Está en la página 1de 37

Introduccin a la Bioinformtica

Dr. Eduardo A. R ODRGUEZ T ELLO


C INVESTAV-Tamaulipas

16 de mayo del 2013

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

1 / 37

Bioinformtica
Introduccin
Qu es bioinformtica?
Un poco de historia
Datos biolgicos
Objetivos
mbito
Aplicaciones prcticas
reas de investigacin
Limitantes

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

2 / 37

Bioinformtica

Introduccin

Bioinformtica
Introduccin
Qu es bioinformtica?
Un poco de historia
Datos biolgicos
Objetivos
mbito
Aplicaciones prcticas
reas de investigacin
Limitantes

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

3 / 37

Bioinformtica

Introduccin

Introduccin

Las herramientas cuantitativas son indispensables en la biologa


moderna
Actualmente la mayora de la investigacin biolgica implica la
aplicacin de algn tipo de matemticas, estadstica, o de
herramientas computacionales
Esto con el fin de ayudar a sintetizar los datos registrados e
integrar diversos tipos de informacin en el proceso de responder
a una pregunta biolgica

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

4 / 37

Bioinformtica

Introduccin

Introduccin
Por ejemplo, la enumeracin y la estadstica son necesarias para
evaluar los experimentos cotidianos de laboratorio, como contar
colonias de bacterias

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

5 / 37

Bioinformtica

Introduccin

Introduccin
Un ejemplo clsico en la historia de la gentica es el de Gregor
Mendel (Austria, 1866) y Thomas Morgan (USA, 1910)
Quienes al contar variaciones genticas de plantas y moscas de
la fruta, fueron capaces de descubrir los principios de la herencia
gentica

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

6 / 37

Bioinformtica

Introduccin

Introduccin
Un uso ms elaborado de instrumentos cuantitativos puede
implicar el empleo de clculo diferencial, por ejemplo para
establecer un modelo cintico de la catlisis enzimtica

O el uso de un gran nmero de ecuaciones diferenciales parciales


no lineales para modelar el flujo sanguneo cardaco
Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

7 / 37

Bioinformtica

Introduccin

Introduccin

Evidente las herramientas matemticas y computacionales hoy en


da se han convertido en parte integral de la investigacin
biolgica
Sin embargo, ninguno de los ejemplos mencionados del uso de
herramientas cuantitativas en biologa pueden ser considerados
como parte de la bioinformtica
A continuacin describiremos a detalle qu es la bioinformtica

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

8 / 37

Bioinformtica

Qu es bioinformtica?

Bioinformtica
Introduccin
Qu es bioinformtica?
Un poco de historia
Datos biolgicos
Objetivos
mbito
Aplicaciones prcticas
reas de investigacin
Limitantes

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

9 / 37

Bioinformtica

Qu es bioinformtica?

Qu es bioinformtica?
La bioinformtica es un rea de investigacin interdisciplinaria:
matemtica aplicada, estadstica, ciencias computacionales,
inteligencia artificial, qumica y bioqumica

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

10 / 37

Bioinformtica

Qu es bioinformtica?

Qu es bioinformtica?
Estudia el desarrollo de mtodos computacionales y tcnicas
estadsticas para resolver problemas prcticos y tericos
derivados del almacenamiento, extraccin, manipulacin y
distribucin de informacin relacionada con datos biolgicos
(principalmente de macromolculas)

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

11 / 37

Bioinformtica

Un poco de historia

Bioinformtica
Introduccin
Qu es bioinformtica?
Un poco de historia
Datos biolgicos
Objetivos
mbito
Aplicaciones prcticas
reas de investigacin
Limitantes

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

12 / 37

Bioinformtica

Un poco de historia

Un poco de historia

El desarrollo de la bioinformtica es el resultado de los avances


tanto en biologa molecular como en ciencias computacionales a
lo largo de los ltimos 30-40 aos
Haremos un resumen de los eventos que han tenido mayor
impacto en el desarrollo de la bioinformtica

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

13 / 37

Bioinformtica

Un poco de historia

Un poco de historia
Tiene su origen en los aos 1950s cuando se logr comprender
la estructura tridimensional del ADN, la molcula responsable de
transmitir la herencia gentica
Mayo de 1952, Rosalind Franklin obtiene la famosa fotografa 51,
una imagen del ADN obtenida mediante difraccin de rayos X
Abril de 1953, James D. Watson y Francis Crick reportan la
estructura tridimensional del ADN (modelo de doble hlice)

http://en.wikipedia.org/wiki/Rosalind_Franklin
Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

14 / 37

Bioinformtica

Un poco de historia

Un poco de historia
Probablemente el primer proyecto Bioinformtica fue llevado a
cabo por Margaret Dayhoff en 1965, quien desarroll la primera
BD de secuencias de protenas

Imgenes tomadas de Wikipedia


Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

15 / 37

Bioinformtica

Un poco de historia

Un poco de historia
Al inicio de los aos 1970, el Laboratorio Nacional de Brookhaven
(USA) estableci el Banco de Datos de Protenas para almacenar
estructuras de protenas en 3D (12 al inicio, 90,611 al da de hoy)

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

16 / 37

Bioinformtica

Un poco de historia

Un poco de historia
El primer algoritmo para alineamiento de secuencias fue
desarrollado por Needleman y Wunsch en 1970
Este fue un paso fundamental en el desarrollo del campo de la
bioinformtica, que abri el camino para las comparaciones de
secuencias y bsquedas en BD de rutina realizadas por los
bilogos modernos
El primer algoritmo para prediccin de estructuras de protenas
fue desarrollado por Chou y Fasman en 1974
Los aos 1980 vieron el establecimiento del GenBank y el
desarrollo de rpidos algoritmos para bsquedas en BD como
FASTA de William Pearson y BLAST de Stephen Altschul et al.

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

17 / 37

Bioinformtica

Un poco de historia

Un poco de historia

El inicio del proyecto del genoma humano a finales de los aos


1980 propici un rpido desarrollo de la bioinformtica
Por su parte el uso masivo de Internet en los aos 1990 hicieron
posible el acceso inmediato, intercambio y diseminacin de datos
biolgicos
En trminos generales la bioinformtica gan prominencia como
una disciplina debido al avance en los estudios sobre el genoma
que produjeron grandes cantidades de datos biolgicos

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

18 / 37

Bioinformtica

Un poco de historia

Un poco de historia
La explosin de informacin sobre secuencias genmicas
generaron una demanda de herramientas computacionales
eficientes para manejar y analizar los datos
El desarrollo de estas herramientas dependi del conocimiento
generado en disciplinas tan diversas como las matemticas, la
estadstica, las ciencias computacionales, las tecnologas de la
informacin y la biologa molecular
La mezcla de estas disciplinas cre un campo orientado a la
informacin en la biologa, el cual es conocido como
bioinformtica
A continuacin describiremos a detalle qu es la bioinformtica

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

19 / 37

Bioinformtica

Datos biolgicos

Bioinformtica
Introduccin
Qu es bioinformtica?
Un poco de historia
Datos biolgicos
Objetivos
mbito
Aplicaciones prcticas
reas de investigacin
Limitantes

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

20 / 37

Bioinformtica

Datos biolgicos

Datos biolgicos
Protenas
Secuencias de aminocidos cada uno representado por una de 20
posibles letras: A, R, N, D, ...
Ejemplo: Insulina
MHHHHHHAAGIPMNNPAIKRIGNHITKSPEDKREYRGLE
LANGIKVLLISDPTTDKSSAALDVHIG...

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

21 / 37

Bioinformtica

Datos biolgicos

Datos biolgicos
Genomas
Secuencias de ADN formadas por las letras A, T, C, G
Cada letra representa la base nitrogenada de un nucletido de la
secuencia (Adenina, Timina, Citosina, Guanina)
Ejemplo: Bacteria E. Coli
GATTCGAACTCGGCCCACGACTTAGAAGTTCTAGAA
CGACATTTTAAGTCAACAACTTACCGCGCCATCTCT...

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

22 / 37

Bioinformtica

Datos biolgicos

Datos biolgicos

Las secuencias de las protenas contienen en promedio entre 100


y 5000 aminocidos
Las secuencias de ADN son mucho ms grandes que las de
protenas
Por ejemplo, el ADN de la bacteria E. Coli tiene 4.7 millones de
bases y el del humano 3.3 billones de bases

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

23 / 37

Bioinformtica

Datos biolgicos

Datos biolgicos
Una gran cantidad de informacin, cada da aumenta ms

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

24 / 37

Bioinformtica

Objetivos

Bioinformtica
Introduccin
Qu es bioinformtica?
Un poco de historia
Datos biolgicos
Objetivos
mbito
Aplicaciones prcticas
reas de investigacin
Limitantes

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

25 / 37

Bioinformtica

Objetivos

Objetivos

El objetivo principal de la bioinformtica es lograr entender mejor


las clulas y la manera en que funcionan a nivel molecular
Esto es realizado mediante el anlisis de secuencias moleculares
en bruto y datos estructurales
De esta manera la investigacin en bioinformtica puede generar
nuevas ideas y ofrecer una perspectiva global de las funciones
clulares

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

26 / 37

Bioinformtica

mbito

Bioinformtica
Introduccin
Qu es bioinformtica?
Un poco de historia
Datos biolgicos
Objetivos
mbito
Aplicaciones prcticas
reas de investigacin
Limitantes

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

27 / 37

Bioinformtica

mbito

mbito

La bioinformtica consta de dos subcampos:


El desarrollo de herramientas computacionales y BD
La aplicacin de estas herramientas y BD en la generacin de
conocimiento biolgico para comprender mejor los sistemas vivos

Estos dos subcampos son complementarios entre s

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

28 / 37

Bioinformtica

mbito

mbito

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

29 / 37

Bioinformtica

Aplicaciones prcticas

Bioinformtica
Introduccin
Qu es bioinformtica?
Un poco de historia
Datos biolgicos
Objetivos
mbito
Aplicaciones prcticas
reas de investigacin
Limitantes

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

30 / 37

Bioinformtica

Aplicaciones prcticas

Aplicaciones prcticas
La bioinformtica se ha convertido en algo esencial para la
investigacin en genmica y biologa molecular
Adems tambin est teniendo un gran impacto en muchas reas
de la biotecnologa y de las ciencias biomdicas
Algunas aplicaciones
Diseo de frmacos basados en conocimiento
Anlisis forenses de ADN
Biotecnologa agrcola

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

31 / 37

Bioinformtica

reas de investigacin

Bioinformtica
Introduccin
Qu es bioinformtica?
Un poco de historia
Datos biolgicos
Objetivos
mbito
Aplicaciones prcticas
reas de investigacin
Limitantes

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

32 / 37

Bioinformtica

reas de investigacin

reas de investigacin

Algunas de las principales reas de investigacin en


bioinformtica incluyen:
Alineamiento de secuencias
Prediccin de genes
Prediccin de la estructura de protenas
Prediccin de la expresin gnica
Interacciones protena-protena
Modelado de la evolucin

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

33 / 37

Bioinformtica

Limitantes

Bioinformtica
Introduccin
Qu es bioinformtica?
Un poco de historia
Datos biolgicos
Objetivos
mbito
Aplicaciones prcticas
reas de investigacin
Limitantes

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

34 / 37

Bioinformtica

Limitantes

Limitantes

Hemos visto el gran potencial de la bioinformtica, pero es


tambin importante reconocer sus limitaciones para evitar
sobreestimar esta disciplina
La bioinformtica y la biologa experimental son actividades
independientes, pero complementarias
La bioinformtica depende de la ciencia experimental para
producir datos primarios para el anlisis.

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

35 / 37

Bioinformtica

Limitantes

Limitantes

A a su vez la bioinformtica, proporciona la interpretacin de los


datos experimentales e importantes pistas para seguir la
investigacin experimental
Las predicciones hechas en bioinformtica no son pruebas
formales de cualquier concepto
No sustituyen a los mtodos tradicionales de investigacin
experimental que prueban en realidad las hiptesis
Adems, la calidad de las predicciones de bioinformtica depende
de la calidad de los datos y la sofisticacin de los algoritmos
utilizados

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

36 / 37

Bioinformtica

Limitantes

Introduccin a la Bioinformtica
Dr. Eduardo A. R ODRGUEZ T ELLO
http://www.tamps.cinvestav.mx/~ertello
ertello@tamps.cinvestav.mx

16 de mayo del 2013

Dr. Eduardo R ODRGUEZ T. (C INVESTAV)

Introduccin a la Bioinformtica

16 de mayo del 2013

37 / 37