Está en la página 1de 37

BIOLOGA

I. INTRODUCCIN A LA BIOLOGA

5. RAMAS DE LA BIOLOGA

1. ETIMOLOGA DE BIOLOGA:
Deriva de las voces griegas:
BIOS
VIDA
LOGOS TRATADO O ESTUDIO

1. BOTNICA
Se ocupa del estudio de las plantas. A su vez se divide en:
A. Botnica criptogmica: estudia las plantas llamadas criptgamas, es decir
aquellas que no desarrollan flores ni semilla, por ejemplo: helechos
(pteridologa) y musgos (briologa).
B. Botnica fanerogmica: estudia las plantas llamadas fanergamas, es
decir aquellas que desarrollan flores (o conos) y semillas, por ejemplo:
maz, papa, girasol, clavel, pino, etc.).

2. DEFINICIN DE BIOLOGA:
Biologa es la ciencia que estudia todas las manifestaciones de vida que existen,
teniendo en cuenta su origen, estructura, funciones, sus relaciones con el medio
ambiente y los complicados procesos que en ellas ocurren.

2. ZOOLOGA
Se ocupa del estudio de los animales. A su vez se divide en:

3. ANTECEDENTES HISTRICOS:
El primer bilogo fue Aristteles, es llamado tambin el Padre de la Zoologa.
Teofrasto, estudi en cambio las plantas y se le considera el Padre de la
Botnica.
William Harvey, mdico y fisilogo Ingls, descubri el funcionamiento de la
circulacin sangunea.
Hans y Zacaras Janssen, construyeron el primer microscopio compuesto.
Anton Van Leewenhoeck (Naturalista holands). Padre de la Protozoologa.
Observ los llamados animalculos en su microscopio.
Carl Von Linneo (Naturalista sueco). Padre de la Sistemtica.
Robert Koch (Mdico alemn). Identific los agentes infecciosos del carbunco,
TBC, y el clera. Introdujo los medios de cultivo.
Louis Pasteur: Padre de la Microbiologa mdica. Neg la Generacin
espontnea y apoy la Hiptesis de la Biognesis.
Gregorio Mendel (Monje y Naturalista Austriaco Agustino). Padre de la
Gentica.
Charles Darwin (Padre de la Evolucin). Obras: Origen de las Especie por la
Seleccin Natural y el Origen del Hombre.
Schleiden y Schwann: Propusieron la Teora Celular.
Alexander Von Humboldt: Padre de la Biogeografa.
Alexander Fleming: Descubri la Penicilina.
Alexander Ilich Oparin: (Ruso) Public el Origen de la Vida.
Max Knoll y Ernest Ruska, construyeron el primer microscopio electrnico.
Ernest Haeckel: (Naturalista alemn). Padre de la Ecologa.
Watson y Crick: (1953): Propusieron el Modelo Doble Hlice del ADN.

A.
B.
C.
D.
E.

Ornitologa: estudia las aves, por ejemplo: gaviota, gorrin, etc.


Entomologa: estudia los insectos, por ejemplo: escarabajo, hormiga, etc.
Ictiologa: estudia los peces, por ejemplo: tiburn, bonito, etc.
Herpetologa: estudia los reptiles, por ejemplo: lagartija, tortuga, etc.
Malacologa: estudia los moluscos, por ejemplo: caracol, calamar, pulpo,
etc.
F. Carcinologa: estudia los crustceos, por ejemplo: camarn, cangrejo, etc.
G. Helmintologa: estudia los gusanos, por ejemplo: lombriz intestinal, tenia,
etc.
3. MICROBIOLOGA
Se ocupa del estudio de los microorganismos. A su vez se divide en:
A. Bacteriologa: estudia las bacterias, por ejemplo: bacilo de Koch
(Causa la tuberculosis), Escherichia coli (vive en el intestino humano).
B. Micologa: estudia los hongos, por ejemplo: Tricophyton
(Causa el pie de atleta).
C. Protozologa: estudia los protozoarios, por ejemplo: Plasmodium
(Causa el paludismo).
D. Virologa: estudia los virus, por ejemplo: VIH (causa el sida).
4. ECOLOGA
Se ocupa del estudio de los ecosistemas y de las relaciones existentes entre
los seres vivos y su ambiente.

Boletn de biologa

BIOLOGA
interrogantes sobre la naturaleza. El mtodo cientfico consta de los siguientes pasos
generales:

5. GENTICA
Estudia la herencia biolgica, sus variaciones y la forma como se transmiten
los rasgos hereditarios de padres a hijos.

A. Observacin.- En esta etapa se registran todos los datos posibles del fenmeno
que ser estudiado, para ello el investigador se vale de sus sentidos (vista,
olfato, odo, etc.) o se apoya en instrumentos como microscopios, lupas,
termmetros, cmaras fotogrficas, etc. Luego del registro de datos, el
investigador estar en condiciones de plantearse un problema en relacin a
lo observado y a buscar la solucin.

6. TAXONOMA
Se ocupa de la clasificacin de los seres vivos y de su nombramiento.
7. EVOLUCIN
Estudia el proceso de transformacin de los seres vivos a lo largo del tiempo.

B. Hiptesis.- En esta etapa, el investigador propone una posible respuesta o


solucin al problema planteado. La hiptesis es una idea que tiene que ser
sometida a prueba para demostrar su validez. Toda hiptesis pretende dar
una explicacin acerca de las causas que originan un fenmeno.

8. ANATOMA
Estudia la forma de los seres vivos y la estructura y disposicin de los rganos
que lo conforman.
9. FISIOLOGA
Estudia las funciones de los rganos de los seres vivos.
10. BIOLOGA CELULAR (CITOLOGA)
Estudia la estructura y funciones de la clula.

C. Experimentacin.- En esta etapa, el investigador realiza una serie de actividades


necesarias para comprobar su hiptesis. Se realiza las veces que sea
necesario. Puede hacerse en un laboratorio o en el campo.
D. Conclusiones.- En esta etapa, el investigador analiza e interpreta los resultados
obtenidos en la experimentacin, de tal modo que comprueba la veracidad o
falsedad de su hiptesis.

11. BIOLOGA MOLECULAR


Estudia la estructura y funciones de los cidos nucleicos (ADN y ARN).
12. BIOQUMICA
Estudia los componentes qumicos de los seres vivos.

E. Generalizacin.- En esta etapa, el investigador da a conocer que su hiptesis ha


adquirido amplia validez, ya que se apoya en conclusiones de muchos
experimentos. De esta manera, las hiptesis comprobadas se convierten en
Leyes y las leyes sistemticamente organizadas sirven para construir
Teoras.

13. HISTOLOGA
Estudia los tejidos que constituyen a los
seres vivos.
14. BIOGEOGRAFA
Estudia la distribucin de los
seres vivos en la tierra

PRCTICA DIRIGIDA N 01
I.
1.2.
3.
4.
5.

6. EL MTODO CIENTFICO.
Es un mtodo de investigacin para conocer,
describir, explicar los procesos en los seres
vivos, es una manera de recopilar informacin y
comprobar ideas. Es la forma en que un
cientfico trata de hallar respuestas a sus

Escribe V o F
Gracias a la Biologa se pueden producir protenas humanas como la insulina.
La Micologa se encarga del estudio de los hongos.

(
(

)
)

La Taxonoma estudia a los restos fsiles.

La matemtica no es una ciencia auxiliar de la Biologa.

Adems de teoras, la ciencia tiene leyes o principios.

Boletn de biologa

BIOLOGA
6.
7.
8.
9.
10
.
II.
1)

La Hiptesis consiste en la explicacin racional anticipada de la observacin


de un fenmeno.
En la medida que otros experimentos continen apoyando la hiptesis, sta
se convertir en una teora.
Un experimento nico no resulta ser nunca la base adecuada para realizar
una conclusin.
Con la experimentacin se puede probar la veracidad de una hiptesis.

La Mastozoologa estudia a los reptiles.

)
I.

Completa:
........................................... es considerado el padre de la Biologa, mientras

II.
III.

que.............................................. se le considera el Padre de la Botnica.

3) ................................................ acu por primera vez el trmino clula al hacer


observaciones en un pedazo de corcho.
El

modelo

Doble

Hlice

en

la

estructura

del

ADN

microscopio compuesto

c) Carcinologa

Padre de la Gentica

d) Hermanos Janssen

Crustceos

e) Micologa

Padre de la Protozoologa

f) Ernest Haeckel

Moluscos

g) Malacologa

Microscopio electrnico

h) Gregorio Mendel

Hongos

Disciplina botnica que estudia los helechos


Ciencia que estudia los tejidos

(__) Histologa
(__)

Pteridologa

Ciencia que clasifica y nombra a los seres vivos(__) Taxonoma

IV. Subraya la respuesta correcta:


1) Discpulo de Aristteles que clasific a los vegetales en hierbas, arbustos y
rboles:
a) Platn
b) Teofrasto
c) Galeno
d) Tales de Mileto
e) Hooke

2) ............................................... propusieron la Teora Celular por los aos 1838 - 1839.

4)

b) Knoll y Ruska

lo

2) Identific a los agentes infecciosos del carbunco, TBC y el clera:


a) Pasteur
b) Harvey
c) Koch
d) Mendel
e) Darwin

propusieron ......................................y...........................
5) La ciencia que estudia a los peces se llama.................................., mientras que

3) Propusieron la Teora Celular:


a) Watson y Crick
b) Schwann y Hooke
d) Schleiden y Ruska
e) Hermanos Janssen

la...................................... estudia a los gusanos parsitos.


6) Una............................................. es una posible respuesta a una pregunta al

4) Descubri la penicilina:
a) Leewenhoeck b) Fleming

planteamiento de un problema, basadas en observaciones, lecturas y los


conocimientos de un cientfico.

c) Harvey

5) Es considerado el Padre de la Sistemtica:


Ruska
b) Schleiden
c) Virchow

7) Los pasos del Mtodo Cientfico son: ....................................... .....................................


8) La ciencia que estudia la herencia biolgica recibe el nombre de................................,

c) Schleiden y Schwann

d) Crick

e) Linneo

d) Cuvier

e) Linneo

6) Seleccin Natural es a Darwin como Sistema Binomial es a:


Von Humboldt b) Linneo
c) Darwin
d) Virchow
e) Newton
5) Vocabulario: Busca en el diccionario el significado de las siguientes palabras:
etimologa, prejuicio, auxiliar, fsil, naturalista, evolucin, herencia, conclusin,
ciencia y experimento.

mientras que la......................................., estudia los restos fsiles de los seres vivos.
9) El naturalista ingls..........................................................., es considerado el Padre de la
Evolucin.
III. Relaciona:
a) Leewenhoeck

Padre de la Ecologa

Boletn de biologa

BIOLOGA
II. NIVELES DE ORGANIZACIN DE LA MATERIA VIVA
A) Poblacin.- Es el conjunto de individuos de una misma especie que ocupa un
lugar fsico determinado en un momento determinado. Ej: una poblacin de seres
humanos, de vicuas, de leones, etc.
B) Comunidad.- Es el conjunto de individuos de diferente especie que ocupan un
lugar o espacio fsico determinado (biocenosis). Ej: Una playa rocosa es una
comunidad formada por estrellas de mar, erizos de mar, cangrejos, etc.
C) Ecosistema.- Relaciona a todos los seres vivos de una comunidad con el medio
ambiente. Ej: Un lago, un ocano, un desierto, un charco, etc.

1. DEFINICIN.
La materia ha sufrido profundas transformaciones a lo largo del tiempo dando origen
a diversos grados de complejidad llamados Niveles de Organizacin , los cuales
estn divididos en 3 grandes grupos: organizacin qumica, biolgica y ecolgica.
2. NIVELES DE ORGANIZACIN.
2.1. QUMICO: Es el nivel de organizacin abitico presentando los siguientes sub
niveles:

3. BIOELEMENTOS
Son aquellos elementos qumicos que los encontramos formando parte estructural y
funcional de la materia viva y que dan origen a las biomolculas. stos se clasifican
en:

A) Atmico.- Constituye la base de la organizacin de la materia, como son los


elementos qumicos: C, H, O, N, Na, K, etc.
B) Molecular.- Se forman por la unin de elementos qumicos, por ejemplo: O 2, O3,
H2O, HCl, aminocidos, azcares simples, bases nitrogenadas, etc.
C) Macromolecular.- Se forman por la unin de molculas, por ejemplo: muchos
aminocidos forman las protenas,
muchos azcares simples forman los
polisacridos, muchos nucletidos forman los cidos nucleicos (DNA, ADN), etc.
D) Agregados supramoleculares.- Resultan de la unin de las molculas a travs
de enlaces dbiles. Por ejemplo: los virus, ribosomas, membranas, centrolos, etc.

3.1. PRIMARIOS.- Son los ms abundantes; se llaman tambin organgenos porque


estn ntimamente relacionados con la formacin de las biomolculas orgnicas. Se
dividen en:

2.2. BIOLGICO: Es el primer nivel de organizacin bitico (con vida). Presenta los
siguientes subniveles:

BSICOS

COMPLEMENTARIOS

C, H, O, N

P, S

3.2. SECUNDARIOS.- Se encuentran en menor cantidad; llamados tambin


oligogensicos. Forman parte de biomolculas orgnicas como las vitaminas y
macromolculas como las protenas, etc. Se les considera como minerales, esenciales
para regular nuestras funciones vitales. Se dividen en:

A) Celular.- Corresponde a las unidades funcionales como son las clulas. La clula
es la unidad bsica de los seres vivos, es decir, la mnima estructura que tiene
vida. Ej: bacterias, protozoarios, levaduras, etc.
B) Tisular.- Corresponde a los tejidos, un tejido es un conjunto de clulas con el
mismo origen, la misma morfologa y fisiologa. Ej: tejido epitelial, tejido
muscular, etc.
C) Organolgico.- Corresponde a los rganos, estos resultan de la asociacin de un
conjunto de tejidos. Ej: corazn, pulmones, riones, etc.
D) Sistmico.- Corresponde a los sistemas, un sistema es un conjunto de rganos
asociados para cumplir funciones especficas. Ej: sistema nervioso, sistema
endocrino, etc.
E) Individual.- Corresponde al individuo que resulta de la integracin de los
sistemas. Ej: un reptil, un ave, un hombre, etc.

MACROCONSTITUYENTES

MICROCONSTITUYENTES
(oligoelementos)

Na, Cl, K, Ca, Mg

Fe, Co, I, Zn, Cu, Mn, F

4. BIOMOLCULAS
Son compuestos qumicos que los encontramos formando parte estructural y
funcional de la materia viva. Se dividen en:
4.1. BIOMOLCULAS INORGNICAS: Son las molculas ms sencillas de la
materia viva. Se caracterizan porque no derivan o no provienen del tomo de
carbono. Ej: agua, sales inorgnicas, gases.

2.3. ECOLGICO: Es el segundo nivel de organizacin superior (abitico y bitico).


Presenta los siguientes subniveles:

Boletn de biologa

BIOLOGA
4.2. BIOMOLCULAS ORGNICAS: Son consideradas las molculas ms
complejas de la materia viva. Se caracterizan porque todas provienen o derivan
del tomo de carbono. Ej: glcidos simples o monosacridos aminocidos, bases
nitrogenadas, vitaminas, etc.

2.

Alimentos que poseen carbohidratos :


tubrculos, harinas, dulces, helados

frutas,

menestras

por

los

factores

biticos

de............................................
4. Los..............................................................se encuentran en menor cantidad y estn
formando parte de las.............................. orgnicas como las vitaminas, enzimas,
adems de regular nuestras funciones vitales, etc.
5. Las.................................................................... son las molculas ms sencillas de la
materia viva. Se caracterizan porque no..................... o no provienen del tomo de

(leguminosas),

carbono.
6. Los glcidos complejos son ejemplos de..................................................., en cambio los

Alimentos que poseen vitaminas y minerales : esencialmente todo lo fresco como


verduras, leguminosas (menestras), frutas.

glcidos simples son ejemplos de................................................

PRCTICA DIRIGIDA N 02
I.

formado

especies que ocupan un lugar determinado. Esta tambin recibe el nombre

Alimentos que poseen grasas: man, palta, carnes, huevo, queso, aceites, helados,
chocolates.

est

3. La................................................... est formada por individuos de diferentes

Alimentos que poseen protenas : menestras (leguminosas), carnes (pescado en


primer lugar), leche, huevos, queso, cereales, sper cereales.

nivel........................................

y............................. .

5. MACROMOLCULAS
Son el resultado de la unin de muchas molculas. Las encontramos formando parte
estructural y funcional de la materia viva. Se dividen en: glcidos (polisacridos,
carbohidratos o hidratos de carbono), lpidos, protenas y cidos nucleicos.

El

IV. Relaciona:
a)
b)
c)
d)
e)
f)
g)
h)
i)
j)
V. Desarrolla

Escribe V o F segn corresponda:

1.

Los diversos grados de complejidad que se manifiesta en los seres vivos se debe a
cambios en la materia a los largo del tiempo.
(
)
2. El subnivel molecular corresponde al nivel atmico de la materia viva.
(
)
3. Los ribosomas y centriolos pertenecen al nivel qumico de la materia viva.(
)
4. Una bacteria es un agregado supramolecular del planeta.
(
)
5. El sistema nervioso del hombre pertenece al nivel tisular.
(
)
6. Una poblacin es una agrupacin de individuos de diferentes especies. (
)
7. Los cidos nucleicos son ejemplos de biomolculas orgnicas.
(
)
8. C, H, O y N son elementos organgenos.
(
)
9. Los cidos nucleicos son ejemplos de macromolculas.
(
)
10. Muchos aminocidos ( por ejemplo 400) forman una protena
(
)

Carbohidrato simple.
(
) Agregado supramolecular.
Co, Cu, I.
(
) Biomolculas inorgnicas.
Levadura.
(
) Oligoelementos.
C, H, O.
(
) Subnivel molecular.
Virus.
(
) Elementos organgenos.
H2O, CO2.
(
) Subnivel celular.
Ca, Mg.
(
) Macromolculas.
Protenas.
(
) Microconstituyentes.
Elementos Traza.
(
) Almidn.
200 glcidos simples.
(
) Macroconstituyentes.
en tu cuaderno las siguientes preguntas:

1. Cul es la diferencia entre bioelementos primarios y secundarios? Da 5 ejemplos


de c/u.
(4 pts: c/u)
2. Cul es la diferencia entre biomolculas inorgnicas y orgnicas? Da 5 ejemplos
de c/u.
(4 pts:
c/u)

III. Completa:
1. Los bioelementos primarios, tambin llamados............................................., se dividen
en: ................................ y........................................... .

Boletn de biologa

BIOLOGA
3. Escribe 3 ejemplos de macromolculas y sus unidades estructurales y
represntalas grficamente.
(3 pts:
c/u)
4. Vocabulario.- ( pto c/u) Busca el significado de los siguientes trminos: poblacin,
comunidad, ecosistema, rgano, especie, glcido, lpido, protena, cido nucleico,
elemento.
III.

Todos los seres vivos estn formados por estructuras complejas llamadas clulas
las cuales estn a su vez formadas por diversas molculas inorgnicas y orgnicas.
En algunos seres vivos estas clulas se organizan para formar tejidos, los cuales
componen rganos, que a su vez forman aparatos o sistemas y todos estos juntos
forman al Ser vivo o individuo.

EL SER VIVO

1.2. IRRITABILIDAD
Todos los seres vivos poseen irritabilidad. Esta propiedad es fundamental en los
seres vivos y consiste en responder a los estmulos y cambios fsicos o qumicos
del medio en que se encuentran.
Entre los principales estmulos, podemos citar: la variacin de la temperatura, los
cambios de color, la intensidad o direccin de la luz, los cambios de la presin
atmosfrica, los cambios de sonido, los cambios de la composicin qumica de la
tierra, el agua o el aire, etc. En las plantas se producen las taxias, las nastias y
los tropismos.

1. CARACTERSTICAS DEL SER VIVO.


Cuando estudiamos los niveles superiores de organizacin de la materia viviente,
podremos notar que existen determinadas caractersticas propias de los seres vivos.
Estas son:

La organizacin compleja.

La irritabilidad

El metabolismo.

La reproduccin.

El movimiento o desplazamiento.

El crecimiento.

La Homeostasis

La Adaptacin y Evolucin.

1.3. METABOLISMO.
Consiste en una serie de cambios o procesos fsicos y qumicos mediante los cuales
los seres vivos mantienen y producen su energa para crecer, conservarse o
repararse. Los fenmenos metablicos, pueden ser anablicos o catablicos.
a) El Anabolismo.
Con este nombre se conoce a las reacciones qumicas que permiten cambiar
sustancias sencillas para formar otras ms complejas, dentro de un organismo
viviente. A travs de este fenmeno el organismo almacena energa, produce
nuevos materiales celulares con los cuales puede crecer, desarrollar y
repararse. Por ejemplo la Fotosntesis.
b) El Catabolismo.
Se llama as a las reacciones qumicas que permiten desdoblar las sustancias
complejas, con liberacin de energa y desgaste de materiales celulares. Este
fenmeno permite obtener la energa que el organismo necesita para su
funcionamiento. Por ejemplo la Respiracin Celular.
1.4. REPRODUCCIN.
La reproduccin es una caracterstica distinta de los seres vivos, que permite a
las clulas duplicar su material gentico, transmitido de una generacin a otra y, a
los organismos, originar sus descendientes con idnticas caractersticas que el
progenitor. La reproduccin puede ser asexual o sexual.

1.1 ORGANIZACIN COMPLEJA.

Boletn de biologa

BIOLOGA
1.5. MOVIMIENTO O DESPLAZAMIENTO.
Las plantas, en su mayora, no se desplazan de un lugar a otro; es decir, son fijas,
pero realizan un movimiento constante durante su crecimiento.
Las algas cianofceas, las bacterias, las euglenas, los sacordinos (amebas) y los
ciliados (paramecios), reaccionan ante los estmulos del ambiente, produciendo en
su cuerpo movimientos ameboideos, o desplazamientos originados por el batido de
flagelos.
El desplazamiento o locomocin de los animales es ms visible, es as como
podemos observar que ellos nadan, bucean, caminan, corren, reptan, saltan, vuelan,
planean, etc.

a) Relacin.
Nos permite sobrevivir en un ambiente determinado, gracias a nuestros sentidos,
sistema nervioso, sistema locomotor y hormonas.
b) Nutricin.
Nos permite sobrevivir como individuos. Se subdivide en digestin, circulacin,
respiracin, excrecin, secrecin, asimilacin, desasimilacin.
c) Reproduccin.
Permite la continuidad de la especie en el tiempo.

PRCTICA DIRIGIDA N 03

1.6. CRECIMIENTO.
El crecimiento es el aumento de la masa celular de los seres vivos, que puede ser
el resultado del mayor tamao de las clulas como ocurre en los animales
unicelulares o tambin, el crecimiento se debe a la mayor cantidad de clulas,
como es el caso de los seres pluricelulares.
Casi todas las plantas crecen hasta su muerte; generalmente los animales tienen
un perodo de crecimiento limitado, que termina cuando llegan a la adultez.
Algunos animales pueden regenerar las partes que pierden de su cuerpo, tales
como, las hidras, las planarias (los gusanos planos), las lagartijas, las salamandras,
las estrellas de mar, el cangrejo, etc.

I. Escribe V o F segn corresponda:

1.7. HOMEOSTASIS.
Es la capacidad del organismo para buscar el equilibrio tanto en sus funciones
como en todas las caractersticas y propiedades que poseen. Cuando este
equilibrio se rompe ya sea por factores externos (estrs) o internos (metabolismo
inadecuado) se tiene como consecuencia el desarrollo de enfermedades.

1.8. ADAPTABILIDAD Y EVOLUCIN.


Las plantas y los animales soportan los cambios del medio donde viven. Esta
propiedad se denomina adaptacin, debido a la facilidad con que les permite
realizar ajustes inmediatos, que dependen de la irritabilidad de las clulas.
Tambin existen ajustes a largo plazo, resultante de fenmenos de seleccin y
mutacin los cuales son la materia prima de la evolucin. Cada organismo es
producto de interacciones complejas entre genes y las condiciones ambientales.
Un organismo que ha logrado el xito est adaptado a su medio y por lo tanto los
organismos ms adaptados o mejor adaptados son producto de la evolucin.

1)

La organizacin especfica no es una caracterstica de los seres

2)
3)
4)
5)
6)

vivos.
La fotosntesis es un ejemplo de proceso catablico.
La formacin de protenas es un proceso metablico.
La fiebre es un ejemplo de homeostasis.
Las plantas poseen irritabilidad.
Las bacterias se reproducen en forma sexual con la participacin de

(
(
(
(

)
)
)
)

7)
8)
9)

gametos.
Las branquias de ciertos organismos es un ejemplo de adaptacin.
La nutricin auttrofa se da en bacterias.
Las aletas de los peces y el aparato bucal de los insectos es un tipo

(
(
(

)
)
)

10
11
12

de adaptacin.
Un erizo de mar posee organizacin especfica.
Las garrapatas y los zancudos carecen de reproduccin sexual.
En la reproduccin asexual la esperanza de vida es mayor.

(
(
(
(

)
)
)
)

II.- Completa:
1.- La............................. es la capacidad de los seres vivos para responder frente a un
estmulo determinado del medio ambiente.

Las respuestas ante estos estmulos

pueden ser de.............................. y...................................


2.- El................................... es el incremento de la masa celular, la cual aumenta en

2. FUNCIONES VITALES DE LOS SERES VIVOS:


Son aquella que nos diferencian de los seres inertes:

tamao y nmero mientras que la........................................ es la capacidad que tienen

Boletn de biologa

BIOLOGA
los seres vivos para mantener un equilibrio interno de su cuerpo con el medio que lo

k) anabolismo

intercambio materia y energa

rodea.

l) caracol

reproduccin asexual

3.- La.............................. es un tipo de movimiento interno que se da a nivel


IV.- Subraya la respuesta correcta:

del......................................... de las clulas de las hojas de una planta.


4.- En la reproduccin............................ los descendientes son idnticos al organismo
progenitor.

Mientras

que

en

la

reproduccin.............................

los

1) Capacidad que tienen los seres vivos para mantener un equilibrio interno de su
cuerpo con el medio que lo rodea:

seres

descendientes son semejantes al organismo progenitor.

a) metabolismo b) homeostasis c) anabolismo

5.- El anabolismo es una reaccin de tipo.................................... porque consume energa.


Mientras

que

el.....................................

libera

energa

es

e) N.A.

2) Conjunto de reacciones qumicas que ocurren dentro de las clulas con la finalidad
de intercambiar materia y energa con el medio ambiente:

una

reaccin.....................................

a) homeostasis

6.- La........................................ es un proceso en donde los organismos forman


descendencia, todo ello con la finalidad de

d) ciclosis

b) irritabilidad

c) adaptacin

d) metabolismo e) b y c

3) No es una caracterstica del ser vivo:

...........................................................

7.-..............................es la funcin vital que nos permite crecer, desarrollarnos, y

a) adaptacin

mantener en equilibrio cada parte de nuestro cuerpo.

b) organizacin c) anabolismo

d) crecimiento

e) N.A.

4) Una cianobacteria es un organismo:

8. Las..................................... son fijas, pero realizan un movimiento constante durante

a) auttrofo

su crecimiento.
III.- Relaciona:

b) procariota

c) eucariota

d) hetertrofo e) a y b

5) Las malaguas y los erizos de mar son organismos:

a) movimiento

fototropismo

b) adaptacin

fiebre y sudor

c) irritabilidad

respiracin celular

d) catabolismo

ciclosis

e) anabolismo

aletas, branquias

f) homeostasis

fotosntesis

g) metabolismo

reproduccin sexual

h) catabolismo

exergnico

i) cianobacteria

realiza fotosntesis

j) bacteria

endergnico

a) procariotas

b) eucariotas

c) metablicos

d) b y c

e) N.A.

6) Es el incremento de la masa celular como resultado del aumento en el tamao de


las clulas individuales:
a) irritabilidad

b) adaptacin

c) crecimiento

d) metabolismo e) N.A.

7) Se da cuando el estmulo que proviene del medio ambiente es constante y


permanente en donde el ser vivo modifica determinada forma de vida:
a) irritabilidad

b) crecimiento

c) metabolismo d) adaptacin

e) homeostasis

8) Es cuando el ser vivo produce respuestas especficas frente a un estmulo


temporal y transitorio:

Boletn de biologa

BIOLOGA
a) adaptacin

b) reproduccin c) homeostasis

d) irritabilidad

e) N.A.

5.- Vocabulario.- Busca el significado de las siguientes trminos. ( pto c/u)


Materia, molcula, inerte, seudpodo, locomocin, adaptacin, energa, tropismo,
progenitor, nastia, taxia.
IV. BIOLOGA MOLECULAR

9) No es una caracterstica de la reproduccin asexual:


a) Se forma un clon.
b) El nmero de descendientes suele ser abundante en corto tiempo.
c) Los descendientes exhiben caracteres recombinados de sus progenitores.
d) No intervienen gametos.
e) Se requiere un solo individuo.

1.1. CONCEPTO: Son todos aquellos elementos qumicos que forman parte de los
seres vivos en condiciones normales. De los 107 elementos que existen (92 naturales
y 15 obtenidos en el laboratorio) slo aproximadamente 27 de ellos se encuentran en
la inmensa diversidad de organismos.
1.2. CLASIFICACIN DE LOS BIOELEMENTOS:

d) VVV

e) FFF

BIOELEMENTO

10) Marca V o F segn corresponda:

Las amebas poseen movimientos

La ciclosis es un tipo de movimiento

Una bacteria es eucaritica


a) FFV
b) VVF
c) VFV

1. BIOELEMENTOS

V.- Desarrolla en tu cuaderno las siguientes preguntas:


1.- Ejemplifica y dibuja cada una de las caractersticas de los seres vivos. (4 pts:
c/u)
2.- Menciona que tipo de reproduccin tienen los siguientes seres vivos. (2 pts: c/u)
a) Rana

: .......................................................................

b) Estrella de mar

: .......................................................................

c) Pepino de mar

: .......................................................................

d) Cucaracha

: .......................................................................

e) Ornitorrinco

: .......................................................................

f) Malagua

: ......................................................................

g) Hidra de agua dulce

: .......................................................................

h) Bacteria

: .......................................................................

PRIMARIOS

H
N

Na

O
S

Ca

Mg

Cl

1.3. ACTIVIDAD FISIOLGICA DE LOS BIOELEMENTOS:


Na (Sodio).- Catin
principal del lquido extracelular, regula el volumen plasmtico,
SECUNDARIOS
Fe ATPasa).
I
Cu provoca
las funciones nerviosas y muscular, (Na+/K+
SuFdeficiencia
deshidratacin.
K (Potasio).- Catin principal en el lquido intracelular, participa en la funcin
nerviosa y muscular.
Cl (Cloro).- Importante en el equilibrio del agua en los organismos y anin principal
entre clulas.
Ca (Calcio).- En su forma ionizada (Ca++) participa en la coagulacin sangunea, en
la contraccin muscular y conduccin nerviosa. Su deficiencia produce raquitismo.

3.- Cul es la diferencia entre reproduccin sexual y asexual? (4 pts: c/u)


4.- Cules son las funciones vitales de los seres vivos? Explica y dibuja un ejemplo
de cada uno. (3 pts: 1 c/u)

Boletn de biologa

BIOLOGA
Mg (Magnesio).- Bioelemento que bajo la forma de sales se encuentra formando
parte de estructuras seas, es componente principal del pigmento fotosinttico
de algas y plantas (la clorofila). Interviene en la sntesis de glcidos, lpidos y
cidos nucleicos.
Fe (Hierro).- Componente de protenas tales como la hemoglobina, mioglobina y
como citocromos. Su deficiencia en humanos y primates produce anemia.
Cu (Cobre).- Forma parte de algunos citocromos; adems de la hemocianina que es
el pigmento encargado de transportar O2 de la mayora de invertebrados. Su
deficiencia produce anemia.
I (Iodo).- Componente de las hormonas tiroideas (tiroxina). Su dficit o carencia
produce el bocio en el adulto y cretinismo en nios.
F (Flor).- Es considerado como endurecedor del esmalte dentario previniendo la
formacin de caries.
2. BIOMOLCULAS

B) CIDOS Y BASES

Caractersticas:
En los seres vivos encontramos con frecuencia
determinadas sustancias que pertenecen a dos tipos de compuestos
qumicos: los cidos y las Bases.
Muchos frutos y alimentos contienen cidos; el cido
ctrico se encuentra en la naranja y los limones, el cido mlico, en las
manzanas; el cido lctico en el yogurt y el cido actico, en el vinagre.
Entre las bases que encontramos con mayor frecuencia
podemos citar el amonaco (NH3), que es un producto de excrecin de
organismos acuticos, que asocindose con el agua forma el Hidrxido
amnico (NH4OH).

2.1. CONCEPTO: Son entidades moleculares que resultan de la interaccin de dos


o ms bioelementos. Adoptan mltiples conformaciones y cumplen diversas
funciones de acuerdo al grado de composicin y estructura que presenten.
2.2. CLASIFICACIN: Las biomolculas pueden clasificarse en dos grandes
grupos:

2.2.1. BIOMOLCULAS INORGNICAS:


A) AGUA

Caractersticas:
Es la biomolcula inorgnica ms abundante de la
superficie terrestre. Como componente corporal de los organismos es el
ms abundante.
En animales inferiores como las medusas poseen un 98%
de agua, en el hombre adulto, el 63% del peso corporal.
Representa el 75-80% del volumen de clulas.
Entre el tomo de Oxgeno y cada uno de los tomos de
Hidrgeno se establece un enlace covalente, la disposicin de los tomos de
Hidrgeno respecto al Oxgeno es tal que entre ellos forman un ngulo de
104,5 (un par de electrones compartidos).

Escala de pH:
El pH es un indicador del grado de acidez o alcalinidad de
una solucin o sustancia. Presenta un intervalo del 0 al 14.
Un pH igual a 7 indica neutralidad, uno menor de 7 indica
acidez y un pH mayor de 7 indica basicidad o alcalinidad.
-

Amortiguadores:
Se les conoce tambin como tampones o buffer.
Son sustancias que evitan los cambios bruscos de pH en
un medio, buscando mantener un equilibrio orgnico interno sin variaciones
u HOMEOSTASIS.
Entre los principales buffer tenemos: Bicarbonatos,
Fosfatos, Hemoglobina.

C) SALES
Son biomoleculas inorgnicas que resultan de la unin de
un elemento metlico con un radical no metlico.
Estas molculas se encuentran disociadas en IONES. Si
presentan carga positiva son denominados CATIONES. Ejemplo: Na+, K+,
Ca++, Fe++, Mg++
Si presentan carga negativa, son denominados ANIONES.
Ejemplo: Cl - ; PO4-2; CO3-1; SO4-3; I- .

Funciones bsicas:
Termoaislante
Termorregulacin
Solvente

D) GASES
Son biomolculas inorgnicas formados por tomos de un
mismo elemento o por la interaccin de elementos diferentes.

10

Boletn de biologa

BIOLOGA
Se caracterizan por que se difunde rpidamente en la
atmsfera y se comprimen fcilmente. Entre ellos tenemos:
O2. Es un gas que se forma gracias a un proceso anablico, forma
aproximadamente la quinta parte de la atmsfera, se le encuentra disuelto
en el agua; indispensable para la respiracin.
CO2. Es una pequea molcula que esta formada por un tomo de carbono y
dos tomos de oxigeno. Su participacin en lo organismos vivos no es tan
amplia como el agua, pero juega un papel importante en dos procesos
biolgicos: la respiracin y la fotosntesis.
N2. Forma parte de compuestos inorgnicos u orgnicos como: Nitratos,
Nitritos y protenas.
O3. Es el estado alotrpico del oxigeno es un gas que se encuentra en la
estratosfera y absorbe los rayos ultravioletas.

Lactosa.- Est presente en la leche de los mamferos. Se usa en farmacia


como vehculo y en medicina como diurtico y laxante suave.

c)

Polisacridos: Formado por ms de diez unidades


de monosacridos unidos por enlaces glucosdicos de peso molecular
elevado.
Almidn.- Polisacrido de reserva energtica en vegetales se le encuentra
en el tallo, raz y frutos. Est formado por unidades de glucosa. Cuando
comemos arroz, yuca, papa o maz estamos comiendo almidn, ste por
procesos digestivos en la boca, estmago e intestino se transforma de
nuevo en unidades de glucosa.
Glucgeno.- Es un polmero de glucosa, polisacrido de reserva energtica
de origen animal, se almacena en el hgado y msculos; as cuando nosotros
necesitamos energa extra por un ejercicio fuerte, el glucgeno se
desdobla en unidades de glucosa.
Celulosa.- Polmero de glucosa, polisacrido estructural que forma parte de
las paredes celulares de las plantas, algas. La celulosa es componente
principal de la madera, el algodn, las fibras vegetales y sus productos
derivados como el papel.
Quitina.- Polisacrido estructural que forma la cubierta externa de los
insectos, arcnidos y crustceos, tambin se le encuentra en paredes
celulares de hongos.

2.2.2. BIOMOLECULAS ORGNICAS:

A)

GLCIDOS (Carbohidratos)
- Importancia:
Energtica: A los glcidos por su alto poder energtico
se les considera los combustibles de los seres vivos.
Estructural: Muchas molculas de glucosa se combinan
para formar complejos llamados polisacridos como por ejemplo, la quitina,
etc.

B)
LPIDOS
- Importancia biolgica:
Estructural: Los lpidos constituyen aproximadamente el 40% de las
membranas celulares.
Energtica: Las grasas son reserva de energa. Se almacenan en el
tejido adiposo bajo la forma de triglicridos.
Termoaislante: Al almacenarse en el tejido adiposo forma una
barrera que impide la prdida de calor producido en el tejido muscular. Las
ballenas, focas y otros animales de regiones polares, soportan las bajas
temperaturas porque tiene gran cantidad de lpidos debajo de la piel.
Electroaislante: Los lpidos que existen alrededor de los axones
neuronales favorecen la transmisin, rpida del impulso a lo largo de los nervios.
Las rayas y anguilas elctricas no se electrocutan por la gran cantidad de lpidos
que existe alrededor de sus nervios.
Nutricional: Intervienen en el transporte y absorcin de las
vitaminas A, D E y K (liposolubles).

- Clasificacin:

a)

Monosacridos: Estn formadas por una molcula.


Entre las ms importantes estn:
Glucosa.- Se conoce como dextrosa, es la principal fuente de energa de
los seres vivos.
Fructosa.- Se conoce como azcar de frutas o levulosa.
Galactosa.-Es el azcar de la leche.
Ribosa.- Pentosa caracterstica del RNA (cido ribonuclico).
Desoxiribosa.Pentosa
caracterstica
del
ADN
(Acido
desoxiribonuclico).

b)

Disacridos: Formados por unin de dos


monosacridos mediante enlace glucosdico:
Sacarosa.- Llamado tambin azcar de caa, que usamos a diario en nuestra
mesa es el disacrido de mayor consumo mundial en la alimentacin.
Maltosa.- Est presente en las semillas en germinacin.

- Clasificacin:

11

Boletn de biologa

BIOLOGA
Lpidos simples: Biomolculas constituidas por un alcohol y cidos
grasos, unidos entre s por enlaces ster. Dentro de los lpidos simples tenemos
a los Glicridos y a las Ceras.
Lpidos complejos: Biomolculas constituidas por un alcohol, cidos
grasos y otros grupos qumicos. Dentro de los lpidos complejos se encuentran
los fosfolpidos y los glucolpidos.
Lpidos derivados: Los principales son los Esteroides. Funcin:
Reguladora, estructural y metablica.
-

C)

b)

PROTENAS

- Definicin:
Las protenas son biomolculas principalmente cuaternarias
compuestas por C, H, O y N, la mayora contienen adicionalmente azufre (S).
Todas las protenas son macromolculas (alto peso molecular) cuyas
unidades monmeras son molculas simples denominadas aminocidos (aa).
Son las biomolculas orgnicas ms abundantes en los seres vivos.

a)
b)

- Importancia biolgica:
Estructural.- Constituyen estructuras protectoras externas como
los cuernos, escamas, uas, pelos y plumas de los animales, adems esqueletos
celulares y corporales. Ejemplo: La Queratina, Tubulina.
Movimiento.- Intervienen en el movimiento a nivel celular y corporal.
Esta funcin la , desempean las protenas contrctiles. Ejemplo: La Actina y la
Miosina.
Transporte.- Algunas protenas son encargadas de transportar
oxgeno, CO2, lpidos, hormonas, Iones.
Biocatalizadores.- Porque aceleran las reacciones intracelulares.
(Metabolismo). Ejemplo: Enzimas.

D)

o
La Fibroina que constituye la seda y telas de araa.
o
La Fibrina que constituye los cogulos sanguneos.
Globulares: Cuando tienen 2 ms tipos de estructuras secundarias: Ejemplo:
o
Las Enzimas, biocatalizadores que aceleran las
reacciones biolgicas.
o
Los Anticuerpos, protenas de defensa contra
cuerpos extraos llamados antgenos.
o
Las Histonas, componentes de la cromatina.
o
Las Tubulinas, constituyentes de los cilios, flagelos
y centrolos.
o
Las Albminas, protenas de reserva (ovoalbmina)
de transporte (seroalbmina).
Segn su composicin:
Simples: Cuando estn constituidos nicamente por aminocidos. Ejemplo:
Tubulinas, albminas, queratina.
Conjugadas: Cuando estn constituidas por aminocidos y un grupo prottico
que se caracteriza por no ser aminocido, pueden ser:
o
Hemoprotenas (grupo Hemo): Hemoglobina,
Citocromos, Mioglobina.
o
Glucoprotenas (glcidos): Mucina interferon.
o
Fosfoprotenas (fosfatos): Caseina, Vitelina.
o
Metaloprotenas (Metal): Hemocianina.

CIDOS NUCLEICOS

- Definicin:
Son compuestos orgnicos de gran tamao y peso molecular, las unidades que lo
constituyen se llaman nucletidos, por tanto, un cido nuclico puede definirse como
una molcula de polinucleotidos.

- Clasificacin de las protenas:


Segn su estructura:
a) Fibrosas: Cuando slo tienen un tipo de estructura secundaria. Constituyen
estructuras resistentes, elsticas y flexibles.
o
El Colgeno que constituye la sustancia
intercelular.
o
La Queratina que constituye pelos, uas, pezuas,
cuernos.
o
La Elastina que constituye las paredes de los vasos
sanguneos.

- Diferencias entre cidos nucleicos:


CARACTERISTICA

12

ADN

ARN

Pentosa

Desoxiribosa

Ribosa

B.N.

A. T. G. C

AUGC

Cadena

Doble

Simple

Boletn de biologa

BIOLOGA

E)

Ubicacin:

Ncleo, Mitocondrias y
Cloroplastos

Ncleo, Citoplasma y
Ribosomas

Funcin:

Depsito de informacin
gentica

Copia y traduccin de
la informacin gentica

PRCTICA DIRIGIDA N 04
I.
1.2.3.4.5.6.7.8.9.10.11.12.13.14.15.16.17.18.-

VITAMINAS

- Definicin:
Son compuestos orgnicos relativamente sencillos requeridos por los organismos en
pequeas cantidades. No pueden ser usadas como fuentes de energa.
- Clasificacin:
Existen 2 clases de vitaminas.
a) Vitaminas liposolubles:
Son solventes en grasas o lpidos.
Son transportadoras en la sangre por
especficas.
Se designan mediante la letra: A, D, E, K :

protenas

Escribe V o F segn corresponda.

fijadoras

Vitamina A.- Llamada retinol, lo encontramos en las verduras (Nabo, zanahoria), en


el hgado, en la mantequilla, queso. Favorece el funcionamiento normal de los ojos.
Vitamina D.- Conocida como antirraqutica, lo encontramos en el aceite de hgado
de bacalao, pescado, huevo, leche, exponer la piel a la luz solar.
Vitamina E.- Conocida como tocoferol, es la vitamina de la fertilidad lo
encontramos en aceites vegetales, carne, leche, espinacas, en los grmenes o
semillas. La vitamina E es necesaria para la fertilidad de los animales.
Vitamina K.- Es antihemorragica, lo encontramos en la alfalfa, lechuga.

II.

Las biomolculas orgnicas se forman a partir de los bioelementos............


(
Oligogensicos : Organgeno...................................................................................
(
Los azcares estn formados por C, H, N y O...................................................
(
C, H, O, N son elementos microconstituyentes..................................................
(
Los bioelementos slo estn presentes en las bacterias.................................
(
Los alimentos son la principal fuente de bioelementos....................................
(
C, H , N y O estn cantidades mayores al 90%..................................................
(
El I es el principal catin intracelular................................................................
(
El P y el S son bioelementos macroconstituyentes.....................................
(
El cloro es el principal anin extracelular............................................................
(
El Na es el principal catin intracelular............................................................
(
El Mg est presente en la molcula de clorofila.............................................
(
En nuestro cuerpo debemos encontrar I, Fe ....................................................
(
Muchas biomolculas forman un bioelemento.....................................................
(
Intervienen en el equilibrio hdrico celular : sodio y Cl...................................
(
Interviene en el transporte del oxgeno : Hemoglobina y Fe..........................
(
La deficiencia de Yodo me causa ceguera............................................................
(
Mn se concentra en la hemoglobina........................................................................
(

)
)
)
)
)
)
)
)
)
)
)
)
)
)
)
)
)
)

Completa:

1.- Un ejemplo de.................................................................... es el Hidrgeno, mientras


que el sodio y cloro son ejemplos de ....................................................
2.- El............................ se concentra en los huesos y dientes, su dficit en los nios
puede causar....................................................

b) Vitaminas hidrosolubles:
- Son solubles en agua, entre las vitaminas hidrosolubles tenemos al complejo de la
vitamina A y la vitamina C.
Vitamina B1 (Tiamina o Aneurina).- Su deficiencia causa el Beri-Beri.
Vitamina B2 (Riboflavina).- Su dficit causa la dermatitis y quellosis.
Vitamina B3 (Niacina).- Su dficit causa la pelagra o mal de la rosa.
Vitamina B5 (cido Pantotnico).- Su dficit causa la calvicie.
Vitamina B12 (Cianocobalamina).- Su dficit causa la anemia perniciosa.
Vitamina C (Antiescorbtica).- Su dficit causa el escorbuto.

3.- El.......................... es el principal anin extracelular interviniendo en el equilibrio


hdrico. Mientras que el potasio es el........................................................................
4.- Los bioelementos primarios o tambin llamados..................................................... se
clasifican en ................................... y............................................ .

13

Boletn de biologa

BIOLOGA
5.- Los bioelementos secundarios se caracterizan porque se localizan en menor
6.- Las molculas que aportan mayor energa en la dieta son:
a) Lpidos
b) Protenas
c) Vitaminas
d) Glcidos

proporcin dentro de la materia viva, y se dividen en...................................................


y.................................................

7.- Los lpidos ms abundantes en la naturaleza son:


a) Vitaminas liposolubles
b) Triglicridos
d) Hormonas
e) Fosfolpidos

6.- C, H, N y O son................................. ...................................... porque se encuentran en


grandes................................................. en los seres vivos.
7.-

Al

unir

C,

podemos

obtener

biomolculas

como

por

8.- Las biomolculas............................. resultan de la unin de bioelementos diferentes


Dos ejemplos de ellas lo constituyen

los.............................. y los...............................
9.- El.......................

9.- Son llamados elementos biogensicos:


a) Agua, oxgeno y CO2
b) cidos nucleicos
c) Glcidos, lpidos y protenas
d) Carbono nitrgeno, oxigeno e hidrgeno
e) B y C

es el medio en el cual tienen lugar la mayor parte de las

reacciones metablicas.
10.- Un biomolcula..................................... elemento indispensable de la materia viva es

10.- Son todos polisacridos excepto:


a) Almidn
b) globulina
c) Celulosa

el agua, en ella se realizan todas las reacciones...................... que hacen posible la


vida de los organismos.

4.- Seale el compuesto que corresponde a una macromolcula:


a) Protena
b) Vitamina
c) Glucosa
d) Colesterol

e) Esteroides

13.- Se le atribuye el descubrimiento de los cidos nucleicos a:


a) Oswald Avery (1944 )
b) Frederich Miescher (1869)
c) Watson y Crik (1953)
d) Gregorio Mendel (1865)
e) N.A.

e) La sacarosa

14.- Son funciones del ADN, excepto:


a) transmisin de rasgos biolgicos
b) almacenamiento de la informacin gentica
c) transcripcin del cdigo gentico
d) traduccin del cdigo gentico
e) replicacin momentos antes de la mitosis

e) Triglicrido

5.- El Fe++ interviene conformando la molcula de:


a) Clorofila
b) Hemoglobina c) Tiroxina
d) cido nucleico
graso

e) Glucgeno

12.- El oso polar puede resistir las bajas temperaturas del ambiente donde vive
porque almacena una gran cantidad de:
a) Grasas
b) Ceras
c) Aceites
d) fosfolpidos e) Esteroides

2.- Las protenas son anfteras por que actan como:


a) Enzimas
b) cidos bases c) cidos
d) Basese) Micelas

d) Lactosa

d) Quitina

11.- Son lpidos que constituyen la membrana celular:


a) Grasas
b) Ceras
c) Aceites
d) Fosfolpidos

III.- Subraya la respuesta correcta:


1.- Seale el compuesto cuyas unidades estructurales son el glicerol y cidos grasos
a) Lpidos
b) Protenas
c) Carbohidratos
d) Vitaminas
e)
Enzimas

3.- De la caa de azcar se extrae:


a) La maltosa
b) El almidn
c) Glucgeno

c) Esteroides

8.- Los lpidos pertenecen a varias clases de molculas diferentes, pero su carcter
comn es que son:
a) Solubles en solventes orgnicos
b) Solubles en agua
c) Contiene nitrgeno
d) Solubles en soluciones salinas
e) Contienen azufre

ejemplo ....................................., .......................................... y...........................entre otros.

unidos por enlaces carbono carbono.

e) Celulosa

e) cido

14

Boletn de biologa

BIOLOGA
15.- No corresponde al ADN:
a) replicacin semiconservadora
c) estructura helicoidal
e) formacin de estructuras biolgicas
IV. Relaciona:
a) B

b) transcripcin de la informacin gentica


d) autoduplicacin

Favorece el endurecimiento del esmalte dentario.

b) Na

Subnivel atmico ( a,b, c,d,e, f, g, h, i, j, k , l ).

c) K

Presente en huesos y dientes.

d) Mg

Su dficit causa Bocio en adultos.

e) F

Presente en la Vitamina B12.

f) Ca

Principal catin intracelular.

g) Co

Biolemento bsico.

h) Carbono

Principal catin extracelular.

i) I

Componente de la clorofila.

j) Cloro

Participa en el crecimiento de las plantas.

k) Fsforo

Principal anin extracelular.

l) Cu
V.

V. DOGMA DE LA BIOLOGA MOLECULAR


1.

Es un proceso biolgico vital que realizan las clulas de todos los seres vivos y que
consiste en la produccin de gran cantidad de protenas, las cuales cumplen
una funcin importante en el organismo como por Ej.: ser responsables de los
caracteres fsicos y sexuales, realizar diversas funciones metablicas, etc.
2.

Cul es la diferencia entre bioelementos primarios y secundarios? (4 Pts: c/u)

b.

Elabora un mapa conceptual de las protenas sealando su clasificacin y


funciones. (4 pts: c/u)

c.

Realiza un cuadro comparativo entre los lpidos y glcidos. (3 pts: c/u)

d.

Que son los cidos nucleicos y cul es su principal importancia? Dibjelos (3 pts:
c/u)

ETAPAS DE LA SNTESIS DE PROTENAS.


A
ADN
Protenas

B
ADN

(Ncleo)

C
ARN

(Ncleo)

(Citoplasma)

A.- Replicacin
B.- Trascripcin
C.- Traduccin
2.1. REPLICACIN: (ADN
ADN)
Para qu se duplica el ADN? Todos los seres vivos son temporales; pueden vivir
unos minutos como las bacterias, varios siglos como las tortugas marinas; o
incluso ms de un milenio como los olivos, pero para que la especie no se extinga
ha de haber siempre por lo menos un momento en que la informacin biolgica se
replique (auto duplica) y las copias pasan a la descendencia.
La clula para dividirse, previamente duplica su DNA, de este modo, las
generaciones celulares mantienen una cantidad constante de DNA.

(
) Bioelemento complementario.
Desarrolla en tu cuaderno las siguientes preguntas:

a.

SNTESIS DE PROTENAS.

e. VOCABULARIO.- Busca el significado de los siguientes trminos: ( pto. c/u)


Elementos, solvente, evaporacin, amortiguar, homeosttico, inodoro, fotosntesis,
atmsfera, osmosis, fosfato, anin, catin.

15

Boletn de biologa

BIOLOGA
Es un proceso que consiste en la sntesis de protenas a partir de la molcula de
ARN. Se realiza en el citoplasma, especficamente entre las 2 subunidades del
ribosoma y participan: ribosomas, ARNm y ARNt. El proceso es el siguiente:

El ARNm posee los codones, los cuales son tripletes de bases


nitrogenadas y son el complemento de los anticodones.

El ARNt posee los anticodones, los cuales son tripletes de bases


nitrogenadas y son el complemento de los codones.

Los ribosomas, al hacer la lectura del ARNm, se detienen ante un codn,


esperando que el ARNt ingrese con su anticodn correspondiente. Cuando
existe el encuentro: codn-anticodn, un aminocido se une a otro
aminocido formndose as las protenas.

2.2. TRANSCRIPCIN: (ADN


ARN)
Consiste en el pasaje de la informacin gentica del ADN (copia de la informacin
hereditaria) a la molcula de ARN, que empieza a sintetizarse por medio de la
complementariedad de las bases nitrogenadas.
Cadena superior
Hebra codificante
Hebra con significado
(con sentido)

TRANSCRIPCIN

ATGCCGTTAGACCGTTAGCGGACCTGAC
TACGGCAATCTGGCAATCGCCTGGACTG

ADN

5
Sntesis
de ARNm

Hebra inferior
Hebra templada
Hebra sin significado
(Antisentido)

3.
CDIGO GENTICO.
Se entiende por cdigo gentico al Alfabeto Qumico que posee todo organismo
del planeta, en donde se renen una serie de tripletes de nucletidos de ARN o
tambin denominados codones, los cuales, a su vez guardan una correspondencia
especial con determinados aminocidos (aa), los cuales al reunirse constituirn a
una protena especfica. Las protenas que logren formarse habrn de ser
utilizadas con fines: estructurales, inmunolgicos, hormonales, enzimticos,
contrctiles, etc.

ARNm AUGCCGUUAGACCGUUAGCGGACCUGAC

2.3. TRADUCCIN: (ARN

PROTENAS)

16

Boletn de biologa

BIOLOGA

Valina
Valina
Valina
Valina

SEGUNDA BASE NITROGENADA

Fenilalanin
a
Fenilalanin
a
Leucina
Leucina
Leucina
Leucina
Leucina
Leucina
Isoleucina
Isoleucina
Isoleucina
Metionina

C
Serina
Serina
Serina
Serina
Prolina
Prolina
Prolina
Prolina
Treonin
a
Treonin
a
Treonin
a
Treonin
a

A
Tirosina
Tirosina
Alto
Alto
Histidina
Histidina
Glutamina
Glutamina
Asparagina
Asparagina
Lisina
Lisina

Cisteina
Cisteina
Alto
Triptfa
no
Arginina
Arginina
Arginina
Arginina
Serina
Serina
Arginina
Arginina

Glicina
Glicina
Glicina
Glicina

U
C
A
G

PRCTICA DIRIGIDA N 05

G
U
C
A
G
U
C
A
G

I. Escribe V o F segn corresponda: ( pt. c/u )

BASE NTROGENADATERCERA

NITROGENADAPRIMERA

BASE

Alanina
Alanina
Alanina
Alanina

c.
Asprtico
c.
Asprtico
c.
Asprtico
c.
Glutmico

1. La informacin gentica o hereditaria de todos los seres vivos est


almacenada en el RNA bajo la forma de un cdigo gentico.
(
2. Un gen es un segmento de ADN que contiene la informacin gentica
necesaria para sintetizar una protena determinada.
(
3. El ADN dirige directamente la sntesis de protenas.
(
4. La transcripcin es un proceso que consiste en la formacin de ARN a
partir de ADN y ocurre en el citoplasma.
(
5. El ARNt capta aminocidos y a la vez posee los anticodones necesarios
para la sntesis de protenas.
(
6. Para que pueda sintetizarse una protena es necesario la participacin
de los 3 tipos de ARN.
(
7. El cdigo gentico rene una serie de codones, los cuales son responsables
de la sntesis de un aminocido particular.
(
8. La traduccin es un proceso de sntesis de protenas a partir del ARN
y ocurre en el ncleo celular.
(

U
C
A
G

17

a)

Relaciona :

b)

ARNm

) AUG

c)

Metionina

) citoplasma

d)

Transcripcin

) codn

e)

Replicacin

) ADN

f)

ARNt

) ncleo

Boletn de biologa

)
)
)
)
)
)
)
)

BIOLOGA
g)

Triptofano

) UGG

h)

Traduccin

) nucleolo

i)

ARNr

) anticodn

d) Hay ruptura y formacin de enlaces puente hidrgeno.


e) N.A.
2. Seala lo correcto acerca de la sntesis de protenas y su relacin con los
genes:
a) Los genes no almacenan informacin hereditaria para producir protenas.
b) Los genes estn formados por diferentes tipos de bases nitrogenadas.
c) Las diferentes protenas que existen en el organismo poseen secuencias
de aminocidos colocadas al azar.
d) La secuencia de bases nitrogenadas presentes en el ADN son
responsables de la secuencia de aminocidos presentes en una protena.
e) b y d

II. Completa los espacios en blanco:

1. La ____________es un proceso que consiste en la sntesis de _______ a


partir de ________.
Mientras que la _______________ implica la sntesis de ___________ a

3. La base nitrogenada Timina en el ADN es reemplazada por........ en el ARN:


a) Adenina b) Citosina
c) Guanina
d) Uracilo
e) a y d

partir de __________.
2. El _________ se dirige al ______________ para colocarse entre los

4. Proceso que consiste en el pasaje de la informacin gentica del ADN al


ARN, y que se lleva a cabo en el ncleo :
a) Replicacin
b) Transcripcin
c) Traduccin
d) Autoduplicacin
e) N.A.

subunidades del _____________.


Por

otro

lado

el

_________

capta

aminocidos

posee

los

______________, los cuales son tripletes de bases nitrogenadas que se

5. Tipo de ARN que posee los codones necesarios, los cuales sern ledos por
los ribosomas:
a) ARNm
b) ARNt
c) ARNr
db y c
e) N.A.

complementan con los ___________.


3. ________________________ es el alfabeto qumico que posee todo
organismo en donde se renen una serie de tripletes de nucletidos,

6. Tipo de ARN que capta aminocidos y posee los anticodones necesarios para
la sntesis de un aminocido particular:
a) ARNm
b) ARNt
c) ARNr
d) b y c
e) N.A.

llamados ___________, los cuales guardan una correspondencia especial


con determinados __________ que al reunirse constituirn una protena.
4. El ______ no puede dirigir directamente la ______________________,

7. El ADN eucaritico:
a) Interviene directamente en la sntesis proteica al abandonar el ncleo y
ser trasladado al ribosoma.
b) Toma parte indirectamente en la sntesis proteica (el DNA permanece en
el ncleo)
c) No tiene nada que ver con la sntesis proteica. Slo interviene en la
divisin celular.
d) Interviene en la sntesis proteica que se lleva a cabo en el ncleo.
e) Codifica para RNAm, pero no para RNAt ni para RNAr.

por lo tanto, debe haber una molcula llamada _______ que lleve la
informacin gentica desde el ___________ al ______________.
VI.- Subraya la respuesta correcta:
1. Seala lo incorrecto respecto a la sntesis de ARN:
a) Las cadenas del ADN se separan
b) Los nucletidos de ARN se colocan frente a los nucletidos de ADN.
c) Slo hay formacin de enlaces puente hidrgeno.

8. En relacin al proceso de sntesis de protenas, marca la respuesta correcta:

18

Boletn de biologa

BIOLOGA

El ARNr se dirige a los nucleolos donde es organizado en 2 subunidades,


los cuales luego formarn los ribosomas.
El ARNt se dirige al ncleo donde adopta la forma de hoja de trbol para
captar aminocidos.
El ARNm se dirige al citoplasma para colocarse entre las 2 subunidades
del ribosoma, quien har la lectura correspondiente.
Los codones y anticodones derivan del ARNm y se unen para formar
aminocidos.

a) VVFV
9.

b) FVFV

c) VFVF

d) FFVV

2.

e) VFFF

Anticodn es el trmino que se aplica a:


a) La lista de aminocidos que corresponde al cdigo gentico.
b) El concepto de que mltiples codones en ocasiones codifican para un solo
aminocido.
c) La parte del RNAt que interacta con el codn.
d) b y c
e) T.A.

10.

Seala lo incorrecto acerca de la sntesis proteica:


a) Los ribosomas al hacer la lectura del ARNm se detienen ante un
anticodon.
b) El proceso de traduccin es intracitoplasmtico.
c) El ARNt transporta los codones y los aminocidos hacia el lugar donde el
ribosoma lee al ARNm.
d) a y b
e) a y c
VI. Resuelve los siguientes ejercicios:

1.

Una bacteria patgena intestinal que produce cuadros de diarrea agudos


en diferentes pacientes, posee una protena codificada por su genoma, la
cual la hace muy resistente a un determinado tipo de antibitico. Dicha
protena forma parte de su membrana y est conformada por gran cantidad
de aminocidos (aprox. 100). Se han encontrado los siguientes codones
dentro del ARNm que son: AAU, AAA, ACG, GCU, UCU, CAU, CAA, GGU,
CGA, CUG, AAG, GGG. Dichos codones con responsables de la formacin de
12 aminocidos presentes en dicha protena y aparecen en ese mismo orden.
(5 Pts.)
a)
Haciendo uso de la tabla del cdigo gentico, encuentra esos 12
aminocidos que forman parte de dicha protena y el orden en que
aparecen.
b)
Cul es la secuencia de nucletidos presentes en el ARNm?
c)
Cul es la secuencia de nucletidos presente en el ARNt?
d)
Escribe la secuencia de nucletidos presente en la molcula de
ADN bacteriano que dio origen indirectamente a dichos aminocidos.
e)
Encuentra el nmero de enlaces fosfodiester y puente
hidrgeno en la molcula de ADN.

Virus (del latn veneno)


Contiene RNA o DNA protegido por la capside( estructura proteica)
se replica dentro de las clulas hospedadoras (pero independientemente de
los cromosomas de la clula) y tambin posee un estado extracelular (virin).
No est formado por clulas.
Agente patgeno que mide entre 30-300 nm (0.03-0.3 um).
Son parsitos intracelulares: necesitan una clula hospedadora para

Un organismo x presenta en su cdigo gentico las bases nitrogenadas


que darn origen a una protena y particular, la cual forma parte de su
cuerpo. Por otro lado, se sabe que los siguientes codones:
(4 Pts.)
1ro: UAU
4to: AGC
2do: UGU
5to: CCU
3ro: CGU
6to: GUU
Codifican 6 aminocidos diferentes que al unirse formaran dicha protena.
Lo que debes hacer es lo siguiente:
a)
Usando la tabla del cdigo gentico, encuentra los 6 aminocidos que
conforman dicha protena y el orden en que aparecen.
b)
Escribe la secuencia de nucletidos presentes en el ARNm.
c)
Escribe la secuencia de nucletidos presentes en el ARNt.
d)
Escribe la secuencia de nucletidos presente en el ADN que dio
origen indirectamente a esta protena.

replicarse, ya que se aprovechan de la maquinaria metablica.


Infectan a todo tipo de organismos celulares.
Retrovirus
Genoma ssRNA pero se replican mediante DNA intermediario.
usan enzima transcriptasa reversa.
Semejantes a elementos transponibles escapados de clulas.
Son virus envueltos
Ciclos virales:

Ciclo lisognico: El cido nucleico viral no expresa sus genes, se integra en


el genoma de la clula o queda libre a modo de plsmido

Ciclo ltico: Fijacin o adsorcin, Penetracin, Eclipse, Ensamblaje,


Liberacin.

1. DEFINICIN Y CARACTERSTICAS:

19

Boletn de biologa

BIOLOGA
Son organismos unicelulares y/o coloniales procariotas (carecen de ncleo), presentan
su material gentico suspendido en el citoplasma, carecen de organelas y plastidios;
presentan como nicos organoides a los ribosomas. Ocupan diversos hbitats del
planeta y desempean papeles claves en la Bisfera.

composicin qumica est basada en pptidoglucano (protena + glcido) le sirve


de proteccin y mantiene la forma de la bacteria.
c.- Membrana Celular: Es una cubierta muy semejante a la membrana celular de
eucariotas, es decir es lipoproteca.
La diferencia radica en que no posee colesterol. Forma unos repliegues internos
llamados mesosomas.

2. CLASIFICACIN.
Estos microorganismos presentan caractersticas comunes y diferenciales en cuanto a
su fisiologa, morfologa, etc., por lo tanto, se les rene en 2 grupos:

d.- Mesosoma: Es un repliegue o invaginacin de la membrana bacteriana que


cumple las siguientes funciones:
El ADN bacteriano se une por un punto al mesosoma y en dicho punto se inicia
la rplica o duplicacin del ADN.
Se encarga de la respiracin celular.
En bacterias auttrofas cumple la funcin de fotosntesis porque posee
fotopigmentos (Bacterioclorofila).
Interviene en la reproduccin participando en la biparticin.

2.1. BACTERIAS.
A) IMPORTANCIA:

Perjudicial: La proliferacin de estos microorganismos en diversos tejidos o


sistemas, es causa de diversas enfermedades.

BACTERIA

ENFERMEDAD

RGANO
COMPROMETIDO

Mycobacterium
tuberculosum

Tuberculosis

Pulmones y otros tejidos

Mycobacterium leprae

Lepra

Piel, msculos, huesos.

Neisseria gonorheae

Gonorrea

rganos sexuales.

Treponema pallidum

Sifilis

rganos sexuales.

Chlostridium tetan

Ttano

piel.

Vibrion cholerae

Clera

intestinos.

Clostridium botulinum

Botulismo

sistema nervioso

e.- ADN (Genoma): Es nico, cclico o circular, disperso en el citoplasma y siempre


por un punto se halla unido al mesosoma. Contiene toda la informacin gentica
de la bacteria.
f.- ARN: Son fracciones de cido ribonucleico dispersos en el citoplasma;
conjuntamente con los ribosomas participan en la sntesis proteca.
g.- Ribosomas: Son las nicas organelas presentes en las bacterias, son
numerosos y participan en la sntesis de protenas.
h.- Flagelo: Son prolongaciones especiales que se encargan de la propulsin de
algunas bacterias de ambientes acuosos.
i.- Fimbrias o Pili: Son apndices tubulares que se proyectan fuera del citoplasma.
Cumplen las siguientes funciones:
Fijacin de la bacteria con determinado sustrato.
Intercambio de nutrientes.
Interviene en la conjugacin, a travs de la cual el material gentico (ADN) de
una bacteria es transferido a otra.

Benfica: Diversas cepas (tipos) de bacterias son utilizadas en diferentes


actividades realizadas por el hombre y tambin de manera natural asocindose
con otros organismos. Ejemplo: En la fabricacin de productos lcteos como
yogurt, queso, tenemos algunas especies como: Lactobacillus casei; en la
produccin de cido actico, alcohol, acetona, tenemos a: Acetobacter aceti; en la
fijacin o captacin de nitrgeno atmosfrico, tenemos a: Rhizobium.

j.- Plsmidos (ADN parsito): Son pequeas porciones de ADN bacteriano


localizados en el citoplasma y se caracterizan porque le otorgan a la bacteria
alguna particularidad por ejm: la resistencia a antibiticos.

B) ESTRUCTURA BACTERIANA:

a.- Cpsula: Es una cubierta que se localiza por encima de la pared celular y es
comn observarla en bacterias patgenas.
b.- Pared Celular: Es una cubierta que se localiza sobre la membrana celular y
est presente en todas las bacterias a excepcin de los micoplasmas. Su

20

Boletn de biologa

BIOLOGA

Productores: Debido a su condicin nutricional fotosinttica, las cianobacterias


generan y liberan oxgeno, adems de servir de alimento a otros organismos.
Fijacin de Nitrgeno: Algunas cianobacterias captan el nitrgeno atmosfrico por
medio de unas estructuras llamadas heterocistos para ser utilizadas por las
plantas. Ejm: enriquece los terrenos de cultivo de arrozales, sin necesidad de
fertilizantes.

Perjudicial:
Su multiplicacin acelerada limita la penetracin de la luz en el agua, debido a la
gran masa poblacional formada.
Luego mueren debido a la descomposicin por bacterias; realizan un gran desgaste
de oxgeno, provocando la muerte de muchos peces.

ESTRUCTURA BACTERIANA
C) FISIOLOGA BACTERIANA:

B) ESTRUCTURA:

Nutricin: Algunas bacterias son auttrofas (quimiosintticas o fotosintticas)


pero la gran mayora son hetertrofas), siendo saprobiticas y parsitas.

Respiracin: Existen las anaerbicas (realizan sus actividades metablicas en


ausencia de oxgeno) y las aerbicas (hacen uso del oxgeno) pudiendo ser:
estrictas y facultativas.

Reproduccin: Principalmente es por la va asexual (por biparticin), donde


ocurre previamente la duplicacin del ADN y posteriormente la sntesis de
nuevas membranas y las nuevas paredes celulares. Eventualmente realizan la
va sexual, donde las bacterias intercambian material gentico por medio de la
conjugacin (reproduccin parasexual).

a.- Cpsula: Muchas cianobacterias secretan una sustancia viscosa y gelatinosa


fuera de la pared celular.
b.- Pared Celular: Sirve de proteccin, es muy resistente, carece de celulosa pero
presenta polisacridos unidos a polipptidos.
c.- Laminillas Fotosintticas: Son membranas internas que contienen pigmentos
como: clorofila (verde), ficocianina (azul), ficoeritrina (rojo), xantfila (amarillo)
encargados de la fotosntesis.
d.- Ausencia de flagelos: En estos organismos no se han ubicado flagelos, su
desplazamiento es por oscilacin.
e.- Colonizacin: Tienden a agruparse formando colonias.

D) CLASIFICACIN BACTERIANA:

Segn sus formas:


Esfricas: cocos.
Abastonadas: bacilos.
Espiraladas: espirilos o espiroquetas.
Forma de coma: vibriones.
Segn el flagelo:
Monotricas: con un solo flagelo.
Anfitricas: con un grupo de flagelos en cada extremo.
Lofotricas: con un penacho de flagelos en un extremo.
Peritricas: con flagelos dispuestos en la periferie de la bacteria.

ESTRUCTURA DE LA

2.2. CIANOBACTERIAS
C) FISIOLOGA:

A) IMPORTANCIA:

Benfica:

21

Nutricin: Son auttrofas fotosintticas, almacenan almidn y aceites.


Respiracin: Es simple, se realiza mediante un intercambio de gases a nivel de
membrana (difusin)

Boletn de biologa

BIOLOGA

8. Las......................................... son conocidas como algas azul-verdosas, y realizan

Reproduccin: Es asexual por biparticin.

fotosntesis debido a la presencia de................................................, donde uno de

PRCTICA DIRIGIDA N 02

ellos puede ser la............................................... de color azul.

I. Escribe V o F segn corresponda: (1/4 pto. c/u)


III. Relaciona: (1/4 pto. c/u)

1. Las bacterias son organismos coloniales, eucariticos y unicelulares

2. La cianobacteria Treponema pallidum produce sfilis.

a) Biparticin

Peptidoglucano.

3. Rhizobium se utiliza en la produccin de productos lcteos.

b) Cianobacterias

ADN parsito

4. Todas las bacterias posee pared celular

c) Lofotricas

reproduccin

5. El mesosoma bacteriano interviene en la biparticin

d) Pared Celular

respiracin bacteriana

6. En la conjugacin bacteriana existe intercambio de material gentico

e) Anfitricas

flagelos en 2 extremos

7. Las bacterias en forma de coma se llaman espiroquetas

f) Conjugacin

reproduccin asexual

laminillas fotosintticas

flagelos en un extremo

8. El Vibrion cholerae, es una bacteria bacilar

g) Mesosoma

9. La ficoeritrina es un pigmento de color amarillo

h) Plsmido

10. Las Cianobacterias realizan fotosntesis debido a sus fotopigmentos.

IV. Subraya la alternativa correcta: (1/4 pto. c/u)

II. Completa: (1/4 pto. c/u)

1.- No es una caracterstica del Reino Monera:


a) Procariotas y coloniales
b) Poseen carioteca.
d) Su ADN es circular.
e) b y d

1. Las bacterias presentan como nicos organelas a los ..................................... y su


ADN est disperso en el ..........................................

c) Tienen ribosomas.

2.- Estructura bacteriana que sirve de proteccin y est hecha a base de pptido
glucano:
a) Pared Celular
b) Membrana Celular
c) Cpsula
d) a y c
e) N.A.

2. El Treponema pallidum es causante de ........................., mientras que Clostridium


botulinum causa el .....................................................
3. La pared celular bacteriana se compone de ................................... y la pared celular

3.- Es una cubierta externa que sirve de proteccin y se encuentra generalmente en


bacterias patgenas:
a) Pared Celular
b) Quitina
c) Membrana
d) Mesosoma
e) Cpsula

vegetal de ................................................
4. El .................................................. es un repliegue de la membrana celular bacteriana
e interviene en la reproduccin asexual llamada: ...........................................................

4.- Estructura bacteriana que cumple funciones de respiracin, fotosntesis y


reproduccin:
a) ARN
b) Plsmido
c) Cpsula
d) Mesosoma
e) ADN

5. La ............................................ es considerado en bacterias un tipo de reproduccin


sexual, y tambin es llamada ....................................................
6. Los ..................................................... son pequeas porciones de ADN, que le

5.- Estructura bacteriana encargada de la produccin polipeptdica:


a) ADN
b) Plsmido
c) ribosoma
d) mesosoma
e) pared celular

confieren a las bacterias rasgos particulares.


7. Segn la forma abastonada, las bacterias se llaman......................................... y
segn la presencia de un grupo de flagelos en cada extremo, recibe el nombre

6.- Apndices tubulares que participan en la conjugacin bacteriana:

a) flagelo
d) mesosoma

de.....................................

22

b) pili
e) N.A.

c) membrana

Boletn de biologa

BIOLOGA
Son muchos los criterios que se toman en cuenta para reunir a las clulas. Es as
que tenemos:
2.1. Por su forma:
* Circulares: Ej.: Los Hepatocitos.
* Estrelladas: Ej.: Las Neuronas.
* Geomtricas: Ej.: Clulas Epiteliales.
* Fusiformes: Ej.: Clulas musculares

7.- Tipo de pigmento presente en las Cianobacterias que es de color azul:


a) Ficoeritrina
b) Xantofila
c) caroteno
d) Ficocianina
e) Clorofila
8.- Con respecto a las Cianobacterias es falso:
a) Poseen pared celular
b) Forman colonias
c) Almacenan almidn y aceites
d) Su multiplicacin acelerada puede ser perjudicial para otros organismos.
e) N.A.

2.2. Por su tamao:


* Microscpicas: Cuyo tamao oscila entre 0, 12 y 100. ; slo son observables al
microscopio. Ej.: la mayora de clulas animales y vegetales, bacterias,
protozoarios, etc.
* Macroscpicas: Aquellas cuyo tamao es mayor a 100; son visibles a simple
vista debido a que son mayores a la dcima parte de 1 mm. Ej.: yema del huevo
de las aves.

V. Vocabulario: ( pto. c/u). Fimbrias, conjugacin, mesosoma, peptidoglucanos,


plsmido, colonia, fotopigmentos, pili, bacilo, estreptococos, estafilicocos, antibitico.

VI. BIOLOGA CELULAR


1. TEORA CELULAR Y CONCEPTO MODERNO
1.1. Etimologa:
La palabra clula proviene de 2 voces:
Griego: Kytos Clula.
Latn: Cella Espacio vaco
1.2. Definicin:
Es la unidad anatmica, funcional y gentica de los seres vivos.
Anatmica: Porque forma parte de los seres vivos, ya sean stas unicelulares o
multicelulares (pluricelulares).
Funcional: Porque cumple una funcin especfica en los organismos, ya sea en forma
conjunta o individual.
Gentica: Porque las caractersticas o rasgos hereditarios que lleva cada organismo,
se debe al material gentico (ADN) que contiene cada clula.

2.3. Por su Nutricin:


* Auttrofas: Son aquellas que tienen la capacidad de sintetizar o producir sus
propios nutrientes, es decir, obtienen su energa a partir de molculas
inorgnicas. Ej.: plantas, algas, algunas bacterias.
* Hetertrofas: Aquellas que carecen de la capacidad de sintetizar sus propios
nutrientes, es decir, obtienen su energa a partir de molculas orgnicas. Ej.: la
mayora de bacterias, hongos, protozoarios, animales.
2.4. Por su complejidad:
* Procariotas: Su organizacin estructural es ms sencilla.
Carecen de envoltura nuclear, es decir, el material gentico est disperso en el
citoplasma.
Slo presentan ribosomas.
Ej.: Bacterias, algas cianofitas.
* Eucariotas: Su organizacin estructural es ms compleja. El material gentico
(ADN) est protegido por el ncleo. Presentan diversos tipos de organelas como:
ribosomas, cloroplastos, mitocondrias, etc. Ej.: clulas de hongos, clulas de
animales, clulas de las plantas, etc.

1.3. La teora celular:


Fue formulada aproximadamente por los aos 1838 1839 y tiene como autores a
dos bilogos importantes: Matas Schleiden y Teodor Schawnn, los cuales
observaron en el microscopio la presencia de clulas en tejido animal y vegetal. Esta
Teora seala lo siguiente:
- Cada organismo vivo est formado por una o ms clulas.
- Los organismos ms pequeos son clulas nicas y las clulas son las unidades
funcionales de los organismos multicelulares.
- Toda clula, proviene de otra preexistente. (Virchow, 1859).

3. ESTRUCTURA DE LA CLULA EUCATITICA


3.1. ENVOLTURA CELULAR:
- Es la parte ms externa de la clula.

2. CLASIFICACIN

23

Boletn de biologa

BIOLOGA
- En los vegetales, algas y hongos es la Pared Celular. La pared celular, es un
agregado supramolecular presente en clulas vegetales y estn formadas de
celulosa. Sus funciones son: dar forma y rigidez a la clula, permite el intercambio
de sustancias, impide el hinchamiento de las clulas vegetales.
- En las bacterias es el Glucoclix. Sus funciones son el reconocimiento celular y la
adherencia entre clulas (controla la proliferacin celular).

b) Organoides: rganos sin membrana.

Ribosomas, son organelas que no tienen membrana pero cuya funcin es la


fabricacin o sntesis de protenas, las cuales son esenciales para la clula.

Centrolo, permite la divisin celular formando el huso acromtico. Presente


en clulas animales.
c) Sistema de endomembranas:

Aparato de Golgi (Golgisoma), es una agrupacin de sacos membranosos y su


funcin es la secrecin celular de algunas molculas como lpidos, protenas,
glcidos, as como tambin la fabricacin de lisosomas, origina la membrana
celular, pared celular, glicoclix, etc.

Retculo Endoplasmtico (R.E), es un conjunto de canales membranosos y a su


vez puede ser de 2 tipos:

R.E. Liso: (REL), aquel en cuya superficie no existen ribosomas y su funcin


es la detoxificacin, as mismo, se encarga de producir, transportar y almacenar
lpidos, etc.

R.E. Rugoso: (RER), aquel en cuya superficie s existen ribosomas adheridos;


participa indirectamente en la fabricacin de protenas, luego las transporta y
almacena, etc.

3.2. MEMBRANA CELULAR:


- Es una capa muy delgada de las clulas que separa el medio interno del externo. Su
funcin es la permeabilidad selectiva, es decir, permite o selecciona la entrada y
salida de nutrientes y otras sustancias adems de la compartamentalizacin.
- Se caracteriza por ser lipoproteica, flexible, fina, limitante, conservante, dinmica
y asimtrica.
3.3. CITOPLASMA:
- Es una sustancia de consistencia viscosa y gelatinosa, constituyendo el medio
interno de la clula. Presenta sustancias alimenticias para el funcionamiento de la
clula como por ejemplo protenas, carbohidratos, grasas, sales minerales.
- Adems contiene organelas celulares (mitocondrias, lisosomas, cloroplastos) que
cumplen funciones vitales, asociaciones supramoleculares, citoesqueleto, etc.

3.4. NCLEO:
Es una estructura generalmente ovoide que se encuentra dentro de todas las
clulas eucariotas. Su funcin consiste en dirigir y controlar todas las funciones y
actividades que realiza la clula, por medio del ADN.

Carioteca, membrana que separa al ncleo del citoplasma.

Cromatina, es el material gentico (ADN) protegido por las histonas.

Cariolinfa, es el contenido del ncleo.

Nuclolo: Son agregados supramoleculares que tambin carecen de


membrana. Se localizan dentro del ncleo y se encargan de formar o sintetizar a
los ribosomas (sintetiza las subunidades mayor y menor).

a) Organelas: rganos membranosos.

Mitocondria, son organelas de doble membrana cuya funcin bsica es la


respiracin celular.

Cloroplastos, son organelas de doble membrana presentes slo en algunos


organismos como plantas y algas, encargndose fundamentalmente de la
fotosntesis.

Cromoplastos son organelas bimembranosas responsables del color de


ciertos frutos, hojas y otras estructuras vegetales como:
- Caroteno:
Anaranjado:
Ej.: Zanahoria
- Xantfila:
Amarillo:
Ej.: Zapallo
- Licopeno: Rojo:
Ej.: Tomate

Lisosomas, organelas con una membrana cuya funcin bsica es la digestin


celular.

Peroxisomas, se encargan de degradar el perxido de hidrgeno (agua


destilada).

Glioxisomas. Transforman lpidos en glcidos y est presente en las semillas.

Vacuolas, son organelas unimembranosas, se localizan en mayor abundancia


en clulas vegetales que en clulas animales. Su funcin es almacenar diversas
sustancias como: agua, sales, pigmentos, glcidos, vitaminas, etc.

PRCTICA DIRIGIDA N 6
I.

Escribe V o F segn corresponda:

1.- La clula es considerada la unidad anatmica porque cumple una funcin en un


organismo.
(
)
2.- La pared celular le da forma geomtrica tpica a la clula vegetal.
(
)
3.- Un leucocito es una clula microscpica.
(
)

24

Boletn de biologa

BIOLOGA
4.- Las bacterias son seres vivos procariticos, porque tienen carioteca.
(
)
5.- El alga unicelular verde-azul es un ser vivo procaritico auttrofo.
(
)
6.- Las clulas de acuerdo a su nutricin pueden ser procariotas y eucariotas. (
)
7.- Los hongos son organismos procariotas hetertrofos.
(
)
8.- Todas las bacterias son seres vivos auttrofos.
(
)
9.- El huevo de un ave es considerado una clula macroscpica porque mide
menos de 100.
(
)
10.- Todas las clulas que poseemos son auttrofas.
(
)

5)

II. Completa el siguiente cuadro:

7)

Estructura

CLULA ANIMAL

respiracin celular, mientras que los.................................. se encargan de la


digestin celular.
6)

1)

El............................ es un conjunto de canales membranosos y a su vez


puede ser de 2 tipos: el................, cuya funcin es la detoxificacin y el.............. el
cual posee gran cantidad de...................................... adheridos a su membrana.
El........................... es un agregado supramolecular que se localiza
generalmente en el.......................... de la clula y cuya funcin es.................. y

CLULA VEGETAL

controlar

Membrana celular
Pared celular
Material gentico
Ncleo
Nuclolo
Mitocondrias
Cloroplasto
Ribosomas
Retculo endoplasmtico
Aparato de Golgi
Lisosomas
Vacuolas
III.

Las........................................ son organelas que se encargan de la

todas

las

actividades

que

realiza

la

material ................... (ADN).

IVI. Escribe las partes de las siguientes clulas:

Completa:
Las clulas.................................. son aquellas que sintetizan su propio
alimento, mientras que las clulas.................................................. obtienen su energa
de compuestos..

2)

Las clulas................................... se caracterizan porque carecen de


membrana nuclear o....................................

3)

Las bacterias, de acuerdo a su nutricin pueden ser consideradas


clulas......................... y de acuerdo complejidad seran.......................................

4)

La.........................................

fue

formulada

por

los

cientficos........................... y en 1838 1839.

25

Boletn de biologa

misma.

Contiene

al

BIOLOGA
a)
b)
c)
d)
e)
f)
g)
h)
i)
j)
k)
l)

CLULA VEGETAL

Ribosomas
Vacuolas
Nucleolos
Mitocondria
Membrana Celular
Ncleo
R. E. R.
Lisosoma
R. E. L.
Pared Celular
Cloroplastos
Golgisoma

(
(
(
(
(
(
(
(
(
(
(
(

)
)
)
)
)
)
)
)
)
)
)
)

contiene al ADN
digestin celular
almacena agua, sales, vitaminas
sntesis de protenas
detoxificacin celular
lipoproteca
respiracin celular
celulsica
secrecin celular
forman a los ribosomas
ribosomas en su superficie
fotosntesis

VI. Subraya alternativa correcta:


1.- La clula es considerada la unidad anatmica o estructural porque:
a) Cumple una funcin especfica en un organismo.
b) Contiene al material gentico.
c) Forma parte de un ser vivo.
d) Se hereda de generacin en generacin.
e) N.A.
2.- Las clulas bacterianas son clulas de tipo:
a) eucariotas

b) macroscpicas

c) procariotas

d) estrelladas

e) a y b

3.- Tipo de clula que se caracteriza por obtener energa a partir de compuestos
orgnicos:
a) Procariotas b) hetertrofas
e) N.A.

c) Auttrofas

d) eucariotas

4.- Clula que carece de membrana nuclear y cuyo ADN est disperso en el
citoplasma:
a) Eucariota

b) fusiforme

c) auttrofa

d) procariota

5.- Las amebas son organismos:

CLULA ANIMALL

a) procariotas y hetertrofas.

V. Relaciona: ( pt. c/u)

26

b) Procariotas y auttrofos.

Boletn de biologa

e) b y d

BIOLOGA
c) Eucariotas y heteromorfos.

d) Eucariotas y hetertrofos.

e) N.A.

exterior de los rganos internos. Tambin, es el que


tapiza las cavidades del cuerpo y la parte interior del
tracto respiratorio, del tracto digestivo y los vasos
sanguneos.

6) El huevo de un ave es una clula que se caracteriza por ser:


a) microscpica hetertrofa eucariota
b) microscpica auttrofa eucariota
c) macroscpica auttrofa procariota
d) macroscpica hetertrofa procariota
e) macroscpica hetertrofa eucariota
III. HISTOLOGA

b)
a.1. Tejido epitelial de revestimiento simple: Este tipo de tejido tiene todas sus
clulas dispuestas en una sola hilera y puede ser: escamoso, cuboidal o columnar,
segn las formas que stas adopten.

a.2. Tejido epitelial de revestimiento estratificado: Este tejido, como su nombre lo


indica, tiene sus clulas dispuestas en varias capas. Este tejido por la forma de sus
clulas, tambin puede ser clasificado en escamoso, cuboidal o columnar.

Se llama tejido al conjunto de clulas que trabajan juntas para cumplir con una
actividad especializada, como por ejemplo, la epidermis de la piel que es el tejido que
cubre y da proteccin al cuerpo. Los tejidos del cuerpo humano se clasifican en:

c)

Tejido Epitelial Glandular: Este epitelio forma la porcin


secretora de las glndulas del cuerpo, que a su vez se
clasifica en epitelio de glndulas exocrinas y epitelio de
glndulas endocrinas, segn secreten sus productos
dentro de conductos o directamente en la sangre.

Epitelio Simple Escamoso


Epitelio Simple Columnar

Epitelio Simple Cuboidal

1. TEJIDO EPITELIAL.
El tejido epitelial cubre las superficies externas e internas de los rganos del cuerpo
humano.
Las principales funciones de este tejido son la proteccin y secrecin. De acuerdo a
estas funciones, el tejido epitelial puede ser de dos tipos:

a)

Epitelio Estratificado
Epitelio Glandular

Epitelio Columnar Ciliado

Tejido Epitelial de Revestimiento: El tejido forma toda


la cubierta exterior del cuerpo; as mismo, la cubierta

27

Boletn de biologa

BIOLOGA

PRCTICA DIRIGIDA N 02
I.- Escribe V si es verdadero o F si es falso. ( pt. c/u)
1. El tejido epitelial es totipotente.
)
2. Una caracterstica del tejido epitelial es su avascularidad.
)
3. El epitelio respiratorio se origina a partir del ectodermo.
(
)
4. En el t. epitelial las membranas contiguas estn unidas por complejos.
)
5. El endotelio de vasos sanguneos est formado por epitelio simple
plano.
(
)
6. La trquea no est formada por epitelio pseudoestratificado.
)
7. Las glndulas sudorparas son de tipo endocrinas.
)
8. El pncreas es una glndula mixta.
)
9. El tejido nervioso es un tejido totipotente.
)
10. Las clulas del tejido epitelial se reproducen constantemente.
(
)
11. El epitelio intestinal tiene funcin de absorcin.
(
)
12. En los testculos existen epitelio germinativo.
(
)
13. El epitelio queratinizado se localiza en la faringe y esfago.
)
14. El epitelio de transicin se localiza en vas urinarias.
)
15. La secrecin de las glndulas endocrinas se eliminan al medio externo.
(
)
16. Las glndulas exocrinas carecen de adenmero.
)

2)
(
3)

4)

5)

(
6)

(
(

7)

8)

III.- Relaciona : ( pt. c/u)


a) Epitelio intestinal
exocrinas
b) Hipfisis
absorcin
c) Corteza ovrica
d) Lgrimas
(
)
e) Testculos
(
)
f) Neuroepitelio
reproductora
g) Epitelio pseudo estratif.
queratinizado
h) Epidermis
(
)

II.- Completa: ( pt. c/u)


1)

descansan sobre
una.............................................................................
El tejido epitelial se deriva de 3 capas embrionarias que
son.....................................,.................................
y...........................................
El epitelio..................................................... se caracteriza
porque aparenta tener varias capas celulares debido a la
localizacin de sus ncleos y posee abundantes
clulas..........................................
Las glndulas................................... eliminan secreciones que
van a la superficie o a un rgano hueco. Mientras que las
glndulas...................................... elaboran secreciones
hormonas que
eliminan a la sangre, dichas secreciones reciben el nombre
de........................................
En el epitelio glandular las clulas epiteliales
son. ....................................., es decir eliminan sustancias al
medio........................................ o...................................
Las glndulas exocrinas presentan una porcin secretora
llamada....................................... y el tubo excretor. Un ejemplo
de dichas lo constituyen las.................................................. .
Un ejemplo de glndula exocrina es............................................
de glndula endocrina es................................................... y de
glndula mixta es..............................................
Una funcin del tejido epitelial es la difusin y un ejemplo
de ello lo constituyen los........................................................... Por
esto, el epitelio de la corteza ovrica cumple una
funcin...............................................

Una caracterstica del tejido epitelial es que posee


poca............................................................ y adems sus clulas

28

Glndulas

Funcin de

(
) Glndulas mixtas
Funcin sensorial
Glndulas endocrinas
(
) Funcin
(

epitelio

Funcin lubricante

Boletn de biologa

BIOLOGA
i)
j)

Mucosas
(
)
Epitelio de transicin
Tejido Conectivo
(
)
Funcin de
difusin
k) Epitelio Polimorfo
(
) Clulas
caliciformes
l) Alvolos Pulmonares
(
) Tejido
totipotente
IV.- Subraya la respuesta correcta: ( pt. c/u)
1).- Son tejidos totipotenciales:
a) muscular
b) epitelial
c) b y c
d) nervioso
e) a y c

a) Glndulas endocrinas
d) Glndulas exocrinas

4).- El endotelio de los vasos sanguneos es un ejemplo de epitelio.


a) seudoestratificado
b) cbico
d) cilndrico
e) estratificado

c) Adenmero

9).- Es un ejemplo de glndula mixta:


a) sudorparas b) hipfisis
c) pncreas

d) hgado

e) c y d

10).- Es un ejemplo de glndulas endocrinas:


a) salivales
b) tiroides
c) hipfisis

d) b y c

e) T.A.

11).- Elaboran secreciones que eliminan al medio interno y dichas secreciones se


llaman hormonas.
a) Glndulas endocrinas b) Glndulas exocrinas c) Glndulas mixtas
d) a y b
e) b y c

2).- No es una caracterstica del tejido epitelial.


a) sus clulas son poco diferenciadas.
b) posee escasa sustancia intercelular
c) es vascular
d) se apoya sobre una membrana basal
e) a y d
3).- No es una funcin del tejido epitelial:
a) proteccin
b) secrecin
c) reproduccin d) transporte

b) Glndulas mixtas
e) N.A.

12).- Epitelio que presenta clulas caliciformes:


a) Pseudoestratificado
b) Monoestratificado
d) Glndular
e) N.A.
13).- Secrecin eliminada por las glndulas endocrinas:

e) N.A.

a) Leche

c) plano

b) Sudor

c) Hormona

c) Compuesto

d) Adenmero

e) a y b

14).- A nivel de la retina el epitelio cumple una funcin de tipo:

5).- A nivel de las vas respiratorias (fosas nasales, trquea y bronquios) podemos
encontrar epitelio:
a) pseudoestratificado
b) queratinizado
c) de transicin
d) glandular
e) N.A.

a) Glndula

b) Germinativa

c) Difusin

d) Sensorial

e) N.A.

V.- Desarrolla en tu cuaderno las siguientes preguntas:


1. Elabora un esquema sobre la clasificacin del tejido epitelial, indicando ejemplo,
funcin y dibujos. (6 pts : c/u)
2. Elabora un esquema con toda la clasificacin de los tejidos y sus ejemplos. (4pts:
c/u)
3. Explica las caractersticas del tejido epitelial. (4 Pts : 1 c/u)
4. VOCABULARIO (1/2 pto. c/u): epitelio, glndula, revestimiento, queratina,
transicin, proliferacin, totipotente, avascular, secrecin, geomtrico.

6).- Epitelio que cambia de forma segn el grado de dilatacin del rgano que reviste:
a) queratinizado
b) simple cbico
c) de transicin
d) pseudoestratificado
e) glandular
7).- Sobre los epitelios glandulares, slo una afirmacin es correcta:
a) Las clulas epiteliales primero se invaginan y luego proliferan hasta el tejido
conectivo.
b) Las secreciones se eliminan slo en el exterior.
c) Es avascular
d) El producto de secrecin liberado puede constituir una hormona.
e) Todas son correctas

2. TEJIDO CONJUNTIVO.
Es el tejido abundante del cuerpo, se le llama tambin conectivo porque su principal
funcin es la de conectar la epidermis con los msculos, stos entre s y con los
huesos. Este tejido tiene bastante irrigacin sangunea y se caracteriza,
fundamentalmente, porque sus clulas estn separadas por un amplio espacio
intercelular, que puede ser lquido, como en la sangre y la dermis o, slida, como en
los huesos. Al tejido conjuntivo se ha logrado clasificar en:

8).- Elaboran secreciones a la superficie o a un rgano hueco como el estmago:

29

Boletn de biologa

BIOLOGA

a)
Tejido Conectivo Fibroso: A este tejido se le llama tejido conjuntivo propio,
porque est formado por clulas redondeadas o ramificadas, que se encuentran
esparcidas en espacios intercelulares lquidos.
Las clulas ramificadas son las clulas tpicas y se llaman fibroblastos, y los espacios
intercelulares est ocupados por numerosas fibrillas llamadas fibras colgenas y
fibras elsticas.

c)
Tejido seo: A este tipo de tejido se le llama comnmente hueso. Es un
tejido conjuntivo que contiene una gran cantidad de sustancia intercelular y, que al
mismo tiempo, sirve para cubrir a las clulas que estn muy separadas entre s. La
cavidad medular, los poros y agujeros, adems de permitir el ingreso de los vasos
sanguneos, que llevan los nutrientes, los nervios y los vasos linfticos, tambin sirven
para aligerar el peso de los huesos.
En la parte compacta, los huesos organizan su masa en estructuras llamadas Sistemas
de Havers, que son conjuntos de laminillas concntricas, donde hay pequeos
espacios llamados lagunas, en los cuales estn alojadas las clulas seas denominadas
osteocitos; la parte central del sistema tiene un conducto, que recibe el nombre de
Canal de Havers.

b)
Tejido Cartilaginoso: Este tejido est formado por una densa red de fibras
elsticas y colgenas, los cartlagos, que se encuentran en una matriz, es decir, la
sustancia intercelular, de consistencia gelatinosa. Este tejido permite el movimiento
de las articulaciones, se le encuentra tambin entre las vrtebras, en el odo externo,
etc.

Vistas microscpicas de la estructura de un hueso.


A. Sistema de Havers.

d) Tejido Adiposo:
Es una clase de tejido conjuntivo, que se caracteriza porque sus clulas llamadas
adipocitos, se han especializado en almacenar grasa. En las clulas adiposas, el ncleo
y el citoplasma han sido desplazados hacia los bordes de la clula por una gran gota
central de grasa.
El tejido adiposo es un tejido de reserva y de proteccin, porque reduce la prdida
de calor a travs de la piel y, por eso, se sita debajo de ella, en la capa subcutnea.

30

Boletn de biologa

BIOLOGA
e) Tejido Vascular o Sanguneo:
La sangre es un lquido de color rojo, que circula por los vasos sanguneos de nuestro
cuerpo. Es viscosa, o sea ms densa que el agua. La sangre arterial tiene un color rojo
brillante y es la que sale del corazn. La sangre venosa, por el contrario, es la que
regresa al corazn y es de color ms oscuro.
Si observamos la sangre al microscopio, veremos que est formada por dos partes
fundamentales: el plasma y los elementos figurados.
El plasma, es la porcin lquida de la sangre, que est compuesta por un 92% de agua
y el 8% restante de protenas, enzimas, hormonas, gases y electrlitos.
Los elementos figurados de la sangre estn integrados por los eritrocitos o glbulos
rojos, los leucocitos o glbulos blancos y los trombocitos o plaquetas.
Los eritrocitos o glbulos rojos son cuerpos sin ncleo, que contiene hemoglobina y
que transportan el oxgeno y el dixido de carbono.
Los leucocitos o glbulos blancos son clulas que poseen ncleo. As mismo existen
dos tipos de leucocitos: los granulados, que pueden ser neutrfilos, eosinfilos,
basfilos y los agranulados, que pueden ser linfocitos y monocitos. Todos ellos se
especializan en la defensa del cuerpo.
Los trombocitos o plaquetas son estructuras en forma de disco sin ncleo y se
encargan de la coagulacin sangunea.

I-

Responde V o F segn corresponda: ( pt.


c/u)
1)

tejido conectivo. (

El tejido sanguneo est formado por la sangre, cuyos elementos principales son: los
glbulos blancos, los glbulos rojos, las plaquetas, la fibrina y el plasma sanguneo.

II-

PRCTICA DIRIGIDA N 03

31

La presencia de oxgeno hace que la sangre venosa


tenga un color rojo brillante.
(
)
2) Un volumen bajo de sangre recibe el nombre de
hipervolemia.
(
)
3) El pH sanguneo flucta entre 2,3 y 5,6 siendo
ligeramente cido.
(
)
4) La porcin lquida de la sangre est representada
por el plasma. (
)
5) La sangre cumple una funcin hemostsica porque
impide la diseminacin de microorganismos.
(
)
6) Los glbulos blancos son llamados tambin
eritrocitos.
(
)
7) Las plaquetas no son clulas, son fragmentos de
citoplasma que proceden del megacariocito.
(
)
8) Los linfocitos B intervienen en la inmunidad
celular.
(
)
9) El tejido conectivo posee abundante sustancia
intercelular.
(
)
10) La clula cebada presenta citoplasma granuloso. (
)
11) El fibroblasto es una clula que cumple funcin de
sntesis de grasa.
(
)
12) La clula Sten Cell, es una clula generatriz porque
forma a las otras clulas del
)
13) Las fibras colgenas son muy delgadas y
resistentes.
(
)
14) El adipocito es una clula macrfaga.
(
)
15) El tejido cartilaginoso es un tejido conectivo
especial.
(
)
16) La sustancia amorfa es transparente y viscosa.
(
)
Completa : ( pt. c/u)

Boletn de biologa

BIOLOGA
1)

2)

3)

4)

5)

6)

7)

8)

IIIa)
b)
c)
d)
e)
f)

Sten Cell
Fibroblasto
Adiposito
Histiocito
Plasmocito
Mastocito

(
(
(
(
(
(

El color rojo brillante de la sangre venosa se debe


a la presencia de .................. y el color rojo oscuro
de la sangre arterial, a la presencia de ......................
Los ................................. son corpsculos anucleados
que no se reproducen y su cantidad puede variar en
cuanto al sexo, habiendo mayor cantidad en
............................. que
en ....................................
Los ....................................... son clulas altamente
especializadas, con ncleo, organelas y cuya
funcin es la defensa del organismo, adems, su
disminucin recibe el nombre
de ...........................................
................................................... son fragmentos
citoplasmticos que proceden de una clula mayor
llamada ........................................................, se originan
en la ..................... y cumplen a funcin
de .................................
La .................................................. es abundante en el
tejido conectivo, el cual posee vasos sanguneos,
linfticos y ...................................................................
Las fibras de tipo ............................................................
son ramificadas, delgadas y flexibles y se localizan
en los .................................................................... .
Las fibras de tipo ....................................... son
abundantes, gruesas y resistentes a la traccin y
se localizan en ................................
y .................................................. .
El macrfago llamado
tambin ................................................., elimina
bacterias, mientras que el .............................................
interviene en procesos alrgicos.

Relaciona:
c/u)
) Sintetiza grasa
) Eliminacin de bacterias
) Proteccin humoral
) Clula madre
) Fabrica sust. intercelular
) Linfocitos

g)
h)

Leucocitos
Eritrocitos

(
(

) Liberacin de histamina
) Transporta oxgeno

IV-

Relaciona:
c/u)

( pt.

1. No es una caracterstica del tejido sanguneo:


a) Color rojo oscuro debido a la presencia de CO2. b) Sabor salado.
c) Volumen: del peso corporal.
d) Tienen un pH ligero alcalino.
e) N.A.

a) Policitemia
d) Etapa mieloide

2.

La formacin de la sangre recibe el nombre de:


b) Volemia
c) Hematopoyesis
e) Hemocaterresis

3.

Etapa en la cual, la formacin de la sangre ocurre


en la Mdula sea roja a partir del 5to mes de
vida:
b) Etapa Meptica
c) Etapa Medular
e) c y d

a) Etapa Mesoblstica
d) Etapa Mieloide
4.

a) Defensiva

Funcin del Tejido sanguneo mediante la cual, se


impide la prdida de sangre a travs de los
factores de la coagulacin:
b) Hemosttica c) Endocrina
d) Excretora
e) Nutritiva

a) protenas

5. No es un componente orgnico del plasma:


b) lpidos
c) carbohidratos d) electrolitos e) N.A.

a) trombocitos

a) g. rojos

32

Corpsculos anucleados que no se reproducen y


tienen forma de un disco bicncavo:
c) g. blancos
d) plaquetas
e) glbulos rojos

7.

Clulas especializadas que poseen ncleo y cuyo


aumento se llama Policitemia:
c) plaquetas
d) b y c
e) N.A.

8.

Clulas de forma esfrica y tamao variable se


originan en la MOR y que se clasifican en:
granulocitos y agranulocitos:
b) plaquetas
c) trombocitos

b) leucocitos

( pt.
a) hemates

6.

b) leucocitos

Boletn de biologa

BIOLOGA
d) leucocitos
9.
a) basfilos
d) linfocitos

e) b y c

2)

Presentan ncleo irregular y sintetizan histamina y


heparina, que desencadenan cuadros alrgicos:
b) eosinfilos
c) monolitos
e) eritrocitos

3)
4)

Cules son las caractersticas del tejido


Sanguneo? (3 pts : 1/3c/u)
Elabora un mapa conceptual del tejido conjuntivo,
incluyendo dibujos y funcin. (4Pt:1/4 c/u)
Menciona las caractersticas del tejido conectivo.
(4 pts : c/u)

10. No es una caracterstica de las plaquetas:


a) Son fragmentos citoplasmticos.
b) Tienen forma de disco alargado
c) Su aumento se llama trombocitopenia
d) Se originan en la MOR
e) Tiempo de vida : 7-12 das.

a) linfocitos
d) eosinfilos

11. Son leucocitos grandes, con ncleo arrionado, y


tienen la capacidad de realizar fagocitosis:
b) monolitos
c) trombocitos
e) basfilos

a) linfocotosT
d) eosinfilos

12. Son leucocitos cuyo ncleo es grande y redondo y


que intervienen en la inmunidad celular:
b) linfocitos B
c) monocitos
e) N.A.

a) Adiposito
d) Fibrosito

13. Clula embrionaria capaz de formar de otras


clulas del T. Conectivo.
b) Macrfago
c) Sten Cell
e) N.A.

a) Leucocito
d) Plasmocito

14. No tiene ncleo y transporta oxgeno en la sangre:


b) Eritrocito
c) Sten cell
e) a y b

a) Macrfago
d) Plasmocito

15. Clula que almacena grasa.


b) Adipocito
c) Leucocito
e) N.A.

V-

3. TEJIDO MUSCULAR.
Este tejido est formado por clulas, cuya funcin bsica es la contraccin. Debido a
esta funcin los msculos son capaces de producir el movimiento junto a los huesos, la
de mantener la postura corporal, y la de producir calor debido a las contracciones.
a) Tejido Muscular Esqueltico: Se llama as porque est insertado a los huesos. Es
un msculo estriado, porque tiene estructuras en forma de banda, que las podemos
ver con el microscopio, y es un msculo voluntario, porque responde a la voluntad para
contraerse.
b) Tejido Muscular Liso: Esta localizado en las paredes de las estructuras interiores
huecas, como los vasos sanguneos, el estmago y los intestinos; no presenta estras y
no responde al control consciente del individuo, por lo que es denominado msculo
involuntario.
c) Tejido Muscular Cardaco: Es el que forma parte de las paredes del corazn y por
eso tiene ese nombre. Es un msculo estriado, porque presenta bandas o estras y es
un msculo involuntario, porque no responde a nuestra voluntad para sus movimientos.

Desarrolla en tu cuaderno las siguientes


preguntas::
1) Elabora un mapa conceptual sobre la clasificacin
de los leucocitos. Incluye dibujos y funcin. (4Pts:
1/3 c/u)

33

Boletn de biologa

BIOLOGA

Las principales partes de una neurona son: el cuerpo celular; las dendritas y el axn.
Las clases de tejido muscular A. Tejido Muscular Cardiaco. B. Tejido Muscular Liso. C. Tejido
Muscular Esqueltico.
4. TEJIDO NERVIOSO.
El tejido nervioso est formado por clulas nerviosas, cuya funcin es enviar los
impulsos nerviosos a todo el cuerpo. Las funciones bsicas que cumple el sistema
nervioso, estn relacionadas con las estimulaciones del movimiento y as mismo, ayuda
al sistema endocrino a mantener la homestasis del organismo y permite la relacin
del individuo con el ambiente.
El tejido nervioso est compuesto de dos clases de clulas: las neuronas y la
neurogla.
A) Las Neuronas: Son clulas nerviosas responsables de la conduccin de los
impulsos de una parte del cuerpo a otra del mismo organismo. Las neuronas tienen
tres partes bsicas: el cuerpo celular, las dendritas y el axn.
El cuerpo celular, contiene un ncleo bien definido, que posee nucleolos. Tiene
adems, un citoplasma, dentro del cual se encuentran las mitocondrias, el aparato de
Golgi y el retculo endoplasmtico.
Las dendritas, son prolongaciones cortas y muy ramificadas del citoplasma del cuerpo
celular, su funcin es captar el estmulo y transmitirlo con gran rapidez.
El axn, es la fibra nerviosa o la prolongacin del cuerpo celular que conduce los
impulsos nerviosos hacia otra neurona o hacia otros rganos del cuerpo. El axn se
encuentra rodeado por una cubierta blanca segmentada, que se llama vaina de mielina.
La vaina de mielina est compuesta por clulas aplanadas llamadas clulas de
Schwann, que se localizan a lo largo de la fibra nerviosa.

La neurona y la neuroglia.
PRCTICA DIRIGIDA N 04
I.

B) La Neuroglia: Es el conjunto de clulas, cuya funcin principal es servir de


soporte a las neuronas. Tambin, la neuroglia realiza la fagocitosis adems de unir las
neuronas con los vasos sanguneos.

34

Escribe V o F segn corresponda : ( pt. c/u)


1) El tejido seo da origen a los elementos formes de la
sangre. ( )
2) El tejido muscular posee poca sustancia intercelular.
(
)
3) Las unidades anatmicas del tejido seo esponjoso son los
osteones.
( )
4) La dureza de un hueso depende de los componentes de la
matriz sea.
( )
5) La laguna sea recibe el nombre de osteoclasto o tambin
osteoplasto.
( )
6) En las vsceras encontramos tejido muscular esqueltico. (
)
7) La contraccin del miocardio es voluntario.
( )
8) El tejido conectivo posee abundante sustancia intercelular.
( )
9) El tejido adiposo es una variedad de tejido conectivo.
(
)
10) El macrfago es llamado tambin clula cebada.
( )
11) Los eritrocitos son clulas con ncleo.
( )

Boletn de biologa

BIOLOGA
12) Las fibras colgenas son muy delgadas y resistentes.
(
)
13) La clula cebada, presenta citoplasma granuloso. ( )
14) El fibroblasto es una clula que cumple funcin de sntesis
de grasa.
( )
15) La clula Sten Cell, es una clula generatriz porque forma
las otras clulas
del T. conectivo.
( )
II.

III.

e)

Trabculas.
(
) Componente orgnico del
hueso.
f) Fibras colgenas. (
) Fosfato de calcio.
g) Osteocele.
(
) Unidad anatmica del T.O.C
h) Osteoclasto.
(
) Laguna sea.
i) Adipocito.
(
) Glbulo blanco.
j) Macrfago.
(
) Clula madre.
k) Fibroblasto.
(
) Glbulo rojo.
l) Sten Cell. (
) Almacenamiento de grasa.
m) Plasmocito.
(
) Fagocitosis.
n) Mastocito.
(
) Clula plasmtica.
o) Leucocito.
(
) Clula cebada.
p) Eritrocito.
(
) Sntesis de la sustancia
intercelular

Completa : ( pt. c/u)


1) Los................................................. son clulas jvenes que
sintetizan la matriz sea, llamada
tambin.....................................................
2) Los............................................................ son clulas
multinucleadas que se encargan de la reabsorcin del hueso.
Mientras que los............................... son las clulas
representativas del tejido seo.
3) En el tejido muscular, se observan las miofibrillas, que son
filamentos alargados compuestos por 2 tipos principales de
protenas que son: .................................... y...................................
4) El tejido muscular almacena glucosa bajo la forma
de..................................., sta es una fusin, pero a la vez se
caracteriza porque sus clulas llamadas miocitos carecen
de la capacidad de.........................................
5) La.................................................. es abundante en el tejido
conectivo, el cual posee vasos sanguneos, linfticos
y...................................... .
6) Las fibras de tipo............................................ son ramificadas,
delgadas y flexibles y se localizan en
los.................................................. .
7) Las fibras de tipo.............................. son abundantes, gruesas
y resistentes a la traccin y tensin y se localizan
en.................................... y........................................

Relaciona :
a)
b)
c)
d)

IV.

Subraya la alternativa correcta : ( pt. c/u)

1) No es una caracterstica del tejido seo:


a) Es avascular.
b) Sustancia intercelular se llama matriz sea.
c) Se alimenta por difusin.
d) a y b
e) N.A
2) No es una funcin del tejido seo:
a) Soporte

b) Rigidez

c) Locomocin

d) Reserva de sales

3) Clula joven que sintetiza a la matriz sea:


a) Osteocito

b) Osteoblasto c) Osteoclasto

d) Osteoplasto

e) N.A.

4) Clula polinuclaer que contiene fosfatasa cida :


a) Osteoblasto
d) b y c

( pt. c/u)
Sist. de Havers. (
) Fosfatasa cida.
Hidroxiapatita.
(
) Unidad anatmica del T.O.E.
Osteoblasto.
(
) Clula madura.
Osteocito.
(
) forma la matriz sea.

b) Ostecito
e) Osteoclasto

c) Osteocele

5).- Clula madura y representativa del tejido seo :


a) Osteoblasto
d) Osteocito

b) Osteoplasto
e) N.A.

c) Osteoclasto

6).- Clula del tejido seo que elabora la enzima fosfatasa alcalina .

35

Boletn de biologa

e) N.A.

BIOLOGA

a) Osteocito
d) Osteoplasto

b) Osteoclasto
e) N.A.

c) Contraccin rpida.
e) b y c

c) Osteocele

14).- Tejido que se caracteriza porque su contraccin es voluntaria y rpida:

7).- No es una caracterstica de la matriz sea :

a) T.M. cardiaco
d) T.A.

a) Es elaborada por el osteoblasto.


b) Posee compuestos orgnicos e inorgnicos.
c) El componente inorgnico lo constituyen las fibras colgenas y polisacridos.
d) b y c
e) a y b

b) Canalculo seo
e) N.A.

a) T.M. esqueltico.
d) T.M. estriado

c) Ostiones

b) T.O.C

c) Canalculo seo

d) T.O.E.

a) T.M. liso
d) Miocardio

e) N.A.

a) T.M. cardiaco.
d) T.M. esqueltico

a) La presencia de fibras colgenas.


b) La presencia de tejido seo esponjoso.
c) La acumulacin de osteoclastos.
d) La presencia de cristales de hidroxiapatita.
e) a y d

c) T.M. liso.

b) T.M esqueltico.
e) N.A.

c) T.M. estriado

b) Miocardio
e) a y b

c) T.M. Liso

18).- Posee una contraccin de tipo rpida , voluntaria, rtmica y no se fatiga


rpidamente:
a) T.M cardiaco
d) T. Estriado

11).- No es una caracterstica del tejido muscular:


b) Sus clulas son fusiformes.
d) Es vascularizado.

a) T.M Liso
b) T.M. cardiaco.
d) a y b
e) N.A.
13).- No es una caracterstica del tejido muscular liso:

b) T.M. liso
e) N.A.

c) T.M. esqueltico

V.
Desarrolla en tu cuaderno las siguientes preguntas:
1) Dibuja y seala qu tipos de tejidos encontramos en los siguientes rganos y
partes del cuerpo: Piel, intestino, vasos sanguneos, vejiga, vagina. (6 pts: 1/3 c/u)
2) Elabora un mapa conceptual acerca del tejido muscular y su clasificacin.(4pts:1/3
c/u)
3) Qu son las neuronas, cules son sus partes y que funcin cumplen en el
organismo? (5 pts : 1 c/u)
4).- Vocabulario: (1/2 pto c/u) Escribe el significado de los siguientes trminos:
Coagulacin electrolito estras plasma osteocito ncleo excitabilidad
contraccin ovoide monolito linfocito.
. HISTOLOGA VEGETAL : (Tejidos vegetales)

12).- Es un tejido cuya contraccin es involuntaria.

a) Clulas fusiformes.

b) T.M. cardiaco.
e) b y c

17).- Tejido muscular que se caracteriza por formar la musculatura visceral:

10).- La rigidez y dureza de los huesos dependen de:

a) Es el ms abundante del cuerpo.


c) Poseen abundante sustancia intercelular.
e) N.A.

c) T.M. liso

16).- Tipo de tejido muscular cuyas clulas pueden presentar 1 2 ncleos y cuya
contraccin es involuntaria y rpida:

9).- Lugar en donde se localiza la MOR.:


a) Osteocele

b) T.M. esqueltico.
e) N.A.

15).- Tipo de tejido muscular cuyas clulas poseen varios ncleos y son cilndricos:

8).- Unidad anatmica fundamental del tejido seo esponjoso:


a) Osteoceles
d) Trabculas seas

d) Se localiza en vas urinarias.

c) T.M. esqueltico.

b) Clulas mononucleadas.

36

Boletn de biologa

BIOLOGA
Es el conjunto de clulas que presentan similar estructura y realizan funciones
complementarias. A continuacin presentamos un resumen de los principales tejidos
vegetales:

TEJIDOS
MERISTEMTICOS :
(Tejidos embrionarios)

a) PRIMARIO
Permite el crecimiento en longitud de la planta.
b) SECUNDARIO
Permite el crecimiento en grosor de la planta.
- EPIDERMIS
Evita el desecamiento de la
planta.
a) PROTECTORES
- PERIDERMIS
Brinda mayor rigidez a las plantas
de tallos leosos.
- COLNQUIMA
Brinda flexibilidad a la planta.
b) MECNICOS O DE
SOPORTE

TEJIDOS ADULTOS :

- ESCLERNQUIMA
Brinda rigidez a las plantas de
tallos herbceos.
- XILEMA
Transporta la savia bruta.

c) VASCULARES
- FLOEMA
Transporta la savia elaborada.
- CLOROFILIANO
Realiza la fotosntesis.
d) PARENQUIMTICOS
- RESERVA
Amilceo: Almacena almidn.

37

Boletn de biologa