Está en la página 1de 54

Coordinacin de Ciencia, Tecnologa e Innovacin

FLACSO. Conferencias Magistrales


Mxico ante s mismo.
Escenarios y encrucijadas

ORGANISMOS TRANSGNICOS,
SUS GRANDES BENEFICIOS Y
LA AUSENCIA DE DAO

Francisco Gonzalo Bolvar Zapata


10 de octubre de 2013
La clula viva:
C
Componentes
t y ffunciones
i
Una clula
U l l bbacteriana.
t i L
Las b
bacterias
t i como Escherichia
E h i hi coli, li son organismos
i unicelulares
i l l
donde no existe el ncleo conteniendo el material gentico, que en este caso es un solo
cromosoma que mide 1 mm.
Eucromatina Retculo Endoplasmico Bicapa
Membrana Celular
(Cromosomas) Rugo Lipdica

i 1f xqt xt
duOSOjt qr t x s

i f xqt

Retculo Endoplsmico jt OM O
Citoplasma
Liso

csjt f t . SsO
Mitocondria qSt s t O
Peroxixoma

Lisosomas

Una clula humana con sus componentes y entre ellos el ncleo donde se
encuentran los cromosomas q que a su vez contienen el material g
gentico
(ADN). En el organismo humano existen trillones de estas clulas. Las
protenas se sintetizan en los ribosomas que se encuentran en el retculo
endoplasmtico. En las mitocondrias se fabrica el ATP.
Molculas informacionales
de la clula viva:
cidos
id nucleicos
l i
(ADN y ARN)
y protenas
Los 24 cromosomas humanos en los que se encuentran los 30 mil genes del genoma
humano. Cada cromosoma est compuesto p p
por una molcula de DNA de
aproximadamente 5 cm de largo, a la que se le asocian protenas. Nuestras 24
molculas de ADN miden aproximadamente un metro. En cada clula humana hay 2
copias de cada cromosoma (diploides) con excepcin de los gametos, esperma y vulo,
donde slo hay una copia (haploides).
Gene

DNA

C ro m o s o m as

El concepto
t de
d gene como un segmento t de
d lla molcula
l l d de ADN que fforman
los cromosomas. Cada gene codifica para una proteina.
El dogma central de la biologa

Replicacin

DNA

Transcripcin

RNA
Traduccin

PROTENA
DNA de doble cadena
5 3
A T GC T C GA A T T C C T GA T GC A T GC A

3 TACGAGCT TT
TAAGGACTACGTACGT 5
RNAm
AUGCUCGAAUUCCUGAUGCAUGCA
A U G CU CG A A U U C CU G A U G C A U G C A

Codn Codn Codn Codn Codn Codn Codn Codn


3 4 5 6 7 8 9 10

M
et Leu G
Met lu Phe Leu M
Leu et H
Glu is A
la
Phe Leu Met His Ala

Protena

Protenaactiva

Sntesis de protena y conformacin de la estructura de la protena que es


resultado o se debe a la secuencia primaria de aminocidos.
La estructura de las protenas
Ala Estructura de
lamina -plegada
Gly

Cys Estructura
T
Terciaria
i i
Lys

Asn

Phe

Phe Estructura de
Trp
hlice alfa

Lys

Thr

e
Phe

Thr

m
Estructura de
lamina -plegada

t
Ser

Cys

Estructura Estructura
Primaria Secundaria

Estructura
Cuaternaria

Las protenas son las herramientas mas importantes de la clula y la funcin de


cada una de ellas es debida a su estructura.
Biotecnologa,
g ,
organismos transgnicos
y bioseguridad.
bioseg ridad
I. Biotecnologa y organismos genticamente modificados.
La Biotecnologa es una multidisciplina, sustentada en disciplinas
tradicionales, como la bioqumica, la gentica, la ingeniera bioqumica
que permite estudiar, modificar y utilizar los sistemas biolgicos
(microbios, plantas y animales).

Con la aplicacin de la biotecnologa se busca hacer un uso


responsable y sustentable de la biodiversidad, mediante el desarrollo
d tecnologa
de l eficaz,
fi li i y competitiva,
limpia ii para facilitar
f ili l solucin
la l i ded
problemas importantes en los sectores de la salud, el agropecuario, el
industrial y medio ambiente.
El ADN es el material gentico de los organismos vivos . Es una
macromolcula formada por millones de nucletidos. La estructura de doble
hlice complementaria es la misma en todos los seres vivos y en los virus. Esta
caracterstica es la que permite la transferencia horizontal y la recombinacin
gentica del material gentico de distintos organismos.

El ADN es una macromolcula formada por la unin de miles de nucletidos. El genoma


humano tiene 3,350 millones de pares de nucletidos en los 24 cromosomas.
Gene

gi d

, St N t Mt N OM

Concepto de gene: el gene es un segmento de la molcula de ADN que forman los


cromosomas. Cada gene codifica para una protena. Tenemos 21 mil genes en los 23
pares de cromosomas en los ncleos de nuestras clulas. Adems 37 genes en nuestras
mitocondrias.
it di Tambin
T bi hay
h genes que codifican
difi solo
l para ARN como llos ribosomales
ib l y
de transferencia entre otros. Estos ARN no se traducen en protenas.
Con el desarrollo de las tcnicas de
ingeniera gentica, la biotecnologa
alcanza una nueva dimensin.

Con estas metodologas es posible


aislar genes especficos de un
organismo y transferirlo a otro,
generndose as los organismos
genticamente modificados (OGM) o
transgnicos. Se muestra el esquema
para construir bacterias transgnicas
Esquema general para la construccin de clulas y plantas transgnicas.
Se muestra el transgen que puede ser introducido por diferentes tcnicas
a una clula receptora. Posteriormente, el transgen llega al ncleo donde
se incorpora como parte de un cromosoma de la clula receptora.
Los transgnicos se disean y
construyen para generar una
nueva capacidad
id d en ell organismo
i
receptor, la cual reside en el
material gentico transferido.

El objetivo de la construccin de
OGMs es el de ayudar a resolver
problemas en los diferentes
sectores, con la certeza de que
estos organismos son seres vivos
d bajo
de b j riesgo
i y por ello,
ll titienen un
menor impacto en el medio
ambiente, biodiversidad y en la
salud humana y animal.
Los transgnicos han
sido utilizados
comercialmente desde
hace casi 30 aos con el
propsito de construir
organismos que
producen p
p protenas
idnticas a las humanas.

Se muestra el diagrama
para la construccin de
bacterias transgnicas
que producen interfern
humano
Existen en las farmacias, incluyendo las de
Mxico medicamentos de origen
Mxico,
transgnico o recombinante como la
insulina, interferones y anticoagulantes
de la sangre, que se utilizan para contender
con varias problemticas de la salud
humana y que se producen comercialmente
con microorganismos transgnicos.

Sin estos
Si t transgnicos
t i no sera posible
ibl
producir las cantidades requeridas por el
mercado, ya que a partir de tejidos y fluidos
humanos como la sangre, no se obtienen
ms
que cantidades
tid d muy pequeas. A
As, llos
transgnicos que producen estas protenas
idnticas a las humanas, no pueden ser
sustituidos por ninguna otra tecnologa.

Desde 1982, la utilizacin de las


protenas recombinantes transgnicas
ha contribuido significativamente a
mantener y mejorar la salud humana.
El uso desde hace muchos aos de protenas recombinantes tambin
ha tenido g
gran impacto
p en la elaboracin de alimentos,, como las
enzimas quimosina, en la produccin de quesos; pectinasas, para la
elaboracin de jugos; glucosa oxidasas y catalasas para la
deshidratacin de huevo; lipasas para fabricacin de aceites de
pescado; glucosa isomerasas, para la produccin de jarabes
glucosados; glucanasas en la produccin de cerveza; entre las ms
importantes
Las plantas
L l t transgnicas
t i se cultivan
lti
desde 1996, y 15 aos despus se
siguen usando sin que hasta la fecha se
hayan reportado efectos nocivos a la
salud humana ni a la biodiversidad
biodiversidad.

Por el contrario, han permitido reducir


ell uso de
d pesticidas
ti id lol que se ha
h
traducido en un menor impacto en el
ambiente, a diferencia de lo que ha
sucedido con la aplicacin de
productos qumicos,
qumicos algunos de los
cuales tienen efectos carcingenos.

El maz y la soya transgnicos se


consumen en muchos pases y cada vez
es mayor el nmero de hectreas que se
cultivan con plantas transgnicas.
Uso responsable
p de los OGM

El Comit de Biotecnologa de la
Academia Mexicana de Ciencias
elabor el libro:

Por un uso responsable de los


organismos genticamente
modificados

En este documento se sealan los


argumentos y conocimientos
cientficos que sustentan el bajo
riesgo de los OGMs,
OG por ser
organismos construidos con
procesos que ocurren
cotidianamente en la naturaleza.
II. Evidencias que sustentan la inocuidad y bajo riesgo de los
organismos transgnicos y sus productos

La teora de evolucin de Darwin


seala qque todos los seres vivos
derivamos de un mismo precursor
comn. Todos los organismos vivos
compartimos muchos genes. De
hecho, el genoma humano es
similar en 98% al del chimpanc, 40%
al de la mosca, 30% al de las plantas .
T bi compartimos
Tambin ti genes
bacterianos incluyendo los
localizados en las mitocondrias de
nuestras clulas.
clulas
El ADN : la estructura de doble hlice complementaria

5
5

Base
nitrogenada 3 T
Nucletido A
Fosfato

A
Azcar
A
T

C
G
G
C

3 5

El material gentico (ADN) tiene la misma estructura general en todos los seres
vivos
i y esto
t permiteit transferir
t f i e incorporar
i genes de
d un organismo
i en otro.
t La
L
clula viva reconoce el material gentico de otro origen que puede adquirir por
diferentes vas (infeccin o transferencia horizontal) y, en muchos casos, lo
incorpora y lo replica como propio.
La transferencia horizontal de
material gentico es un fenmeno
que ocurre diariamente en todas las
especies y los virus y las
bacterias son los principales
responsables de este fenmeno.
Este tipo de transferencia permite
que ADN d de una especie i pueda
d ser
transferido a otra. Cada da se
acumula ms evidencia que indica
que este tipo de fenmeno ha
jugado un papel importante,
conjuntamente con otros
mecanismos en la evolucin de
mecanismos,
las especies y en la estructuracin
y reorganizacin de los genomas.
El fenmeno de la transferencia
horizontal de material gentico
g
ocurre cotidianamente en las
bacterias que reciben e incorporan
material gentico gracias al
llamado fenmeno de
transformacin. Este material
gentico puede provenir de cualquier
origen
i d
de llos dif
diferentes
t organismos
i
que habitan el suelo, incluyendo los
que mueren.

Tambin se ha demostrado que hay


bacterias que son capaces de
transferir de manera horizontal
material gentico a plantas como el
g
caso de la bacteria Agrobacterium
tumefaciens que transfiere ADN propio
al tabaco.
El genoma de organismos superiores ha evolucionado incrementando parte
de su material gentico a travs de infecciones virales, y de material gentico
proveniente de microorganismos que hayan infectado a nuestros
antepasados; incorporndose as parte del material gentico del organismo
que infecta en el genoma de las clulas receptoras. Los humanos tenemos 37
genes en nuestras mitocondrias
Se ha dado, mediante
Eucromatina Retculo Endoplasmico
la endosimbiosis, la
Membrana Celular Bicapa
(Cromosomas) Rugo Lipdica incorporacion de
material gentico en
etapas tempranas de
Nucleolo la evolucin de las
clulas precursoras
Aparato de Golgi
de los animales y
plantas,
l t a travs
t de
d
la infeccin o
Ncleo asociacion con
precursores de los
p
Retculo Endoplsmico Citoplasma actuales organelos
Liso
celulares, que son
Mitocondria Peroxixoma
similares a las
bacterias como es el
bacterias,
Lisosomas
caso de la
mitocondria
Adems, en las plantas, los
cromosomas vegetales
contienen un gran nmero de
genes provenientes de las
bacterias fotosintticas que
dieron origen a los
cloroplastos.
El maz tiene 104 genes en
sus cloroplastos y al menos 90
en sus mitocondrias.
mitocondrias
En nuestro genoma y en el de todos los organismos vivos hay material
gentico repetido, probablemente de origen bacteriano o viral, llamado
transposones que representa al menos 30% del genoma humano. En el maz
los transposones constituyen 85% de su genoma. Los transposones son
secuencias de DNA que pueden translocar su posicin en el genoma,genoma es
decir pueden brincar de un lugar a otro, inclusive entre cromosomas, por lo
que han jugado y siguen jugando un papel importante en la reorganizacin y
evolucin del genoma. En el maz, los granos de colores diferentes en una
mazorca son resultado de este tipo de fenmeno que indica la gran plasticidad
del genoma y que ocurre en un mismo individuo.
Otro tipo de material
repetido en nuestro
genoma, es el retroviral
(el retrovirus es un tipo de
virus que tiene su genoma de
ARN). Este tipo de material
repetido probablemente se
estabiliz en nuestro
genoma y/o en el de
nuestros precursores
biolgicos, mediante
mecanismos de infeccin y
posterior incorporacin de
la copia en ADN del
genoma viral al nuestro o al
de nuestros predecesores.
Este es otro tipo de
transferencia horizontal que
influye diariamente en la
dinmica y reorganizacin del
genoma.
Cuando se construye un organismo
genticamente modificado o transgnico
independientemente de los mtodos utilizados
(transformacin, biobalstica o electroporacin
que per se no afectan el genoma de la clula
receptora) se introduce, a travs del fenmeno de
transferencia horizontal del ADN, material
gentico especfico (transgene) a una clula.
P t i
Posteriormente t mediante
di t ell fenmeno
f de
d
recombinacin gentica, el transgene es
incorporado como un segmento del material
gentico de la clula receptora en alguno de sus
cromosomas. Si en este evento -que que es, de facto,
una reorganizacin del genoma- se afectara una
funcin codificada en el cromosoma que resultara
vital para la clula, ese organismo transgnico en
particular no sobrevivira. El mismo tipo de evento
podra
d suceder
d en ell caso ded una reoganizacin
i i
natural del genoma cuando es infectado por un
retrovirus -el VIH causante del SIDA por ejemplo-
o afectado por un transposn que cambia su
posicin ya que debido a estos fenmenos
posicin,
pudiera ocurrir la insercin de su material
gentico en un locus esencial y que por ello, la
clula receptora en la que ocurriera el arreglo, no
sobrevivira. Luego, la incorporacin y
reorganizacin de material gentico
en un
genoma es un proceso natural que ocurre
diariamente en la naturaleza, independientemente
de los transgnicos.
Dadas todas estas evidencias en favor de la plasticidad y
capacidad de reorganizacin del genoma y de la transferencia
h i
horizontal
t l de
d ADN como un fenmeno
f natural,
t l resulta
lt difcil
dif il
entender la preocupacin de que un gene de una bacteria del
suelo que codifica para la protena Bt que es txica
nicamente p para ciertos insectos q
que haya
y sido incorporado
p por
p
tcnicas de ingeniera gentica a una planta, tenga la posibilidad
de generar una catstrofe ecolgica. Lo anterior se sustenta en
el hecho de que los seres vivos han evolucionado y lo siguen
haciendo a travs de adquirir material gentico por transferencia
haciendo,
horizontal, mutando y reordenando sus genes y cromosomas, sin
provocar catstrofes ecolgicas. Los escenarios que preocupan
por la presencia de un transgene en un organismo podran
darse diariamente por la transferencia horizontal y la
reorganizacin del genoma al infectarse las plantas y/o animales
por virus o bacterias.
As, la preocupacin de que los OGM vayan a ser
responsables de transformar y degradar las especies que se
utilizan en la agricultura y las dems que conforman la
bi f
biosfera, i i i porque hay
se minimiza h evidencias
id i cadad vez ms
importantes de esta plasticidad del genoma y de que
estos fenmenos de reorganizacin gentica ocurren
todos los das en la biosfera,
biosfera independientemente de los
transgnicos. Muchos de estos procesos de cambio en los
genomas son generados, se insiste, mediante la transferencia
horizontal de ADN el cual no es un fenmeno antinatural. De
lo anterior, se concluye que los transgnicos generados
tambin por transferencia horizontal son organismos de bajo
riesgo.
g
Hemos modificado genticamente,
genticamente a lo largo de cientos de aos,
aos
las especies que utilizamos para alimentacin, y hasta hace poco
sin conocer la estructura del ADN, utilizando mutgenos que se
sabe generan mltiples cambios en los genomas de los
organismos Sin embargo,
organismos. embargo estas tcnicas de mutagnesis y los
organismos generados, no se cuestionan como los transgnicos,
cuando en el fondo hoy sabemos que los mtodos usados
previamente generan cambios mucho ms amplios en el genoma
de estos organismos.
organismos La razn de la falta de cuestionamiento es,
es
probablemente, la ausencia de dao por estos organismos altamente
modificados, desde el punto de vista gentico.
III) Uso y aplicacin responsables de los organismos
genticamente modificados
g

III.1) Consideraciones generales:

bl que lla utilizacin


E indispensable
Es i di tili i del
d l conocimiento
i i t cientfico
i tfi y de
d la
l
tecnologa se d
d::

i) de
d forma
f responsable
bl y respetuosa
t d lla salud
de l d humana
h y animal,
i l y
cuidando el medio ambiente;
ambiente;

ii) de manera justa


ii) justa,, tratando de reducir las diferencias sociales e
inequidades;;
inequidades

iii)) respetando la riqueza cultural


iii cultural;;

iv)) conforme la aplicacin de un marco jurdico adecuado


iv adecuado;; y

v) tras un anlisis detallado de las ventajas y los riesgos que


representa el uso o no de una tecnologa particular, para la solucin de
algn problema
problema..
LaCienciaesunaactividadhumana
intrnsecamentearraigadaensuespritu
inquisitivo,quebuscagenerarconocimiento
cientficosobreelUniversoylaNaturaleza,
incluidoelserhumanoylaSociedad.Elsustento
de la originalidad del nuevo conocimiento
delaoriginalidaddelnuevoconocimiento
cientficodebedarseatravsdelaevaluacin
porparesysupublicacinenrevistasylibros
arbitrados.Esfundamentalavalarlaveracidad
d l
delconocimientoyaquelamentiradestruyela
i i t l ti d t l
credibilidaddelasociedadporeltrabajo
cientfico.Elconocimientocientficopuede
utilizarseparaeldesarrollodetecnologa
novedosaycompetitiva,conelpropsitode
resolverproblemasygenerarsatisfactorespara
lasociedad.
Acuerdos internacionales y regulacin en Mxico para
el uso de los OGMs

La utilizacin y liberacin al ambiente de los OGMs, ha despertado


cuestionamientos y el establecimiento de acuerdos internacionales y
d legislaciones
de l il i a nivel
i l nacional,
i l como:

i) Convenio sobre la Diversidad Biolgica (CDB), en vigor a partir de


1993,, entre otros se establece el compromiso
p del establecer un
acuerdo sobre la seguridad de la biotecnologa

ii) Protocolo de Cartagena sobre la Seguridad de la Biotecnologa


d l CDB,
del CDB ratificado
tifi d por Mxico,
M i entrando
t d en vigor
i ell 11 de
d septiembre
ti b
de 2003. Establece el compromiso de definir regulaciones y medidas
necesarias para evaluar los movimientos transfronterizos de los
OGMs.

Mediante el Protocolo de Cartagena, los pases firmantes se


comprometieron a establecer las regulaciones y medidas necesarias
para evaluar los movimientos transfronterizos
p f de los transgnicos
g
que pudieran tener efectos adversos sobre la conservacin y
utilizacin sostenible de la diversidad biolgica o sobre la salud
humana.
Ley de Bioseguridad de Organismos Genticamente
Modificados (LBOGM)

En Mxico,
E M i ell Congreso
C d la
de l Unin
U i con ell apoyo del
d l
Comit de Biotecnologa de la Academia Mexicana
de Ciencias, en cumplimiento con compromisos
i t
internacionales
i l adquiridos,
d i id d
despus d un proceso de
de d
consulta, discusin y revisin que tuvo una
duracin de tres aos, emiti la Ley de Bioseguridad
d Organismos
de O i G ti
Genticamente
t Modificados
M difi d (LBOGM).
(LBOGM)
Ley de Bioseguridad de Organismos Genticamente
Modificados (LBOGM)

Objetivo garantizar la proteccin de la salud humana, del medio ambiente,


la diversidad biolgica y de la sanidad animal,
animal vegetal y acucola,
acucola de
actividades con OGM. Entre los elementos que contiene se encuentran:

Definicin de los principios y poltica de bioseguridad -como la evaluacin


caso por caso y paso por paso, con base en conocimiento cientfico;

Determinacin de competencias de diferentes dependencias


gubernamentales;

Establecimiento de las bases para el funcionamiento de la Comisin


Intersecretarial de Bioseguridad de Organismos Genticamente Modificados
(CIBIOGEM);
(CIBIOGEM)

Establecimiento de regmenes para el manejo de OGM (permisos, avisos y


autorizaciones),

Bases para el establecimiento del Sistema Nacional de Informacin sobre


OGM,
Recomendaciones y consideraciones para el uso y
aplicacin responsable de los transgnicos

Consenso internacional sobre la necesidad de evaluar y dar seguimiento,


g , caso
por caso, con base
b en ell conocimiento
i i t cientfico.
i tfi

Monitorear la presencia de los OGMs.

En este anlisis se debe considerar la comparacin de los beneficios y posibles


riesgos derivados del uso de un determinado OGM, as como los riesgos de no
emplearlos, manteniendo los esquemas actuales de produccin y de degradacin
que se presentan por ejemplo, por el uso de pesticidas qumicos.

Es importante desarrollar en Mexico , las variedades adecuadas para los diferentes


suelos y regiones, buscando utilizar y recuperar suelos deserticos o contaminados.
Las variedades actuales de muchos transgenicos no estan diseadas para Mexico y
no necesariamente incrementan la productividad en Mexico ya que son variedades
de primera generacion diseados contra las plagas de los paises productores.
Hay un consenso sobre la importancia de realizar investigacin
interdisciplinaria sobre los transgnicos, a travs de la aplicacin
de las ciencias micas (genmica. protemica; etc.), ecologa,
bioinformtica, entre otras. Lo anterior es importante ya que hay
acadmicos que consideran que los transgenes pudieran generar
respuestas no evidentes en el organismo receptor; aunque
algunos
l otros
t pensamos que ste
t no sera ell caso, ya que como
se seal, la transferencia horizontal del material gentico y la
reorganizacin del genoma son fenmenos que ocurren
cotidianamente en la naturaleza,
naturaleza y los transgnicos son creados por
transferencia horizontal y reorganizacin del genoma y por ello son
organismos de bajo riesgo.

Estos estudios generarn conocimientos ms completos sobre


los OGM, que ayudarn a responder algunas preguntas .
Adems, es importante incorporar tambin estudios sociales y
econmicos del uso de esta tecnologa (es decir, impacto del uso de
los OGM patentados en los pases pobres, aspectos bioticos y
sociales, relacionados con la derrama de los beneficios a los
agricultores, etc.).

Por lo anterior, es indispensable la formacin de recursos humanos de


manera interdisciplinaria y el fortalecimiento de la infraestructura en
biotecnologa y la bioseguridad
Los transgnicos
L t i representan
t una herramienta
h i t importante
i t t en ell
desarrollo de la agricultura nacional, y esta claro que debe
mantenerse un riguroso control, sobre la evaluacin de posibles
riesgos que pudieran ocasionar las nuevas construcciones en la
salud humana y a la biodiversidad. Ademas, existen diferencias de
opinin sobre la pertinencia de liberar de inmediato las variedades
de cultivares transgnicos en los que Mxico es centro de origen
como el maz. As, mientras que algunos academicos desearan que
ningn maz modificado llegara a suelo agrcola nacional, otros
opinan
p que los p
q permisos p podran otorgarse
g para siembra en
p
determinadas regiones, una vez determinado en estudios de campo
experimental, el nivel de riesgo y los controles necesarios para
limitar el flujo de genes. De hecho, las consecuencias de un eventual
flujo gnico es tambin un tema polmico. La liberacion de maiz
transgenico en Mexico debe tambien tomar en cuenta, aspectos
sociales, economicos y culturales de las regiones donde se pretenda
liberar los problemas a resover y las alternartivas.
liberar, alternartivas
Otra ppreocupacin
p importante
p y vlida de los sectores q que han
expresado opiniones adversas al maz transgnico, es que las
variedades transgnicas que actualmente comercializan las empresas
multinacionales no son las adecuadas para la agricultura nacional, ya
que las p
q plagas
g en EUA son distintas a las mexicanas. Por lo anterior,
resulta fundamental el apoyo a los grupos acadmicos para que
las instituciones pblicas del pas puedan desarrollar las
variedades que Mxico requiere.
Usos ilegales y cuestionables de ciertos OGM

LaLBOGMsealaexplcitamente,queningnOGMpodrserutilizado
comoarmabiolgica.EsposibleconstruirOGMs quepudierantener
impactosnegativosenlasaludhumana,animalyvegetal.EstosOGMs no
pueden ni deben siquiera construirse
puedennidebensiquieraconstruirse.

Ejemplosdeestetipopudieranserbacteriasquenormalmentevivenenel
intestinodelhumanoalasqueseincorporarangenesproductoresdetoxinas
queafectanlasaludcomolatoxinadelbotulismoodelclera.Aniveldelas
plantas,unejemplopodraserlautilizacindegenesterminadoresovirales
l t j l d l tili i d genes terminadores o irales
queimpidanlagerminacindelassiguientesgeneracionesdesemillas,ya
queestosgenespudierantransmitirseaotrasplantasgenerandodao.
Se requiere que los legisladores y
responsables de las reas administrativas
cuenten con informacin actualizada sobre
el tema y con la asesora de p personal
tcnico. Es indispensable que las entidades
gubernamentales responsables de la definicin
de las polticas para la liberacin de
transgnicos dispongan de los elementos
adecuados para implementar el Reglamento de
la LBOGM .
IV.Consideracionesfinales

El tema de la biotecnologa moderna aplicada a la agricultura tiene


muchos elementos de discusin y de polmica. Sin embargo, en el
sector de la salud en lo referente a la produccin de nuevos
bi
biomedicamentos,
di t l aplicaciones
las li i avanzan dde manera clara
l y
contundente contendiendo con muchos problemas clnicos,
proporcionando herramientas poderosas, novedosas y respetuosas
del medio ambiente para resolver muchos de estos problemas.
problemas.

Se requiere de una sociedad bien informada que pueda analizar


todas y cada una de las alternativas tecnolgicas para contender
con los diferentes problemas y demandas, y de un decidido apoyo
a la comunidad cientfica nacional para poder evaluarlas y
aprovecharlas.
IV.Consideracionesfinales
La biodiversidad es una gran riqueza nacional y del planeta. Se debe utilizar
responsable y sustentablemente en busca de incorporar un mayor valor
agregado a productos de origen biolgico, y la biotecnologa ha ayudado en este
sentido y puede seguir ayudando en muchos aspectos
aspectos. Se requiere
requiere, para ello
ello,
contar con informacin cientfica slidamente sustentada y analizada de manera
responsable e integral, y no con supersticiones y prejuicios sin sustento que
demonicen los organismos transgnicos y sus productos, para realizar un
anlisis objetivo
j de las ventajas
j y los riesgos
g de utilizar los OGM as como de no
utilizarlos.

Se cuenta con un conjunto amplio de evidencias sustentadas cientficamente


que soportan las razones para considerar a los OGM como organismos con
niveles de riesgo similares a los que existen en la biota, ya que son creados por
procesos de transferencia horizontal de material gentico y reorganizacin del
genoma, que ocurren cotidianamente en la naturaleza y que han sido
parcialmente responsables de la evolucin de las especies
especies.

Finalmente, en el texto se sealan las recomendaciones para un uso


responsable
bl de
d los
l OGM que en nuestro t pas
est
t normado,
d como se ha
h
sealado, por el Protocolo de Cartagena, la Ley de Bioseguridad de
Organismos Genticamente Modificados y su Reglamento.
IV.Consideracionesfinales
Elusodecualquiertecnologatieneriesgospotenciales.Enestesentido,esimportante
sealarqueenelcasodeciertosfrmacosenlosquesedemuestradaosalasaludporsu
uso,normalmentelasagenciasgubernamentalesresponsablesretirandelmercado(delas
farmacias)estosmedicamentos.Enelcasodelosproductosdeorigentransgnicoy,en
particular,delosalimentostransgnicos,existendosejemplos(eldelmazStarlink enEUA
yunavariedaddechcharosenAustralia)enlosqueseencontraronposiblesefectos
alergnicosporsuconsumo,fueronretirados.Sinembargo,encuantoaloscultivos
l i f i d Si b l li
transgnicosquehoyendaseutilizan,existeevidenciacientficaslida deausenciade
daoalasaludhumanasustentadaenmuchaspublicacionesquedemuestranausenciade
daoporelconsumoporanimalesdediferentescultivarestransgnicos.

Existenalgunaspublicacionesrecientesendondesereportanposiblesefectosnegativosen
algunos animales por el consumo de ciertos OGM Es importante sealar nuevamente la
algunosanimalesporelconsumodeciertosOGM.Esimportantesealarnuevamentela
relevanciadequeestosexperimentossepuedanrepetirporotrosgruposdemanera
independienteparavalidarlosresultados,yaquepudieranexistirotrosfactores
responsablesdelposibledao,comolapresenciadepesticidasoherbicidasqumicosenlos
cultivares utilizados y que stos fueran los verdaderos responsables de los efectos
cultivaresutilizadosyquestosfueranlosverdaderosresponsablesdelosefectos
negativosdetectadosporciertosgrupos.Sinembargo,dedemostrarsecontundentemente
daoporalgnOGMhabraquecancelarelusodeeseOGM.
IV.Consideracionesfinales
Se insiste que hasta la fecha, los datos publicados en la literatura no han
motivado la cancelacin y el retiro del mercado de los cultivares transgnicos
g
que supuestamente los causan, por parte de las agencias gubernamentales
responsables en diferentes pases de la autorizacin del consumo y liberacin
de estos OGM. Asimismo, la Organizacin Mundial de la Salud ha avalado el
uso de estos organismos como alimento. Por lo anterior, los organismos
transgnicos y sus productos hoy autorizados y presentes en el mercado, se
siguen utilizando y consumiendo en ms de 50 pases por cerca de 300
millones de personas.
Se reitera q
que existe un conjunto
j importante
p de evidencias cientficas slidas
generadas por muchos grupos de manera independiente, que sustentan el
bajo riesgo que implica el utilizar transgnicos o sus productos comerciales,
por ser organismos generados por procesos de transferencia horizontal de
ADN y de reorganizacin
g del ggenoma que ocurren cotidianamente en la
naturaleza.

La biotecnologa
g no es en forma innata buena o mala. Tiene un p potencial
para aligerar o agravar el impacto de la actividad agropecuaria en el medio
ambiente. El reto es desarrollar, proveer y manejar la biotecnologa en
beneficio del ser humano y del ambiente.
REPORTE DE UNA DCADA DE INVESTIGACIN
SOBRE OGM EN LA UNIN EUROPEA (2001-
(2001-2010)
The main conclusion to be drawn from the efforts of
more than 130 research projects,
projects covering a period of
more than 25 years of research, and involving more
than 500 independent research groups, is that
biotechnology, and in particular GMOs, are not per
se more risky than e
e.g.
g conventional plant breeding
technologies.

It is predicted that, whereas the past century was


transformed with the commercialisation of personal
computers and the development of the Internet, the
21st century will be revolutionised by our growing
understanding of the functioning and interaction of
biological systems
systems, whether at the molecular or at
the ecosystem level.
Biotechnology is not a purely academic exercise: its
findings and developments will lead to applications and
products
essential to society. However, only a structured
dialogue with policymakers, stakeholders and the
public, based on sound science and empirical
evidence, will clear the way for a balanced
assessment of the benefits and risks of
biotechnology and GMOs within the framework of
the bio-economy.
htt //
http://www.agbioworld.org/declaration
bi ld /d l ti

Declaration
ScientistsInSupportOfAgriculturalBiotechnology
We,theundersignedmembersofthescientificcommunity,believethatrecombinantDNAtechniques
constitutepowerfulandsafemeansforthemodificationoforganismsandcancontributesubstantiallyin
enhancingqualityoflifebyimprovingagriculture,healthcare,andtheenvironment.Theresponsible
geneticmodificationofplantsisneithernewnordangerous.Manycharacteristics,suchaspestand
, y pp y
diseaseresistance,havebeenroutinelyintroducedintocropplantsbytraditionalmethodsofsexual
reproductionorcellcultureprocedures.Theadditionofnewordifferentgenesintoanorganismby
recombinantDNAtechniquesdoesnotinherentlyposeneworheightenedrisksrelativetothe
modificationoforganismsbymoretraditionalmethods,andtherelativesafetyofmarketedproductsis
furtherensuredbycurrentregulationsintendedtosafeguardthefoodsupply.Thenovelgenetictools
offergreaterflexibilityandprecisioninthemodificationofcropplants.Nofoodproducts,whether
produced with recombinant DNA techniques or with more traditional methods are totally without risk
producedwithrecombinantDNAtechniquesorwithmoretraditionalmethods,aretotallywithoutrisk.
Therisksposedbyfoodsareafunctionofthebiologicalcharacteristicsofthosefoodsandthespecific
genesthathavebeenused,notoftheprocessesemployedintheirdevelopment.Ourgoalasscientistsis
toensurethatanynewfoodsproducedfromrecombinantDNAareassafeorsaferthanfoodsalready
beingconsumed.Currentmethodsofregulationanddevelopmenthaveworkedwell.RecombinantDNA
techniqueshavealreadybeenusedtodevelop'environmentallyfriendly'cropplantswithtraitsthat
preserve yields and allow farmers to reduce their use of synthetic pesticides and herbicides The next
preserveyieldsandallowfarmerstoreducetheiruseofsyntheticpesticidesandherbicides.Thenext
generationofproductspromisestoprovideevengreaterbenefitstoconsumers,suchasenhanced
nutrition,healthieroils,enhancedvitamincontent,longershelflifeandimprovedmedicines.Through
judiciousdeployment,biotechnologycanalsoaddressenvironmentaldegradation,hunger,andpovertyin
thedevelopingworldbyprovidingimprovedagriculturalproductivityandgreaternutritionalsecurity.
Scientistsattheinternationalagriculturalcenters,universities,publicresearchinstitutions,andelsewhere
arealreadyexperimentingwithproductsintendedspecificallyforuseinthedevelopingworld.Wehereby
expressoursupportfortheuseofrecombinantDNAasapotenttoolfortheachievementofaproductive
andsustainableagriculturalsystem.Wealsourgepolicymakerstousesoundscientificprinciplesinthe
regulationofproductsproducedwithrecombinantDNA,andtobaseevaluationsofthoseproductsupon
thecharacteristicsofthoseproducts,ratherthanontheprocessesusedintheirdevelopment.
Los siguientes Norman Borlaug. Nobel Peace Prize 1970
cientficos, James Watson. Nobel Prize in Phisiology or Medicine 1962
ganadores de Timothy Hunt. Nobel Prize in Phisiology or Medicine 2001
Premios Nobel
Nobel, Peter C. Doherty. Nobel Prize in Phisiology or Medicine 1996
han firmado la Paul D. Boyer. Nobel Prize in Chemistry 1997
Declaracin Oscar Arias Sanchez. Nobel Peace Prize 1987
AgBioworld en
g Nobel Prize in Chemistry
Paul Berg. y 1980
apoyo a la
Biotecnolga Phillip A. Sharp. Nobel Prize in Phisiology or Medicine 1993
Agrcola. Douglas D. Osheroff. Nobel Prize in Physiscs 1996
Entre ellos, Marshall Nirenberg. Nobel Prize in Phisiology or Medicine 1968
ntese
t que Richard E.
E Smalley.
Smalley Nobel Prize in Chemistry 1996
firman Watson, Edward Lewis. Nobel Prize in Phisiology or Medicine 1995
Borlaug y Sydney Brenner. Nobel Prize in Phisiology or Medicine 2002
Kornberg, que Eric Wieschaus. Nobel Prize in Phisiology or Medicine 1995
son los
l Leon N. Cooper. Nobel Prize in Physics 1972
expertos ms Edmond H. Fischer. Nobel Prize in Phisiology or Medicine 1992
reconocidos en George A. Olah. Nobel Prize in Chemistry 1994
el rea de la gy or Medicine 1974
Christian de Duve. Nobel Prize in Phisiology
bi l
biologa Mario Molina. Nobel Prize in Chemistry 1995
molecular.
Tambin Mario Arthur Kornberg. Nobel Prize in Phisiology or Medicine 1959
Molina asienta Donald A.Glaser. Nobel Prize in Physics 1960
su firma.
firma Roger Guillemin
Guillemin. Nobel Prize in Phisiology or Medicine 1977
Sheldon Glashow. Nobel Prize in Physics 1979
Adems, ms de 3,400
personas han firmado Jean Marie Lehn. Nobel Prize in Chemistry 1987
la Declaracin Richard J. Roberts. Nobel Prize in Phisiology or Medicine 1993