ACTA AGRONOMICA SINICA

Volume 35, Issue 10, October 2009

Online English edition of the Chinese language journal
Cite this article as: Acta Agron Sin, 2009, 35(10): 18221830.

RESEARCH PAPER

Cloning and Expression Profile of Gibberellin Insensitive

Dwarf GID1 Homologous Genes from Cotton
DONG Jing, YIN Meng-Hui, YANG Fan, ZHAO Juan, QIN Shan, HOU Lei, LUO Ming, PEI Yan, and
XIAO Yue-Hua*
Key Laboratory of Biotechnology and Crop Quality Improvement, Ministry of Agriculture/ Biotechnology Research Center, Southwest
University, Chongqing 400716, China

Abstract: To advance the understanding of gibberellins (GA) functions in cotton (Gossypium hisutum L.) development, especially fiber
development, 6 cotton GID1 homologous genes, GhGID1-1 to GhGID1-6 (GenBank accession numbers FJ790125 to FJ790130), were
cloned by searching expressed sequence tag (EST) sequences, extending the flanking sequences by Y-shaped adaptor dependent extension
(YADE) method, and amplifying the full-length cDNA by 3 rapid amplification of cDNA ends (RACE). Multiple sequence alignment
indicated that the deduced GhGID1-1 to GhGID1-6 proteins shared high sequence identity with GID1s from other species and contained
multiple binding sites with GA and DELLA protein, as well as HGG and GXSXG domains conserved in hormone-sensitive lipase (HSL)
family. Three amino acid residuals (G169, G196, and R251) related to rice (Oryza sativa L.) GID1 were also conserved in cotton GID1s. In
the phylogenetic tree of GhGID1s and GID1 proteins with known functions, GhGID1-1 to GhGID1-6 were clustered together with 3
Arabidopsis GID1 proteins, and distantly related to GID1s from rice and Selaginella moellendorffii. According to the results by
quantitative reverse transcription polymerase chain reaction (RT-PCR), the transcripts of GhGID1-1 to GhGID1-6 were detected in roots,
hypocotyls, leaves, petals, anthers, ovules, and fibers. GhGID1-1 and GhGID1-2 were expressed mainly in floral organs, and GhGID1-4
was expressed preferentially in fiber and root. Exogenous GA in medium resulted in alteration of gene expression level in the ovules
cultivated in vitro, and the expression of GhGID1-1 and GhGID1-2 was obviously inhibited by GA. These results suggested that the 6
GhGID1 homologous genes might encode biologically functional GID1 homologues involved in GA signaling in cotton. GhGID1-1 was
predominantly expressed in ovules; its expression level reached the climax at 10 d post anthesis (DPA) and maintained the high level at
14 DPA and 18 DPA. In fibers, GhGID1-4 was the main GID1 homologue expressed, and its highest-level expression occurred at 6 DPA
and declined to a very low level at 14 DPA and 18 DPA. This result strongly suggested that these are relatively independent GA signaling
systems in ovules and attached fibers.
Keywords: GID1; cotton; fiber development; expression specificity

Gibberellins (GA) represent an important group of

phytohormones and growth regulators, which are involved in
regulation of various developmental processes, such as seed
germination, root and stem growth, differentiation of floral
bud, and the development of fruit and seed [1, 2]. GID1,
encoding a soluble GA receptor, was firstly cloned from a
GA-insensitive dwarf mutant of rice (Oryza sativa L.) [3].
GID1 protein can bind specifically to bioactive GAs, and
further form a complex with a GA negative regulator DELLA
protein. By mediating the degradation of DELLA proteins or

suppressing their activities, GID1 may promote de-repression

of the repression of GA response system and activate GA
responsive genes [37]. As an important component, GID1
protein has recently become the research focus in the GA
signaling pathway. Furthermore, transgenic studies have
indicated that up-regulation of GID1 gene can increase GA
sensitivity and confer GA-overproduction phenotypes to the
transgenic plants [3, 6, 7], suggesting that GID1 gene may be
employed as the target gene to manipulate GA-related
physiological processes through biotechnological method.

Received: 3 March 2009; Accepted: 25 June 2009.

* Corresponding author. E-mail: xiaoyuehua@swu.edu.cn
Copyright 2009, Crop Science Society of China and Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. Published by Elsevier BV. All rights reserved.
Chinese edition available online at http://www.chinacrops.org/zwxb/
DOI: 10.1016/S1875-2780(08)60110-8

DONG Jing et al. / Acta Agronomica Sinica, 2009, 35(10): 18221830

Cotton (Gossypium hisutum L.) fibers are extremelyelongated single-celled fibers originating from the outermost
epidermis of ovule, and the mature fiber is composed of over
95% cellulose. The unique cell structure and chemical
composition make cotton fiber to an excellent model system
for studying certain physiological processes including cell
elongation and carbon partitioning [8]. Previous studies have
demonstrated that GA plays an important role in regulating
the growth and development of cotton fiber [915]. Addition of
GA3 in the medium might promote fiber initiation and
elongation on in vitro cultured ovules [913], whereas GA3
applied to floral bud may increase fiber number per ovule [14].
Chen et al. [13] showed that IAA and GA3 could enhance fiber
elongation in the fiber-less mutant, and had synergistic effect
on promoting fiber elongation. Du et al. [15] reported that
endogenous GA1+3 could increase ovule weight and fiber
length after fertilization. In recent years, transcriptomic
studies have revealed up-regulation of some GA synthetic and
responsive genes during fiber initiation and elongation [1618],
which implies that both GA biosynthesis and response are
involved in the regulation of cotton fiber.
To reveal the GA responsive mechanism in cotton, Aleman
et al. [19] cloned each 2 genes for GID1 and DELLA proteins,
and elucidated the functions and interactions of these proteins
by prokaryotic expression, yeast two-hybridization, and
transgenic complementation in Arabidopsis. However, these
GID1 genes were preferentially expressed in floral organs,
implying that these genes were mainly related to the
development of floral organs. To elucidate the functions of
GA response in fiber development, we cloned 6 GID1
homologous genes from cotton on the basis of expressed
sequence tags (ESTs). Real-time reverse transcription
polymerase chain reaction (RT-PCR) analysis indicated that
all these GID1 homologous genes displayed tissue- or
organ-specific expression, of which GhGID1-4 was expressed
preferentially in elongating fiber.

1
1.1

Materials and methods

Materials

Upland cotton cultivar Xuzhou 142 was provided by

Professor DU Xiong-Ming of the Cotton Research Institute,
Chinese Academy of Agricultural Sciences, Anyang, Henan
Province, China. Escherichia coli strain DH5 was
maintained in our laboratory.
1.2

Searching and analysis of homologous ESTs

The rice GID1 protein (GenBank accession number

AB211399) was employed as the probe sequence to query the
upland cotton ESTs in GenBank (http://www.ncbi.nlm.nih.gov,
2007) by tBlastn method. The obtained unigenes and singletons
were transformed to amino acid sequences with the aid of

Blastx searching, which were then compared to the GID1s

from rice and Arabidopsis by multiple sequence alignment
and clustering analysis. The closely related unigenes and
singletons were selected, and the corresponding full-length
cDNAs were cloned. All the primers are listed in Table 1.
1.3

Sequence extension and 3 RACE

Cotton DNA was extracted using the modified cetyltrimethylammonium bromide method [20]. Y-shaped adaptor
dependent extension (YADE) method was used to amplify the
flanking sequences of ESTs that lacked the initiation ATG
(AI055546 and Ghi4864) as previously described [20, 21].
The cDNA genes were amplified by 3 rapid amplification
of cDNA ends (RACE) with specific primers designed
according to the sequences upstream to the putative initiation
ATGs. Approximate 5 g of total RNAs from root, flower, or
10-DPA (days post anthesis) ovules (including fibers) were
used in the reverse transcription reaction. Amplification of
cDNA was conducted using the reverse transcription kit
(TaKaRa, Dalian, China) according to the manufacturers
instructions. PCR products were separated in argarose gels,
cloned into pGEM-T (Promega, Shanghai, China), and
sequenced by Invitrogen (Shanghai, China).
1.4

RNA extraction and real-time RT-PCR analysis

RNAs were extracted from various organs and tissues of

cotton plants grown in the field. Roots and hypocotyls were
harvested from 5 d old seedlings, and stems and leaves were
collected from mature plants. Flowers were tagged on the day
of anthesis, and ovules and fiber were gathered from the bolls
of different DPA.
Real-time RT-PCR was performed using the PrimeScript
RT-PCR Kit (TaKaRa, Dalian, China) according to the
manufacturers instructions. One microgram of total RNA was
used to synthesize the first-strand cDNA. The cDNA was then
diluted by 5 folds and 5 L dilutes were used as templates in
real-time PCR analysis. Cotton Histone3 gene (Table 1) was
amplified as RNA standard [22]. To ensure comparable
amplification efficiency among different genes, amplicons
were designed to reside at the 3 ends of the open read frames
(ORFs), and the amplicon lengths ranged from 200 to 300 bp.
The amplification condition was as follows: 95C for 2 min;
40 cycles of 94C for 30 s, 56C for 30 s, and 72C for 30 s.
PCR data were collected and analyzed with Icycler IQ
real-time PCR detection system (Bio-Rad, Shanghai, China),
and each sample was detected for 3 duplicates. The relative
expression levels were calculated as the ratio of values of
GID1 homologous genes to histone3. Microsoft Excel
program was employed to depict expression data.
1.5

In vitro ovule culture and phytihormone treatment

Ovules including fibers cultured in vitro were used to study

DONG Jing et al. / Acta Agronomica Sinica, 2009, 35(10): 18221830

Table 1 Sequence and purpose of primers used in this study

Gene

Unigene or EST

Primer sequences (53)

GhGID1-1

Ghi9117

AGTCTGGTTTGTTCGGCCAT

Upstream primer for 3 RACE

ACCATCCAGCTTGTAATCCA

Upstream primer for quantitative RT-PCR

GhGID1-2

GhGID1-3

GhGID1-4

GhGID1-5

GhGID1-6
Histone3

Ghi10228

Ghi2061

GTTACGGTTCAGTGGAGACT

Downstream primer for quantitative RT-PCR

GAGCCATGGCTGGTAGCAA

Upstream primer for 3 RACE

CGAAAAGTCTGGTAGTCGTG

Upstream primer for quantitative RT-PCR

CTACGCAGGGTGAGTGGTA

Downstream primer for quantitative RT-PCR

CATGGCTGGTAGAAATGAAG

Upstream primer for 3 RACE

CTGAAGGCGAAGATCGAGA

Upstream primer for quantitative RT-PCR

GTCCGACTTAATAGACCCTT

Downstream primer for quantitative RT-PCR

AI055546

TTCATGGTGGGAGCTTTGCA

The first YADE primer for 3-extension

Ghi4864

TTCCTCGGCGAATAGTGCTA

The second YADE primer for 3-extension

GGATTCCACAGCTCGTGC

The first YADE primer for 5-extension

Ghi13407

Ghi13407

CGCAACATGGTGTGCGATG

The second YADE primer for 5-extension

GGAATGGCTGGAAGTAATGA

Upstream primer for 3 RACE

ACCTAACGGTAGAAGTCTTG

Upstream primer for quantitative RT-PCR

AATCACCCCGAGATCGTGAA

Downstream primer for quantitative RT-PCR

GGAAATGGCTAGAAGTAATGA

Upstream primer for 3 RACE

CTAACGGTAGAAGTCTCGAG

Upstream primer for quantitative RT-PCR

GAATGTCAAGCTCCTGTCGT

Downstream primer for quantitative RT-PCR

CCTAACGGTAGAAGTCTTGAA

Upstream primer for quantitative RT-PCR

TAACAGTATGGAAGTGATTGC

Downstream primer for quantitative RT-PCR

GAAGCTGCAGAGGCATACC

Upstream primer for quantitative RT-PCR

CTACCACTACCATCATGGC

Downstream primer for quantitative RT-PCR

the effects of phytohormones on the expression levels of

various GID1 homologous genes. Ovules were harvested from
2-DPA bolls and cultured on BT medium with 0.5 mol L1
GA3, 5 mol L1 of indole acetic acid (IAA), or 0.15 mol L1
of brassinolide (BR). After culturing at 30C for 12 h, RNA
was extracted from ovules with fibers and analyzed by
real-time RT-PCR.

Usage

Results

2.1 Sequence analysis of cotton GID1 homologous ESTs

and cloning of corresponding cDNA genes
By searching the upland cotton ESTs in GenBank using
rice GID1 protein as the probe sequence, a total of 8 unigenea
and 1 EST homologous to GID1 were found. Multiple sequence
alignment and clustering analysis showed that 5 unigenes
(Ghi9117, Ghi10228, Ghi2061, Ghi4864, and Ghi13407) and
1 singleton (AI055546) were closely related to rice and
Arabidopsis GID1s and clustered in a single clade (Table 1
and unpublished data). Since these sequences might represent
cotton GID1 homologous genes, the primers were designed
according to these sequences to clone corresponding genes by
Y-shaped adaptor dependent extension (YADE) and/or 3
RACE.
BlastX analysis showed that Ghi9117, Ghi10228, Ghi2061,
and Ghi13407 contained initiation ATGs, Ghi4864 had

terminator codon, while AI055546 consisted of the middle

part of corresponding ORF. Based on the sequence of
AI055546, we used YADE method to extend the up- and
down-stream flanking region. The fragments of 1793 bp and
1998 bp were obtained at 3 and 5 ends, respectively. The 3
flanking sequence was overlapped with Ghi4864, suggesting
that AI055546 and Ghi4864 might originate from the same
gene. The 5 flanking sequence contained a putative initiation
ATG and its upstream sequence of 712 bp.
According to the upstream sequences of different GID1
homologous unigenes, the primers were designed to amplify
the corresponding cDNA genes by 3 RACE. Except that 2
GID1 homologous genes were amplified with the Ghi13407
primer, a single cDNA gene was obtained for the rest of
unigenes (Table 2). These genes were named GhGID1-1 to
GhGID1-6 with GenBank accession numbers of FJ790125 to
FJ790130, respectively. Except for GhGID1-3 encoding 345
amino acid residues, the other 5 genes encoded 344 amino
acid residues with the sequence length comparable to those of
Arabidopsis GID1a and GID1c proteins. It was also found that
GhGID1-1 and GhGID1-2 were highly similar to GhGID1a
and GhGID1b cloned by Shi et al. [16], with the identity of
99.7% and 98.5% in amino acids and 99.7% and 98.7% in
nucleotide.
2.2

Homologous analysis of cotton GID1 proteins

As shown in Fig. 1, multiple sequence alignment was carried

DONG Jing et al. / Acta Agronomica Sinica, 2009, 35(10): 18221830

Table 2 Sequence characteristic of GID1 homologous genes in cotton

Gene name

Accession number

cDNA length (bp)

GhGID1-1

FJ790125

GhGID1-2

Length of open reading frame

Sequence similarity to known protein

DNA (bp)

Amino acid

Protein

Identity (%)

1249

1035

344

GhGID1a

99.7

FJ790126

1472

1035

344

GhGID1b

98.5

GhGID1-3

FJ790127

1153

1038

345

GhGID1b

88.7

GhGID1-4

FJ790128

1370

1035

344

AtGID1c

82.3

GhGID1-5

FJ790129

1568

1035

344

AtGID1c

81.7

GhGID1-6

FJ790130

1089

1035

344

AtGID1c

80.8

Fig. 1 Multiple sequence alignment of GhGID1s and GID1 proteins from other plants
Numbers on right of the figure indicate positions of the amino acid sequences of cDNA.
Solid bars indicate the binding sites of GA and DELLA proteins. HGG and GXSXG conserved domains in HSL family are marked with asterisks.
Amino acids related to HSL activity are indicated with black dots. Arrowheads present the amino acid residuals essential to the rice GID1 protein.
AtGID1A to AtGID1C, Arabidopsis GID1 proteins (GenBank accession numbers NP_187163, NP_191860, and NP_198084);
OsGID1: Rice GID1 protein (AB211399); SmGID1a and SmGID1b: S. moellendorffii GID1 proteins (ABX10756 and ABX10757).

DONG Jing et al. / Acta Agronomica Sinica, 2009, 35(10): 18221830

out using 12 GID1 proteins, including the 6 deduced GhGID1

proteins from cotton and 6 functionally confirmed GID1
proteins from rice [3], Arabidopsis [23], and Lycophyte
(Selaginella moellendorffii) [24]. The 6 cotton GID1 homologs
shared high sequence similarity with other GID1 proteins, and
the conserved sequences scattered in the full length. The
conserved sequences in the cotton GID1 homologs included
GA and DELLA binding sites determined by Ala scanning
(TWVLIS, LDR, FFHGGSF, HS, IYD, YRR, DGW,
GDSSGGNI, GNI, MF, LDGKYF, DYW, and GFY) [24],
conserved domains in hormone sensitive lipase (HSL) family
(HGG and GXSXG) [5], and the 3 amino acid residues (G169,
G196, and R251) that proved to be essential to the GID1
function by rice mutants [5, 25]. Similar to other GID1 proteins,
among the 3 amino acid residues (S, D, and H) related to the
HSL activity, only S and D were conserved in cotton GID1
homologs, and H was substituted by I (Fig. 1, this amino acid
residue was V or I in Arabidopsis and rice). These results
indicated that GhGID1-1 to GhGID1-6 were probably cotton
GID1 homologous genes, which might encode biologically
functional GA acceptor, and be involved in GA recognition
and signaling in cotton development.
The phylogenetic tree of these GID1 proteins from various
species showed that the 6 cotton GID1 proteins were most
closely related to Arabidopsis GID1s and distantly related to
rice GID1, but most distantly to Lycophyte GID1 (Fig. 2).
This result is consistent with the taxonomic relations of these
species. In the dicotyledonous plants, 9 GID1 proteins were
divided into 2 groups, of which GhGID1-1, GhGID1-2,
GhGID1-3, and AtGID1B presented in one group, and the
remaining GID1 proteins went to the other group (Fig. 2).
This indicates that multiple GID1 genes in the dicotyledonous
plants originated early, at least before the divergence of
Malvaceae and Cruciferae.
2.3 Temporal and spatial expression of cotton GID1
homologous genes
Real-time RT-PCR analysis revealed that all the 6 cotton
GID1 homologous genes were expressed in the tissues and
organs investigated with different levels (Fig. 3). Generally,
GhGID1-1 and GhGID1-2 had the highest expression level,
GhGID1-4 was moderately expressed, and the expression
levels of GhGID1-3, GhGID1-5, and GhGID1-6 were low.
The expression levels of the 6 cotton GID1 genes were
different among tissues and organs. Consistent with Alemans
report [19], GhGID1-1 and GhGID1-2 were preferentially
expressed in floral organs (petals and anthers), and had an
evident expression in roots, while GhGID1-4 was mainly
expressed in fibers and roots.
In ovules and fibers, GhGID1-1 and GhGID1-4 were the

Fig. 2 Unrooted phylogenetic tree of GhGID1s from cotton

and GID1 proteins from other plants

predominantly expressed GID1 genes (Fig. 4). In the ovules

from 6 DPA to 18 DPA, GhGID1-1 transcript reached the
climax at 10 DPA, and kept a high level at 14 and 18 DPA;
whereas, the expressions of the rest GID1 homologous genes
in the ovules displayed a similar trend in spite of the
obviously lower levels. In fibers, the highest expression level
of GhGID1-4 gene was found at 6 DPA, and the expression
level decrease quickly after 10 DPA, suggesting that GhGID1-4
was related to the regulation of fiber elongation at early
stage. GhGID1-1 gene was expressed in fibers at a low level
at the early stage, and the expression level did not increase
until 18 DPA. These results suggested that the expression
regulation of GID1 genes in fibers and ovules was relatively
independent, and also implied that there were relatively
independent GA response systems in ovules and the attached
fibers.
2.4 Influences of phytohormones on expressions of
cotton GID1 genes
GA treatment decreased, to different extents, the expression
levels of the 6 cotton GID1 genes, among which the
expression levels of GhGID1-1 and GhGID1-2 were
obviously reduced by 27- and 25-fold, respectively (Fig. 5).
This indicated that cotton GID1 homologous genes, especially
GhGID1-1 and GhGID1-2, were regulated by GA in feedback
manner. In contrast, only weak fluctuations of cotton GID1
homologous genes were observed after IAA and BR
treatment (Fig. 5), indicating that BR and IAA were not
directly related to the expression regulation of cotton GID1
homologous genes.

DONG Jing et al. / Acta Agronomica Sinica, 2009, 35(10): 18221830

0.0

0.0

0.000

0.00

0.000

0.000

Fig. 3 Expression levels of six GID1 homologous genes in different cotton organs and tissues
Ro: Root; Hy: Hypocotyls; Le: leaf; Pe: Petal; An: anther; O0: 0-DPA ovule; F6: 6-DPA fibers; O6: 6-DPA ovule.

Discussion

GID1 gene was firstly cloned from rice. There is only a

single copy of GID1 gene in the rice genome, corresponding
to a single copy of DELLA protein gene (SLR1) [26].
Compared to rice, there are more complex GA signaling
components in Arabidopsis, from which 3 GID1 homologous
genes (AtGID1A, AtGID1B, and AtGID1C) and 5 DELLA
protein genes (GAI, RGA, and RGL1 to RGL3) were found [23].
The expression profiles of the 3 GID1 genes were different
but with some overlapping. Functionally, they were relatively
differentiated with the ability to complement each other [27, 28].
The 6 cotton GID1 homologous genes shared high sequence
similarity with Arabidopsis GID1 genes and contained the
conserved amino acid residues related to GID1 functions, for
example, DELLA and GA binding sites and conserved sites of
HSL family. This suggests that these GID1 homologous genes
may encode functional GID1 proteins and participate in the
regulation GA recognition and signal conduction. As for
expression profiles, the 6 cotton GID1 homologous genes
differed greatly in their expression patterns (Fig. 3). The
predominantly-expressed genes varied with tissues and organs,

suggesting relative functional differentiation of these genes.

On the other hand, the 6 cotton GID1 homologous genes have
detectable expression in all the tissues and organs investigated,
and their expressions are regulated by GA (Fig. 5), implying
functional overlapping to some extent. In addition, we have
cloned 4 DELLA protein genes, 4 GA 20-oxidase genes, 2
GA 3-oxidase genes, and 6 GA 2-oxidase genes (data not
shown). All these results suggested an extremely complex
system in cotton to deal with the regulation of GA
biosynthesis, signal recognition and transduction.
Gibberellin is an important group of plant growth regulators
and phytohormones, which is involved in regulation of
various physiological processes. Application of GAs in vitro
or in planta could promote fiber initiation and elongation on
cotton ovules [911] and the expansion of ovules [12, 15]. However,
it still needs to be elucidated the molecular basis of GA
biosynthesis, signal recognition and transduction during fiber
development, and the relationship of GA regulation system in
ovules and the attached fibers. In this study, it was found that
the predominantly-expressed GID1 genes differed in fibers
and ovules with different kinetics of expression level (Figs. 3
and 4), suggesting relatively independent GA response system

DONG Jing et al. / Acta Agronomica Sinica, 2009, 35(10): 18221830

0.00

0.000

0.000

0.00

0.0000

0.000

Fig. 4 Expression of six GID1 genes at various stages in ovules and fibers of cotton

in fibers and ovules. This result paved a way for further

studying the function of GA and GID1 genes in fiber
development.
Previously, exogenous application was the major method to
study GA functions in fiber development. Because of side
effects, high cost, and the risk of environmental pollution,
exogenous application is hardly feasible in field [29]. As the
GA receptor gene, GID1 gene that is overexpressed can
promote the GA sensitivity, resulting in a GA-overproduction
phenotype and a rescue of the GA deficient phenotype caused
by the overdose expression of DELLA proteins [5, 7, 8].
Therefore, it is feasible to manipulate GA sensitivity and
promote plant growth by engineering GID1 gene. Cloning of
cotton GID1 genes, especially the fiber-specific GID1 gene,
provides potential target genes to regulate GA response,
enhance fiber development, and improve fiber yield and

quality through biotechniques.

Conclusions

Six GID1 homologous genes were cloned from cotton. The

6 cotton GID1 homologous proteins (GhGID1-1 to GhGID1-6)
shared high sequence similarity with GID1 proteins from
Arabidopsis and rice. The expression levels of the 6 cotton
GID1 homologous genes differed in various tissues and
organs, and in ovules and fibers at different stages, suggesting
that these genes were regulated developmentally. Gene
GhGID1-4 was preferentially expressed in elongating fibers,
and presumably participated in regulation of fiber elongation.
In the in vitro cultured ovules (including fibers), the
expression of GhGID1-1 and GhGID1-2 was obviously
inhibited by GA in a feedback manner.

DONG Jing et al. / Acta Agronomica Sinica, 2009, 35(10): 18221830

0.00

0.00

0.000

0.0000

0.0000

0.00000

Fig. 5 Response of six cotton GID1 homologous genes to various phytohormones

BT: BT medium without any phtohormone; GA: BT medium with 0.5 mol L1 GA3;
BR: BT medium with 0.15 mol L1 BR; IAA: BT medium with 5 mol L1 IAA.

Acknowledgment
This study was financially supported by the National High
Technology Research and Development Program of China
(2007AA10Z134).

[4]

References

[5]

[1]

[2]

[3]

Swain S M, Singh D P. Tall tales from sly dwarves: novel

functions of gibberellins in plant development. Trends Plant
Sci, 2005, 10: 123129
Olszewski N, Sun T, Gubler F. Gibberenllin signaling:
biosynthesis, catabolism, and response pathways. Plant Cell,
2002, 14(suppl): 6180
Ueguchi-Tanaka M, Ashikari M, Nakajima M, Itoh H, Katoh
E, Kobayashi M, Chow T Y, Hsing Y I, Kitano H, Yamaguchi

[6]

[7]

I, Matsuoka M. GIBBERELLIN INSENSITIVE DWARF1

encodes a soluble receptor for gibberellin. Nature, 2005, 437:
693698
Ueguchi-Tanaka M, Nakajima M, Motoyuki A, Matsuoka M.
Gibberellin receptor and its role in gibberellin signaling in
plants. Annu Rev Plant Biol, 2007, 58: 183198
Hirano K, Ueguchi-Tanaka M, Matsuoka M. GID1-mediated
gibberellin signaling in plants. Trends Plant Sci, 2008, 13:
192199
Ueguchi-Tanaka M, Hirano K, Hasegawa Y, Kitano H,
Matsuoka M. Release of the repressive activity of rice DELLA
protein SLR1 by gibberellin does not require SLR1 degradation
in the gid2 mutant. Plant Cell, 2008, 20: 24372446
Ariizumi T, Murase K, Sun T P, Steber C M. Proteolysisindependent down-regulation of DELLA repression in
Arabidopsis by the gibberellin receptor GIBBERELLIN

DONG Jing et al. / Acta Agronomica Sinica, 2009, 35(10): 18221830

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]
[19]

INSENSITIVE DWARF1. Plant Cell, 2008, 20: 24472459

Kim H J, Triplet B A. Cotton fiber growth in planta and in
vitro: Models for plant cell elongation and cell wall biogenesis.
Plant Physiol, 2001, 127: 13611366
Beasley C A, Ting I P. The effects of plant growth substances
on in vitro fiber development from fertilized cotton ovules. Am
J Bot, 1973, 60: 130139
Davidonis G H. A comparison of cotton ovule and cotton cell
suspension cultures: response to gibberellic acid and
2-chloroethylphosphonic acid. J Plant Physiol, 1993, 141:
505507
Gialvalis S, Seagull R W. Plant hormones alter fiber initiation
in unfertilized, cultured ovules of Gossypium hirsutum. J
Cotton Sci, 2001, 5: 252258
Jiang S L, Wang X D. Fiber induction and development from
cotton ovules of five fiber mutants in vitro. Cotton Sci, 2002,
14(2): 7175 (in Chinese with English abstract)
Chen C H, Wang X D, Yao Y L. Inducement of fiber cell
elongation from ovule of lintless mutant (Ligon Cotton,
Gossypium hirsutum L.) in vitro with IAA and GA3. Acta
Agron Sin, 2005, 31: 229233 (in Chinese with English
abstract)
Seagull R W, Giavalis S. Pre- and post-anthesis application of
exogenous hormones alters fiber production in Gossypium
hirsutum L. cultivar Maxxa GTO. J Cotton Sci, 2004, 8:
105111
Du X M, Chen J G, Zhang T Z, Pan J J, Wang R H. Difference
of endogenous hormones level in cotton ovules of 5 fiber
mutants and effects on fiber initiation and early development.
Acta Gossypii Sin, 1998, 10: 4351 (in Chinese with English
abstract)
Shi Y H, Zhu S W, Mao X Z, Feng J X, Qin Y M, Zhang L,
Cheng J, Wei L P, Wang Z Y, Zhu Y X. Transcriptome
profiling, molecular biological, and physiological studies
reveal a major role for ethylene in cotton fiber cell elongation.
Plant Cell, 2006, 18: 651 664
Yang S S, Cheung F, Lee J J, Ha M, Wei N E, Sze S H, Stelly D
M, Thaxton P, Triplett B, Town C D, Chen Z J. Accumulation
of genome-specific transcripts, transcription factors and
phytohormonal regulators during early stages of fiber cell
development in allotetraploid cotton. Plant J, 2006, 47:
761775
Taliercio E W, Boykin D. Analysis of gene expression in cotton
fiber initials. BMC Plant Biol, 2007, 7: 22
Aleman L, Kitamura J, Abdel-mageed H, Lee J, Sun Y,
Nakajima M, Ueguchi-Tanaka M, Matsuoka M, Allen R D.
Functional analysis of cotton orthologs of GA signal

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

transduction factors GID1 and SLR1. Plant Mol Biol, 2008, 68:
116
Xiao Y H, Luo M, Fang W G, Luo K M, Hou L, Li D M, Pei Y.
PCR walking in cotton genome using YADE method. Acta
Genet Sin, 2002, 29: 6266 (in Chinese with English abstract)
Xiao Y H, Peng Y, Luo M, Li D M, Hou L, Pei Y. Sequential
amplification of flanking sequences by Y-shaped adaptor
dependent extension using multiple templates. J Plant Physiol
Mol Biol, 2007, 33: 8590
Zhu Y Q, Xu K X, Luo B, Wang J W, Chen X Y. An
ATP-binding cassette transporter GhWBC1 from elongating
cotton fibers. Plant Physiol, 2003, 133: 580588
Griffiths J, Murase K, Rieu I, Zentella R, Zhang Z L, Powers S
J, Gong F, Phillips A L, Hedden P, Sun T P, Thomas S G.
Genetic characterization and functional analysis of the GID1
gibberellin receptors in Arabidopsis. Plant Cell, 2006, 18:
33993414
Hirano K, Nakajima M, Asano K, Nishiyama T, Sakakibara H,
Kojima M, Katoh E, Xiang H, Tanahashi T, Hasebe M, Banks
J A, Ashikari M, Kitano H, Ueguchi-Tanaka M, Matsuoka M.
The GID1-mediated gibberellin perception mechanism is
conserved in the Lycophyte Selaginella moellendorffii but not
in the Bryophyte Physcomitrella patens. Plant Cell, 2007, 19:
30583079
Ueguchi-Tanaka M, Nakajima M, Katoh E, Ohmiya H, Asano
K, Saji S, Hongyu X, Ashikari M, Kitano H, Yamaguchi I,
Matsuoka M. Molecular interactions of a soluble gibberellin
receptor, GID1, with a rice DELLA protein, SLR1, and
gibberellin. Plant Cell, 2007, 19: 21402155
Itoh H, Ueguchi-Tanaka M, Matsuoka M. Molecular biology of
gibberellins signaling in higher plants. Intl Rev Cell Mol Biol,
2008, 268: 191221
Iuchi S, Suzuki H, Kim Y C, Iuchi A, Kuromori T,
Ueguchi-Tanaka M, Asami T, Yamaguchi I, Matsuoka M,
Kobayashi M, Nakajima M. Multiple loss-of-function of
Arabidopsis gibberellin receptor AtGID1s completely shuts
down a gibberellin signal. Plant J, 2007, 50: 958966
Nakajima M, Shimada A, Takashi Y, Kim Y C, Park S H,
Ueguchi-Tanaka M, Suzuki H, Katoh E, Iuchi S, Kobayashi M,
Maeda T, Matsuoka M, Yamaguchi I. Identification and
characterization of Arabidopsis gibberellin receptors. Plant J,
2006, 46: 880889
Li Y, Duan H, Wu Y H, McAvoy R J, Pei Y, Zhao D, Wurst J,
Li Q, Luo K. Transgenics of plant hormones and their potential
application in horticultural crops. In: Liang G H, Skinner D Z
eds. Genetically Modified Crops: Their Development, Uses,
and Risks. New York: Food Products Press, 2004. pp 101112