Está en la página 1de 60

INSTITUTO POLITCNICO NACIONAL

ESCUELA NACIONAL DE CIENCIAS BIOLGICAS

Descripcin de una nueva especie del gnero Rahnella aisladas del


tracto digestivo de Dendroctonus sp.

TESIS

QUE COMO UNO DE LOS REQUISITOS PARA OBTENER EL GRADO DE

MAESTRIA EN CIENCIAS QUIMICO BIOLGICAS

presenta:

Q.B.P BRENDA VEGA CORREA

DIRECTORES

Dra. Flor Nohem Rivera Ordua

Dr. Gerardo Ziga Bermdez

MXICO D.F
DICIEMBRE 2016

1
2
3
Este trabajo fue realizado en el Laboratorio de Ecologa Microbiana del
Departamento de Microbiologa de la Escuela Nacional de Ciencias Biolgicas del
Instituto Politcnico Nacional, bajo la direccin de la Dra. Flor Nohem Rivera
Ordua y el Dr. Gerardo Ziga.

La sustentante fue becaria del Consejo Nacional de Ciencia y Tecnologa


(CONACYT) con nm. de registro 576556, Beca de Estmulo Institucional de
Formacin de Investigadores (BEIFI) y Beca Tesis Maestra del IPN.

Esta investigacin form parte de los proyectos: CONACYT-SEP No.169494


Dinmica de la comunidad microbiana asociada al tracto digestivo de
Dendroctonus rhizophagus Thomas & Brigth (Curculionidae: Scolytinae) a travs
de su ciclo de vida y SIP 20161001: Los citocromos P45O completos (CYPOMA)
de Candida oregonensis asociada al tracto digestivo de Dendroctonus
rhizophagus

4
INDICE
I INTRODUCCION............................................................................................... 11
1.1 Interaccin microorganismos-insecto..............................................................11
1.2 El tracto digestivo como un hbitat para los microorganismos............................11
1.3 Diversidad de bacteriana del tracto digestivo de Dendroctonus...........................13
1.4 Identificacin taxonmica de especies bacterianas...........................................14
1.4.1 Caracteres fenotpicos............................................................................ 14
1.4.2 Caracteres genotpicos...........................................................................15
1.4.3 Anlisis de secuencia multilocus (MLSA)...................................................16
1.5 Taxonoma polifsica.................................................................................... 17
1.6 Gnero Rahnella......................................................................................... 18
II. ANTECEDENTES.......................................................................................... 19
III. JUSTIFICACIN.............................................................................................. 20
V. OBJETIVOS.................................................................................................... 22
5.1 Objetivo general.......................................................................................... 22
5.2 Objetivos particulares................................................................................... 22
VI. MATERIALES Y MTODOS.............................................................................. 23
6.2 Aislados de Rahnella sp................................................................................ 23
6.3 CARACTERIZACIN FENOTPICA...............................................................23
6.3.1 Caracterizacin morfolgica........................................................................23
6.3.1.1 Morfologa macroscopica......................................................................23
6.3.1.2 Morfologa microscpica.......................................................................24
6.3.1.3 Pruebas bioqumicas........................................................................... 25
6.3.1.4 Catalasa y Oxidasa.............................................................................. 25
6.3.1.5 Crecimiento a diferentes temperaturas...................................................26
6.3.1.6 Crecimiento a diferentes pH..................................................................26
6.3.1.7 Anlisis proteico ribosomal....................................................................26
6.2 CARACTERIZACIN GENOTPICAS.............................................................27
6.2.1 Extraccin de DNA genmico...................................................................27
6.2.2 Tcnica ERIC-PCR................................................................................ 28
6.2.3. Amplificacin y secuenciacin de los genes multilocus (MSLA)....................29
6.2.4 Anlisis de las secuencias multilocus (MLSA).............................................31

5
6.2.5 Determinacin del contenido de G+C........................................................31
VII. RESULTADOS............................................................................................ 33
7.1. Caracterizacin fenotpica.........................................................................33
7.1.1 Morfologa macro y microscpica.............................................................33
7.1.2 Pruebas bioqumicas.............................................................................. 34
7.1.3. Perfil proteico ribosomal.........................................................................37
7.2.1 Extraccin de DNA cromosmico..............................................................39
7.2.2 Anlisis de patrones ERIC-PCR...............................................................39
7.2.3 Anlisis de las secuencias del gen 16S rRNA.............................................40
7.2.4 Anlisis de secuencias MLSA..................................................................43
7.2.5 Contenido de G+C................................................................................. 45
VIII. DISCUSION.................................................................................................. 47
IX. CONCLUSIONES............................................................................................ 50
X. ESTUDIOS PROSPECTIVOS...........................................................................51
XI REFERENCIAS............................................................................................... 52

6
INDICE DE TABLAS

Tabla 1. Aislados de Rahnella sp. 25

Tabla 2. Componentes de la reaccin de PCR para la amplificacin de 29


ERIC-PCR

Tabla 3. Iniciadores empleados para la amplificacin de los genes gyrB, 31


rpoB, infB y atpD.

Tabla 4. Iniciadores internos empleados para la secuenciacin de los 36


genes gyrB, rpoB, infB y atpD

TABLA 5. Caractersticas bioqumicas diferenciales del gnero Rahnella 37


para los aislados de Rahnella sp.nov.

Tabla 6. Caractersticas bioqumicas diferenciales entre las diferentes 43


especies del gnero Rahnella

Tabla 7. Valores de similitud entre los aislados de Rahnella sp.nov. y las


especies de referencia del mismo gnero. 46

Tabla 8. Porcentaje de G+C de las especies que integran el gnero


Rahnella y Rahnella sp.nov. 46

7
INDICE DE FIGURAS

Figura 1. Caractersticas microscpicas de Rahnella 34

Figura 2. Perfiles preteicos ribosomales de las especies correspondientes 39


al gnero Rahnella

Figura 3. Electroforesis del DNA cromosmico de los aislados de 40


Rahnella sp. nov.

Figura 4. Electroforesis de ERIC-PCR de las diferentes cepas de 41


Rahnella

Figura 5. rbol filogentico por mxima verosimilitud a partir del 16S 42


rRNA de los aislados de Rahnella sp. nov. y secuencias de referencia de
los gneros Rahnella, Serratia, Ewingella y Gibbsella

Figura 6. Producto de PCR del gen gyrB de los aislados de Rahnella sp. 44
nov.

Figura 7. Producto de PCR del gen atpD de los aislados de Rahnella sp. 44
nov.

Figura 8. Producto de PCR del gen infB de los aislados de Rahnella sp. 45
nov.

Figura 9. Producto de PCR del gen rpoB de los aislados de Rahnella sp. 45
nov.

Figura 10. rbol filogentico por mxima verosimilitud a partir de los 42


genes MLSA de los aislados de Rahnella sp. nov

RESUMEN

El gnero Ranhella fue descrito en 1979 en base a sus caractersticas fenotpicas


en una especie nica Ranhella aquatilis. Esta especie ubicua que tiene una amplia
distribucin en ambiente (agua, suelo, endfito de plantas y tracto digestivo de

8
insectos) y ocasionalmente aislada de muestras clnicas y alimento. Algunos
estudios documentaron que exista una gran variacin gentica entre los
diferentes aislados. actualmente se han reconocido seis especies que integran a
este gnero Rahnella victoriana, R. variigena, R. inusitata, R. bruchi, R.
woolbedingensis R. aquatilis. La comunidad bacteriana presente en el tracto
digestivo de la mayora de las especies del gnero Dendroctonus, est integrada
por especies identificadas como Ranhella aquatilis Ranhella sp., las cuales son
especies dominantes en este microhbitat. Por lo tanto, el objetivo de este estudio
es realizar la descripcin de una nueva especie pertenecientes al gnero
Rahnella aisladas del tracto digestivo de Dendroctonus sp. Los resultados de este
estudio mostraron, a travs de una aproximacin polifsico, que el taxn
bacteriano referido como Rahnella sp. presente en el intestino de las especies
analizadas del gnero Dendroctonus corresponde a una nueva especie,
denominada Rahnella dendroctorum. Bacilo pleomrfico Gram negativo, con un
tamao aproximado de 0.4-0.6 x 2-3.5 m que posee fimbrias y flagelos. Las
colonias son blancas, redondas, convexas, bordes enteros, lisa, cremosa, no
genera pigmento difusible, hmeda, traslcida, brillante en medio TSA despus de
incubarlas 48 h a 28C. Crece mejor en un rango de temperatura de 28 a 37C a
pH 7. El contenido G+C en su genoma fue de 52%. Entre los atributos que
permitieron describir a este taxn como nueva especie destacan: 1) la actividad
positiva de la enzima triptfano desaminasa (TDA), ya que en las otras especies
del gnero Rahnella es negativa 2) las diferentes huellas genticas con los
marcadores ERIC-PCR desplegadas por los miembros de este taxn, con
respecto a las especies descritas del gnero Rahnella; 3) su integracin como
grupo independiente en la filogenia del 16S rRNA, del resto de las especies
conocidas del gnero Rahnella, 4) su agrupacin independiente en la filogenia
inferida con los marcadores MLSA, del resto de las especies conocidas del gnero
Rahnella.

ABSTRAC

The genus Ranhella was described in 1979 based on its phenotypic characteristics
in a single species Ranhella aquatilis. This ubiquitous species has a wide

9
distribution in environment (water, soil, plant endophyte and insect digestive tract)
and occasionally isolated from clinical samples and food. Some studies
documented that there a great genetic variation between the different isolates. Six
species have been recognized that integrate this genus, Rahnella victoriana, R.
variigena, R. inusitata, R. bruchi, R. woolbedingensis y R. aquatilis. The bacterial
community present in the gut of most species of the genus Dendroctonus, is
composed of species identified as Ranhella aquatilis or Ranhella sp., Which are
dominant species in this microhabitat. Therefore, the objective of this study is to
perform the description of a new species belonging to the genus Rahnella isolated
from gut of Dendroctonus sp. The results of this study showed, through a
polyphasic approximation, that the bacterial taxon referred as Rahnella sp. present
in the gut of the species analyzed of the genus Dendroctonus corresponds to a
new species, denominated Rahnella dendroctorum. Gram negative pleomorphic
bacillus, with an size of 0.4-0.6 x 2-3.5 m that has fimbriae and flagella. The
colonies are white, round, convex, whole edges, smooth, creamy, does not
generate diffusible, moist, translucent, bright pigment in TSA medium after
incubation 48 h at 28C. This species grows better a temperature range of 28 to
37C at pH 7. The GC content from their genome was of 52%. Among the
attributes that allowed us to describe this taxon as a new species are: 1) the
positive activity of the enzyme tryptophan deaminase (TDA), since in the other
species of the genus Rahnella it is negative 2) the different genetic profile with the
ERIC-PCR deployed by the members of this taxon, with respect to the described
species of the genus Rahnella; 3) its integration as an independent group in the
phylogeny of the 16S rRNA, of the rest of the known species of the genus
Rahnella, 4) its independent grouping in the phylogeny inferred with the MLSA, of
the rest of the known species of the genus Rahnella.

10
I INTRODUCCION

1.1 Interaccin microorganismos-insecto


Las asociaciones simbiticas entre insectos y microorganismos sugieren, que
la diversificacin de los insectos no ha sido un proceso intrnseco a ellos, sino
tambin resultado de la contribucin de sus simbiontes al sumar sus capacidades
metablicas, lo que facilitado la explotacin de diversos sustratos y la adaptacin
de los insectos a diversos hbitats (Douglas, 2009; Klepzig et al., 2009; Popa et
al., 2012).
Los insectos han establecido en el trascurso de su proceso evolutivo
innumerables relaciones simbiticas, obligadas o facultativas, con diversos
microorganismos como bacterias, hongos filamentosos y levaduras (Moran et al.,
2005; Douglas, 2009; Engel and Moran, 2013). De tal manera, que los
microorganismos han jugado un papel fundamental en diversos procesos vitales
de los insectos como son desarrollo, reproduccin y supervivencia de su husped
(Klepzig and Six, 2004; Rajagopal, 2009; Feldhaar, 2011; Engel and Moran, 2012;
2013). Adems, los microorganismos simbiontes han provedo a sus huspedes
nutrientes (Bridges, 1981; Delalibera et al., 2005; Hofstetter et al., 2006;
Vasanthakumar et al., 2006; Morales-Jimnez et al., 2009; 2013) y proteccin
(Boone et al., 2008), as como coadyuvado en procesos de desintoxicacin y en
los sistemas de comunicacin qumica (Callaham and Shifrine, 1960; Brand et al.,
1977; Boone et al., 2013; Adams et al., 2011, 2013; Xu et al., 2015; Briones-
Roblero, et al., datos no publicados).

1.2 El tracto digestivo como un hbitat para los microorganismos


La anatoma del tracto digestivo de algunas especies de insectos ha sido
ampliamente estudiada y caracterizada (Hosokawa et al., 2012; Buchner, 1965;
Fukatsu and Hosokawa, 2002; Brune, 2010). La estructura del intestino es similar
entre la mayora de los insectos, aunque poseen algunas diferencias anatmicas
asociadas con la adaptacin a diferentes modos de alimentacin (Engel and

11
Moran, 2013). De manera general, se conoce que el intestino de los insectos est
conformado por tres regiones anatmicas: estomodeo, mesentern y proctodeo,
las cuales poseen caractersticas anatmicasfuncionales especficas. La
compartamentalizacin del canal alimentario define y regula muchas de las
funciones que se desarrollan en sus diferentes regiones. Por ejemplo, en
mesenteron anterior estn presentes una gran cantidad de enzimas digestivas que
facilitan la degradacin de grandes partculas de alimento; en el mesentern
posterior se llevan a cabo principalmente procesos de digestin y absorcin; y en
el proctodeo se llevan a cabo procesos de absorcin y excrecin (Brune, 1998;
Daz et al., 1998, Silva- Olivares et al., 2003; Fujita, 2004; Chapman et al., 2013;
Engel and Moran, 2013). En el caso especifico de los descortezadores del gnero
Dendroctonus, se ha documentado que el canal alimentario es el sitio donde se
desarrollan procesos de desintoxicacin, transporte y produccin semioqumicos,
compuestos qumicos esenciales para la colonizacin de huspedes, reproduccin
y supervivencia de esto insectos (Daz et al., 1998; Silva- Olivares et al., 2003;
Ceja-Navarro et al., 2014).

Se argumenta que una amplia gama de factores biticos y abiticos hacen


propicio al intestino de los insectos para ser un hbitat que albergue una gran
variedad de poblaciones microbianas (Brune, 1998), entre las que destacan: pH,
temperatura, potencial redox, concentracin de oxgeno, disponibilidad de
nutrientes, interacciones ecolgicas, tolerancia, tasas de crecimiento poblacional,
comunicacin qumica y respuesta inmune del insecto (Lemke et al 2003; Shi et
al., 2010; Engel and Moran, 2013; ustr et al., 2014; Bauer et al., 2015; Ceja-
Navarro et al., 2014). Todas estas caracterstica suelen ser presiones de seleccin
que cambian en el espacio y tiempo durante el desarrollo del insectos, limitando,
condicionando y regulando su presencia en el intestino de los insectos.

En las ltimas dcadas se ha incrementado el nmero de nuevas especies


microbianas aisladas del intestino de diversos insectos como son: termitas, abejas,
cucarachas, mosca de la fruta, gorgojos y descortezadores entre otros
(Skrodenyte-Arbaciauskiene et al., 2012; Bang et al., 2015; Li et al., 2015;

12
Menndez et al., 2015; Praet et al., 2015; Pramono et al., 2015; Rohland and
Meyers, 2015; Ma et al 2016; Kenerov et al 2016; Liu et al., 2016). As, por
ejemplo, fue descrita Erwinia typographi aislada del intestino del descortezador Ips
typographus (Skrodenyte-Arbaciauskiene et al., 2012) y Pseudomonas
coleopterorum fue aislada de Hylesinus fraxini (Menndez et al., 2015).

1.3 Diversidad de bacteriana del tracto digestivo de Dendroctonus


La -diversidad de microorganismos asociada a los insectos vara en
funcin del hbitat, hbitos alimentarios, nivel de la cadena trfica y especie de
insecto (Klepzig et al., 2009; Douglas, 2009). Particularmente, en el gnero
Dendroctonus se ha determinado la composicin y abundancia de las
comunidades microbianas empleando mtodos dependientes e independientes de
cultivo de algunas de las especies que integran este gnero (Delalibera et al.,
2005; Vasanthakumar et al., 2006; Yilmaz et al., 2006; Rivera et al., 2009; Morales-
Jimnez et al., 2009; 2012; Winder et al., 2010; Adams et al., 2013; Hu et al.,
2014; Xu et al., 2015; Lou et al., 2014; Briones-Roblero et al., 2017; Durand et al.,
2015; Mason et al., 2016).

Dos de las conclusiones ms importantes de todos estos estudios han sido,


por un lado que el intestino de los estos descortezadores alberga una diversidad
de microorganismos muy baja comparada con la de otros insectos (Lundgren et
al., 2007; Lehman et al., 2009; Engel and Moran., 2013; Kenerov et al., 2016;
Praet et al., 2015); y por el otro, que muchos de ellos poseen capacidades
fisiolgicas y nutricionales fundamentales para los insectos (Morales-Jimnez et
al., 2009, 2012, 2013; Rivera et al., 2009; Hu et al., 2014; Briones-Roblero et al.,
2017).

En particular, la comunidad bacteriana cultivable del intestino de las


especies del gnero Dendroctonus est integrada principalmente por miembros de
las filas Proteobacteria, Firmicutes, Actinobacteria, Bacteroidetes, las cuales estn
conformadas principalmente por 32 gneros bacterianos entre los que destacan:
Acinetobacter, Arthrobacter, Bacillus, Enterobacter, Erwinia, Kocuria,
Pseudomonas, Pantoea, Ranhella, Serratia y Stenotrophomonas, entre otros

13
(Bridges et al., 1984; Delalibera et al., 2005; Vasanthakumar et al., 2006; Yilmaz
et al., 2006; Morales-Jimnez et al., 2009; 2012; 2013; Xu, 2015; Briones-Roblero
et al., 2017). La identificacin taxonmica de estas bacterias, se ha realizado
mediante la secuenciacin parcial o total del gen 16S del rRNA; no obstante, este
gen ribosomal en la mayora de las ocasiones no ha sido suficiente para realizar la
asignacin taxonmica a nivel de especie, De tal manera, que en la mayora de
los estudios la identificacin de un gran nmero de aislados en estos estudios
qued nicamente a nivel de gnero o bien a niveles jerrquicos ms altos
(Delalibera et al., 2005; Vasanthakumar et al., 2006; Yilmaz et al., 2006; Morales-
Jimnez et al., 2009; 2012; 2013; Xu et al., 2015; Briones-Roblero et al., 2017).

1.4 Identificacin taxonmica de especies bacterianas

1.4.1 Caracteres fenotpicos


La identificacin taxonmica de las bacterias se inici con el uso de caracteres
fenotpicos, los cuales se basa en la expresin observable del genotipo, y por lo
tanto depende de las condiciones ambientales. Dado que la informacin gentica
no se expresa en su totalidad, el fenotipo refleja nicamente una pequea parte de
dicha informacin y esto se ve reflejado en la identificacin de algunos
microorganismos. Los esquemas tradicionales de identificacin fenotpica
bacteriana se basan en caractersticas morfolgicas (micro y macroscpicas),
propiedades bioqumicas y metablicas. Sin embargo, una limitante importante en
el uso de estos caracteres es la plasticidad fenotpica, la cual se define como la
capacidad de un organismo de producir diferentes fenotipos morfolgicos,
bioqumicos o fisiolgicos como respuesta a cambios en el ambiente (Tindall et al.,
2010; Pigliucci et al., 2006; Whitman et al., 2009). La falta de concordancia entre
las caractersticas fenotpicas del aislado en estudio y las correspondientes a la
cepa tipo condujeron en mltiples ocasiones a identificaciones taxonmicas no
definitivas de las especies en cuestin. Por ello, como una alternativa auxiliar para
incrementar la capacidad para identificar correctamente a las especies, se
incorporaron mtodos genotpicos que hacen uso de la informacin contenida en
el material gentico de la clula (DNA y RNA) (McArthur, 2006).

14
Dos de las tcnicas moleculares desarrolladas e incorporadas en la taxonoma
de procariontes y eucariontes fueron la estimacin del contenido de G+C del
genoma e hibridacin DNA-DNA. La primera fue incorporada como atributo
taxonmico ms en los microorganismos, debido a que el contenido de G+C es
constante para una especie dada. No obstante, la similitud en la composicin
estas bases no necesariamente sustenta una relacin taxonmica o filogentica.
Este atributo simplemente mide el grado de heterogeneidad gentica de las
especies, por ello, se han establecido niveles de corte para definir la variacin del
atributo entre los miembros de una misma especie (<5%) y entre las especies del
gnero (10-12%) (Mesbah et al., 1989; Stackebrandt and Liesack,1993; Gonzles
and Saiz-Jimnez, 2002; Moreira et al., 2011). La tcnica de Hibridacin DNA-
DNA, por su parte, fue un mtodo introducido para determinar el grado de
similitud entre el genoma de dos especies. De tal manera, que una hibridacin de
DNA igual o menor al 70% y una diferencia en la temperatura media de fusin
igual o menor a 5C, fueron considerados atributos tiles en el reconocimiento de
nuevas especies (Stackebrandt and Goebel, 1994; Gonzles and Saiz-Jimnez,
2004; Sharp et al., 2005; Moreira et al., 2011).

1.4.2 Caracteres genotpicos


La incorporacin de estos atributos produjo un cambio en el trabajo y
pensamiento taxonmico, ya que se paso de taxonoma sustentada en el especie
taxonmica a una basada en el concepto fentico (similitud) o filogentico
(ancestro-descendiente) (Woese, 1987).

En la identificacin taxonmica de los procariotas por mtodos fenticos se


incorporaron diversas tcnicas moleculares (RAPDs, RFLPs, ANDRA, BOX-PCR,
DGGE, ERIC, PFGE y otros) cuyos productos permitieron una mejor comparacin
de la variacin intra- e interespecfica. Sin embargo, si bien estas tcnicas dan
cuenta de la variabilidad gentica en esos niveles, son por si solas poco tiles
para definir e identificar especies porque establecen comparaciones por similitud.

La incorporacin del gen 16S rRNA en la taxonoma de los procariontes


permiti incorporar el concepto de homologa, el cual es un concepto unificador en

15
las relaciones ancestro-descendiente de las especies (Woese, 1987; Rosell-Mora
and Amann, 2001; Konstantinidis and Tiedje, 2007; Yarza et al., 2008). Entre las
caractersticas que favorecieron el uso del gen 16S rRNA en la taxonoma
destacan: su distribucin universal, ya que es un componente esencial en la
funcin celular para la sntesis de protenas; tener una longitud razonable para
comparacin (1500 pb); contener regiones conservadas y altamente variables (20-
30 bases exclusivas en una especie); y poseer un alto polimorfismo interespecfico
para diferenciar entre las especies bacterianas (Dams et al., 1988; Woo et al.,
2008). Todas estas caractersticas hicieron que este gen fuera considerado el
estndar de oro para los estudios taxonmicos y filogenticos de las bacterias.
Sin embargo, actualmente una de las principales desventajas del uso de este gen
como un marcador taxonmico y filogentico es su insuficiencia informativa para
ambos propsitos; adems de que dependiendo del grupo de bacterias, el gen
puede estar duplicado muchas veces. Por ello, se ha recurrido a otros
marcadores moleculares, entre los que destacan aquellos relacionados con el
metabolismo central (Gevers et al., 2005; Maiden, 2006; Adkambi et al., 2011;
Brady et al., 2014; Mulet et al., 2012; Glaeser and Kmpfer, 2015)

1.4.3 Anlisis de secuencia multilocus (MLSA)


El anlisis de secuencia multilocus (MLSA, por sus siglas en ingls) es un
mtodo cada vez ms utilizado en la taxonoma y filogenia de procariontes. El
mtodo consiste en la secuenciacin de genes completos o fragmentos parciales
que codifican para protenas del metabolismo central de las bacterias (Maiden et
al., 1998; Gevers et al., 2005). Estos genes poseen tasas de evolucionan lenta
pero constante, por lo que tienen un mayor poder resolutivo comparado a nivel de
gnero y/o especie que el gen 16S rRNA. El supuesto de que se parte es que una
filogenia construida mltiples genes refleja mejor la relacin entre los taxones
bacterianos (Gevers et al., 2005; Glaeser and Kmpfer, 2015). El nmero y tipo de
genes seleccionados en los MLSA depende de los taxones bacterianos
estudiados, as como de la resolucin requerida para diferenciar a los taxones
(Maiden et al., 1998; Zeigler, 2003). Los genes ms utilizados son aquellos que
codifican para las subunidades de enzimas ubicuas, como son la subunidad de

16
DNA girasa (gyrB), la subunidad de ARN polimerasa (rpoB), factor de RNA
polimerasa (rpoD), la recombinasa A (recA), la subunidad de la ATP sintasa
F0F1 (atpD), el factor de iniciacin de la traduccin IF-2 (infB) y la chaperonina
GroEL (groEL) (Martens et al., 2008; Tindall et al., 2010; Glaeser and Kampfer.,
2015; Adkambi et al., 2011).

1.5 Taxonoma polifsica


Actualmente, la taxonoma de los procariotes se ha robustecido por el
desarrollo de diversas metodologas, de tal forma que Colwen (1970) acuo el
trmino Taxonoma Polifsica para referirse a la taxonoma que incorpora
diferentes niveles de informacin tanto genmicos como fenotpicos. El objetivo de
esta aproximacin es utilizar todos los datos disponibles para definir e identificar
mejor a los grupos bacterianos (Colwell, 1970; Gillis et al., 2005).

Por ello, actualmente, para definir nuevas especies bacterias se emplea un


conjunto de atributos fenotpicos y genotpicos. En los primeros destacan las
propiedades fsicas y metablicas de los microorganismos, la morfologa micro y
macroscopica, ultraestructura, potencial metablico, composicin de protenas,
hibridacin DNA-DNA, contenido de G+C y resistencia a antibiticos (Schleifer and
kandler, 1972; Smibert and Krieg, 1994; Rossell-Mora, 2006; Martens et al., 2008;
Tindall, 1990); entre los genotpicos sobresalen aquellos de huella gentica (ERIC-
PCR; BOX-PCR, RAPD, RFLPs, campos pulsados) que permiten una
caracterizacin amplia de la variacin gentica y los de secuenciacin de gen 16S
rRNA, MLSA, muchos otros genes y genomas completos, que permiten conocer
los niveles de variacin gentica y establecer relaciones ancestro-descendiente de
las especies (Yarza et al., 2008; Metzker, 2010; Bentley, 2006; Tindall et al., 2010;
Schleifer, 2009; Praet et al., 2015; Tegtmeier et al., 2016).

Otras pruebas ms que han integrado para tener una mejor identificacin
taxonmica son los mtodos quimiotaxonomicos, los cuales hacen uso de la
composicin qumica de las clulas bacterianas. Los componentes celulares ms
frecuentemente utilizados son la composicin de la pared celular, cidos grasos
(lpidos y lipopolisacridos), quinonas isoprenoides y poliaminas (Schlefer.,1972;

17
Collins and Jones, 1981; Ross and Grant., 1985; Suzuki et al., 1993; Tighe et al.,
2000).

La aplicacin de la taxonoma polifsica ha permitido la identificacin de


una gran variedad de taxones bacterianos nuevos y la reclasificacin de otros
(Schleifer, 2009; Tindall et al., 2010; More et al., 2010; Ramasamy et al., 2014; Li
et al., 2015; Bang et al., 2015; Rohland and Meyers, 2015).

1.6 Gnero Rahnella


El gnero Rahnella fue propuesto en 1979 para agrupar cepas fenotpicamente
similares aisladas de muestras de agua en Francia, integrada por una nica
especie Ranhella aquatilis, perteneciente a la familia Enterobacteriaceae. Es una
especie ubicua, ampliamente distribuida en el ambiente (agua, suelo, rizfora de
cultivos, intestinos de algunos insectos) y ocasionalmente aislada de alimentos y
muestras clnicas (Izard et al; 1979; Harrell et al 1989; Alballaa et al., 1992;
Brenner et al., 1998; Kim et al., 1997; Kmpfer, 2005; Morales-Jimnez et al.,
2009; 2012; Martinez et al., 2012; Brady et al., 2014; Briones-Roblero et al., 2017).
Esta especie esta genticamente relacionada con Ewingella americana y algunas
especies del gnero Serratia de acuerdo a la secuencia del gen 16S rDNA (Kim,
1997).

La secuenciacin de los genomas de algunos aislados identificados como


Rahnella aquatilis y Rahnella sp. mostraron una amplia variacin gentica entre
ellas (Izard et al; 1979; Kmpfer, 2005). Esta informacin permiti clasificar a
algunos aislados asociados a este gnero en tres genomospecies: la
genomoespecie 1 correspondiente a la cepa tipo de R. aquatilis; la genomospecie
2 conformada por cepas aisladas de agua, muestras clnicas humanas y
caracoles; y la genomospecies 3 definida por una sola cepa de procedencia
desconocida. Las genomospecies 2 y 3 mostraron menos de 60% de similitud de
DNA con la cepa tipo de R. aquatilis, sin embargo, a pesar de ello, no fueron
descritas como nuevas especies (Brenner et al., 1998). Brady et al. (2014)
realizaron un anlisis taxonmico polifsico de aislados de este gnero,
incluyendo a las genomoespecies 1 y 2, que resulto en la descripcin de cinco

18
nuevas especies: Rahnella victoriana, R. variigena (genomoespecie. 2), R.
inusitata (genomoespecie. 3), R. bruchi y R. woolbedingensis. Las aproximacin
incluy la amplificacin por la tcnica de ERIC-PCR, secuenciacin del gen 16S
rRNA, MLSA, ensayos fenotpicos, pruebas quimiotaxonmicos e hibridacin DNA-
DNA. Actualmente, el gnero Ranhella esta integrado por estas seis especies
(Brady et al., 2014).

II. ANTECEDENTES
Diversos trabajos enfocados en determinar la -diversidad de la comunidad
bacteriana del tracto digestivo de especies del gnero Dendroctonus, mediante
tcnicas dependientes e independientes de cultivo, han aislado e identificado a
travs de la secuenciacin del gen 16S rRNA y atributos bioqumicos diversos
gneros bacterianos presentes en su intestino, entre los que se encontraron
Acinetobacter lwoffii, Arthrobacter sp, Pseudomonas fluorescens, Pseudomonas
putida, Pseudomanas sp. Serratia proteomaculans, y Rahnella sp. Esta ltima
especie fue identificada como un miembro dominante de la comunidad bacteriana
del intestino de estos descortezadores, independientemente del estado de
desarrollo y de la regin geogrfica de la cual se colecto estos insectos (Morales-
Jimnez et al., 2009; 2012; Briones-Roblero et al., 2017). Adicionalmente, se ha
determinado que esta especie posee diversas actividades enzimticas, las cuales
sugirieren un papel importante en procesos digestivos y desintoxicacin en estos
insectos insecto (Briones-Roblero et al., 2017).

El anlisis filogentico de las secuencias del 16s rRNA de los aislados


identificados como Rahnella sp. y de las secuencias de referencia estrechamente
relacionadas, mostraron que los aislados se integraron en un clado o grupo
independiente, cercano a R. inusitata. Asimismo, se determin que la mayora de
los aislados mostraron valores de similitud entre el 9799 % con R. Inusitata y R.
aquatilis (Briones-Roblero et al., 2017). Esta evidencia sugiere que los aislados
identificados como Rahnella sp., podran tratarse de una nueva especie.

19
III. JUSTIFICACIN

El intestino de los insectos resulta ser un hbitat que alberga diversos


microorganismos como bacterias, levaduras y hongos. Se ha documentado que
los insectos poseen una gran diversidad bacteriana, reportando un gran nmero
de especies bacteriana nuevas. Debido a que el intestino posee caractersticas
fisicoqumicas que en conjunto lo hacen un sistema nico, el cual est sometido a
diferentes presiones de seleccin, lo que posiblemente pudiera provocar la
divergencia de muchas nuevas especies. Desafortunadamente, la identificacin
taxonmica de una gran variedad de bacterias solo ha llegado a nivel de gnero
debido a que la secuencia del gen 16S rRNA no es capaz de resolver hasta
especie. Actualmente, el anlisis polifsico incluye marcadores fenticos,
genticos y quimiotaxonmicos, que en conjunto permiten la identificacin de
nuevas especies bacteriana.

Por ello, a travs estos anlisis polifsicos se intenta identificar taxonmicamente


a los aislados de Ranhella sp. provenientes del intestino de algunas especies del
gnero Dendroctonus.

20
IV. HIPOTESIS

Dado que Ranhella sp. nov es un simbionte dominante en el tracto digestivo de las
especies del gnero Dendroctonus y que el anlisis filogentico de sus aislados
sugieren que podra ser una nueva especie, entonces una aproximacin polifsico
deber confirma si estos aislados pertenecen a una nueva especies del gnero
Ranhella.

21
V. OBJETIVOS

5.1 Objetivo general

Caracterizar por medio de una aproximacin polifsica los aislados


pertenecientes al gnero Rahnella asociados al tracto digestivo de especies
del gnero Dendroctonus.

5.2 Objetivos particulares

1. Realizar la caracterizacin fenotpica de los aislados de Rahnella


sp. provenientes del tracto digestivo de Dendroctonus sp.

2. Determinar la huella gentica de los Rahnella sp. mediante la


tcnica de ERIC-PCR.

3. Realizar la reconstruccin filogentica con cuatro genes


multilocus (MLSA): gyrB, rpoB, atpD y infD

4. Comparar el perfil proteico de los genes ribosomales de la cepa


tipo seleccionada y las cepas de referencia del gnero Rahnella.

5. Determinar el contenido de G+C en el genoma de la cepa tipo


seleccionada.

6. Descripcin taxonmica de la nueva especie del gnero Rahnella


sp.

22
VI. MATERIALES Y MTODOS

6.1 Cepas de refencia

En este estudio se emplearon las seis cepas tipo de las especies del gnero
Rahnella: Rahnella victoriana (DSM 27397T), Rahnella variigena (previamente
reportada como Rahnella genomosp. 2, LMG 27711T), Rahnella inusitata
(Rahnella genomosp. 3, LMG 2640T), Rahnella bruchi (DSM 27398T ), Rahnella
woolbedingensis (DSM 27399T ) y Rahnella aquatilis (LMG 2794). Estas cepas
fueron adquiridas de la Coleccin de cultivos Bacterianos BCCM/LMG de Blgica,
a travs de Coleccin Nacional de Cepas Microbianas y Cultivos Celulares del
CINVESTAV-IPN, Mxico (CINVESTAV, IPN) con nmero de registro interno
CDBB-D-1985 a CDBB-D-1990.

6.2 Aislados de Rahnella sp.

A partir de un total de 300 aislados obtenidos del tracto digestivo de


Dendroctonus adjunctus, D. mexicanus, D. valens y D. rhizophagus, los cuales
fueron identificados como Rahnellas sp., mediante la secuenciacin del 16S rRNA
(Briones-Roblero et al., 2017; Hernndez-Martinez, comun. pers.), se
seleccionaron 10 aislados tanto de larvas e insectos adultos (Tabla 1).

6.3 CARACTERIZACIN FENOTPICA

6.3.1 Caracterizacin morfolgica

6.3.1.1 Morfologa macroscopica


Los diez aislados fueron sembrados por estra cruza en agar soya
tripticaseiana (TSA, Dibico, USA) e incubadas a 48C durante 24 h. Se
determinaron las siguientes caractersticas: tamao, forma, color, bordes,
elevacin, luz reflejada, luz transmitida, superficie, aspecto, consistencia y
pigmento difusible (Brooks et al., 1991; De Vos et al., 2009)

23
Tabla 1. Aislados de Rahnella sp. aislados del tracto digestivo de diferentes
estadios de desarrollo de algunas especies del gnero Dendroctonus

Identificacin Estadio de
Aislados Huesped
taxonmica desarrollo

ChdrAdgB13 Rahnella sp Adulto Dendroctonus rhizophagus


ChdrLvgB08 Rahnella sp Larva Dendroctonus rhizophagus

ChdrPugB47 Rahnella sp Pupa Dendroctonus rhizophagus

ChdrPegB23 Rahnella sp Adulto Dendroctonus rhizophagus


DMEMP6 Rahnella sp Adultos Dendroctonus mexicanus
DMEMP7 Rahnella sp Adultos Dendroctonus mexicanus
DADMP04 Rahnella sp Adultos Dendroctonus adjuntus
DADMP19 Rahnella sp Adultos Dendroctonus adjuntus
DVAB8 Rahnella sp Adulto Dendroctonus valens

DVLB39 Rahnella sp Larva Dendroctonus valens

6.3.1.2 Morfologa microscpica

La morfologa celular de los aislados de Rahnella sp., se determin


mediante tincin negativa y tincin de Gram. Para llevar a cabo la tincin negativa
se eligi el aislado ChdrAdgB13, el cual fue sembrado en 25 mL de caldo soya
tripticasa (TSB, Dibico, USA) e incubado a 28C por 48 h en agitacin.
Transcurrido el tiempo, se transfirieron 1.5 mL del cultivo en un tubo Eppendorf
estril, centrifugado a 1400 rpm, con el objeto de obtener el paquete celular. El
sobrenadante fue eliminado y el paquete celular fue resuspendido en 1 mL de
solucin de fosfatos (PBS NaCl 138Mm, KCl 3Mm, NaHPO 8.1mM, KHPO 1.5
Mm, HO). Una vez preparada la suspensin se colocaron 30 L sobre una rejilla
de cobre 200/MESH (huecos/pulgada) y se dej expuesta por 2 min. Enseguida,
se depositaron sobre la rejilla 10 L de agua bidestilada por10 s, seguido de 20 L
de acetato de uranilo 2% (p/v) por 1 min, el exceso de acetato de uranilo se retir
con papel de filtro y la muestra se dej secar a temperatura ambiente. Una vez

24
realizada la tincin, la muestra se observ en un microscopio electrnico de
transmisin modelo JEOL GMM-1010 (JEOL, Japn) (Woeste and
Demchick.,1991) y se realizaron mediciones de ancho y largo de las clulas.
Adems, se realiz la tincin de Gram.

6.3.1.3 Pruebas bioqumicas

Para determinar las caractersticas fisiolgicas de los 10 aislados, stos


fueron sembradas por estra cruzada en medio TSA y se incubaron a 28C durante
24 h. Transcurrido el tiempo, se realiz una suspensin bacteriana ajustando al
tubo 0.5 de la escala de McFarland, 200 L de la suspensin se tomaron e
inocularon en cada uno de los pozos de la galera API 50 CH, API 20 E
(bioMrieux, Inc,. Hazelwood Missouri, USA) y Biolog Gen II (Biolog). Todo este
proceso se llev en condiciones de esterilidad e incubados a 28C por 24 a 48 h.
Despus de este tiempo se hizo la lectura de los resultados de manera manual, de
acuerdo a lo sealado por el fabricante.
El API 50 CH es un sistema compuesto por 50 pruebas bioqumicas para
determinar la capacidad de fermentacin de carbohidratos de los
microorganismos. El sistema API 20E es un sistema de 20 pruebas bioqumicas
para la identificacin de bacterias de la familia Enterobacteriaceae y otros bacilos
Gram-negativos y el sistema Biolog Gen II fue empleado para evaluar las
capacidades metablicas de Gram-negativos. En conjunto los tres sistemas se
complementan para una mejor caracterizacin fisiolgica de los aislados de
Rahnella sp.

6.3.1.4 Catalasa y Oxidasa

La produccin de la enzima catalasa, la cual rompe el perxido de


hidrgeno (H2O2) en oxgeno y agua, se aprecia por la generacin de burbujas.
Una colonia aislada fue colocada en un portaobjetos, se agregaron 2-3 gotas de
H2O2 al 3% ,y se observ la presencia o ausencia de burbujeo (MacFadin, 2003).

25
La prueba de oxidasa est diseada para identificar la enzima citocromo C.
Estas enzimas no slo tienen la capacidad de oxidar al citocromo C, sino tambin
de catalizar la reduccin de ste por accin de un agente cromognico reductor
tetrametil-p-fenilendiamina que desarrolla un color azul cuando esta oxidado. Un
cambio de color se produce si el agente reductor es oxidado, indicando que la
enzima citocromo c oxidasa est presente y la ausencia de color indica no est
presente la enzima (MacFadin, 2003; Bailey and Scott, 2007). Para realizar esta
prueba, se esparci una colonia en el portaobjetos y se adicionaron 2 gotas del
reactivo de oxidasa, el desarrollo de un color morado oscuro despus de unos
minutos indic la presencia de la enzima.

6.3.1.5 Crecimiento a diferentes temperaturas

La habilidad que presentan los aislados bacterianos para crecer a diferentes


temperaturas permite una primera discriminacin a nivel de gnero. Para ello, los
aislados de Rahnella sp. y las cepas de referencia fueron sembrados por estra
cruzada en medio TSA e incubados a diferentes temperaturas: 4, 10 28, 37 y 44C
por 48 h; la presencia y/o ausencia de crecimiento se monitoreo cada 24 h.

6.3.1.6 Crecimiento a diferentes pH

Para determinar el intervalo de pH ptimo de crecimiento de los aislados de


Ranhella sp y las cepas de referencia, se prepararon tubos con 5 mL de TSB, los
cuales fue ajustado a tres diferentes pH 4, 7 y 10. Cada tubo fue inocula con 100
L de la suspensin bacteriana ajustada previamente al tubo 0.5 del nefelometro
de Mcfarland y fueron incubados a 28C por 24 h. Los ensayos fueron realizados
por triplicado. Una vez transcurrido el tiempo se determin el crecimiento
bacteriano a 600 nm empleando un Multiescan Go (Thermo Scientific, USA).

6.3.1.7 Anlisis proteico ribosomal

26
Para determinar el perfil proteico ribosomal se tom una colonia de las cinco
cepas de referencia y el aislado ChdrAdgB13. Las identificaciones de los perfiles
se realizaron en el analizador Vitek MS Plus (VITEK). Cada una de las colonias
seleccionadas se colocaron por separado sobre una placa de metal pulido, a cada
una de las colonias se les aplic una matriz de solucin saturada de cido alfa-
ciano-4-hidroxicinamico, acetonitrilo y cido trifluoroactico y se dej secar a
temperatura ambiente. Esta matriz cumple dos funciones: 1) expone las protenas
intracelulares mediante la ruptura de la membrana celular y 2) facilita la
vaporizacin y la ionizacin de las protenas mediante un haz de laser pulsante.
Las protenas despus de ser ionizadas fueron transportadas por una cmara de
vaco siendo detectadas por un haz de luz. Dependiendo de la relacin
masa/carga de cada fragmento se determin el tiempo de retencin de cada
protena. Este tiempo fue utilizado para construir el espectro especfico de las
masas y comparado automticamente con una base de datos del equipo.
Adicionalmente, con el espectro de pesos y la abundancia de cada conjunto de
protena ribosomal correspondientes a cepa de referencia, fueron empleadas para
comparar manualmente cada perfil proteico (Ryzhow et al., 2001; Emonet et al.,
2010; Welker et al., 2011)

6.2 CARACTERIZACIN GENOTPICAS

6.2.1 Extraccin de DNA genmico

Todos los aislados fueron sembrados en TSA e incubados bajo las


condiciones previamente descritas. A partir de un cultivo de 24 h se colecto la
biomasa en tubos Eppendorf con 500 L de solucin de lisis (Tris-HCl 10 mM pH
8.0, EDTA 1mM, NaCl 10Mm, SDS 1%, Tritn x-100 2%), para llevar a cabo un
rompimiento mecnico se colocaron 2-3 mm de perlas de vidrio. Posteriormente,
500 L de cloroformo-alcohol isoamilico (24:1), se agito en vrtex 10 min, se dej
reposar 1 h en hielo y se realiz un choque trmico a 65C por 30 min. Enseguida,
se centrifuga 5 min a 14000 rpm, se coloc el sobre nadante en un tubo nuevo y
adicionndole 1 mL de isopropanol y se almaceno a -20C por 1h. Transcurrido el
tiempo se centrifuga 10 min a 14000 rpm, se elimin el sobrenadante, se lav la

27
pastilla con alcohol etlico al 70%, se retir el sobrenadante y se dej secar a
45C. Por ltimo, se resuspendi la pastilla en 30L de agua destilada (Hoffman
and Winston, 1987). Para visualizar la calidad del DNA se llev a cabo un
corrimiento electrofortico en un gel de agarosa al 1% y se ti con bromuro de
etidio (10 mg/mL).

6.2.2 Tcnica ERIC-PCR

Se realiz la amplificacin de las secuencias ERIC-PCR (amplificacin de


secuencias intergnicas de consenso repetitivas de enterobacterias), con el
objetivo de tener un patrn de huella gentica de los aislados y descartar la
clonalidad entre ellos. La reaccin se realiz en un volumen final de 25 L con los
componentes descritos en la tabla 2 y se utilizaron los iniciadores universales
ERIC 1 (5 ATGTAAGCTCCTGGGGATTCA 3) y ERIC 2 (5
AAGTAAGTGACTGGGGTGAGC 3) (Wilson and Sharp, 2006; Brady et al., 2014).
Las condiciones de amplificacin empleadas fueron las siguientes:
desnaturalizacin 94C durante 1 min a, alineamiento 52C 2 min, extensin a
65C 8 min por 30 ciclos y una extensin final de 65C por 16 min (Hulton, 1991;
Brujin,1992).

Tabla 2. Componentes de la reaccin de PCR para la amplificacin de


los ERIC-PCR

Componentes Cantidades

Buffer 2.5 L (1x)


Iniciador F 1.0 L (10 pMol)
Iniciador R 1.0 L (10 pMol)
dNTPs 1.0 L (10 mMol)
DNA molde 1.0 L (50-100 ng)
H2O 16.3 L
Taq polimerasa 0.2 L (1 U)

Para visualizar los perfiles ERIC se llev a cabo un corrimiento electrofortico


en geles de poliacrilamida. La preparacin del gel consisti un gel separador 10%
(3.0 mL de una mezcla de acrilamida al 30% y bis-acrilamida al 0.8%, 2.25 mL de

28
4X Tris-HCl/SDS pH 8.8, 4.05 mL de agua, 0.03 mL de persulfato de amonio al
10% y 0.006 mL de TEMED) y un gel concentrador 15% ( 0.39 mL de una mezcla
de acrilamida al 30% y bis-acrilamida al 0.8%, 0.75 mL de 4X tris-HCl/SDS pH 6.8,
1.83 mL de Agua, 0.015 mL de persulfato de amonio al 10% y 0.003 mL de
TEMED). Una vez realizado el corrimiento del gel fue teido con bromuro de etidio
(10 mg/mL) y visualizado en un transiluminador.
Enseguida fueron identificados los patrones de bandeo de cada aislados y
cepa de referencia y comparados entre s, para determinar si los aislados
mostraban clonalidad y para comparar los patrones de los aislados problemas con
los patrones de las cepas de referencia.

6.2.3. Amplificacin y secuenciacin de los genes multilocus (MSLA)

Los genes para el estudio de MLSA fueron los siguientes gyrB, rpoB, infB y
atpD, los cuales fueron previamente seleccionados para la identificacin de las
especies pertenecientes al gnero Rahnella (Brady et al., 2014), los fragmentos
esperados para estos genes oscilaron entre 600 y 700 pb (Tabla 3). Las
reacciones de PCR fueron las misma que se emplearon para los ERIC-PCR (Tabla
2). Las condiciones de amplificacin fueron las siguientes desnaturalizaciones
iniciales de 94C durante 5 min, seguido de 30 ciclos de desnaturalizacin a 94C,
una alineacin de 58C para los genes infB y atpD y 46C para los genes gyrB y
rpoB, una extensin de 72C 1 min, y una extensin final de 72C durante 5 min
(Brady et al., 2014).
Para visualizar la integridad de los amplicones se realiz una electroforesis
en geles de agarosa al 2% y se tio con bromuro de etidio (10 mg/mL) para
posteriormente ser visualizados en un transiluminador.

29
Tabla 3. Iniciadores empleados para amplificacin de los genes
gyrB, rpoB, infB y atpD

Tamao del
Gen Secuencia fragmento
(pb)

GyrB-01-F TAARTTYGAYGAYAACTCYTAYAAAGT 742


GyrB-02-R CMCCYTCCACCARGTAMAGTT 742
RpoB-CM7-F AACCAGTTCCGCGTTGGCCTG 637
RpoB-CM31B-R CCTGAACAACACGCTCGGA 637
AtpD-01-F RTAATYGGMGCSGTRGTNGAYGT 642
AtpD-02-R TCATCCGCMGGWACRTAWAYNGCCTG 642
InfB-01-F ATYATGGGHCAYGTHGAYCA 615
InfB-02-R ACKGAGTARTAACGCAGATCCA 615

La purificacin de los amplicones se realiz con el kit molecular biology


(Thermo cientific, USA), siguiendo las especificaciones del fabricante. Para la
secuenciacin de los amplicones se emple un segundo juego de iniciadores para
secuenciar una regin interna que oscil entre 142 a 242 pb dependiendo del gen
(Tabla 4).

Tabla 4. Iniciadores internos empleados para la secuenciacin de los genes


gyrB, rpoB, infB y atpD

Tamao del
Iniciador Secuencia
fragmento (pb)

GyrB-07-F GTVCGTTTCTGGCCVAG 142


GyrB-08-R CTTTACGRCGKGTCATWTCAC 142
RpoB-CM81-F* CAGTTCCGCGTTGGCCTG 230
RpoB-CM31b-R* CGGACCGGCCTGACGTTGCAT 230
AtpD-03-F TGCTGGAAGTKCAGCARCAG 242
AtpD-04-R CCMAGYARTGCGGATACTTC 242
InfB-03-F ACGGBATGATYACSTTCCTGG 145
InfB-04-F AGYTTAGATTTCTGCTGAGC 145
RpoB-CM81-F* y RpoB-CM31b-R* iniciadores diseados en este estudio.

30
6.2.4 Anlisis de las secuencias multilocus (MLSA)

Las secuencias de los genes gyrB, rpoB, infB y atpD fueron comparadas
independientemente con las secuencias depositadas en la base de datos del NCBI
(Nacional Center for Biotechology Information). Los alineamientos de las
secuencias problema y de referencia se realizaron con el programa Clustal X v.
2.1). Una vez obtenidos los alineamientos, las secuencias se analizaron
visualmente para localizar sitios nucleotdicos ambiguos con el programa Seaview
v.2.01 . Este mismo procedimiento se realiz con las secuencias del 16S rRNA de
los 10 aislados de Rahnella sp., previamente obtenidas (Briones-Roblero et al.,
2017) y de las secuencias de referencia depositadas en el NCBI (Brady et al.,
2014).
Se realiz un anlisis de inferencia filogentica por el mtodo de Mxima
Verosimilitud entre los aislados problema y cepas de referencia en la plataforma
PhyML (Guindon and Gascuel, 2003). El gen 16S rRNA y los cuatro genes gyrB,
rpoB, infB y atpD fueron analizados de manera independiente. Previo a este
anlisis se determin el mejor modelo de sustitucin nucleotdico Para ello, se
estim el mejor modelo de sustitucin nucleotdica para los dos conjuntos de datos
con el programa jModelTest (Posada, 2008). La robustez de los rboles se valor
por medio de la prueba del Bootstrap despus de 1000 pseudoreplicas.
Xenorhabdus nematophila fue utilizado como grupo externo para ambos conjuntos
de datos.
Para poder aplicar los criterios de Rosell-Mora y Amann (2001)
relacionados con el uso del gen 16s RNA, se determino el porcentaje de similitud
nucleotdica entre las secuencias problemas y las secuencias de referencia con el
programa MatGAT (Campanella et al., 2003).

6.2.5 Determinacin del contenido de G+C

Para determinar este atributo se emple la secuencia del genoma del


aislado ChdrAdgB13. El genoma mostr un tamao de 5,833,258 pb y estuvo
integrado por 1450 contings. La secuenciacin de este genoma se llev a cabo
mediante el sistema HiSeq 2500 de Illumina (Otogenetics, GA, USA) y el

31
ensamble se realiz va novo y referenciado. Posteriormente, el genoma
ensamblado fue anotado en la plataforma del Servidor RAST Versin 2.0 (Rapid
Annotation using Subsystem Technology).

32
VII. RESULTADOS

7.1. Caracterizacin fenotpica

7.1.1 Morfologa macro y microscpica


Todos los aislados de Rahnella sp. nov mostraron las mismas morfologa
macroscpica: blancas, redondas, convexas, bordes enteros, lisa, cremosa, no
genera pigmento difusible, hmeda, traslcida, brillante en medio TSA despus de
incubarlas 48 h a 28C.

La cepa ChdrAdgB13 fue designada el tipo de Rahnella sp. nov. y fue


depositada en la Coleccin Nacional de Cepas Bacterianas y Cultivos Celulares
del CINVESTAV-ZACATENCO (No. Registro en trmite). Rahnella sp. nov. es un
bacilo pleomrfico Gram negativo, con un tamao aproximado de 0.4-0.6 x 2-3.5
m que posee fimbrias y flagelos (Figuras 1A-D).

A)

B) Flagelo

20000x

C)

Fimbrias
D)
40000x
75000x

33
Figura 1. Caractersticas microscpicas de Rahnella sp. nov. A) Bacilos
pleomrficos Gram negativos (100x), B-D) Micrografas de la tincin
negativa de la cepa ChdrAdgB13.,

7.1.2 Pruebas bioqumicas


Los aislados de Rahnella sp. nov. fueron catalasa positiva y oxidasa
negativa; positivas a -galactosidasa; productoras de acetoin y gelatinasa,
triptfano desaminasa e indol; negativas a arginina dihidrolasa, lisina
descarboxilasa, ornitina descarboxilasa, citrato, H 2S y ureasa; reductora de nitrato
a nitrito; productora de cido a partir de glicerol, L-arabinosa, D-ribosa, D-xilosa,
D-galactosa, D-glucosa, D-fructosa, D-manosa, L-ramnosa, dulcitol, D-manitol, D-
sorbitol, N-acetilglucosamina (variable en los aislados, negativa en la cepa tipo),
arbutina, esculina, citrato ferrico (variable en los aislados, negativa en la cepa
tipo), salicina, D-celobiosa, D-maltosa, D-lactosa, D-melibiose, D-sacarosa, D-
trehalosa, D-rafinosa, gentiobiosa, D-fucosa, L-fucosa (API 50CHB/20E);
Oxidadoras de Dextrina, glicgeno, tweens 40 y 80, N-acetilglucosamina, L-
arabinosa, D-celobiosa, D-fructosa, L-fucosa, D-galactosa, gentiobiosa, -D-
glucosa, -D-lactosa, maltosa, D-manitol, D-manosa, D-melibiosa, D-rafinosa, L-
ramnosa, D-sorbitol, sacarosa, D-trehalosa, turanosa, ster metlico del cido
pirvico, cido actico, cido ctrico, cido frmico, cido D-galacturnico, cido D-
glucosaminico, D,L cido lctico, cido malnico, cido qunico, cido D-sacrico,
glucuronamida, L-alaninamida, D-alanina, L-alanina, L-alanilglicina, L-aspargina,
cido L-asprtico, cido L-glutmico, cido glicil-L-asprtico, cido glicil-L-
glutmico, D- serina, L-serina, inosina, uridina, timidina, glicerol, -D, L, glicerol
fosfato, -D-glucosa-1-fosfato, -D-glucosa-6-fosfato, cido cis-acontico (negativa
en la cepa tipo), cido bromosuccnico (variable en los aislados, negativa en la
cepa tipo) (Biolog) (Tabla 5, 6).

La temperatura ptima de crecimiento de los aislados de Rahnella sp. nov.


fue de 28 y 37C, el pH de 7.0.

34
Tabla 5. Caractersticas bioqumicas diferenciales del gnero Rahnella para los aislados de Rahnella sp. nov

PRUEBAS BIOQUIMICAS ChdrLvgB08 ChdrAdgB13 ChdrPegB23 ChdrPugB47 DADMP04 DADMP19 DVAd08 DVLV39 DMEMP06 DMEMP07

Vogues-Proskauer + + + + + + + + + +
cido a partir de
D-Arabinosa + + + + + + + + + +
D-Sacarosa + + + + + + + + + +
D-Fructosa + + + + + + + + + +
D-Arabitol + + + + + + + + + +
Gluconato de potasio - - - - - - - - - -
5-Cetogluconato de potasio - - - - - - - - - -
Utilizacion de
N-acetil D-galactosamina + - - - + - - + + -
D-Arabitol - - + - + - - - + +
D-Sorbitol + + - + + + + + + +
cis-cido aconitico + - - - + + - + - +
D-cido galactonico + - - - - - + + - +
D-Acidogluconico + - - + - - + + + +
-cido cetobutirico + - - - - - + + - +
-cido cetogluconico - - - - + + - + - -
cido succinamico + - - - - - - + - +
cido urico - - - - - - - - - -
Triptofano desaminasa + + + + + + + + + +

35
Tabla 6. Caractersticas bioqumicas diferenciales entre las diferentes especies del gnero Rahnella

PRUEBAS BIOQUIMICAS R. victoriana R. variigena R. R. bruchi R. aquatilis R. inusitata Rahnella sp. nov
woolbedingensis
Vogues-Proskauer + + - - + + +
cido a partir de
D-Arabinosa - - - + - - +
D-Sacarosa - - + - - - +
D-Fructosa + + - - + - +
D-Arabitol - - - + - + +
Gluconato de potasio (+) - - - + - -
5-Cetogluconato de (+) - - + + - -
potasio
Utilizacion de
N-acetil D-galactosamina - - + - - (d)
D-Arabitol - - - - - + (d)
D-Sorbitol + + + + - + +
cis-cido aconitico (+) D + (d) + - d
D-cido galactonico - - + - + (d) (d)
D-Acidogluconico - D + - + + d
-cido cetobutirico D - + - + + (d)
-cido cetogluconico + - d - + - (d)
cido succinamico - D + - + - (d)
cido urico - D + - - + -
Triptofano desaminasa - - - - - - +
+ 90100% cepas +; (+) 7089% cepas +; d 5069% cepas +; (d) 3049% cepas +; () 1029% cepa+; 91100% cepas.
En letras negritas se resalta la prueba diferencial entre la cepa tipo de la nueva especie y las seis especies del gnero Rahnella

36
7.1.3. Perfil proteico ribosomal
El sistema VITEK-MS de espectrometra de masas MALDI-TOF identific a
las especies del gnero Rahnella y a Rahnella sp. nov. como Rahnella aquatillis
con un valor de confianza del 99.9. Sin embargo, los perfiles proteicos de las
especies de Rahnella y la problema fueron diferentes y nicos (Figura 2).

37
a) b)

c) d)

e) e)

especies del gnero Rahnella sp., en las cuales se observan las masas (Da) de cada protena ribosomal y la abundancia de estas. a) R. variigena, b) R.

38
7.2 Caracterizacin genotpica

7.2.1 Extraccin de DNA cromosmico


La integridad y calidad del DNA cromosmico de los aislados de Rahnella
sp. nov. fueron de buena calidad, la talla molecular fue mayor a 12 000 pb (Figura
3). La concentracin del DNA genmico de los aislados vari de 1800 a 2300
ng/L.

MP 1 2 3 4 5 6 7 8 9

1200 pb

Figura 3. Electroforesis de DNA cromosmico de los aislados de Rahnella sp. 1. Marcador de


peso molecular - 1kb, 2. DADMP04, 3. DEMEP6, 4. DEMEP7, 5. DVAB88, 6. ChdrLvgb08,, 7.
ChdrAgb13, 8. DADMP19, 9. ChdrPegb23,

7.2.2 Anlisis de patrones ERIC-PCR


La huella gentica de los aislados de Rahnella sp. nov. no mostraron
clonalidad, ya que cada aislado despleg un perfil distinto, los cuales tambin
fueron diferentes a los de las especies de referencia (Figura 4).

39

A
B
Figura 4. Electroforesis de ERIC-PCR de las diferentes cepas de Rahnella. Marcador de 1kb, 1.
DADMP04, 2. DEMEP6, 3. DEMEP7, 4. DVAB88, 5. chdrLvgb08, 6. chdrAgB13, 7. DADMP19, 8.
ChdrPegB23, 9. DVLV39, 10. ChdrPugB47, 11. R.bruchi, 12. R.variigena, 13. R.victoriana, 14.
R.inusitata, 15. R woolbedingensis, 16. R. aquatilis.

7.2.3 Anlisis de las secuencias del gen 16S rRNA


El rbol filogentico inferido a partir del 16S rRNA mostr la integracin de
un grupo grande formado por todas las especies de los gneros Serratia,
Gibbsiella, Rahnella y los aislados de Rahnella sp. nov. En este grupo las especies
de Serratia y Gibbsiella integraron un subgrupo bien definido, mientras que las
especies de referencia de Rahnella y los aislados de Rahnella sp. nov.
conformaron diferentes subgrupos, en uno de ellos se agruparon todos los
asilados problema. Todos los subgrupos presentaron soportes de bootstrap > 50%
(Figura 5), sin embargo el bootstrap del grupos grande con respecto al taxn
terminal de Erwingella americana fue <50%. La topologa muestra que las
especies de Rahnella y los aislados de Rahnella sp. nov. poseen una considerable
variacin intraespecfica, la cual vari entre las especies, incluyendo los aislados,
del 96.7 a 99.3%, y entre los aislados problema del 98.7 al 100% de similitud
(Tabla 7).

40
Figura 5. rbol filogentico por Mxima Verosimilitud (-lnL= 4075.5319) a partir del 16S rRNA de
los aislados de Rahnella sp. nov., y secuencias de referencia de las especies de los gneros
Rahnella, Serratia, Ewingella y Gibbsiella. El modelo de sustitucin nucleotdica fue GRT+I+G (I=
0.7980 y G= 0.4960). Los valores > 50% de bootstrap se indican en los nodos. Las secuencias
problemas se muestran en negritas.

41
Tabla 7. Valores de similitud entre los aislados de Rahnella sp nov. y las especies de referencia del
gnero Rahnella

R. aquatica R. woolbedingensis R. bruchi R. victoriana R. variigena R. inusinata


Aislados
(AJ233426) (KF308409) (KF308407) (KF308403) (KF308405) (U90758)
DVAB8 97.7 98.7 98.7 98.6 98.5 99
ChDrPegB23 98.1 98.4 98.4 98.9 98.8 99
DADMP4 97.7 98.7 98.7 98.5 98.4 99.2
DMEX6 97.4 98.4 98.4 98.2 98.1 98.9
DMEX07 97.4 98.4 98.4 98.2 98.1 98.9
ChDrLvgB08 98.1 98.4 98.4 98.9 98.8 99.0
ChDrPugB47 98.0 98.4 98.4 98.8 98.7 98.9
DADMP19 97.7 98.7 98.7 98.5 98.4 99.2
ChDrAdgB13 97.8 98.7 98.7 98.6 98.5 99.1
DVlV39 96.9 97.9 97.9 97.8 97.7 98.4

42
7.2.4 Anlisis de secuencias MLSA
Los amplicones de los genes gyrB, atpD, infB y rpoB para los aislados
bacterianos de Rahnella sp. nov. fueron del tamao de 600 y 720 pb segn el gen
analizado (Figuras 6-9).

MP 1 2 3 4 5 6 7 8 9 10

720 pb

Figura 6. Productos de PCR del gen gyrB de los aislados de Ranhella sp nov.
MP. Marcador de Peso molecular 1kb, 1. DADMP04, 2. DEMEP06, 3.
DEMEP07, 4. DVAB88, 5. ChdrLvgb08, 6. ChdrAgB13, 7. DADMP09, 8.
ChdrPegB23, 9. DVLV39, 10. ChdrPugB47.

1 2 3 4 5 6 7 8 9 10

642 pb

Figura 7. Productos de PCR del gen atpD de los aislados de Ranhella sp. nov. MP.
Marcador de Peso molecular 1kb, 1. DADMP04, 2. DEMEP06, 3. DEMEP07, 4.
DVAB88, 5. ChdrLvgB08, 6. ChdrAgB13, 7. DADMP09, 8. ChdrPegB23, 9.
DVLV39, 10. ChdrPugB47.

43
MP 1 2 3 4 5 6 7 8 9 10

615 pb

Figura 8. Productos de PCR del gen infB de los aislados de Ranhella sp. nov MP.
Marcador de Peso molecular 1kb, 1. DADMP04, 2. DEMEP06, 3. DEMEP07, 4.
DVAB88, 5. ChdrLvgb08, 6. ChdrAgB13, 7. DADMP09, 8. ChdrPegB23, 9.
DVLV39, 10. ChdrPugB47.

MP 1 2 3 4 5 6 7 8 9 10

637 pb

Figura 9. Productos de PCR del gen rpoB de los aislados de Ranhella sp. nov. MP.
Marcador de Peso molecular 1kb, 1. DADMP04, 2. DEMEP06, 3. DEMEP07, 4.
DVAB88, 5. ChdrLvgb08, 6. ChdrAgB13, 7. DADMP09, 8. ChdrPegB23, 9.
DVLV39, 10. ChdrPugB47.

44
El rbol filogentico obtenido a partir de las secuencias concatenadas de
los genes gyrB, atpD, infB y rpoB de los aislados y de las secuencias de referencia
las especies de los gneros Rahnella, Serratia y Ewingella americana, mostr la
presencia de dos grandes grupos. El primero de ellos integrado por todas las
especies de Serratia y el segundo, por la especies de Rahnella y E. americana.
Este segundo grupo se integr por siete subgrupos de Rahnella y otro de E.
americana. Los aislados de Rahnella sp. nov. integraron un grupo bien definido e
independiente del resto de las especies del gnero. Todos grupos y subgrupos
mostraron bootstrap > 50% (Figura 10).

7.2.5 Contenido de G+C


El contenido G+C determinado para la cepa tipo ChdrAdgB13 fue del 52
mol%, que es semejante al de las especies del gnero (Tabla 8).

Tabla 8. Porcentaje de G + C de las especies que integran el gnero


Rahnella y Rahnella sp. nov.

Especie % G+C (Mol)

Rahnella victoriana 53
Rahnella variigena 52
Rahnella inusitata 51
Rahnella bruchi 51
Rahnella woolbedingensis 51
Rahnella aquqtilis 51
Rahnella sp. nov. 52

45
Rahnella bruchi

Rahnella woolbedingensis

Rahnella variigena

Rahnella aquatilis

Rahnella victoriana

Rahnella sp nov

Rahnella inusinata

Figura 10. rbol filogentico por Mxima Verosimilitud (-lnL= 4055.763) a partir de los genes gyrB,
atpD, infB y rpoB concatenados de los aislados de Rahnella sp. nov., y secuencias de referencia de
las especies de los gneros Rahnella, Serratia y Ewingella americana. El modelo de sustitucin
nucleotdica fue GRT+I+G (I= 0.8390 y G= 0.5693). Los valores > 50% bootstrap se indican en los
nodos. Las secuencias problemas se muestran en negritas.

46
VIII. DISCUSION
El gnero Rahnella est ampliamente distribuido en diversos hbitats como
suelo, semillas y races de rboles de pino, races de plantas cultivadas y agua
(Izard et al; 1979; Brenner et al., 1998; Kim et al., 1997; Kmpfer, 2005; Morales-
Jimnez et al., 2009; 2012; Brady et al., 2014; Briones-Roblero et al., 2017), sin
embargo hasta recientemente solo se haba descrito una especie, R. aquatilis y
tres genoespecies (Izard et al.,1979: Brenner et al., 1998). No fue sino hasta hace
un par de aos atrs que mediante una aproximacin de taxonoma polifsica se
describieron cinto nuevos taxones: R. victoriana, R. variigena, R. inusitata, R.
bruchi y R. woolbedingensis. Estas especies fueron aislados de lesiones presentes
en tejido de dos especies de encinos (Quercus robur y Q. petraea) y de la galeras
de Agrilus biguttatus presentes en estos rboles (Brady et al., 2008, 2014).

Diversos trabajos realizados con descortezadores de gnero Dendroctonus


han reportado la presencia de Rahnella aquatilis y Rahnella sp. del exoesqueleto,
galeras e intestino de estos insectos, as como endfitos de algunos los
huspedes (Pinus arizonica y P. durangensis) de estos escarabajos (Morales-
Jimnez et al., 2009, 2012; Durand et al., 2015; Mason et al., 2015; Briones-
Roblero et al., 2017; Gonzlez-Escobedo, datos no publicados). La identificacin
taxonmica de este taxn se ha realizado nicamente por secuenciacin parcial o
completa del gen 16S rRNA, lo que ha impedido en estos estudios tener una
asignacin confiable del taxn a nivel especifico.

A pesar de ello, este simbionte se han reportado como especie dominante y


miembro del bacterioma ncleo del intestino de los descortezadores del gnero
Dendroctonus (Hernndez-Garca et al., en preparacin) y una bacteria persistente
a travs del ciclo de vida de Dendroctonus rhizophagus (Morales-Jimnez et al.,
2012; Briones-Roblero et al., 2017). Tambin, se le han documentado algunas
capacidades metablicas como son la produccin de esterasas, lipasas y
xilanasas (Briones-Roblero et al., 2017; Lorenzo-Cruz comn. pers.), reciclaje de
cido rico (Morales-Jimnez et al., 2013) y la capacidad de tolerar y crecer en
presencia de monoterpenos -pineno, -pineno y 3-careno (Boone et al., 2013; Xu

47
et al., 2015; Briones-Roblero, en preparacin), compuestos presente en la resina
de los pinos txicos para los descortezadores (Lpez et al., 2011).

Los resultados de este estudio muestran, a travs de una aproximacin


polifsico, que el taxn bacteriano referido presente en el intestino de las especies
analizadas del gnero Dendroctonus corresponde a una nueva especie,
denominada Rahnella dendroctorum. El epteto especfico de la taxn hace
referencia al grupo de insectos de donde fueron aisladas las cepas bacterianas de
del mismo, el nombre es genitivo, neutro y plural.

Entre los atributos que permiten describir a este taxn como nueva especie
destacan: 1) la actividad positiva de la enzima triptfano desaminasa (TDA), ya
que en las otras especies del gnero Rahnella es negativa (Tabla 6); 2) las
diferentes huellas genticas con los marcadores ERIC-PCR desplegadas por los
miembros de este taxn, con respecto a las especies descritas del gnero
Rahnella; 3) su integracin como grupo independiente en la filogenia del 16S
rRNA, del resto de las especies conocidas del gnero Rahnella, 4) su agrupacin
independiente en la filogenia inferida con los marcadores MLSA, del resto de las
especies conocidas del gnero Rahnella.

Sin embargo, para confirmar la validez taxnomica de esta nueva especie


faltan an por realizar la pruebas de hibridacin DNA-DNA y las pruebas
quimiotaxonomicas de contenido de cidos grasos de la pared celular y
determinacin de lpidos polares de las membranas.

Descripcin de Rahnella dendroctorum sp. nov. Rivera-Ordua

(den.droc.to.nus rum. N.L. gen. pl. n. dendroctorum of Dendroctonus, refirindose


al gnero de los insectos de los cuales el organismo fue aislado).

Bacilo pleomrfico Gram negativo, con un tamao aproximado de 0.4-0.6 x 2-3.5


m que posee fimbrias y flagelos. Las colonias son blancas, redondas, convexas,
bordes enteros, lisa, cremosa, no genera pigmento difusible, hmeda, traslcida,
brillante en medio TSA despus de incubarlas 48 h a 28C. Crece mejor en un

48
rango de temperatura de 28 a 37C a pH 7. Los aislados de Rahnella
dendroctorum fueron catalasa positiva y oxidasa negativa; positivas a -
galactosidasa; productoras de acetoinasa y gelatinasa, triptfano desaminasa e
indol; negativas a arginina dihidrolasa, lisina descarboxilasa, ornitina
descarboxilasa, citrato, H2S y ureasa; reductora de nitrato a nitrito; productora de
cido a partir de glicerol, L-arabinosa, D-ribosa, D-xilosa, D-galactosa, D-glucosa,
D-fructosa, D-manosa, L-ramnosa, dulcitol, D-manitol, D-sorbitol, N-
acetilglucosamina (variable en los aislados, negativa en la cepa tipo), arbutina,
esculina, citrato ferrico (variable en los aislados, negativa en la cepa tipo), salicina,
D-celobiosa, D-maltosa, D-lactosa, D-melibiose, D-sacarosa, D-trehalosa, D-
rafinosa, gentiobiosa, D-fucosa, L-fucosa (API 50CHB/20E); Oxidadoras de
Dextrina, glicgeno, tweens 40 y 80, N-acetilglucosamina, L-arabinosa, D-
celobiosa, D-fructosa, L-fucosa, D-galactosa, gentiobiosa, -D-glucosa, -D-
lactosa, maltosa, D-manitol, D-manosa, D-melibiosa, D-rafinosa, L-ramnosa, D-
sorbitol, sacarosa, D-trehalosa, turanosa, ster metlico del cido pirvico, cido
actico, cido ctrico, cido frmico, cido D-galacturnico, cido D-glucosaminico,
D,L cido lctico, cido malnico, cido qunico, cido D-sacrico, glucuronamida,
L-alaninamida, D-alanina, L-alanina, L-alanilglicina, L-aspargina, cido L-asprtico,
cido L-glutmico, cido glicil-L-asprtico, cido glicil-L-glutmico, D- serina, L-
serina, inosina, uridina, timidina, glicerol, -D, L, glicerol fosfato, -D-glucosa-1-
fosfato, -D-glucosa-6-fosfato, cido cis-acontico (negativa en la cepa tipo), cido
bromosuccnico (variable en los aislados, negativa en la cepa tipo) (Biolog).

El contenido G+C de R. dendroctorum fue del 52 mol%

49
IX. CONCLUSIONES

1. El anlisis polifasico permitio reconocer la presencia de una nueva especie


Rahnella dendroctorum en el canal alimentario de algunas especies del
gnero Dendroctonus.

2. Una prueba diagnostica de R. dencroctorum es la actividad de enzima


Triptfano desaminasa (TDA).

3. . R. dencroctorum mostr diferentes huellas genticas con los marcadores


ERIC-PCR, con respecto a las especies descritas del gnero Rahnella

4. Los aislados reconocidos como R. dencroctorum se integraron como grupo


independiente en la filogenia del 16S rRNA, del resto de las especies
conocidas del gnero Rahnella,

5. Los aislados reconocidos como R. dencroctorum se agruparon independiente


en la filogenia inferida con los marcadores MLSA, del resto de las especies
conocidas del gnero Rahnella.

50
X. ESTUDIOS PROSPECTIVOS

1. Realizar la hibridacin DNA-DNA entre Rahnella dentroctorun y las seis


especies que integran el gnero Rahnella.

2. Determianr el perfil de lpidos polares y cidos grasos de membrana y pared


celular de Rahnella dentroctorun

3. Derminacin del papel funcinal de Rahnella dendroctorum en el canal


alimentario de las especies del gnero Dendroctonus.

51
XI REFERENCIAS

Adams, A.S., Boone, C.K., Bohlmann, J., Raffa, K.F. 2011. Responses of bark
beetle associated bacteria to host monoterpenes and their relationship to insect life
histories. J Chem Ecol 37: 808-817

Adams, A.S., Aylward, F.O., Adams, S.M., Erbilgin, N., Aukema, B.H. 2013.
Mountain pine beetles colonizing historical and nave host trees are associated
with a bacterial community highly enriched in genes contributing to terpene
metabolism. Appl Environ Microbiol 79: 3468-3475.

Alvarez, C., Kukutla, P., Jiang, J., Yu, W., Xu, J. 2012. Draft genome sequence of
Pseudomonas sp. strain Ag1, isolated from the midgut of the malaria mosquito
Anopheles gambiae. J Bacteriol 194: 5449.

Anzai, Y, Kim H, Park, JY, Wakabayashi, H. 2000. Phylogenetic affiliation of


Pseudomonas based on 16S rRNA sequence. Int J Syst Evol Microbiol 50: 1563
89.

Ba, A.S., Phillips, S.S. Jr., 1996. Yeast biota of the red imported fire ant. Mycol Res
100: 740-746.

Bang, B. H., Rhee, M. S., Chang, D. H., Park, D. S., Kim, B.C. 2015. Erysipelothrix
larvae sp. nov., isolated from the larval gut of the rhinoceros beetle, Trypoxylus
dichotomus (Coleoptera: Scarabaeidae). J microbiology , 107(2): 443-451.

Bansal, R., Hulbert, S.H., Reese, J.C., Whitworth, R.J., Stuart, J.J., Chen, M. S.
2014. Pyrosequencing reveals the predominance of Pseudomonadaceae in gut
microbiome of a gall midge. Pathogens 3: 459-72

Barberio. C., Cello F. di, Chelazzi. L., Colombini I., Fallaci. M., Fani R. 2001.
Molecular and physiological analysis of mesophilic aerobic heterotrophic bacteria
from the gut of two species of the genus Phaleria Latreille, 1802 (Coleoptera,
Tenebrionidae). Ann Microbiol 51: 95-105

Bauer, E., Lampert, N., Mikaelyan, A., Khler, T., Maekawa, K., Brune, A. 2015.
Physicochemical conditions, metabolites and community structure of the bacterial
microbiota in the gut of wood-feeding cockroaches (Blaberidae: Panesthiinae).
FEMS microbiol ecol 91(2): 1-14.

Brady, C., Cleenwerck, I., Venter, S.N., Vancanneyt, M., Swings, J., Coutinho, T.A.
2008. Phylogeny and identification of Pantoea species associated with plants,
humans and the natural environment based on multilocus sequence analysis
(MLSA). Syst Appl Microbiol 31: 447460.

52
Brady, C., Hunter, G., Kirk, S., Arnold, D., Denman, S. 2014. Rahnella victoriana
sp. nov., Rahnella bruchi sp. nov., Rahnella woolbedingensis sp. nov., classification
of Rahnella genomospecies 2 and 3 as Rahnella variigena sp. nov. and Rahnella
inusitata sp. nov., respectively and emended description of the genus Rahnella.
Syst Appl Microbiol 37: 545552

Brand, J.M., Schultz, J., Barras, S.J., Edson, L.D., Payne, T.L, Hedden RL. 1977.
Bark beetle pheromones: enhancement of Dendroctonus frontalis
(Coleoptera:Scolytidae) aggregation pheromone by yeast metabolites in laboratory
bioassays. J Chem Ecol 3: 657666.

Bridges, J.R. 1981. Nitrogen-fixing bacteria associated with bark beetles. Microbial
Ecology 7: 131-137.

Briones-Roblero, C.I., Rodrguez-Daz, R. , Santiago-Cruz, J.A. , Ziga, G ,


Rivera-Ordua, F.N. 2017. Degradation capacities of bacteria and yeasts Isolated
from the gut of Dendroctonus rhizophagus (Curculionidae: Scolytinae). Folia
Microbiol 62 (1): 1-9.

De Bruijn, F.J. 1992. Use of repetitive (repetitive extragenic palindromic and


enterobacterial repetitive intergeneric consensus) sequences and the polymerase
chain reaction to fingerprint the genomes of Rhizobium meliloti isolates and other
soil bacteria. App Enviro Microbiol 58(7): 2180-2187

Brune, A. 1998. Termite guts: the worlds smallest bioreactors. Trends Biotechnol.
16:1621

Boone, C.K, Keefover-Ring, K, Mapes, A.C, Adams, A.S, Bohlmann, J, Raffa, K.F,
2013. Bacteria associated with a tree-killing insect reduce concentrations of plant
defence compounds. J Chem Ecol 39: 1003-1006.

Buchner, P. 1965 Endosymbiosis of animals with plant microorganisms. New York:


Interscience. 909

Callaham, R.Z., Shifrine, M. 1960. The yeast associated with bark beetles. Forest
Sci 6: 146-154.

Campanella, J., Bitincka, L., Smalley, J. 2003. MatGAT: an application that


generates similarity/identity matrices using protein or DNA sequences. BMC
Bioinform 4: 29.

Ceja-Navarro, J.A, Nguyen, N.H, Karaoz, U, Gross, S.R, Herman, D.J, Andersen,
G.L, Bruns, T.D, Pett-Ridge, J, Blackwell, M, Brodie, E.L. 2014. Compartmentalized
microbial composition, oxygen gradients and nitrogen fixation in the gut of
Odontotaenius disjunctus. The ISME journal 8(1): 6-18.
53
Ceja-Navarro, J.A, Vega, F.E, Karaoz, U, Hao, Z, Jenkins, S, Lim, H.C, Kosina, P,
Infante, F, Northen, T.R., Brodie, E.L. 2015. Gut microbiota mediate caffeine
detoxification in the primary insect pest of coffee. Nature, 6. 618.

Cole, J.R., Wang, Q, Crdenas, E, et al., 2009. The ribosomal database project:
improved alignments and new tools for rRNA analysis. Nucl Acids Res 37

Colwell, R. R. 1970. Polyphasic taxonomy of bacteria. In Culture Collections of


Microorganisms. J. Bacteriol. (104) 1 434-442

Chapman, R.F, Simpson, S.J, Douglas, A.E. 2013. The Insects: Structure and
Function. Cambridge, UK: Cambridge Univ. Press. 5th ed.

Dams, E., Hendricks, l., Van de Peer, y., Neefs, j., Smits, G., Vandenbempt, I., y De
Wachter, R. 1988. Compilation of small ribosomal subunit RNA sequences. Nucleic
Acids Res 16, Suplemento: r87-r175

Daz, E, Cisneros, R, Ziga, G, Uria-Galicia E, 1998. Comparative anatomical and


histological study of the alimentary canal of Dendroctonus parallelocollis, D.
rhizophagus, and D. valens (Coleoptera:Scolytidae). Ann Entomol Soc Am 91:479
487.

Delalibera, I., Handelsman, J., Raffa, K.F. 2005. Contrasts in cellulolytic activities of
gut microorganisms between the wood borer, Saperda vestita (Coleoptera:
Cerambycidae), and the bark beetles, Ips pini and Dendroctonus frontalis
(Coleoptera: Curculionidae). Environ Entomol 34: 541-547.

Douglas, A.E. 2009. The microbial dimension in insect nutritional ecology. Funct
Ecol 23: 38-47.

Engel, P., Martinson, G.V., Moran, N.A. 2012. Functional diversity within the simple
gut micriobiota of the honey bee. PNAS 11: 1-6.

Engel, P., Moran, N.A. 2013. The gut microbiota of insects - diversity in structure
and function. FEMAS Microbiol Rev 37(5): 699-735.

Gonzlez, J.M. Saiz-Jimenez, C. 2002. A fluorimetric method for the estimation of


G+C mol% content in microorganisms by thermal denaturation temperature.
Environ Microbiol 4: 770-773.

Feldhaar, H. 2011. Bacterial symbionts as mediators of ecologically important traits


of insect hosts. Ecol Entomol 36: 533543.

Fukatsu, T., Hosokawa, T. 2002. Capsule-transmitted gut symbiotic bacterium of


the Japanese common plataspid stinkbug, Megacopta punctatissima. Appl Environ
Microbiol 68: 389396.

54
Fujita, A. 2004. Lysozymes in insects: What role do they play in nitrogen
metabolism? Physiol Entomol 299: 30510.

Gonzlez, J. M., Saz-Jimnez, C. 2004. A simple fluorimetric method for the


estimation of DNA-DNA relatedness between closely related microorganisms by
termal denaturation temperatures. Extremophiles 9: 75-79.

Guindon S., Gascuel O. 2003. PhyMLa simple, fast, and accurate algorithm to
estimate large phylogenies by maximum likelihood. Syst Biol 52: 696704.

Hoffman CS, Winston F. 1987. A ten-minute DNA preparation from yeast efficiently
releases autonomous plasmids for transformation of Escherichia coli. Gene
57:267272

Hofstetter, R.W., Cronin, J.T., Klepzig K.D., Moser J.C., Ayres, M.P. 2006.
Antagonisms, mutualisms and commensalisms affect outbreak dynamics of the
southern pine beetle. Oecol 147: 679691.

Hosokawa, T, Hironaka, M, Mukai H, Inadomi, K, Suzuki, N., Fukatsua, T. 2012.


Mothers never miss the moment: a fine-tuned mechanism for vertical symbiont
transmission in a subsocial insect. Anim Behav 83: 293300

Hulton, C.S.J, Higgins, C.F, Sharp, P.M. 1991. ERIC sequences: a novel family of
repetitive elements in the genomes of Escherichia coli, Salmonella typhimurium
and other enterobacteria. Mol Microbiol 5:825-34.

Hu, X., Yu, J., Wang, C., Chen, H. 2014. Cellulolytic bacteria associated with the
gut of Dendroctonus armandi larvae (Coleoptera: Curculionidae: Scolytinae).
Forest 5: 455-465.

Izard, D., Gavini, F., Trinel, P.A., Leclerc, H. 1979. Rahnella aquatilis, nov.member
de la famille des Enterobacteriaceae. Ann Microbiol 130: 163177.

Kim, K.Y., Jordan, D., Krishnan, H.B. 1997. Rahnella aquatilis, a bacterium isolated
from soybean rhizosphere, can solubilize hydroxyapatite. FEMS Microbiology
letters 153: 273-277.

Kmpfer, P. 2005. Genus: Rahnella. In: Brenner, D.J., Krieg, N.R., Staley,J.T.
(Eds.), Bergeys Manual of Systematic Bacteriology, The Proteobacte-ria, Part B,
The Gammaproteobacteria, Springer (2), 2nd pp 759763.

Kenerov, L., Moritz, R., Engel, P. 2016. Bartonella apis sp. nov., a honey bee gut
symbiont of the class Alphaproteobacteria. Int J Syst Evol Microbiol 66(1): 414-421.

Klepzig, KD, Six, DL, 2004. Bark beetle-fungal symbiosis: context dependency in
complex associations. Symbiosis 37: 189-205.

55
Klepzig, K.D., Adams, A.S., Handelsman, J., Raffa, K.F. 2009. Symbioses: A key
driver of insect physiological processes, ecological interactions, evolutionary
diversification, and impacts on humans. Environ Entomol 38: 67-77.

Lehman, R., Lundgren, J.G., Petzke, L.M. 2009. Bacterial communities associated
with the digestive tract of the predatory ground beetle, Poecilus chalcites, and their
modification by laboratory rearing and antibiotic treatment. Microb Ecol 57:349358

Lemke, T., Stingl, U., Egert, M., Friedrich, W., Brune. A. 2003. Physicochemical
conditions and microbial activities in the highly alkaline gut of the humusfeeding
larva of Pachnoda ephippiata (Coleoptera: Scarabaeidae). App Environ Microbiol
69: 66506658.

Lpez, M., Cano-Ramrez, C., Shibayama, M., Ziga, G. 2011. -Pinene and
myrcene induce ultrastructural changes in the midgut of Dendroctonus valens
(Coleoptera: Curculionidae: Scolytinae). Ann Entomol Soc Am 104(3); 553-561.

Li, L, Praet J, Borremans, W, Nunes, OC, Manaia, CM, Cleenwerck, I, Meeus, I,


Smagghe, G, De Vuyst, L, Vandamme, P. 2015. Bombella intestini gen. nov., sp.
nov., an acetic acid bacterium isolated from bumble bee crop. Int J Syst Evol
Microbiol 65(1): 267-273.

Liu, B., Luo, J., Li, W., Long, X. F., Zhang, Y. Q., Zeng, Z. G., Tian, Y. Q. 2016.
Erwinia teleogrylli sp. nov., a bacterial isolate associated with a Chinese cricket.
PloS one, 11(1), e0146596.

Lou, Q.Z., Lu, M, Sun, J.H. 2014 Yeast diversity associated with invasive
Dendroctonus valens killing Pinus tabuliformis in China using culturing and
molecular methods. Microb Ecol 68:397-415.

Lundgren, J., Lehman, R.M., Chee-Sanford, J. 2007. Bacterial communities within


digestive tracts of ground beetles (Coleoptera: Carabidae). Entomol Soc Am
100(2): 275-282

Ma, Y., Yin, Y., Rong, C., Chen, S., Liu, Y., Wang, S., Xu, F. 2016. Pantoea pleuroti
sp. nov., isolated from the fruiting bodies of Pleurotus eryngii. Curr Microbiol 72(2):
207-212.

Mason, C.J, Hanshew, A.S, Raffa, K.F, 2015. Contributions by host trees and
insect activity to bacterial communities in Dendroctonus valens (Coleoptera:
Curculionidae) galleries, and their high overlap with other microbial assemblages of
bark beetles. Environ Entomol 42: 348-856

Menndez, E., Ramrez-Bahena, M.H., Fabryov, A., Igual, J.M., Benada, O.,
Mateos, P.F., Peix, A., Kolak, M., Garca-Fraile, P. 2015. Pseudomonas
56
coleopterorum sp. nov., a cellulase-producing bacterium isolated from the bark
beetle Hylesinus fraxini. Int J Syst Evol Microbiol 65(9): 2852-2858.

Mesbah, M., Premachandran, U., Whitman, W.B. 1989. Precise measurementof


the G + C content of deoxyribonucleic acid by high-performance liquid chro-
matography. Int J Syst Bacteriol 39: 159167.

Morales-Jimnez, J., Ziga G., Villa-Tanaca, L., Hernndez-Rodrguez, C. 2009.


Bacterial community and nitrogen fixation in the red turpentine beetle,
Dendroctonus valens LeConte (Coleoptera: Curculionidae: Scolytinae). Microb
Ecol 58:879891

Morales-Jimnez, J., Ziga, G., Ramrez-Saad, H.C, Hernndez-Rodrguez, C.


2012. Gut-associated bacteria throughout the life cycle of the bark
beetle Dendroctonus rhizophagus Thomas and Bright (Curculionidae: Scolytinae)
and their cellulolytic activities. Microb Ecol 64:268278.

Morales-Jimnez, J., De Len, A.V.P., Garca-Domnguez, A., Martnez-Romero,


E., Ziga, G., and Hernndez-Rodrguez, C. 2013. Nitrogen-fixing and uricolytic
bacteria associated with the gut of Dendroctonus rhizophagus and Dendroctonus
valens (Curculionidae: Scolytinae). Microb Ecol 66(1): 200-210.

Moran, NA, Dunbar, HE, Wilcox, JL. 2005. Regulation of transcription in a reduced
bacterial genome: nutrient-provisioning genes of the obligate symbiont Buchnera
aphidicola. J Bacteriol 187:42294237.

Moreira, A.B., Pereira, N., Jr., Thompson, F.L. 2011. Usefulness of a real time PCR
platform for GC content and DNADNA hybridization similarity estimations
invibrios. Int J Syst Evol Microbiol 61, 23792383.

Boone, C.K., Keefover-Ring, K., Mapes, A.C., Adams, A.S., Bohlmann, J., Raffa,
K.F. 2013. Bacteria associated with a tree-killing insect reduce concentrations of
plant defense compounds. J Chem Ecol 39:1003-1006.

Pigliucci, M., Murren, C.J., Schlichting, C.D. 2006. Phenotypic plasticity and
evolution by genetic assimilation. J Exp Biol. 209(Pt 12), 2362-7.

Popa, V., Dziel, E., Lavalle, R., Bauce, E., Guertin, C. 2012. The complex
symbiotic relationships of bark beetles with microorganisms: a potential practical
approach for biological control in forestry. Pest Manag Sci 68: 963- 975.

Posada, D. 2008. jModelTest: phylogenetic model averaging. Mol Biol Evol 25:
1253-1256.

57
Pramono, A. K., Sakamoto, M., Iino, T., Hongoh, Y., Ohkuma, M. 2015.
Dysgonomonas termitidis sp. nov., isolated from the gut of the subterranean
termite Reticulitermes speratus. Int J Syst Evol Microbiol 65(2): 681-685.

Praet, J., Meeus, I., Cnockaert, M., Houf, K., Smagghe, G., Vandamme, P. 2015.
Novel lactic acid bacteria isolated from the bumble bee gut: Convivina intestini gen.
nov., sp. nov., Lactobacillus bombicola sp. nov., and Weissella bombi sp. nov.
Antonie van Leeuwenhoek, 107(5): 1337-1349.

Rajagopal, R. 2009. Beneficial interactions between insects and gut bacteria.


Indian. J. Microbiol 49: 114-119.

Rivera, F.N., Gonzlez, E., Gmez, Z., Lpez, N., Hernndez, R.C., Berkov, A.,
Ziga, G. 2009. Gut-associated yeast in bark beetles of the genus Dendroctonus
Erichson (Coleoptera: Curculionidae: Scolytinae). Biol J Linnean Soc 98: 325-342.

Rohland, J., Meyers, P.R. 2015. Streptomyces fractus sp. nov., a novel
streptomycete isolated from the gut of a South African termite. Antonie van
Leeuwenhoek, 107(5): 1127-1134.

Ross, H.N.M., Grant, W. D. 1985. Lipids in archae-bacterial taxonomy. In:


Chemical Methods in Bacterial Systematics (M. Goodfellow, ed.), 290-291.
Academic Press, New York.

Rossell-Mora, R., Amann R. 2001. The species concept for prokaryotes. FEMS
Microbiol Rev 25: 39-67.

Rossell-Mora, R. 2006. DNA-DNA reassociation methods applied to microbial


taxonomy and their critical evaluation. In Molecular identification, systematics, and
population structure of prokaryotes p.p23-50. Springer Berlin Heidelberg.

Shi ZH, Sun JH. 2010. Immunocompetence of the red turpentine beetle,
Dendroctonus valens LeConte (Coleoptera: Curculionidae, Scolytinae): variation
between developmental stages and sexes in populations in China. J Insect Physiol
56:16961701.

Schleifer, K. H., Kandler, O. 1972. Peptidoglycan types of bacterial cell walls and
their taxonomic implications. Bacteriol Rev 36: 407-477.

Schleifer, K. H. 2009. Classification of Bacteria and Archaea: past, present and


future. Syst Appl Microbiol 32: 533542.

Sharp, P. M., Bailes, E., Grocock, R. J., Peden, J.F., Sockett, R.E. 2005. Variation
in the strength of selected codon usage bias among bacteria. Nucleic Acids Res.
33:1141-1153.

58
Skrodenyte-Arbaciauskiene, V., Radziute, S., Stunzenas, V. Bda, V. 2012.
Erwinia typographi sp. nov., isolated from bark beetle (Ips typographus) gut. Int J
Syst Evol Microbiol 62: 942948.

Stackebrandt, E., Liesack, W. 1993. Nucleic acids and classification. Handbook of


new bacterial systematics. Academic, London, 151-194.

Stackebrandt, E., Goebel, B.M. 1994. Taxonomic note: a place for DNA-DNA
reassociation and 16S rRNA sequence analysis in the present species definition in
bacteriology. Int J Syst Bacteriol 44: 846-849.

Silva-Olivares, A., Daz, E., Shibayama, M., Tsutsumi, V., Cisneros, R., Ziga, G.
2003. Ultrastructural study of the midgut and hindgut in eight species of the genus
Dendroctonus Erichson (Coleoptera: Scolytidae). Ann Entomol Soc Am 96(6): 883-
900.

Suzuki, K., Goodfellow, M., and ODonnell, A.G. 1993. Cell envelopes and
classification. Handbook of new bacterial systematics. Academic, London, 195-
250.

ustr, V., Stingl, U., Brune, A. 2014. Microprofiles of oxygen, redox potential, and
pH, and microbial fermentation products in the highly alkaline gut of the
saprophagous larva of Penthetria holosericea (Diptera: Bibionidae). J insect
physiol 67, 64-69.

Tegtmeier, D., Riese, C., Geissinger, O., Radek, R., Brune, A. 2016. Breznakia
blatticola gen. nov. sp. nov. and Breznakia pachnodae sp. nov., two fermenting
bacteria isolated from insect guts, and emended description of the family
Erysipelotrichaceae. Sys App Microbiol. 39: 319-329.

Tighe, S. W., de Lajudie, P., Dipietro, K., Lindstron, K., Nick, G., Jarvis, B. D. 2000.
Analysis of cellular fatty acids and phenotypic relationships of Agrobacterium,
Bradyrhizobium, Mesorhizobium, Rhizobium and Sinorhizobium species using the
Sherlock Microbial Identification System. Int J Syst Evol Microbiol 50: 787-801.

Tindall, B. J. 1990. Lipid composition of Halobacterium lacusprofundi. FEMS


Microbiol Lett 66, 199202

Tindall, B. J., Rossell-Mra, R., Busse, H.J., Ludwig, W. & Kmpfer, P. 2010.
Notes on the characterization of prokaryote strains for taxonomic purposes. Int J
Syst Evol Microbiol 60: 249266.

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., Higgins, D.G. 1997
The ClustalX windows interface: flexible strategies for multiple sequence alignment
aided by quality analysis tools. Nucleic Acids Res 25: 4876-4882.

59
Vasanthakumar A., Delalibera I., Handelsman J.R., Klepzig K.D., Schloss, P.D.,
Raffa K.F. 2006. Characterization of gut-associated bacteria in larvae and adults of
the southern pine beetle, Dendroctonus frontalis Zimmermann. Eviron Entomol 35:
1710-1717.

Wilson LA, Sharp PM. 2006. Enterobacterial Repetitive Intergenic Consensus


(ERIC) sequences in Escherichia coli: Evolution and implications for ERIC-PCR.
Mol Biol Evol 23:1156-68.

Winder, R.S., Macey, D.E., Cortese, J. 2010. Dominant bacteria associated with
broods of mountain pine beetle, Dendroctonus ponderosae (Coleoptera:
Curculionidae: Scolytinae). British J Entomol 107: 43-56.

Woese C. 1987. Bacterial evolution. Microb Rev 51: 221-71.

Xu L, Lou Q, Cheng C, Lu M, Sun J, 2015. Gut-associated bacteria


of Dendroctonus valens and their involvement in verbenone production. Microb
Ecol 70:101223.

Yilmaz H, Sezen K, Kati H, Demirgag Z. 2006. The first study on the bacterial flora
of the European spruce bark beetle, Dendroctonus micans (Coleoptera:
Scolytidae). Biol Brat 61:679686

60