcontiene2 copias del mileo. por eso IIII:I
sola holoenzima es capazdesintetizar las 2 hebras de ADN de forma simiiltiira: para
ello la hebra conducida forma un lazo alrededor de la holoenzima. de iiiaiirra que
cambia ladireccin de la hebra, y permite que la enzima pueda alargar las 1 hebras al
mismo tiempo (Fig. 25.9).
Cada cierto tramode la molcula del ADN se forma un nuevosegmento de ARN
iniciador, que permite un nuevo crecimiento. En el proceso de la replicacin del
cromosoma de E. mliseforman entre 2 000 y 4 000de estosfragmentos mn una longitud
de 1a 2 kb. La ADN polimerasa IDes capazde incorporar unos 1000 desoxinucletidos
por segundo, de ahquelasntesis deun fragmentode Okasaki demora de 1a 2 segundos.
Cuando la pol U1 encuentra un hbrido ADN I ARN no puede continuar incorporando
nucletidos. Simultneo al desplazamiento de la ADN polimerasa 111,el complejo y es Fig. 25.9. Accin de la ADN polimerasa 111
capazde ensamblar anillos deslizantes de lassubunidades fi por delantede la horqui- diirante la ~longarin.Durante la
lla, y hacia ese anillo se transfiere el ncleo de la polimerasa cuando el movimiento de fase de elongatin la ADN palimc-
la enzima cesa ai encontrar el hbrido ADN IARN. rasa Ill forma un tomplejaderom-
posici6n asiiii61rica sohre las 2 hc-
Este procesose va repitiendoconstantemente en una de las cadenas, por lo quese bras del ADU. En rada una de las
dice que lasntesis es discontinua. En la otra banda, sin embargo, lasntesis progresa hehras c\istr r l niidea unido a la
sin interrupciones, puesse realiza en favor del movimiento dela horquilla,por lo que suhiinidad / j i p c I i da la nioiili-
dad nrccsari;i. l.**dciiiissuhunida-
en ella la sntesis es continua; de ah se describe la replicacin como un proceso que des SP agrupan iiir I i x i s la Iiehra
es al mismo tiempo continuo y discontinuo -algunos autores lo llaman semidiscon- rondiiit<ira: esta cstrurlura hace
tinuo-, esta caractersticadel proceso se ilustra en la figura 25.10. que el ADU hrnic un gran lazo
Como resultado del proceso descrito, una de las hebras del ADN se encuentra casi alrededor de la polimerasa de for-
ma que las 2 hrhras del ADN, al
completamente replicada, en tanto la otra hebra presenta como productos de la entrar el1 coniacto con la super&
replicacin fragmentos que contienen ARN iniciador hacia el extremo 5 ' ;entonces rir de Id eiiriina. queden ton una
interviene otra enzima, la ADN polimerasa 1. Esta enzima, adems de la actividad orientarWn 5 , -> 3 . y de esta far.
polimerasa, posee actividad de exonucleasa 5 ' +3 ' para ADN de doble cadena o ma la pf~lililcrnra111 es capaz de

hbridos ADN ARN; debido a esta actividad, ella va eliminando uno a uno 10s sintetirar dc nirnera simultnea la
hehra riinductora > la conducida.

Componentes celulares y Gentica mwlecular 449


Para sellar esas mellas se requiere la ADN ligasa, que cataliza la formacin del
enlace fosfodister y sella la brecha que exista en el ADN (Fig. 25.12).

Fig. 25.12. Accin de la ADN ligasa. Utilizand<i romo cofaitor el NAD', la ADN ligasa de la E. col
une nudetidos contiguas mediante la formacin de un enlace fosfodister, con lo cual los
frapientos formados en la banda conducida se unen unas ion otros y se forma una banda
continua. -- m--
La ADN polimerasa 1 es una enzima ms sencilla que la pol 111, pues se trata de
una cadena polipeptidica nica de 109 kD; adems de las actividades menciona-
das tambin posee actividad esonucleasa 3 , -5 ' , cuya importancia se ver ms
adelante. En su movimiento sobre el ADN es capaz d e provocar el
desenrollamiento.
La ADN ligasa es tambin una enzima sencilla, formada por una sola cadena
polipeptdica de 77 kD y fue descubierta en 1966 en 5 laboratorios simultnea-
mente. Para la unin de 2 oligodesosinucletidos se requiere que estn formando
parte de una doble cadena de ADN. La formacin del enlace fosfodister entre los
fragmentos necesita de una fuente de energa que en la E. colila proporciona el
NAD' (Fig. 25.13).
Como las 2 horquillas se mueven en direccin opuesta, la cadena que se
sintetiza de manera continua (en favor del movimiento de la horquilla) no es la
misma en cada horquilla y recibe el nombre de banda conductora, en tanto, la que
se sintetiza discontinuamente recibe el nombre de banda conducida.
En la E. colise conoce adems otra enzima, la ADN polimerasa 11, cuya funcin
parece estar ms bien relacionada con los mecanismos de reparacin del ADN, pues
algunos mutantes que carecen de ella no presentan alteraciones en la replicacin. El
movimiento de las horquillas se favorece por la accin de las helicasas, y las torsiones 3. Mecanismo de accin de la ADN
que se generan se alivian por la topoisomerasa 1 (Fig. 25.14). ligas.. La reaccin ocurre en va-
En resumen, la nota ms sobresaliente de la elongacin es la actividad de la rias etapas. I,a enzima reacciona
ADN polimerasa 111 que aade uno a uno los desoxinucletidos en una hebra con el NAD' y forma un complejo
intermediario E:AMP. En un pasa
dirigida por la secuencia de la hebra contraria; de esta forma el proceso transcurre posterior la transferencia del gru-
rpidamente. Este alargamiento se produce de manera diferente en cada una de las po adenilato activa el extremo
2 hebras, para la fibra conductora slo hace falta la participacin de la pol 111; la 5 '-P, ron lo cual se facilita la for-
otra se alarga discontinuamente y requiere la participacin del comple,jo ni- macibn del enlaec fosfodister. La
ligasa y el AMP seseparan del ADN
ciador, la pol 111, la pol 1 y la ADN ligasa. En la E. coli se utiliza N.AD* como y la molcula queda hrmada intc-
fuente de energa para la accin de las ligasas. grarnente.
Fig. 25.14. Funcin de la topoisomerasa 1
en la elongacin. (a) E1 desplaza-
miento de la Iielicasa va creando
zonas de tensin por delante de la
horquilla que dificultan su avan-
ce. 1.a topoisomerasa 1 relaja esas
tensiones y facilita el proceso. (b)
Esquema del mccanisma de la
topoisomerasa 1 que consta de 2
pasos: Iro. corte de una banda del
ADN que queda unido a la enzima
y Zdo., paso de la otra banda por
la brecha y cierre del corte.

Terminacin

La terminacin de un ADN circular puede imaginarse como un proceso relativa-


mente sencillo. Al unirse las 2 horquillas que venan movindose en direccin opues-
ta,seforma una sola, pero en realidad estoseventos no son bien conocidos y se estima
que deben ser muy diferentes en los ADN lineales y circulares.
En la E. coli, la terminacin ocurre en una zona denominada terC que est locali-
zada a unos 180"de oriC. Es una regin larga,de aproximadamente 350 kb,flanqueada
a ambos lados por los sitios de terminacin terA, terB, terC y terD. Los terA y terB
inhiben el desplazamiento de la horquilla de replicacin que se mueve en direccin
contraria a las agujas del reloj, en tanto, los terB y terC tienen el mismo efectosobre la
otra horquilla.
Se ha identificado que el producto del gen tus se une con elevada afinidad a los
sitios ter e inhibe la replicacin. Tus es una protena de 36 kD, que se une al surco
mayor del ADN en los sitios ter, de modo que su efecto presenta el fenmeno de la
polaridad, es decir, inbibe el movimiento de una horquillaquesemueve en unsentido,
pero no la que se mueve en sentido contrario. A pesar de estos datos an faltamucho
por aclarar en cuanto a terminacin de la replicacin.
Al terminar la replicacin, las cadenas circulares quedan entrelazadas una
con otra y se requiere un niecanismo llamado descatenarizacin, en el que inter-
viene la topoisomerasa 11 para separarlas. El mecanismo de esta transformacin es
similar al estudiado para las topoisomerasa 11, con la diferencia de que en este
caso es cortada una de las molculas, y por la brecha que se origina se hace pasar
la otra molcula (Fig. 25.15).
w ~ e l n p x n m uq u o u e m a ua h saluouema
souis!ue8~ou q q u ! anb 'su+ ua so~gm!ldalseuiag!s ap u?pmqsuWal el u03 sop
-qlnsai saio@~sns u?!quq op!ual eq q u o u e m a ua u?pmgda~el ap qpnlsa 13
.aluauilep~edo p a u a p e ~heopepp
~ ueq as o ~ g e q d euials!s
a~ p p saluauoduio~
SO[ap s o y e wpezuem
~ souaui equanma as oiad 'saluoue~aidap la u02 eaup[nui!s
elaueui ap asopugpuesap op! eq saluo.ieJna ua u y p e q d a ~el ap o!pnlsa 13
'mma9 e awnh L (q) emvaqe el md epaloui e w el essd sui!zua sl e sep!un uepanb
anb (e) sepueq sns ua ep>?loui sun 8vaJ [en> ay emd ' J ~ ~ ~ JN(IV
J ! Jun ~p u<>!~e~![da.'
el ap leug IB sopeuixq so;sua;e> sol a x q a p 11 ssa~auias!odaael wp!xz!mwexa<l ' S I ' S Z 3!d
La velocidad de movimiento de una horquilla de replicacin en E. colies de
10 000 pares de bases por minuto. Las polimerasas de eucariontesson mucho menos
activas y tienen una velocidad que vana entre 500 y 5 000 paresde bases por minuto
segn la enzima. Como una clula animal tpica contiene aproximadamente una can-
tidad de ADN que es 50 veces mayor que el de la bacteria, el tiempo de replicacin del
ADN eucariontesera unas 1000 veces mayor que el de E. coli, esto es unos 30 das; Sin
embargo, la replicacin slo demora unas pocas horas.
Los cromosomas de eucariontes utilizan mltiples puntos como orgenes de la
replicacin y sta es bidireccional. Se han caiculado hasta 5 000 sitios de iniciacin en
un mismo cromosoma, cada uno separado por unos 30 000 pares de bases. En los
huevos fecundados se han calculado hasta 50 000 sitios de iniciacin, con lo que la
duracin de la replicacin es de nnos pocos minutos. Sin embargo,todos estos orge-
nes no se activan simultneamente, ms bien existe un programa de activacin,pues
nnos puntos comienzan la replicacin al inicio de la fase S, otros en un momento
intermedio y otros al final (Fig. 25.16).

Fig. 25.16. Horquillas mltiples en los eueariontes. La replicaein en eueariontes se produce con la
formacin de numerosas horquillas que al crecer bidireeeionalmente se encuentran unas
con &ras y se fusionan, con lo cual se aumenta considerablemente la velocidad del procesa.
Pera como se muestra no todos los sitias de iniciacin se activan simultneamente.

El enorme nmero de horquillas es un reflejo del nmero de polimerasas.


Mientras la E. coli contiene de 10 a 20 molculas por clula, los eucariontes
contienen de 20 000 a 60 000 molculas de la polimerasa a que es la principal.
La estructura nncleosmica del ADN eucarionte debe disociarse del complejo
ADN-protena y reformarse con las molculas neoformadas. Se ha comprobado que
esto sucede simultneamente con la replicacin del ADN. Las histonas slo se sinteti-
zan durante el perodo S, de ah que es ms correcto referirse a la replicacin del
cromosoma que a la del ADN.
Por ltimo, se debe recordar que las clulas de los animales superiores, como el
hombre, contienen una dohle dotacin de genes (son diploides)y cuando se produce
la duplicacin de los cromosomascontendr 4 copias de genes homlogos (tetraploides);
esto significa que el nmero de copias de un mismo gen es variable durante el ciclo
celular,en G1 es doble, durante el perodos la informacin se duplica y, por lo tanto,
es cudruple durante todo el perodo G2. En el perodo M la informacin se divide en
2 y van a parar a cada una de las clulas hijas, que reinician su ciclo celular con una
dotacin doble de la informacin gentica.

454 L-Bmm
Replicaan en eucariontes pluriceluiares

Del estudio de los sistemas simples se ha partido para reconstruir el proceso en


eucariontes complejos. En estos estudios se han podido caracterizar varios genes im-
plicados en el proceso y se ha emprendido la purificacin de muchas protenas
replicativas; entre las especies estudiadas se encuentran numerosas lneas humanas.
Para no hacer extensa la descripcin del proceso en los organismos eucariontes, sta se
har tomando como referencia el sistema replicativo de la E. Coli, que ya fue estndia-
do, pues en lneas generales los procesos se asemejan mucho. Slo se insistir en las
diferencias y en las homologas funcionales, estructurales o ambas entre los compo-
nentes de uno y otrosistemas replicativos.
El origen de la replicacin en eucariontes es ms complejo y su estructura defini-
tiva no ha sido dilucidada por completo; contiene secuencias funcionalmente
homlogas al de E. coli, pero tamhin motivos estructurales especficoscomo algunos
que sirven de sitios de unin para factores de transcripcin. La unin de protenas
especficas produce tambin el desenrollamiento local de la doble hehra del ADN en
sitios que sirven para alojar protenas que formarn el complejo de preiniciacin,cnya
estructura no est del todo conocida.
El origen de replicacin es reconocido por un grupo de 6 protenas de pesos
moleculares variables, que forman el llamado complejo de reconocimiento del origen,
ORC (origin recognition complex). Se ha encontrado que existe una gran similitud en
la secuencia de aminocidos de estas protenas, en especies tan diferentes como la
Drosophila y el hombre, lo cual indica que realizan funciones similares en todos los
organismos.
La protena estabilizadora del ADN de hebra simple (SSB) recibe el nombre de
protena replicativa A (RP-A de replication protein) que se presenta en forma de
heterotrmeros, los que estabilizan las zonas monofihrilares en la horquilla de
replicacin.
Se conocen 2 ADN ligasas cuya principal diferencia con la de los procarionteses
que utilizan ATP en vez de NAD' como cofactor. Tambin han sido caracterizadas
varias helicasas. Los 2 tipos de topoisomerasas se han ohtenidode diferentes orgauis-
mos eucariontes; las de tipo 1se encuentran localizadas en zonas de intensa transcrip-
cin, principalmente en el nuclolo, y la tipo 11ha sido identificada como la principal
protena que participa en la organizacin molecular de los cromosomas, presenta aso-
ciada una actividad de protena quinasa cuya significacin es desconocida.
Existen al menos 5 ADN polimerasas: la cc que es la principal y presenta asociada
una actividad de iniciadora; la p, es la ms pequea de todas las ADN polimerasas
conocidas, aparece slo en animales superiores y parece estar implicada en los meca-
nismos de reparacin; la y que slo aparece en las mitocondrias; la 6 resulta una
protena grande y es la nica donde se ha descrito actividad de3 ' - 0 H exonucleasa; y
la q que est relacionada con los mecanismos de reparacin.
El ensamblaje del replisoma ocurre de forma similar al proceso en la E. coli, pero
presenta algunas diferencias importantes. En los eucariontes participan 2 ADN
polimerasas, la a que produce la iniciacin de las dos hebras y la 6 que funciona en la
elongacin. El homlogo de la subunidad p es una protena denominada antgeno
nuclear de clulas pruliferantes (PCNA de pmlifei1tingceUnudearmOgen),un trnero
que forma el anillo deslizante que proporciona el movimiento del replisoma. La
translocacin del PCNA hacia la horquilla de replicacin se realiza por una protena
formada por 5 subunidades, que se denomina factor de replicacin C (RF-C de
replication factor) y, por lo tanto, es el homlogo funcional del complejo y. Una vez
formado el replisoma, el proceso de la replicacin ocurre de forma similar al de E. coli,
slo que en cada cromosoma existen numerosos orgenes de replicacin, por lo cual
cada replisoma tiene que sintetizar pequeos sectores de ADN. Aun en el caso de la
hehra conducida, la longitud de los fragmentos de Okasaki es menor y se calcula entre
150 y 200 nucletidos, que es el tamao que se corresponde con la estructura de un
nucleosoma. La dificultadprincipal que no se presenta en la E. coiies la replicacin de
los telmeros, que ser descrita en el acpitesiguiente.

Replicacio de los telmem

Unode los grandes problemasquepresentala replicacin de un ADN nocircular, es


la replicacin de los extremos, que en los cromosomas recibe el nombre de telmeros.
Desde el punto de vista ehvcturalestos extremosse caracterizan por presentar pequeas
secuenciasdedesoxinucletidos,repetidasmuchas veces, y la hebrade direccin 5 ' -3 '
posee un segmento finalmonofibrilar de 12a 16nucletidos. La dificultad estriba en el
hechodeque unadelas 2 hebras no puede replicarsecompletamentepor losmecanismos
conocidos y esoimplica la prdida progresiva de material gentico a partir de los extre-
mos. Hace unos pocos aos fue descubierta y purificada una enzima que cataza la
formacin de los telmeros, por ello se le dio el nombre de telomerasa; tal vez lo ms
interesante, en la forma de actuar de esta enzima, es que emplea como cofactor una
molcula de ARN, al cual utiliza como molde para aadir deso~ucletidos a los extre-
mos telomricos. Como los telmeros presentan secuencias repetidas, el ARN puede
aparea~mn~artedeesaseeuen&,~ lapartenoapareadasirvedemoldealatelumerasa
para alargarla hebra de ADN. Una vez terminadoel alargamiento, la enzima se desplaza,
produce un nuevo alargamientoy assucesivamente hasta que el nmerode repeticiones
seael caracterstico de laespecie. El mecanismodesntesisdela hebra complementaria no
est esclarecido(Fig. 25.17).

A = Unin de la telomerasa
..........
.......... 5' C-C-A-A-T-C-C-C

Fig. 25.17. Accin de Is telomerasa. La sin-


tesis de las telmeros se lleva a cabo
por accin de la telomerasa en un
proceso que puede ser dividido en
B = Palimenzaci6n
.........
.......... 5' cy] G.G.G.T.T.A~;.
t
.';~::

3 etapas. (A) La enzima se une al


extrema del telmero, utilizando
el mecanismo de apareamiento de
bases entre su ARN y el ADN
Ielamrieo. (B) Utilizando coma
molde su ARN la enzima alarga el
extremo 3 ' de la hebra del ADN.
C = Translocalizacin
..........
.......... 5' <y .c
G-G-G-T-T-A . .',-:~

(C) Una vez alargado el Ielmero D = polimenracin..........


G-G-G-T-T-A
4
la enzima se separa y vuelve a unir- , ~ L . ~ , ~
~ ~ ~

se al nuevo extremo y (D) comien- .......... 5' C-C-C-A-A-T-C


ra un nuevo cielo de polimeri-
zarin.

-
Esiudios recientes uarecen demostrar aue la longitud de los telmeros est rela-
cionada con la posibidad de divisin de la clula, de modo que mientras ms corto es
el telmero, menor es la potencialidad proliferativade la clula; esto ha hecho que la
telomerasa se convierta en un posible blanco para el tratamiento del cncer.

Fidelidad del proceso


La replicacin del ADN ocurre una sola vez durante el ciclo de vida de la
clula, de ah la necesidad de que el proceso se realice con una elevada fidelidad

456 -ua*le*
de copia, que las molculas hijas contengan exactamente la misma secuencia de
bases nitrogenadas que la molcula paterna. En estudios con bacterias que se
reproducen rpidamente y que permiten estudiar en corto tiempo varias genera-
ciones d e clulas, se ha calculado que en la replicacin se comete un error, o sea,
se incorpora una base errnea por cada mil a cien mil millones de bases incor-
poradas (loya 10"). Si el genoma de la E. coliposee aproximadamente 4 x 10"b,
la posibilidad d e error es menor que una base incorrecta por ciclo replicativo.
Ninguno de los mecanismos conocidos por s solos son capaces de explicarlo,
pero la accin conjunta de todos ellos puede crear un efecto potencializador, es
decir, todos juntos provocan una fidelidad mucho mayor que la suma de todos
ellos por separado. Algunos de estos mecanismos se comentarn a continuacin y
se har nfasis en varios de ellos.
El primer factor de fidelidad es la elevada especificidad del apareamiento de
bases formando los pares adenina-timina y citosina-guanina. El otro es la elevada
especificidad de las polimerasas, las cuales slo incorporan los desoxinucletidos
que forman pares complementarios al ADN que se est copiando.
Otro factor que contribuye a la fidelidad es la utilizacin de un ARN inicia-
dor, ya que como ste es eliminado y reemplazado por el segmento de ADN corres-
pondiente, estas zonas son rectificadas siempre. De usarse un segmento de ADN
como iniciador, estas zonas no se leeran de nuevo y cualquier error en ellas se
podra mantener.
Existe, adems, un mecanismo de rectificacin. A pesar de todo lo anterior,
cuando se incorpora una base errnea entra a funcionar el mecanismo denomina-
do de edicin. La base incorrecta no forma pares de bases tan estables como la
correcta y esa zona del ADN se debilita; esto hace que en ocasiones los
desoxinucletidos aadidos posteriormente no se unan bien a la banda complemen-
taria, lo que sirve como seal a la ADN polimerasa 111, que con su actividad
exonucleasa 3 ' 4 ' comienza a eliminar los nucletidos mal apareados. Cuando
llega a una zona donde el pareamiento es correcto detiene su accin y entonces la
polimerasa 111contina alargando la cadena de forma adecuada. En este mecanis-
mo tambin pueden intervenir endonucleasas que producen la hidrlisis del enla-
ce fosfodister prximo a las bases mal apareadas, hacindolo siempre en la cade-
na neoformada, pues sta no tiene an el patrn de metilacin caracterstico, y
con ello se diferencia de la cadena que sirve de molde o patrn. Todos estos
mecanismos contribuyeii a que los errores de copia sean mnimos y el proceso
transcurra con una elevada fidelidad.

Inhibidores de la replicacin
Existe un numeroso grupo de sustancias, de las cuales muchas de ellas son
antihiticos. que actan como inhibidores d e la replicacin y cuyo empleo ha
contrihuido a dar la !isin actual sobre el proceso. Atendiendo a s u mecanismode
accin se clasifican en 2 grupos: los que actan sohre el ADN molde y los que
actan sohre las protena5 replicativas.
Al primer grupo pertenecen los colorantes de acridina, la actinomicina D y el
etidio, que se intercala11entre las bases y dificultan la separacin de las cadenas;
la netropsina !la clistaiiiicina .A. que se unen fuertemente a zonas ricas en pares
A-T; y la bleuiiiicina ! iieiicarzinostatina, que producen roturas de los enlaces
'
entre los carhonos 3 ' 4 ' de la desoxirribosa.
Al segundo grupo pertenecen la afidicolina, que inhihe la ADN polimerasa
alfa; y la novohiociiia !el rido iialidxico. que actan sobre la topoisomerasa 11.
Un importante g r u p o d e inhibidores lo constituyen los 2 ' - 3 '
didesoxirribonuclesidostrifosfatados, que se han empleado para determinar la se-
cuencia de bases de los ADN; slo actan in vitro, ya que los nuclesidos trifosfatados
no atraviesan la membrana celular (Fig. 25.18).

o o
II
CH3,
CH - CH
,!
CH: \
NCH3 CH, N - CH3
/ /
o=c c\=
,o
/CH,
CH, -N
\
\
c=n
-
/-
I ,,CH,- CH HC-CH, I
O=C CH2
\
CH-CH\
/
NH HN CH3
Fig. 25.18. lnhihidores de la replicacin. / \
O=C
En la figura se muestra la estructu- \ /C = O
CH -- CH
ra de la aelinoniirina D que est
compuesta por un anillo triple de
1 \
NH '.
F-
NH
CH
1
CH,
fenoxazona y 2 polipptidas ccli- : ~ CH3
cos laterales. Al interactuar ron el
ADN el anillo de fenoxazana se
. .
intercala entre 2 pares de bases Actinomicina D
(preferiblemente GC) y los pp- . ...
. ,
,
, (,
,
," . , ,.?, ,
tidos interactan con lai zonas ve-
cinas fortaleciendo la unin entre ,.: ..
',. ,
las 2 bandas. La? protenas repli-
eativas al llegar al sitio donde est
la actinomieina D no pueden se-
parar las bandas del ADN y se de-
tiene el movimiento de la horqui- N-C
Ila. La novobioiina y el rido 0x0- 1 1
niliea par su parte san inhibidores OH H O 1
de las topaisomcrasas y su accin C=O CH2
dificulta la replieaein.
1
NH, Navobiocina cido oxolnico LH3

A manera de conclusiones
Hasta aquise han desarrollado los aspectos ms sobresalientes deunode los ms
importantes procesosde la niateria viva. Coniose vio al inicio,se planteaban unasene
de problemas importantes para su realizacin, problenias c l i p complejidad hacan
prever respuestas coniplejas y as ha resultado.
Pero cabra preguntarse ;por qu resulta tan complejo este proceso? No existen
mecanismos ms simples e igtiahiiente probables para un proceso de esta naturaleza?
;.Por qu se requiere un iiniero taii elevado de enziiiias. con tan elevados grados de
coniplejidad estructural y fiuicional'>
Por supuesto. que estas respuestas no las tiene nadie. Cuando se analiza un meca-
iiisniu de este tipo slo podemos decir las ventajas que representa con respecto a otro
alternati! o. sin llegar a saber por qu los organismos con estas caractersticas han sido
seleccionados de manera evolutiva sobre otros: esa es la base del razonamiento que
harenios a contiiiuacibii.
La replicaciuii se produce slo una \ez durante la vida de la clula,por lo cual
errores que se cometan durante el proceso pueden acarrear consecuenciastrascenden-
tes para el organismo y para la especie. Segn parece, sta es la razn primaria del
elevado grado de complejidad,lo que est apoyado, adems, por el hecho de que en la
medida que aumenta la longitud del ADN en las clulas es mayor el grado de com-
plejidad del proceso y mayor el nmero de factores protenicos especif~cos
involucrados.
El elevado grado de precisin que requiere la transferencia de informacin,de
generacin en generacin, con un elevado grado de fidelidad, obliga a la complejidad
del proceso molecnlar que constituye su fundamentofinal.

Resumen
La trasmisin de la informacin gentica de un organirmio a sus descendientes
constituye el fenmeno ms importante de ia materia viva, y aunque adquiere
diferentes formas de acuerdo con el tipo de organismo, su fundamento f i i es el
mecanismo de replicaun del ADN. Toda la informacin gentica est codicada
en la secuencia de bases nitrogenadas del ADN, y el apareamiento especfico de
ellas es el mecanismo bsico utilizado en todos los sistemas replicativos. La
replicaan tiene un carcter reiterativo, pues los desoxinucletidos son aadidos
por el mismo mecanismo al extremo de una cadena en crreimiento, procede por
complementaridad, acoplada a la hidrhis del pirofosfato y de forma antipara-
lela y semiconservativa.
La replicacin ms senciua es la de los virus de los proeariontes, cuyo estudio
ha permitido esclarecer algunos de los mecanismosmoleculares involucrados en el
proceso. En la replicacin del ADN de la E. cofi participan numerosas enzimas
como las topoisomerasas, helieasas, polimerasas, ligasas, ectera, as como otras
muchas protenas de carcter no enzimtico, pero cuya participacin es indispen-
sable en el proceso. Para su estudio, este proceso se ha dividido en 5 etapas. La
preioiciacin ocurre en un sitio especfico, denominado origen y en l las
topoisomeras~sU aumentan el superenmliamiento negativo, las helicasas separan
las 2 cadenas y las SSB estabilizan esta estructura que se denomina horquilla de
iniciacin. En la iniciacin un conjunto de protenas forman el wmplejo iniciador
que mediante la hidriisis del ATP, como fuente de energ'a, localiza una secuencia
especa y sintetiza un oligorribonucietido complementario al ADN denomina-
do ARN iniciador, el cual aporta el p p o 3 ' -0Hnecesario para la incorporacin
del primer desodrribonude6tido por la ADN- polimerasa Iii. La elongacin ocu-
rre de forma diferente en las 2 hebras. En la banda wnductnra el proceso es conti-
nuo y con la sola participacin de la ADN-polimerasaIii. En la banda conducida el
proceso es discoonuo y resulta necesaria la formacin de muchos ARN iniciado-
res en la medida que crece el tamao de la horquilla. La ADN polimerasa J H aade
los desoxinucletidoshasta encontrar un ARN iniaador. Los ARN iniciadores son
eliminados por la ADN polimerasa 1que, adems, Llena con desoxinucletidos los
sitios ocupados anteriormente por el ARN. La ADN ligasa une los fragmentos for-
mados dando integridad a la cadena neoformada. El movimiento de la horquilla es
facilitado por la accin combinada de las helicasas, las topoisomerasas1 y las SSB.
La terminacin constituye la etapa menos conocida; existe un sitio especfico para
la terminacin, al cual se unen protenas que provocan la terminacin de la
replicacin. En los ADN circulares se forman catenatos para cuya separacin es
n e c e a i a la accin de las topoisomerasas U. Posterior a la tenninarin ocurre la
modicacin que consiste en la meolacin de bases especficas, con lo cual se pro-
tege al ADN de la accin hidroltica de las enzimas de restriccin. Todo el proceso
presenta una elevada fidelidad de copia que viene dada, entre otros factores, por la
precisin del apareamiento de bases, la espedfddad de las polimerasas, la e W -
nacin del ARN iniciador y el mecanismo de reeticacin.
El estudio de la replicacin en eucariontes est an en sus primeros pasos,
debido a la compleja estmctura de los cromosomas y a la dificultad para la obteo-
cin de grandes cantidades de mutantes que permitan seguir una estrategia similar
a la uazada en procnriontes. No obstante, los estudios reazedos en virus y leva-
duras han dado susprimeros frutos. A partir de esos estudios,y con la identificacin
de genes y caracterizacin de protenas involucradas en la replieacin, es posible
en estos momentos tener una representacin bastante aproximada del proceso en
los organismos superiores, aunque an quedan muchos detalles importantes por
esclarecer.
Numerasos son los antibiticos cuya accin espeeea consiste en actuar como
inhibidores de la replieacin, los cuales, adems del beneficio que han reportado a
la lucba contra las enfermedades infecciosas, han sido de ine&ble valor para el
estudio del complejo proceso de la replicacin del ADN.
Los resultados obtenidos experimentalmente en diferentessistemasreplicativos
permiten intentar una descripcin generalizada del proceso, que tendr su expre-
sin partinilar en cada organismo dado. La repiicacin comienza en sitios especi-
fim del ADN, denominados orgenes de repiicacin, que contienen secuencias de
bases nitrogenadas que sirven para la unin de protenas espefficas. La unin de
estas protenas producen el desenrollamientolocal de la doble hebra del ADN, que
por accin de otras protenas es agrandado. Un sistema enzimticoespecfico for-
ma el ARN iniciador, que ser alargado por el replisoma que contieue,almenos,las
actividades de ADN polimerasa y de exonucleasa 3 ' -15 ' y que funciona en el
mecanismo de edicin. Una de las hebras se forma de manera connua, en tanto, la
otra se sintetiza por fragmentos que luego son unidos por Laaccinde ADN ligasas.
Todo el proceso se caracteriza por la elevada velocidad de pomerizacin, la alta
prwesividad y la extraordinaria fidelidad de copia.

Ejercicios
1. Demuestre que en el proceso de replicacin se cumplen los principios siguientes:
a) De los cambios graduales.
b) De acoplamiento.
c) De transferencia de informacin.
2. Teniendo en cuenta las caractersticas de su accin explique por qu es necesario
que en la preiniciacin intervenga la topoisomerasa II y durante la elongacin la
topoisomerasa 1.
3. ;Por qu algunos autores afirman que la replicacin es un procesosemidiscontinuo?
4. cul es la justificacin molecular de la necesidad de formar el ARN iniciador?
5. ;Puedeun mutante de la E. colique carezca de Iielicasas realizar la replicacin de
manera eficiente?
6. Cul esladifereiiciafuiiciot~al durantela replicacin entre la ADN polimerasa 1y
la ADN polimerasa III?
7. Para poder aislar con facilidad los fragmentosde Okasaki se prefiere utilizar bacte-
rias mutantes que son deficientes en la actividad dela ADN ligasa. ;Por qu cree
usted que sea asi?
8. Teniendo en cuenta las caractersticas funcionales de todas las ADN polimerasas
conocidas. plantee un modelo que pueda explicar cmo es posible la replicacin
de una ~iiolculalineal (no circular) de ADN.
Y. Para investigar si exista un sitio para la terminacinenelcromosomacircular de la
E. coli se realiz el experimento siguiente: el ADN fue cortado y se extrajo un
fragmento de gran tamao, despus los 2 extremos fueron unidos y se estudi el
proceso de replicacin, tomando muestras seriadas y analizndolas por
autorradiografa.Deduzca cules deben ser los resultados esperados:
a )Si en efecto existe un sitio parala terminacin.
bi Si el sitio de terminacin no existe.
En todos los organismos celulares el material gentico est constituido por ADN
de doble banda; aun cuando su estructura general es muy similar y eit compuesto por
las mismas bases nitrogenadas (A, T, C, C) existen notables diferencias entre las
organizaciones particulares de los genomas en procanantes y eucariontes.
Una primera diferencia reside en el contenido de ADNde los diferentes organismos.
Una bacteria tpica como la E. coli posee un material gentico equivalente a 4 x 10"
bases. En un insecto como la Drosophiln nielu~~ogaster es de 1.6 x 10' y en los inam-
feros, de 4.8 x 10".
En segundo lugar, en los procariontes el ADN ocupa un lugar central en la clula.
sin que exista una separacin fsica entre l y el resto del organismo. En las clulas
eucariontes el material gentico (ADN) se encuentra separado fsicamente del resto de
la clula por una envoltura constituida de una doble membrana (captulo 23).
Pero tal vez la diferencia ms sobresaliente radica en la forma caractei-ktica que
est organizado el material gentico en los eucariontes. Como muclias de esas
particularidades influyen notablemente en los mecanismos de expresin de la
informacin gentica y su regulacin, se estudiarn primero las particularidades
fundamentales de la orgaiiizacin del genoma en los organismos eucariontes.

En las clulas de eucariontes el ADN total se encuentrd dividido en un nmero


variable de molculas, caractei-stico de cada e5pecie. y forinando con protenas.
estructuras muy complejas denominadas cn~musornas:el riiiiero y la forma de los
cromosomas son tpicos de cada especie.
En un organismo existen 2 tipos fu~idanientalesde clulas en cudnlo al iiiiiero de
cromosomas que contienen: las sointicas y las sexuales. Las primeras contienen el
doble de croinosoinas que las segundas. por eso se dice que aqullas son diploides y
stas Itimas. haploides. En las clulas sointicas los cromosornas se presentati por
pares homlogos. los 2 miembros de la pai-eja son equivalentes, por lo que contienen
una dotacin gentica doble con resprcio a la5 sexuales.
El ADN que forma parte de lo\ cromosomas es una sola molcula. que al parecer
est en forma lineal y iio circular. A todo su la]-goest asociado con protenas que son
fundameiitnlineiite Iiistoiias. aunque existen otras no muy bien caracterizadas que
;unto con In\ historias determinan las foi-mas organizativas peculiares d e los
cromosomas. Como se vio en el captulo 23, el grado de "empaquetamiento" del
complejo ADN protenas vara durante el ciclo celular, y las estructuras ms compactas
-los cromosomas propiamente dichos- existen slo durante el perodo de divisin
celular. Durante la interfase esta estructura se hace mucho menos compacta y se presenta
en forma de cromatina. Como la mayora de los estudios relacionados con la
organizacin del genoma ha tomado como punto de referencia los cromosomas, en
este texto se utilizar este trmino para referirse a estos complejos ADN protenas, sin
tener en cuenta su grado de "empaquetamiento". Cada cromosoma contiene un nmero
caracterstico de genes ordenados de forma lineal a lo largo de su estructura. Por
procedimientos mltiples se ha podido conocer la localizacin de numerosos genes en
los cromosomas humanos (Fig. 26.1). Durante la maduracin de las clulas sexuales
(gametognesis) se produce la reduccin del nmero de cromosomas, y cada gameto
maduro (vulo y espermatozoide) contiene solamente una sola copia de cada par de
cromosoma, por lo tanto en las clulas sexuales cada gen est representado slo una
vez, a diferencia de las clulas somticas que por ser diploides tienen una representacin
doble de cada gen

Fig. 26.1. Loealizacin de algunos genes


en cromosomas humanos. (a) Se
representa la localizacin de algu-
nas genes del cromosoma 11 eomo
son algunos protaoncogenea
(POG), las cadenas de las globinas 3 GLM
P (HBE),y(HBGZ y HBGI), 6(HBD)
y p (HBB); paratohormona (PTH), CPSC
fosfatasa cida 2 (ACPZ), lactato
deshidrogenasa A (LDHA), genes
de las cateminas (CPSC). de las

de la colagenasa (CLGN) (b) La


localizacin de algunos genes eu-
yas alteraciones producen enfer-
medades eomo la deficiencia de AHAK
inlerlern (DIF), galactoseiiiia
(GLM), porfiria heptica aguda
(PHA) y anemias heniolticas por
deficiencia de la adenilato quinasa
(AHAK), todos localizados en el
Aun cuando existen numerosos enfoques para tratar este problema, y de cada uno de
cromosoma 9.
ellos puede derivar una concepcin distinta de gen, de acuerdo con las caractersticas de
ste que ms se pretenda destacar y como consecuencia de la profundizacin de los
conocimientos sobre la naturaleza del gen, para los objetivos de este captulo se utilizar
la definicin ms empleada en la actualidad. Se da el nombre de gen a uno o varios
sectores de una molcula de ADN, que contiene en su secuencia de bases nitrogenadas la
informacin necesaiia para llevar a cabo la sntesis de una cadena poliniicleotdica espe-
cifica. Este ADN puede codificar la sntesis de todos los tipos de ARN, especialmente los
ribosomales, los de transferencia y el mensajero. En este ltimo caso, la secuencia de bases
es traducida en secuencia de aminocidos durante la traduccin.
Al conjunto de todos los genes contenidos en una clula se le da el nombre de
genoma. Las secuencias, que pueden ser exactamente iguales en ambos cromosomas o
diferir en algo. siguen originando en esencia el mismo producto, aunque con pequetas
diferencias, esto hace que en una poblacin puedan existir numerosas formas del
mismo gen. Uno de los ejemplos ms sobresalientes en seres humanos es el gen
que codifica la cadena !J de la hemoglobina, este gen est localizado en el
cromosoma 1 I y de l se han reportado ms de 200 formas que difieren por lo
general en el cambio de alguna base nitrogenada que, aunque en muchos casos
determina cambios en la secuencia aminoacdica de la protena, sigue siendo
esencialmente la B-globina (tabla 26.1).
Tabla 26.1. Diferentes tipos de alelos en la cadena /I de la hemoglobina

Tipo Defecto molecular Fenotipo

Hb S Cambia en P6 glu-val Sicklemia

Hb C Cambia en P6 glu-lis

Hb E Cambia en P26 glu-lis

Hb M e,,\,,,,, Cambiaen P53 his-tir Meta Hb

Hh M S"*A,,%<"7"
Cambia en P63 his-tir Meta Hb

Al conjunto de formas alternativas del mismo gen que pueden ocupar el mismo sitio
en el cromosoma (locus) se le da el nombre de alelos. Pueden existir numerosas formas
allicas del mismo gen, pero una clula diploide slo puede contener 2 como mximo,
una en cada uno de los cromosomas homlogos. Si el par est representado por genes
idnticos, y por tanto sus productos son indistinguibles, el organismo es homocigtico
para esa pareja, pero si se trata de formas allicas, entonces es heterocigtico. Es muy
difcil encontrar algunas clulas u organismos pluricelulares que no sean Iieterocigticos
para uno u otro par de genes; esta diferencia en la estmctura de los genes se refleja en su
producto, o sea, en la protena y su funcin. Se utiliza el trmino de genes de tipo silvestre
para referirse al gen que supuestamente consewa su formaoriginal, a sus formas alternativas
se les denomina mutantes. por cuanto es la mutacin el mecanismo fundamental en la
formacin de los alelos. En ocasiones algunos de los alelos mutantes codifican un producto
que no es funcional. Suponga que existe un gen "A" que es de tipo silvestre y su mutante
"a" que da un producto anormal, incapaz de realizar cualquier funcin. Existen 3
combinaciones posibles para esta pareja de genes (Fig. 26.2):

1. Los 2 genes son de tipo silvestre, por lo que el organismo es homocigtico (AA) y
todo el producto gnico es normal.
2. Un gen es de tipo silvestre y el otro es mutante (Aa), el organismo es heterocigtico
y slo contiene aproximadamente la mitad del producto gnico normal.
3. Los 2 genes son mutantes (aa), el organismo es homocigtico, por lo que todo el
producto gnico es anormal. Si ese producto realiza una funcin importante para la
vida, la clula en esas condiciones no sobrevivir o lo har en condiciones precarias.

Fig, 26.2. Posibles combinaciones de alelos.


Pueden existir numerosos alelas de
un mismo gen, pcro en un orga-
nismo dado slo pueden haber 2,
uno por cada cromosoma. Si se
representa en azul el gen de tipo
silvestre que es dominante y en
rojo el mutante reeesivo, podemos
encontrar 3 eambinaeioiiea: (a)
Los 2 genes san tipo silvestre y el
organisiiio es homoeigtieo domi-
ziante. (h) Un gen es tipo silvestre
y el otro mutado, ari como el or-
ganismo cs heteroeigtieo. (c) Los
El conjunto de genes presente en una clula constituye el genoma, pero el par de 2 genes son mutants y el organis-
ellos que determina u11 carcter particular recibe el nombre de genotipo. La mo es homocigtico reeeslvo. De-
pendiendo de las raraderstieas del
manifestacin externa del ge~iotiporecibe el nombre de fenotipo; ste puede definirse producto gnico el heteraciglim
desde muchos puntos de vista, desde la posibilidad de inetabolirar una sustancia o pucdc manifestar o no un fenntipo
reconocer una seal qumica, hasta los rasgos ms externos del organismo como el anormab

Componentes celulares y Cienetica molecuiar 463

L,
color de los ojos, la forma de las extremidades. etctera. Los caracteres acostumbran a
clasificarse en dominantes o recesivos, de acuerdo con los patrones de trasmisin
gnica. En ocasiones se comete el error de hablar de genes dominantes y recesivos,
pero en realidad estos trminos slo se refieren al carcter determinado por el genotipo.
Estos conceptos son relativos y contrarios, o sea, la existencia de uno determina la
existencia del otro. En un inicio se deca que el carcter era dominante cuando siempre
se expresaba en el fenotipo, mientras que el recesivo slo lo haca si estaba en estado
homocigtico; aqu se conceba el fenotipo como las caractersticas ms externas del
organismo. En la medida que se han ido perfeccionando el conocimiento sobre la
expresin de los genes y los procedimientos que permiten localizar y cuantificar el
producto gnico, la concepcin del fenotipo y con ella la del carcter recesivo se han
modificado; es de esperar que con las nuevas tcnicas introducidas que permiten
detallar la estructura del gen, la diferencia esencial inicial entre estos 2 conceptos
tienda a desaparecer. La distincin entre caracteres dominantes y recesivos es muy
importante en la prctica mdica, pues hay enfermedades que se trasmiten como un
carcter dominante y otras como recesivo, todo lo cual el mdico debe tener muy
presente para hacer los asesoramientos genticos del paciente y de la familia.
Un ejemplo permitir esclarecer los conceptos definidos hasta el momento. Para
los grupos sanguneos ABO existen bsicamente 3 alelos. El grupo sanguneo A es
dominante y est determinado por el alelo A. Ntese que aqu el fenotipo no es algo
externo, pues por la sola observacin del sujeto no es posible determinar su grupo
sanguneo. El grupo sanguneo B es tambin dominante y lo determina el alelo B. El
grupo O tiene carcter recesivo y se origina por el alelo O. Una persona con la
combinacin gnica AA ser del gmpo sanguneo A, en tanto la del genotipo BB ser
del B. Las combinaciones genotpicas A 0 y BO originan fenotipos A y B,
respectivamente. El genotipo 00 corresponde al grupo sanguneo 0 . Ahora bien,
como A y B son dominantes, la persona que tenga un genotipo AB expresar amhos
genes por igual y ser del gmpo sanguneo AB. Cuando 2 genes que determinan el
mismo caricter se expresan de igual forma en el fenotipo, se dice que los caracteres son
codominantes.
Esto tiene su explicacin molecular. Las sustancias que determinan el grupo
sanguneo ABO son pequeos heteropolisacridos que forman parte de la membrana
de los eritrocitos. Como se muestra en la figura 26.3, los sujetos del grupo sanguineo O
Fig. 26.3. Determinacin gentica de los
grupos sanguineos ABO. Los
eritroeitas poseen un polisacrido
unida a lpidos o protenas de sus
membranas, ste posee carcter
antignieo y est formado como
se muestra en IP figura por gluco-
sa (Glu), galaefora (Gal), furnsa
(Fue) y N-acetilglucosamina
(NAGlu), y es denominado antge-
no O. El gen A codifica la enzima
A que aade al polisacridoun resto
de N-aeetilgalactosamina (NAGal)
y lo convierte en el antigeno A.
Por su parte el gen B codifica la
enzima B que aade al nntgeno O
un resta de galactosa y lo ronvier-
te en el antigeno B. Si la persona
pasee los 2 genes poseer tambin
las 2 enzimas y aproximadamente
tienen en sus eritrocitos el polisacndo mostrado en (a). El gen A codifica una enzima
la mitad de sus anlgenos sern A y que aade la N- acetil-galactosamina al extremo del polisacrido, cambiando su
la otra mitad ser B, por lo que ella especificidad reaccional; en tanto el gen B codifica la enzima que aade galactosa,
ser del grupo AB. De no poseer otorgando una especificidad diferente. En los sujetos AA 6 A 0 la estructura resultante
ninguna de estas genes, entonces
ser del grupo O.
ser como se muestra en (b). en los BB BO es como en (c). En los 00 es como en (a).
mientras que en los AB se encontrarn como en (b) y (c) aproximadamente a partes
iguales.
Genes y ADN
De acuerdo con numerosos estudios el ADN contenido en una clula diploide
Ii~iinanaes aproximadamente 7,3 x 10" g. Si el peso molecular promedio de un par de
iiucletidos es de 1,025 x 10~"g se deduce que la clula diploide humana contiene
alrededor de (7,3 x 10~"/1,025x 1W)7,l x 1 O9 pares de bases por genoma diploide,
3,s x 10' por geiioma haploide.
Si todo este ADN codificara protenas de aproximadamente 500 aminocidos
cada una, podra producirse ms de un milln de ellas. Como para cada aminocido se
requieren 3 bases harn falta (500 x 3) 1 500 pares de bases. A partir del genoma total
seran (3.5 x lO''I1,S x 10') 2,3 x 10"protenas.
Por varios mtodos genticos se ha determinado que la clula humana contiene
aproximadamentede 70OX a 100000genes. Si se mantienen los mismos "supuestos"anteriores,
pan la codificacinde 100 000protenas senm necesarkai [(7x 109 x (3 x IW)] 2,l x 10*pares
de bases, lo cual representa [(2,1 x 107)1(3x 10') aproximadamente 1071, es decir, que
slo aproximadamente el 10 %del ADN contiene informacin para la sntesis de
riiolculas especficas (protenas. ARNr y ARNt). De aqu se deduce que la mayor parte
del ADN est implicada en los mecanismos de regulacin de la expresin gentica o en
otras funciones an desconocidas.
Si se asla el ADN de una bacteria y se cona mediante emiiiias en unos 500 a 1 000
fragmentos y se centrifiigaii en un gradiente de densidad de CsCI. se observan que se
renen en una zona nica y estrecha (Fig. 26.4).
Esto se debe a que la densidad del ADN es proporcional a su contenido en G + C
y la composicin promedio de cada fragmento, que contiene varios cientos de bases,
no vara mucho de uno a otro. Si se aplica el mismo procedimiento al ADN de un
mamfero se obtienen 2 zonas, la mayor con una composicin aproximada de A + T del
60 %,pero la menor con ms del 90 P/a de A + T. lo cual constituye un hecho inusual. Al
ADN contenido en esta zona se le denomina ADN satlite, &te ha sido observado en
muchos organismos y en el ser humano constituye del 0.5 al 1 lo (10' pares de bases)
del genoma.
Una caracterstica importante del ADN satlite es lade estar formado por secuencias
repetidas organizadas en tndem, una a continuacin de la otra. Estas secuencias
generalmente son cortas, de 5 a 10 bases, pem pueden llegar a tener de 100 a 200 bases.
Las secuencias caractersticas de la D. mrlarioguster son las siguientes: -
1.683

Densidad

Fig. 26.4. Dcteecin del ADN satlite. Si el


ADN de los procarionles se corta
con nurleasas espeefiras cn un
grupo reducida de fragmentos de
gran tamatio y despus se
Se ha podido determinar la localizacin de este ADN satlite, para ello se procedi centrifugan en gradiente de densi-
de la forma siguiente: se tomaron muestras de ADN satlite y a partir de l se fonn dad, estos fragmentos sc agrupan
en una zona estrecha del tubo de
ARN niarcado con YHJ-undina. Se fijaron clulas cultivadas sobre un portaobjetos y se centrfugacin donde la densidad
trataron con lcalis para desnaturalizar el ADN. Con este tratamiento el croinosoma de ellos sea igual a la del medie. El
queda pr8cticarnente intacto. Se aadi el [ M - A R N y se dio tiempo suficiente para ADN de eurariontes. al scr somc-
permitir la hibridacin. Se lav la preparacin para eliminar el exceso de reactivo y se tido al misma procedimiento, se
concentra en 2 zonas de densidad
someti a un proceso de autorradiografa. Al revelar la placa se encontr que el ADN diferente. La de menor densidad
satlite se localizaba fiindameiitaliiieiite en los centrmeros y con menor frecuencia en corresponde al ADN satlite.
los telomeros; se Iia pensado que est relacionado con la fijacin del hubo durante la
divisin celular, pero esto no ha sido comprobado. No debe confundirse al ADN satlite
con los satlites descritos en la estructura de algunos cromosomas, pues aliuque la
palabra puede tener en ambos casos la misma connotacin (una estructura asociada
con otra) se refiere en cada caso a conceptos diferentes.

Componentes celulares y &netica molecular 465


Estos hallazgos impulsaron a realizar el estudio ms a fondo acerca de las
caractersticas de los ADN de eucariontes. Un procedimiento que ha dado muchos
resultados es el estudio de la cintica del proceso de renaturalizacin. Para ello se
extrae el ADN de un organismo y sin fraccionarlo se desnaturaliza. despus se coloca
en condiciones que permiten la renaturalizacin, siguiendo el proceso en funcin de la
concentracin inicial de ADN (Co) y el tiempo (t). Cuando esto se hace con el ADN de
la E. coli se obtiene una curva tpica que se muestra en la figura 26.5 (a); se interpreta
como si el proceso ocurriera por la presencia de una sola especie molecular. Cuando se
hace con ADN de mamferos se obtiene una curva que . aparece
. en la figura
- 26.5. (b),
que presenta varias mesetas como si en el proceso intervinieran ms de una especie
molecular, una de renaturalizacin rpida, otras intermedias y otra lenta; esto se debe
a la existencia de secuencias con mayor o menor grado de repetitividad.

Fig. 26.5. Curva Cal. Si se desnaturaliza el


ADN de la E. col (azul) y se sigue
el proceso de renaturalizaein, se
obtiene una lima continua corno
corresponde a una sola especie
moleeular. El ADN de marniferos
(rojo) presenta varias curvaturas,
lo cual indica que ste se compor-
ta de forma heterognea. Una frac-
cin (1) presenta una reasociacin
rpida y otra (4) es lenta, a la vez
que se observan otras 2 (2 y 3)
. iiresentan
aue . una velocidad de
reasociacin intermedia; esto sip- 90
nifica que el ADN de marniferos '. .
se comporta coma si ealuviera for- 100
mado por 4 especies moleeularei. 1 0 l . I2 10~1 1Cot(M.5, ,O2 )
I$ 16 ,/6 IU?

El anlisis detallado de estas curvas y el uso de otros mtodos complementarios


permiten distinguir4 tipos de secuencias en el ADN de eucaiontes: las altamente repetidas,
que aparecen por varios cientos o millones de copias y se corresponden con las de
renaturalizacin rpida; las medianamente repetidas, que se presentan en un nmero de
copias que va de 10 a varios cientos; las moderadamente repetidas con un nmero de
copias de 2 a 10 y junto con las anteriores representan la fraccin de velocidad intermedia
de renaturalizacin; por ltimo, las secuencias de copia nica que son las de menor
velocidad de renaturalizacin. En forma de copia nica se encuentra la mayora de los
genes de laclula, pero en realidadconstituye la menor fiaccin del ADNcelular. Ejemplos
de secuencias moderadamente repetidas son los genes de las histonas y de los ARNt. En
algunos casos estas secuencias no son exactamente repetidas y los productos gnicos
presentan pequeas diferencias en su composicin. Las secuencias medianamentr repetidas
en general no son codificantes y se cree que tengan alguna funcin reguladora. Las
altamente repetidas incluyen al ADN satlite y algunos genes, como los que codifican los
precursores de los ARNr, para los que se han calculado que existen unas 24 000 copias
para el de 5 S y unas 500 copias para el precursor de los otros 3 tipos.

Estructura del gen


Una vez analizadas las caractersticas generales de los ADN de eucariontes, es
conveniente detenerse a examinar la estructura interna del gen. Como ya se seal, un
gen est constituido por uno o ms segmentos especficos del ADN, cuya secuencia de
bases contiene la informacin necesaria para la sntesis de molculas especficas, o sea,
protenas, ARNt y ARNr.
Si se compara la longitud de algunos genes de eucariontes con la de sus productos
se observa que ste es generalmente mucho menor que aqul. As, de acuerdo con la
longitud de su gen, la cadena P de la hemoglobina deba poseer unos 500 aminocidos
cuando en realidad slo contiene 146 aminocidos.
Hechos como ste comenzaron a ponerse de manifiesto a mediados de la dcada
de los aos 60 y despertaron un vivo inters. Despus de mltiples esfuerzos se ha
podido comprobar que los genes eucariontes no son continuos, sino que se encuentran
interrumpidos por secuencias de nucletidos que no codifican para la protena dada;
por lo tanto la caractenstica general del genoma de poseer zonas codificantes y no
codificantes se repite a pequea escala en la estructura misma del gen. As cada gen
est constituido por un nmero de secuencias codificantes que alternan con secuencias
no codificantes. Las primeras reciben el nombre de exones (e.rit, salida, alude al hecho
de que estas secuencias una vez transcritas abandonan el ncleo) y las segundas, el de
intrones (inside, dentro, pues una vez transcntas quedan dentro del ncleo). El nmero
de exones es variable para los diferentes genes; el de las globinas presenta 3 exones, las
cadenas pesadas de las inmunoglobulinas 5, la ovoalbmina 8, la conalbmina 18 y la
cadena a del colgeno 53 (tabla 26.2).

mbla262. Caractersticas estructurales d e algunos genes humanos

Pmtena Residuos Cromosomas Gen@b) Exones

Colgeno Inl lo00 17 18 000 51

Factor Mn 2 332 X 186 O00 26

Receptor de LDL 839 19 45 000 18

La secuencia de bases as como la longitud de los intrones no parecen presentar


regularidad alguna, pero suelen ser mayores que los exones. La nica regularidad que
ha sido observada es una pequea secuencia que se encuentra al inicio y al final de
cada intrn, pues todos los conocidos comienzan por GT y terminan con AG; esto
puede comprobarse en la figura 26.6, donde se muestran los resultados de un estudio
de la secuencia de las uniones entre intrones y exones en ms de 100 genes.

Ex6n Intrn Exn

(O O 86---------------- 5 130 0 1

;; 16

16
81

10
10
139
o

0
3 .--............84

41...............1
~
. ; l;i 123

67
28

32
~ i g 26.6.
. caractersticas de 10s intrmes.
La figura representa la secuencia
de bases nitrogenadar alrededor
de las uniones exn-intrn y la
intrn-exn. as como demueslra
Total
a n a l i ~ a d o 139
) ~ ---( 1 1-
130
cioconstancia
la y del par del
AGpar GTfinal.
en el en el ini-

Componentes celulares y Gen6tica molecular 467


Todo parece indicar que la fragmentacin de los genes no es al azar. Son muchos
los ejemplos que demuestran que cada exn codifica para una zona especfica de la
protena con caractersticas estructurales y funcionales muy definidas, o sea, un dominio.
Esto ha hecho pensar que los intrones pudieran haber tenido una importante funcin
en la evolucin, que favorece el intercambio de segmentos gnicos al formar nuevos
arreglos que daran lugar a protenas diferentes, a partir de bloques de otras protenas.
La presencia de los intrones hace ms flexible al genoma de los eucariontes, lo cual
acelerara el proceso evolutivo. Por otra parte, estos exones pueden arreglarse de forma
diferente, al ser transcriios en su ARNm o durante el procesamiento de estos ltimos,
dando lugar a la formacin de protenas diferentes a partir del mismo segmento de
ADN. Una vez ms se trata de conceptos relativos, pues en muchos casos los intrones
de un gen representan otros genes. As en el gen NFI, cuya alteracin produce una
enfermedad llamada neurotihromatosis 1 , presenta un intrn de gran tamao en el cual
estn ubicados otros 3 genes.
Por ultimo, es bueno sealar que no toda la secuencia de bases que aparece en los
exones se traduce en secuencias especficas de aminocidos. Hacia el extremo 5' aparece
una secuencia de bases. cuya funcin est relacionadacon la iniciacin de la traduccin
y facilita la incorporncin del ARNm al ribosoma. Otra secuencia aparece hacia el
extremo 3' y est relacionada con el mecanismo de terminacin. En esta zona existe
una seal que indica el lugar doiide debe producirse la modificacin del extremo 3' del
ARNm. coiiocida como sitio de poliadenilacin y que se estudiar con ms detalles en
el captulo siguiente (Fig. 26.7).

Fig. 26.7. Estructura generalizada de un gen


cucarionle. Si leemos el gen de iz-
quierda a derecha, lo primero que
encontramos es la regin del pro-
Unidad de Transcripcin A
matar, can sur secuencias regula- " Promotor Exn 1 uih.6111
doras especialmente TATA en la I
rana de -30. El sitio para el Cap -30
corresponde al primer nucletido
que ser transerito y ocupar el TATA
extremo 5 ' -P del ARNni. El
\ ATG
triplete ATG seala el sitio donde
debe comenzar la traduccin. Lue-
go ovones e intrones se alternan
de acuerdo can el gen especfico
de que w trak. Despus del ltimo
a n ap-e una zona que contiene Por su parte, los procariontes tienen generalmente su ADN formando una sola
lasffuenOaMTAAA,queindiaq~e cadena, cuya asociacin con protenas no resulta tan regular como en los eucanontes.
unay 20 bases ms adelante est el Casi siempre contienen sus genes en copia nica y stos no presentan secuencias
sitio donde debe incoiporaise la cala
intercaladas. Cuando en algunos casos los genes pueden ser mayores que su producto,
de poli A. El punto exaclo de la ter-
minacin no ha sido tobimente es- las adiciones se encuentran hacia los entremos, de manera que la secuencia codificadora
clarecido. es casi siempre continua.

E n procariontes,los genes cuyos productos estn relacionados funcionalmente se


organizan en operones (captulo 34) y son transcntos en un ARNm policistrnico, que
contiene informacin para ms de una cadena polipeptidica. Todo el sistema se controla
por medio d e una secuencia especfica d e bases -el operador- y puede activarse o
desactivarse regulando el funcionamiento de ste.
Esto no sucede en eucariontes. Muchos genes eucariontes funcionalmente
relacionados pueden formar gmpos (cluster) denominados familias gnicas. La actividad
de los miembros de la familia es habitualmente (pero no siempre) regulada de forma
coordinada.
OS I oz I OZI OZ 1
ontogenticodel organismo. El ejemplo mejor conocido es el de los genes de la
hemoglobina. Esta protena es un tetrmero formado por 2 subunidades de tipo a
y 2 de tipo p. Hay varias formas de estas subunidades que se diferencian en
unos pocos aminocidos y la forma presente depende de la etapa del desarrollo
del organismo.

Fig. 26.9. Familias multignicas complejas. El grupo est formado por genes que se transeriben de
forma independiente. L a figura representa la familia de las - . las hiitonas en (a) el
cenes rima
eriza de m&, (b) la ~ros&hila mdanogaster y (c) en el tritn, una especie de salamandra
marina. La flecha indica el sentida de la transcripcin.

En el caso de las subunidades de tipo P, existen 4 variantes (E, y, 6 y B). Durante


el perodo embrionario (menos de 8 semanas despus de la fecundacin) slo se produce
la cadena E, de la semana 8 a la 41 se sustituye por la y y a partir del nacimiento por la
p y una pequea fraccin de la F; igual sucede con las subunidades de tipo a. La
familia a est localizada en el cromosoma 16 y la P en el 11 y curiosamente estn
organizadas en el mismo orden en que se activan (Fig. 26.10).

Fig. 26.10. Familias multignicas comple-


jas controladas por el desarrollo.
Este grupo est compuesta par
genes que se activan e inactiva"
d e acuerdo ron el momento del
desarrollo. (a) La familia gniea
de la a-globina en el cromosoma
16, 5 es una cadena embrionaria,
la al y a 2 se producen dcsde la
da fetal hasla la adultez. ~5 y yial
representan seudogenes. (b) La
familia gnica de la R-globina lo-
calizada en el cromosoma 11; E es
una cadena emhrionaria, Gy y Ay
son fetales y las R y S comienzan
en la vida ktal v semantienen hasta
el estado adulto. yi 151 representa
un seudagen. Como se indica en
las flechas, estos genes se organi-
zan en el mismo orden en que son
activados, la cual no siempre su-
cede.
Genoma humano
El estudio del genoma humano es uno de los campos irs importantes y mis
complejos de la biologa celular contempornea. El tamao y la organizacin
cromosmica de ste son similares al de otros aniiiiales. pero los mtodos empleados
para su estudio resultan ms coiiiplicados. El desxrollo de la tecnologa del ADN
recombinante ha permitido encoiitr;ir prcediiiiieiitos directos para continuar,
profundizar y rectificar resultados eii~~iiti.;idosrii dcadas anteriores por estudios
indirectos, a los cuales muchc coiiirihiiyi, el c\tiidi de la correlacin entre las
enfermedades de origen gent9ii.o y los Ii;ill;iz~(ishioqiiiiiicos y citogenticos de los
pacientes. A manera de concliisiiiii de este c;ipiiil se iiiencionarn las caractersticas
ms notables del geiionia de los \eres liiiiiimc~.
El genoina Iiuiiiniio est5 c(iii\titiiid<i pnr iiilculas de ADN organizadas en 22
pares de criiisiiiii;is ;iutiisi,iiiic<is. el par de cromosomas sexuales (XY) y el
niitocondrial (t:iinhiL.ii Ilaiiiiido crinsma M 6 25). Sus dimensiones pueden expresarse
en tEriiiiiios de iiiiicni toiiil de p r e z de bases o de genes. El genoma nuclear haploide
hiiiii;iiiii coiiticiic 3.3 x 10" pb y el iiiitocondrial 16 569 pb.
Pnih;ihleiiiciite cl Ii<iiiihretiene entre 50 000 y 100 000 genes estructurales, que
codilicnii I:i seciiciici;~aiiiiiinacdica de protenas o la nucleotidica de ARN ribosoinales
y de irmslereiicia. A csie estiinado se ha llegadopor medio de numerosos procedimientos
y resiilin ;ipy;id pnr el nmero de genes localizados en un segmento de ADN de
loii~iiiidcoiiocidii. que ha sido estudiado en gran detalle. No debe confundirse el
niiiero de y i e s con el de protenas. pues como se podr ver en captulos posteriores
un iiiisiiio gen puede dar lugar a ms de una protena y, adems, existen otros mecanismos
que prodiicen la formacin de un gran nmero de protenas a partir de un segmento
gnico limitado.
El cniiiins~iiiaiiiitocondrial presenta una mayor densidad de genes (por ausencia
de intmnes y espaciadores mucho ms cortos) y presenta 13 genes para protenas, 22
para ARNr y 2 para ARNr (125 y 16s).
Se Iiaii locdizado unos 800 loci, cerca de 120 en el cromosoma X y los restantes en
los autosiiiicns. Cada uno contiene como mnimo 1 200 pares de bases en informacin
codificada. pern son mucho mayores debido a los intrones y las secuencias que los
tlanquenii. t;iiito hacia el extremo 5' como hacia el 3'. Hacia la zona adyacente al
extreiiin S' se encuenti-an las regiones reguladoras, y hacia la 3' la secuencia AATAAA
conocida como sitio de poliadenilacin.
Entre uno y otro gen se hallan secuencias espaciadoras de varias kb cuyas funciones.
si Im tieiieii. son desconocidas. stas consisten en secuencias repetidas, de las cuales
la iiiis frecuente es la llamada familia Alu, pues contiene la cuarteta AGCTTCGA que
es reconocida por la enzima de restriccin Alu 1(de Arthrobacter luteus); estas secuencias
repetidas est6n presentes cientos de miles de veces en el genoma humano, especialmente
en los espaciadores. pero en ocasiones en los intrones.
De todos los estudios realizados hasta el presente pueden derivarse algunas
caracterstic;is generales en cuanto a la organizacin de los genes humanos en los
cminosoiiias y que pueden resumirse en las siguientes:

l. En general los genes cuyos productos estn relacionadosevolutivao funcionalmente


aparecen agrupados en los cromosomas, sin embargo no existen agrupaciones
gnicas para estructuras y funciones de rganos particulares, como odos, corazn,
pulmn u organelossubcelularescomo lisosomas, mitocondrias,etctera.
2. Los genes que codifican las enzimas que catalizan reacciones sucesivas en una va
metablica particular no se encuentran por lo general agrupados en el mismo
cromosoma. As, los genes para las enzimas galactoqninasa, galactosa-1-fosfato
undil-transferasay la gaiactosa-4-epimerasa,que propician la entrada de la galactosa
a la va glucoltica estn localizados en los cromosomas 17,9 y 1,respectivamente.
Igual sucede con las enzimasdelciclodelau r q p u e s IacarbamilfosPatosintetasa 1,
ornitina transcarbamilasa, argininosnccnicosintasa, argininosnccnicoliasa y la
arginasase encuentran codificadasen los cromosomas2, X, 9,7 y 6, respectivamen-
te. Un hecho curioso es que la triosafosfato isomerasa, gliceraldehdo-3-fosfato
deshidrogenasa,enolasa y lactato deshidrogenasa, relacionadas todas con la va
glucoltica, presentan sus genes agrupados en el cromosoma 12.
3. Los genes que codifican para las subunidades de protenas heteromricasse hallan
usualmente en cromosomas diferentes; mientras el gen para la subunidad a d e la
hemoglobina est en el cromosnma 16, la subunidad P est codificada en el 1l. Lo
mismo sucede con las formas isoenzimticas de la lactato deshidrogenasa cuya
subunidad M se codifica en el cromosoma 11 y la H en el 12. Una excepcin
notable es el fibringeno,cuyas 3 subunidades se codifican por genes localizados
en el cromosoma 4.
4. En contraste con lo anterior, algunos genes coditican ms de una cadena
polipeptidica; estose debe fundamentalmenteal procesamientoposterior del ARNm;
as sucede con la insnlina cuyas 2 cadenas son codificadas por un gen nico nbica-
do en el cromosoma 11. Es tambin el caso del gen de la proopiomelanocortina
localizado en el cromosoma 2 que da origen a 7 polipptidns con funciones dife-
rentes.
5. Los genes quecodifican laformacitoslica y mitocondrial de la misma enzima se
encuentran en cromosomas diferentes, como sucede con la transaminasa
glutmico-oxalactica,cuya forma citoslica se codifica en el cromosoma 10 y la
otra en el 16 y la isocitrato deshidrogenasa en el 2 y el 15,respectivamente.
6. Una caractersticasobresaliente es la existencia de los pseudogenes, o sea, secuen-
cias de bases similaresa la de genes funcionales,pero que no se expresan al parecer
por haber perdido algn sector indispensable para su transcripcin; estos
pseudogenes ocupan una porcin considerable del genoma. Los ms conocidos
son los de las cadenas a y p de la hemoglobinaen los cromosomas 16 y 11, respec-
tivamente.

El desarrollo que han alcanzado las diferentes tcnicas, para el estudio de los
cidos nucleicos, hace tener esperanzas de que en los prximos aos se conocern
muchos ms elementos acerca de la estructura y la organizacin del genoma humano.
A este objetivo debe contribuir de fonna sobresalienteel Proyecto del Genoina Humano.
que pretende establecer la secuencia de bases de todas las molculas de ADN contenidas
en los cromosomas humanos y realizar estudios comparativos con secuencias de otros
organismos, para determinar la funcin de cada uno de los segmentos de ADN. Esta
investigacin es transcendental para la biologa contempornea y debe estar terminada
para los primeros aos del prximo siglo.

Resumen
El material gentico de todos los organismos celulares est constnido por el
ADN, que puede exLsr en una sola molcula como en los proeariontes, o en varias
como en los encariontes, en los niales, adems, est separado del reato de la clula
por una doble membrana. El ADN de eucariontesse encnentra asociado con prote-
uas, formando el par cromatina-cromosoma. El nmero y la forma de los
cromosomas son caracterLsticos de cada especie. En los cromosomas se hallan
secuencias de bases nitrogenadas que contienen la infomci6n neeessria para la
&tesis de las protenas, los ARNr y los ARNt: stos son los genes. El conjunto de
todos los genes en un organismo deine el genoma Un gen puede tener muchas
formas al6Ucas pero una dlula s61o puede tener 2. Si son ignales, la d u l a es
homaeig6tica, y heterocig6tieasi sondesiguales. La pareja de genes que determina
un earcter forman el genotipo y su manifestscin externa es el fenotipo. Un ejem-
plo caraetersocn de la relacin genotipo-fenotipo en seres humanos lo constituyen
los g m p sanguneosABO.
En la clula eucarionte existen distintos tipos de secuencias nueleotdicas en el
ADN: las altamente repetidas, mediana y moderadamente repetidas y las semen-
cias nicas. Los genes casi siempre se encuentran en secuencias de copia nica,
aunque existen notables excepciones como los de las historias y los ARNr. Las
secuencias altamente repetidas se locazan en los centrmeros y con menor fre-
cuencia en los telmeros; su hinan es de800nocida Los genes eucariontes son
diseonnuos,pues presentan secuencias hieraladas no codificantes (htrones), se-
parando las codificantes (exones). Los geoes cuentan adems con sus promotores y
con sus seeuenciasfnncionales-aunque no ccdicantes- tanto hacia el extremo 5'-P
como hacia el 3'-OH.
Muchos genes relacionados funcionalmente se agrupan,formando famias
gnicas que pueden ser simples, complejaso reguladaspor el desurolio ontogentico
del organismo.
El genoma humano constituye un caso especial dentro de los organismos
eucariontes por la importancia extraordinaria que tiene su mnoeimiento pmfnn-
do. Se han LoealVado ms de 800 genes en los cromosomas humanas y a partir de
n u m e m estudios se han podido precisar algunas de sus caractersocas ms so-
bresalientes: los genes que ccdican proteinas espeficas de un rgano o tejido no
estn agrupados en el mismo cromosoma, as como tampoco los relacionados con
una va metablica; las subunidades de protehw heteromncas se codifican por
genes localizados en cromosomas diferentes; algunos genes ccdiean ms de una
cadena popeptidica; tambin se encuentran separados los genes que ccdican
formas diferentes de la misma e m k q por ltimo, la presencia de pseudogenes en
una proporcin notable del genoma es un heeho apreciable en el genoma humano.
F.stos conocimientos tienen no S610 una importancia terica, sino tambin prc-
tica sobre todo en el campo de las ciencias mdicas-

Ejercicios
1.Un gen A tiene un alelo A ' . Si el genotipo femenino es AA y el masculino A ' A '
cules sern los posibles genotipos de los descendientes?
2. Cul sera el resultado de la pregunta anterior si los genotipos masculino y feme-
nino hubieran sido AA ' ?
3. Se ha calculado que en el ADN de la E. coli existen 1 500 genes. Si cada uno
codifica una protena de 500 aminocidos y el ADN total es de 4 x 10' pb. Cul
ser la proporcin codificante de ese ADN?
4. Cules son los tipos de secuenciai de ADN que encontramos en las clulas
eucariontesy qu relacin tienen con las funcionesdel ADN?
5. A un cultivodeclulassele aade ['HI-uridina durante lominutos. Las clulas se
lavan para eliminar el exceso de reactivo. Se sigue entoncesla marca radiactiva por
los compartimentoscelulares. En los primeros minutos despus de la exposicin
toda la radiactividad se localiza en el ncleo de todas las clulas. A medida que
pasa el tiempo se observa que las clulas se comportan deforma diferente, mientras
en algunai de ellas la radiactividad permaneca en el ncleo, en otras se localizaba
en el citoplasma Cmo pueden explicarse estos resultados?
6. Se sabe que la ARh' polimerasa tarda aproximadamente 5 minutos en sintetizar el
ARNr de 28 S. Calculecuntas molculas pueden formarse en 8 horas si:
a) Existe un slo gen para el ARNry se transcribecon una sola polimerasa cada vez.
b) Existen 100 copias del gen y cada uno es transcrito por una sola molcula de la
enzima.
c) Existen 100 copias del gen y cada uno es transcrito por 100 polimerasas
simultaneamente.

Componentes celulares y Gentica molecdar 473


Con anterioridad se estudi cmo la replicacin del ADN es el fundamento
molecular de la transferenciade informacinde una clula u organismoa sus descen-
dientes. Se asegura que en el ADN radica la informacinque determina las caractersti-
cas estructurales y funcionales de las clulas que lo contienen; luego en las clulas
deben existir mecanismos por medio de los cuales se logre la expresin de la informa-
cin gentica, ese mecanismo en lneas generales consiste en sintetizar protenas, cuya
secuencia de aminocidos est codificada en la secuencia de bases nitrogenadas del
ADN, y este proceso consta de 2 etapas fundamentales.
En la primera la secuencia de bases del ADN se copia en una molcula especfica
de ARNm,esta etapaes la transcripcin. La segunda consiste en utilizar lasecuencia
de bases del ARNm para, a partir de ella, sintetizar una cadena polipeptdica con una
secuencia especfica de aminocidos,esta etapa es la traduccin (Fig. 27.1).
Estos 2 procesos que ocurren de manera continua -en algunos casos basta simult-
neamente-constituyen el mecanismofundamental,mediante el cual el ADN determina
las caractersticasestructurales y funcionalesde unaclula y de un organismo como un
todo; por eso, como se vio anteriormente, no es imprescindible la duplicacin exacta
de todos los componentes celnla~s al producirse la divisin celular, pues basta con la
divisin del ADN y los componentes celulares que intervienen en su expresin para
quelas clulas hijassean de la misma especie que las parentales.

Aspectos generales
La transcripcin es el proceso central en el crecimiento y desarrollo de las clulas,
en lacual los genes que se encuentran en el ADN de los cromosomassonselectivamente
localizados, reconocidos y transcritos, produciendo ARN mensajeros, ribosomales
(estructurales)y de transferencia (adaptadores). El notable progreso en Los ltimos
aos de la gentica bacteriana,el ADN recombinante, la bioqumica-fsica, etctera,ha
Fig. 27.1. Relacin transcripein traducrin.
ampliado considerablementelos conocimientossobre este proceso. Aun cuando pue- En los proeariontes (a) al no eiis-
dan existir diferencias en los mecanismos de transcripcinen diferentes organismos, tir envoltura nuclear la traduccin
hay una serie de caractersticascomunes a todos ellos que se enumeran a continuacin. comienza generalmente antes de
terminar la transcripcin. En los
Los precursores de la sntesis de los ARN son los 4 ribonuclesidos trifosfatados, cuearionles (b) cl ARNm se forma
ATP, GTP, UTP y CTP. En la reaccin de polimerizacin, los ribonucletidos son en el ncleo y alli se procesa antes
aadidos uno a uno al extremo de una hebra en crecimientopor enzimas denominadas de ser transportada al citoplasma
ARN polimerasas dependientes de ADN o ARN polimerasas. donde es traducida.
La secuencia de bases del ARNes complementaria a la hebrade ADN, quese est
copiando. Aunqueel ADN es en general dedoble hehra,en cada sector especficoslo
una de ellas se utiliza como molde o patrn para la sntesis de ARN.
La hebra de ARN crece en el sentido 5 ' -3 ' ,mientras va copiando la hebra del
ADN que est en direccin 3 ' -5 ',luego la sntesis es antiparalela y nnidireccional.
La reaccin bsica de polimerizacin consiste en la adicin de un ribonuclesido
trifosfatado al extremo 3 ' - 0 H del nucletidoprecedente, con liberacin de pirofosfato,
formndose un enlace fosfodister. Al igual que en la replicacin, la polimerizacin
avanza acoplada a la hidrlisisdel pirofosfato. Las ARN polimerasas son capaces por
s mismas de iniciar la sntesis, luego no hay necesidad de un iniciador.
En resumen, la transcripcin se produce por el mecanismo bsico de
complementaridad de bases. aadidas en formas gradual, unidireccional y antiparalela,
sin necesidad de un iniciador y acoplada a la hidrlisis del pirofosfato.

Etapas de la transcripcin
En el estudio de este procesoseseguir el mismo ordenamiento quecon el estudio
de la replicacin: la iniciacin, la elongacin y la terminacin, as como los eventos
previos a la iniciacin (preiniciacin) y los posteriores a la terminacin (postermi-
nacin). En primer lugar se analizar c6mo ocurre el proceso en los organismos
procariontes, queson los mejores conocidos. Ms tarde se tratar la transcripcin en
eucariontes dondese ha producido un extraordinario avance en los ltimos aos. La
transcripcin es un proceso ms simple que la replicacin. En la E. coli una sola
enzima es suficientepara la realizacin de todo el proceso; se comienza por describir
las caractersticas estructurales y funcionales de la enzima para no intermmpir la se-
cuencia de los eventos moleculares.
Esta enzima debe realizar mltiples acciones para llevar adelante la transcripcin:
reconocer el comienzo de lacadena de ARN que se debesintetizar en una doble hebra
de ADN, para lo cual debe identificar una secuencia de bases especfica,debido a las
irregularidades de la estructura del ADN en esa zona del genoma; colocar cada
nucletido en su posicin correcta de acuerdo con la secuencia de bases del ADN;
realizar la sntesis total de la molcula de ARN desde el principio hasta el final;
reconocer las seales que indica el lugar apropiado para la terminacin del proceso;
debe adems reconocer sitios reguladores tantoen el ADNcomoen el ARN transcrito,
y poder interactoar con factores proteinicos y pequeas molculas que modulan la
actividad de la enzima en su recorrido sobre el ADN.
La ARN polimerasa mejor conocida es la de E. coli,quefue descubierta por Weisy
Gladstoneen 1959. Esta enzima est constiiuida por 5 subunidades; 2 subunidades a de
136 kDdemasa molecular cada una; una P de 150 kD; una p 'de 155 kD, y una ode7U kD,
para un total de ms de 450 kD. Es una de las mayores enzimas conocidas. Cada clula
bacteriana contiene aoroximadamente unas 3 000 molculas de la enzima.
Diversos procedimientosexperimentalespermiten afirmar que la subunidad P est
relacionada con la unin de los ribonucletidos sustratos y de los inhibidores de la
polimerizacin, as como la subunidad p ' en la unin con el ADN. Ambas subunidades
contienen un ion Zn2+por molcula. La funcin de la subunidad a est relacionada
con el ensamblaje de la enzima. Ninguna de las subunidades presenta actividad
cataltica, ni de unin con el ADN en ausencia de las otras. La suhunidad a s e disocia
fcilmente de la holoenzima, quedando el ncleo constituido por el resto de las
subunidades. Recientemente se ha reportado la existencia en la E. coli de, por lo
menos, 5 subunidades o diferentes.
La holoenzima presenta una forma ms bien alargada, con una longitud mwma de
25 nm, es lo sufcientementegrande paraentrar en contactocon casi 75 pares de bases del
ADN, sin embargo, el ncleo slo presenta 10 nm de longitud que le permite cubrir
aproximadamente 30 pb.
El ncleo de la enzima tiene gran afinidad por el ADN, y se une a ste fuertemente
en cualquier lugar de la cadena.

Eventos previas a la inieiaci6n (preinieiacin)

Los eventos de preiniciacin consisten en la localizacin, por parte de la ARN


polimerasa, de un sitio especficodel ADN y laseparacin de las 2 cadenas, de forma
que la secuencia de bases sea accesible a la enzima.
Por convencin se representa la hebra de ADN, que no es copiada, y se designa
como la hebra codificante por ser muy parecida en su secuencia al ARN, sta se debe
escribir de izquierda a derecha en el sentido 5 ' 3 3 ' .La otra hebra se denomina
molde porque esa es precisamente su funcin. La primera base que se transcribe se
toma como referencia y se designa como +l.Las escritas a su izquierda llevan nmeros
negativos y las que van hacia la derecha nmeros positivos -la posicin O no existe-,
por ejemplo:

Tngase presente qnesi en la secuencia escrita a partir dela adenina +1 sustitui-


mos las T por U, tendramos la secuencia del ARN transcrito primario.
El elemento central en la regulacin de la transcripcin es el promotor, que se
define como un segmento de ADN, ste contiene las seales para la unin adecuada de
la holoenzima de la ARN polimerasa y su posterior activacin para formar un sitio
capaz de iniciar la transcripcin. El promotor contiene, adems, en so en sus alrededo-
res, otras seales que controlan la unin especfica de protenas reguladoras. Estas
protenas modulan la efectividad de la unin de la polimerasa con el promotor. Para
designar la efectividad que tiene la transcripcin en los diferentes promotores se utili-
za el concepto de fortaleza del promotor, de donde se derivan los promotores fuertes
(muy efectivos) y dbiles (poco efectivos).
Al parecer el reconocimiento entre la ARN polimerasa y el promotor se debe a la
presencia de un grupo de donantes y aceptores de puentes de hidrgeno orientados
especficamente, que interactan con grupos similares en el dominio de unin de la
enzima; estos determinan la especificidad del reconocimiento. A la estabilidad contri-
buyen otras interacciones menos especficas,pero ms fuertes, como las interacciones GTC::' 1: .: T G T C
ACG:;'; -I: 1 ACG
8
inicas entre las cargas negativas de la parte montona de la estructura del ADN y TAT(7;' :r ,. ! T A T
residuos bsicos del dominio de unin de la protena, y quizs interacciones CCG; l i:.<.< i~CCG
hidrofbicas entre el metilo de la timina y grupos apolares de la superficie de la T A C L , ' :L -1,. 1 T A C
enzima. , ,~.-I.
.
A T T . . 1 ..., i. . ATT
,- I
. ... . ..- . .- ,
En este momento es conveniente hacer la distincin entre 2 trminos quese utili-
zarn frecuentemente y se refieren a las secuencias consenso y a las conservadas,
ambas derivan del anlisis de sectores homlogos del ADN. Las secuencias consenso Fig. 27.2. Secuencias consenso y conserva-
das. Las secuencias consenso (a)
seconstrnyen a partir de las bases que ocupan una determinada posicin, en la mayora se obtienen a partir del anlisis dc
de los casos estudiados, aunque como tal no exista en ninguno de ellos. Las conserva- un nmero de secuencias de sec-
das son las secuencias que aparecen completas en la mayor parte de los casos esiudia- tores equivalentes del ADN, y no
dos,lnego son reales. Las secuencias consenso en general slo existen como posibili- siempre existen en la realidad. Las
secuencias conservadas (b) son
dad (Fig.27.2). aqullas que se mantienen casi in-
En los promotores conocidos se distinguen 2 secuenciasconsensoimportantes. La alterables en todos loi organismos
primera aparece alrededor de la posicin -10 y tiene la estmctnra TATAATG. La otra analizadas.

Componentes celularw y Gentica molecular 4?7


secuenciaimportanteaparece alrededor de la posicin -35y contienetpicamente 8 pares
de bases,porejemplo,TGlTGACA,dondeexisteunpredominiodepam AT.Ladistancia
entre las posiciones ms conservadas de -10y -35 es por lo general 17 (? 1).En la figura
273 se muestra la estructuraprimaria de algunos promotores.

Regin -35 Regin -10


lac ACCCAGGCTTTACACTTTATGCTTCCGGCTCG'r'Lt.'r(iTTGTGT<iAATTGTGA
gal P2 ATTTATTCCATGTCACACTTTTCGCATCTTTGTTA'iGC7rATGGTTATTTCA
trp AAATGAGCTGTTGACAATTAATCATCGAACTAGTrr'.:4CCTAGTACGCA+\GTT

Fig. 27.3. Estructura del promotor. Se muestra la secuencia del promotor de 3 upemnes. En azul, la
secuencia de -35 que parcee estar muy conservada. En rojo, la regin -10 can su secuencia
consenso TATAAT. La letra roja corresponde con el primer nucletido, en ser transcnto que
generalmente es A.

La fortaleza de los promotores est relacionada con estas caractersticas. Si la


secuencia se asemeja ms a la consenso, la fortaleza del promotor aumenta, disminu-
yendo en la medida que se hace ms diferente. La distancia entre las secuencias que &a
la mayor fortaleza esde 17 pb.
La subunidad 0,al unirse al ncieo de la polimerasa,aumenta la afinidad por estas
secuencias,de manera que permite a la enzima unirse a esta zona especfica del ADN.
Se cree que la unin se produce primero en la zona de -35 y despus en la otra ms
cercana, pero ambas son indispensables.
La unin de la polimerasa en el sitio adecuado provoca un desenrollamiento local
del ADN (favorecido por el elevado contenido de pares AT)que incluye aproximada-
mente las bases de -10 a +5. Esta estructura es muy estable y recibe el nombre de
promotor abierto (Fig. 27.4).

Fig. 27.4. Unin de la ARN polimerasa al


promotor. Para realizar la unin al
promotor, la ARN polimerasa ras-
trea la seal sobre el ADN (a) has-
La localizar el oromotor (bi
. . al cual
sc une firmemente y logra una
desnaturaliracin limitada (c), que c
permite el acceso a la seeufneia de
bases de la hebra molde.

Una vez formado el nromotor abierto. la enzima comienza a deslizarse sobre el


ADN hasta anibara la primera base que va a ser copiada. En ocasionespara la unin de
la polimerasa con el sitio adecuado se requieren protenas adicionales (capitulo 34).
En resumen, los eventos de preiniciacin comprenden el reconocimiento de sea-
les especficas, la unin ADN-enzima formando un promotor cerrado y su transforma-
cin posterior en un promotor abierto. La enzimasedesliza hasta la posicin +l para
dar comienzo al proceso.
La iniciacin de la transcripcin comienza con la unin al complejo, formadopor
la polimerasa y el promotor abierto del ribonuclesidotrifosfatoque formar el extre-
mo 5 ' -P de la cadena naciente de ARN. La unin del segundo nucletido y la forma-
cin del enlace fosfodister forma tambin parte de la iniciacin; por lo tanto, consiste
en la formacin de un complejotemario entrela polimerasa, el ADN y un segmento de
ARN, lo suficientementelargo para que el complejo sea estable y no sedisocie.
La ARN polimerasa contiene 2 sitios de unin para nuclesidos trifosfatados,
llamados sitios de iniciacin y de elongacin. El primero une frecuentemente
nucletidos de purina (93 % en una serie estudiada), casi siempre ATP (52 % en la
misma serie),luego la primera base en ser copiada es casi siempre la timina, que ocupa
la posicin +1 en nuestro ejemplo. Una vez formado el par AT se incorpora otro
nuclesido trifosfatado al sitio de elongacin; slo se incorporar aqul capaz de
formar un par con la base +2, por ejemplo, la citosina (Fig. 27.5).

Fig. 27.5. Iniciacin. Una vez formada el


promotor abierto la polimerasa
comienza a unir los nucletidos,
dirigida par una de las bandas del
AUN. Cuando la cadena contiene
de 6 a 8 nucletidos se separa la
subunidad a y slo contina ae-
tuanda el ncleo de la polimerasa.

Cuando los 2 sitios estn ocupados se produce la reaccin y queda formado el


primer enlace fmf0diktc.r. Innicdiahmente drspus M*produce el muvimiento de la
polimeraid hacia el nucletidu siguiente. El final de la iniciacin est determinado
por laseparacin del factor a y la formacin de un complejo temario estable. Se crea
que esto ocurra con la formacin del primer enlace fosfodister,pero estudiosposte-
riores demostraron que se requiere la incorporacin de 6 a 9 nucletidos para que esto
ocurra, como se muestra en la figura 27.6.

Fig. 27.6. Final de la iniciacin. Al separar-


se la subunidad a se produce un
cambia de confarmacjn en la
polimerasa que reduce sus dimen-
siones,haciendo que el nmero de
bases cubierto por la enzima sea
mucha menor.
Una vez liberado el factor o, la volimerasa adauiere una nueva conformacin v se
forma un complejo temario (polim&a : A D N : A ~naciente) que es muy estable:
La reaccin de elongacin comprendelos pasos siguientes:

1. Unin a la enzima del nuclesido ifosfato sustrato, es especficatanto para la base


como para la ribosa.
2. Ataque nucleofilico del P(a)al 3: - 0 H con la formacin del enlace fosfodister,
generando pirofosfato.
3. Liberacin del pirofosfato de la enzima, que es hidrolizado por las pirofosfatasas.
4. Translocalizacin de la polimerasa a lo largo del ADN en un nucletido, con el
desenrollamiento por delante y el reenrollamientopor detrs.

Lazona deelongacin tieneunalongitud constantede 17~b.10auesneiereane esto


se debe a una propiedad de la enzima y no alasecuencia de b&essdelbN.'a veiocidad
promedio de la elongacin est entre 30 y 60 nucletidos por segundo (Fig. 27.7).

Fig. 27.7. Elongarin. Un nuclesido


trifosfato, cuya base es comple-
mentaria a la del molde, es coloca-
do en el sitio de elongacin; se
forma el enlace fosfadister con la
liberacin de P-P y la polimeraso
avanza hacia el prximo nuele-
tido. Estos eventos se repiten tan-
tas veces como nueletidos tenga
el gen que se est transeribicnda.

Un detalle interesante es que el desplazamientode la polimerasa no se produce a una


velocidad constante; hay zonas en que el desplazamiento es ms rpido-qne en otras,
inclusoexistenpausas donde laenzima se detiene totalmente, estas pausas estn relacio-
nadas con las zonas ricas en pares CG. La polimerasaen su movimientova desenroilando
la doble hebra del ADN, y esto es msdid en las mnas donde predominan los pares CG.
Durante esta fase al ncleo de la polimerasa se une la NusA (69 kD) y al
parecer evita la terminacin prematnra de la cadena; su accin no es procmtiva, pues
con frecuencia se asocia y disocia de lapolimerasa.
En la elongacin se forma un hbrido ADN:ARN, pero mucho ms corto que el
formado en la iniciacin de la replicacin. Algunos autores aseguran que la zona
hbrida slo comprende unos 12 pares de bases. En la medida que la polimerasa
avanza, el ADN vuelve a enrollarsedetrr:de ella.
En resumen, la elongacin consiste en el aumento gradual de la cadena
polirribonucleotdica por accin fundamentalmentedel nclGde la ARN polimerasa.
El complejo de la ARN polimerasa, movindose sobre el ADN, es estabilizado por
protenas auxiliares que impiden la dislocacin de la enzima.

Terminaan

La terminacin de la sntesis del ARN ocurre en sitios de secuencia de bases


especficasen la molcula del ADN. Se conocen numerosas de estas secuenciasy todas
tienen las caractersticasque se muestran en la figura 27.8.
Direccin de la transcripcin
T>
Secuencias repetidas invertidas

1
1
/ Zona rica ZOnarica
ienGC enAT

'o'
I I

Transcripcin

ARNm

Fig. 27.8. La seal de terminacin. Las ca-


ractersticas de la secuencia del
ADN en la zona de terminacin
pueden dar lugar a una estructura
eruciforme en el ADN y a una es-
tructura de "tallo y asa'' en el ARN
transcrito.

Existen 3 regiones importantes:

1.Una secuencia repetida-invertida con un segmento no repetido central, o sea, la


secuencia en una hebra del ADN sena del tipo:

....
ABCDFG ZZYYZZ ......G'FrE'D'C'B'A',
donde: A y A', B y B' y las dems son bases complementarias. De esta forma la
secuencia es capaz de formar pares de bases intracatenarios, dando lugar a una
estmctura en tallo y asa enel ARN y posiblemente tambin en el ADN.
2. Una secuencia rica en CG muchas veces esta localizada dentro del tallo, aunque
puede parcialmenteencontrarse dentro del asa.
3. Es usual quese presente a continuacinuna secuencia rica en AT,que sale fuera del
tallo y hace que el ARN contenga una adenina seguida por 4 a 8 uridinas.

Todo parece indicar que la formacin de la estnictura en "tallo y asa", en la mol-


cula del ARN, est implicada notablementeenel mecanismo de la terminacin. Se ha
comprobadoquemientrasmayorseael contenido de pares GC dela estnictnraen "tallo
y asa", y mayor la longitud de la cola de poli(U), la terminacin ser ms efectiva.
No se conoce con exactitud cmo se produce la terminacin, pero parece estar
relacionada con una pausa en el movimiento de la polimerasa. E1 proceso incluye: el
cese de la elongacin de la cadena de ARN, la liberacin del ARN neoformado y la
liberacin de la ARN polimerasa del ADN (Fig. 27.9). En el proceso de terminacin
intervienen protena especficas,cuya accin no est totalmente esclarecida.
Existen 2 tipos de mecanismos de terminacin: la sealada con anterioridad, que
es reconocida por la propia polimerasa.
El otro tipo de terminacin ocurre por la accin de una protena especficadeno-
minada rho (p); sta es una protena oligomrica que no se uneni a la polimerasa ni al
ADN. Su unin al ARN le estimula una fuerte actividad de nucleosidotrifosfatasa
OVTpasa). Aun cuando el mecanismo del factor rho no est totalmente esclarecido, se
-- -

@omponentes celulares y 8entica moiecuiar 481


Fig. 27.9. Terminacin. La terminacin cona-
la de los pasos siguientes: cese de
la elongacin, separacin del ARN
neoformada y separacin de la
ARN polimerasa.

encuentra relacionado tambin con la existencia de pausas en el movimiento de la


polimerasa, aunque no se ha detectado ninguna homologa en las secuencias estudia-
das. Rho es una protena formada por 6 subunidades de 46 kD cada una, cuya agre-
gacin se estabiliza por la unin al ARN en presencia de ATP;cada monmero se une
a un segmento de 12 a 14baies, por lo que en total se unen de 72 a 84 bases (Fig.27.10).
En resumen, la terminacin incluye el detenimiento de la elongacin, la libera-
cin del ARN y de la polimerasa. En ocasiones son necesarias secuencias especficas
del ADN y en otrasse requieren protenas especficas.

Fig. 27.10. Unin de Rllu al ARN. El factor


Rho se une a una secuencia espe-
cfica del ARN, lo cual estimula su
accin hidrulitica provocando la
terminacin de la transcripcin.
Eventos posterminacin

En procariontes los distintos tipos de ARN sufren diferentes grados de modifica-


cin antes de ser totalmente funcionales. A continuacin se tratar someramente este
proceso llamado de maduracin.
Los ARN mensajeros no sufren modificaciones;la estructura tipica de un mensa-
jero contiene 4 sectores funcionalmente diferentes. Una secuencia inicial hacia el
extremo 5 ' ,conocida como secuencia conductora y que contiene una zona rica en
purinas y un triplete de bases espectico, el AUG, llamado tambin codon deiniciacin
(Fig. 27.11).
Fig. 27.11. Extremo 5' del ARNm de
praiariontes. Hacia el extrema 5'
del codon de inieiaci~(en rojo)
aparece una mna rica en purinas
conocida como secuencia de Shine
y Dalgarno, y es la que va a per-
mitir la fijacin del ARNm al
ribasama cm la pasickh precisa.
Hacia el extremo 3 ' contiene tambin una secuencia de longitud variable,cono-
cida como secuencia de terminacin. Un tercer tipo de sector est constituido por las
secuencias codificadoras, aqullas que contienen la informacin para la sntesis de
polipptidos especficos.
La figura 27.12 resume las principales caractersticas estructurales de los ARNm
de procariontes.

Fig. 27.12. Estructura de un ARNm palicistrnico. Las ARNm de prucariontes son policistrnicos,
contienen la informacin para varias cadenas polipeptdicas (G1, G2, G3 y G4), cada una de
lar cuales presenta su mdon de iniriaein (AUG) y de terminacin (UAG) separados por
sceueniias espaciadoras ( E l , E2 y E3), la zona conductora hacia el extremo 5' que contiene
la secuencia de Sliine y Dalgarno (SD), as como la zona no traducible del exlrema 3'-OH.

Los ARN mensajeros de procariontes contienen tpicamente informacin para


varias cadenas polipeptdicas, por lo que reciben el nombre de policistrnicos. En la E.
coliun solo ARN mensajero codifica para 3 enzimas relacionadas con el metabolismo
de la lactosa, y uno slo, para las 10 enzimas de la sntesis de la histidina.
Enhelas secuencias codicadorasseencuentran zonas delongiind variable conocidas
comoespaciadores. Los ARN policistrnicos tienen una longitud tipica de 3000 a 8 000
bases, aunque los hay mayores como el de la histidina que contiene 12000 nucletidos.
LosARNm de procariontes se comienzan a traducir generalmenteantes de que tennine su
hanscripcin,~sea, los 2 procesos son simultneos. lo que indica que estas molculas no
debenexperimentarningnproceso demaduracin; esel tip de ARN de mayor labilidad
metablica, pues su nda media alcanza como promedio 1,8 minutos.
En cuanto a los dems tipos de ARN, su sntesis no difiere de la del mensajero,
pero hay hechos que indican que ni los ARNt ni los ARNr son los transcritos primarios
(productos inmediatos de la transcripcin) comoson:

1. El extremo 5' presenta un nuclesido monofosfato y no un trifosfato, como cabe


esperar de un transcrito primario.
2. Los ARNt y los ARNr son mucho ms cortos que los transcritos primarios.
3. Todos los ARNt contienen bases raras que no aparecen en las molculas recin
sintetizadas.

Componentes celulares y Gentica molecular 483

- -
Todos estos cambios se realizan despus de la transcripcin en un proceso llama-
do modificacionespostranscripcionaleso maduracin.

El ARNt mejor conocido es uno de la E. coli que lee el codon GAU y transfiere
tirosina, que est formado por85 nucletidos. La E. coli tiene 2 genes para este ARNt
que estn adyacentes y presentan 2 secuencias idnticas de 350 bases,cada unacon un
espaciador de 200 nucletidos. Los 2 genes son transcritos en un solo ARN, que es
cortado cuando se hacompletadosusntesis. La transcripcin comienza 41 bases antes
del extremo 5 ' -P del ARNt y termina 224 bases despus del extremo 3 ' -0H.
Primero ocurre la transformacin del extremo 3 ' por la eliminacin de las bases en
vanos pasos enzhticos, hasta dejar d o 2 nucletidos despus del CCA; despus se
eliminan las bases anteriores al extremo 5 ' , quedando ste formado. La enzima
ribonucleasa P (Amasa P) bidroliza la molcula en el lugar adecuado, pues reconoce
su estructura tridimensional en esta zona; inmediatamente la misma enzima elimina
los 2 nucletidos sobrantes del extremo 3 ' ,con lo cual la molcula adquiere su tama-
o definitivo. Por ltimo, se produce la modificacin de las bases nitrogenadas en
sitios especficos y se forma la pseudouridina, la tionridina, la metilguanosina y la
isopenteniladenosina (Fig. 27.13).

Fig. 21.13. Maduracin del ARNI. Las


pasos indicados en el esquema
se explican detalladamente en el
texto.
Maduracin de lm ARNr

Los ribosomas bacterianoscontienen 3 tipos de ARN conocidoscomo ARNr de S S,


16 S y de 23 S, los cuales contienen 120,l S41 y 2 904 nucletidos, respectivamente.
Estas molculasjunto con las de algunos ARNt son sintetizadas en un precursor que
contiene ms de 5 000 nucletidos. Un caso tpico puede ser el siguiente:

- -
ARNr 16s ARNt(ne) - ARNtiAla) - ARNr 23s ARNr 5S - ARNtiAsp) - ARNtiTrp)

El transcrito primario va siendohidrotizado en la medida que se va formando por


un conjunto de enzimas del tipo de las endonncleasas y exonncleasas; esta forma de
transcribir los ARNr tiene la ventaja de que stos son sintetizadosen la misma pro-
porcin (1:l:l) en que son utilizados por la clula en la formacindelos ribosomas.
En resumen, las caractersticasmssobresalientes de la maduracinenprocariontei
se resumen en los puntos siguientes:

1. Todos los ARNt y ARNr son procesados, no aslos ARNm.


2. Se requieren cerca de 10 tipos de ARNasa que generan tanto el extremo 3'-OH
como el 5'-P.
3. Las ARNasas reconocen preferentemente a las estructuras tridimensionales ms
que a las secuencias de bases.
4. Las bases rarasson formadas por transformacin enzimtica de las comunes.

Los conocimientos sobre la transcripcin en eucariontes se han iocrementado


intensamente en los ltimos 10 aos y han mostrado que el proceso es mucho ms
complejo que en los procariontes, aunque en lneas muy generales es similar. A conti-
nuacin se har un breve resumen de los hechos ms sobresalientes de este proceso en
los organismos superiores.
La transcripcin en el ncleo de los eucariontesse realiza por 3 tipos de enzimas
ARN pomerasas denominadas1, IIy III. Adems, existeuna enzima en las mitocondrias
y otra en los cloroplastos. La pol 1se localiza en e1 nuclolo y realiza la sntesis de los
ARNr. La tipo 11es del nucleoplasmay realiza la sntesis de los ARNm, en tanto la de
tipo 111que es tambin del nucleoplasma, lleva a cabo las sntesis de los ARNt y del
ARNr de 5 S. Cada enzima est formada por unas 10 subunidades y las 3 mayores
presentan gran similitnd con las subunidades a,P y ' de la E. coli. Estas enzimas se
distinguen por su sensibilidad al inhibidor a-amanitina, que tiene un efecto intenso
sobre la polimerasa 11,menos marcadosobre la 111y ninguno sobre la 1.
La reaccin de polimerizacin catalizada por estas enzimas es similar a la de las
polimerasas de procariontes. Todas ellas requieren de varias protenas adicionales
llamadas factoresde transcripcin. Estos factores son especcospara cada polimerasa
y pueden dividirse en 2 grandes grupos: los generales y los genicoespecficos. Los
generales son aqullos necesarios para la transcripcin de cualquier gen por una
polimerasa dada, y asexisten factores generales de la polimerasa 1, de la 11y de la 111.
Los genicoespecficosslo se han descrito para la polimerasa 11, pues se trata de la
enzima que debe transcribir genescon mayor grado de variabilidad en su expresin.
Los factores de transcripcin generales de la polimerasa 1 son UBF y SL-1; los de la
pomerasaIIsonTFm,TFIIB,TFIII>,TFIIE,TFIIF y TFW;y losdelapoherasa m
son TFIIIA, TFIIIB y TFIIIC. Los genicwspecficosslo se mencionarn en los caros
necesarios.
La formacin del complejo de preiniciacin comprende 3 etapas bsicas, en cada
una de las cuales participa al menos un factor de transcripcin. El primer paso consiste
en la unin de un factor de transcripcin a una secuencia especfica del promotor. El

Componentes celulares y @enticamolecular 485


segundo,en la unin de otro factor de transcripcin que va a servir como una especie
de puente para la unin de la poliunerasa. El tercer paso es la unin de la polimerasa.
Slo en el c& de la ARN poliherasa U hay factores de transcripcinqueseintegran al
complejo con posterioridad a la entrada de la enzima.

Sntesis y maduraei6nde los ARNr

La transcripcin de los ARNr (excepto el de 5 S) se realiza en el nuclolo por


accindela A f i p o h e r a s a 1. Las geneskm
' repetidos numerosas veces y organizados
en tndem. En el ser humano cada unidad de tramcripcin en direccin S ' -P -> 3 ' - 0 H
contiene los genes para los ARNr de 18; 5,8 y 28 S, est formada por un segmento de
ADN de aproximadamente 13700 ph y separada de la siguiente por un espaciador de
30 000 pb. Estas unidades se encuentran localizadasen los cromosomas 13,14,15,21
y 22. cada unidad daorigen a un transcrito primario de45 S quedurante la maduracin
produce los ARNr definitivos.La transcripcin puede ser vista mediante el microscopio
electrnico,donde se obtiene una imagen arborescente (Fig. 27.14).
La formacin del preARNr de45 S demora de3 a 4 minutos. Durante lasntesisse le
h;insfierenm& de 10~grupasmeolos alas basa y ribosas de nurietidm es@n>s. una
vez terminada la transcripcin, una ARNasa h i d r o b un enlacefosfodiilster que reduce el
tamao dela molcula en algunos cientos de nucletidos en el extremos ' -P;despus se
produce un corte hacia el extremo 3 - 0 H del preARNr de 18S, que es el que
adquiere su forma definitiva al eliminarse los restantes nucletidos del extremo S ' -P.
~kultn8oadicho~mcew,este~RNse va uniendoaprotenashasta formarla subunidad
menor del ribosoma, que esliberada hacia el citoplasma donde sele incorporan otros 4
Fig. 27.14. Transcripcin de genes organi- grnpas meolm. La maduracin del otm fragmentose produce de forma similar.
zadas en tndem. La figura simula Los genes para el ARNr de 5 S estn localizados en el cromosoma 1 y su
una inicrafotografa electrnica. transcripcin la realiza la ARN polimerasa IU, y no tiene profeso de maduracin.
Cuando un gen se encuentra repe- Por mtodos de ingenieragenticahan podiodeterminarselas secuenciasnece-
tido en el genama y esl organiza-
sarias parasu transcripcin, lo ms asombroso es que para lasntesis se requiere de una
do en tndem, o sea, uno a conti-
nuacin del otro, al producirse la zona de unos 50 nucletidos que comienza en la posicin +47, dentro del gen. Un
transcripcin eoii numerosas poli- 4
factor generalde transcripcin une a esta secuencia-ypermitela unin de lapolkerasa
merasas es posible observar una 111, que comienza la transcripcin en la posicin +1que es ocupada por una G. Las
imaflen arborescente. alteracionesproducidas en la secuencia alrededor del punto de iniciacin slo cam-
bian el sitio de iniciacin, sin embargo, el proceso se-ve seriamente afectado por
cambios en la zona de +47, por lo que se concluye que la nica seal necesaria es la que
aparece en el interior del gen. La protena que alse une fue el primer factoractivador
de la transcripcin, purificado a partir de clulas de eucariontes (Fig. 27.15).

Fig. 27.15. Promotor del ARNr de SS en


eucariontes. La ms curioso en la
estruchira de este promotor es que
una de las secuencias que lo inte-
gran se localiza en el interior del
gen entre las posiciones 47 y 96.
Sntesis y maduradn de los ARNt

Los genes de los precursores de los ARNt son transcritos por la ARN polimerasa
111, de muchos de ellos se conoce totalmente la secuencia de bases y a partir de ella se
han podido precisar las secuencias necesarias para la transcripcin. Hacen falta 2
regiones: la primera,localizada entre las posiciones +10 y +20 y la segunda, entre +S0
y +60 del ARNt maduro -lasseales estn dentrodel gen- y stas corresponden a las
asas D y TC, respectivamente; luego estas zonas tienen una funcin dual: en la estruc-
tura tridimensional de la molcula y en la promocin de la transcripcin de sus genes
(Fig. 27.16).

Fig. 27.16. Promotor del ARNt en eucarioii-


tes. Hay 2 secuencias integradas
de manera funcional en el promo-
tor de este gen g que se encuentran
dentro de ste. Esas secuencias co-
rresponden can 2 asas del ARNt
maduro; luego desempean 2 fun-
ciona importantes.

Los ARNt se forman a partir de un precursor de mayor tamao, que es procesado


hasta el estado definitivo. La maduracin incluye la reduccin del tamao en los 2
extremos, la modificacin de las bases nitrogenadas (aproximadamente una de cada
10),la adicin del extremo CCA y la eliminacin de los intrones que comprende los
pasos siguientes:

1.Hidrlisis por endonucleasas de los enlaces fosfodister en las uniones exn-intrn


e intrn-exn, y se forman un extremo3'-P y unos'-OH.
2. Una quinasa transfiere un Pdel ATPal exn, formando un extremo S'-P. El Pde la
posicin 3' del otroextremo se traslada a la posicin 2' espontneamente.
3. Por accin de una ligasa (similar a la ADN ligasa) se unen los 2 extremos en una
rearci6n dependiente del \TP.
1.I'na fosi'ata>aelimina el Pde la posirin 2'.

La fipura 27.17 muestra todoel Droceso.


~ e s & sque el proceso de madukdn se ha completado-y nunca antes- los ARNt
maduros son transportados hacia el citoplasma.

Unidadesde transeripei6n
Antes de describir la maduracin de los ARNm es conveniente hacer algunas
consideraciones. En primer lugar, los ARNm de eucariontes son monocistrnicos, slo
tiene informacin para la sntesis de una cadena polipeptdica. Tanto el extremo
5 ' -P como el 3 ' - 0 H estn modificados por una estructura en forma de casquete,
el primero, y por una larga secuencia de adeninas repetidas, poli(A), el segundo.
Los ARNm maduros no contienen las secuencias de bases que corresponden a los
intrones en el ADN, pues son eliminadas durante la maduracin.

Componentes celularrs y Genetica molecular 487

L
Fig. 27.17. Eliminacin de intrones en los
ARNt En la eliminacin de los
intrones, los 2 exones son proce-
sados de forma diferente. Una
endonueleasa (EN) hace el corte
en los sitios de unin del intrn. El
fosfato de la posicin 3' pasa a la
2' espontneamente,en tanto, una
quinasa ( Q ) adiciona un grupo
fosfato al extremo S', que despus
es activado par una ligasa (L)que
le transfiere un grupo adenilato.
Por ltimo, se forma el enlace
fosfodister, mientras que una
fosfalasa (F) elimina el grupo
fosfato de la posicin 2'.

Al segmento de ADN que contiene la secuencia de bases que transcribe la


ARN polimerasa 11se le denomina unidad de transcripcin. Estas unidades pue-
den ser simples si dan origen a un solo tipo de ARNm, o complejas si dan lugar a
ms de uno. Una unidad simple de transcripcin tpica contiene la zona del
promotor por la cual se une la polimerasa 11; estos promotores presentan una
secuencia consenso (TATAAT) aproximadamente entre las posiciones -25 y -35.
Otras secuencias se encuentran ms alejadas hacia el extremo 5 ' y sirven como
sitios de unin para los factores genicoespecficos y, por lo tanto, pueden variar
en nmero y estructura en concordancia con cada gen en particular; estos factores
de transcriocin oueden incrementar la intensidad del oroceso cientos de veces. a
partir del nivel basa1 de expresin que logran los factores generales. Otras secuen-
cias ms alejadas pueden actuar como elementos potenciadores (Fig. 27.18).
La incorporacin de nucletidos comienza en la base +1 a la cual durante la
maduracin se aadir el casquete (cap); despus aparecen exones e intrones de
forma alternativa. En el ltimo exn aparece unasecuencia consenso, la AATAAA,
que indica el punto donde debe aadirse la cola de poli(A). El sitio exacto donde
termina la transcrivcin no est del todo conocido. I
as unidades c&nplejas son menos regularesy pueden presentarse las situaciones l
1
siguientes:

1.Varios sitios de iniciacin y uno de terminacin, pero con procesamiento diferente


J
del transcrito primano.
2. Un sitio de iniciacin y varios de terminacin, con procesamiento diferente.
3. Varios sitios de iniciacin y terminacin, pero con igual procesamiento.
4. Un sitio de iniciacin y uno de terminacin, con diferente procesamiento.
Otras secuencias Fig. 27.18. Estructura general de los pro-
reguladoras motores eucariontes. Los pmmo-
deSitio
CAP tares eucariontes son ms cample-
-110 -40 -35 -25 jas que los proeariontes. El sitio
para el CAP corresponde can el
primer nueletido en ser transerita,
por lo que representa la posicin
+ l . En la regin de -25 a -35 se
encuentra la secuencia TATAAA,
entre -40 y -110 se encuentran 2
secuencias que pueden correspon-
derse con alguna de las represen-
tadas en el cuadro inferior y en
olra zona que puede ser la repre-
sentada- estar ms hacia el extre-
mo 5' o incluso hacia el extremo
3'- se encuentran secuencias que
estimulan mucho la transcripcin
(enhancer), pera que no parecen
ser constantes en todos los genes.
En la figura 27.19 se muestra un resumen de las posibles unidades complejas de
hanseripcin.

ARN m

ARN m
Fig. 27.19. Unidades transcripcionaks com-
b ..
// .... . . .~ .. plejas. (a) El gen de 1s ealcilonina
....~e.= . ,
gen
?. .
-+A?
.! .
V.,.l
>., ., , // , . !, , . ' con un solo sitio de iniciacin (i) y
ii h // A, A, 2 de ~>oliadenilaein(A) y madu-
racin diferente que, segn el pri-
mer caso,da origen a la cakitonina

ARN m m ? ' en el timides y, segn el segundo


raso, origina un pptido relacio-
nado con la ralcitanina que apare-
ce en el hipotlamo y en otras re-
giones del SNC. (b) Unidad- con
varios sitios de iniciacin y de
poliadenilacin, como sucede con
el gen de la amilasa de ratn que
en el primer casa da lugar a la en.
aima salivar y en el segundo, a la
paneretiea. (e) Hay un solo sitio
ARN m de iniciacin y de poliadenilacin,
pem el procesamiento es diferente
roma los genes del gamma
ARN m I I I fib"ngen0 de la rata que origina
el tipo A, en el primer caso, y el
tipo^^, en el segunda. (d) Presen-
cia de varios sitios de iniciacin y
de poliadenilacin, pero no hay
diferencias en la maduracin,
como se observa en el gen que
codifica diferentes formas de la
enzima dihidrofolato reduetlsa de
ratn. Estas diferentes variantes
pueden d a r lugar a protenas
ARN m m l A 7 - dismiles que, sin embargo, estn
codificada en el misma segmento
de AUN.
Sntesis y maduracin de loa ARNm

La sntesis del ARNm, una vez comenzada, se produce de forma ininterrumpida


hasta el final, se copian tanto los exones como los intrones. De manera simultnea
algunas de sus adeninas son metiladas (0,l %)y el ARN naciente va unindose con
protenas formando las partculas de ribonucleoprotenas que contienen ARN nuclear
heterogneo (PRNnh) (Fig. 27.20).

Fig. 27.20. Iniciacin en eueariontes. A


medida que el ARNm se va for-
mando, una transrnetilasa que uti-
liza S-adcnosil-metianina (SAM)
como eofactor, metila diferentes
nucletidos de adenina, lo cual
convierte al eafactor en S-adena-
sil-homaeistena(SAH). Cuando el
ARNm tiene un tamao adecuado
comienza a unirse con protehas,
dando lugar a la formacin de las
partculas de ribonucleoproteinas
heterogneas nucleares (PNPhn).

Poco despus de comenzada la sntesis -menos de 100 nncletidos- se produce la


incorporacin del casquete, proceso que al parecer consta de los pasos siguientes:

1.Una fosfatasa elimina el P(y) del extremo 5 ' -P.


2. La guanilato transferasa incorpora el grupo guanilato del GTPal extremo 5 ' -P-P,
formando un enlace anhdrido 5 ' -P-5 y el pirofosfato que es hidrolizado por las
pirofosfatasas,lo cual favorece la reaccin energticamente.
3. Un grupo de transmetasas transfieren sucesivamente grupos metilos ala posicin
7 (Cap O) de la guanina y a la posicin 2 ' del primer (Cap 1) y segundo (Cap 2)
nucletidos, utilizando como cofactor la S-adenosil-metionina(Fig. 27.21).

El significado de esta metilacin se discute, pero 2 conclusiones parecen ser


convincentes: la transformacindel extremo 5 ' -P protege al ARN de la accin de las
exonucleasas,y esta estructura est relacionada con la unin del mensajero al nbosoma
(captulo30).
La terminacin no est bien esclarecida. La polimerasa 11contina su accin
despus de la secuencia AATAAA, pero entre 500 y 2 000 nucletidos posteriores se
producen el cese del crecimiento de la cadena y el fin de la transcripcin. En pocos
segundos (90 a 120)la cadenase corta en un punto que dista 15a30nucletidos dela
secuencia AATAAA, y las poli(A) polimerasas van incorporando uno a uno los
nucletidos de adenina hasta un total que puede variar entre 120 y 250 nucletidos
(Fig. 27.22).
presentan la estructura completa.

Sitiodepoli (A)

/ Terminacin
-- ~ 1 27.22.
~ . Formacin de la cola de Poli A.
-- La secuencia AATAAA indica que,
en unos 20 pb ms adelante, se
5 .
debe oroducir la incor~oraeinde
Eliminacin de nucletidos la cala de poli adcnina POMA). Al
. IAUAAA realizarse la lrsnscripcin, u n a
5'
4
' Adicin de poli (A)
&.,4-,\-. ...,\- 3'
endonueleasa hidroliza el ARNm
en cl sitio adecuado y la poli(Al
polimerasa adiciona adeninas que
5' 250 pueden llegar alcanzar el nJmero
de 250.
De esta manera quedan formados los extremos 5 ' y 3 ' a los pocos minutos de
terminada la transcripcin; estos extremos no experimentan ninguna otra modifca-
cin durante la maduracin.
El siguiente paso consiste en la eliminacin de los intrones, donde intervienen
ribonucleoprotenas que contienen los ARN nucleares pequeos U1, U2 y U5 (Fig.27.23).

Fig. 27.23. Corte y empalme de exones en


el ARNm. El primer corte se pro-
duce en el extremo 5 ' del intrn,
que va seguido de su cireulari-
zacin y el segundo corte, conclu-
ye con el empalme entre los 2
exones. En todo el proceso inter-
vienen las ARNpn y protenas es-
pecificas.

Los intrones se eliminan uno a uno, esta etapa al parecer comprende los pasos
siguientes:

1. Se produce la unin del preARNm con las ribonucleoprotenas,y la asociacin del


U1 a la zona de unin exn-intrnfavorecela hidrlisis del enlacefwfodisterpara
formar un exhemo libre 3 ' - 0 H en el exn.
2. Existe una secuencia de bases en el intrn separada de su extremo 3 ' por 20 a 40
nucletidos -en las levadurases UACUAAC-, que est muy conservada y favorece
la formacin deun asaintraintrn, a10 cual contribuyeel U2. Esta asase e s t a b i i
por la formacin de un enlace fosfodister 2 ' -5 ' entre el extremo 5 ' -Pdel intrn y
una adenosina prxima al extremo 3 ' de ste.
3. Se produce la hidrlisi del enlace fosfodister en la unin intrn-exn,generando
. .
un exn con el extremo 5 ' -P. En este naso narticioa el U5. El intrn senarado es
atacado por las nncleasas y los nncletidos son reutilizados.
4. Se produce el enlace fosfodister3 ' -5 ' que une los extremos de los 2 exones. Esto
puede realizarse ya que durante todo el proceso de corte y empalme se forma un
gran complejo ribonucleoprotenico que mantiene unidos a todos los componen-
tes del sistema.

Todo el proceso requiere ATPcomo cofactor -que no puede ser sustituido por
ningn otro NTP- y Mgha bajas concenhaciones,pues muy elevadas tienen un efecto
inhibitorio.
Como se dijo anteriormente si la unidad transcriptiva es simple, el corte y el
empalme se producen siempre de la misma forma, originando siempre un mismo
ARNm; pero en las unidades complejas se emplean diferentes sitios de iniciacin
o de incorporacin del poli(A), o formas distintas de corte y empalme que pueden
originar ARNm diferentes y que, por lo tanto, darn origen a distintas protenas.
Se ha insistido en que la maduracin del ARNm constituye un punto de control
fundamental en el mantenimiento de los niveles adecuados de ARNm en el cito-
plasma.
Sobre el transporte de ARNm al citoplasma poco se sabe, solamente est
comprobado que ocurre una vez que el proceso de maduracin ha concluido. Al
contrario de los ARNm de procariontes, los de eucariontes son muy estables en el
citoplasma y tienen una vida media de horas; se ha pensado que esto se debe a la
modificacin de sus 2 extremos. Un fenmeno curioso es que la cola de poli(A) se
va acortando en el citoplasma. Dos experiencias son claves en estas conclusiones:
se aislaron ARNm que eran muy estables, se les elimin la cola de poli(A) y se
inyectaron en el citoplasma de una clula y se comprob que presentaban un
recambio muy rpido. Por otra parte, se tom el ARNm de histonas que no contie-
ne poli(A), se le aadi ste, se inyectaron en el citoplasma celular y se observ
que la velocidad de recambio disminuy considerablemente.
El conocimiento de estos procesos ha permitido conocer el origen de algunas
enfermedades, de las cuales las ms conocidas son algunos tipos de talasemia;
sta comprende un grupo de entidades nosolgicas que se caracterizan por la
ausencia total o parcial de una de las cadenas de la hemoglobina.
En algunos pacientes que presentan el tipo (no sintetizan cadenas P) se ha
descubierto una mutacin que origina un cambio G -,A en el extremo 5 ' del
segundo intrn; esto inactiva a este sitio y se produce un ARNm a partir de otro
sitio donante dentro del intrn. En otros casos del tipo P' (producen un bajo nivel
de cadenas p) se han localizado mutaciones en el primer intrn, donde se crea un
nuevo sitio aceptor. Se produce un corte y empalme anormales, utilizando este
nuevo sitio con preferencia al normal y disminuyendo asla formacin de cade-
nas B normales. Por ltimo, se han descrito casos del tipo u" (no sintetizan cadenas
u) que han perdido las 5 bases inmediatas al primer exn, con lo cual se pierde el
sitio donante para el corte y el empalme. Al no poderse utilizar este sitio se
emplea otro que est localizado dentro del exii.
Todos estos fenmenos son conocidos recientemente por lo que existen mu-
chos puntos no esclarecidos. Es de esperar que en los prximos aos se tenga un
conocimiento ms completo de los mecanismos empleados y del significado bio-
lgico de este complejo proceso de sntesis de los ARNm en las clulas eucariontes.

Inhibidores de la transcripcin
Pudieran considerarse 2 tipos de inhibidores: los que impiden la separacin de las
cadenasdel ADN, que por lo general son tambin inhihidores de la replicacin, y los que
actan de forma directa sobre las polimerasas. Los primeros ya fueron tratados en el
captulo 25. Entre los segundos se encuentra el antibitico rifampicina, que acta
sobre la ARN polimerasa, impidiendo la fase de iniciacin. Una sustancia conocida
como u-amanitina inhibe la sntesis de ARN en eucariontes por actuar sobre la ARN
polimerasa ii. Adems de sus acciones teraputicw por locual seran ya nificientemen-
te importantes,estos inhibidoresson de inapreciable valor en el laboratorio, pues su uso
hapermitidoesclarecer muchosaspectos de estos complejos procesos (Fig. 27.24).

Componentes celulares y Cknetica molecular 493


CH, CH,

Rifamicina B

Fig. 27.24. Inliihidores de la transcripcin.


En la figura sc muestra la cstrui- o=
t u r a qumica de la rifanipiiina I
B, uno de los inhihidures d e la
transcripcin ms empicado en
las investigaciones sobre este
C-C-N-C-C -N-C-CH,- N-H
tema. La a-amanitina perniite
diferenciar las 3 palimcraaas de
eucariontes. pura la I u resis-
tente a su accin, la 111 se inhibe
poro, pero la 11 es inhibida de
manera intensa por esta sustancia. a- Amanitina

Resumen
La transcripcin es el proceso central en el crecimiento y desarrollo de la
clula, en la cual la informacin gentica contenida en el ADN se copia en un ARN
especco, ribwmal, de transferencia o mensdero. El desarrollo tcnico alcanza-
do en los itimos aos ha permitido obtener una visin comprensible, en principio,
de este fenmeno. Lea precursores de la transcripcin son los nuclesidos iri-
fosfatados que son Unidos mediante enlace fosfodister 3 ' -5 ' ,por accin de la
ARN polimerasa, segn la secuencia de bases de una hebra del ADN.
En los proeariontes -especialmente en la E. coi&una sola enzima es eapaz de
reazar todo el procmo, sta es una protena oligomrica a la cual se unen otras
subunidades en diferentes fases del evento. Para comenzar la transcripcin la
polimerasa debe unhe ntimamente al promotor y lograr la aperinra de la doble
hebra del ADN, en este paso la subunidad a es fundamental; luego comienza la
incorporacin de los ribonuelesidos trifosfatados cnyas bases son complementa-
rias a lasdel ADN; la protena NusA impide la terminacin prematura de la cadena.
La terminacin se produce gracias a una seal especca en el ADN, aunque en
ocasiones la protena Rho determina el m e de la sntes'i, sin que al parecer existan
seales para ello. Despuk de terminada la sntesiscomienza el profeso de madura-
cin. Los ARNm no sufren modicaciones, pero los ARNr y ARNt se sintetizan en
forma de prenirsores de gran tamao, quedeben ser acortados hasta alcanzar su
forma denitiva
En los euuuiontes existen 3 tipos de ARN polimerasa: el tipo 1es del nuclolo
y rralizala sntesisde los ARNr; los 11y iii son del nucleoplasma y llevan a cabo la
sntesisde los ARNm, la primera, y de los ARNt y el ARNr de 5 S, la segunda.
Los ARNr derivan de un transeritoprimario de 45 S, que es metilado en bases
y ribosas de uucletidos especeos y acortado hasta su tamao denitivo. Es m-
nasa que en el ARNr de 5 S, la seal que promueve la transcripcin es intragnica.
Los ARNt tambin se originan de un precursor mayor; en su procesamiento se
incluyen la redueein del tamao, la eliminacin de intrones, la adicin del extre-
mo CCA-OH y la modicacin de Las bases nitrogenadas. Como en el caso de los
ARNr de 5 S, las sesales promotoras son intragnicas. Los ARNm se sinteizan por
la polimerasa U a partir de una unidad de transcripcin, simple o compleja. El
promotor se encuentra fuera del gen y en l existen varias secuencias necesa-
rias para la transcripcin. El proceso de copia incluye tanto los exoues como
los intrones. La seal de terminacin -si existe- no ha sido an identificada. La
maduracin consiste en la modificacin del extremo 5 ' -P por un nucletido de
guanina metilada (Cap); la transformacin del extremo 3 ' -OH, en una larga
cola de adeniua -poli(A)- y en el corte y empalme de la cadena para la elimina-
cin de los intrones. Se ha comprobado que una misma unidad de traoseripcin
puede originar varios tipos de ARNm maduros por diferencias en la maduracin.
Un hecho hte-te lo constituyeel hallazgo de que algunostipos de talasemia
se deben a trastonios en el profeso de maduracin de los ARNm de la globina.

Ejercicios
1.Para hacer una experiencia de transcripcin in vitro se sintetizan artificialmente3
polidesoxinucletidos con la siguiente estructura:

a) TGTTGACA 18 bases AATATTG


b) TGTTGACA 16 bases TTTATAG
c) TGTTGACA 17 bases TATAAAG

Puede usted determinar cul de ellos funcionar como el promotor ms fuerte y


cul como el ms dbil? Argumente su respuesta.

-
2. En una exoeriencia donde se oretenda investigar el oroceso de trauscriocin. se
aadi al sistema rifampicina y se vio que la iniciacin quedaba bloqueada. Si se
;iada estreptoligidina ocurra la iniciacin, pero quedaba bloqueada la elongacin
Cules seran las conclusiones que este experimento aporta sobre el mecanismo
molecular de la transcripcin?
3. En un experimento posterior se comprob que la rifampicina se una fuertemente a
la subunidad p ' de la polimerasa y que la estreptoligidina se asociaba con la
subunidad p ;Cules seran las conclusionesms importantes de estos experimen-
tos con respecto al mecanismo de accin de la ARN polimerasa?
4. Qu consecuenciastraera para la transcripcin una alteracin de la protena NusA
quedisminuyera su afinidad por el ncleo de la polimerasa?
5. Cul es la caracterstica ms sobresalientede la transcripcin realizada por la ARN
pomerasa i ?
6. La cordicepina inhibe la accin de la poli(A) polimerasa. Qu consecuencias
pudiera tener su accin sobre las clulas prowriontas y eucarioutas? Argumente su
respuesta.

Componentes celuiates y Genetica molecuiar 495


Ntese que parte de la enzima se encuentra en forma de complejo E1 que no da
producto, pues no puede unir al sustrato, lo que significa que existe una disminucin
del nmero de centros activostilesy, por tanto, una menor velocidad de la reaccin.
Una caracterstica de los inhibidorescompetitivos es quesu estructura es semejan-
te a la del sustrato. En la figura 16.11 se muestra cmo la succinato desbidrogenasa
puede ser inhihida de forma competitiva por el malonato, cuya estructura es muy
similar a ladel succinato, que es el sustrato naturaldela enzima.

Fig. 16.11. Mecanismo de la inhihicin com-


petitiva. La similihid estructuraldel
inhibidor con cl sustralo hace que
aqul pueda unirse al centra acti-
vo, pero sus diferencias le impi-
den la transformacin. La enzima
auccinato-deshidrogenasa une al
cido sucrinico y acta sobre los
hidrgenos colocados eii carbonos
adyacentes. C u a n d o el cida
malnieo, que tiene una estructu-
ra similar, se une al centro activo
de la enzima produce una inhibi-
cin, pues no puede ser transfar-
mado, quedando unida al centro
activo y, por tanto, impide la en-
trada y transformacin del sustrato
verdadero.

Wbieio no competitiva

En la figura 16.12 al igual que en el caso anterior semuestran adems los resulta-
I
- dos del experimento sin el inhibidor.
Y"
,'
Los efectos de este inhibidor sobre los parmetros cinticos son contrarios al
~ / ' anterior, se observa una disminucin de la Vm sin alteraciones de la Km; ni siquiera en
,/ , concentracioneselevadsimas de snstrato se logra eliminar la inhibicin.
I ,"
7 .S"
, !
VM
, -':, ',
Si la Km no se ha modificado quiere decir que no existe impedimento para la
.
unin de la enzima con el sustrato.,oero la afectacin de la Vm indica aue el inhibidor
disminuyede alyna forma la capacidad cataltica de la enzima. Se acepta que la unin
, "M
enzima-inhibidor se produce en un sitio diferente del centro activo y que esa unin
modifica las propiedades catalticasde la enzima, posiblemente modificando la con-
1
.- -1
~d 1% formacin del centro activo de forma que no impide la unin del sustrato pero dificul-
ta grandementesu transformacin.
Fig. 16.12. Inhihidares no competitivas. El El esquema de la reaccin con la participacin de un inhibidor no competitivo ser
inhibidor no competitivo no se alo-
ja en el centro activo y no puede
impedir la entrada delsustrala,pera
de alguna forma dificulta su trans- E + S +ES+ E + P
formacin; en supreaencialaseur- E + I d E I
vas que se obtienen difieren en el
valor de I N m , pero no alteran el ES + 1 +EIS
valor de -1lKm. Variaciones en la E1 + S +EIS
concentracin del inhibidor dan
origen a una familia de curvas que
se cortan en el eje de las abeisas en La enzima existe en un estado libre y en forma de varios complejos (EI, ES y EIS)
el punta -I/Km.
de los cuales slo ES da productos. Si suponemos que la unin de S a la enzima no
i d u y e sobre la unin de 1y viceversa,entonces la constante de disociacinde E1 ser
igual a la de EIS y viene dada por cualquiera de las ecuaciones siguientes:

El valor aparente de Vm' que se obtiene en presencia del inhibidor se relaciona


con la Vm de la reaccin sin el inhibidor por la ecuacin

~ m ='Vm. (1+ -)
[Il
Ki
En este caso tambin la enzima existe en forma de varios complejos de los cuales
slo ES puede dar productos, pero no existe ningn impedimentopara la unin con el
sustrato; la existencia de esos complejos determina una disminucin del nmero de
centros activos tiles en la preparacin y, por tanto, una disminucinde la velocidad
de reaccin.
Los inhibidores no competitivos no son anlogos estructurales del sustrato; el
iodoacetato es un potente inhibidor no competitivode las enzimas que poseen grupos
sulfibidrilos en, o cerca de, su centro activo.
Algunos medicamentos utilizados diariamente en la prctica mdica son
inhibidoresennmticos, como el caso de las sulfamidasque se emplea en el tratamien-
to de infeccionesbacterianas.
En general las armas qumicassuelen ser tambin inhibidores enzimticosque al
bloquear determinadas reacciones puedeu daar un rgano o tejido especfico. si la
enzima que resulta inhibida est presente slo en l, o al organismo en su totalidad si
la enzima inbibida est muy distribuida en la economa.
La lucha contra la produccin, almacenamientoy utilizacin de las armas qumi-
cas debe constituir una posicin de principio de todo cientfico, pues es parte del
comportamiento tico impedir el uso de los avances de la ciencia en perjuicio de la
humanidad.

Resumen
La eintica enzimstica es la parte de la enzimologh que se ocupa del estudio de
la velocidad de las reacciones enzimeas v de las factores aue la modiscan.
En los eshidias ein6eos se deben obsekar algunas reglas que permitan hacer
una interpretacin ademada de las resuliadas, wmo son medir siempre veldda-
des ini&es y variar en cada experimento slo uno de las factores que pueden
alterar la velocidad. Los principales factores que ininyen sobre la velocidad de la
reaeO6n son las concentracionesde etuimas, mistraios y wfactores, la temperatu-
ra, el pH y la presencia de activadores o inhibidores.
La velocidad de las reacciones enzimtieas es diredamente proporcional a la
wnceniracin de enzima, lo cnal constuye el tundamento de toda la cintica
enzimtica.La wncentracin de sustrato innuye sobre la velocidad de forma muy
caracterstica.A medida que la wncentraci6n de mistrato aumenta se produce un
aumento de la velddad, pero en concentraciones muy elevadas de mistrato se
produce un estado de saturacin de la enzima que no permite mayores incrementas
de velocidad. Para explicar este comportamiento se emplea la teora deMiehaellis-
Menten, segn la cnal bastan 2 parmetms para explicarlo, uno, la Km define la
-dad de la enzima por el sustratoy el otm, Vm es un indicador de la capacidad
cataoca de la emima
Cuando en la reacein intervienen 2 susiratos, uno de los mpeetosms impor-
tantes que se debe determinares el orden en que seiigsnlm sustratosy seliberan los
productos. Atendiendo a este punto de vista se describen los mecanismos ordena-
dos, los azarow y el ping pong.
La inilueneis de la mncentraein de los whctores es similar a la del sustrato.
La velocidad varia con el pH y existe una wna de pH pmo donde la veloci-
dad es la mayor. Variaciones del pH en ambas lados de esta wna determinan una
disminucin de la velddad.
Al aumentar la temperahva la velocidad de reaeein aumenta, pero pasado un
limite comienza a disminuir, pues se producen alteraciones de la estructura
..
tridimensonal de la emha.
Los activadoresproducen un aumento de la velddad de la reaccin, se distin-
guen 2 principales, aqulios que se unen a la enzima libre y los que se unen al
nishsto. Por su parte los inhibidores disminuyen la velocidad de la reaccin, bien
porque modiean la Km, en cuyo caso son de tipo competitivo, o por alteraciones
de la Vm, que reciben el nombre de no competitivos.
Los eshidioseinticm son importantespara el conocimiento del meraniSrno de
a d 6 n de las enzimas, con el propsito de conwerio y modifi~~rlo. Muchos medi-
eamentos y algunas armas qumicas suelen ser bbibidores enzimticosespefim.

Ejercicios
1.Cules son las razones por las que en los estudios cinticos debe siempre medirse
velocidades iniciales?
2. En una experienciacintica se observa que al aumentarla concentracin de enzima
no se produce el esperadoaumento proporcional de la velocidad. A qu factores
pueden deberse estos resultados?
.
3. Si 2 enzimas actan sobre el mismosustrato con Km de 4 x 10" v 7 x 10.",resuec-
tivamente Qu conclusiones pueden derivarse deestos valores?
4. Calcule el nmero de recambio de una enzima que al estar en una concentracin de
10" M forma 3 x 10.' M del producto en un segundo.
5. Una enzima cataliza la reaccin:

Alanina ------ ,
Etanolamina + Co,

en un experimento realizado a pH=8 y a 30 "C se obtienen los datos siguientes:

V"(pmol de CO, min-')

Calcule la Km para la reaccin


6. En el estudio de la reaccin:

L-asprtico -, L-ala + Co,

se encontr que el P-hidroxi-asprtico era un inhibidor de la enzima. Al tratar de


determinar qu tipo de inhibidor era se obtuvieron los datos siguientes:

[L-asprticol vo(mmol de CO, min-') (mg de protena)-'


mmol 1.'

sin inhibidor con inhibidor

Constmya una grfica de l/vu vslI[S] y determine de qu tipo de inhibidor se trata.


Uno de los problemas centrales de la gentica molecular consiste en conocer
cmo la informacin contenida en el ADN y transcrita en un ARNm puede dirigir la
sntesis de una cadena polipeptdica especfica, o sea, cul es la relacin entre la
secuencia de bases del ARNm y la de los aminocidos de una protena; ste es el
contenido del problema del cdigo gentico.
El cdigo gentico surge como una necesidad natural, debido a las diferencias
existentes entre la estructura de las molculas que conservan la informacin (ADN) y
aqullas que la expresan en funciones especficas (protenas).Se acostumbra decir que
esta informacin est en 2 lenguajes diferentes: el primero, en forma de una secuencia
de bases y el segundo, de aminocidos. Al pasar la informacin del ADN al ARNm se
mantiene en el mismo 1engnaje.por lo que el proceso se denomina transcripcin. Pero
al pasar del ARNm a las protenas hay un cambio de lenguaje y por tanto es una
traduccin. Para traducir es necesario poseer la relacin de equivalencia que existe
entre los signos utilizadosen un lenguaje y los empleados por el otro. En esto consiste
la necesidad del cdigo gentico.
En nuestros das la solucin de este problema pudiera parecer algo muy sencillo,
pues bastara con determinar la secuencia de bases de un gen y la de aminocidos de la
protena por l codificaday correlacionarlas,pero esto no fue posible en los primeros
aos de la dcada de los 60 cuando se enfrent la solucin de este problema. Los
mtodos dedeterminacin de la estructuraprimaria de las protena estahan ya estable-
cidos desde el trabajo de Sanger con la insulina (1956) pero los procedimientos que
permitieron hacer lo mismo con el ADN, con un elevado grado de fidelidad, no apare-
cen hasta finales de la dcada de los 70 cuando el cdigo ya haba sido descifrado.
Este estudio comenzar por un esbozo de los trabajos fundamentales para desci-
frar el cdigo gentico y despus se realizar un anlisis y se destacarn sus caracters-
ticas principales. Desde el punto de vista bioqumico el cdigo se define como la
relacin de equivalencia entre la secuencia de bases del ARNm y la secuencia de
aminocidos de la protena.

Primeros pasos
El problema del cdigo genticofue formuladopor primera vez por GwrgeGamour
en 1953,y en su solucin participaron numerosos investigadores,empleando funda-
mentalmente mtodos qumicos y biolgicos.
(;IIIIIOII W P U ~ I Ique la cadnia polipeptdira ce forma directamente $obre la doble
h6lire del 4DN. estando rada aniinocido situado rn un hueco rntrc 4 nucletidoc:
este hueco tendra aproximadamente la forma de un rombo. Dos nucletidos pertene-
can a una banda y 2 a la otra. El cdigo de rombos rojos de Gamowasegura preci-
samente las 20 letras, pues como utiliza 4 bases da origen a (4') 256 combinaciones; no
obstante, esta forma de codificacin directa impona algunas Limitaciones a la secuen-
cia de aminocidos de la protena, esto quiere decir que una vez fijado un aminocido,
el siguiente no poda ser cualquiera de los 20, sino un nmero muy reducido de ellos.
Sin embargo, las investigaciones demostraron que tal limitacin no exista en las
protenas, cuyas secuencias de aminocidos eran conocidas.
El descubrimientode quela sntesis de protenas se realizaba en una estructura
citoplasmtica (los ribosomas) y la existencia de los ARNm rechazaron definitivamen-
te la hiptesis de Gamow.
Por razonamientos tericos se estableci la relacin de codificacin -que se com-
prob despus experimentalmente-,o sea, cuntas bases son necesarias para codificar
un aminocido. Como el lenguaje del ARNm slo tiene 4 letras (A, U, G, C) y el de las
protenas 20, la relacin no poda ser 1:1, pues las protenas constaran de 4
aminocidos; si fueran 2 las bases alcanzarapara (4'=16) 16aminocidos; pero con 3
bases (4L64),el nmero de combinaciones era mayor que el nmero de aminocidos,
por lo que qurd est;il~lrcid~~ que a cada aiiiinotid~~en la protena le correspondan 3
.
bases en el 4RSm.,\ la relacin de codificacin ei 3:l. I.:ste triulete dr hase*;. ..
uor ser la
unidad de codificacin, recibi el nombre de codon.
Teniendo en cuenta que son posibles 64 combinaciones de bases y que slo 20
aminocidosdiferentes se incorporan en la sntesis de protenas,se deduce que al menos
para algunos aminocidos existe ms de un codon, o sea, el cdigo es degenerado. Los
codones que se traducen en el mismo aminocidoreciben el nombre de sinnimos.
Otra consideracinimportante se refiere a la forma en que el ARNm es traducido,
si el cdigo es o no superpuesto. Si el cdigo no es superpuestocada base nitrogenada
formar parte de un solo d o n , mientras que si fuera superpuestoformaraparte de ms
de uno:

3. UAG14GCIGCCKCUKUUFnrAPAGkGCMCl Superpuesto

Esta alternativa pudo resolverse teniendo en cuenta que se conoca la secuencia


de aminocidos de algunas protenas. Si el cdigo fuera superpuesto, un cambio en
una base ocasionara el cambio de ms de un aminocido continuo en la protena. Sin
embargo eran conocidas algunas protenas en las cuales slo se produca el cambio de
un aminocido por otro, lo que implica que el cdigo no es superpuesto.
Las 3 primeras caractersticasdel cdigo fueron: que estaba formado por tripletes
(codones),stos no eran superpuestosy que el cdigo tena carcter degenerado.

Descifrado del cdigo


Los primeros experimentos encaminadosa descifrar el cdigo fueron realizados
por MarshallNirembergy Heinrich Matheien 1961. Ellos tuvieron un xito inicial al
conseguir un extracto celularcutableque sintetiraba pn~tenatactivamente, logra-
. ..
run dirinir la sintesis de un oo1ioi.otid11oor traduccin de un u~~lirril>onucletid~~
sinttico que actuaba como ARNm (Fig. 28.1).
Este sistema fue til no slo en la dilucidacin del cdigo gentico, sino tambin
para esclarecer muchos aspectos relacionados con el mecanismodesntesisde protenas.
Los polinucletidosse s i n t e h n uolizando una enzima - pokueleodofosforilasa-,
descubieka en 19.55por Maiianne Grumberg-ManagoySevem Ochoa. Esta enzima se
diferencia notablemrntrde la SR\; polinier~w,pues utili7a rmni,suctratuslus nuclckid~n
difi*ifatad~m:como nolibera oimtififat~~ suaccii~nnu orwrmaiuulada ala hidrlishde
ste, y lo m& importantees que esta enzima no es di&& por un molde de ADN, por lo
que la secuencia del polinucletidoes al azar dictada por la proporcin relativa de los
diferentes nuclesidosdifosfatos presentes en la mezcla de reaccin.
Fig. 28.1. Obteiiein de extractos celulares
sintetizadores de protenas. Las
bacterias s o n l r i t u r a d a s con
aluminacomo ahrnsi\o y SP le aa-
d c desoairi-ihonucleasa que. al
hidrolizar CI D N , eiita que en el
extracto pueda aparecer ARNni
cndgeno. Uiia primcra ientrifu-
g a c i h a haja velocidad eliniina la
Fosfoenol Piluvillo alumina ) los restos reliiliires que
Piruvato Quiiiasa no estan bieii Iionmgeneizn<liis.
Buffer pH= 7.8 Una segunda centrifugaiiii a
poli ( U ) 3 0 U00 g sii.\c p a r a e l i m i n a r
membranas y paredes cclularrs,
lo que deja un sol>i.ea~dante cl cual
se denniiiin S-30 (sol>i'enadante
de 30 000 gi ron el qisc Sr realiza-
ron los prinicrus expcriiiieittos. Una
tercera rentrifugaiin a 100 OOU g
permite separar los rihasomas, y a
El procedimiento consistaen preparar unconjunto de tubos de ensayo,de com- partir del sohrenadante S.lo0 se
~osicinsimilar,en cada uno de los cuales se aada un aminocido diferente marcado ~ i w d r i iohtmei- 10s AKNt p las
con '"C. eiizitiias aiti\adoi.as. El prcpara-
Cuando al sistema se le aada poliuridina se obtena la formacin de do S-100 s r utilizb en experinicn-
(0s posteriores.
polifenilalanina. Se logr de esta manera descifrar la primera palabra del cdigo: el
codon UUU significa fenilalanina (Fen).
Por un procedimiento similar se pudieron asignar otras 2 palabras: el CCC para la
prolina (Pro)y el AAA para la lisina (Lis). Los polmeros de poliguanosina no pudieron
emplearse porque forman una compleja estructura tricatenaria que no sirve de matriz
para la traduccin.
La etapa siguiente consisti en determinar la composicin -no la secuencia- de
los dems tripletes. Si la enzima polinucletido fosforilasa se incuba con UDP, el
resultado por supuesto es el poli U. Si se incuba con UDP y GDP se obtiene un
copolmero que contiene U y G. La secuencia de bases es azarosa, pero controlando la
proporcin de nucletidos se puede calcular la frecuencia con que deben producirse
cada uno de los codones. La tabla 28.1. muestra los resultados obtenidos en un
polinucletido preparado a partir de una mezcla que contena 76 % de U y 24 % de G.

P Frecuencia relativa de tripletes de bases obtenidas al controlar la propor-


T ~ M281.
cin de cada una en la mezcla de reaccin

Triplete Probabilidad Frecuencia


-

UUU

UUG

UGU

GUU

UGG

GUG

GGU

GGG 0,24 x 0,24 x 0,24 = 0,012 3J

Nota: Aparecen 4 clases de frecuencias para los 8 rodoncs posibles.

componentes celulares y GenCtica molecular 499


Si se utiliza este polmero en un sistema como el descrito anteriormente, con 20
tubos de ensayo que contengan los 20 aminocidos, pero slo uno de ellos marcado
con "C, se puede medir la frecuencia con que cada aminocido se incorpora al
polipptido que se sintetiza (tabla 28.2).

Tabla 28.2. Coniposicin de los codones segn la frecuencia de incorporacin de los


aminocidos
--

Aminocido Cantidad incorporada Composicin del codon

Fen

Val

Len

CsS

m
Gli

La comparacin de los 2 resultados sugiere que los codones correspondientes a la


valina (Val), cistena (Cis) y leucina (Len) contienen 2 U y 1G, mientras que los del
triptfano (Trp) y glicina (Gli) tienen 2 G y 1U.
Por variaciones en la composicin del polmero se lograron otras combinaciones
hasta determinar todos los codones que contenan U, despus se procedi de igual
forma para los que contenan C y por ltimo, los que tenan A. Los de G no se determi-
naron por las razones expuestas.
Mediante este procedimiento se pudo conocer la composicin (no la secuencia)
de aproximadamente 50 codones.
Otros experimentos de gran relevancia fueron realizados para asignar los codones
que faltaban y para comprobar los existentes.
Una nuevalnea experimental fue asumida por Nirembergy otros. En 1 9 6 4 cono- ~
ca que algunos polinucletidos sintticos estimulaban la unin de los ARNt con sus
aminocidos correspondientes y los ribosomas, este complejo de 3componentes poda
ser identificado por el mtodo de nltracentrifugacin, en un gradiente de densidad de
sarnosa Desafortnnadamenteeste mtodo de anlisisera demasiado laboiiaw; Niremberg
y otros disearon una forma ingeniosa y rpida de aislar el aminoacil-ARNt unido al
ribosoma y al ARNm, utilizando un filtro de nitrocelulosa. Los ribosomas quedaban
adheridos al filtro, sin embargo, los aminoacil-ARNt pasaban por el filtro fcilmente,
excepto que estnneran unidos a los ribosomas. En particular Nirembergy PhiUpLeder
(1964)fueron capaces de inducir launin de Fen-ARNt al ribosoma, utilizando poli U sin
otro homopolmero, el complejo formado fue retenido en el filtro de nitrocelulosa. La
utilizacin de copolimeros como ARNm sintticos, traa por resultado la adsorcin de
aminoac-ARNt-ribosoma,cuyo aminocido coincida con los resultados de los experi-
mentos realizados en los sistemas libres de clulas. Estos experimentos tambin demos-
traron la ektenciade un complejo aminocido-ARNt-ARNm-ribosoma como interme-
diario durante lasntesis de protenas.
Los trinucletidosestimulaban la formacin del complejo,dando una confirmacin
directa del carcter de tripletes del cdigo gentico. Nirembergse dio cuenta que era ms
fcil sintetizar trinucletidos de secuencia conocida que un ARNm; su trabajo que co-
menz con el triplete GUU correspondiente a Val, progres rpido, y alrededor de 50 de
los 61 codones fueron asignados directa y convincentementepor este mtodo.

500 mhqdmakldicd
Otra Lnea experimental diferente sigui H. Ghobind Khorana (1966), quien com-
binando procedimientos enzimticos y de sntesis orgnica logr la sntesis de
polinucletidos de secuencia conocida, a partir de la polimerizacin de dinucle-
tidos; uno de ellos fue el poli (AC) que produce ACACACACAC, el cual puede ser
ledo en grupos d e 3 bases como ACAlCAClACAlCAC de manera que el polipptido
sintetizado, tomando este polmero como ARNm, constara de 2 aminocidos
alternantes, que fue el siguiente:

Por los experimentos descritos anteriormente, se sabia que la composicin del


codon de la treonina (Tre) era de 2 A y 1C y el de His de 2 C y 1A, por lo tanto ACA
codifica para Tre y CAC para His.
La utilizacin del poli(UG) produca:

Cis-Val-Cis-Val-Cis-Val

con lo que se comprobaba que UGU corresponda a la Cis, y se asign el GUG a la Val.
Khoranalogr tambin la polimerizacin de trinucletidos, por ejemplo, el poli
(UAC) que puede ser ledo de 3 formas diferentes:

l.UACIUAC(UACILIACIUACvACvACqueoriginapolitirosina
2. ACUlCUbCUbCUbCUbCUli\.CU que codifica politreonina
3. CUA(CUA(CUA(CUA(CUArUA(CUAque forma polileucina

Experimentos como estos consiguieron no slo determinar la secuencia de mu-


chos de los codones de composicin conocida, sino adems, corroborar los que haban
sido asignados por otros mtodos.

Los codones que indican el final de la cadena polipeptdica y que no codifican


ningn aminocido tambin fueron asignados por la utilizacin de polmeros de se-
cuencia conocida.
Si se utilizaba el poli(UAUC) la traduccin poda comenzar en 4 sitios diferentes,

originando slo 4 codones diferentes (UAU, AUC, UCU y CUA) que produce la se-
cuencia alternante Tir-Leu-Ser-Ile que puede comenzar con cualquiera de ellos. Esta
situacin se repeta con muchos polinucletidos del tipo poli(MNPQ).
Cuando se ensay el poli(GUAA)se esperaba encontrar un resultado similar,pues
stedebe producir tambin 4codonesypor tanto un tetrapptido repetido:

Sin embargo, se encontr que no se producan largos polipptidos, sino que se


formaba slo 2 productos: el tripptido Val-Ser-Lis y el dipptido Ser-Lis. A partir de
los codones ya asignados (VakGUA, Ser=AGU y Lis=AGG) se pueden alinear los
pptidos con los distintos tipos de secuencia y se obtienen los resultados siguientes:

1.GUAAGUAAGUAAGUAAGUAAGUAA
Val - Ser Lis - ? -
2.UAAGUAAGUAAGUAAGUAAGUAAG
-
Val Ser - Lis - ?
3.AAG UAA GUA AGU AAG UAA GUA AGU
Lis ?
4.AGUAAGUAAGUAAGU AAGUAAGUA
-
Ser Lis - ?

Lo que muestra que la sntesis se detiene en el codon anterior al UAA y esto


indicaba que ste deba una seal de terminacin.
Experimentos similares mostraron que el poli(AUAG) produca slo el tripptido
ne-Asp-Arg y el dipptido A S ~ - Aprobando
~~, que UAG era otro codou de t d n a -
cin. Por ltimo, con poli(UGA) slo se formaba polimetionina y poliasprtico, lo que
llev a la conclusin aoe UGA era tambin un codon de terminacin.
Como resultado he una broma de laboratorio a estos 3 codones se le dieron nom-
bres propios -mbar para el UAG, ocre al UAA y palo al UGA- y stos se utilizan
comentemente en la literatura cientfica.

Codon de iniciacin
En los sistemas in vitro la sntesis de protenas comienza en cualquiera de las
bases del polinucletido sinttico utilizado, pero in vivo esto no es as, se requiere de
un codon de iniciacin. Por experimentos in vitrose ha podido determinar que el ms
utilizado para ello es el AUG, aunque en muy pocos casos tambin el GUG; esto fue
corroborado ms tarde en numerosos estudios de secuencias de ADN. Estos codones
tienen adems la funcin de codificar aminocidos especficos -el AUG metionina y el
GUG valina- para incorporarlos dentro de la cadena. En el captulo30 se explicar
cmo la clula puede diferenciar una de otra.
Como resultado de todos estos trabajos a nales de 1966el cdigo gentico haba sido
descifrado completamente El total de codones y su signicadoapareceen lafigura28.2.
-
Aunaue el cdizo fue descifrado nor exoerimentos in vitro. la exactitud de la
asignacin de cada codon ha sido confirmada por anlisis genticos y bioqumicos. La

U C A G
U
Fen Ser Tir Cyr
Ser C
U Fen Tir CY~
Leu Ser A
Ter Ter
- Leu Ser Ter Tic G
Fig. 28.2. El cdigo gentico casiuniversal.
Estructura actual del cdigo
--
.
Leu Pro His .1rg U

genlieo. Ntese que cn la mitad


izquierda predominan los
:c
.
Leu
Leu
~ r n
Pm
~

GIN
i - ~ c g
,Are
c
A
aminocidos apolares y en la de- Leu Pro -
.2 GIN 112 G
rceha los palarcs; estas 2 mitades
difieren en que la segunda base Ile Tre AIN Ser 1 U
sea pirirnidinica a la izquierda, o
purniea a la derecha. Ocho de las
16 casillas estn ocupadas por el
mismo aminocida, la que signi-
fica que la tercera base es redun-
dante. Slo 2 aminocidos estn
codificados por un eodon cada
uno. INI se refiere al eodon de ini-
ciacin y TER a los de termina-
cin.
reciente tecnologa de secnenciacin del ADN ha dado la confirmacin definitiva a
este problema, qne pareca un sueo casi imposible,cuando fue postulado en 1953y
que poco msde 10 aos despus quedaba totalmente resuelto.

Universalidad del cdigo


Tanto los experimentos de Niremberg como los de Khorana fueron realizados
utilizando los componentes del sistema hiosinttico de protenas de la E. coli, pero
despus fueron realizados repetidamente utilizando bacterias, vinis, hongos,plantas y
animales, incluyendoa los mamferos. Los resultados en todos los casos coincidieron
y llevaron a postular la universalidad del cdigo.
Ms tarde se ha encontrado que el sistema informativo de las mitocondriaspresen-
ta desviaciones con respecto al cdigo universal. Esas variaciones ya fueron estudia-
das en el captulo 37 (tabla 37.4). Para otros organismosel cdigo mitocondrial ofrece
otras variaciones.
Estos descubrimientosLimitaron el carcter universal del cdigo y por ello hoy se
dice que es casi universal.

Mucho se ha escrito y especulado sobre la forma de organizacin del cdigo,


tratando de descubrir cules son las leyes que subyacen en su organizacin. Aunque
este objetivo no parece haberse alcanzado totalmente, se han podido sealar algunas
de sus regularidades ms sobresalientes.
El punto central de la atencin ha sido el carcter degenerado del cdigo. Para
32, o sea, la mitad de los codones, se tiene una degeneracin completa de la tercera
base, el aminocido queda codificado totalmente por las 2 primeras bases (por ejem-
plo, UC codifica Ser) para los dems (con la excepcin de las parejas UGAAJGG y
AUAIAUG) la degeneracines casi completa, pues slo requiere el carcter purnico
o pirimidnico de la tercera base. Esto se resume diciendo que los codones del tipo
XYU y XYC son siempre sinnimos al igual que los del tipo XYA y XYG, con las
excepciones mencionadas (tabla 28.3).

p b h ~ 8 3Grupo
. 1de codones, donde las 2 primeras bases son suficientespara la
codiiicacin del aminocido

X Y N Aminocido

G C 6 Ala

G U 5 Val

U C 5 Ser

Nota: Grupa 1. Para el cadon XYZ. Z =(A,G,C,U)

CampoacatescdularrsyOenaicamdsailiu 503
Teniendo esto presente se pueden agrupar los codones slo por las 2 primeras
bases, en 2 grupos de 8 cada uno: en el primer grupo los pares XY, que codifican los
aminocidos con independenciatotal de Z y, en el segundo, los que varan segn Z sea
purnica (Pu) o pirimidnica m).
La columna n indica el nmero de puentes de hidrgeno que puede formar la
pareja XY al unirse a un par complementario(X'Y'). El valor n pudiera Uamarse grado
de complementaridad, que en el primer grupo es 6 y 5 (promedio 55) y el segundo 5 y
4 (promedio45). Se puede pensar que mientras mayor sea n,menor valor tendr la
interacciu Z-Z', ya quela unin XY-X'Y' es suficientementeestable.E1 valor de la
tercera base ser discutido nuevamente en el siguiente acpite. Estas caractersticas
han hecho suponer que el cdigo primitivo era de slo 2 letras y que ha evolucionado
hacia su estado actual de 3 letras.

lhblpZ&4. Grupo 11de codones, donde la tercera base tiene una funcin determinante

X Y N Aminocido

2FRi Z=Pi

No*: Grupo 11. Para CI codan XYZ.

La secuencia de bases codifica slo la secuencia de aminocidos de la protena,


pero su estructura tridimensional depende de su secuencia. Alteraciones en la secuen-
cia pueden ocasionar alteraciones en la conformacin y, por lo tanto, en la funcin.
Como se vio en la seccin de biomolculas,en esto influye notablemente la polaridad
de la cadena R de los aminocidos, los de carcter hidrofbicos son los determinantes
en el plegamiento de la cadena. La sustitucin de un aminocido apolar por uno polar
puede causar cambios drsticosen la conformacinde la protena; alteraciones de este
tiposlo ocurren cuando existe el cambio de una purina por una pirimidina que est
ocupando la segunda posicin del codon. Los cambios en la primera base tambin
influyenmenos en la naturalera polar o apolar del aminocido codikado. Sin embar-
go debido al carcter degenerado del cdigoes muy poco probable que esto suceda.
Si se toma como ejemplo el codon GUG y se analizan todos los cambios posibles
y sus resultados, se ver en la figura 28.3 que de 9 cambios posibles, slo en un caso
que afecta la segunda base, la val se cambiara por un aminocido polar (glu) y, por
tanto, podra influir notablemente en la estructnra de la protena. En codones de otros
aminocidos hidrofbicos estoes menos evidente,pero en general 2de cada 3 cambios
no producen alteraciones en el carcter hidrofbico del residuo de aminocido.
No obstante, lo dicho anteriormente, en ocasiones existen aminocidos que son
tan vaiiosos en la estructura de la protena, que no admiten ser cambiados por ningn
otro aunque ste sea muy semejante, por ejemplo, un aminocido cuya cadena R
aporte el grupo cataltico al centro activo de una enzima.

Una vez conocido el cdigo gentico, o sea, la relacin entre la secuencia de bases
del ARNm y la de aminocidos de las protenas, es necesario conocer cmo se realiza
el proceso de descodificacin,cmose lograla conversin de un lenguaje en otro. Al
estudio detallado de los mecanismos de este proceso est dedicada el captulo 30.
Ahora slo se estudiar brevemente el fundamento del proceso de descodificacin.
Para poder descifrar el cdigo hace falta otro tipo de ARN llamado de transferen-
cia y cuya estructura fue estudiada en la seccin de biomolculas. Es necesario recor-
dar que en estas molculas existen 2 sitios bien definidos que ocupan los extremos de
la estructura de la aL. En uno de ellos (el extremo 3 ' -OH) se encuentra el triplete
5 ' XCA-3 ' a cuyo 3 -OH se une un aminocido especfico; en el otro extremo se Fig. 28.3. Importancia del carcter degene-
encuentra el asa anticodon con su secuencia caracterstica 5 ' ---Pi--U--XYZ-- rado. A partir del coda" GUC se
pueden ohteiicr Y codones, cam-
Pu(modificada)--3' ,donde XYZ representa el anticodon. Es este triplete el que se une
hiando una sola base cada vez. Sin
al codon del ARNm durante la traduccin, por la formacin de pares de bases embargo en 3 ocasiones el s i ~ n i f i -
--
complementarias. Por ejemplo, si el anticodon tiene la secuencia 5 ' AAA-3 ' su cado del codoii no cambia y de las
codon complementarioser el UU. A este tipo de ARNt se unir por el extremo 3 ' -0H 9 posibilidades slo en un caro sc
altera cl c a r c t e ~ polar del
el aminocido feuilalanina. Si el anticodon fuera 5 ' --GGG-3 ' se complementara
aniinucido codificado.
con el codon 5 ' --CCC-3 ' y el ARNt llevara en el extremo 3 ' -OH a la prolina. La
reaccin de unin del aminocido al ARNt correspondiente se estudiar con ms
detalles en el captulo 30.
Teniendo en cuenta que existen 61 codones que codifican aminocidos, cahra
suponer la existencia de 61 tipos de ARNt con sus anticodones correspondientes a
cada uno de los codones del ARNm. Esta idea fue sustentada inicialmente al hallar que
cuando se purificaba ARNt de la leucina (leu-ARNt) y se examinaba en un sistema
artificial de sntesis de protenas, haba una especie (leu-ARNt,) que incorporaba el
aminocido cuando se utilizaba poli(UC), pero no al emplear poli(UG), mientras otra
especie (leu-ARNt,,) lo haca con el segundo pero no con el primero, esto significaque
el leu- ARNt, lee el codn CUU y el leu-ARNt,,, el GUU.
Sin embargo, la idea un codon-un ARNt no prospermucho tiempo debido a los
experimentos de Holley, quien logr establecer la secuencia completa de bases del
ala-ARNt de levadura. Esta molcula lee 3 (GCU, GCC y GCA) de los 4 codones de la
alanina. El examen de la secuencia de las zonas no apareadas mostr que en un solo
-
sitio haba una secuencia 5 ' -GC--3 ' por lo que esta pareja deba ser parte del
aniicodon (se debe recordar que por convencin, las secuenciasde los cidos nucleicos
se escriben del extremo 5 ' al 3 ' y el apareamiento se realiza en sentido antiparalelo,
por lo que el codon 5 -- AUC-3 ' debe tener un anticodon 5'--GAU--3 ' ).
Esto implicaba que el anticodon fuera la secuencia 5 ' --IGC-- 3 ' ,en la cual 1
simboliza el nucletido raro de inosina. Como el ala-ARNt responde a los 3 codones
(GCU, GCC y GCA) entonces, la inosina no forma puentes de hidrgeno o puede
formarlos con U, C y A. Si fuera la primera situacin tambin leera el codon GCC, lo
cual no suceda, por lo tanto, 1puede formar puentes de hidrgeno, aunque no sea en la
forma de los pares habituales U-A y G-C (Fig. 28.4).
La aparicin de la inosina en el aniicodon se debe a que siempre que en la primera
posicin aparezca A en el transcrito primario, sta es desaminada enzimticamente
produciendo hipoxantina. que es la base que forma parte de la inosina.
La explicacin a este fenmeno fue propuesta por Francis Crick (1965) con la
idea del acoplamientovacilante (wobble). Hasta ese momento se crea que apareamientos
diferentes de A-U, A-T y G-C no aparecan en los cidos nucleicos. Esto es cierto en el
ADN por las caractersticas estructurales de la molcula, como se n o en la seccin de
biomolcnlas. Sin embargo, como el apareamientocodon-anticodon se produce entre 2
molculas de ARN no es necesario consemar la eshuciura regular de la doble hlice. Crick
demostr que pueden existir otros apareamientos en la interaccin codon- anticodon,
pero que esto requera en primer lugar que las 2 primerasbases fonnaran apareamientos
tpicos, para que segarantizara unaestabilidad mxima y,en segundolugar, queel terrer
par de bases no produjera mucha distorsin como ocurre habitualmentecon los pares
purina-purina, identificandocomo posibleslos apareamientosque aparecen en la figura
28.5.
Laposibidad deformarlos4 paresadicionalesdebases (A-1,U-1, C-1y G-U) explica
cmo una sola molcula de ARNt puede aparearse con varios codones.
Ahora es comprensible el caso de los ala-ARNt de levadura. Uno deellos,estudiado
por HoUey, que tiene el anticodon IGC puede formar pares de bases con 3 de los codones
(GCU, GCC y GCA), pues la inosina puede aparearse con U, C y A. El otro (denominado
ala-ARNt,,)slo acopla con el codn GCG, para lo cual seran posibles 2 anticodonesel
CGC y el UGC, pues G puede formar pares de bases con C y con U. Si fuera el UGC
entonces deba leer tambin GCG y GCA, pero como este no es el caso,el anticodon deba
ser CGC y lo es en realidad.
Aunqueensolucinlos tnnucletidosseaparean mal,pues su tamao no les permite
estabilizarse por las interaccionesde apilamiento de bases; en el proceso de traduccin
estas interaccionescodon-anticodon se estabilizan debido a vanos factores:

1.Tanto elcodoncomoel a n t i d o n forman parte de molfulas mayom,locual permite


que la unin entreellos pueda estabilizarsepor apilamientode bases.
2. Hacia el lado 5' del antidonsiempre hay una U,loquesugiere quedebetener alguna
participacin en la estabilizacin de la unin codon-anticodon.
3. El apareamientose produce normalmente cuandoambos (ARNty ARNm) estn uni-
dos a los ribosomas. Es posible que esa unin haga que el codon y el anticodon se
posicionen de fonna que la estabilidad de la unin sea mxima.

Fig. 28.4. La inosina como formadora de


pares de bases. La inasina (en ca-
lor) puede formar pares de bases
con la eitosina (arriba), uracilo
(centro) y adenina (abajo), por lo
cual su aparicin en el anticodan
del ARNt noimpide el apareamien-
to con el codon del ARNm. La
aparicin de la inasina en la pri- Fig. 28.5. Modelo de acoplamiento vacilante. Segn la hiptesis del apareamiento vacilante en la
mera posicin del anticodon per- unin del cadon con el anticodon, pueden aparecer pares de bases que no se encuentran
mite que varios codonea sean lei- normalmente en el ADN. En cada casa el anticodon esti en rojo y el codon en azul. La
das par el mismo ARNt. flecha indica la direccin 5'->3'. En todas las casos slo se representa la tercera base.
Obsrvese que las codones que aparecen en la misma horizontal son siempre sinnimos.

Resumen
Desde el punto de vista bioqumieo el cdigo gentico es la relacin de equiva-
lencia entre la sxuencia de bases nitrogenadas de los ARNm y la secuencia de
aminocidosde las protelnas. El d o n es la unidad de e o d i i i d n y est formado
por 3 bases, por lo que la relaci6n de d c a c i 6 n es 31. Cada base niirogenada del
ARNm forma parte de un solo codon, lo que quiere decir que el edigo no es super-
puesto. Por lo general cada aminocido es &cado por ms de un codon, lo que
significa que el cdigo es degenerado.
El deseiffado del cdigo fue posible gracias a 2 grupos de trabqjo principal-
mente el de Niremberg y el de Khoraoa El primero, utizaodo un sistema Ubre de
clulas y poliaueletidos sintticos, como inicio, y rinucletidosde secuencia cono-
cida, despus, logr establecer la estructura de numerosos codones. El segundo,
utilizando poliaucietidos de secuencia conocida conrm las asignaciones hechas
por Niremberg y establecila secuencia de otros codones, entre eLlos, los de termi-
nacin. A nales de 1966 el cdigo estaba totalmente descifrado.
Todaslas bacterias, virus, hongos, vegetales y animales utilizan el mismo cdi-
go; d o en las mitoeondrias aparecen variaciones, por lo que se considera que el
edigo tiene carcter quasiuniversal.
Los m& de la edmcua del cdigo Llevan a la idea de que su forma acuai es
resultado de un proceso evolutivo, en el cual se ha ido ganando en seguridad. El
eareter degeneradoposibitaamplias variaciones en la secuencia de bases del ADN,
y por lo tanto del ARNm, sin modicar esencialmente la edmcura primaria de las
pmieinas.
El proceso de deseodificacinse Lleva a cabo en los ribosomas con la participa-
cin de los ARNt, que contienen el triplete anticodon, que al aparearse con el codon
facilitan que cada amino4cido ocupe una posicin precisa en la cadena
polipeptidica. El apareamiento se produce con mayor fuerza en las 2 primeras
basesque en la tercera, lo que expiica que un mismo ARNt pueda leer varios codones.

Ejercicios
1. Como se observa en la figura 28.2 existen 6 codones para la Leu, Ser y Arg ,Cul
ser el nmeromnimo de Leu- ARNt,Ser-ARNt y Arg-ARNt que debe tener una
clula para sintetizar protenas eficientemente si todos los codones son utilizados
con la misma frecuencia?
2. El codon UAC codifica Tir y el UAG es un codon de terminacin Podra un
tir-ARNt aparearse al UAG y provocar que la sntesis de la protenacontinuara ms
all de su lmite normal?
3. El codon de iniciacin preferencial es el AUG, perose ha visto que tambin puede
emplearse el GUG y en ambos casos se incorpora Met Pudiera explicarse esta
situacin, suponiendo que un mismo ARNt pueda leer los 2 codones?
4. Los cidos aspriico y glutmico ocupan la misma casilla del cdigo, difierenslo
en la tercera base Cules deben ser los anticodones del asp-ARNt y el glu-ARNt
paraque en la cadena polipeptdica no pueda incorporarse uno de ellosen vez del
otro?
5. Un bioqumico afirm haber establecido la secuencia de bases de un Tir-ARNt
cuyoanticodon tena la secuencia 5 ' - ICA-3 ' .pero este hallazgo se puso en duda
por todos sus colegas Cules seran las razones que hicieron poner en duda el
hallazgo anunciado?
6. Un ARNm es modificado artificialmenteincluyndole una G entre los codones 15
y 16,y se observa que el polipptido sintetizado difieredel original en la secuencia
de aminocidos a partir del 16; despus se hace una segunda modificacin al
ARNm y se observa que ahora la secuencia de aminocidos del polipptido slo
difiere del original en los aminocidos 16,17 y 18 En qu consisti la segunda
modificacin?Cmo se pueden explicar los 2 resultados obtenidos?

Componentes wlulaues y Ckn6Pica moleculau s(n


Una vez esclarecidoel aspecto informacional empleado en el proceso general de
expresin de la informacin gentica, cabe discutir los aspectos estructurales y
funcionales de las partculas donde ocurre el fenmeno de descodificacin, cuyo
resultado es la sntesis de una molcula de protena.
Los ribosomas fueron observados por primera vez con la ayuda del microscopio
electrnico por George Palade, en 1955, por lo que algunos autores an los siguen
llamando grnulos de Palade. Con posterioridad se ha podido demostrar la presencia
destos en el citoplasma de todas lasclulas animales y vegetales, hongos y bacterias,
as como en algunos organelos citoplasmticos,especialmentelos cloroplastos de las
clulas vegetales y las mitocondrias.
Los ribosomas son los ms abundantes de los componentes celulares. En una
bacteria en fase de crecimiento activo pueden encontrarsecerca de 20000 ribosomas,
los cuales contienen aproximadamente el 10 % de las protenas y el 80 % del ARN
celular. En eucariontes la proporcin de protenas es menor, pero mayor su nmero
absoluto, y contiene la mayor parte del ARN celular.
: Los rihosomas bacterianos se encuentran unidos al ARNm que a su vez est unido

al ADN. En el citoplasmade los eucariontes los ribosomas estn comnmente asocia-


dos al citoesqueleto y en ocasiones a membranas del retculo endoplasmtico; todo
esto significaque durante la traduccin no estn libres en las clulas, sino asociados
directa o indirectamente con alguna de las estructuras celulares.
El inters en el estudio de los ribosomas no radica slo en su participacin en la
sntesis de protenas, sino adems, en el proceso de su propia formacin a partir de sus
componentes molecnlares. Tambin es de inters la interrelacin funcional que se
establece entre sus componentes, que se manifiesta en el hecho de que, ellos por
separado, no pueden dar cuenta de ninguno de los principales eventos que tienen lugar
cuando todos estn organizadosen la forma adecuada.
Los avances tecnolgicos alcanzados en los aos que van desde mediados de la
dcada de los 60 basta nuestros das, han permitido comenzar a desentraar la estruc-
tura molecnlar de los ribosomas, la organizacin tridimensional y la biognesis, as
como han posibilitado una primera aproximacin a la relacin estructura-funcinde
estos organelos.
Este captulo comenzar por el estudio de los rihosomas bacterianos, especial-
mente los de la E. coli, lo que servir de referencia para la comparacin con los de otro
origen. Los aspectosfuncionalesde estas partculas, sin embargo, slo sern completa-
mente comprensibles despus del estudio del captulo siguiente.
Primeros indicios
La historia del conocimiento de los rihosonias se remonta al descubrimientoen
los primeros aos de la dcada de los 50, de que la capacidad de diversos tipos
celulares para sintetizar protenas se relacionaba con el contenido celular de ARN, y
quelamayor proporcin de ste apareca en forma de pequeaspartcnlas (queenton-
ces denominaron microsomas)en el citoplasma celular; esto sugera que las partculas
deban intervenir de alguna forma en la sntesis de protenas, pero la importancia real
de los ribosomas slo se puso de manifiesto despus de algunos aos de intensa
investigacin bioqumica.
El trabajo principal fue desarrollado por Paul C. Zamecnik y otros, quienes
aadan a homogenatos de hgado de rata, aminocidos marcados con "C y ATP
como fuente de energa para lograr detectar la formacin de pequeas cantidades
de protenas. Mediante un proceso de eliminacin llegaron a establecer que va-
rios organelos celulares, entre ellos el ncleo y las mitocondrias, no eran necesa-
rios para la sntesis de protenas, pero que los ribosomas eran esenciales. Tambin
lograron identificar otros componentes esenciales para la sntesis de protenas,
entre ellos, los ARNt y la enzima que une los aminocidos a los ARNt correspon-
dientes. Estos sistemas, sin embargo, producan una escasa cantidad de protenas.
Los avances posteriores se llevaron a cabo con los trabajos presentados por
Marshall W. Niremberg y J. Heinrich Matthaei, acerca de los sistemas libres de
clulas, descritos en el captulo anterior.
A partir de ese momento se comenz el estudio intensivo de los ribosomas, la
separacin y la caracterizacin de sus componentes,la funcin de cada uno de ellos en
la traduccin, el ensamblaje de la partcula y su regulacin, que son los aspectos que se
tratan a continuacin.

Composicin molecular
Los ribosomas de la E. colise han estudiado con mayor intensidad que los de
cualquier otro organismo; al ser analizados en la ultracentrfuga presentan un coefi-
ciente de sedimentacin de 70 S, con un peso de partcula de 2 520 kD y estn consti-
tuidos por 66 % de ARN y 34 % de protenas.
Esta partcula puede ser disociada en 2 subunidades de tamao desigual. La
menor presenta un coeficiente de sedimentacin de 30 S, se le conoce como
subunidad 30 S, con un peso de 930 kD; est formada por una molcula de ARN
de 16 S que tiene un total de 1 541 nucletidos, para un pesomolecular de560 kD, lo
que representael60 % del peso de la subunidad, el 40 % restante lo constituyen 21
protenas con un peso total de 370 kD, que se han designado S1 a S21 para indicar
que pertenecen a la subunidad menor (small, pequeo) del ribosoma.
La subunidad mayor presenta un coeficiente de sedimentacin de 50 S, se le
conocecomo subunidad 50 S, con un peso de partcula de 1590 kD; est formada por
2 molculas de ARN, una de 23 S que contiene 2 904 nucletidos y otra de 5 S que
contiene 120 nncletidos, que en total representan 70 % del peso de la partcula, el
30 % restante lo constituyen 31 protenas designadas L1 a L34 (large, grande). Aun-
que se considera que hubo un error en la asignacin inicial de los nmeros a las
protenas, an se sigue usando la numeracin del 1al 34. El cuadro 29.1 resume
los aspectos principales de la coinposicin de los ribosomas procariontes.
Cuadro 29.1. Composicin molecular de los ribosomas de procariontes y encariontes

Propiedad Ymcanontes Eucariontes

Subunidadmennr
Peso molecolar 0,9 x 10' l,44 x 10'
ARN 16 S 18 S
Peso molecular 0.51 x 10' 0,7 x loL
Protenas 21 35
Pesomolecnlar 8 300 - 25 800 -
11 200 41 500
Peso total de protenas O39 x 10" 0,74 x 106
Sedimentacin 30 S 40 S

Subunidadmayor
Peso molecular 1,s x 10"
ARN tipo/peso 5 S/ 40 O00
23 S/0,98 x 10"

Peso total de ARN 1,02 x 10'


Protenas 32
Peso molecolar 5 300 - 24 600
Peso totaide protenas 0,78 x 10'
Sedimentacin 50 S

Se ha podido establecer, tanto la secuencia de bases de los 3 ARNr como la de


aminocidos de las 52 protenas ribosomales. Por anlisis de secuencia de ARNr de
diferentes orgenes se han elaborado los modelos correspondientes de estructura se-
cundaria de cada uno de los ARNr de la E. coli. En general se observa gran conserva-
cin en la secuencia y la organizacin consiste en la alternancia de zonas pequeas
apareadas y no apareadas (Fig. 29.1).

Fig. 29.1. Estructura secundaria del ARNr


de 5 S. Como se muestra en la fi-
gura para el ARNr de 5 S los de-
ms ARNr muestran una estruetu-
ra, caracterizada por la alternancia
de zonas cortas de apareamientoy
zonas de no apareamiento tambin
cortas.

Componentes celulares y Gentica molecuiar 511


En cuanto a las protenas no parecen presentar relacin estructural alguna segn
su secuencia aminoacdica y sus propiedades inmunolgicas. Existen 2 excepciones:
la S20 es idntica a la L26. en el 80 % de los casos se asla asociada a la snbunidad
menor, pero en algunos casos aparece en la mayor reflejando posiblemente que se
localiza en la zona de unin entre las 2 subunidades. La L7 difiere de la L12 slo por
presentar un grupo acetilo unido al grupo amino terminal. Esta protena, designada
L7kl2, forma dmeros en solucin, por lo que existen 2 dmeros por ribosoma. Todas
las dems protenas estn presentes en una copia por ribosoma, lo que significa que
todos los rihosomas de una bacteria tienen exactamente la misma composicin.

Estructuratridimensional
El modelo asimtrico es el ms aceptado como conformacin general del ribosoma
de la E. coli, en el cual la partcula 70 S aparece ms o menos redondeada con un
dimetro aproximado de 23 nm.
La subunidad menor es una partcula asimtrica alargada hacia los polos, con
dimensiones aproximadas de 23 x 11nm, sta se presenta dividida en 2 partes desigu'a-
les por una especie de depresin. La menor, recibe el nombre de cabeza y ocupa el
tercio superior; la mayor; se designa como base, de la cual sobresale una pequea
porcin denominada plataforma, que estseparada de la cabeza por una hendidura. La
distribucindel ARN y las protenases aproximadamente concntrica, pero no homo-
gnea, pues las protenas estn hacia la periferia y el ARN, que tiene una disposicin
en forma de V, est hacia el centro. Este modelo que aparece representado en la figura
29.2 (a) hasido confirmado con numerosas pruebas experimentales.
La snbunidad mayor consiste en un cuerpo principal de forma hemisfricacon un
dimetro aproximadode 23nm que tiene3 protuberancias que difieren en su forma y
tamao: una protuberancia central redondeada y 2 laterales; una de ellas tiene forma
de varilla y contiene las protenas L7/L12 y se extiendede 8 a 12 nm haciaun lado de
la partcula; la protuberaiicia del lado opuesto es ms bien redondeada y se caracteriza
por la presenciadela protena Ll. En una proyeccin perpendicular a la protuberancia
L7/L12 aparece una muesca o depresin en la superficie de la partcula. Ladistribu-
cin de los ARN (hacia dentro) y las protenas (hacia afuera) es ms homognea que en
la subunidad 30 S; sus rasgos esenciales se recogen en la figura 29.2 (b).
En el rihosoma 70.9 lasubunidad menor est colocada asimtricamentesobre la
mayor,lo que permite que la plataformade la 30 S entreen contacto con la subunidad
50 S, ya que la depresin entre la cabeza y la base de la subunidad menor queda
alineada con la muesca de la suhunidad mayor como se representa en la tigura 29.2 (c).

Localizacin de los componentm


Muchas de las protenas y algunas wnas de los ARNr, que componen los ribosomas,
han sido localizadas mediante diferentes procedimientos de los cuales los de mejor
resultado han sido los mtodos inmunolgicosasociados con la niicroscopia electrni-
ca, la dispersin neulrnica y la formacin de enlaces cruzados. A continuacin se
expone una versin simplificada de cada uno de ellos, sus especificaciones, as como
algunos de los resultados obtenidos.
Para el primero se procede de la siguiente forma: se obtienen las protenas
ribosomales,se aislan y purifican,despus cad'a una de ellas por separado se utiliza,
mediante mtodos de inmunizacibn, para obtener anticuerpos especficospara cada
una delas protenas ribosomales. A una suspensin de ribosomasse le aade un anti-
cuerpo especfico contra una de sus protenas y despus de dejar que la reaccin
antgeno-anticuerpo se lleve a cabo, ia muestra se prepara para su observacin por
microscopio electrnico. Las microfotografiasmuestran la posicin del anticuerpo
El mtodo dediFpeminneuhnica permitegtudiar la estnictura interna del ribosoma
Si una bacteria se hace crecer en un niedio que contenga agua pesada \que contiene
driiterio. isotopu pkwdu del Iiidrgcnu > lJ,O),sus protein&\ilas ribusi>malr\)conlen-
drn el istopo.Se procede entoncesa reali&la reconstniccin del ribosoma, utizando
protenas ligeras (que contienen hidrgeno) combinadas con 2 protenas pesadas (que
contienen denterio). Una vez reconstmidos los ribosomas, se les hace incidir un haz de
neutrones que al atravesar la partcula se dispersa. El ngulo de dispersin es diferente
parael hidrgenoy paraeldeuterio,sisemidesepuededetenninaraqu&tanciaestn
las protenas pesadas dentro del ribosoma. Repitiendo la experiencia w n okas protenas
se puede ir ubicando la posicin relativa de cada una de ellas. (Fig. 29.4).

Fig. 29.4. Resultados de la dispersin


neutrnica. Se muestra erqueni-
tieanientc 1"s resultados del m&>-
du dc dispersin neutrnica apli-
cado a la suhunidad 30 S del
nhosoma de la E. ceoli.

La formacin de enlaces cruzados se realiza tratando los rihosomas con algn


reactivo que pueda formar enlaces covalentes entre grupos cercanos (el ms empleado
es el 2-imino- tiolano); despus las partculas son disociadas en sus componentes y por
mtodos electroforticos se identifican los componentes que resultaron unidos por el
agente entreemzador. Este mtodo permite conocer las molculas que estn ms prxi-
mas unas aotras. Variandolas caractersticas del reactivo se pnede aumentar la distan-
cia entre las protenas qne resultan unidas. Por mtodos similares puede conocerse la
disposicin de diferentes sectores de los ARNr; este procedimiento ha sido de suma
importancia para cnnocer las molculas que se encuentran ubicadas en la superficiede
contacto entre las 2 subunidades (Fig. 29.5).

Fig. 29.5. Resultado de los experimentos de


cntreiruzamicnto. A partir de los
resultados obtenidos con los
reactivos de entrecruzamiento se
ha construido este esquema de la
suhunidad mayar del ribosonia de
la E. crili. Ntese las amplias rela-
ciones estructurales de la protena
1.2 y las escasas de L9 y L25.
Utilizando estos 3 procedimientos se ha podido localizar la posicin de muchas
protenas en las 2 subunidades y adems algiinos sitios funcionales, por lo que se ha
podido determinar que las protenas S3, S7, S10, S14 y S19 estn en la zona de la
cabeza; S4, SS, S8 y S12 en la depresin que separa la cabeza de la base, y S6 y S11 en
la plataforma. La protuberancia central contiene la L18 y los 2 extremos del ARN 5 S,
las 4 molculas de L7L12 estn en la rama de la derecha y la L1 y L9 en la cresta de la
izquierda.
Por procedimientos diferentes se han podido conocer algunas de las zonas de
interaccin entre los ARNr y las protenas (Fig. 29.6).

Extremo 3'iicl5S

Fig. 29.6. Laralizaiin de los ARNr. Se


muestran algunos sectores de los
ARNr que han sido localizados por
diferentes procedimientos en la
suhimidad menor (izquierda) y la
mayor (derecha) del fibosoma d e
Extremo 3del 23s la E. coli.

Dominios funcionales
Los ribosomas de todos los organismos presentan en general 2 regiones funciona-
les: la traduccional y la de salida o secrecibn; ubicadas en lugares opuestos. El domi-
nio traduccional incluye la cabeza y la plataforma de lasubunidad menor, ascomo la
protuberancia central y las laterales de la subunidad mayor; es en este dominio donde
han sido localizados varios sitios funcionales (Fig. 29.7).

Fig. 29.7. I>oiiiinios en el ribosenia. Los


ribosoinas presentan 2 dominios
distinguibles: d traduciiunal que
aparece en la parte supcrior de la
lnea disrontinua y el de salida o
secrecin que aparece en la infe-
rior. La figura muestra la iinin al
dominio traduecianal de los ARNt
y protenas que intrrviencn en la
traduccin (P),as como d domi-
nio de secrecin unido a menihra-
nos celulares hacia donde est sa-
liendo el polipGptido recin sinte-
tizado. El ARNm~rerepresenta en
rojo.

Componenoes celulares y Gen6tica molecuiar 515


Durante la traduccin existe una especializacin funcional de las 2 subunidades,
mientras en la de 30 S se produce el reconocimiento codon-anticodon,en la subunidad
50 S es donde se produce el enlace peptdico que unir los aminocidos durante la
sntesis de las protenas. Para la actividad ribosomal es necesario que las 2 subunidades
se encuentren unidas, pues la unin de ellas permitela formacin de los sitios funcio-
nales del ribosoma como el P o peptidil, el A o aminoacil y el E o de salida. La funcin
de estos sitios en la sntesis de protenas se estudiar en el captulo siguiente.
El sitio de unin de los aminoacil-ARNtest localizado en la zona de lacabezade
la subunidad 30 S donde se ubican las protenas S3, S10, S14 y S19, as como las S4,
S5,S8 y S12. En esta misma zonaesdondese unen otras protenas queson necesarias
durante el proceso de traduccin (captulo 30), tambin se encuentran los sitios de
unin a los factores de iniciacin 1 , 2 y 3, y los factores de elongacin FE-Tu y FE-G
(Fig. 29.8).

FE-Tu FE-G
l 1 FI- 1.2.3.

Fig. 29.8. 1,ocalizaciiin de interaeein con


protenas no rihosomales. Se re-
presenta la zona de interardn de
la subunidad menor ion algunas
protenas no rihosomales que par-
ticipan en la iniciacin de la tra-
dueeiiin. Para una explicaciiin ms
detallada ver el rapitulo siguiente.

Diferentes experimentos indican que la protena S11 participa en el reconoci-


miento codon-anticodon, luego este evento ocurre en la plataforma que es donde se
localiza dicha protena. El extremo 3'-OH del ARNr de 16 S interacta durante la
iniciacin de la traduccin con el extremo 5'-P del ARNm y tambin est uhicadi~en
esta zona.
La protuberancia derecha (L7L12) dela subunidad mayor est implicada en la
bidrlisis de GTP a la cual seencuentra acoplado el proceso de traduccin.
Por ltimo, existen evidencias de que la protena L27 est relacionada con la
actividad de formacin de los enlaces peptidicos. La localizacin de esta protena
entre la protuberancia central y la izquierda (Ll),cercana a la plataformade la 30 S.
hace suponer que es en este sitio donde se lleva a cabo la unin de los diferentes
aminocidos.
Si el dominio traduccional est bastante hien conocido, todo lo contrario sucede
con el de salida o secrecin. Pocas protenas (L7 y L19) han sido localizadas en esta
zona, por donde la cadena polipeptidica recin formada abandona al rihosoma.

Biognesis de los ribosomas


Para la formacin de los ribosomas es necesario la presencia simultnea de todos
sus componentes, las 3 molculas de ARNr (5,16 y 23 S) y las 52 protenas. Como se
estudi en el captulo 27, los ARNr de la E. coliestn codificadosen el ADN en forma
continua y se transcriben al um'sono en un precursor de gran tamao, que es profesado
hasta que cada uno alcanza su forma defmitiva. La E, colitiene 7 copias de estos genes.
j Tambin los genes que codifican protenas nbosomales se encuentran organiza-
d~ en grupos (operones)y varias de estas protenas se transcriben en un solo ARNm
policistrnico. Estos grupos de genes se encuentran localizados en diferentessitios del
cr*osoma bacteriano; se han descrito 7 operones que controlan la sntesis de las
protenas ribosomales (Fig. 29.9).

Fig. 29.9. Operones de las protenas


rihosamales. Las protenas rihoso-
males estn codificadas en 7 seg-
mentos de ADN de longitud varia-
hle. Cada unode ellos s i transerihe
en un solo ARNm que se traducv
secueneialmente. A, B y B' repre-
sentan subunidades a, y P', res-
peetivamente de la ARN polime-
rasa. EF-G y EF-Tu representan
protenas no ribosomales indispcn-
sahles para la traducriii. En rojo
apareeen las protena? que cantro-
lan la expresin de rada uno de las
fragmentos (aperones).

Las subunidadesribosomales se han podido reconstruir a partir desus componen-


tes purificados,con lo cual se pretende conocer el orden exacto en que cada uno de los
componentes es integrado en la formacin de la partcula.
Todo el sistema de sntesis de los ribosomas est sometido a un fino y complejo
control que ser analizado detenidamente en un captulo posterior.

Los ribosomas del citoplasma de los eucariontes son de mayor tamao que los de
procariontes con un coeficientede sedimentacin de 80 S con un peso de partcula de
4420 kD y estn constituidos por 60 % de ARNr y 40 % de protenas.
La subunidad menor presenta un coeficiente de sedimentacin de 40 S con
una masa de 1 400 kD y est formada por una molcula de ARN de 18 S que
contiene 1 900 nucletidos, con un peso total de 700 kD que representa el 50 %
de la partcula; el 50 % restante corresponde a unas 35 protenas con un peso total
de 700 kD.
La subunidad mayor -de 60 S y un peso de 2 820 kD-presenta en su composicin
3 molculas diferentes de ARNr,unade 28 S con 4 700 nucletidos, otra de5,8 S con
160 nucletidos y la tercera de 5 S con 120 nucletidos; ellos 3 constituyen e1 65 %
del peso de la partcula que incluye adems unas 50 protenas. En la figura 29.1 se
recogen los principales aspectos de la composicin molecular de los ribosomas
eucariontes.
La complejidad estructural de estos organelos hace que su estudio no est tan
avanzado como en los procariontes, por lo que no se puede contar hasta el momento
con un modelo detallado de su estructnra.
La biognesis de los ribosomas ocurre en el nuclolo donde se sintetizan los ARNr
de 28,18 y 5,s S; el de 5 S se produce en el nucleoplasma. Las protenas ribosomales
son sintetizadas por los ribosomas en el citoplasma y son transportadas al ncleo

Componentes celulus y C k m m & b 517


donde se produce el ensamblaje de las subunidades que ms tarde son llevadas al
citoplasma donde se forman los ribosomas funcionalesde 80s.
En los organelos los ribosomas presentan formas variadas. En las mitocondria$de
encariontes inferiores (hongos)son algo mayor que los de E. coli; en las plantasson
algo menores que los del citoplasnia de la propia clula; en los mamferos sin embargo,
son mucho ms pequeos con un tamao total de 60 S y una baja proporcin de ARNr
(25-31%).En los cloroplastas los ribosoma tienenun tamao semejante a los de las
bacterias pero con una mayor proporcin de ARNr. Ni la composicin detallada ni la
estructura tridimensional de estos ribosomas ha sido estudiada en detalle.

En los procariontes varios ribosomas se unen a un mismo ARNm formando los


polirribosomas o polisomas,stos pueden estar libres en el citoplasmaao unidos a la
membrana plasmca
En eucariontes la mayona de los ribosomas se encuentran en forma de polisomas
y slo una pequea fraccin se hallacomo ribosomas libres. Es fcildistinguir 2 tipos
de polisomas: los que aparentementeestn libres en el citoplasma y los que se encuen-
tran unidos a las membranas del retculo endoplaimtico, ste es el nico tipo de
membranaseucanontesal cual pueden unirse los ribosomas.
Los polisomas adheridos forman modelos caractersticos como asas, rosetas,
crculos, espirales e hileras dobles en los que participa un nmero variables de
ribosomas (de 5 a ms de 20). En algunos tipos celulares predomina un solo modelo,
por ejemplo, espirales en los plasmocitos e Iiileras dobles en los fibroblastos, mientras
que en otros hay mezclas variadas.
Los polisomas libres sintetizan principalmente protenas para el uso de la clula,
en tanto la. adheridos lo hacen para la secrecin,membranas u organelos membranosai,
.
oero no existen diferenciasestructurales entre ellos. La orouorciode ribosomas libres
A

y adheridos puede variar notablementedurante la vida celular, una clula exocrina,


por ejemplo, Comienza su proceso de diferenciacin con una poblacin predominante
de pdisomai libres, que elaboran las protenas necesarias para su crecimiento y repro-
duccin, pero al estar completamentediferenciada, presenta casi todos sus polisomas
adheridos y slonnafraccin muy pequea en forma libre.

Resumen
Los nbosomas son los organelos especialuados en la sn- de las protenas y
constituyen un componente universal de todas los orgaoianos celulares.
Los ribosomas procariontes estn formados por 2 subunidades de tamao
diferente. La menor o de 30 S tiene un ARNr de 16 S y 21 protenas., su fnncin
fundamental consiste en el reconocimiento don-anticodon. La mayor o de 50 S
presenta 2 tipos de ARNI, el de 23 Sy el de 5 S y 31proteinss, su funcin espeeca
fundamental es la formacin del enlace peptidieo. La partcula funcional o de 70 S
es la que funciona d-te la t r a d u d n .
Su estnietura iridimensional se define a partir del modelo asimirico. La
subunidad de 30 S consta de una cabeza, una base y una plataforma, y la de 50 S
consta deun cuerpo hemwrico con 3 protuberancias y una muesca En el ribosoma
funcionai la unin de las 2 subunidades conserva el carcier asimtrico.
Empleando tcnicas inmunolgicas asociadas con la microscopia electrnica,
ladispersin ueutrnica y la formacin de enlam cruzados se han podido determi-
nar la posicin de varios componentes ribosomaies, as como algunos de sus sitios
fqcionales. La mayora de las localizaciones se han realizado en el dominio
trridueeional y muy pocas en el de sada o secretar.
', La formacin de los ribosomas es un proceso complejo que requiere de la
pdcipacin simultnea de todos sus componentes, para lo cual es necesario la
snmistanto delos ARNr como de las protenas. Algo se ha avanzado en los Iomos
ao$en la monstrueein in viho de los ribosomas.
ks ribosomas eueariontes son mayores y ms complejos. La subunidad me-
nor o de 40 S presenta un ARNr de 18 S y unas 35 protenas. La mayor o de 60 S
tiene 3ARNr de 28; 5 3 y 5 S y alrededor de 50 p r o t e h . Juntasforman lapart'm-
la funcional de SO S.
La estructura de los ribosomas de organelos (mitowndrias y doroplastos) es
mucho menm conocida.
En las clulas los ribosomas se agrnpan formando posomas que pueden estar
aparentemente libres en el citoplasma, o unidos a membranas formando figuras
mctersticas. Los posomas Libres elaboran protenas Otoplasmticas, en tanto
los adheridos sintezan protenas de Secreei6n o de componentes membranosos.

1. Cmo se evidencia en la estructuracin de los ribosomas el principio de


organizacionde las macromolculas?
2. Cmo procederka usted para determinar la posicin de alguna de las protenas que
forman parte de los rihosomas?
3. Cules son las principales diferencias entre los ribosomas procariontes y los
eucariontes?
4. ;Existen algunas diferencias entre los polisomas libres y los unidos a membranas
en los encariontes?
5. En el ciclocelular deloseucariontes existe una etapa en que cesa la biognesis de
los ribosomas ;,Puede usted deducir en cul y por qu?
6. Desde hace tiempo se sabe que la estreptomicinaes un inhibidor de la iniciacin de
la traduccin; despus se demostr que este antibitico se une fuertemente a la
protena S12 ;Cules son las posibles conclusiones que pueden derivarse de estos
2 hechos?

Componentes celulares y Gentica molecuiar 519


La traduccin constituye la etapa crucial en el mecanismo de expresin de la
informacin gentica. Es en este proceso donde tiene lugar la sntesis de la protena
especfica que ha de cumplir una funcin determinadaen la clula o el organismo, con
lo cual la informacin contenida en los genes quedar totalmente expresada. En la
traduccin se realiza el trnsito del genotipo al fenotipo.
La explicin de la biosntek de protenas en tnninos moleculares constituye por
tanto un problema central de la biologa molecular. En 1961es que se obtuvieron los
primeros progresos significativosen el estudio de este proceso, a partir de extractos
bacterianos que sintezaban protenas activamente. Estudiosms recientes en eucariontes
permiten afirmarque,en lneas generales,el proceso ocurre deformasimaren todoslos
organismosvivos y que lasmayores diferenciasradican en sus mecanismos de control.
El estudio de la traduccin incluye 3 grandes aspectos: el informacional o del
cdigo, que ya fue estudiado en el captulo 28; el topogrfico o de la estructuracin
del sistema sintetizador de protenas, visto en el captulo 29, y el qumico, o sea, el
problema concreto de la sntesis de las protenas, es decir, la iniciacin de la sntesis, la
unin de los aminocidos en el orden correcto, la Liberacin de la cadena polipeptdica
neoformada, la adquisicin de su conformacin y, en ocasiones, las modificaciones
que ocurren simultnea o posteriormente a la sntesis. A este ltimo aspecto esi dedi-
cado el contenido del presente captulo.
Como se hizo en los casos anteriores este proceso se estudiar en primer lugar
cmo ocurre en procariontes, especialmente en la E. colicorno punto de referencia para
el estudio en eucariontes,basado en el sistema de reticulocitos de conejos que es el que
ha sido estudiado de forma ms completa.

Primeros aportes
A mediados de la dcada de los 50 Crckpropuso la hiptesis de que no exista una
interaccin directa entre los aminocidos v los cidos nucleicos aue los codificaba v
qneera necesariauna molcula adaptadorasin poder precisar nada sobre ella. Esta idea
se vio corroborada pocos aos despus cuando en 1957,Hoaglanddescubri un tipo
de ARN capaz de unirse especficamentecon aminocidos y que se denomin soluble,
pero que ms tarde se nombr detransferencia (ARNt).
Un aspectointeresantedel problema fue resuelto en una elegante experienciarealiza-
da porHowardDintzW,quien determinla direccin en quese produce la sntesis. Para
ello se utilizaron reticulocitos que sintetizaban hemoglobina activamente. Las clulasse
exponan a aminocidosmarcadoscon 'H durante diferentesperodos, que siempreeran
menores que el requerido para la sntesisde la protena. La hemoglobina se extraa y se
separaban las cadenas a y fi que eran entonces tratadas con tripsina. A los pptidos
resultantes se les meda la radiactividad y se comprobaba que sta era mayor hacia el
extremo carbofico. De hecho haba un gradiente de incremento de radiactividad desde
el extremo N terminal hacia el C termina1,por lo tanto, esa era la direccin de la sntesis.
Los experimentos para dilucidar el cdigo gentico ya haban mostrado queel ARNm se
lea en el sentido5 ' -->3 ' .A esta relacin entre la direccin de lectura del ARNm y la de
sntesis de la cadena polipeptdica se le denomina colinealidad.
Otro hecho sobresaliente fue puesto al descubierto en el laboratorio de Frederick
Sanger, quien dej establecido que existe un codon especfico para la iniciacin y que
ste es ledo por un ARNt especfico que difiere estructuralmente del resto de las
molculas del mismo tipo.
Sangertambin pudo determinar que este ARNt era cargado con la metionina y
que a sta se una un gmpo formilo, formando la formilmetionina,primer aminocido
que era incorporados la sntesis de protenas.
El inters por los mecanismos de sntesis de protenas es tal, que son muchos los
hombres y los laboratorios que han realizado aportes al esclarecimiento del proceso
hasta el nivel en que se encuentra en nuestros das.

Caractersticasgenerales
La traduccin tiene lugar en un organelo citoplasmtico especfico (los rihosomas)
y se produce forma unidireccional desde el extremo N terminal hacia el C terminal,
colinealmente a la lectura del ARNm (Fig. 30.1). Tiene carcter gradual y repetitivo,
pues los aminocidos van incorporndose uno a uno mediante el mismo mecanismo.
Tambin posee carcter acoplado, pues la energa necesaria para el proceso proviene
de la hidrlisisde nuclesidos trifosfatados. Tiene carcter dirigido, pues el orden que
los aminocidos ocupan en la cadena polipeptdica est determinado por el orden de
los codones en el ARNm.
Para la realizacin de la traduccin se requiere de ms de 200 macromolculas y
hanscwe a una velocidad promedio de unas 10aminocidos incorporadospor segundo.

,y.---- \
Fig. 30.1. Colinealidad ARNm protena. A
medida que el ARNm se va leyen-
do en el sentido 5 ' -->3 ' , la rade-
na polipcptidiia se va sintetizando
desde el extremo N-terminal hacia
cl extrcnio C-terminal; dc esta for-
ma la posicin de tos aniinoeidos
en la cadena polipeptdica queda
determinada por la posicin de los
eodoncs correspondientes en el
ARNm.

En el estudio de la traduccin se considerarn de manera secnencial las mismas


etapas que en los procesos anteriores, o sea, los eventos previos a la iniciacin, la
iniciacin, la elongacin, la terminacin y los eventos posteriores a la terminacin.

Eventos previos a la iniciacin


Se tomar como evento prelio a la iniciacin el proceso mediante el cual los
aminocidosson unidos enzimticanieiitea su ARNt especuieo y que recibeel nombre
de activacin de aminocidos.
La formacin de un enlace peptdico entreel grupo carboxilode un aminocido y
el grupo amino de otro es tem~odinnucamentedesfavorahle. Adems, los aminocidos
por sno pueden reconocer los codones sobre el ARNm y ordenarse en la forma adecua-
da, estos 2 obstculos son salvados por la reaccin de activacin.
Lae~quecataliiaestareacunfueaisladapor primera vezafinales deladcada
de los 50 a partir de extractos de hgado de rata, y ha ido recibiendodiferentes nombres
hastalaactualidad en que seconoce con elnombre genncodeaminoacil-ARNtsintetasa
Esta enzima constitnye hasta el 10 % de las protenas celulares, lo que equivale de
unas 1000 a 5 000 molculas por clula con sus variaciones de acuerdo con el estado
de la actividad celular.
Hasta el momento se conoce que en las bacterias existe una enzima para cada uno
de los 20 aminocidos. Cualquier modificacin del aminocido ocurre con posteriori-
dad a la accin de la enzima. Como un aminocido puede ser unido a ms de un ARNt
(especies isoaceptoras) debe existir en ellos alguna analoga estructural que le permita
ser reconocidos por la misma enzima.
Las aminoacil-ARNt sintetasas constituyen una familia de enzimas que
estmcturauiientepueden clasicme en 3 g m p : tipo 1,consisten en e h a s monomneas
fi>rm;idaspor una UILI i:ulrn;r pdipcplidira de 110 a 121) kD. como las acth ante\ de
s,alinaeiwlcucinadcla I.^cr1l~tipoll,fi1n~~~p1r2suhiinidUdnHli.i1tica\de 1Mla IWI kl).
mmolasdepmlina,trptfanoy metioninadelaE &,y tipom,fonnadaspor4nibunidades
iguala 2 a 2 de aproximadamente 280 kD, como de la fenilalanina de la E. d i .
Todas ellas catalizan la esterificacinde un aminocido al ARNt correspondiente,
lo cual se conoce generalmente como cargar el ARNt Para simbolizar al ARNt
especficopara un aminocido, por ejemplo para la alanina, se escribe ARNt"'" y para
sealar con cul aminocido est cargado se escribir Ala-ARNt, por lo que la escritura
completa sera Ala-ARNP. Es importante recordar esta notacin pues en ocasiones,se
utilizan con fines experimentales ARNt cargados con un aminocido diferente al que
le corresponde y la notacin ayudar a distinguir de qu se trata en cada caso.
Los estudios sobre el mecanismo de reaccin hacen posible su separacin en
2 etapas, la primera, llamada de activacin propiamente dicha, y la segunda, de
transferencia; ambas etapas son reversibles (Fig. 30.2).
N"i

Fig. 30.2. Activacin de los aminucidos. Los aminocidos son unidos en una primera etapa al fosfato a dcl ATP, Comando un aminoaeiladenilato que
en una segunda etapa reacciona ron el ARNt correspondiente, transfirindole su grupo aminaacilo; ambas etapas de la reaccibn son
reversihles y calalizadas por las aminoacil-ARNt-sintft~sas~
En la primera etapa la enzima en presencia de iones Mg2+transfiere el aminocido
por su grupo carboxilo alfosfata msinterno del ATP,formndoseun enlace anhidrido
mixto de alta energa. Esto da lugar a la formacin de pirofosfatoque abandona la
enzima y un aminoaciladenilato que permanece unido al centro activo de la sintetasa.
La hidrlisis del pirofosfato favorece el sentido de la reaccin.
En la etapa de transferencia el grupo aminoacilodel aminoaciladenilato se trans-
fiere al restoderibosadel extremo 3 ' - OHdel ARNt correspondiente,formndoseel
aminoacil-ARNty AMP. Existen 2 familias de enzimas que se diferencian en que una
de ellas transfiere el aminocido hacia el 3 ' -0H y la otra hacia el 2 ' -OH, lo cual
depende de la forma en que se produce la unin enzima sustrato. De todas formas el
grupo aminoacilo puede migrar del 3 ' al 2 ' ,y viceversa, unas 10 000 veces por
segundo. Como ya fue expresado, la reaccin general es reversible y presenta una
constante de equilibrio que vara entre 0,3 y 0,7, dependiendo del aminocido, de lo
que se deduce que el enlace ster del aminoacil-ARNttiene un contenido energtico
comparable con el del enlace anhdrido de cido del ATP.
Del mecanismo expuesto se infiere que las sintetasas poseen una doble especifici-
dad, pues por una parte deben reconocer al aminocido especficoy por otra al ARNt
que le corresponde. La traduccin correcta del mensaje gentico depende en elevado
grado de la especificidad deesta reaccin, pues no se conoce un mecanismo de rectifi-
cacin como el de la replicacin. De las 2 etapas, la de mayor especificidad es la
segunda. Esto se pudo comprobar cuando se utiliz la sintetasa especfica para la
isoleucina, e incubndola con valina se logr la formacin del valil-AMP, pero al
aadir el ARNtV"en vez de producirse la transferencia del grupo valilo al ARNt, se
estimul la hidrlisis del valil-AMP.
Casi todos los aminocidos una vez unidos a su ARNt correspondienteestnen
condiciones de unirse a los ribosomas para la sntesis de protenas, no obstante, existe
una notableexcepcin.Se trata de aqul que va a servir parala iniciacin.
Como ya se estudi en el captulo 28, el codon de iniciacin es el AUG (y en
algunos organismos el GUG), que adems codifica la metionina. Smgerdescubri que
existen 2 tipos de ARNt""', uno que se emplea en la iniciacin,el ARNty, y otro para
las posiciones interiores, el ARNt"?. La misma sintetasa cataliza la unin de los 2
ARNt a la metionina, pero el Met-ARNt,"" es posteriormente modificadopor la accin
de una transformilasa especfica que utiliza como donante activado de formilo el
N1"formiltetrahidrofolato(FH,), como aparece representado en la figura 30.3. El pro-
ducto de la reaccin se denomina N-formilmetionil-ARNt(fmet-ARNtmh'"). Esta enzi-
ma slo reconoce al ARNt y no al ARNtm,lo cual hace suponer la existencia de
diferencias estructurales entre los 2 ARNtM".La formilacin de la metionina en el
ARNt es esencial para la iniciacin de lasntesisde protenas. La traduccin de ARNm
virales aadidos a extractos bacterianos es bloqueada por la adicin de trimetiprima,
un potente inhibidor de la dihidrofolato reductasa,sin embargo,la inhibicinessupri-
mida por la adicin de N'Uformil-FH,o defmet-ARNt, .

ARN,,--CH. O A R N , , - ~ ~ ~
Fig. 30.3. Reaccin d e formilaein del
metionil ARNf iniciador. Una en- Transformilasa
, >
zima tronsforniilaaa, que utiliza
romo donante d e farmila al y-(> F( 1, , . -0 OH
N1"f<,rmil-tetrahidrofolato,modi- li:,-,, .
.,. , . - . ,, ~ : , -,-:, -,z
fica el grupa amino de la metimina
ic:i'll_ H !C'k!.#.
unida al AKVt,. Esta reaccin es - ~

indispensable para la iniciacin de


la traduccin en procariontes. cil.
'i
r+
Iniciacin
La traduccin comienza con la formacin de un complejo de iniciacin 70 S. Los
comoonentesone interachan son las 2 subunidades del ribwma. ARNmfmet-ARNt?'"
y GTP; se reqiiere adems la participacin de 3 protenas llamadas factores de inicia-
c i h e identificadassimblicamentecomoFI- 1,FI-2 y FI-3. LosFI-l y FI-3son prote-
nas bsicas, relativamente estahles al calor y formadas por una solacadena polipeptdica;
el FI-1 con un peso de 8,9 a 9,4 kD y de 21 a 233 M>,el FI-3. Por otra parte el FI-2 es una
protena cida y termolbil con un peso de 90 a 118kD.
A continuacin se describe la secuencia de eventos que llevan a la formacin de
este complejo. Para lograr una mejor comprensin se ha dividido en 4 fases Wig. 30.4).

Fig. 30.4. Etapa de iniciaci6n. Al disociarse


los rihowinas estimulados por
FI-l. ste se une a la suhunidad
mcnore impides" rcasoriaciti ion
la mayor. El resto de los factores
quedan tamhiii incorporados a la
suhunidad menor; entonces pue-
de ocurrir que el Ir-:GTP incor-
pore al fmet-ARNt, e que el FI-3
incorpore al ARNni. El pase si-
guiente complcta la incorporacin
GDP + @ GDP + @ de todos los eomponentcs y la fase
se completa al rcincorperarse la
+O+.+' suhunidad mayor.
5' \ --'

Formacin del complejo de preinieiaun

En el citoplasma celular los ribosomas se encuentran asociados como partculas


70 S y disociados en un equilibrio dinmico. En concentraciones fisiolgicas de Mg"
casi todos estn asociados. La disociacin de los ribosomas se produce por la accin
combinada de FI-1 y FI-3. El FI-1aumenta la velocidad de disociacin de los ribosomas,
con lo cual se incrementa el nmero de subunidades 30 S libres a las cuales se une
entonces el FI-3 impidiendo su reasociacin con las subunidades mayores. Como el
complejo30 S:FI-3 es incapaz de unirse a la 50S,de hecho desplaza el equilibrio hacia
la disociacin, permitiendo la unin de ms FI-3. El F1-2 ligado a GTP se une entonces,

Componentes celulares
en una unin que es altamenteestahilizada por FI-1 y FI-3. Por su parte la unin del FI-1
es estabizadapor FI-2 y FI-3. En experimentosin iitrose ha mniprobadoquecadafactor
por separado puedeunine a la 30 S,perolaprmencia delos 2 restantesestab'izala unin.
Lus3factores se unen contiyamente y muy cercadelextremo3'-OH del AUNrde 16
S y adyacentes a la zona de unin de la 50 S. A la estructura as formada se le denomina
complejo de preiniciacin.

Incorporacin del fmet-ARNS

El factor directamente involucrado en la incorporacin del fmet-AUNt,es el FI-2,


lo cual se comprob en experiencias in vitro donde era el nico capaz de lograr la
incorporacin del ARNt, a los ribosomas, utilizando el trinucletido AUG como
ARNm. El FI-2 es incapaz de unirsea formilnietioninalibre o unida a polinucletidos,
pero lo hace fuertemente a cualquier ARNt cargado con metioninaque tenga blo-
queado el gmpo amino. Parece ser que el fmet-ARNt.,se une slo al ribosoma de forma
muy dbil y elcomplejo FI3:GTP &tabiliza la unin.'La incorporacin del fmet-ARNti
determinala salida delFI-3 del complejo. Este evento puede ocurrir antes o despus
del que se describir a continuacin.

Incorporacin del ARNm

La incorporacindel ARNm se produce por la intervencin delFI-3. El ARNm tienc


un sitio de unin al ribosoma determinado por la secuencia 5'---AGGAGGU---a' o
parecida (secuenciade Shine y Daigarno) enuna posicin similar hacia el lado 5'-P del
codou de iniciacin; sta se aparea con una zona rica en pirimidinas del extremo 3'-OH
del ARNrde 16S la 5'- GAUCACCUCCUA--3'.Este apareamiento posicionael codon
AUG deformaque pueda apareane con el anticodon del fmet-ARN:. El estudio de varias
secuenciasha demostrado que la longitud de esta secuencia del ARNm es variable y que
el nmero de pares de bases entre ellas vaia de 3 a Y; mieniras ms p a r e de bases se f m e n
ms eficientees la unin y nienos dependencia existe de la presencia del FI-3. La-mnade
unin al rihosoma estcompuesta por las protenas S7,Sl,Sll,S12, SI8 y S21.
Normalmente la zona del extremo 3'-OH del ARNr de 16s est en forma de una
horquilla determinada por el apareamientointracatenariodelas ha% que no permiten la
unin con el ARNm. La accin combinada del FI-3 y de la protena S1 logran separar las
bandas de la horquilla y permiten la hteraccin por apareamientode b a s e n & el AUNm
y el ARNr de 16 S.

Formacin del complejo de iniciacin 70 S

La subunidad 50 S se une ahora y provoca la hidrlisis del GTP mido al FI-2, con lo
cual EI-1, FI-2, FI-3,GDP y Pi abandonan el ribosoma y el tinet-AUNt,devieneactivopara
la formacin del enlace peptdico.
El W P acta como un modulador alostrico. Si se emplea GDPCP (Fig. 30.5) ste se
une al FI-2 y el complejo FI-2 j GDPCP se une al ribosoma, pero no se separa de l al
incorporanela 50 S. Si previamente se remueveel GDPCP,e fonna una 70 S totalmente
tiuicional,osca,la hidmlisisdelGTPnoesimprescindiblepara la ubicacindelfmet-AIZN:,
slopara cambiar el efector de GTP a GDP y con ello variar la conformacin del FI-2. Se
ha postulado que esto produce a su vez una transconforniacin del fmet-ARNt que le
permite interactuar con la peptid transferasa. Este paso se hadenominado acomodacin.
Para liberar al FI-2se reuuiere la narticinacin del FI-1 en cuvaausencia nila hidrlisis
del GTP permite la liberacin del FI-2 ni la incorporacin de la 70 S. Parece ser que al
hidrdizarse el GTP,el El-2 quedaunido al GDPqne dehe intercambiar con el F1-l para
ahandonarel ribosoma
Las protenas L11 y la L7L12 estn involucradasen la hidrlisis del GTP. El contac-
to enhp FI-2:GTP y la prominencia L7L12 produce en esta itima una ~amconfonnacin
que activala GTPasa unida el ribosoma.
Fig. 30.5. Estructura del GDPCP. La figura mucstra las estructuras del GTPy del GDPCPque presenta
cmo, en ste ltimo, el grupo fosfato ms externo est unido al resto de la molcula por un
grupo mrtilcno, por lo cual este compuesto no es hidrolizable romo cl GTP y resdta dc gran
utilidad como su anlogo.

La etapa deiniciacin es la ms compleja de todas pero tngase presente que de la


adecuada ubicacin del codon de iniciacin depende que el resto del proceso se lleve a
eabo con la fidelidad requerida.

Una vez que se ha formado el complejo de iniciacin de 70 S al nivel del codon de


iniciacin,comienza un proceso de carcter cclico, en el que cada aminoacil-ARNt se
incorpora al sitio A del ribosoma, cuyo sitio P est ocupado por la fmet- ARNt,; se
produce la formacin del enlace peptdico entre los aminocidos activados y el mori-
mientodel ribosoma hacia un nuevo codon del ARNm con lo cual vuelve a iniciarse el
ciclo,sta es la etapa de elongacin. Tambin en la elongacin se requierela participacin
de orotehas esoeciicasno ribosomales, que se conocen como factores de elongacin y se
s&bolizan como FE-ni.FE-% FE-G; SU estudiose realizar porfases comoen el caso
anterior (Fig. 30.6).

Incorporaa6n del aminoad-ARNt

Al producirse el complejo de iniciacin de 70 S, un segmento de aproximadamen-


te 30 nucletidosdel ARNm queda cubierto por el ribosoma, pero slo 2 molculas de
aminoacil-ARNt pueden estar en contacto con el ribosoma al mismo tiempo, de ah
que en la sntesisde protenas slo intervienen simultneamente 2 de los 10 codones
cubiertos por los ribosonias; cada uno de los aminoacil-ARNt ocupan sitios diferentes
en el ribosoma. El nicositio que puede ser ocupado por el aminoacil- ARNt entrante
es el sitio A (de aminoacil) o de entrada. Previo a la entrada del aminoacil-ARNt, el
sitio expone el codon que corresponde al siguiente aminocido que debe ser iiicorpo-
rado a la cadena polipeptdica.
El codon que representa el ltimo aminocido que ha sido aadido a la cadena
ocupa el sitio P (de peptidil) o donador, donde se localiza el polipptido que ha sido
sintetizado hasta ese momento, o el fmet-ARNt,al inicio del proceso.
El factor que interviene en la incorporacin dcl aminoacil-ARNt al sitio A se
obiuvo originalmente como una fraccin nica, a partir de extractos de la E. coliy se
IeUam factor T, que m tardefueseparadoen2
~ componentes, uno queera estableal
calor y por ello se le Ilani FE-Ts (la s por stable) y otro que era inestable y se nombr
FE-TU(la u por unstahle).

Componentes celulares y Gentica molecdar 527

h ~
Fig. 30.6. Elongan. Las 3 ctapns fundamentales de la elongacin se repiten de manera continua
tantas veccs como aminocidos tiene la protena, por eso esta etapa tiene carcter reiterativo.
(a) El complejo como queda al final de la iniciacin. (b) Se ha incorporada el arninoacil-
ARNt al sitio A del ribosoma, que en el paso siguiente ( e ) queda unido al aininoaril qiie
ocupaba el sitio P. Se produce la transloeacin (d) y comienza un nuevo ciclo de elongacin.

La formaactiva del FE-Tb esun complejo binario con el GTP, queentonces puede
unirse al aminoacil-ARNtformando un complejo ternario, por lo que es probable que
la funcin del nucletido de guanina sea la de garantizar la conformacin adecuada
del factor. Como sucede en la iniciacin, la hidrlisis del GTPconstituye el mecanismo
de variar el efector y con ello su conformacin.
La forma activa del FE-Tu puede ser regenerada por EF-Ts, que reacciona con el
complejo FE-Tu:GDP y desplaza al GDPal tiempo quese forma un complejo entre los
2 factores FE-Tu:FE-Ts (este fue el que inicialmentese llam factor T); el FE-Ts es a su
vez desplazado por el GTPformndose el complejo FE-ni:GTP, que puede unirse a un
nuevo aminoacil-ARNt y el FE-Ts que puede reciclarse (Fig. 30.7).
Las interacciones entre FE-Tu, FE-Ts y GTPson reversibles in Wtro, no as la
unin con el aminoacil-ARNt, esto es lo que dirige la reaccin en un solo sentido.
El FE-TU es una cadena polipeptdica nica de 393 aminoacidos, con un peso
molecular de 43 kD y es una de las protenas ms abundantes de la E. coli, pues existen
unas 70 000 molculas por clula, lo que representa el 5 % del total de protenas
- - l de aminoacil-ARNt de la
celulares. Esto es suficiente Dara ooder ligar el ~ o ototal
clula y aproximadamente 10 veces el nmero total de ribosomas. La cantidad del
FE-Ts es aproximadamente igual al nmero de ribosomas, lo cual implica que la mayor
parte del FE-Tu se encuentra en forma de complejos binarios o tern&os.
En la formacin del complejo ternario con el FE-TkGTP, la caracterstica estruc-
tural ms importante del aminoacil-ARNt pareceser el brazoaceptor, aquel donde se
une el aminocido. Los cambios en el nucletido final de adenina impiden el recono-
cimiento del aminoacil-ARNt.El nico aminoacil-ARNtque no puede ser reconocido
por el complejo FE- Tu:GTPes el fmet-ARNti,loque excluye la posib'idad que la fmet
pueda ser incorporada en respuesta a un codon AUG interno. Una razn de este com-
e Fig. 30.7. Ciclo del factor de elniigarin T.
1. El FE-Tu (en azul) unido al GTP
GTP ( e n rolo) ~ w x e i a n acon el
D ainiriuaeil-,\RNt. 2. El cornplqjo
formado se incorpora al rihosoma.
3. E1 GTP es hidrolizado a GDP y
ronq>le,io TuIGDP abandona cl
ribosanm 1. En ese nionicnto in-
terviene ci FE-% que se une al
FE-TU drsplazando al GDP. 5. Con
posterioridad el GTP desplaza al
FE-Ts; ron lo cual el factor queda
eii cuiidiciones para recomenzar
el ciclo.

portamiento pudiera ser la estructura del brazo aceptor del ARNti el cual delante del
ACCA-aminoacil contiene un C:A no apareado en vez del par presente en todos los
dems ARNt. Otro hecho sera la presencia del grupo amino bloqueado, pues se ha
comprobado que el bloqueo del grupo amino en otros aminoacil-ARNt impide su
unin con el complejo FE-TxGTP.
Estudios con GDPCP han demostrado que la hidrlisis del GTP ocurre con poste-
:
rioridad a la incorporacin del complejo aminoacil-ARNt / FE-Tu GTP al ribosoma
pero, previa a la formacin del enlace peptdico, se produce la hidrlisis de un GTP por
cada aminoacil-ARNt que es incorporado.

Formaci6n del enlace peptidico

El enlace peptdico se forma en una reaccin en la cual se transfiere el gmpo unido


al ARNt que ocupa el sitio P (sea un pptido o el fmet) hacia el grupo amino del
aminocido unido al ARNt aue ocuoa el sitio A. catalizada Dor una actividad de
peptidiltransferasa presente en la subunidad 50 S del ribosoma. Estudios recientes
indican que existe una notable participacin del ARNr en esta actividad cataltica,
aunque el concurso de protenas ribosomales no ha sido descartado totalmente.
Aunque el sitio activo se localiza completamente en la subunidad mayor,la acti-
vidad puede ser detectada slo en el ribosoma completo. La necesidad de la subunidad
menor puede entenderse como un mecanismo de seguridad que evita la unin azarosa
de aminoacil-ARNt por la subunidad mayor solamente.
Unode los problemas anno resueltos de lasntesis de protenas es laexplicacin de
cmo es posible que 2 ARNt ligados a codones contiguos puedan localizar sus brazos
aceptores lo suficientemente cerca uno de otro para permitir la formacin del enlace
peptidico, teniendo en cuenta la estructnra hidimensional de los aminoacil-ARNt.

El ciclo de elongacin se completa con la translocacin, en la cual el ribosoma


avanza 3 nucletidos a lo largo del ARNm. Al formarse el enlace peptdico el ribosoma

Componentes celulares y Gedtica moIecular 529


S
'\

/' '
\,
e Fig. 30.7. Cielo del factor de eloiigatin T.
1. El FE-Tu (eii arul) unido al GTP
GTP (en ro)o) reacciona con el
b aininuaeil-.\RNt. 2. El complejo
formado se inrorpora al rihnsorna.
3. El GTP es hidrolirado a GDP y
romplqio 'I'uIGDP abandona cl
rihosonia. 1. En ese niomento in-
tenieiie PI FE-Ts que se une al
FE-Tu desplarando al GDP. 5. Con
posterioridad el GTP desplaza al
FE-%, r o n lo cual el factor queda
en cundiriones para recomenzar
el cielo.

portamiento pudiera ser la estructura del brazo aceptor del ARNti el cual delante del
ACCA-aminoacil contiene un C:A no apareado en vez del par presente en todos los
dems ARNt. Otro hecho sera la presencia del grupo amino bloqueado, pues se ha
comprobado que el bloqueo del grupo amino en otros aminoacil-ARNt impide su
unin con el complejo FE-'k:GTP.
Estudios con GDPCP han demostrado que la hidrlisis del GTP ocurre con poste-
rioridad a laincorporacin del complejo aminoacil-ARNt / FE-Tu ; GTPal ribosoma
pero, previa a la formacin del enlace peptdico, se produce la hidrlisis de un GTP por
cada aminoacil-ARNt que es incorporado.

Formaan del enlace p e p t d i

El enlace peptdico se forma en una reaccin en la cual se transfiere el grupo unido


al ARNt que ocupa el sitio P (sea un pptido o el fmet) hacia el grupo amino del
aminocido unido al ARNt oue ocuoa el sitio A. catalizada oor una actividad de
peptidiitransferasa presente en la subunidad 50 S del ribosoma. Estudios recientes
indican que existe una notable participacin del ARNr en esta actividad cataltica,
aunque el concurso de protenas ribosomales no ha sido descartado totalmente.
Aunque el sitio activo se localiza completamente en la subunidad mayor, la acti-
vidad puede ser detectada slo en el ribosoma completo. La necesidad de la subunidad
menor puede entenderse como un mecanismo de seguridad que evita la unin azarosa
de aminoacil-ARNt por la subunidad mayor solamente.
Uno de los problemas an no resueltos de lasintesis de protenas es la explicacin de
cmo es posible que 2 ARNt Ligados a codones contiguos puedan Localizar sus brazos
aceptores lo suficientemente cerca uno de otro para permitir la formacin del enlace
peptidieo, teniendo en cuenta la estructura tridimensional de los aminoacil-ARNt.

El ciclo de elongacin se completa con la translocacin, en la cual el ribosoma


avanza 3 nncletidosa lo largo del ARNm. Al formarse el enlace peptdico el ribosoma

Componentes celulares y Ckn6tic.m m1ecuiar 529


porta un ARNt descargadoen elsitio P y un peptidil-ARNt en el sitio A. Como parte de
un mismo mecanismo, en la translocacin se expele el ARNt del sitio P y simultnea-
mente el peptidil-ARNt se mueve del sitio A hacia el sitio P. El ribosoma entonces
presentaunsitio A no ocupado, que permitirlaentrada del siguienteaminoacil-ARNt
En esta fase intervieneel FE-G (la G alude a que liga nucletidos de guanina) que
constituye una de las principales proteinas de la clula con un peso molecular de
72 kD y representa e1 2 % de las proteinas celnlares,lo que hace queseencuentre en
cantidad aproximadamente igual al nmero de ribosomas.
Como en los casos anteriores, se debe formar un complejo FE- G GTP que
garantiza la conformacin adecuada para la unin al ribosoma y despus la hidrlisis
del GTP no slo proporciona la energa necesaria para el movimiento, adems cambia
la conformacin de la protena permitindole abandonar el ribosoma.
Los ribosomas no pueden unirse simultneamente al FE-Tu, y al FE-G, por lo que
la sntesis de protenas sigue un ciclo en el cual estos factores son alternativamente
unidos a, o liberados de, los ribosomas.
Este ciclo de elongacin se repite tantas veces como aminocidos sean necesario
incorporar a las protenas, por lo cual constituye el perodo de mayor duracin de todo
el proceso.

Terminacin
La terminacin de la sntesis de protenas implica un fenmeno poco frecncntc.
pues se trata de la interaccin de un codon directamente con una protena.
Se han caracterizado 3 proteinas que intervienen en la terminacin y sedenomi-
nan factores de liberacin FL. El FL-1 reconoce los codones UAA y UAG, en tanto
FL-2, los UGA y UAA y requiere que el peptidd-ARNt se encuentre en el sitio P. Parece
ser que los factores de liberacin realizan su accin en el sitio A, ya que algunos ARNt
mutantes capaces de reconocer codones de terminacin compiten con ellos por entrar
al ribosoma. El FL-3 estimula la accin de los 2 restantes.
La actividad de los factores de liberacin implica la separacin de la cadena
polipeptdica neoformada y al desensamblaje de todo el aparato biosintetizador
(Fig. 30.8).

lhduccin en eucariontes
La traduccin en eucariontes, como ha sido estudiada en reticnlocitosde conejos,
sigue en heas generales elmismo procedimiento queen los organiFmosprocariontes.No
obstante, en cada paso se destacan diferencias especficas que vienen dadas principal-
mente por 3factoresfundamentales:

1.Los ribosomas eucariontesson ms grandes y complejosque los procariontes.


2. Los ARNm deeucariontes son casi siempremonocistrnicos,codificanparauna sola
cadena polipeptdica.
3. En el proceso intervieneun nmero mucho mayor de protenas no hbosomales.

Estos elementoshacen n e d o detenerse en cada etapa para resaltar las principales


diferencias, ya que no se cuenta an con datos completos como en el caso de los
prucariontes.
La iniciacin es la etapa quepresentamayoresdifemncias.Se handescrito ms de 15
pmtenas noribo~malesqueparticipanenlainiciacin. Pamsignlcarsuorigeneucarionte
se escribe la letra "e'' delantedel smbolo del factor.
Enla formacin delpooldesubunidades de 40 S intervienenel eF'I-3 quese uneaeua
y el eFI-6 que se une ala de 60 S, y tienen en ambos casasunefecto antiasociante. El eFI-
2:GTP forma un complejo temario con el met-ARNt, (los eucariontes no utilizan
formilmetionina)que despusse incorporaal ribosoma antesde la entrada del ARNm,por
lo cualsu ubicacin no depende de unainteraccin codon-anticodon. El e n - 3 participa
Fig. 30.8. Tcrniinacin. Al aparecer cn el
sitio A el codo" de termiiiaeiii, el
factor de liberaiiiin interacriens
directamente ion el ARNm y dc-
termina no slo la separacin de la
prateiiia neoformada, sino adenis.
la dcrurganiraribn de todo el sis-
tema sintetirador.

en la incorporacindel ARNm despus que ha sido ubicado el met-ARNt,,por un meca-


nismo diferente a como ocurre en procariontes. El ARNm se une al rihosoma por su
extremo 5' donde existe la estmctura del casquete al cual previamente se ha unido una
protena especfica.La subunidad40 S semueve entoncesalolargo del ARNm, utilizan-
do la energa de bidrlisis del ATP hasta encontrar el primer codon de iniciacin que
siemprees el AUG. El eFI-3contribuye a esta unin al desestahikar la estructura secun-
d d a d e l ARNm que impidesu unin al ribosoma. Cuando se produce launin del codon
deiniciacin con el anticodondelmet-ARy,el ribosoma deja demoversey entonces por
la accin del eFI- 5 se produce la incorporacin de la subunidad 60 S impulsada por la
hidrKidel GTP.
Los eFI-2, eFI-3 y eFI-5 son imprescindibles para ia formacin del complejo de
iniciacinde80 S, los demsfactores conocidos, en-1,eFI-4A,eFI-4B,eFI-4C,eFI-4D y
eFi-4Finteractuandocon los primeros mejoran grandementela eficiencia del proceso.
Los factores Co-eFI-2A,Co-eFI-2By Co-eFI-2Ccontrolan la formacin del complejo
t e d o e F I - 2 I GTP 1 met-ARN$
Mencin especial merece el eFI-2, ste ha sidopurificado a partir de mltiples orga-
nismos y en diferenteslaboratorios,presentaun peso molecular de alrededor de 145kD;
se trata de una protena polimrica formadapor 3 subunidades diferenies,la a con peso de
35 a 38 kD; la P, de 52 a 56 kD, y la y, de 48 a 52 kD. La subunidad u liga GTP con baja
afidad,pero GDP con a f i d a d muy elevada y puede ser fosforilada por una protena
quinasa independiente de AMPc que es estimulada por la deficiencia de p p o s hemos en
el reticulocito, los ARN de doble hebra y el interfern,conlo cual se inactivael factor y se
inhibela iniciacin. La P puede ser fosforiladaporla casena quinasa IIpero esta modifi-
cacin no altera su funcionamiento.La y no es fosforiladapor ninguna de las quinasas
anteriores y es la que se une al met-ARNt,.

Componentes celuiares y Gentica molecuiar 531


Como la afinidad del eFI-2 es mayor para el GDP (que favorecela conformacin
inactiva) que para el GTP (que favorece La activa), es necesaria la participacin deotra
protena denominada eFI-2A para realizar el intercambio GDPIGTP, pero su mecanis-
mo es desconocido.
Las fases de la elongacin son iguales a las descritas para los procariontes. La
incorporacin de los aminoacil-ARNt se lleva a cabo con la formacin previa de un
complejo ternario aminoacil-ARNt:GTP:eFE-la que, al posicionarse en el ribosoma,
provoca la hidrlisis del GTP y libera el complejo binario eFE-1a:GDPque se activa
con la participacin del eFE-lb; estos 2 factores, adems de eFE-ly de funcin desco-
nocida,suelen agruparse formando un complejode elevado peso molecular quese ha
denominado eFE-1.
La incorporacin del aminoacil-ARNtva seguida de la formacindel enlace peptidim.
La translocacin se produce por la participacin de eFE-2 una protena de 100 kD que
unida al GTPse asocia al ribosoma y provocasu desplazamiento. Es interesante que este
factor seamodificadopor la toxina diftrica que transfiereel grupo ADP-ribosadelNAD'
a un resto de histidina modificado de la protena, con lo cual se producen su inactivacin
y la inhibicin de la elongacin. Se ha descrito la existencia de un eFE-3, que es una
protenade 125kD conactividadesde GTPasa y ATPasa quesonimpreseindibles parala
elongacin, pero su funcin especfica no se ha determinado.
En eucariontes existe una sola protena que acta como factor de liberacin (eFL)
que est compuesta por 2 subunidadrq idnticas de 55 kD. Para unirse al sitio A donde
aparece el codon de terminacin forma un complejo con el GTP, cuya hidrlisis parece
ser el ltimoevento dela terminacin, necesario para ladisociacin de todo el sistema
sintetizador de protenas.

Posterminacin
La cadena polipeptdica formada en el ribosoma suele experimentar modificacio-
nes que pueden producirse simultnea a s u formacin (modificaciones
cotraduccionales), o una vez que ha sido liberada del ribosoma (modificaciones
postraduccionales), que dan lugar a la forma definitiva y funcional de la protena.
En los procariontes el grupo formilo de laformilmetionina es eliminado antes de
terminar la traduccin por la accin de una desformilasa especfica, y en ocasiones,
tanto en procariontes como en eucariontes, enzimas del tipo de las aminopeptidasas
catalizan la separacin de varios aminocidos a partir del extremo N terminal. La
eliminacin de los aminocidos parece estar influida por los aminocidos que ocupan
las posiciones siguientes: la metionina permanecer como primer aminocido, si el
aminocido que ocupa el segundo lugar es arginina, asparagina, cido asprtico
glutmico, isoleucina o lisina; mientras que ser separada si los aminocidos que
ocupan el segundo lugar las alanina, glicina, prolina, treonina o valina. Frecuentemen-
te el grupo aminoterminal as formado es acetilado por accin de transacetilasas.
Algunas cadenas laterales de los aminocidos son modificadas, por ejemplo, du-
rante la sntesis del colgeno se produce la hidroxilacin delos restos de prolina y de
lisina; tambinsonesterificadosgruposfosfatos arestos de serina, tirosina y triptfano
de numerosas protenas.
Los gmpos prostticos son aadidos a las protenas como el hemo de la hemoglo-
bina y como los cofactores que se unen de forma covalente a la enzima como la biotina,
el FAD, etctera.
Un evento postraduccional importante es la formacin de los puentes disulfuro
entre 2 cistenas que contribuyen a la estructura tridimensional de muchas protenas.
La cadena protenica puede ser bidrolizada en diferentes puntos como sucede con
los zimgenos del tubo digestivo, como el pepsingeno, el tripsingeno, etctera, que
parecen ser formas de almacenamiento de la enzima y que slo alcanzan su estado
funcional en el momento de su accin.
La proinsulina es hidrolizada con la liberacin de un segmento polipeptdico
denominado pptido C que se encuentra en el centro de la molcula, haciendo que la
forma funcional de la hormona est formada por 2 cadenas polipeptdicas, cuando se
ha sintetizado como una cadena polipeptdica nica. En la hipfisis se forma una
protena que es procesada mediante protelisis parcial especfica y que puede dar
lugar a varias hormonas de acuerdo con la posicin de los enlaces peptdicos que son
hidrolizados.
El ensamblaje de las protenas formadas por subunidades tambin se produce
despus de la traduccin. Este ensamblaje parece ser ms sencillo en procariontes,
donde en muchos casos todas lassubunidades de una arotena multimrica se forman
a partir de un solo ARNm policistrnico y, por lo tanto, se traducen de manera simult-
nea; en los eucariontes cada subunidad se forma a partir de ARNm diferentes.

Distribucin de protenas
En los organismos eucariontes tiene una significacin especial el proceso de
distribucin de las protenas. Todas las protenas se forman en los ribosomas pero
deben realizar sus funciones en diferentes compartimentos celulares y, en ocasiones
deben ser llevadas hacia el exterior de las clulas. Las protenas que permanecen en el
citosol, as como las destinadas a las mitocondrias, los peroxisomas y el ncleo son
sintetizadas por ribosomas libres; las destinadas a otros compartimentos o hacia el
exterior se sintetizan en nbosomas unidos a las membranas del retculo endoplasmtico.
A manera de ilustracin se describir el trnsito de protenas a travs de los sistemas
membranosos de laclula, entre otras cosas por ser el mejor conocido.
Las proteinas que deben ser procesadas en el retculo endoplasmtico se forman
en un estado de preprotena, pues contienen hacia su extremo N terminal un pequeo
pptido de 22 a 30 aminocidos denominados pptido seal. Cuando este pptido ha
sido traducido es reconocido por un complejo nucleoprotenico conocido como part-
cula de reconocimientode la seal que est formada por un ARN de aproximadamente
300 nucletidos y 6 protenas de diferentes tamaos. Esta partcula acta tambin
sobre el ribosoma, bloquea la traduccin y posteriormente transporta los ribosomas
hacia las membranas del retculo, transfirindolosa una protena receptora quees parte
integral de la membrana. La unin del ribosomaa su receptor recluta haciaesazonaa
un grupo de protenas que se organizan en forma de canal denominado aparato
translocador, y hacia el cual es transferido el ribosoma. La unin del ribosoma al
aparato translocador se realiza de forma que el dominio de secrecin queda en contac-
to con la luz del canal, y al continuar la sntesis de la protena sta es descargada hacia
la luz del retculo (Fig. 30.9).
Formando parte del aparato translocador se han identificado al menos 4 protenas,
todas ellas con actividad enzimtica. La peptidasa seal separa el pptido seal del
resto de la cadena polipeptdica, en tanto la pptido seal hidrolasa produce la degra-
dacin hidroltica del pptidoseal hastasus aminocidos constiiuyentes. Las 2 enzimas
restantes actan sobre la cadena polipeptdica en crecimiento. La oligosacaril
transferasa cataliza la transferencia de oligosacridos hacia residuos especficos de
serina o asparagina, en tanto, la tiol disulfuro isomerasa cataliza la formacin de los
enlaces disulfuros y contribuye a la formacin de la estructura tridimensional de las
proteinas.
Las protenas que pasan a la luz del retculo contienen pequeas secuencias
aminoacdicas que indican su destino. La presencia hacia el extremo C terminal de la
secuencia KDEL determina que la protena permanezca en el retculo, en tanto la seal
KxKx KKxx u otras con 2 lisinas dirigen las protenas hacia el aparato de Golgi. La
presencia de manosa-6-P en el extremo de los oligosacridos orienta las protenas
hacia los ribosomas. Se cree que existe otra seal para las protenas que forman grnu-

Componentes cslulans y aeddca molacuiir 533


En los eventos previos a la iniciacin tiene lugar la activacin de los aminocidos,
reaccin en la cual se libera AMP por lo que representa un gasto energticoequivalen-
te a 2 ATPpor cada aminocidoque es activado. En la iniciacin un GTPes hidrozado
cuando el formil metionil-ARNt se incorpora al sitio P. Durante la elongacin se re-
quiere un GTP para la incorporacin de cada aminoacil-ARNt y otro ms para la
translocacin. Como esta etapa tiene carcter repetitivo, representa el mayor gasto;
tambin en la terminacin se consume un GTP.
Para tener una idea real del gasto que el proceso representa se tomar como ejem-
plo la sntesis de la a-globina que como sesabe tiene 141 aminocidos. La activacin
de esos aminocidos representa un gasto total de 282 ATP. La iniciacin y la tennina-
cin consumen un GTP cada una. En la elongacin haran falta 2 GTP por cada
aminocido, por lo tanto el total sena otra vez de 282 ATP. En total seran 566 molcn-
las de ATPpor cada molcula de la w-globina.

Debido a las diferencias entre los componentes del sistema tradnccional en


procariontes y eucariontes, los inhibidores del proceso en un tipo de organismo,
suelen no serlo en el otro, aunque existen excepciones.
Los principales inhibidores de la traduccin son antibiticos que no slo han
tenido valor en el tratamiento de las enfermedades infecciosas, sino tambin en el
esclarecimientode muchos de los aspectos de mecanismos de la traduccin.
La puromicina permiti comprobar la existencia de los 2 sitios funcionales del
ribosoma. Este antibitico acta como un anlogo del aminoacil-ARNt (Fig. 30.101,
pero no del fmet-ARNt,lo cual demostr que uno y otro se ubican en sitios diferentes.
La adicin de puromicina a un sistema de sntesisde protenas provoca la terminacin
prematura de la cadena, originando pequeos pptidos de diferentes tamaos.

Fig. 30.10. Mecanismo de accin de la puromicina. Existe una gran similitud estructural entre la CHOH
puromicina y el aminoaeil-ARNt, por lo que el antibitico se une al sitio A del ribosoma e
impide la entrada del ARNt cargado, provocando la lerminacin abortiva de la sntesis de la
protena.

La estreptomicinase une a la protena S12 e impide la incorporacin del ARNti


cargado o causa errores de lectura del cdigo, si el proceso est en fase de elongacin. ~ i g 30.11.
. Inhibidores de la traduccin.
El cloranfenicolinhibe la peptidil transferasa. La eritromicinase une a la subunidad Los principales inhibfdores de la
S0 S e impide su reasociacin con el complejo de iniciacin de 30 S, pero no tiene traduccin son antibitieos, algu-
nos de ellos slo tienen accin so-
efecto sobre la elongacin (Fig. 30.11).
bre organismos procariontes (*),
otras solamenle sobre eueariontes
(**) y muy pocos sobre ambos.

Componentes celulares y 'Cicdticatn~kauiir 535


Resumen
La traduccin comtitnye La etapa cm& del proceso general de expresin de
la informacin gentica, pues en ella se producen las protenas cuyas funciones
espeeas determinan un organismo.
Este proceso tiene lugar en los ribosomas y se produee unidireecionalmente
del extremo N-terminal al C-terminalmiheal a la l e a del ARNm. Tiene d e -
ter gradual y repetitivo y est acoplada a la bidr6Lisis de NTP,para su realizacin
se requieren ms de 200 macromolculas espefiq. Para su inmrporacin a las
protehas los amino6ddos deben ser activados, lo cnaise logra con su unin a los
ARNt espeeos por enzimas denominadas aminoacil-ARNt-sintetasa
La iniciacin consiste en la formacin del eomplejo de iniciacin de 70 S, para
lo cual es necesario la separacin de las subunidades de los ribosomas y La unin
espeeca a la menor del ARNm y del fmet-ARNt,. En esta etapa son necesarias 3
protenas especas llamadas factores de iniciacin, tambin se requiere la ener-
ga de hiddsis del GTP.
La elongaan consiste en la incorporacin uno a uno de los aminoad-ARNt
determinados por los d o n e s que aparecen sucesivamente en el ARNm y para lo
cnai se requieren de los factores de elongacin y de la bidr6sis del GTP.
Durante la terminacin almuias nrotenas e s n ~ e aconocidass como fadores
el
de liberacin interacian eon d o n de te&cin y no 8610 determinen el 5nal
de La sntesis, sino tambin el desensamblaje del sistema bioaiiatom. En muchas
d o n e s las protenas son modicadas durante o con pterioridad a la traduc-
cin hasta ser totalmente funcionales.
La traduccin en eucariontes es similar en ineas generaies a como ocnrre en
p d o n t e s , p e r o existen diferencias sobre todo en el nmero mayor de protenas
no ribosomales que el pmceso requiere.
Existen numemBos antibitieos cuyo mecanismo de a d n consiste en inhibir
alguna de las fases de la traduccin, pero estos antibitieos han contribuido consi-
derablemente al conocimiento del proceso.

Ejercicios
1.Demuestre que en el proceso de la traduccin se cumplen los siguientes principios:
a) De los cambios graduales.
b) De acoplamiento.
c) De interrelacin.
d) De transferencia de informacin.
2. Por qu en los experimentos de Nirembergy otms (captulo 28) se podan utilizar,
como ARNm, polinucletidos que no contenan el codon AUG para la iniciacin?
3. Qu significado tiene en cuanto a la fidelidad de copia de la traduccin las
propiedades de las enzimas aminoacil-ARNt-sintetasa?
4. La enzima nuclesido-difosfato-quinasacataliza la reaccin:

ATP + GDP = ADP + GTP

por qu cree usted que la inhibicin de esta enzima provoca una inhibicin de la
traduccin?
La recombinacin gentica es uno de los procesos ms importantes en que partici-
pa el ADN celular, durante su transcurso se produce el intercambio de grandes segmen-
tos de ADN entre 2 molculas. Sin el oroceso de la recombinacin. los cromosomas
fueran una combinacin fija de alelos particulares sujetos nicamente a los cambios
mutacionales; el lugar de los daos provocados por las mutaciones se agrandara en
muchas veces, pues pasara del gen al cromosoma; las mutaciones dainas se iran
acumulando hasta anular funcionalmente al cromosoma. Al intercambiar los genes de
uncromosoma a otro la recombinacin permite la separacin de lasmutaciones dai-
nas de las beneficiosas. haciendo nosible la eliminacin de las orimeras v la conserva-
cin de las segundas. Desde el punto de vista de la evolucin, un cromosoma viene a
ser algoascomo "un ave de paso", una asociacin temporalde aielos, cuya existencia
particular en los grandes perodos evolutivos sera e h e r a .
Exisen numerosas formas de recombinacin gentica, teniendo en cuentael modo
en que se produce el intercambio de los bloques de ADN y de acuerdo con el tipo de
organismo donde se produce. El mecanismo es complejo y no est totalmente escla-
recidoni enlos organismos mssimples, a pesar del extraordinarioavance logrado en
su comprensin durante los ltimos aos.
En este captulo se discutirn brevemente los conocimientos actuales sobre los
mecanismos moleculares de la recombinacin gentica, tomando como referencia el
sistema mejor conocido que es el de la E. coli, algunas evidencias experimentales
sobreel procesoen eucariontes, la funcin de la recombinacin en la evolucin de los
seres vivos y por ltimo, se pondr de manifiesto la aplicacin de muchos de los
conceptos relacionados con el estudio de la gentica humana, sobre todo en el campo
de la medicina.

Historia del problema


A pesar de que el gen como unidad del fenmeno hereditario fue descubierto por
GregorMendel, quien adems estableci las leyes que rigen su segregacin, a media-
dos del siglo XIX, esto qued casi olvidado hasta principios del siglo XX cuando
prcticamente las leyes de Mendelfueron "redescubiertas". Es a partir de ese momento
que comienza el desarrollo de la gentica. Entre los aos 1910 y 1925 Thomas Hunt
Morgan y suscolaboradores llevaron a cabo extensos estudios sobre la gentica de la
mosca del vinagre Drosophila melanogaster; mediante cuidadosas observaciones vi-
suales detectaron ms de 100 anormalidades fisicas, debidas a mutaciones en los genes
oue se exoresaban en variaciones en el color de los oios.
" . la forma de las alas, las
antenas, etctera. Morgan determin que estos caracteres se segregaban en 4 grupos
que se correspondan con el nmero de cromosomas de la DrosophiIa, introduciendo
el concepto de ligamiento para aquellos genes que por estar ubicados en el mismo
cromosoma con frecuencia se segregan unidos. Sin embargo, en algunos casos se
observaba que los descendientes se apartaban del patrn de ligamiento, esto quiere
decir que aparecan caracteres mezclados; a este fenmeno se le dio el nombre de
recombinacin.
El proceso de la recombinacin pudo ser observado durante el estudio microsc-
pico de la meiosis de las clulas germinales, donde los cromosomas homlogos se
disponen uno al lado del otro en una estructura denominada sinapsis, y luego se
observa la fusin de stos en determinados puntos denominados qniasmas.
Las experiencias de transformacin del neumococo realizada por Fred Griffiths,
en 1928, constituyen tambin un proceso de recombinacin gentica, aunque en
aquel momento no se conoca.
Desde entonces el fenmeno de la recombinacin fue observado cada vez con
ms frecuencia en los estudios experimentales y se obtuvieron numerosos datos acer-
ca de l, tanto cualitativos como cuantitativos, que permitieron la construccin de
mapas genticos basados en la frecuencia de recombinacin. Sin embargo el mecanis-
mo inolecular continuaba siendo un misterio.
Un paso significativo fne dado en este sentido cuando en 1964 Rohin HolIida';
a partir de la interpretacin de numerosos resultados experimentales, propuso un
modelo que satisfaca todos los requerimientos y en el cual desempeaba una funcin
iiiiportaiite mi intermediario en el que 2 cromosomas recombinantes se mantenan
unidos de forma co\ alente. en una regin determinada por una conexin entrecruzada
formada por el intercambio recproco de2 de las 4cadenas de las 2 molculas de ADN
que participan en el proceso. Esta estructura se conoce hoy como el intermediario de
Hollidaq.
Este intermediario tuvo una comprobacin fsica en 1970, cuando pudo rer
visoalizado por microscopia electrnica. En los ltimos aos estudios con extractos
de la E. coli y con productos gnicos purificados, que estaban involucrados en la
recombinacin, han profundizado el conocimiento del proceso al nivel enzimtico.
Al estudio de la recombinacin a este nivel est dedicado el contenido de este captu-
lo.

Tipos de recombinacin gentica


La recombiiiacin se expresa en fenmenos diferentes entre los microorganismos
que son generalmente Iiaploides y los orgaiiismos diploides. En los haploides siem-
pre se requiere de la existencia de una molcula de ADN extraa o de un segmento de
ellaquese traslada de un lugar aotro. En los diploides el intercambiopuedeproducir-
se entre 2 molculas que se encuentran en cromosomas homlogos.
En el proceso de transformacin una molcula de ADN que aparece en el medio,
por haber sido liberada por otra bacteria, es captada e incorporada al cromosoma
bacteriano, determinando la aparicin de caracteres nuevos en la bacteria receptora,
como sucedi en el experimento de Griffiths. Por su parte la transdnccin necesita de
un virus como vector, el cual asimila un segmento de ADN de una clula infectada y
lo transfiere a otra que lo incorpora a su genoma. Por ltimo, la conjugacin se
produce por el traspaso directo entre bacterias de pequeas molculas de ADN circu-
lares llamados plsmidos. En todos estos casos se requiere la existencia de grandes
zonas de secuencias homlogas entre el ADN donante y el aceptor, las secuencias
deben ser idnticas o casi idnticas. Debido a este requerimiento estos procesos perte-
necen al tipo llamado recombinacin homloga o general.
Un segundo tipo se presenta cuando un virus infecta una bacteria y el ADN viral
experimenta un proceso de integracin al ADN bacteriano, donde no existe homologa
entre la secuencia donante y la aceptara, sino que se produce por la presencia de
secuencias especficas que permiten que enzimas determinadas las reconozcan, cor-
ten y empaten con el ADN viral, este tipo recibe el nombre de recombinacin por sitio
especfico.
En la transposicin un segmento de ADN m i g a de una parte a otra de la molcula
o de un cromosoma a otro en los organismos diploides, sin que se requiera la existen-
cia de secuencias homlogas.
En ocasiones se emplea el trmino de recombinacin ilegtima para aquellos
casos que no se ajustan a ninguno de los sealados, cuyos mecanismo y requerimien-
tos son desconocidos.
En lo que se refiere a organismos superiores se suele hablar de recombinacin
sexual para designar aqulla que se produce en las clulas sexuales, y recombinacin
somtica cuando ocurre en el resto de las clulas.

Modelo de HoWday
En la figura 31.1 aparece representado el modelode Holliday, ste comprende 2
grandes etapas: la iniciacin y la maduracin.

Dos dobles hlices homlogas se alnean una al lado de la otra (apareamiento) (A)y
cada una de las banda$ es cortada mediante enzima5en unlugar especfico(B),secrea mi
extremo Libre que abandona la hebracomplementaria a la cual estaba unida por puentes
de hidrgeno, se asocia con la cadena complementaria de la otra molcula (invasin de
hebra) (C D) y se estableceuna ioteraccin fisicaentm las 2 molculas a recombinar. Esta
estructura puede estabilizane por la accin de la ADN ligasa que forma los enlaces
fosfodister correspondientesen cada hebra (E).La hebra invasorapuede ir estableciendo
cada vez un mayor nmero de puentes de hidrgenos con la molcula invadida, despla-
zando a la cadena original (migracin de hebra) (F). La estructura as formada recibe el
nombmde intermediario de Holliday.
Este intermediario no es esttico y su posicin puede ir variando en un sentido o en
otro por el mecanismo demigracin,~puede rotar sobresu eje cilndrico (isomerizaun)
(G,H)adquiriendo una nueva forma.
Laconstruccin demodelosespacialesha probado, sorpresivamente,que no existen
impedimentos estricos para la existenciade esaestructura y quecasi todas las basesse
encuentran apareadas.
La migracin de la hebra puede dar lugar a la formacin de zonas heterlogas de
ADN,segmentos donde el apareamiento delas bases est alteradocon la formacin de
reas que son genticamente heterocigticas; ste es uno de los hechos que ms ha
apoyado el modelo de Holliday.
Estudios tericos y prcticos han llevado a la conclusin que la velocidad de
migracin es lo suficientemente elevada como para permitir la formacin de zonas
hbridas en condiciones fisiolgicas.
Dada la simetra de la estructura, la maduracin puede ocurrir de 2 forma$,dando
lugar a 2 pares de cromosomas recombinantes.
La ruptura de arriba abajo o de izquierda a derecha (1) libera molculas de ADN de
igual tamao en las cuales pueden existir regiones heterocigticas, y que los genes que
estn en los flancos pueden mantenerse en su posicin original o con igual probabili-
dad pudo haberse realizado una recombinacin recproca (J,K).
Este modelo es muy atractivo como mecanismo general de la recombinacin
porque puede dar cuenta de las propiedades genticas de cromosomas recombinantes
Fig. 31.1. El modelo general de Hoilidag.
El modelo de recombinacin pro-
puesto por Hollidag plantea que 2
nioleiilas de ADN se aparean Val
?seproduieun~orteencadauna
de las bandas (b). Los extremos
libres invadcn la molcula contra-
ria le y dl, formando piicntcs de
hidrgeno can la cadena comple-
mentaria. La ADN ligasa sella la
brecha (el y se produce la inigra-
eiii de la hebra (fl, dando el in-
termediario de Holliday. Obsrve-
se que en este momento existe una
zona formada por 4 cadenas de
ADN enrollada una sebrc otra. La
isomerizariii por rotacin (g g h)
el corte posterior en uii sentido
\ci.tieal u horizontal (il daii lugar
a 2 molculas recombinadas ikl.
La zona heter6luga o heterorig-
tiea se observa cuando en iin sce-
tor de la molcula, una de las ca-
denas aparece en rojo y la otra en
azul.
que se producen en las formasms complejas deintercambio de genes que se conoce,
la meiosis de los eucariontes.
Dos hechos importantes conviene recordar:

1. La recombinacin ocurre con la conservacin netadel material gentico, por cada


2 cromosomas que entran al proceso salen 2 cromosomas.
2. Los cromosomas recombinantes se producen en pares recprocos, no en general
entre la poblacin, sino durante eventos individuales de entrecruzamiento.

Comprobacin del modelo


Aunque el modelo de Holliday fue propuesto sobre la base de estudios genticos
en eucariontes, su confirmacin se realiz por estudios en procariontes, especialmente
en la E. coli.
El genoma de la E. coliest constituido por una gran molcula circular de ADN y
que en el citoplasma bacteriano se encuentran molculas independientes de ADN
tambin circulares, pero de mucho menor tamao que reciben el nombre de plsmidos.
Si ocurriera la recombinacin entre 2 molculas circulares de ADN debe formarse
una estructura semejante al nmero 8, como se muestra en la figura 31.2 o una molcu-
la doble, dimrica, de acuerdocon el momento en quese observe la estructura.
Este tipo de estructuras en forma de 8 fue observado en el microscopioelectrhico
a partir de plsmidos extrados de la E. coli.
Aunque la existencia de la estructura en 8 puede considerarse como una evidencia
del mecanismo propuesto, no es suficiente para demostrarlo, pues se pueden obtener
estructuras similares por la existencia de 2 crculos concatenados o por 1 solo crculo
que se ha torcido sobre si mismo dando lugar a esta imagen. Para eliminar esas posibi-
lidades los extractos fueron tratados con una enzima de restriccin que provocaba 1
solo corte en cada una de las molculas; si se tratara de alguno de los casos menciona-
das deba obtenerse 1 2 molculas lineales de ADN segn el caso; si fuera el interme-
diario de Holliday lo que se est visualizando, el resultado sera una estructura de
forma similar a la letra griega chi (x)con 2 pares de brazos de igual longitud. Esta fue
la estructura visualizada (Fig. 31.3), con lo cual qued demostrada la existencia del
intermediario de Holliday.

Fig. 31.2. Recombinacin de molculas rir-


culares. Cuando las 2 molculas
recomhinantes san circularesexiste
una estructura intermedia que re-
cuerda la figura del nmero 8.

Fig. 31.3. Molculas circulares recombina-


das. Cuando las molculas circu-
lares recombinadas re tratan can
una enzima de restriccin, que
haga slo un corte en cada una de
las molculas, se origina una figu-
ra similar a la letra griega ehi.

Componentes celulares y Genetica molecular 541


Formaa6n del intermediario de Holliday
Existen 3 modelos fundamentales propuestos para explicar la formacin del inter-
mediario de Holliday, con el propsito de ajustar el mecanismo propuesto a los datos
experimentalessobre todo en cuanto al grado de heterologq del ADN recombinado.
El modelo descrito en la figura 31.1 supone que cada una de las molculasde ADN
una vez apareadas son cortadas mediante enzimas en un sitio especfico. La hebra que
posee el extremo libre invade la otra molcula en zonas de secuencias homlogas y
posteriormente el mecanismo de migracin aumenta la zona de ADN heterlogo. La
brecha existente es sellada por la accin de la ADN ligasa; de esta forma la zona
heterloga es similar en ambas molculas.
Un mecanismo alternativo (Fig. 31.4) plantea que el corte se produce en una sola
hebra de una de las 2 molculas (Fig. 31.3) y sta invade la otra molcula en zonas
homlogas. Se produce entonces la migracin de la hebra mientras que la ADN
polimerasa 1va llenando el espacio que queda en la otra molcula. En algn momento
posterior se produce la invasin de la otra molcula y con ello aparece el intermediario
de Holliday cuando Las bandas son selladaspor la ligasa. En este caso las zonas heterlo-
gas son de tamao diferente.

Fig. 31.4. Modelo de alternativo de reeombinacin. En este modelo una de las cadenas invade a la
otra (a, b y e ) y la hebra que
~ ~ - queda
- desapareada es rellenada por la ADN polimerasa 1 (c, d
. .
ve). Desous es aue se oraducc la invasin de la hebra contraria (0.Y el .
vroceso sigue
- izual
.
al modelo ya descdto. Obsrvese que en este casa la zona heterloga es diferente en cado
una de las moleulw recombinadas.

Un tercer modelo se muestra en la figura 31.5, segn el cual se produce cierto


grado de desnaturalizacin del ADN en las cadenas apareadas, lo cual posibilita la
invasin recproca de las bandas si existen secuencias homlogas. Se producela mi-
gracin en los 2 sentidos, para lo cual es necesario la participacin de la topoisomerasa
1, originndose 2 zonas de entrecruzamiento que por 1solo corte dan lugar al inter-
mediario de Holliday. Aqulas zonas heterlogas son iguales en tamao.

Por estudios con bacterias mutantes se han podido identificar 12 genes


involucradosen el proceso de la recombinacin, que son principalmente de las fami-
Fig. 31.5. Modelo de recombinacin sin corte. Una desnaturalizacin local permite la invasin
reeiproea de las 2 molleulas (b), que +,a aumentando en longitud (e y d). El paso de
isomerizacin por rotacin (e y 0 y el corte (g) dan lugar al intermediaria de Holliday (h)
que se madura y da 2 molculas recombinadas, cuyas zonas heterlogas son de igual
longitud.

lias rec y ruv. Adems, estn los relacionados con las protenas que participan en el
metabolismo general del ADN, como la ADN polimerasa 1, la ADN ligasa, las SSB y las
topokomerasas 1y 11.
No todos los genes de la familia rec han podido ser caracterizados con igual
profundidad,lo cual supone que el proceso no est completamente esclarecido. Sin
embargo, el conocimiento actual permite una buena aproximacin al mecanismo
molecular del proceso.
Estudios experimentaleshan demostrado que mutaciones en el gen recA pueden
reducir hasta 1000 veces la recombmacin gentica. La pmteia RecA es un polipptido
de 40 kD cuya sntesis se incrementa notablemente en situaciones que afectan de
forma negativa el metabolismo del ADN (luz ultravioleta,cido nalidxico, bleomicina
o mitomicina C), haciendo que pase de su nivel normal de unas 2 000 molculas por
clula a 50 000 aproximadamente,o sea, el 6% del total de las protenas celulares.
La primera actividad enzimtica conocida de RecA fue su accin proteoltica,
cuyo significado se aclara en el captulo 33 y que no est relacionada con la
recombinacin.
.
Con nostenondad se demostr aue la interaccin con ADN de cadena simple
~~ ~

(DNs) dcsarn,llaba en ella una fuerteactividad de adellusintrifosf3tax~ cA'rPsa) !.le


permita catiilizar la ;isUiiilaiii,n de esa hehra a una moliriila de :\DNde d d ~ l hebra
e
(ADNd), donde existieran zonas de secuencias homlogas.
En experimentosde recombinacin la cantidad de RecA nec-ana es directamente
proporcional a la cantidad de ADNs en el sistema en forma estequiomtrica; un
monmero de 40 kD es necesario por cada 3 bases de ADNs. La RecA puede unirse
tanto al ADNs como al ADNd,pero de forma diferentey compleja. Su unin al ADNs es
ms simpley no requiere ATPpues si se aade,ste es hidrolizado rpidamente y RecA
seune y se separa alternativamentedel ADNs. En contraste,en condiciones isiolgicas,

Componentes celulares y Gentica molecular 543


la unin de RecA al ADNd requiere ATP y es unas 100 veces ms lenta que su unin al
ADNs. El sitio de unin del ADNs y el ADNd es el mismo o son tan prximos que
llegan a superponerse.
El producto de recB es un polipptido de 140 kD que se asocia al producto de
recC, un polipptido de 128 kD y al de recD de 58 kD, formando una protena
multimrica conocida como RecBCD. Mutaciones en estos genes disminuyen la
recombinacin al nivel del 1% del tipo silvestre, muy importante aunque menos que
recA. Tiene una potente actividad de exo y endonucleasa. Lo ms sobresaliente es una
actividad de endonucleasa de sitio especfico comola enzimade restriccin que reco-
noce la secuencia 5'-GCTGGTGG-3', conocida como motivo chi (x).La enzima corta
el ADN en el cuarto o sexto nucletido despus de 3'. Los productos de los dems
genes de la familia rec son menos conocidos, aunque se sabe que RecF es una protena
de unin al ADNs, R e d es una exonucleasa para ADNs y RecQ es una helicasa.
La otra familia gnica implicada es NV. RuvAes una protena de 22 kD que forma
tetrmeros los cuales sc unen al ADN que presente forma de X. RuvB es una dbil
ATPasade 34 kD que se une al complejo ADN RuvA, y RuvC que slo tiene 19 kD es
capaz de resolver los intermediarios de Holliday por rupturas endonucleolticas.
Cuando RecBCD se incuba con ADNd, ATPy ADNs su actividad de nucleasa se
suprime y acha desenrollando el ADNd, como una helicasa, exponiendo ADNs que es
cubierto por las SSB. Se ha propuesto un modelo a partir de los estudios cinticos de la
enzima. En condiciones fisiolgicas un extremo de RecBCD se une al ADNd y co-
mienza a desenrrollarlo a una velocidad de300 nucletidos por segundo. La cadena
formada es liberada en el otro extremo a una velocidad de 200 nucletidos por segun-
do. La diferencia de velocidades origina un asa de ADNs, que va creciendo a medida
que la enzima se desplaza sobre el ADNd. Estas bandas simples interaccionan con las
SSB que las cubren totalmente, apareciendo cadenas simples que pueden servir de
sustrato a RecA para comenzar la recombinacin. Cuandoaparece el motivo chi (v)
corta la hebra y genera el extremo libre necesario para la accin de RecA, que se
polimeriza en forma helicoidal alrededor del ADNs y forma un surco donde se puede
alojar,tanto el ADNs como el ADNd, por lo cual sesupone que un ADN trifibrilar acha
como intermediario de la recombinacin.
Una vez formado el complejo ADNs:ADNd:RecA se produce la asociacin entre
las 2 hebras si existe homologa de secuencia, de no ser asse produce la hidrlisis del
ATP y la separacin del complejo que vuelve a unirse en otro sitio hasta formarse un
apareamiento estable (Fig. 31.6).

invasora.

La homologa que se requiere no es absoluta de lo contrario, las zonas heterlogas


nose formaran. En pmebasrealizadasse hademostrado queel ADN con una homologa
de1 90% pueden ser recombinado, en tanto otros con un 70% no puede recombinarse;
el lmite de mxima tolerancia no es conocido an. En este primer paso se produce el
apareamiento de 300 a 500 pares de bases, despus el ATPes bidrolizado y el complejo
se disocia. Para la migracin es necesario la accin reiterada de RecA que se asocia y
disocia bidrolizando ATPen cada ciclo.
En esta primera etapa intervienen las SSB, aun cuando RecA puede hacer todo el
proceso hasta la formacin del intermediario de Holliday, este evento mejora ex-
traordinariamente su eficiencia si al sistemase aade SSB, con lo cual se requiere de
menos cantidad de protena RecA y de hidrlisis de ATPpara lograr un grado igual de
recombinacin en relacin con preparaciones que no contienen SSB.
Mientras la hebra invasora no se encuentre unida de forma covalente con la ADN
ligasa, no se presentar ningn problema topolgico, pues existe un extremo libre que
permite la relajacin de las tensiones que se van creando a medida que la migracin
avanza. Pero una vez quela brecha hasido selladaaparecern los problemas topolgicos
que pueden ser resueltos con la participacin de la topoisomerasa 1, que por ruptura y
formacin de enlaces fosfodister permite aliviar las tensiones en forma similar a como
ocurre en la replicacin.
La enzimologa de la maduracin es menos conocida. El descubrimiento de las
enzimas codificadas por los genes de la familia ruv ha comenzado a esclarecer esta
etapa final del proceso de recombinacin.Sin embargo, an queda mucho por aclarar.
Se espera que los modernos mtodos de anlisis genticos permitirn que en los prxi-
mos aos todos los mecanismos implicados en el proceso de recombinacin gentica
queden totalmente aclarados.

Signicado biolgico de la recomb'iaun


La recombinacin gentica es un fenmeno fundamental en los seres vivos, pues
constituye uno de los principales mecanismos de intercambio de informacin gentica
entre ellos. El hecho de que un organismo pueda captar e incorporar a su genoma
segmentosextensos de ADN provenientes de otras fuentes, como sucede en la transfor-
macin, constiiuye un factor trascendente en la evolucin delos seres vivos, pues ello
le permite la adquisicin de nuevos caracteres que pueden representar una ventaja
selectiva. Lo mismo sucede con la transduccin cuya diferencia esencial consiste en
que el material genticoes transportado de una clula a otra por la accin de un virus.
El virus de laimnunodeficienua humana productor del sndrome deinmunodeficiencia
adquirida (SIDA) cuando penetra en las clulas del sistema linfoide forma un ADN que
con posterioridad se integra al genoma celular mediante un mecanismo de
recombinacin por sitio especfico.
En organismos con reproduccin sexual la recombinacin gentica representa el
mecanismofundamental -aparte de la mutacin- para la creacin de nuevos genotipos
por una redistribucin de los genes parentales, lo cual en muchos casos puede originar
genotipos ventajosos que representaran una mejora en la adaptacin al medio au-
mentando la supervivencia y la reproduccin.
Pero la recombinacin puede representar tambin un mecanismo de defensa o
depuracin contra las mutaciones dainas y una forma de hacer perdurables las bene-
ficiosas. Si no existiera la recombinacin al producirse una mutacin daina, sobre un Fig. 31.7. Separacin de genes mutados.
En uno de los 2 cromosomas
gen, comenzara un proceso irreversible sobre el cromosoma que la porta que conduci- homlogos ha ocurrido una mu-
ra inevitablemente a su desaparicin funcional. Una nueva mutacin agravara el tacin henefieiosa que se represen-
proceso y as sucesivamente. Los efectos de mutaciones beneficiosas seran opacados ta en rojo (a) SEmuestra el prace-
por los daos establecidos. Como ya se ha dicho la localizacin de un gen en un so de mutacin, pero ahora se tra-
ta de una daina representada en
cromosoma slo es temporal, pues al producirse la recombinacin ese gen puede tras- negro. El organismo que herede
ladarse a otro cromosoma y de esta forma 2 mutaciones dainas pueden ser fsicamente ese cromosoma heredar los 2
separadas, incluso una beneficiosa de otra daina como se muestra en la figura 31.7. genes mutantes; pera romo apare-
Durante la gametognesis en la divisin meitica ocurre la recombinacin de los ec en (b) un proceso de reeombi-
nacin separa las 2 mutaciones
cromosomas homlogos, con lo cual pueden aparecer gametos con genotipos diferen- durante la evolucin, los organis-
tes a los parentales. mos que adquieran la mutacin
Se ha planteado tambin la existencia de recombinacinentre lasclulas somtieas beneficiosa se pafirn adaptar me-
embrionarias, lo que ha permitido desarrollar toda una teora para explicar la forma- jor al ambiente sin llevar consigo
la mutacin daina.
cin de la gran diversidad de inmunoglobulinas por las clulas linfoides, como se
discute con mayor amplitud en el captulo 82.
En la mitosis de las clulas somticas se han observado entrecruzamientos de
cromtidessimilar a los de la meiosis, pero no ocurre recombinacin, pues en este caso
las cromtides que intercambian son hermanas y por lo tanto iguales.
En resumen, el proceso de recombinacin gentica es uno de los principales meca-
nismos que intervienen en la produccin de la gran variabilidad de los seres vivos,
hasta tal punto, que se puede afirmar que en una especie dada no existen 2 individuos
totalmente iguales.

Resumen
La reeombinaci6n gentica es uno de los procesos ms importantes en que
participa el ADN celular, durante &te se produce el intercambio de grandes blo-
ques entre 2 molculas de ADN. Existen diierentestipos de reeomb'ici6n de acner-
do con las caracterseas de la molcula donante v la m o t o r a La transformaci6u.
traasduM6n y coqjngaci6n pertenecen al grnpo denominado recombinaci6n gene-
ral u homloga; en tanto la transposia6n es de tipo heter61oga. Al nivel moleeular
la reeombiici6n consa de 2 eapas: la mieid6n, con la formacin del interme-
diario de Holliday, y la mad-6n.
Se ha planteado un modelo general para explicar el proceso en tnninos
enzimstim; &te comienza con la parapaci6n de la protena RecBCD que al
moverse sobre el ADN crea una zona desnaturalizada de varios cientos de bases
que se mantiene gracias a la intemenein de las protenas SSB. Una de estas cade-
nas invade a la otra molcula que participa en el pmceso.
En e& momento interviene la protena R e d que se une a la hebra invasora
formando un complejo ADN-ReeA, que explora la otra molcula hasta encontrar
una zona de homoloela en la secuencia de bases. oara lo cual orovoca la
desnahiralizeci6npare% de la moleula receptora. Al Gcontrar la zona hom6lnga
se produce el apareamientode bases entre la hebra invasora y la molcula recepto-
ra. A medida que el apareamientoprogresa se crean zonas de t e d n en la m o l h -
la que pueden ser eliminadas con la parcipaci6n de la topoiwmerasa L La rota-
cin de la molcula formada da lugar a la aparici6n del intermediariode Holliday.
La mptura del intermediarioproduce 2 nuevas molculas recombinadas, pero
de esta etapa es pow lo que se conoce y 5610 recientemente se ha encontrado una
enzima producida por el fago T4 que reeonoce esta estructura como sustrato.
La freeuencia en la reeombinaein de 2 o ms genes ha permitido la elabora-
d6n de mapas geneticm en varios organismos.
La remrnbinacin gentira es el principal mecanismo capaz de explicar la
gran diversidad de organismos que componen una especie, de ab su valor en el
pmceso evolutivo. Adems puede significar un mecanismo de pmteeei6n, pues
permite la separacin de las mutaciones dainas de las beneficiosas. Se espera que
en Ina pr6ximos aos se produz~annotables avances en nuestro conocimiento sobre
los mecanismos moledama de la reeombinaci6n gentica

Ejercicios
1.Qu significadotuvo en la historia del conocimiento de la recombinacin gentica
la aparicin del modelo de Holliday?
2. ;Segnelmodelode Holliday puedearmane que en todo procesade recombinacin
se obtienen siempre 2 molculas recombinadas?
3. Qu entiende usted por una molcula de ADN heterocigtica? ;Qu funcin
desempea en la recombinacin?
4. Cules son las principales analogas y diferenciasentre los modelos propuestos
para explicar la formacin del intermediario de Holliday? En cul de ellos es
imprescindiblela participacin de la topoisomerasa I?
S. Los organismos que carecen de la protena RecA realizan la recombinacin con
muy baja frecuencia Cmo explicara usted este fenmeno en esos organismos?
6. Por qu puede afirmarse que la recombinacin gentica ha desempeado una
importante funcin en el proceso evolutivo de los seres vivos?

Componenies celulares y Ckn6tica molecular 547


Los seres vivos se desarrollan en dependencia del medio y si bien de ste obtienen
todo lo necesario, tambin pueden experimentar daos debido a la presencia en su
ambiente de agentesfsicos y qumicos capacesde interactuar con las biomolcnlas y
provocar alteraciones en ellas. Esta situacin tambin puede originarse como resulta-
do de interacciones entre las propias sustancias componentes de los seres vivos en
condiciones especiales.
La actividad del hombre en ocasiones puede modificar de forma negativa las
caractersticas del medio, sea de forma accidental o deliberadamente, con el propsito
de hacer dao. La contaminacin ambiental es sin dudas uno de los grandes problemas
de nuestro tiempo que requiere del concurso internacional para su solucin defuiitiva.
En este captulo se estudiarn aquellos agentes que pueden alterar el material
gentico y por tanto, provocar la aparicin de variaciones fenotpicas en los indivi-
duos y en su descendencia.
Despus de aclarar los conceptos fundamentales y la terminologa que se debe
emplear, se estudiarn los mecanismos que originan las mutaciones,sns consecuencias
positivas y negativas analizadas desde diferentes puntos de vista, para terminar con el
anlisis de algunas situaciones relacionadas con la prctica mdica.
El anlisis de las mutaciones en procariontes permitir su estudio detallado y su
comparacinposterior con los encariontes, principalmente en el hombre.

Definiciones y nomenclatura
En este tema se emplea un conjunto de trminos que deben ser definidos antes de
comenzar el estudio de los contenidos.

Concepto de mutacin

Se denomina mutacin a toda alteracin permanente que se produce en el material


gentico, el ADN, y que se trasmite a los descendientes durante el ciclo replicativo.
Como ya fue visto en el captulo 25 y se analizar con ms detalle en el captulo 33, no
todas las alteraciones son trasmitidas a los descendientes, gracias a un sistema de
mantenimiento y reparacin del ADN. El organismo que se Origina como Consecuen-
cia de una mutacin y que difiere del organismo original recibe el nombre de mutante.
El agente capaz de provocar la aparicin de una mutacin se denomina agente
mutagnico o mutgeno, el cual puede ser de naturaleza fisica o qumica y puede
originarse en el interior o exterior del organismo. Por ltimo, el mecanismo por el cual
un mutgeno origina la mutacin recibe el nombre de mutagnesis.
Si la E. colique existe en la naturaleza es capaz de formar leucina a partir de una
fuente carbonada y una nitrogenada, el organismo se nombrar leui y se considera que
es el tipo silvestre. Si por la accin de un mutgeno se obtiene un mutante que no es
capaz de crecer en un medio carente de leucina (ha perdido la capacidad de sintetizar
ese aminocido),entonces se nombra leu'. En este sistemade nomenclaturael tipo (+)
es siempre el tipo silvestre, aunque no sea el que existe en la naturaleza, y el tipo (-) es
el mutante. Para referirse al genotipo se utilizarn letras minsculas y para el fenotipo
las maysculas.

Tipos de mutaciones

Las mutaciones pueden clasificarse atendiendo a numerosos criterios de los cua-


les los ms utilizados son los que se definen a continuacin. Segn su origen las
mutaciones pueden ser espontneas o inducidas. Algunas mutaciones se producen
como consecuencia del normal funcionamiento de la clula y reciben el calificativo de
espontneas y ocurren en una proporcin que es caracterstica para cada organismo.
Las mutaciones que se producen como consecuencia de la accin del hombre sobre
determinados organismos reciben la denominacin de inducidas. Laefectividad de un
mutgeno debe medirse por su capacidad para incrementar la proporcin de las muta-
ciones en un organismo determinado.
Teniendo en consideracin el grado de afectacin que el mutgeno origina en el
material gentico, las mutaciones pueden clasificarse en 2 grandes grupos: aqullas
que pueden visualizarse en el microscopio por afectar un sector grande del ADN, que
reciben el nombre de mutaciones cromosmicas (tambin llamadas aberraciones es-
tructurales), y las que afectan slo una o muy pocas bases nitrogenadas por lo que
tienen un nivel molecular o submicroscpico y se denominan mutaciones gnicas.
Las aberraciones cromosmicas estructurales ms importantes son: la delecin,
cuando falta una porcin del cromosoma; la insercin, cuando aparece un segmento
adicional, y la translocacin, cuando un segmento de un cromosoma aparece en otro.
Para su estudio detallado debe consultarse un texto de citogentica.

Mutaciones gnicas

Las mutaciones gnicas se producen fundamentalmente por alteraciones en


la secuencia de bases del ADN. Estas alteraciones pueden ser consecuencia del
cambio de una base por otra, entonces se les denomina puntuales. Los cambios de
ms de una base son fenmenos que aunque probables resultan muy poco frecuen-
tes. Otros tipo se producen por la adicin (insercin) o sustraccin (delecin) de
una o ms bases (Fig. 32.1).
ATGGCACGTCA

Fig. 32.1. Principales mutaciones gnieas.


Las principales mutaciones gnieas
son aqullas que se producen por
el cambio de una base por otra (ir-
quierda), la insercin dc una base
(centro) o la deleein de una base
(derecha). Como puede inferirse
de la figura, las consecuencias de
cada tipo dcbcn ser diferentes.
Se llama transicin al cambio de una punna por otrao una pirimidha por otra, en
tanto recibe el nombre de transversin el cambio de una pnrina por una pirimidina, o
viceversa.
Las mutaciones pueden ocurrir en las secuencias de bases que codifican
aminocidos de la cadena polipeptdica o radicar en secuenciasreguladoras (promoto-
res, etctera). Las que afectan las secuencias codificantes pueden estar localizadas en
diferentes partes del gen y pueden alterar el codon de iniciacin, los intermedios o los
de terminacin, lo cual indica que las consecuencias de las mutaciones pueden ser
muy diversas.
Cuando una mutacin se produce en la zona de codificacin del gen puede no
alterar la secuencia de aminocidos en una protena y se denomina silente. Existen
casos en que la mutacin provoca el cambio de un aminocido por otro similar que no
altera la funcin de la protena y entonces se denomina mutacin neutra.

Mutagnesis
Son numerosos los agentes que pueden actuar como mutgenos pero pueden
reunirse de acuerdo con el mecanismo por el cual producen las mutaciones en los
siguientes grupos.

Mutgenos aniogos de bases

Un anlogo de base es una sustancia que no es ninguna de las bases habituales del
ADN, que puede ser incorporada a stedurante la repcacin por formar pares de bases
con alguna de las bases normales; que por tautomerizacin (captulo 8) puede cambiar
so patrn de apareamiento en el siguiente ciclo replicativo y originar un cambio de
bases en el ADN.
Un ejemplo de este tipo es el bromouracilo que es un anlogo de la timina y por
eliose apareacon la adeninaen su forma ceto,pero al cambiar a su forma enol forma par
con la guanina (Fig. 32.2) y en el siguiente ciclo replicativo aparecer un par GC
donde antes exista uno AT.

H
l Fig. 32.2. Anlogos de bases. La parte su-
O N perior dc la figura muestra la es-
/N /"-" ,y.---(:: .ii, "-/
\ \:: tructura dc la timina y del
H-C/
\
\CPC
4 \, \ - 7 (.

f'
. ,.
',;, 5-bromourarilo, donde sc advier-
te su siniilitud estructural. En la
H/N-~
\ N=C
82 -

Y ) . . :
y

-'
,i3
<.-i'"NN-
\ N=C Y-"
'N-H
\.'
.<' -- x
parte inferior se muestra, ema en
la forma cela, el 5-bromouraeilo
H
' (j 'il
I forma paresde havescon laadenina
H y acta como un anlogo de la
. e r oen forma enal se
timina.. ~
Adenina 5-Br-Uracila aparea con la guanina y sustituye
Guanina S-Br-Uracilo
(forma ceto) a la eitosina.
(forma enoi)
Para que esto suceda se requieren de 2 ciclos replicativos, como se muestran en la
figura 32.3.
Otro ejemplo es la 2-aminopurinaque sustituye a la adenina; no tautomeriza,pero
puede aparearse con la mina y con la citosina; aunque el apareamiento con la citosina
es muy dbil es lo suficientementefuerte para provocar en el siguiente ciclo replicativo
la transicin AT->GC.

Fig. 32.3. Mutaciones por anlogos de ha-


ses. Cuando durante un cielo
replieativo se incorpora el
5-bromouracila, en su forma ceto,
formar pares de bases can la
adenina, pero en el eielo siguiente
cambia a su forma enal y se aparea
con la guanina, originando en el
prximo cielo la aparicin de un
par G:C donde exista original-
mente un par A:T.

Un mutgeno qumico es una sustanciaque reacciona con alguna de las bases del
ADN y la modioca de forma que cambia su patrn de apareamiento; los ms poderosos
son el cido nitroso (HNO,), la hidroxilamina, el sulfonato de etilmetano y la
N-metil-N'-nitro-N-Ntrosoguanidina(Fig. 32.4).

O O-CH,
SS/
8'c~H,

Fig. 32.4. principales mulgenos qumicos.


Se muestran la7 eihichiras de los
mutgenm quimiem ms utilizados
El &ido nitrnio (a), la hidroxila-
mina (b), sulfonato de etilmetana
(e) y la N-nitr^N'-metil- N-ni-
guanidina (d).

El cido nihosotransforma los grupos aminos en cetnicos y por tanto, transforma


la citosina en uracilo, la adenina en hipoxantina y la guanina en xantina (Fig. 32.5),
que forman los pares UA,HC y XC;esto provoca los cambios G C en AT y AT en G C
cuando la citosina y la adenina son desaminadas. La desaminacin de la guanina en
xantina no provoca mutaciones, ya que GC da XC.Por un proceso muy complejo la
hidroxilamina reacciona con la citosina y la modificade manera que forma pares con
la adenina, por lo queocurre un cambio de GC en AT.
El sulfonato de etilmetano (o de etiletano) es un agente alqnilantes, provoca la
adicin de grupos alquilos a las bases ~trogenadasdelADN y pueden reaccionar con
la guanina y en menor grado con la adenina. La adicin de un grupo alquilo en el N-7
dela purina produce 2 efectos,el apareamiento de G con T y la labilizacin del enlace
.NH,
I -
!!1
8

N//C\ C t,x,L ...


I II- i !l

+,-, C
\N /C
(!4\.V
!
/(:

Fig. 32.5. Efecto de agentes dessminantes.


Los agentes desaminanles, como
el cido nitroso, actan sobre las
bases nitrugenadas y al
desaminorlaseanviertenla eitosina
en uraeila (arriba), la adcnina en
hipaxantina (centro) y la guanina
en xantina (abajo). En algunos
casos estos eamhios pueden afee-
tar el patrn de apareamiento.

N-glicosdico del nucletido que se hidroliza rpida y espontneamentecreando un


sitio apurnico, que si no es reparado, en el siguienteciclo replicativo puede dar origen
a la aparicin de cualquiera de las bases en la cadena complementaria.
El N-metil-N'-nitro-N-uitrosoguanidiua es un poderoso mutgeno que acha por
alquilacin. En una poblacin bacteriana produce cerca de 1% de mntantes y muchos
de ellos mltiples. Las mutaciones se producen en grupos muy cerca unas de otras. Se
supone que su accin se realiza en la horquilla de replicacin.
Otro grupo importante de mutgenos son las llamadas especies reactivas del ox-
geno que son un grupo de radicales libres que se forman a partir del oxgeno en
diferentes reacciones redox. Como todo radical estas especies son muy reactivas y
pueden alterar tanto las bases como la pentosa del ADN.

Algunos colorantes como el naranja de acridina, la proflavina y la acroflavinason


molculas planas de 3 ciclos, cuyas dimensiones son aproximadamente iguales a las
de un par de bases, esto le permite intercalarse entre 2 pares de bases y al ocurrir la
replicacin generalmentese producen inserciones de una base (muy pocas veces de 2)
y con mucha menor frecuencia deleciones; el mecanismo se desconoce.

Radiaciones

La luz ultravioleta,los rayos gamma, los rayos X y otras radiaciones ionizautes


son poderosos agentes mutagnicos. Su mecanismo de accin, as como sus conse-
cuencias se estudiarn con ms detalle en el captulo33.

Consecuencia de las mutaciones


Las ms frecuentes de las mutaciones gnicas son las puntuales, las cuales se
definen como el cambio de una base por otra. En este caso pueden originarse varias
situaciones: en primer lugar puede producirse una mutacin silente, pues debido al
carcter degenerado del cdigo gentico estudiado en el captulo 28, los cambios,

Componentes celulares y Cknt5tica molecular 553


sobre todo en la tercera base, pocas veces acarrean cambios en el aminocido codifica-
do; en segundo lugar puede originarse una mutacin neutra, lo que significa que,
aunque se produce el cambio de aminocidos,stos son tan simares que no producen
afectaciones del producto gnico; por ltimo, puede producirse un cambio de
aminocidos que afecte sensiblementela estrnctura y por consiguiente la funcin de La
proteina codificada, modificandoel fenotipo y stos son los que pueden reconocerse
como mutantes (Fig. 32.6).

TTTGCCCTAAGT

UUUGCCCUOAGT UUUGC hU AGT

Fig. 32.6. Consecuencia de las mutaciones puntuales. Al producirse el cambia de una base par otra,
las consecuencias pueden ser diferentes debido al carcter degenerado del cdigo gentica.
El cambio de A x G da origen a una mutacin silente (derecha), pues se codifica el mismo
aminocido; C x A produce una mutacin neutra, pues cambia la leucina par la isoleucina
que son aminocidos del mismo tipo (centro); por ltimo, el cambio de T x G, si debe
originar un fenotipo mutante, pues la leurina que es un aminocida apolar se cambia por
arginina (izquierda) que es del tipo polar inico.

Otro tipo importante son aqullas que transforman el codon de iniciacin, lo que
impide la sntesis de la protena, pues en las concentraciones fisiolgicas de Mg2+,slo
con el codon AUG puede iniciarse la sntesis.
En otros casos estn implicadoslos codones de terminacin que pueden dar lugar
a 2 situacionesdiferentes: una es que un codon de lectnra sea convertido por el mutgeno
en un codon de terminacin, con lo cual provoca la terminacin abortiva de la cadena
polipeptdica; la otra, ocurre cuando un codon de terminacin es convertido en un
codon de lectura, lo cual ocasionar un aumento en el nmero de aminocidos de la
protena hacindola generalmente inservible (Fig. 32.7).

CCCTGGCATTAAGCC
Fig. 32.7. Mutaciones que afectan la termi-
nacin. En el primer casa (izquier- CCCUGGCAUUAAGCC
da), el cambio G x A da origen a la Pio - Trip - His - m
aparicin de un eadon de termi-
nacin y la terminacin anticipa-
da de la sntesis de protenas. En el
segundo casa (derecha), el cam-
bio A x C transforma un codon de
terminacin en uno de tirosina y
can ello prolonga la cadena CCCUGGCAUUACGCC
CCCUGACAUUAAGCC
polipeptdica ms all del limite
normal. Pla T- Pro ~ T n p His - m - Ala

Estas mutaciones pueden afectar tambin las zonas reguladoras, por ejemplo, la
fortalezade un promotor depende enhp otms factoresde la secuenciaconsenso TATAAT,
por lo que una mutaci6n que aleje la secuencia real de la consensodebilitar al promo-
tor, y la que lo acerque, lo har ms fuerte. Situaciones similares pueden originarse en
otras secuencias reguladoras como seestudiar en el capitulo 34. Las inserciones y las
deleciones provocan un corrimiento del marco de lectura, pues como los codones son
ledos uno a continuacin del otro, la adicin de una base dar lugar a una lectura
diferente a partir del punto de insercin. Igual sucede con las deleciones (Fig. 32.8).

GCAATCCTTTTTCAGGGGAAA

GCAAUCCUUUUUCAGGGGAU
Alii 1 1.w - Feii - Gln GIi 1.1\
Fig. 32.8. Inrercienes y dcleciones. 1.n in-
serriiin (izquierda) y la delecin
(derecha) de una hase alteran la
secuencia de aminocidos d e la
protena. a partir del punto doiidc
se produjo la mutaciii. ObsCrve-
+<;
GCAATCGCTTTTTCAGGGGAAA GCAATCTTTTTCAGGGGAAA se que mientras mis cercana sea la
rnutacibn al inicio del gen, en nia-
GCAAUCGCUUUUUCAGGGGAAA GCAAUCUUUUUCAGGGGAAA )or grado alterar la estructura de
Ala ,
IIc 4 a h 1 &L :GL && Ala - lic Fcn - Fen - lii - Git - Li, In pwteina que el gen codifica.

Las consecuencias de inserciones y deleciones son diferentes segn el punto


donde se producen, teniendo mayor connotacin aqullas que ocurren en los codones
iniciales, pues originan un producto totalmente alterado. Este tipo de mutaciones
puede alterar tambin las secuencias reguladoras, pues en ocasiones 2 secuencias
tpicas deben estar separadas por un nmero determinado de bases para ser efectivas,el
aumento o disminucin de este nmero puede alterar la funcin regnladora.

Mutaciones mayores
Con una frecuencia muy haja ocurren cambios que afectan secuenciasde muchas
bases (hasta miles) y que taxnbindebenserconsideradascomo mutaciones; las principa-
les son deleciones, duplicaciones y rearreglos. Las deleciones de 100 hasta l 000 pb
ocurren espontneamente,pero pueden ser estimuladas por agentes de entrecruzamiento;
presumiblemente los largos segmentos entrecruzados son eliminadosde alguna forma,
quizs con la participacin de algn mecanismo de recombinacin.
En una duplicacin (o triplicacin que tambin puede ocurrir) una secuencia de
bases se repite y aparece organizada en tndem (Fig. 32.9). La longitud del segmento
duplicadoes tpicamente tan larga que incluye a variosgenes. Estemecanismoes poco AGCTGCTATCCGA
frecuenteen bacterias, pero se observa en anfibiosdurante el mecanismo de amplificacin
+
TCCACGATACCCT
gentica y en clulas de mamferos relacionado con los mecanismos de resistencia a
algunas drogas como se discute en el captulo 84.
Parece ser que la duplicacin de genes ha desempeado tina funcin importante ACCTCCTATCGCIATCCCA
en el proceso de la evolucin; como un gen duplicado puede mutar independiente- TCGACCATAGCGATAGGCT
mente del otro, a partir de un gen nico puede producirse una familia de genes que
tiene un grupo de caractersticas comunes, pero posee aspectos especficos que los
diferencian y que, adems de una ganancia de material gentico, puede dar origen a
+ +
AGcTCTATCGCGA
protenas con funciones similares, pero con algn grado de diferenciacin. El ejem- TCGAGATAGCGCT
plo ms sobresaliente lo constituye el gen de la globina, que al parecer era nico en
un inicio y que por mecanismos de duplicacin y despus por mutaciones indepen- -
dientes ha dado lugar no slo a las cadenas que componen los diferentes tipos de
hemoglobina, sino tambin a la mioglobina, una protena muscular relacionada con Fix. 32.9. Mutaciones niayorcs. La dupli-
el almacenamiento de oxgeno en determinadas fibras musculares. cacin y la inversin de grandes
sectores del ADN constituyen fe-
Un rearrrglo tpico es la inversin, un segmentode ADN que es separadoy reinsertado
nmenos que ao son pocu fre-
con una orientacin invertida (Fig. 32.9). Los rearreglos de este tipo generalmente origi- eucntfs y que generalmente im-
nan un fenotipo mutante con respecto a los genes involucrados, pero si no son esencia- plican varios genes. Los mecaiiis-
les para el crecimiento a veces no son detectados. inus de produccin de cslus tipos
Los mecanismos moleculares de la duplicacin y el rearreglo no son conocidos, dc niirtaciones son desconocidos.
presumiblemente impliquen errores de replicacin, recombinacin, o ambos.

Componentes celuiares y Oenttica molecdar 555


Supresin
Hasta ahora slo se ha visto el proceso de obtencin de mutantes a partir del tipo
silvestre, el fenmeno contrario tambin existe y se le denomina retromutacin o
reversin. Una forma de reversin seria queel mutante recuperarael genotipo original,
pero eso no siempre ocurre, pues existen muchas formas de reversin.
Si se colocan lo4 bacterias Leu- en un medio carente de leucina no se obtiene
crecimiento alguno, pero si colocamos lo7bacterias Leu-serecogen unas pocas colo-
nias Leu', esto se debe a que estas bacterias elaboran su propia leucina y se les llaman
revertantes. El hecho de que muestren un fenotipo Leui no significa necesariamente
que presenten el genotipo leu+original.
La reversin es debida a mutaciones espontneas y por lo tanto, es un proceso
azaroso que no est influido por el medio carente de leucina, pero ste permite
detectarlas. En el laboratorio es posible estimular la reversin con el empleo de
mutgenos.
Algunos anlisis matemticos de las frecuencias de mutaciones espontneas de-
muestran que el genotipo original slo se lograra en una por cada 15 x 10'Oclnlas,
peroexperimentalmen~sedei&estraqne el fenotipooriginal se obtiene en una frecuen-
cia de una por cada 108clulas.La explicacin seria que la mutacin ocurre en otro
sitio diferente, que permite recuperar el fenotipo original, a este tipo se ledenomina
mutaciones de segundo punto o supresoras. En ocasiones la segunda mutacin ni
siquiera ocurre en el mismo gen, por lo que deben distinguike las supresiones
intragnicas de las extragnicas.
El estudio del producto gnico ha demostrado que en la mayora de los casos la
sustitucin del aminocidooriginal permanece, pero ha aparecidoun segundo cambio
que compensa al primero. Considreseel ejemplo hipottico que se muestra en la figura
32.10, de una protena de 97 aminocidoscuya estructura est determinada completa-
mente por una atraccin inica entre un aminocido (+) en la posicin 18y otro (-)en la
64; si ocurre una mutacin que cambia al aminocido 64 por uno (+), la protena ser
totalmente inactiva. En este caso se puede lograr la reversin de3 formas principales:

1. Una mutacin que haga que a la posicin 64 regrese el aminocido original.


2. Una mutacin que cambie el aminocido (+)dela posicin 64 por otro (-) aunque
no sea el original.
3. Una mutacin que produzca la aparicin deuu aminocido (-) en la posicin 18.

Fig. 32.10. Reversin intrafihica. La es-


tructura de la prolcna representa-
da en la figura sc mantiene exclu-
sivamente par una interaccin
inica entre 2 aminocidos espe-
cifico~.Si una mutacin afecta a
uno de ellas, la protena puede rc-
a p e r a r su conformacin inicial
por otra mutacin que restituya el
mismo aminocido u otra de lo
misma carga, o un aminaeido que
cambie la carga del otro
aminoScido que interviene en la
interacein.
En todos los casos sealadosse recuperada el fenotipooriginal, aunque slo en el
primerose restituira el genotipo silvestre.
Otra situacin ocurre con las mutaciones que provocan alteraciones del marco de
lectura; una insercin puede revertir como consecuencia de una delecin y viceversa,
en estos casos mientras ms prxima se produzca la segunda mutacin, mayor ser la
probabilidad de obtener el fenotiposilvestre.
Los casos analizadoshasta el momento corresponden a supresiones intragnicas,
pero tambin existen las extragnicas. Suponga que una protena est formada por 2
subunidades, cada una de las cuales est codificada en un gen diferente. Si una muta-
cin en uno delos genes afecta el sitio de reconocimientoentre las 2 subunidades, no
se podr formar el dmero y la protena estar inactiva. Si ocurriera una mutacin en el
otro gen que modificara el sitio de reconocimientode manera que pudiera formarse el
dmero. se restituira el tiuo silvestre.
Otro tipo de mutaciones extragnicasse encuentra en el caso de las mutaciones
queoriginan codonesde termiuacin, en estos casosla sntesis dela protena dada se
interrumpe cuando el codon mutado aparece. Una mutacin en ARNt que permita leer
ese codon actuara como supresora.

Mutaciones en humanos
El genoma humano surge como consecuenciade un largo proceso de evolucin y
no est exento de alteraciones mutacionales. Los actuales mtodos de anlisis han
permitido demostrar la existencia de mutaciones de todo tipo en los seres humanos; en
algunos casos estas mutaciones no tienen ninguna significacin y se descubren como
resultado de estudios masivos en grandes poblaciones, que se realizan en busca de
situacionesanormales, por lo que surge el concepto de polimorftsmoque se refiere a la
existencia de numerosas formas (secuencias)de una misma protena, tengan o no un
significado patolgico.
El c m ms sobresalientees el de la hemodobina de la cual se conocen alrededor de
400 tipos diferentes,aunque slo unos pocos de ellos causan alteraciones morbosas.
Las deleciones tambin aparecen en humanos y son causas de diferentes enferme-
dades, un resumen de stas se presenta en el cuadro 32.1.

Cuadm 32.1. Algunas enfermedades debidas a deleciones gnicas

Gen Enfermedad

Factor VI11de la coagulacin Hemofilia A

Factor IX de la coagulacin Hemofilia B

21-hidroxilasa Hiperplasia adreual congnita

Fenilalanina hidroxilasa Fencetonuria

Receptor de LDL Hipercolesterolemia familiar

Colgeno I a l Osteognesis imperfecta severa

Hipoxantina guanina SndromeLesh Nyham


fosforibosiltransferasa
Como resumen de las distintas alteraciones que pueden presentar los genes huma-
nos el cuadro 32.2 muestra diferentes causas de p-talasemia, una enfermedad que se
caracteriza por la sntesis de cantidades insuficientes de la P-globina, sta es una de las
cadenas polipeptdicas que componen la hemoglobina. Se puede apreciar como exis-
ten mutaciones que afectan a los exones y a los intrones e incluso a secuencias
repladoras, a codones de iniciacin y de terminacin, etctera.

Cuadro 32.2. Mecanirnos moleculares productores de talasemias

Mecanismomolecular Ejemplos

1.Mutaciones puntuales
a) Transcripcin defectiva
mutaciones del promotor

b) Defectosde maduracin del ARNm


corte anormal G a A intrn 1posicin 1
G a A intrn 2 posicin 1
G a C intrn 1posicin 5 (2)

nuevo sitio de corte GAG a AAG en codon 26 (5)

intrn dentro del gen G a A en 110intrn l(3)


G a T en 654 intrn 2 (4)

sitio de poliadenilacin AATAAA a AACAAA (4)

c) Traduccin defectiva
terminacin premahua codon 17 A a T = lis a ter
codon 39 C a T = glN a ter (3)

2. Deleciones
a) Transcripcin defectiva parcial de 619 ph (6)

b) Defectos de maduracin 25 pb extremo 3' de intrn 1

c) Traduccin defectiva 2 bases en el codon 8


4 bases en codones 41/42

3. Insercin
corrimientodel niarco delectura 1 base en 819
1 base en 71/72 (4)

( 1 ) En negros americanos. (2) En indius asiticos


(3) ITu ineditei-rncos. (4) En chinos.
(5) Currespiiiide a H h E. ( 6 ) La Hh Leporc.

Resumen
Las mutaciones son alteraciones que se producen en el material gentico y que
se trasmiten a los descendientes. Los agentes mutagnicos o mutgenos son aqu-
iios capaces de producir mutaciorm, que pueden ser de nahiralem sica o qumica.
Los principales tipos de mutaciones gniw son las puntuales, por sustituci6n de
una base; las h e d o n e s , por la adici6n deuua base, y las deldones, por la sustrac-
cin de una base.
Las mutaciones pueden ser espontneassi se producen como coll~eeueuciade
la actividad normal del organismo o inducidas cuando en ellas interviene la mano
del hombre, con intenciones experimentales, accidentalmente, o por una actitud
criminal.
Las mutaciones pueden provocame eon la utilizadn de anlogos de bases como
el bmmouracilo y la Zaminopurina; mutgenos quimicm corno el cido nitmso, la
bidmxamk, la N-meol-N-nimN-ni-dina y el dionato de elmetano,
los cuales modifican las bases nitmgenadas cambiando su patrn de apareamiento.
'IgmbiQi son mutagniw las radiaciones ulavioleta, las ionizantes y las susanfias
intercalantea como el naranja de acridina, la pmflavina y la aeroflavina
Los efeftos causados por las mutaciones pueden ser diferentes segn el tipo de
mutacin (puntnal, h e d 6 n y deleein) y el sitio donde se producen (secuencias
codificantes o reguladom).
Otros tipos de mutaciones afectangrandes sectoresdel ADN como las grandes
deleeiones, las duplicadones y los rearreglos cuyos mecaniwos son desconocidos.
La supresin es el mecanismo por el cnal a parr de un mutante se logra
obtener el fenotipo dvestre y sta se debe ala ocurrencia de una segunda mutacin
en el mismo gen (intragnica), o en un gen Merente (extragnica).
Existen numerosos ejemplos de mutaciones en humanos muchas de las cuales
son causas de enfermedades,el ejemplo ms destacadocomo sucede en otms aspee
tm ya estudiados es el gen de la globina, que codifica la p o d n pmtenica de la
hemoglobina.

Ejercidas
1.Qu tipo de mutacin (transicin o transvenin) se produce si un cultivo celular es
tratado con:
a) bromouraco
b) 2-aminopurina
c) cido nitroso
d) hidroxilamina
e) sulfonato de etilmetano
: f) N-metil-N'-nitro-N-nitrmoguanidina

2. Qu tipo de mutaciones se originan con el uso de las llamadas sustancias in-


tercalantes?
3. A continuacin se muestra la secuencia de la hebra codificante de un segmento de
ADN queusteddebetomar como referencia para responder las preguntas siguiente:

1. Escriba la secuencia del pptido que se codifica.


11. Cmo se modifica esa estrnctura si:
a) cambia A x T en la posicin 12
b) cambia T x C en la posicin 15
c) cambia T x A en la posicin 8
d)inserta un G entre 16y 17
e) delecin de la C de la posicin 21
0 cambia T x A en la posicin 2
g) cambia G x A en la posicin 27
h) cambia A x G en la posicin 30
4. Cmo pudiera suprimirse una mutacin por otra dentro del mismo gen?
5. ;Cmo puede suprimirse una mutacin por otra que ocurra en un gen diferente?
6. Si 2 clulas bacterianas tienen el mismo fenotipo, jnecesitan tener el mismo
genotipo?

Componentes celulares y Genbtica nmlecuh 559


No existe Nnguna otra biomolcula cuya integridad tenga para la clula el significa-
do vital que tiene el ADN. Todas lascaractersticas estructurales y funcionalesde la clula
estn codificadas eii ltima instancia en estas grandes y complejas molculas. La pmihi-
lidad de expresar esas caractersticas como la de poder trasmitirla a sus descendientes
dependen en elevado grado de la integridad estmctural de estas molculas, tanto de su
estructura primaria como de su arquitectura tridimensional.
No obstante, las posibilidades que tiene esta molcula de sufrir alteraciones es bas-
tante elevada, ya sea durante su funcionamiento como molde para la replicacin y la
transcripcin, como por su snsceptibilidad a la accin de agentes fisicos y qumicos
provenientes del exterior o del interior de la clula.
No es de extraar que durante los millones de aos de la evolucin, tndos los organis-
nios. desde los unicelulares hasta los plnricelnlares hayan desarrolladomecanismos que
lc periiiitaii conservar dentrode ciertos mites la ms elevada fidelidad de la informacin
contenida enel ADN.
En la seccin de hiomolculas quedb demostrado que la sola estructura del ADN,
con siis elevadas estabilidades quimicofisica y metablica constituye un primer nivel de
seguridad en la conservacin,su asociacin con protenas en organizacionesde cada vez
iiiayor complejidad aumentan el grado de seguridad que se incrementa an ms en los
eucariontes, donde el ADNest confinado al ncleo y separadodel restodela clula por
una envoltura de doble membrana
El ADN noconstituye una molcula invulnerable a la accin de agentes queoriginan
en l cambios que pueden traduciiseen daos a su estructura y por ende enalteraaonesde
sus funciones.
En este captulu .seexaminarn l a principales clanos que puede experimentar el ADN
celular,as como los diferentes sistemas que tienden a comervar la informacin original,
tanto durante la actividad normal de laclula comoeii respuestas algn agente agresor,
por ltimo. sc estudiari cmo algunas alteraciones en los sistemas de conservacin pue-
den originar alteraciones niorbosas en los seres humanos.

Cuiiio fiierhtudiacli~eii el raptulo31,las bacterias pnedencapturar ADNdel medio


cxtracelular e incorporarlo a su genoma por el fenmeno de transformacin; ste sin
embargo. tiencsus limitaciones. La bacteria escapazdedistinguirentrrel ADN propio?.
elextrao,lo que viriir dado porqiic cada cspccie hacteriana posee un grupo de enzimas
que metilan el ADY e11 posicioiirs esl~ecficas.principalmente en adenina y citosina.
creando un patrii de iiietilacin que indica el origen del ADN; este proceso se conoce
como niodificacin. Si~iiiiltiieaineiiteexiste un conjunto de endonucleasas que si al
interactuar con el ADN en los mismos sitios no encuentran el natrn de metilacin
caracterstico de su especie, entonces lo hidrolizan; este fenmeno se denomina res-
triccin. En su conjunto el sistema de modificacin-restriccin protege a la clula
contra la contaminacin de molculas extraas de ADN.
En la tabla 33.1 se relacionan algunas de las enzimas de restriccin mejor caracte-
rizadas y sus sitios de accin.
Aunque cada especie presenta su propio patrn de metilacin, cualquier molcula
de ADN de origen extrao que logre incorporarse a la bacteria, ser reconocido como
ajeno y resultar hidroluado por las endonucleasas.

lhbla 33.1. E n z h a s de restriccin y sus sitios especficos de accin


- -

Enzima Microorganismo Sitio especfico

A.

EcoRl Esrherichia coli GXAATITC

BamHl H
B.rii>iiloliq~i~f~~cie~~,s G*GATCC

Bgll B. globigli A*GATCT

Hindl H. inIluenzae A*AGCm

Sall S. nlbus G G*TCGAC

T-1 T riqrioficus T*CGA

B.

Ball B. albidum TGG*CCA

Hael H. aemphL<_ GG*CC

SmaI S. marcescens CCC*C&G

* Indica el punto del corte.


Lcycnda: A: Generan fragmentos monofibrilares. B: No generan fragmentos nionofibriiares.

Los sistemas de modificacin-restriccin se clasifican en 3 grupos, cuyas caracte-


rsticas principales se muestran en la tabla 33.2.

lsbla33.2. Caractersticas de los diferentes tipos de enzimas de restriccin

Caractersoca Tipo 1 . Tipo U ~i~ m


Actividad modificacin-reshiccin Multuncimial simple *aradas Multifuncionalsimple
~cturapmteiica 3 subunidade diferentes Simple 2subunidadesdiferentes
Requerimientospardlamhiccin ATP, SAM, Mg" Mg2* ATP, Mg" (SAM)
Requerimientmpardlametilacin SAM (ATP, Mg") SAM SAM (ATP, Mgi')
Secuencia especfica T-G-A-N -T-G-C-T hhdmmi~ A-G-A-C-C
Sitio de hidrlisis 1000 pb del sitio de unin En el sitio de unin 26 pb del sitio de unin
Restriccin g metilacin Mutuamenteexcluyentcs separadas Simultneas
Sitio de melilacin Especco Especfico Ekpectico
d
u"!me ~ o wvs ua aluauienanu asq.rahuoJ anb aua!) 'N(TV le ol!)aui o d n ~ 9ni apaJ wvs la
Las enzimasdel tipo IIIconstan detsubunidades, una R y otra SM, con un tamao
de 106 a 110 kD para la R y de 73 a 80 kD para la SM, y para la unin al ADN se
requiere de ATP. Una vez unida, las 2 actividades compiten entre s, la metilacin en el
sitio de unin y la restriccin unos 24 a 26 pb a uno de los lados.
Esta actividaddelas enzimasse est realizandodemanera constantelo que constitu-
ye un sistemade conhol de la integridaddel ADN celular, pero cuando se pmdnce un dao
sobre el ADN, se ponen en accin otros mecanismos enzimticos que reciben el nombre
genrico de sistemasde reparacin. Se presentarn brevemente los principales tipos de
dao que pueden ocurrirleal ADN y los mecanismos que permiten su reparacin.

Daos al ADN
Existen 3 mecanismos fundamentales que pueden provocar alteraciones estructu-
rales en el ADN y que son: la sustitucin de bases durantela replicacin, el cambio de
bases como resultado de una inestabilidad qumica inherente a la estructura de la base
o del enlace N-glicosdico y las alteraciones resultantes de la accin qumica o de otro
tipo de agentes ambientales. Estos mecanismos provocan algunos defectos.

Bases mal apareadas

Una delas hebras contiene una base qoeno puede formar puentes de hidrgenos
adecuados con la otra hebra. Este defecto puede ser el resultado de un error en la
replicacin que no haya sido rectificado por las polimerasas, lo cual es muy poco
frecuente. Otro ms comn es la desaminacin espontneade citosina a uracilo segui-
do de la conversin de ste en timina, y menos frecuente,la desaminacin de adenina
a hipoxantina que forma pares de bases con la citosina y no con la timina.
Estos errores son corregidos por un sistema de N-glicosidasas que comprende las
fases representadas en la figura 33.2.
En primer lugar se produce la desaminacin, ms tarde la Uracil N-glicosilasa
(O Hipoxantina N-glicosilasa) hidroliza el enlace N-glicosdico de esos nucletidos
daados, dejando la base de la hebra opuesta sin apareamiento. Un grupo de
endonucleasas conocidas como AP (apurnicas o apirimidnicas) hidroliza el enlace
fosfodister cuya base ha sido removida, y otros enlaces algunos nucletidos ms
adelante,dejando una brecha en la banda daada. La ADN polimerasa 1Uena la brecha,
pues dispone del extremo 3 ' - 0 H necesario y, por ltimo, la ADN ligasa sella los
extremos apareados por la polimerasa 1y el ADN queda reparado.

Fig. 33.2. Reparacin de bases alteradas. Bases perdidas


Cuando por accin de algn agente
una basc resulta daada se vrodu- El enlace N-glicosdico de los nucletidos de purinas se rompe espontneamente
ce una distorsin en la molcula
del ADN que sirve de seal a los
a temperahiraf~iolgicacacon baja velocidad, en un proceso denominado despurinifica-
sistemas de revaracin. Una enzi- cin. Se puede romper un enlace por cada 300 purinas por da a 37 'C y pH 7,10 que
ma N-glicosidaaa hidraliza el en- representa unos 1000 enlaces en una clula animal. La velocidad aumenta al dismi-
lace N-glicosidieo entre la base y nuir el pH o al aumentar la temperatura. Como se trat en el captulo 32, los agentes
la desoxirrihosa. creando un sitio alouilantes aceleran este oroceso.
AP (apurinico o apirimidnico).
Las endonueleasas AP hidroliran
Una vez roto en enlace N-glicosdico el proceso de reparacin es igual al caso
el enlace fasfadistcr inmediato. anterior, comenzando con la accin de las endonucleasa AP.
La ADN polimerasa 1 comienza a
incorporar nucletidos al extremo
3 ' -OH, desplazando la hebra da- Alteraaones de bases
ada. Una endonucleasa o la pro-
pia polimerasa 1 separan el seg-
mento que estaba daada y la Las bases nitrogenadas pueden ser transformadas en una amplia variedad de com-
ADN ligasa eicrra la brccha, dn- puestos qumicos por la accin de numerosos agentes fsicos y qumicos, como por
dole integridad a la hebra y dejan-
do la niollcula reparada.
Fig. 33.3. Alteraciones de la timina. La
timina es la base ms sensible a los
daos. (a) La formacin de 5.6,
-dihidruxidihidratimina. (b) La
formacin del dmcro de timiiia
por la accin d e los rayos
ultravioleta.

ejemplo las radiaciones ionizantes (las partculas beta emitidas por radioistopos na-
turales, o los rayos X) pueden cansar la rotura de los anillos de purinas y pirimidinas y
originar diferentes tipos de sustituciones qumicas. La base ms susceptiblees la timina,
uno de sus cambios ms frecuentes es su conversin en 5,6,dihidroxidihidrotimina
(Fig. 33.3 a)).Los radicales libres que se producen durante el desarrollo de diferentes
reacciones metablicas tambin pueden originar mltiples cambios.
Una de las alteraciones de bases mejor estudiada es la formacin de dmeros de
pirimidinas, especialmente de timina, provocada por la luz ultravioleta (Fig. 33.3 b)).
La formacin de estos dmeros por una parte distorsiona la hlice, pues las bases se
aproximan una a la otra, y por otra parte debilitan los puentes de hidrgeno con el par
correspondiente de la otra banda, esta situacin causa la inhibicin de la replicacin y
de la transcripcin.

Rohuas de una hebra

Muchos son los agentes que pueden provocar la rotura del enlace fosfodister
entre ellos los perxidos, los compuestos que contienen grupos sulfihidrilos (como la
cistena) y metales, como el Fe" y el Cu"'. Tambin se puede originar por radiaciones
ionizantes. Lai desoxinibonncleasas que siempre estn cerca del ADN pueden acciden-
talmente provocar tales roturas.

Roturas en las 2 hebras

Se producen cuando se utilizan radiaciones ionizantes muy intensas que al provo-


car rotura al azar en el ADN, puede suceder que 2 de ellas se produzcan en sitios muy Fig. 33.4. Roturas dc bandas. Las radiaciu-
cercanos pero en bandas opuestas. Generalmentese daan las bases adyacentes y estas nes ionizanles pueden provocar las
roturas de bandas. Cuando la ra-
lesiones casi nunca pueden ser reparadas (Fig. 33.4). diacin no es muy intensa s i pro-
ducen roturas dc una sola handa,
pero cuando son muy intensas pro-
Enlaces entrecruzados vocan roturas mltiples que dc
ocurrir en sitios muy Cercanos, y
en hehras apuestas, pueden dar
Algunos antibiticos (mitomicina C) o reactivos qumicos (ion nitrito) pue- lugar a la fragmentacin de la
den d a r lugar a la formacin de enlaces covalentes entre las bases de la misma molcula del ADN.
I I I I 1 1 1 1 hebra o de las 2; esto impide la separacin de las hebras durante la replicacin o
I I I I 1 1 1 1 la transcripcin (Fig. 33.5).

Sistemas de reparaan
Los sistemasde reparacin son de 2 tipos fundamentales: los que dependen de la
luz (fotorreactivacin)y los que nodependen de sta (reparacin oscura). El segundo
tipo incluye 3 niecanismos fundamentales: reparacin por escisin, reparacin por
recombinacin y la respuesta SOS.

Fig. 33.5. Agentes dc entrecruzamiento. Les


agentes q u e producen enlaces En todas las clulas, desde las bacterianas hasta las humanas, ha sido aislada una
covalentes entre las bascs del ADN enzima que interviene en la reparacin del dao causado por la irradiacin con la luz
pueden hacerlo uniendo bases de ultravioleta; eUa cataliza la ruptura de los dneros de timina (los dneros de citosina y
la misma hebra o bases de las he-
bras complementarias. Estos agen-
de citosina-timinase forman en menor proporcin y tambin son reparados por esta
tes son fuertes inhibidores de la enzima) siempre quese produzca una fuerte irradiacin con luz visible (300-600nm)
replieaein y de la transeripei6n. preferiblementeluz solar (Fig. 33.6).

Reparaa6n por eseisi6n

A diferencia del anterior, este mecanismo comprende vanas etapas catalizadas


mediante enzimas que aparecen representadasenla figura 33.7. En el primer caso una
endonucleasa reconoce la distorsin provocada por el dmero de timina y produce la
hidrlisis del enlace fosfodister hacia el lado 5' del dmero.

Fig. 33.6. Reparacin por fotorreaetivacin.


Cuando Is luz ultraviolela prova
ca la formacin de dimeros de
timina y se produce la distorsin
de la doble hlice, sta inferaets
i o n el producto de los genea uvr.
Si la bacleria se expone a la luz, el
sistema se activa y repara el dao
al eliminar los enlaces que provo.
earm la formacin del dimero.
Fig. 33.7. Reparacin por esiisiii. Eii au-
sencia de la luz, los dimcros de
timina son eliminados por la ac-
cin combinada de las endonurlea-
sas qiie cortan la hebra de ADN cn
un sitio prximo a la lesin, la
ADN polimerasa que rellena el es-
pacio que dej el dimero y la lignsa
que le da integridad a la hebra re-
parada.

La ADN pol 1comienza a anadir desoxinucletidos al extremo 3' y produce el


desplazamiento de la banda que contiene al dmero unos 20 nucletidos. El segmento
es hidrolizado por la ADN pol 1o por otras endonncleasas. El segmento separado es
hidrolizado hasta desoxinucletidos simples ms el dmero de timina que es expnlsa-
do de la clula y puede recuperarse en el medio de cultivo. El paso final consiste en
unir el nuevo fragmento a la hebra que se realiza por accin de la ADN ligasa.
La actividad de escisin en la E. colidepende del producto de 3 genes, uvrA, nvrB
y uvrC. Los productos deuvrA y uvrB constituyensubunidadesde una protena com-
pleja con actividad de endonucleasa, el producto de uvrC es necesario para la mxima
actividad in vivo, pero su funcin exacta se desconoce.
El sistema uvr es capaz de reparar lesiones distintas a los dmeros de timina siem-
pre que stas produzcan una distorsin de la hlice.

Reparacin por remmbinaah

El estudio con mutantes descubri que la E. coliposee otro sistema de reparacin


diferente al nvren el cual est implicada la protena RecA ya estudiada en el captulo 31.

Componentes celulares y Gentica moleailar 567


Cuando en la replicacin la ADN pol 111encuentra un dmero de timina, se detiene
unos segundos y despus reinicia la replicacin soslayando la existencia del dmero y
dejando brechas en la hebra hija. De esta forma no pueden producirse clulas hijas
viables, pues las molculas de ADN contendran largas brechas dondequiera que se
encontrara un d'nero de timina; sin embargo, es posible obtener molculas hijas ade-
cuadas mediante un mecanismo conocidocomo intercambio de hebras hermanas.
La idea esencial consiste en que las brechas se llenan con una banda buena de la
otra molcula por un mecanismo similar a la recombinacin (Fig. 33.8).

Fip. 33.8. Reparacin por reronibinacin.


Cuando en el momento d e la
replicacin las ADN polimerasas
encuentran un dimero de timina,
reinician la rcplicaein soslaysn-
do el dmero. Posteriormente, por
un mecanismo de recombinacin
se utiliza el sector no daado de la
otra molcula vsecampleta la ban-
d a neoformada; este mecanismo l l l I I l l 1 l l l l
aunque no elimina el dao, per- LLlA ' ! ! l I !
, ,
-
mite que la molcula se replique y,
que al producirse la divisin celu-
lar, ambas clulas hijas reeihan una
molcula viable de ADN. 1 l / l I l I l 1 I I l
l I I I l

Si al replicarse una molcula de ADN, la polimerasa se encuentra con un dmero de


timina en una hebra, la enzima reinicia la replicacin ms all del dmero, dejando una
brecha en la hebra hija; se produce entonces la invasin de la molcula por una hebra
en buen estado de la otra molcula. En este paso es donde probablemente participa
RecA. La banda invasora es cortada y por la accin combinada de la ADN pol 1y la
ADN ligasa queda incorporada a la molcula, esto hace que aparezca una brecha en la
otra molcula quees reparada por la accin combinada dela ADN polimerasa 1 y la
ADN ligasa.
La reparacin por recombinacin ha sido demostrada en numerosas bacterias,
pero no se conoce si existe en las clulas animales.

SistemaSOS

En este mecanismo se produce la sntesis del ADN de forma continua sobre los
dmeros de timina, por lo cual se obtiene un producto que contiene numerosos errores.
Este sistema no est perfectamente esclarecido, pero al parecer determina una prdida
de la actividad correctora de la ADN pol 111. Muchos genes bacterianos estn
involucrados en la respuesta SOS, de ellos los que mejor se han estudiado son el recA
y el lexA. El gen lexA codifica una protena que acta como regulador de la sntesis de
numerosas protenas, entre ellas de RecA y LexA. Cuando esta proteha est presente (y
normalmente lo est), los genes que intervienen en el sistema SOS estn inactivos, o
sea, muy poco ARNm es transcrito a partir de ellos. En estas condiciones RecA no
presenta actividad proteoltica, sin embargo, cuando la replicacin es bloqueada, la
pequeia cantidad de RecA presente es activada ensu formaproteoltica,para lo cual es
necesario la presencia de segmentos de ADN de una sola banda. Esta actividad
proteultica funciona slo sobre determinadas protenas, una de ellas es LexA que es
hidrolizada en 2 fragmentos que noson capacesdeinhihir lasntesis delos ARNm, por
lo que las protenas del sistema SOS son sintetizadas. Estudios recientes parecen
demostrar que LexA sufre un proceso de autoprotelisiisque es estimulado cuando est
asociada con RecA. Fenmenos similares ya han sido descritos para otras protenas.
Cuando la reparacin se ha completado RecA pasa a su forma inactiva y LexA
vuelve a desconectar el sistema rpidamente.

Reparacin de otros daos


El daocausado por los agentes que provocan la aparicin de enlaces entrecnizados
es reparado con la participacin de los productos de los genes uvr y rec, pero se
desconoce su mecanismo.
La reparacin de las roturas de una banda requiere el concurso de la ADN pol 1y la
ADN ligasa. Estas roturas generalmente se acompaan de alteraciones de las hases
adyacentes con la frecuente formacin de la 5,6,dihidroxidihidrotimina y su separa-
cin requiere dela actividadde una endonucleasa especficadiferente a la utilizada en
la eliminacin de los dmeros de timina. aunaue el mecanismo es similar. cuva existen-
cia ha sido demostrada en casi todos los organismos incluyendo al hombre.
Los mecanismos de reparacin de las roturas en las 2 hebras del ADN han comen-
zado a dilucidarse recientemente y no existe an una visin muy completa del proce-
so, de todas formas es bueno sealar que se trata del tipo de dao ms dificil de reparar.

Alteraciones de la reparacin
En los ltimos aos el estudio de varias enfermedades genticas han llevado a la
conclusin de que en algunas de ellas existen alteraciones del sistema de reparacin
del ADN. En algunos casos parece ser la causa primaria, mientras que en otros se trata
slo de una deficiencia secundaria, por ejemplo, el Xerodermapigmentosum, la ataxia
telangiectsica, el sndrome de Fanconi y el sndrome de Bloom.
El Xerodermapigmentosum es una enfermedad que afecta la piel y el sistema
nervioso. La exposicin a la luz solar en los primeros meses produce eritemas, que
duran varios das, y bronceamiento acentuado. Las lesiones son ms intensas y ms
tempranas en las regiones del cuerpo expuestas al sol: cara, cuello, dorso de las manos,
etctera. La esclerosis drmica progresiva y las contracturas conducen a la deforma-
cin dela boca,los ojos y la nariz. Comnmenteexiste fotofobia con blefaritis,quera-
titis,opacidadesy lceras. Muchos pacientes mueren antes de los 20 aos por neoplasma
cutneo metastsicn. En cultivo de clulas obtenidas de estos pacientes se ha observa-
do una actividad deficiente en cuanto a la reparacin del ADN debido a los daos
causados por la luz ultravioleta. La enfermedad se trasmite como un rasgo autosmico
recesivo.
El estudio de clulas en cultivo procedentes de pacientes con esta enfermedad ha
demostrado que existen al menos 7 grupos de complementacin, lo que equivale a
decir que al menos existen 7 genes involucrados en la cansa de la enfermedad; estos
genes han sido designados XP-A a XP-G y se ha podido determinar que todos los
productos de estos genes participan en los mecanismos de reparacin por escisin de
nucletidos.
En el cncer de colon de tipo hereditario y no polipsico se ha determinado que su
cansa esencial radica en deficiencia del proceso de reparacin del malapareamientos.
La mayorade los casos puedeser ahibuida a mutaciones en los geneshMSH2,hMLH1,
hPMSl o hPMS2, los cuales codifican protenas que intervienen en el proceso de
reparacin.
La ataxia telangiectsicacomienza en edad temprana y a los 10 aos los signos de
ataxia son de una inestabilidad total, con hipotona muscular y abolicin de reflejos
tendinosos, tambin hay un bajo coeficiente de inteligencia.
La telangiectasia comienza entre los 3 y 4 aos de edad, en conjuntiva, orejas y
parte expuesta del cuello. Se constata una disminucin de los niveles de
inmnnoglobulina A. En el cariotipo pueden aparecer variadas aberraciones
cromosmicas. Hay tendencia al desarrollode linfomas, la muertellega en edad tem-
prana del paciente. Los fibroblastos de estos pacientes muestran una evidente dismi-
nucin de la actividad reparadora del ADN,especialmentefrente a radiaciones gamma.
Se trasmite como un rasgo autosmico recesivo. Parece ser que las alteraciones de la
reparacin son secundarias y que el defecto principal radica en la mutacin de un gen
supresor tumoral, al que se ha denominado ATM (siglas del ingls que significan
mutado en la ataxia telangiectsica).
El sndrome de Fanconi tiene como signo ms sobresaliente la hiperpigmentacin
y una disminucin general del nmero de clulas sanguneas (pancitopenia). Los
pacientes presentan baja estatura, tendencia a desarrollar leuceinia. Presentan una
actividad de reparacin del ADN disminuido sobre todo a la accin de agentes que
provocan entrecruzamiento de las hebras. Se trasmite como un rasgo autosmico
recesivo. En este caso tambin parece tratarse de un defecto secundario y el primario
est asociado a mutaciones en varios genes supresores tumorales.
El sndrome de Bloom se presenta ms en los varones que en las hembras. Existe
una evidente fotosensibilidad con aparicin de eritemas persistentes desde el primer
mes de vida. Despus aparecen las telangiectasiasprincipalmente en la cara y el dorso
de las manos. Los pacientes poseen baja estatura, pero no existe retraso mental y son
individuos sexualmente normales. Existe una disminucin de la actividad de repara-
cin del ADN, los linfocitos son particularmente sensibles al sulfonato de etilmetano.
Tienden a desarrollar leucemias. Se trasmite como un rasgo autosmico recesivo. Se ha
reportado recientemente que este sndrome est ligado a mutaciones en el gen de la
ADN ligasa.
Otras enfermedades relacionadas directamente con alteracionesen los procesos de
reparacin son el sndrome Cockaine,la tricotiodistrofia y el sndrome de hipersensi-
bilidad a la luz ultravioleta (UV').
Por ltimo, se ha invocado que una marcada disminucin de la actividad de los
sistemas de reparacin del ADN, pudiera ser la causa principal de las modificaciones
que se observan en los individuosdurante el periodo de envejecimiento; esto se tratar
con mayor detalle en el captulo SS.
Resumen
No existe otra macromolcnia niyaintegridad estructural tenga parala d u l a
el significado vital que tiene el ADN; su conservacin constituye por lo tanto una
actividad principal de la clula, tanto para evitar la contaminacin con ADN for-
neo como para reparar cualquier dao producido en las propias molknlas.
Unas de las primeras caractersticas que contribuyen a la conservacin del
material gen6tico son la propia estmdura del ADN, su asociacin con protenas y
su ubicacin, que en los eueariontes esta separado del resto de la clula por una
doble membrana.
Otro mecanismo lo constituye el sistema de modificacin-restriccin, pues
por una parte permite la ideniraeiu del propio ADN y por otra, la degradacin
de los ADN extraos evitando la contaminacin.
No obstante,el ADN es una molcula que est expuesta a daos como son: bases
mal apareadas, bases perdidas, alteraciones de bases, rotura de una o de las 2
bandas, formacin de enlaces entrecruzados, etc6tera. Para casi todos estos daos
existen sistemas de reparacin que pueden requerir de la exposicin a la luz o no.
La fotorreactivacin, la reparacin por esfisin o por recombinacin son meca-
nismos con los cuales la clula cuenta para enfrentar los daos. El sistema SOS
proporciona un mecanismo de emergencia que slo funciona en caso de daos
graves y aunque permite la sobrevivencia del organismo, da lugar a la aparicin
de mltiples mutaciones.
Algunas de las enfermedadesde los sereshumanos se deben o se acompaan de
trastornos en los mecanismos de renaracin. entre otras. el Xeroderma
pigmeoasum, la ataxia telangieet&sica, el sindrome de Bloom, y el sndrome de
Fanconi. Itimamente se ha planteado la posibilidad de que el proceso de envejeci-
miento est tambih relacionado con una especie de agotamiento de los mecanis-
mos de reparacin del ADN.

Ejercicios
1.A veces durante la replicacin se produce un mal apareamientode bases que noes
detectado por el sistema corrector de la ADN polimerasa 1. Estos defectos pueden
ser reparados Cmo pueden las enzimas distinguir cul es la base mal colocada y
cual es la correcta?
2. Si a una bacteria sele introduce un fragmentodeADN deotra bacteriade la misma
lnea celular jactuar sobre ella el sistema de modificacin-restriccin?
3. Cules son las principales analogas y diferencias estructurales y funcionales
entre los 3 tipos de endonucleasasde restriccin?
4. ;Por qu cree usted que los daos por rotura en las 2 bandas del ADN casi nunca
pueden ser separados?
5. Qu repercusin tendr sobre la replicacin del ADN el tratamientode las clulas
con mitomicina C?
6. &Quimportanciatiene para el mdico el conocimiento de los diferentes mecanis-
mos de reparacin del ADN?
Los seres vivos estn en constante intercambio de materia, energa e informacin
con el medio, sta es una caracterstica esencial de la vida, peroesteintercambio no se
produce de igual manera en todos los organismos.
Las bacterias, por la forma en que viven, estn sometidas a cambios pronunciados
del medio, del cual extraen sus fuentesde sobrevivencia. Los eucariontes monocelulares,
aunque poseen una estructura ms compleja, estn en iguales condiciones.
En los organisnios pluricelulares ms desarrollados no todas las clulas se encuen-
tran expuestas a grandes cambios en la composicin del medio; en el hombre,slo las
clulas del tubo digestivo y el hgado experimentan grandes variaciones en la compo-
sicin del medio; el resto de las clulas del organismo se desarrollan en un niedio de
composicibn prcticamente constante.
Estas condiciones de vida influyen significativaniente en los iiiecanisnios utiliza-
dos por cada tipo de organismo, que le permite adaptarse a los cambios anibientales.
Los organismos monocelulares deben poseer mecanismos que funcionen de manera
rpida, tanto, como cambia el medio; mientras los organismos superiores pueden em-
plear mecanismos de respuesta ms lenta.
La presencia de nutrientes,su tipo y cantidad son algunos de los factores que ms
influyen en la sobrevivencia de un organismo; si ste no dispone de mecanismos
capaces de adaptar su metabolismo,cuando se producen cambios negativos denutrientes
en el medio, perecer en un tiempo ms bien corto.
En este captulo se estudiarn los mecanismos generales de regulacin de expre-
sin de la informacin gentica en los diferentes niveles, que permiten a los organis-
mos adaptarse a las condiciones cambiantes del medio. Se comienza por presentarlos
en procariontes, donde han sido mejor estudiados y posteriormente se hacen algunas
consideraciones acerca de los conocimientos actuales sobre la situacin en los orga-
nismos pluricelulares.

Aspectos generales
Los iiiecanisinos de seleccin natural han idoconservando las formas de vida que
presentan mayor eficiencia. Entre los organismos monocelulares, cualesquiera cambios
pernianente !hereditario que aumenten la eficiencia global del metabolismo celular,
hacen que estos tipos crezcan algo ms rpido que el tipo silvestre. Si se deja pasar un
tiempo prolongado la nueva lnea celular, desplazar totalmente al tipo silvestre.
Por ejemplo, si en una poblacin de 10' bacterias que duplican su nmero en
30 minutos, una bacteria es alterada de forma quesedupliquecada2YJminutos,cii
aproximadamente 80 das de crecimiento continuo, el Y9,9 % de la poblacin ser del
nuevo tipo; este tiempoes quizs muy largoen trminosde trabajode laboratorio, pero
es insignificante en cuanto a tiempo evolutivo se refiere, por lo tanto, sobre esta base
es razonable pensar que los sistemas de regulacin surgieron y se desarrollaron en el
sentido de ganar mayor eficiencia, como consecuencia del proceso de evolucin.
Existen algunas caractersticas ms o menos generales de la regulacin intracelular
que pueden resumirse en las siguientes:

1. Las molculas que ocasionalmente se utilizan, son sintetizadas slo en el momento


para ser empleadas.
2. Una actividad enzimtica que consume energa de manera intil en un momento
dado,o utiliza una sustancia que essustrato de otra reaccin de mayor prioridad,
est frecuentemente inhibida.
3. Cuando existen varias vas posibles de produccin de energa, la clula utiliza la
que produce mayor cantidad por unidad de tiempo.
4. Una alteracin de una va hiosinttica, que reducc la produccin de molculas
deficientes, resulta eficaz y tiende a conservarse.

La caracterstica esencial de estos mecanismos de regulacin es que ellos se co-


nectan y desconectan segn la necesidad. No existen ejemplos de mecanismos que
estn completamente desconectados y siempre existe un nivel basal de fnncionamien-
to. Por comodidad para hacer referencia a un sistema que funciona a su nivel basal, se
dice que est desconectado.
En los sistemas hacterianos, donde varias enzimas actan deforma sucesiva en
una ruta metablica,esfrecuenteel hecho de que, todasestn presentes o todas estn
ausentes; este fenmeno recibe el nombre de regulacin coordinada.
La regulacin de la expresin de la informacin gentica, puede realizarse al nivel
pretranscripcional, transcripcional y postranscripcional; el segundo caso es el ms
frecuente y el ms econmico.

Regulacin transcripcional
Los mecanismos inoleculares para cada sistema de regulacin pueden variar mu-
cho, pero frecuentementese clasifican en 2 grandes tipos: positivos y negativos.
En la regulacin negativa, la clula presenta un inhibidur, cuya accin determina
que la transcripcin se encuentre desconectada. En la positiva, hay molculas que
provocan una activacin del promotor. Las regulaciones positiva y negativa no son
excluyentes, y de hecho existen sistemas que estn regulados por las 2 formas.
En estos casos se hace necesaria la existencia de 2 efectores. Para evitar confnsio-
nes en lo sucesivo, debe tenerse presente la diferencia fundamental entre las 2 formas
mencionadas. En la regulacin negativa la unin del efector (que suele ser una prote-
na) al ADN provoca la inhibicin de la transcripcin, en tanto, que en la positiva, la
unin determina una activacin de la transcripcin.
A continuacin se presenta un estudio ms o menos detallado de los principales
mecanismos de regulacin transcripcional.

Desde principios de este siglo se conoce que la E. colicuando crece, en un medio


que contiene glucosa, no utiliza la lactosa que se aade al medio de cultivo. Si se
trasladan las clulas a un medio carente de glucosa, pero que contiene lactosa como
fuente de carbono, a los pocos minutos las clulas utilizan la lactosa de manera eficien-
te. Si al medio anterior se aade glucosa, a los pocos minutos las clulas dejan de
utilizar la lactosa y continan utilizando slo glucosa.
Si se aaden al mediosimultneamente la glucosa y la lactosa, las clulas utilizan
la glucosa y una vez agotada sta, comienzan a utilizar la lactosa. La primera explica-
cin quese dio a este fenmeno,conocido entonces como adaptacin enzimtica, fue
la existencia en las clulas de precursores inactivos de las enzimas que utilizaban la
lactosa y que sta activaba.
Para investigar la certeza de esta hiptesis se realiz una experiencia que, por su
sencillez y claridad, se expone a modo de ilustracin.
Se tom una colonia de E. coli, se puso a crecer en un medio que contena
["SI-Metionina, al cual no se aada lactosa; despus de algn tiempo las clulas
fueron lavadas y pasadas a un medio con metionina normal, a los pocos minutos se
aadi lactosa; se midi la aparicin de las enzimas activas y cuando alcanzaron un
valor elevado, se homogeneiz el cultivo y se aislaron las enzimas; se midi la radiac-
tividad y se comprob que no contenan azufre radiactivo.
Se repite la experiencia pero incorporando la metionina radiactiva junto con la
lactosa y despus de un procesamiento similar se detecta el azufre radiactivo en las
enzimas. Como se deduce de este experimento, las enzimas no existen como precnrso-
res inactivos en ausencia de lactosa, sino que son sintetizadas totalmente a partir del
momento en que la lactosa es aadida, siempre que el medio no contenga glucosa.
Luego pudo comprobarse que adems de la enzima b- galactosidasa,que hidroliza
el enlace 0-glicosdico de la lactosa produciendo galactosa y glucosa, se produca la Fig. 34.1. Induccin enzimtica. La figurii
representa los resultados de una
induccin de una protena que llamaron galactopermeasa, pues sta forma parte del
experiencia tpica de induceiii de
sistema transportador de membrana para los galactsidos. De manera coordinada se las enrimas del apcrbn lar. Conio
regula la sntesis de las protenas que favorecen el transportedel azcar hacia el inte- se ohserva a los pocos minutas de
rior de la clula y las que comienzan su degradacin. sir aadida la lactosa (1) coriiien-
za la sntesis del ARNm y pustc-
Hoy se sabe que hay una tercera enzima implicada en la induccin, la denominada
riormentr de las encimas corres-
galactosa transacetilasa,cuya funcin en el metabolismo de la galactosa no est total- pondientes. Al retirarse la laitosa
mente esclarecido. 12) eonienzar el descenso de la
A estefenmenomediante el cual la presencia deuna sustancia en el medio provoca concentracin del ARNm que scr6
seguido par una disminucin de
la sntesis de una determinada enzima, o grupode enzimas, se le da actualmenteel nombre
la concentracin de las eniimas.
de induccin de la sntesis de enzimas o induccin enzimtica (Fig. 34.1).
El estudio de distintos microorganismos con medios selectivosha puesto de ma-
nifiesto que la induccin endmtica no es exclusiva de las enzimas del metabolismo
dela lactosa,sino que est presente o relacionada con las endmas que intervienen en
el catabolismo de otros azcares.
Las sustancias capaces de provocar la induccin reciben el nombre de inductores,
stos son metabolizados por la enzima y sus concentraciones disminuyen con el tiem-
po. Existen sustancias, relacionadas estructuralmente con los inductores naturales,
que tienen un poderoso efecto inductor, pero no son metabolizadas por las enzimas,
denominadas inductores gratuito$, cuyo empleo ha contribuido de manera eficaz al
esclarecimientode estos mecanismo$.La estructura de la lactosa que es el inductor del
opern lac y del isopropiltiogalactsido, que es un inductor gratuito son similares
(Fig. 34.2).

Modelo del opern

En 1961,despus de casi 20 aos de trabajo, Francois Jacob y Jacques Monod


del Instiiuto Pasteur propusieron un modelo para explicar el mecanismo molecular por Fig. 34.2. lnductores del oeern lae. En la
el cual se realiza la induccin de lasntesis de protenas. En las pginas siguientes se parte supcrier de la tigura se mues-
ofrece la visin actual del modelo, que lgicamente ha sido enriquecido con nuevos tra la estructura de la laetusa, que
es el inductor natural del opern
aportes desde el monieiito en que fue propuesto.
bc. y en la parte inferior, la de un
En el ADN bacteriano se distinguen varios sectores desde el punto de vista funcio- inductor gratiiito,el isopropiltioga-
nal; aquellos sectores que codifican la sntesis de polipptidos especficos,reciben el lactsido.

Componentes celularts y Guietica molecuiar 575


nombre de genes estructurales, adems por la forma en que fueron identificados y
localizados originalmente, como consecuencia de una experiencia denominada
cis trans, se les da tambinelnombre decistrones; deahsurgen lasdenominaciones
de los ARNm monocistrnicos y policistrnicos (captulo 27).
Adyacente a los cistrones se encuentra otro sector que controla o regula la expre-
sin de los cistrones y recibe el nombre de operador. Como el operador no codifica
ningn polipptid0,ni tampoco un ARN,nose trata de un gen, y para referirse a l se
dice el lociis (sitio) operador. El conjunto de segmentos de ADN compuesto por el
operador y los cistrones que estn bajo su control recibe el nombre de opern; este
trmino tambin proviene de la informtica y se emplea aqu por ser la unidad de
operacin, lo cual significa que cuando el opern se conecta funcionan todas sus
partes como si fueran una sola, igual sucede cuando se desconecta.
Un tercer sector es el promotor, al cual se une la ARN polimerasa.
Por ltimo, se distingue un sector que codifica la sntesis de una protena
especifica, cuya actividad determina el funcionamiento de los cistrones; este
sector recibe el nombre de gen regulador y la proteina por l codificada se deno-
mina protena represora o represor. El gen regulador puede encontrarse adyacente
a los cistrones o alejado de ellos.
El funcionamientodel modelo consisteen: la protena represora es de tipo alostrico
y tiene un sitio de elevada afinidad por el ADN del operador en una de sus 2 conforma-
ciones (la R),mientras que en la otra conformacin (la T) tiene muy poca afinidad. La
unin del represor al operador se produce mediante el reconocimiento de una secuen-
cia especfica de bases de estesector, que forma un coniplejo de elevada estabilidad e
impide de esta forma el desenrollamiento del ADN, que es imprescindible para la
transcripcin. Los inductores provocan el desplazamiento del equilibrio
conformacional del estado R al T.
Como la unin del represor al operador determina la inhibicin de la transcrip-
cin, estamos en presencia de un sistema de regulacin negativa (Fig. 34.3).

Fig. 34.3. hlodela general del oper". En el ADN se encuentran seriicneias ron diferrntcs fuiirioiics:
el gen regulador que codifica a la protena represara; la zona del opcrador-proiiii,tc>r 10-PI
donde se cine el represor y la R N polinierasa, as romo los genes cstrurliirales a ristruiies
que codifican la sntesis de protenm especficas (genernliiiciite cnliiiiasl. Cada oper6ii
posee un nmero caraiteristicu de risfrones.

Se han estudiado numerosos operones inducibles, casi todos relacionados con la


utilizacin celular de monosacridos, aunque no exclusivamente.Si hien es cierto que
cada unoen sus lneas generales se corresponde con la situacin descrita anteriormen-
te, se tieneencuenta que cada uno tienesus particularidades. Para los objetivos deeste
texto se ha seleccionado aqul que, por ser el primero y ms estndiado, ofrece una
visin ms completa de su mecanismo.
Opern lac

La estructura y el funcionamientodel opern lae han llamado el inters de mu-


chos cientficos en los arios posteriores a la proposicin del modelo del opern. En
estos momentos se tiene una visin completa de todo este complejo sistema (Fig.
34.4).

Pares de bases 1111 -70 3 060 800 800

Polipptida Reprsmr - Pgalacrusidasa Perrneaa Acetilasti

Peso rnolecular 38 000 - 125 000 30 000 30 O00

Nmero de arninoScidos 360 1021 -275 - 275

Forma activa Tctrniero Tetrrnero Mcinbriinii Dinrio

Y SU peso 152 000 500 000 30 000 60 1100

Fig. 34.4. Estructura del opern lac. Se muestran las principales caractersticas estructurales del
oper" lae y de sus productos.

La protena represora ene caractersticassimilares a todos los represores conoci-


dos+ trata de un tetrmero formado por subunidades idnticas que presenta una clara
simetra molecular (Fig. 34.5).

Fig. 34.5. Unin represor aperador en el


operii lac. Eii la parte superior se
muestra la estructura primaria dc
la zona del aperador lae con sus
ranas de simetra a color. En la
parte inferior se observan diferen-
tes vistas del complejo formado
entre el operador y el represor del
aper6n lar.

En el promotor se encuentran las secuencias estudiadas en -35 y en la zona de


-4 a -10. El operador, comoera de esperar, presentaunasecuencia repetida invertida
con un centro de simetra, lo que concuerda con la estructura del represor (Fig. 34.5).
El represor lac contiene al menos 2 sitios, uno de ellos le permite la unin al ADN
y el otro, tiene como ligandos pequeas molculas de galactsidos que actan como
inductores. La unin del inductor al represor provoca un cambio de conformacin que
se trasmite a todas las subunidades, haciendo que todas adopten el estado T, cuya
afinidad por el ADN del operador es muy baja. En estas condiciones el represor se
disocia del operador, lo que permite la unin de la ARN polimerasa en el locus promo-
tor y da inicio a la transcripcin. La traduccin del ARNm correspondiente da origen
a las enzimas que degradan la lactosa, con lo cual la concentracin del disacrido
disminuye,provocando la separacin del inductor. Esta separacin hace que la prote-
na adquiera de nuevo el estado R y en esta forma se une al operador, lo que impide la
unin de la ARN polimerasa (Fig. 34.6).

Componentes celulares y Genetica molecuiar 577


A O d NXV
.. . .. . . . .. .
uqaado lap o)uapeuo!aunj [ap ope[Iir)apo ! p w 1
sjesor~elel ap uqpeqgn e1aanpoad
as ou aluasard nsa esoanl8 el !S anb loa? :a>ue8oaaa)ir!eun epanb osad :qaauoasap
El sistema AMPc-CAP sirve como regulador positivo de muchos operones rela-
cionados con la utilizacin de distintos monosacridos, cuando falta la glucosa todos
estos operones estn en condiciones de conectarse, pero slo lo har el que tenga su
inductor presente, debido a que el sistema de transporte de la glucosa y el productor de
AMPc estn acoplados de tal manera que,cuando se transporta la glucosa, no puede
producirse el AMPc y viceversa. Deesta forma los niveles intracelulares del nucletido
cclico son una seal, que indica la ausencia del transporte de glucosa a travs de la
membrana y por lo tanto, la clula debe estar preparada para la utilizacin de otro
monosacrido como fuente de energa.
En resumen cuando existe glucosa en el medio, la clula la usa como fuente de
energa y de carbono, lo que disminuye los niveles celulares de AMPc; si se aade
lactosa (o algn otro monosacrido) no puede utilizarse, pues faltara el complejo
AMPc-CAP, y si se retira la glucosa del medio o se coiisunie toda la existente, los
niveles de AMPc aumentan favoreciendo la formacin del AMPc-CAP de manera que
al aadir la lactosa (u otro azcar) se inactiva el represor y comienza la tranwripcin de
los cistrones.
Como el represor al unirse al ADN inhibe la transcripcin, se trata de un regulador
negativo, pero el AMPc-CAP lo que hace es activar la transcripcin, luego es un
regulador positivo, por lo tanto, en el opern lac (y en otros muchos) existe simult-
neamente un sistema de regulacin que es al mismo tienipo positivo y negativo.

Otro fenmeno relacionado con la regulacin de la expresin gentica surgi con


el estudio de las vas biosintticas en algunas bacterias, especialmente en la E. coli.
Esta bacteria contiene un equipo enzimtico que le permite la sntesis de todos los
aminocidos,para formar sus protenas a partir de una fuente de carbono (puedeser la
glucosa) y una fuente de nitrgeno (cloruro de amonio).
Las rutas biosintticas de algunos aminocidos son comple,jas y requieren de
numerosas enzimas; cuando algunos de estos aminocidos son aadidos al medio de
cultivo se produce un rpido descenso de las concentraciones intracelulares de las
enzima5 relacionadas con la ruta biosinttica correspondiente. Como en el caso ante-
rior, esta disminucin afecta a todas las enziinas involucradas en la ruta, luego se trata
de una regulacin coordinada. Cuando el aminocido es retirado del medio se produce
un incremento de la concentracin de las enzimas; igual que en el caso de la induc-
cin, estas variaciones se deben a cambios en la velocidad de sntesis de las endmas y
no de su actividad.
Este fenmeno, en el cual la presencia de una sustancia en el medio es capaz de
provocar la inhibicin de la sntesis de una enzima o grupos de enzimas, recibe el
nombrede represin de la sntesis deenzimaso represin enzimtica. (Fig. 34.8). A la
sustancia que provoca la represin se le da el nombre de correpresor.
Para explicar el mecanismo de la represin enzimtica se utilizar el mismo niode-
lodel opern descrito antes; se tomar comoejemplo el operu que controla lasntesis
del triptfano en la E. coli, por ser el mejor conocido.

Fig. 34.8. La represiil eiiriiiittiea. La figu-


ra 111ucs11.a10s resultados dr una
esperiencia tipica dc represili
eiicim6lira. donde al asdii- el
coreprcsor ( 4 ) comienza a disini-
La figura 34.9 representa la estructura del opern t1.p.
nuir la cuneentrari<in inti.arelinlar
El gen regulador codifica la sntesis de la protena represora, que es tambin una de la enzima, qinc slo ruelrf a
protena alostrica con sitios especficos de u n i h al ADN del operador. Su unin auiiieiitar al retirar el corcprcsor.
determina la inhibicin de la transcripcin y con ello sesuprime la sntesisde enzimas, Estos cambios de eancetitraciii
ohedcecn a variaciones eii la sin-
luego se trata de un sistema de regulacin negativa.
tesis de la enzinia.

Componentes celulares y Genttica moleculm 579


Pares de bases

Polipptida Guia
\ Atranilato/ Indol-glicerol-P
\
T"ptfano
/
sintetasa sinletasa sintetasa

Peso molecular 60 000 60000 45 O 0 0 50 000 29000

Fig. 34.9. Eslruetura del opern trp. En la figura se muestran las principales caractersticas estructu-
rales del o ~ e r nIrD Y de sus oroduetos. La zona o~erador-promotor(PIO) no est bien

A y B las subunidades de la triptfano sintetasa. Los sitios t son terminadores de los cuales
existen 2 al final del apern.

La diferencia con el sistema del opern lac estriba en que en este caso el
represor se sintetiza en forma inactiva (conformacin T), que presenta muy poca
afinidad por el ADN.
La unin del correpresor provoca un cambio de conformacin que aumenta ex-
traordinariamente la afinidad por el ADN y favorece la unin con el operador; este
correpresor result ser el propio triptfano.
Cuando la clula no dispone de triptfano exgeno, su concentracin intracelular
es tan baja que no hay posibilidades de unin con el represor y,por lo tanto, los genes
son transcriutos de forma continua. La adicin de triutfano al medio aumenta brusca-
mente su concentracin intracelular, favoreciendo su unin al represor y con ello la
inhibicin de la transcripcin. La utilizacin intracelular del triptfano disminuye su
concentracin, volvindose a la situacin inicial (Fig. 34.10).
Existen varios operones represibles bien estudiados y en lneas generales con-
cuerdan con el presentado en este texto, aunque como era de esperar tienen algunas
caractersticasespecficas.

Fig. 34.10. Funcionamiento del opern frp. El apcrn frp funciona de acuerdo con la disponibilidad
del triptbfano. Cuando no existe triptfano en el medio celular (A), el represor es inactivo
v no ~ u e d funirse al ooerador. lo cual ocrmitc aue se realice la transcripcin de los zenes del

del ARNm correspondiente


ua uimv p p alq!anper] ou euoz el UOJ apuodsauo~anb'? eqal e[ UOJ epeuS!sap euoz
e m alspra u?rl. rauqd la h ropeiado la arlua '6.b~ei&g el ua enrasqo as ouio3
El ARNm del opern trp comienza aser ledo por el ribosoma, al llegar al pptido
gua, como la concentracin de triptfano es elevada, estos codones son ledos sin
dificultad y el ribosoma avanza a su velocidad normal, sobrepasando las zonas 1y 2
del ARNm conductor; como la zona 2 no puede formar pares de bases con la 3, sta
h r m a apareamiento con la zona 4 y se constituye la estructura necesaria para la termi-
nacin de la transcripcin.
Por lo tanto, a elevadas concentraciones intracelulares de triptfano, en caso de
que la transcripcin se inicie,sta termina antes de que comience la transcripcin de
los cistrones.
A bajas concentracionesintracelulares de triptfano, cuando el ribosoma llega a la
sntesisdel pptido gua, su movimiento se "atasca", pues no hay trp-ARNt disponible.
Esta evidente reduccin en la velocidad del ribosoma produceun secuestrode lazona
1,pero deja libre la 2 que forma pares de bases con la zona 3. La formacin del brazo
2-3 impide la formacin del apareamiento 3-4 y, al no producirse esta estructura, la
transcripcin contina (Fig. 34.1 1). A la secuencia de bases que origina la estructura de
terminacin en la zona conductora se le conoce como secuencia atenuadora y es por
ello que el mecanismo en general recibe el nombre de atenuacin.
En el caso de estas enzimas hay un doble mecanismo de control, al nivel del
represor y al nivel del atennador; es posible que en determinados momentos uno de
ellos no funcione, pero siempre existe la seguridad del fiincionamiento del otro. El
sistema del atenuador ha resultado ser ms general de lo que se pensaba, ya han apare-
cido varios estudios de secuencias de pptidos guas para diferentes sistemas, incluso,
el sistema gentico que controla la sntesis de las enzimas relacionadas con la sntesis
del aminocido histidina se controla slo por el mecanismo de atenuacin.

Eficiencia del promotor

Las enzimas que no son inducibles ni reprimibles y por tanto su concentracin


celular es prcticamente constante, a lo largo de todo el ciclo celular, reciben el nom-
bre de enzimas constitutivas. El hecho de que su concentracin intracelular no vare
con el tiempo es un ndice de que su sntesis se produce de forma continua; en estos
casos, la transcripcin es ininterrumpida, pues la vida media de los ARNm es muy
corta, es de esperar entonces, que todas las enzimas constitutivas estuviesen a la misma
concentracin; pero esto noocnrre realmente, lo que se mantiene constante a lo largo
del tiempo es la proporcin entre las distintas enzimas constitutivas, aunque cada una
de ellas presenta su concentracin caracterstica.
La clave del problema est en que no todos los promotores funcionan con igual
eficiencia. Existen los llamados promotores fuertes, que se transcriben con mayor
facilidad un nmero mayor de veces durante el ciclo celular. Debido a los factores
relacionados con su estructura existe una elevada afinidad entre la ARN polimerasa y
las secuencias especficas del promotor. La unin de la enzima con el ADN origina
rpidamente un promotor abierto de elevada estabilidad, y la transcripcin es inmedia-
ta. En otros casos los promotores son dbiles, se transcriben muy poco. La afinidad de
la ARN polimerasa es muy baja por el promotor, y la formacin de un promotor abierto
estable es un evento poco frecuente, slo en los casos en que esto ocurre se logra la
transcripcin.
Por supuesto, pueden darse todas las situaciones intermedias; como cada prorno-
tor funciona como promedio un nmero fijo de veces por unidad de tiempo caracte--
rstica de cada uno de ellos- la concentracin de cada enzima depender de sta, sin
embargo la relacin de concentraciones se mantiene invariable.

Este tipo de regulacin, aun cuando es posible, es al parecer mucho menos fre-
cuente. Hay pocos casos esclarecidos donde la regulacin se exprese por variaciones
en el mecanismo de la traduccin, una vez formado el ARNm correspondiente.
El caso ms esclarecidoes la regulacin de la sntesis de las protenas que forma
parte de los ribosomas en los procariontes, que como se vio en el captulo 29 se
encuentran organizados en 7 operones.
Es necesario recordar que estos organismos carecen de envoltura nuclear y por
ello la transcripcin y la traduccin estn vinculadas directamente. Para formar los
ribosomas son necesarias las sntesis de los ARNr y de las diferentes protenas, por lo
que deben ocurrir la transcripcin de los ARNm correspondientesa cada uno de los
operonesy su posterior traduccin.
Como cada tipo de ARNr se une a un grupo especficode protenas durante el
proceso de "autoensamblaje" del ribosoma, debe existir una adecuada proporcin
entm el nmero de ambos ipmde molnilas. Cuando se "ensamblan" muchos r i h m a s ,
el nmero de ARNr empieza a disminuir y puede existir una superproduccin de
proteinas ribosomales, las protenas que controlan la expresin de cada uno de los
operonesse unen al ARNm correspondiente impidiendo la traduccin. Slo si apare-
cen ms molculas de ARNr, puede continuar la traduccin, de lo contrario sta se
mantiene inhibida (Fig. 34.12).

Fig. 34.12. Regulaein de la sntesis de protenas ribosomales. Para la formacin de los "bosomas se
requierc de la sintesis de los ARNr y las protenas en la proporcin adecuada. Si se produce
un exceso de protenas, stas se combinan con su propio ARNm e inhiben la traduccin.

Regulaan en eucariontes
Los sistemas reguladores eucariontes pluricelulares son algo diferentes a los
procariontes. La existenciade la membrana nuclear hace al ADN menos sensiblea los
cambios que se producen en el citoplasma y en el medio. Los requerimientos de las
clulas en organismos pluricelulares son muy diferentes de los procariontes. Las clu-
las embrionarias por ejemplo, se multiplican rpidamente, en tanto las clulas del
organismo adulto en ocasiones slo requieren nutrientes para su mantenimiento, pues
se dividen en casos excepcionales o nose dividen en absoluto.
Los estudios en eucariontes se dificultan por no existir tcnicas que produzcan y
aslen mutantes,separen y manipulen genes, as como extraer y purificar molculas de
ARNm especficas. En estos aspectos se ha avanzado mucho en la ltima dcada,
gracias a la introduccin de los procedimientos de la tecnologa del ADN recombinante.
Por otra parte, la dilucidacin de algunos mecanismos reguladores de la expresin
gentica en eucariontes indica que son numerosas la5 formas en que este fenmenose
realiza.
Las caractersticas de la organizacin del genoma de los eucariontes, la existencia
de la cromatina, la elevada proporcin de secuencias no codificantes, la existencia de
mecanismos que permiten el reordenamiento de los genes eucariontes y la misma
estructura del gen contribuyen a aumentar las dificultades en el estudio de sus meca-
nismos de regulacin.
A diferencia de los procariontes, existen varios nivelesde regulacin en los orga-
nismos pluricelulares que se expresan de forma diferente en los distintos tipos de
clulas, y que estn relacionados con las distintas etapas del proceso de expresin de
la informacin gentica.
Un primer nivel de regulacin viene dado por la seleccin de los genes que deben
transcribirse en un momento dado en cada clula. Durante mucho tiempo se pens que
la diferencia entre la eucromatina y la heterocromatina no era slo un aspecto de
apariencia tintorial; hoy sesabeque en la eucromatina estn contenidos los genes que
se transcriben de forma activa, mientras la heterocromatina presenta los genes que
estn silenciados. El ejemplo ms sobresaliente se da en el par de cromosomas sexuales
de la hembra; slo uno de los cromosomas X es activo, mientras el otro aparece fuerte-
mente "empaquetado" y puede observarse como un corpsculo que recibe el nombre
decuerpo de Barr, en lasclulasde las hembras.

Regulacin preir~oscripcional

Los genes que se encuentran en copia nica pueden ser suficientes para producir
una lenta acumulacin de protenas; por el contrario, una acumulacin ms rpida de
protenas se logra en el caso de genes de copias mltiples, hecho ste que es habitual
en el genoma. Sin embargo, en algunos casos ocurre la amplificacin de un gen o
conjunto de genes, como sucede en algunas clulas germinales o en las que desarrollan
resistencia a determinados frmacos.
El ejemplo mejor conocido se produce en los ovocitos del Xenopuslaevis, donde
los genes para los ARNr se incrementan unas 4 000 veces. La clula precursora del
ovocito contiene aproximadamente S00 genes para los ARNr, que despus de la ampli-
ficacin llegan hasta cerca de un milln, lo cual representa e1 75 % del ADN nuclear;
esto permite al ovocito sintetizar 10" ribosomas necesarios para la gran cantidad de
protenas que debe formar durante el perodo inmediato despus de la fertilizacin, en
este tiempo de apenas 3 semanas el nmero de nuclolos se incrementa de uno a varios
centenares.
Este ADN aparece como pequeas estructuras circulares que se replican mediante
crculos rodantes, aunque el mecanismo exacto no est totalmente esclarecido; cada
crculo puede contener varias copias de los genes de los ARNr.
Una vez queel ovocito ha madurado, el ADN circular esdegradado lentamente.
Despus de la fertilizacin el ADN cromosmicose replica y ocurre la mitosis repetida-
mente, mientras el embrin se desarrolla; sin embargo, el ADN extracromosmico no
se replica y este factor unido a su lenta degradacin hacen que al alcanzarse el nmero
de algunos cientos de clulas, este ADN amplificado ya no exista.
La amplificacin de los genes para los ARNr se ha observado en gran nmero de
organismos entre ellos insectos, anfibios y peces. En los mamferos este mecanismo
est muy asociado con el fenmeno de resistencia a determinadas drogas; stas actan
habitualmente como inhibidores enzimticos. Se han reportado cerca de 10 enzimas
cuyas concentraciones intracelulares aumentan mucho, debido a la amplificacin de
sus genes y de esta forma pueden soslayar la inhibicin, haciendo que la clula sea
resistente a la accin de la droga; un caso tpico de esta situacin se discute en el
captulo 84. Por ltimo, es interesante sealar que el mecanismo de amplificacin
gnica parece ser el responsable de la aparicin de algunos tumores malignos cuando
el gen amplificado es precisamente un oncogn.

Sin embargo el nivel ms estudiado es el transcripcional, especialmente el de la


ARN polimerasa 11que sintetiza los ARNm. El promotor de estos genes es complejo y
presenta una estructura modular con 2 tipos de elementos principales. Cerca del sitio
de iniciacin de la transcripcin se encuentra el elemento central del promotor, que en
muchos casos contiene la secuencia consenso TATAAT y es el sitio de unin de los
factores generales de transcripcin (captulo27). Ms hacia la izquierda estos promo-
tores contienen varias secuencias denominadas elementos distales del promotor, que
tambin son sitio de unin de protenas y son diferentes para los distintos genes
transcnptos por la ARN polimerasa 11. La unin a estos sitios de protenas especficas
en unos casos produce un incremento de la transcripcin, o sea, se produce el fenme-
no de la induccin, mientras que en otros casos hay un decremento de la intensidad del
proceso, que implica represin. A diferencia de los procariontes, donde los nutrientes
son esenciales en la regulacin, en los organismos superiores las sustancias determi-
,. .
nantes son mensaieros aumicos como las hormonas. aue oor variados mecanismos
e

favorecen la unin de esos factores de transcripcin guico-especficosa sus sitios


correspondientes; as, la insulina favorece la unin de una protena especifica en el
gen de la glucoquinasa en el hgado y en las clulas P del pncreas, lo que induce la
sntesis deesta enzima.
La complejidad del promotor permite que a ste se unan protenas que pueden
tener efectos contrarios sobre la transcrincin. cuando esto sucede una de ellas es
dominante sobre la otra; por e,jemplo,el gen de la fosfoenolpirvico carboxiquinasa
del hgado contiene 2 sitios de unin para el receptor del cortisol, que acta como un
factor gnico especfico y estimula la transcripcin del gen. Ms hacia la izquierda,
tambin presenta un sitio de unin para la protena activada por la insulina, esta unin
inhibe la transcripcin. Cuando las 2 protenas se encuentran unidas se produce la
inhibicin del proceso, lo cual significa que la accin de la insulina es dominante
sobre la del cortisol.

Tambin el procesamiento del ARN es un punto de control. El caso mejor conoci-


do se da durante la diferenciacinsexual en la Drosophila melanogaster, pero por su
complejidad no ser estudiado en este texto. Tambin se ha sealado que puede ser un
punto de regulacin el transporte del ARNm del ncleo al citoplasma, pero losmeca-
nismos involucrados en el proceso no estn perfectamente esclarecidos.
Una vez en el citonlasma. el ARNm se une a orotenas v se mantiene almacenado
hasta el momento de la traduccin. Algunos ARNm presentan secuenciasespecficas a
las cuales se unen protenas reguladoras que estimulan o inhiben la traduccin, segn
sea el caso; el ejemplo ms conocido es los ARNm de protenas que estn relacionadas
con el metabolismo del hierro. Por otra parte, son numerosos los factores de traduccin
que sufren ciclos de fosforilacin-desfosforilacin durante la vida celular y esto puede
indicar aue estn sometidos a mecanismos de re!zulacin.
Por ltimo, existen mecanismos que regulan el destinofinal de las protenas sinte-
tizadas. Todos los estudios realizados sealan que las protenas contienen secuencias
especficas de aminocidos o estructuras tridimensionales tpicas que indican su lugar
de destino: el citosol, el ncleo, los organitos citoplasmticoso el espacio extracelular.
Todos estos mecanismos estn bajo intensas investigaciones, y es de esperar que
en los prximos arios se pueda contar con una visin mucho ms aproximada de los
mecanismos que regulan la expresin de la informacin gentica en los organismos
superiores, especialmenteen el hombre.

Resumen
La dependencia manifiesta que existe entre los organismos vivos y el medio
donde se desarrollan trae aparejada la neeesidad de la existencia de meeanismos
de regulacin de la expresin de la informacin gentica, que permite la adapta-
cin del complejo metabiieo celular a los cambios constantes del medio. Estos
mecanismos difieren de acnerdo con el tipo de organismo que se irate, ya que estos
pueden estar expuestos a mayores o meuom variaciones de las caractersticasdel
medio, sobre todo con respecto a la obtencin de nntrieutes.
En general estos mecanismos de regulacin se caracterizan por la sntesis de
una protena especfica, slo cuando es u&, la inhibicin de actividades
enzimeticas que representan un mayor gasto de energa o una mayor produccin
de deshechosy vas productoras de mayor cantidad de energa metablica en tiem-
pos menores. Otra caractersUca relevante es la existenda de la regulacin eoordi-
nada que permite ejercer de manera simulinea el mecanismo sobrevarias enzimas
que intervienen en la mirmia secuencia metablica.
La regulacin de la expresin gentica puede rralizarse en 3 niveles funda-
mentales: pretranseripcional, transcripcional y posbanscripcional. El primero
est poco eshidiado y su ejemplo ms fehaciente es el mecanismo de amplicacin
gnica que tiene lugar en algunas clulas de organismos superiores.
El nivel transcripcionai se refiere a los mecanismos que actan directamente
estimulando (positivo) o inhibiendo (negativo) la sntesis de los ARNm. En
proeariontes existen 2 variantes: las induccin y represin enzimticas y la atenua-
cin.
La induccin enzimtica se caracteriza porque la presencia de una sustancia
(inductor)estimula la sntesisde protenas esflcas; en la represin la presencia
de determinada susiancia (compresor) provoca la inhibicin de la sntesisde pro-
tenastambin espeeiscas. Estas 2 situacionesrecibieron una explicacin mole&
con la aparicin del modelo del operu, segn el cual en el ADN celular pueden
disnguirse diferentes sectores funcionales: el gen regulador, el promotor, el ope-
rador y los genes estnichuaies (cishones).
El gen regulador codifica la protena represora que se une al operador y
bloquea la sntesisde los ARNm. La interaccin del represor con molcuias peque-
as puedehacer que ste se separe del operador (induccin)y, con ello, se comience
la sntesis de ARNm, o por el contrario puede ser n d a esa interaccin para
que el represor pueda unirse al operador (represin), con lo cual la sntesis de
ARNm se inhibe.
La atenuacin se caracteriza por la existencia de una zona del ARNm Uamada
gua (leader) que contiene varios d o n e s para un aminodcido determinado; si al
traducirse esa zona el amino6cido est abundante en la clula, la transcripcin se
inhibe, en caso contrario conma.
Muchos operones de induccin requieren adems la participacin del comple-
jo CAP-AMPc para poder funcionar an en presencia del inductor.
El ejemploms sobresalienteen proeariontes de regulacin postranscripcional
es la sntesis de protenas nbosomales, las cuales actan como inhibidores de su
propia formacin.
La regulacin de la expresin gentica en los eucariontes plnriceluiares resul-
ta mucho ms compleja que en los unicelulares. La zona de transcripcin est
relacionada con la eummatina, la cual se transerihe de forma activa, mientras la
betero~~umana apenas lo hace. Los genes tranSrritos por la ARN polimerasa 11
presentan promotores complejos que permiten la unin no slo de los factores
generales de transcripcin, sino, adems, de fadores gnico espe&cos que unas
veces estimulan el proceso y otras veees lo inhiben. De esta forma se reazan en
estos organismoslos fenmenosde induccin y represin de la sntesis de protenas.
En ocasiones, un mismo gen puede estar bajo el efecto de los 2 tipos de factores
(setivadores e inhibidores) y en esos ess<w el efecto de uno de ellos predomina sobre
el otro.
Tambin parreen ser puntos de control el procesamientodel ARNm y su trans-
porte hacia el citoplasma Tambin exisien indicios de repuiacin al nivel de la
traduccin y del m&mu por el cual las protenas sintetizadas alcanzan su
desno final. Los estudios que se realizan en estos momentos auguran que en los
prximos aos se tendr una informacin ms detallada de los mecanismos de
regulacin de la exprrsi6n gentica en los organismossuperiores, especialmente en
el hombre, tal vez eUo pueda contribuir a su bienestar y felicidad.

1. ;Qu repercusin podra tener sobre el mecanismo de regulacin del opern lac,
una mutacin en el gen regulador que produjera una modificacin en la conforma-
cin de la protena represora? Discuta por lo menos 2 alternativas.
2. ;Cmo podra afectarse el funcionamientodelopern lac,si ocurriera una muta-
cin en la zona del operador-promotor? Discuta al menos 3 posibilidades.
3. Cmo repercutira sobre el funcionamientodel opern lac una mutacin que diera
origen a la aparicin de un codun de terminacin en la zona central del cistrn de
la p- galactosidasa?
4. ;Qu caractersticasdebe poseer una sustancia para poder actuar como inductor
gratuito de un opern determinado?
5. Si en la zona gua del ARNm del opern trp ocurriera una niutacin, que diera lugar
a la aparicin de un tercer codon para el triptfano,;influira esto en la sensibilidad
del mecanismo de atenuacin a los cambios de concentracin del aminocido en la
clula?
6. ;Cmo puede el mecanismo de amplificacin gnica regular la sntesis de prote-
nas especficas?
7. Cree usted que el mecanismo de regulacin postranscripcional utilizado en la
sntesis de protenas ribosomales pudiera ser igualmente efectivo en otras protenas
conjugadas?
Entre las ciencias terica y tcnica existe una relacin dialctica. La teora busca
el conocimiento de las leyes generales de la naturaleza a partir del estudiodetallado de
numerosos fenmenos, en tanto, la tcnica persigue el objetivo de convertir esos
conocimientos en instrumentos prcticos vinculados directa o indirectamente a la
produccin material.
Esta interaccinse ha hecho tan evidente en las ltimas dcadas, con la aparicin
de la revolucin cientficotcnica,que ha llevado a formular la tesis de la conversin
de la ciencia en una fuerza productiva; pero existe tambin la relacin inversa, o sea,
los avances tecnolgicos tambin contribuyen, de forma considerable,al desarrollo
de la ciencia terica con la produccin de instrumentos que alcanzan cada vez un
grado ms elevado de perfeccin y que sirven para profundizar an ms en el
conocimiento de la naturaleza. A esta situacin no escapan algunos campos, al parecer
tan alejados, de la vida prctica como la gentica molecular.
Existen muchos ejemplosde como en los ltimos 40 aos, el desarrollo tecnolgico
ha conducido a gigantescos pasos de avance en el conocimiento de la biologa
molecular. La difraccin de rayos X permiti a los investigadores tener una visin
detallada de la estmctura de las macromolculas,ascomo la tcnica de centrifugacin
en gradientes de densidad de CsCl abri las puertas al conocimiento del mecanismo de
replicacin del ADN. La adquisicin ms reciente lo constituyela tcnica para unir
molculas de ADN in vitro,denominada tecnolw'a del ADN recombinante. Esta tcnica
bsica y sus mltiples variantes han revolucionado el estudio de la gentica de los
eucariontes y ha proporcionado fuentes de protenas especficas en cantidades
consideradasanteriormentecasi imposible.
En este captulo se estudiarn los procedimientos generales de esta tecnologa y
algunas implicacionesde sus procedimientos, en especial aqullos que ms vinculados
estn con la prctica mdica. No se pretende, ni mucho menos, hacer un anlisis
pormenorizado de este tema,qne por lodems esten constante crecimiento,ni siquiera
dar una descripcin de sus mltiples procedimientos. El objetivo principal es dar a los
lectores una idea de cmo estos conocimientos del nivel molecular de la biologa
pueden ser utiluados en la prctica.

Piocedimiento general
Existen numerosos procedimientos para la manipulacin de los genes, de
acuerdo con los objetivos que se persigan. Un procedimiento general para la
Obtencin de genes especficos
El mayor impactode esta tecnolg'a fue sobrelos mecanismos de las clulas eucariotas,
por eso slo se har referencia a la obtencin de genes eucariontes en forma simplificada,
pues en ocasiones, la complejidad del proceso rebasa los lmites de este texto.
El primer intentodeobtencin de ungen eucariontefue directamentede laclula; se
extraan las molculas de ADN y seexponan a la accin de una enzima de restriccin; los
fragmentos quese obtenan solanser muy grandes y eranecesario volver afragmentarlos
medianteunaendonucleasa con especificidad diferente a la primera; esto poda repetke
varias veces basta obtener fragmentos de tamao adecuado para su manipulacin. El
estudiode los puntos de corte de varias enzimas sobre una molcula de ADN origina los
h d o s m a p a s de restriccin, queconsisten en la representacin dela molcula de ADN,
sealando los puntos donde es cortada por cada una de las endonucleasas ensayadas;
cuando se tem'a el fragmento deseado se proceda a su insercin en un vector. Pero este
procedimiento no dio los resultados esperados; a partir de experienciasde este tipo fue
que quedaron establecidos el carcter disconnuo de los genes eucariontes y la existencia
de los intrones; estas caractersticasentorpecan la expresin de los genes eucariontesen
bacterias.
El segundo procedimiento consisti en aislar no al geu,sino al ARNm transcrito a
partir de l, para ello generalmentese seleccionaba una clula especializadaen la sntesis
de determinadaprotena, de manera que la concentracindel ARNm fuera lo ms elevada
posible, por ejemplo, los reticulocitos para el ARNm de la globina, las clulas P del
pncreas para ARNm de insulina, etctera. Este proceder tiene la ventaja de que ya han
sido eliminados los intrones. Para la obtencin del gen se incuban el ARNm con
los 4 dNTP y una enzima que se obtiene de retrovirns, que es capaz de formar una
molcula de ADN tomando como molde una de ARN, por lo cual se le ha denominado

ADN comolementario (ADNcL .,en el cual se conserva la informacin necesaria Dara la


sntesisde protenas, pero se han eliminado los intrones y, por lo tanto, no se requiere del
procesamiento del transerito primario.
El tercer procedimiento consisteen hacer la sntesis artificial del gen; en estos casos
se parte de la kuencia de aminocidosdel pptido, pues la sntesis de ADN muy largos
no ha sido posible an, y se deduce la secuencia de bases del ADN mediante el cdigo
gentico.
Esta secuencia no necesariamente es igual a la del gen natural debido al carcter
degeneradodel cdigo. Por procedimientoscomplicados de sntesis artificial se logra una
copia del gen con la secuencia de bases especficas.

Para el proceso de recombinacin Ni vitroson necesarias las enzimasde restriccin,


que ya fueron estudiadas en el captulo 33. A los efectos de este procedimiento se
tendrn en cuenta slo 2 tipos de enzimas, aqullas que al producir el corte sobre
las 2 hebras del ADN lo hacen de forma que originan pequeos fragmentos
monofbrilares, y las que cortan en el mismositio las2 hebras sin dejar en el producto
este tipo de fragmento; esta distincin se hace porque, de acuerdo con el tipo de
enzima empleada, el procedimiento que se debe seguir ser diferente.
En el primer caso se opera de la forma siguiente: se extrae el ADN de la clula y se
digierecon una enzima de reshiccin,sea laEcoR1,deesta formase obtienen numemros
fragmentos. El vector que se va a emplear se digiere igualmente con la misma enzima;
se trata de que el vector empleado slo tenga un sitio sensible a la accin de la
endonucleasaempleada;despnsseincubanjuntas las 2mnestras de ADN para permitir
su recombinacin y se aade ADN ligasa para sellar las brechas y dejar la molcula
insertada en el vector (Fig. 35.2).
En el segundo caso se requiere de una enzima que es algo excepcional y que se
obtiene de algunos tejidos animales, se trata de la nuclwtidil transferasa terminal, la
cual es una ADN polimerasa que aiiadedesoxinucletidos(a partir de WTP) al exiremo
3 ' - 0 H de un fragmento de ADN de cadena simple, con el hecho sobresaliente de que
no requiere un molde para su accin.

Componentes celulares y Genetica moiacuiar 591


La recombinacin in vitrotambin ha permitido un modo relativamente fcil para
la obtencin de genes. En ocasiones es ms sencillo trabajar con el genomacompleto
que con un gen particular, sobre todo si este ltimo es desconocido; eso se logra de la
forma siguiente: se extrae el ADN celular y se corta en fragmentos,utilizando enzimas
de restriccin en fases sucesivas hasta que los fragmentos tengan un tamao de fcil
manipulacin, estos fragmentosse aslan unos de otros y cada uno es recombinado con
un ADN viral, generalmente de fagos. Las colonias de fagos bien identificadas se
conservan, y pueden servir para la identificacin de genes especficos; a esta coleccin
del genoma de una clulaen fragmentosguardados en vectores especficos,casi siempre
en virus, se le da el nombre de genoteca.
Cmo buscar un gen en una genoteca? Existen varios procedimientospero slo
se har referencia a uno de ellos, un ejemplohipottico ser ms ilustrativo. Suponga
que un tipo de bacterias sintetizaunasustancia P& que es necesaria para so crecimiento
y reproduccin, se obtiene un mutante de fenotipo Pq, que no sintetiza esa sustancia;
si se tiene una genoteca de la bacteria Pq+se puede aislar el gen mutado, para ello haga
crecer las bacterias Pq-en varias colonias aadiendo al medio de cultivo la sustancia
Pq, luego infecte cada una de las colonias con un virus de la genoteca portador de un
fragmento del ADN. Si se elimina la sustancia Pq del medio de cultivo, slo podrn
crecer aquellas bacterias que han incorporado de la genoteca el gen mutado. Como el
fragmento est identificadopuede fragmentarsecon enzimas de restriccin y hacer una
suhgenoteca,que vuelve a probarse en otros cultivos, y as sucesivamente hasta obtener
el gen que se busca. Por un procedimiento similar a ste se pudo descubrir y aislar el
oncogen ras.
Otros procedimientos de recombinacin in vitro no sern discutidos.

En el acpite anterior se him referencia a los vectores; se entiende por vector a una
molcula de ADN que se emplea para introducir el gen deseado en una clula. Para que
un vector sea til debe reunir las condiciones siguientes:

1. Debe ser cauaz de reolicarse.


2. Debe existir algn procedimientopara detectar su presencia.
3. Debe haber alguna forma de introducir el vector en una clula.

Los 3 tipos fundamentalesde vectores empleadosen estos procedimientosy que,


por lo tanto, cumplen estos requisitosson los plsmidos, algunos virus- especialmente
los hacterifagos-y los llamados cromosomas artificialesde levadura.
Los plsmidos son molculas circularesde ADN extracromosmico encontradas
en muchas bacterias y en algunas especies de eucariontes. Muchos plsmidos contienen
genes que son esenciales en determinados medios; por ejemplo, los plasmidos del tipo
R contienen genes que aportan a la clula la resistencia a determinadosantibiticos,
que pueden aparecer en el medio por accin humana o por la presencia de otros
microorganismosque los producen. Los pIsmidos de ste y otros tipos son generalmente
identificados por los genes que portan, sin embargo, en ocasiones, el plsmido es
encontrado de manera accidental como una peqnea molcula circular de ADN presente
en una muestra aislada de un extracto celular.
Los plsmidos tienen por lo regular una sola molculade ADN, cuyopesomolecular
est entre lo6para los menores y 108para los mayores.
Los plsmidos slo pueden replicarsedentro de su propia clula, pero la forma en
que lo hacen no es necesariamente igual a la que se utiliza en los cromosomas, incluso
2 plsmidos de una misma clula pueden tener formas distintas de replicacin. Se
pueden distinguir 2 tipos de plsmidos de acuerdo con el control de su replicacin: los
de control estricto y los de control relajado; los del primer tipo existen en muy pocas
copias por clula y su replicacin se realiza junto con el ADN cromosmico, y al
dividirse la clula se reparten de forma equitativa entre las 2 clulas hijas, y los del
segundo tipo existen en un nmero mayor y su replicacin es independientede la del

Componenees celulares y Gen6tica molecuiar 593


ADN cromosmico. Si se inhibe la sntesis de protenas,estos plsmidos se multiplican
rpidamente y pueden llegar a haber cientos por clula por lo que son preferidos para
ser empleados como vectores.
Muchos plsmidos pueden transferir una rplicade ellos desde una clula donante
a una receptora; por ejemplo, si una sola clula de E. co que contieneel plsmidoF se
aade a un cultivo de clulas tipo F-que no contengan el plsmido, despus de varias
generaciones una gran proporcin de clulas contendr el plsmido F, o sea, se ha
realizado la transferenciade una rplica del plsmido F, de una clula F'a una clula
F-,sin que la clula inicial haya perdido el suyo. Como despus de la transferencia,F
se replica, con cada transferencia aparecen ms clulas donantes y como el fenmeno
ocurre 1 a 2 veces por generacin, el plsmido se propaga rpidamente en el
cultivo. Estas caractersticas de los plsmidos, as como su posibilidad de
conjugacin (captulo 31) hacen de ellos unos magnficos portadores de genes
para la tecnologa del ADN recombinante.
Los dems vectores ms empleados son los virus, stos se encuentran formados
por una molcula de ADN y una cubierta de protena$. Cuando un virus se aade a un
cultivo bacteriano, ste se fija a la pared celular e inyecta su ADN al interior, en tanto,
las protenas de la cubierta quedan fuera, como se muestra en la figura 35.4.
Dentro de la clula el virus utiliza el aparato metablico de sta para la replicacin
de su ADN y la sntesis de las protenas virales, de manera que con un solo virus que
penetre en una clula pueden obtenerse cientos de copias del ADN viral, que despus
puede recuperarse con relativa facilidad.
Los cromosomasartificiales de levadura son grandes molculas de ADN, que se
construyen con los centrmeros y los telmeros de cromosomas de levaduras y
segmentos de ADN extrao; tambin contienen las secuencias necesarias para la
replicacin. El criterio de seleccin del vector est determinado esencialmente por el
tamao del gen deseado. Los plsmidos son capaces de acomodar los genes ms
pequeos, en tanto los cromosomas artificiales de levadura acomodan los de gran
tamao y los virus,los de tamao intermedio.
Una vez que el gen deseado ha quedado incorporado al vector, ste debe ser
transferido al interior de unaclula, locual en el caso de los plsmidos puede hacerse
mediante sales de calcio que aumenten la permeabilidad de las membranas de Las
clulas hacterianas.
En el interior de la clula el ADN se replica muchas veces, por lo que se originan
Fig. 35.4. Mecanismo de la penetracin de
numerosas copias del gen deseado, o sea, el gen ha sido clonado.
un virus. Los virus se fijan a la Si el gen no es muy grande puede realizarse la clonacin in vitro mediante el
pared de las clulas bacterianas e procedimiento de la reaccin en cadena de la polimerasa; para ello es necesario contar
inyectan su material gentico al con 2 pequeos oligonucletidos que sean complementarios a los extremos 5 ' del
interior de la clula. en tanto, las
protenas que forman la cubierta gen, los cuales tendrn la funcin de servir de iniciadores; se procede de la forma
de virus se quedan en el exterior; siguiente: el ADN se calienta a una temperatura de aproximadamente 94 T para
esta hace que los virus puedan ser provocar su desnaturalizacin, despus se aaden los oligonucletidos j se enfra
utilizados dicientemente como
veetores en las experiencias de
lentamentehastaunas56 "C,para permitir la hibridacin de los oligonucletidos a los
ADN recombinante. extremos 5 ' de las 2 hebras del ADN desnaturalizado; entonces se aade una A D S
polimerasay la temperaturaseeleva a 72 'C para realizar la elongacin del iniciador.
En la actuadad todos los componentesdel sistema,incluyendo los 4 desoxinuclesidos
M&tad~se~Smiultneamente,pne~seublizalaenzimaTaq,e>madadel Temwph~~
aquaticus, que es resistente a los cambios de temperatura. Existen equipos que hacen
todo el procedimiento de manera automtica. El primer ciclo demora casi 90
segundos, pero para los siguientes pueden utilizarse entre 50 y 60 segundos; se
debe tener presente que en cada ciclo, el nmero de molculas de ADN presentes
se duplica, por lo cual existe un crecimiento exponencial del tipo 2",donde n es
el nmero de ciclos. Por este procedimiento pueden obtenerse numerosas copias
del gen en escasos minutos.
Identicaein del gen pec0mbinado
El plsmido ms empleado para la clonacin es el pBR322 de E. coli, que tiene un
peso molecular de 2,9 x lo6y porta los genes para la resistencia a la tetraciclina (tet) y
a la ampicilina (amp), por lo que las bacterias que contienen el plsmido pueden ser
detectadas al ponerlas acrecer en un medio que contenga esos antibiticos. Adems,
este plsmido presenta 7 sitios de restriccin para otro tanto nmero de enzimas.
El mtodo ms empleado para detectar el plsmido recombinante es el llamado
inactivacin por insercin. Los sitios para las enzima. BamHI y Sal1estn dentro del
gen tet, luego si se produce la recombinacin utilizando cualquierade estaF enzimas,
el plsmido se torna amp' y tet-, o sea, ha ocurrido una inactivacin del gen tet por la
insercin del ADN que queremos donar.
El procedimiento en lneas generales es como sigue: el gen deseado se inserta en
el gen tet del plsmido pBR322 y ste se aade a un cultivo de E. colique sea amp-tet.
Despus de esperar un tiempo adecuado para permitir la penetracin del plsmido, las
clulas se transfieren a un medio que contiene cicloserina y tetraciclina. La cicloserina
mata a las clulas que crecen, se multiplican y que son resistentes a la tetraciclina. Las
quecontienen el plsmido recombinado no pueden crecer por la presencia de tetraciclina
en el medio; despus de un tiempo prudencial las clulas se lavan y se cambian a un
medio que contiene ampbilina, antibitico al cual las clulas son resistentes.
Por este procedimiento sobreviven las clulas amp' tet-, que son precisamente las
que contienen el plsmido recombinado (Fig. 35.5)
+ +
amp tet

am; tet ?, m p - tet

+ *
amp tet amp te1

+
amp tet

smp tct

Fig. 35.5. Ideiitiiiiarin del plsniido ~.ecombinado.Si empleamos un plsmido que tiene los genes
,>ara la resistencia a la tetraciclina (tet) y a la ampicilina (amp), o sea, es de tipo tet'amp; Y
el D S de iiuestro inters se incorpora en la zona del gen tet, se origina un plsmido que es
tet aiiip-. Si este plsmido rciombinndo sc introduce en una bacteria que sea t e t a m p , la
Iiiirtci.ia re torna ter amp*. Estas baeteriasse exponen a la accinsimultneadela tetraciclina
! la cicloseriiia. Como las bacterias que sean tet* crecen y se multiplican, la cicloserina las
iiiata. en tanto. las ter, como presentan una inhibicin de su crecimiento, na son afectadas
por la cicloserina. Si despus las bacterias sobrevivientes se pasan a un medio que contiene
ampicilina, slo quedarn aqullas que sean resistentes y, par lo tanto, sean ter amp*, que
son las que han incorporado el plsmido recombinada.
Problemas en la produccin de protenas eucariontes
La utilizacin de bacterias para la produccin de protenas de eucariontes origina
los problemas siguientes:

1. Las ARN polimerasas bacterianas no reconocen los promotores de eucariontes.


2. Los ARNm transcritos de genes eucariontes no contienen en el extremo conduc-
tor la secuencia rica en purinas, que permite a los ARNm de procariontes unirse
especficamenteal ribosoma.
3. Las protenas eucariontes sufren modificacionespostraduccionales especficas.
4. Las bacterias contienen proteasas que reconocen como extraas las protenas
eucariontes y las bidrolizan.

Los problemas 1 y 2 pueden eliminarse si el gen se une previamente a un promotor


bacteriano, por ejemplo, el promotor del opern lac.
El procesamiento de las protenas en general se realiza in vitro. La proteccin
contra las proteasas se logra en ocasiones por la obtencin de bacterias mutantes, que
carecen de esa actividad especca, o por el empleo de inhibidores.Aun as, no es fcil
lograr todas las condiciones requeridas para un caso especfico, de ah que el nmero
de experiencias exitosas no sea aun muy elevado.

Expresin de genea donados


Para la expresin de los genes clonados es necesario que stos sean transcritos y
traducidos,para eso debe constmirse el llamado vector de expresin.
Si el vector utilizado en la clonacin contiene un promotor cerca del sitio de
insercin, este promotor puede ser usado, pero en muchos casos el vector carece del
promotor adecuado, entonceses necesario reconstruirlo de forma que contenga, adems
del gen deinte&,el promotor adecuado.En estos casos se trata de emplear un promotor
fuerte para hacer mxima la transcripcin, o un promotor que presente alguna
caracterstica especial.
El procedimientocomnmente ualizado es redisear un plsmido, de manera que
contenga la regin promotor operador del opern lac y hasta un pequeo sector del
gen de la p- galactosidasa seguido del gen deseado. En estas condiciones la adicin
del inductor conectar el sistema que producir la protena deseada, y la adicin de
glucosa desconectarel sistema al aumentar la concentracin intracelular del AMPc.
El trabajo ms difieil consiste en la purificacin de la protena producida, pues es
una tarea muy labo-riosaque requiere una gran destreza y en la mayora de los casos no
poca imaginacin.
A pesar de todos estos recursos no siempre se logra la expresin del gen; slo una
de las 2 hebras del ADN es utilizada como molde en la transcripcin, y en el proceso de
recombinacin artificial se introduce ADN de doble hebra. Como los 2 extremos son
iguales, por la simetra dela secuencia,existe la posibilidad de que el apareamientose
produzca de forma que coincida la cadena codificadora del promotor con la no
codificadora del gen insertado, en este caso la expresin es imposible.
Basta quema o varias clulaslogren la incorporacindel gen enla forma adecuada,
para que al cabo de algunas horas se tengan tantas copias como se quiera; la E. coli
tiene un tiempo de duplicacin de slo 30 minutos.

Experiencia tpica
Una vez conocidos todos los elementos de trabajo, as como las dificultadesque
encierran estos experimentos, se describir una experiencia exitosa de sntesis de un
producto eucarionte por medio del aparato metablico de la E. Coli, se trata de la
somatostatina, una hormona polipeptdica de 14 aminocidos que se sintetiza
normalmente en el hipotlamo y el pncreas.
Como el nmero de aminocidos es pequeo, se procedi a la sntesis artificial del
gen que contiene51 pb, cuya secuencia en la banda codificadora sera:

T A C-( las 42 bases que codifican la somatostatina)-AC T A C T

la secuencia de bases en el ARNm sera

A U G-(las42 bases de lasomatostatina)-UG A U G A.

As, este ARNm tiene un codon para la metionina (que no se emplea en la


iniciacin), la secuencia codificadora y 2 codones de terminacin consecutivos.
Se uoliz como vector un plsmido de E. d i q u e fue reconstruidocon un segmento
del opern lac y que contena la zona del promotor operador, as como un pequeo
sector del extremo N-terminal de la P galactosidasa. El vector fue cortado mediante
una enzima de restriccin y recombinado con el ADN sintetizado.
Una vez lograda la incorporacin del pl&mido a la bacteria, stasfueron colocadas
en un medio de cultivo carente de glucosa al que se adicion isopropiltiogalactsido
(IFTG), un inductorgratuitodel opern lac.
Cuando se produce la induccin se obtiene una protena que contiene un segmento
del extremo N-terminal de la p- galactosidasa, unido a la somatostatina mediante la
metionina, y que termina gracias a la doble seal de terminacin del ADN sintetizado.
Esta protena es purificada y tratada con bromuro de ciangeno,un agente que provoca
la ruptura de enlaces peptdicos del lado carboxiico de la metionina,de esta forma la
metionina ligante queda unida al extremo de la galactosidasa y se libera la
somatostatina (Fig. 35.6).

H>N Met A l a -Gly X y s -Lys -AsN P h r -Phc ,


TI,,
O=C - Cys - Ser - TE - Phr - Tic - Lys ' Fig. 35.6. Sntesis de la somatostatina. El
HO' plimiido hir ~ ~ o n s t n i i dcon
o el gcii
d e la somatostatina, sintetizado
artificialmente, y el promotor del
opedn lac El d o n pana la metioninn
pemiitiqueal tratarel prndueto ron
bromuro de iiangexio se liliernrn la
Met H,N-Ala-Gly Ser-Cys-C=O sonratostatina del segniento de
'OH B.gdalact<sida% qiic tena unido.

El uso de la metionina como ligante puede ser til en la sntesis de pptidos


pequeiios, a menos que la metionina forme parte de la estructura del pptido.
En la actnalidad se han logradosintetizar otras protenas de eucariontesmediante
procedimientos similares al descrito como son: la insnlina, hormona pancretica de
gran importancia en el tratamiento de la diabetes mellitus, la ovoalbmina y
especialmente el interfern humano, un potente agente antiviral y posiblemente
antitumoral. Esta protena es producida actualmente en nuestro -pas -por diferentes
prncedimientos como ingenie& genticay fue utilizada en el tratamiento de la epidemia
de dengue hemorrgico, introducida de manera criminal en Coba y que cost la vida a
ms del00 personas entre ellas a muchos nios.
En principio cualquier protena eucarionte puede ser producida mediante esta
tecnologa con un sistema apropiado.

Empleo diagnstico
La presencia de formas allicas de un gen en un individuo, que en algunos casos
pudiera ser patolgica, es detectada habitualmente por electroforesis o mtodos
antignicos de las variantes de protenas, aun cuando se sabe que ello se debe en
ltima instancia a variaciones en la secuencia de bases del A D N en los loci
cromosmicos correspondientes. Recientemente mtodos derivados de la tecnologa
del A D N recombinante han permitido el anlisis directo de las secuencias del gen, as
como determinar sus alteraciones especficas que provocan cambios estmctnrales de
una protena particular. La utilidad de esta tcnica es que permite la distincin entre 2
copias de un locnsparticular del genoma humano.
El mtodo ms utilizado en la prctica para el estudio de las variaciones gnicas es
el uso de las enzimas de restriccin; como estas enzimas realizan su accin en sitios
especficos del ADN, un cambio en la secuencia puede conducir a la aparicin o
desaparicin de un sitio particular y, por lo tanto, se altera el tamao de los fragmentos
que se obtienen cuando el A D N es digeridoutilizando esa enzima; lo mismo ocurre si
existen deleciones o inserciones.
La diferencia en los tamaos de los fragmentos de una regin determinada de
cromosomas homlogos puede ser detectada, con lo que se determina la existencia de
los alelos.
Suponga que un gen presenta 2 alelos Al y A2,en el Al existen 2 sitios reconncidos
por una enzima de restriccin separados por una distancia de 20 kb; pero en A2,
producto de las mutaciones, ha aparecido un nuevo sitio de restriccin para la misma
enzima entre los 2 anteriores, de manera que la accin de la enzima dar lugar a 2
fragmentos de 8 kb y 12 kb, respectivamente (Fig. 35.7).

Fig. 35.7. Alelos que difieren en sus sitios


de restriccin. Los genes A l y A2
son aleles que se difereiirian por-
que en unos de ellos la iiiiitncin
ha originatlo un nuew sitio de res-
triccin. As, cuando el ADN es
tratado con esa enzinia, el alelo A l
originar un solo fragmento de
restriccin de 20 kh, en tanto, que
A2 origina un frazrnenta de 8 kb
Si el A D N de una clula se extrae y fragmenta con la enzima de restriccin, se
obtendrn numerosos fragmentos que deben ser sometidos a electroforesis en -gel de
agarosa para separarlos de acuerdo con su tamao.
Se prepara un polinucletidoque contenga una secuencia de bases similar a la del
fragmento con tamaode8 kh, utilizando dNTPmarcado con fsforo radiactivo, que
recibe el nombre genrico de sonda.
Una vez terminada la electroforesis, la placa de agarosa se transfiere a un soporte
slido embebido en una solucin que contiene la sonda y se da el tiempo suficiente
para permitir la hibridacin entre la sonda y el ADN fragmentado. El soporte se separa
delasolucin y se cubrecon una placa fotogrfica (autorradiografia)qne,al ser revelada,
muestra la posicin de los fragmentos de inters. Como la sonda slo puede hibridarse
en la zona del fragmento de 8 kb, aparecer unida tanto al alelo Al como al fragmento
pequeo del alelo A2,que por ser de diferentes tamaos aparecen en sitios diferentes
en la autorradiografia (Fig. 35.8).
Si una familia es portadora de una enfermedad gentica producida por genes de
este tipo, puede hacerse el diagnstico prenatal mediante la obtencin de clulas del
lquido amnitico y procesndolas de esta manera. En nuestro pas ha sido introducido,
hace algunos aos, un procedimiento similar para el diagnstico prenatal de la
sicklemia. Procedimientos de este tipo pueden ser utilizados en los departamentos de
Fig. 35.8. Identificacin de fragmentos de
restriccin. El ADN genmieo de
3 individuos es fragmentado me-
diante una enzima de restriccin.
Los fragmentos se someten a una
electroforeais en gel de agarosa que
los separa de acuerdo con su lon-
gitud. Se transfieren a un soporte
slida y se embeben en una solu-
cin que contiene la sonda
radiactiva durante el tiempo ne-
ce5arbpara permitir la hibridacin;
despus se somete a un iiroceso de

se observa en las resultados, el su-


jeto A es homocigtico para el alelo
A l (de 20 kb), el sujeto C es
homocigtico para el alelo A2 y
el B es heterocigtiea, pues pre-
senta tanto el alelo A l de 20 kb
c o n a el A2 que origina el frag-
mento de 8 kb.

trasplante de rganos para realizar una caracterizacin ms profunda de la


compatibidad entre los donante y los receptores. Tambin este proc~dimientopuede
ser utilizado en medicina legal, siempre que en un hecho delictivo queden como
huellas clulas de los delincuentm, como en el caso de homicidios, violaciones, etctera.

Perspectivas
Muchos son los campos del quehacer humano donde la tecnologa del ADN
recombinante puede dar grandes resultados. La introduccin de genes especficosen
bacterias puede ser de gran utilidad, si estos organismos con su actividad provocan un
mejoramiento del suelo, un incremento en la fijacin de nitrgeno u otras

Componentes celulares y Genttica molecular sss


modificaciones que hagan que se obtengan cosechas ms productivas, tanto cualitativa
como cuantitativamente.
La produccin de agentes biolgicos, que ayudan al hombre a combatir las enfer-
medades en formas inocna y econmica, es tambin una de las posibilidadesde estas
tcnicas.
La produccin de microorganismos, que ayudan a combatir la contaminacin
ambiental tanto de la atmsferacomo de los mares y nos, propiciara que el hombre
pueda vivir en un planeta con ambiente menos agresivo; sta entre otras producciones
constituyen posibilidades casi inmediatas de la tecnologa del ADN recombinante.
& .
Aun cuando en estos momentos no se vislumbra., ouede.,oue en un futuro no
lejano,esta tcnica sea capaz deenfrentar el hatamiento de enfermedades hereditarias,
al producir rectificaciones de los genes alterados mediantesnsustitucio por los nor-
males.
Se requieren muchos ;io?.de investigaciny trabajo para que la humanidad agote
las posibilidades de esta nueva conquista de la ciencia.
Es lamentable que la ingeniera geotica tambin puede ser utilizada en contra de
los hombres. La creacin de organismos productores de enfermedades con elevada
capacidad inefectiva, contra los cuales no existen tratamiento y la contaminacin del
ambiente con productos residuales del metabolismo de bacterias alteradas son ejem-
plos menores de cmo pueden utilizarse las manipulacionesgenticas contra sus pro-
pios descubridores.
Esto no debe Uevar a suspender las investigacionesen este campo, pues el empleo
que se d a sus resultados no depende de los procedimientos empleados, sino de las
concepciones tico-polticasde los gobernantes de los pases donde se desarrolle esta
importante tecnologa.
La explosin de la bomha atmica en Hiroshima y Nagasaki, con toda su secuela
.
de muerte s destruccin aue se extiende basta nuestros das.. nor una narte., v" las
grandes centrales tomo elctricas que existen en numerosos pases que han llevado la
comodidad y el desarrollo a grandes ncleos de poblacin, por otra, ejemplifican de
forma clara que el peligro no est en las fuerzasde la naturaleza que el hombre descn-
bre, sino en el empleo que el propio hombre hace de ellas.
En todo caso nuestra posicin, desde el punto de vista tico, lleva a condenar el
uso de estas -y de cualquier otra- conquistas de la ciencia como instrumento para
provocar la destruccinde la humanidad, en vez de hacerlo parasu bienestar y desarro-
llo.

Resumen
Uno de los xitos ms sobresaentes de la gentica moleeular ha sido la intm-
ducei6n de la tecnologa del ADN reeombinante, que ha permitido obtener protef-
nas eueariontes en cantidades antes insospechadas y al mismo tiempo un anlisis
del gen al nivel molenilar.
El procedimiento general consiste en la obtenei6n de un gen particular, su
incorporaci6n a un vector y su propagaci6n. Los genes pueden obtenerse por frag-
mentari6ndelADN,por aislamientodel ARNm y slntesisdel een wr lamswi~tasa
inversa o por sinte& artificial del gen. LO; vectorea & empleados son los
plsmidos, los Virus y los mmosomas artieiales de levadura. La uni6n del gen al
vector puede ocurrir de 2 formas, segn el tipo de enzima de resMed6n empleada
en el proceso. Cuando la enzima no da fragmentos monofibrilares se requiere el
c o n m de la nudeotidil t r a n s f e m terminal.
La producci6n de protenas eucariontes en bacterias presenta varias
dificultades, pero basta con obtener algunas clulas recombinantes que,
proporcionndoles el medio adecuado, en pocas horas se tendrn tantas como se
quiera.
Mediante estos pmcedimientos se han obtenido nume- protenas, entre
ellas la somatostatina, la insulina y el interfern, el eual se obtiene con xito en
nuestro pas desde hace algunos dos.
La tecnologa del ADN recombinante puede ser 6oI en el anlisis del gennma y
proporciona un pmcedimiento preciso para el diagn6soco prenatal de algunas
enfermedades genticas; tambin puede ser utilizada en Jasdepartamentos de
trasplante y en medicina le@
Amplias son las perspectivas de esta tecnologfa para la agricultura, el
saneamiento ambiental y ia medieina No obstante, tambin puede ser empleada en
perjuido del hombre, dependiendo de quienes sean los que la empleen y no de los
pmcedimientos tcnicos.La humanidad debe condenar enrgicamente el empleo
criminal de estos procedimientos.

Ejercicios
1.;Cules cree usted que son las caractersticasque presentan los plsmidos que les
permite servir de vectores en los procedimientos del ADN recombinante?
2. Haga un diseode unexperimento para recombinar U> vitmun gen con un plsmido,
utilizando alguna de las enzimas de restriccin que aparecen relacionadas en el
captulo 33.
3. ;Cul fue el principal inconveniente encontradoal utilizar directamentelos genes
eucariontes para la recombinacin in vitro? Cmo pueden eliminarseesos incon-
venientes?
4. Por qu no siempre se logra la expresin de los genes an cuando han sido
incorporados al vector y ste se multiplica en la clula receptora?
5. ;Qu ventaja representa la incorporacin del promotor lac en los vectores?
6. ;Cmo puede la tecnologa del ADN recombinante favorecer el desarrollo de un
departamentode trasplantede rganos?
7. ;El hecho de que los procedimientos del ADN recombinante puedan ser utilizados
para causar dao a la humanidad, debe indicarnos que hay que concluir las inves-
tigaciones en este campo?
8. ;Qu perspectivas representa la tecnologa del ADN recombinante para los pases
subdesarrouados?
Resumen de la seccin

Esta seccin se ha dedicado al estudio de los principales aspectos relacionados


con la informacin gentica interpretndolos desde el punto de vista de la estructura,
las propiedades y las funciones de las macromolculas.
La informacin gentica es una de las formas de expresin de la informacin
molecnlar que puede ser de tipo secuencial y conformacional; por lo que no se trata de
un nuevo tipo de informacin, que distinguirla cualitativamente slo pretende realzar
su significado para la vida de las clulas. No obstante las diversidades de procesos y
mecanismos, se pueden encontrar algunas generalidades que a manera de resumen
general se exponen a continuacin.
Toda la informacin gentica que determina la identidad de cada organismo est
codificada en la secuencia de bases nitrogenadas del ADN y por lo tanto es esencial-
mente de tipo secuencial. Pero el ADN contiene adems en su estructura las inshuccio-
nes para su lectura, dadas por las irregularidades estrnctnrales que surgen a lo largode
la molcula, de acuerdo con la secuencia de bases en sectores especficos. Todo el
proceso de surgimiento y transformacin de los seres vivos durante el perodo evolu-
tivo alcanzan su ltima expresin en la lucha entre la estabilidad y la mutabilidad de
esa secuencia de bases.
Conservar la informacin gentica de un organismo y garantizar que ste origine
siempre descendientes iguales a s implica conservar inalterada la secuencia de bases
desn ADN. Por el contrario, la aparicin de variedadesen la formao las funciones de
los organismos significa la alteracin de la secuencia de bases de su ADN con respecto
a lade sus progenitores. La existencia de secuencias no codificantes, de genes repeti-
dos y los mecanismos de modificacin-restriccin por una parte y el complejo meca-
nismo de replicacin del ADN, que implica una elevada fidelidad de copia, as como
los de reparacin aseguran a la estabilidad del material gentico; mientras que las
mutacio