Scribd Logo
Cargar

¡Te damos la bienvenida a Scribd!

  • BIO Study Guide CH 3

    Cargado por

    Hoang Anh
    1 vistas1 página
    This study guide covers key concepts about nucleic acids including their structure, monomers, linkage between nucleotides, how they differ from proteins, the differences between DNA and RNA, how DNA strands are held together, the central dogma of molecular biology involving replication, transcription and translation, and provides a DNA sequence to transcribe to RNA. It asks questions about the monomers that make up nucleic acids, the functional groups on ribose sugars, how individual nucleotides are linked, the roles of nucleotides and nucleic acids, the templates and products of replication, transcription and translation, and how these processes differ between prokaryotes and eukaryotes.

    Descripción original:

    Bio2108 study guide

    Título original

    BIO Study Guide Ch 3

    Derechos de autor

    © © All Rights Reserved

    Formatos disponibles

    DOC, PDF, TXT o lea en línea desde Scribd

    ¿Le pareció útil este documento?

    ¿Este contenido es inapropiado?

    Denunciar este documento
    This study guide covers key concepts about nucleic acids including their structure, monomers, linkage between nucleotides, how they differ from proteins, the differences between DNA and RNA, how DNA strands are held together, the central dogma of molecular biology involving replication, transcription and translation, and provides a DNA sequence to transcribe to RNA. It asks questions about the monomers that make up nucleic acids, the functional groups on ribose sugars, how individual nucleotides are linked, the roles of nucleotides and nucleic acids, the templates and products of replication, transcription and translation, and how these processes differ between prokaryotes and eukaryotes.

    Copyright:

    © All Rights Reserved
    Descargue como DOC, PDF, TXT o lea en línea desde Scribd
    Marcar por contenido inapropiado
    1 vistas1 página

    BIO Study Guide CH 3

    Cargado por

    Hoang Anh
    This study guide covers key concepts about nucleic acids including their structure, monomers, linkage between nucleotides, how they differ from proteins, the differences between DNA and RNA, how DNA strands are held together, the central dogma of molecular biology involving replication, transcription and translation, and provides a DNA sequence to transcribe to RNA. It asks questions about the monomers that make up nucleic acids, the functional groups on ribose sugars, how individual nucleotides are linked, the roles of nucleotides and nucleic acids, the templates and products of replication, transcription and translation, and how these processes differ between prokaryotes and eukaryotes.

    Copyright:

    © All Rights Reserved
    Descargue como DOC, PDF, TXT o lea en línea desde Scribd
    Marcar por contenido inapropiado
    de 1

    Study guide Chapter 3

    How are nucleic acids similar to and different from proteins in terms of structure and
    function?
    What do the individual monomers (nucleotides) of nucleic acids look like?
    What functional groups attach to the 1, 2, 3, and 5 carbons of the ribose sugar in a
    nucleotide?
    How is RNA different from DNA in structure, function, and stability?
    How are individual nucleotides linked together in a nucleic acid? Why is it important to
    use nucleotide triphosphates as the monomers?
    What holds the two strands of a double-stranded DNA molecule together?
    What functions are served by nucleotides and nucleic acids in the cell?
    What is the Central Dogma of molecular biology?
    What is the template (starting material to be copied or read) and what is the product for
    replication, transcription, and translation? What are the building blocks used to make the
    product (the monomers linked together to make the final polymer)?
    How are transcription and translation different in prokaryotes and eukaryotes?
    What would be the RNA transcript of this DNA sequence:
    5 GGATGCCTAAGTTTTAGGCCATGTAC 3

    También podría gustarte