Documentos de Académico
Documentos de Profesional
Documentos de Cultura
Virus Research
journal homepage: www.elsevier.com/locate/virusres
Graduate Program in Biochemistry, Department of Biochemistry, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand
Department of Anatomy, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand
c
Graduate Program in Immunology, Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand
d
Department of Physiology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand
e
Division of Molecular Medicine, Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand
f
Medical Biotechnology Unit, National Center for Genetic Engineering and Biotechnology, National Science and Technology Development Agency, Thailand
b
a r t i c l e
i n f o
Article history:
Received 19 December 2013
Received in revised form 24 March 2014
Accepted 24 March 2014
Available online 1 April 2014
Keywords:
Dengue virus
ERK1/2
Liver injury
Apoptosis
FR180204
a b s t r a c t
The liver is considered to be an important organ of dengue virus (DENV) replication and pathogenesis.
However, molecular mechanisms of hepatic injury are still poorly understood. Modulation of Mitogen
Activated Protein Kinases (MAPKs) was previously shown to affect DENV-induced apoptosis of hepatocytes in vitro. However, the in vivo role of ERK1/2, a member of the MAPK family, and the question
whether its activation can facilitate cell survival or cell death, has not been thoroughly investigated.
Therefore, the role of ERK1/2 in a mouse model of DENV infection was examined. Our results show that
DENV induces phosphorylation of ERK1/2 and increases apoptosis. Inhibition of phosphorylated ERK1/2
by the selective ERK1/2 inhibitor, FR180204, limits hepatocyte apoptosis and reduces DENV-induced
liver injury. Clinical parameters, including leucopenia, thrombocytopenia, transaminases and histology,
show improvements after FR180204 treatment. The expression of cell death genes was further identied
using real-time PCR array and Western blot analysis. Caspase-3 was signicantly decreased in FR180204
treated DENV-infected mice compared to the levels of untreated DENV-infected mice suggesting the role
of ERK1/2 signaling in immune-mediated liver injury during DENV infection.
2014 Elsevier B.V. All rights reserved.
1. Introduction
Dengue virus (DENV) infection is one of the most important
mosquito-borne viral diseases, which is endemic in tropical and
sub-tropical regions. Clinical manifestations of DENV infection
include dengue fever (DF), dengue hemorrhagic fever (DHF), and
dengue shock syndrome (DSS). Patients with DHF generally present
with hemorrhagic tendencies, plasma leakage, thrombocytopenia,
and hemoconcentration. DSS may occur in cases of subsequent
infection with a different serotype of DENV (Halstead, 2007).
Hepatic dysfunction is a crucial feature seen in DENV infection (Halstead, 2007). Transaminase levels are increased in
DENV-infected patients (Halstead, 1988; Kuo et al., 1992; Souza
Corresponding author at: Department of Anatomy, Faculty of Medicine Siriraj
Hospital, Mahidol University, Bangkok, Thailand. Tel.: +66 2419 7035;
fax: +66 2419 7035.
E-mail addresses: thawornchai.lim@mahidol.ac.th, limjindaporn@yahoo.com
(T. Limjindaporn).
http://dx.doi.org/10.1016/j.virusres.2014.03.025
0168-1702/ 2014 Elsevier B.V. All rights reserved.
16
liver with FR180204 treatment (n = 3) using the Invitrap Spin Universal RNA Mini Kit (Stratec Molecular) and quantied using a
Nanodrop machine. Equivalent amounts of RNA from each sample
were converted to cDNA with SuperScript III First-Strand Synthesis System (Invitrogen) with a reverse primer, NS1-R 5 GCC
ATC AAT GAG AAA GGT CTG G 3 . Amplication was performed
using the SYBR Green I reaction mix (Roche) in the presence of
NS1 specic primers including NS1-F 5 CCG GCC AGA TCT GGA
GAC ATC AAA GGA ATC 3 and the NS1-R in a Roche Light Cycler
480. In vitro transcription-derived DENV NS1 RNA with known copy
number served as a standard control for qRT-PCR. The Ct of viral
RNA was measured and compared to the standard control. Results
were obtained from three independent experiments and analyzed
using the GraphPad Prism 5 program.
2.4. Detection of host RNA by real-time PCR array
The Mouse Apoptosis RT2 ProlerTM PCR Array (Qiagen) interrogates 84 genes related to apoptotic pathways. RNA was extracted
from mock, DENV-infected liver, DENV-infected liver with 2%
DMSO or DENV-infected liver with FR180204 treatment using the
Invitrap Spin Universal RNA Mini Kit (Stratec Molecular). Total RNA
was quantied using a Nanodrop machine; equivalent amounts
of RNA from each sample were converted to cDNA using the
SuperScript III First-Strand Synthesis System (Invitrogen), mixed
with RT2 qPCR mastermix containing SYBR Green (Qiagen), and
equivalent volumes were aliquoted to each well of the real-time
PCR arrays. The real-time PCR cycling program was run on a Roche
Light Cycler 480 machine. The threshold cycle (Ct) of each gene was
determined and the data were analyzed using the web program at
http://www.pcrdataanalysis.sabiosciences.com/pcr/arrayanalysis.
php.
Expression changes detected by the real-time PCR arrays
were validated by quantitative real-time PCR using different set
of primers. Total RNA was extracted from mock (n = 3), DENVinfected liver (n = 3), DENV-infected liver with 2% DMSO (n = 3)
or DENV-infected liver with FR180204 treatment (n = 3) with the
Invitrap Spin Universal RNA Mini Kit (Stratec Molecular) and
quantied using a Nanodrop machine. Equivalent amounts of RNA
from each sample were converted to cDNA using SuperScript III
First-Strand Synthesis System (Invitrogen), and PCR amplication
was carried out using TNF--specic primers including TNF-F 5
CCCCCAGTCTGTATCCTTCT 3 and TNF-R 5 TTTGAGTCCTTGATGGTGGT 3 , and GAPDH-specic primers including GAPDH-F5
TGAATACGGCTACAGCAACA 3 and GAPDH-R 5 AGGCCCCTCCTGTTATTATG 3 , respectively. Amplication was performed using
the SYBR Green I reaction mix (Roche) in a Roche Light Cycler
480. The Ct of mRNA of TNF- and GAPDH were measured and
the differences between their Ct were calculated. The relative
expression values (2Ct ) were then determined. Results were
obtained from three independent experiments and analyzed using
the GraphPad Prism 5 program.
2.5. Western blot analysis
Total protein was extracted from mock (n = 3), DENV-infected
liver (n = 3), DENV-infected liver with 2% DMSO (n = 3), DENVinfected liver with FR180204 treatment (n = 3) in RIPA buffer
containing protease inhibitor (Roche) and subjected to Western
blot analysis (Towbin et al., 1979). Phosphatase inhibitor (Roche)
was also added to maximize detection of phosphorylated proteins.
Protein concentrations of the lysates were determined using the
Bradford protein assay (Bio-Rad) and adjusted to equivalent concentrations prior to mixing with loading dye and heating at 95 C
for 5 min. Samples were separated by SDS-PAGE and blotted onto
nitrocellulose membrane. The membrane was blocked in 5% BSA
17
Fig. 1. Quantication of viral NS1 and viral titers from liver tissues of DENV- infected Balb/c mice. Mice were infected with L-15 medium (Mock) or DENV at a dose of 4 105
FFU in a volume at 0.4 ml of L-15 medium. Seven days after DENV infection, liver tissues were collected and stored in RNA later. Total viral RNA was isolated for viral NS1
quantication and viral supernatant from the liver homogenate for the FFU assay. (A) Standard curve plotted by qRT-PCR, from the threshold cycle numbers (Ct) of ten
fold serially diluted cDNA generated from DENV NS1 RNA standard with known copies (the dots in the gure corresponds to each ten fold dilutions) (B) Representative
amplication plot for the NS1 copies of Mock-infected (blue) and DENV-infected viral RNA (red) (C) Viral NS1 copies in 1 g total RNA of mock-infected and DENV infected
liver tissue (D) Viral titers expressed from liver tissue homogenate in FFU per milligram (FFU/mg) of mock-infected and DENV-infected mice. All the results were obtained
from three animals (n = 3) from each group. For (C) and (D), statistical analysis was done by an unpaired t-test using GraphPad Prism 5 program and the data were represented
as mean SEM. The asterisks show the level of signicance (p < 0.05 considered to be statistically signicant). (For interpretation of the references to color in this gure
legend, the reader is referred to the web version of the article.)
18
Fig. 2. Detection of DENV E antigen from the liver tissues of DENV- infected Balb/c
mice. (A) Western Blot analysis, using antibody to DENV E and normalized to GAPDH
(B) Densitometry analysis of DENV E protein normalized to GAPDH by Western blot
analysis Results were obtained from three animals (n = 3) from each group. Statistical
analysis was done by an unpaired t-test using GraphPad Prism 5 program and the
data were represented as mean SEM. The asterisk shows the level of signicance
(p < 0.05 considered to be statistically signicant).
Fig. 3. DENV induced liver injury in Balb/c mice. Mice were infected with L-15
medium or DENV at a dose of 4 105 FFU in a volume at 0.4 ml of L-15 medium.
Seven days after DENV infection, blood samples were processed for serum preparation and subsequent analysis of liver enzymes, ALT (A) and AST (B). The results
were obtained from twelve mice in each group and the exact values of enzymes
are expressed in scatter plot. The line represents the average value from the total
twelve mice from each group Statistical analysis was done by an unpaired t-test
using GraphPad Prism 5 program and the data were represented as mean SEM.
The asterisks show the level of signicance (p < 0.05 considered to be statistically
signicant).
Fig. 4. Histological analysis for DENV-induced liver injury in Balb/c mice. Mice were infected with L-15 medium or DENV at a dose of 4 105 FFU in a volume at 0.4 ml
of L-15 medium. Seven days after DENV infection, liver tissues were collected in 10% Formalin in PBS for histological examination (H&E staining). (A) Mock-infected liver
tissue which shows the normal pathology (B) DENV-infected liver tissue, which shows the classical liver injury induced by DENV, including ballooning of the hepatocyte,
cytoplasmic vacuolization, and cellular necrosis. The data shown are representatives for more than three independent experiments.
19
Table 1
Fold changes in the gene expression proling of DENV-infected mice compared to
control mice.
Gene name
Gene description
Fold changes
Tnf
Tnfrsf11b
4.9933
3.7581
Cd40lg
Bnip3l
Tnfsf10
Pycard
Cd70
Bnip3
Bcl2a1a
Fas
Traf1
Nod1
Dad1
Casp12
Bcl10
Bax
Bcl2l1
Cd40
Bid
Gadd45a
Diablo
Apaf1
Bad
Bak1
Bnip2
Casp14
Casp4
Fig. 5. DENV altered hematological parameters in Balb/c mice. Mice were infected
with L-15 medium or DENV at a dose of 4 105 FFU in a volume at 0.4 ml of L-15
medium. Seven days after DENV infection, blood samples were processed immediately for hematological analysis including white blood cells (A), platelets (B) and
hematocrit (C). The results obtained from two independent experiments with n = 6
for individual group. The results were expressed as mean SEM from twelve animals
from each group. The asterisks indicate statistically signicant differences between
groups (p < 0.05).
3.2266
3.1821
3.1167
3.0525
2.7895
2.6945
2.3950
2.2501
2.0994
1.9185
1.9053
1.8790
1.8404
1.8277
1.8150
1.8150
1.7532
1.7532
1.7291
1.7171
1.7171
1.6472
1.5801
1.5369
1.5263
in Balb/c mice resulted in detected levels of viral RNA, viral proteins and infectious viral particles. To calculate the copy number of
viral RNA, a standard control was rstly generated using DENV NS1
RNA derived from in vitro transcription with known copy number
as a template (Fig. 1A). Secondly, qRT-PCR assay was performed
using RNA extracted from mock or DENV-infected liver, respectively. Totally, 1.5 108 copies of DENV NS1 RNA were detected
in 1 g of total RNA from liver of DENV-infected mice, but none
was detected in control (Fig. 1B and C). In addition, viral titers
in liver extracts were determined to demonstrate the presence of
replicative viral particles after DENV infection. Mice were euthanized at day 7 after DENV infection and liver tissues from mock or
DENV-infected mice were homogenized and centrifuged to obtain
supernatant. The presence of infectious viral particles in supernatants was then measured by the FFU assay. Totally, 1.4 105 FFU
of infectious viral particles were detected in 1 mg of liver of DENVinfected mice, but none was detected in mock control (Fig. 1D).
Western blot analysis was subsequently performed to measure
the amount of viral proteins using an antibody specic to DENV
envelope protein (DENV E). DENV E was detected in livers of DENVinfected mice, but none was detected in control (Fig. 2A and B). The
result from this study and from others suggest that intravenous
injection system is the good route of administration of DENV in
Balb/c mice, as DENV antigens were detected, which is in contrast to
the subcutaneous injection system, in which DENV antigens could
not be easily detected (Franca et al., 2010).
Balb/c mice have been used to study liver injury during DENV
infection (Barth et al., 2006; Paes et al., 2005, 2009). Liver damage
was more severe in the intravenous injection as compared to the
intraperitoneal injection (Barth et al., 2006; Paes et al., 2005, 2009).
Elevation of liver enzymes showed a peak of both AST and ALT at the
7th day post DENV infection (Paes et al., 2005, 2009). In the present
study, DENV was injected intravenously and could induce liver
20
Fig. 6. TNF- expression was increased in DENV-infected Balb/c mice. Mice were
infected with L-15 medium or DENV at a dose of 4 105 FFU in a volume at 0.4 ml
of L-15 medium. Seven days after DENV infection, liver tissues were collected, and
RNA and protein was isolated. (A) The relative mRNA expression of TNF- by RTPCR; (B) Western bloting analysis of TNF- using antibodies to TNF-, normalized
to GAPDH; (C) Densitometric analysis of TNF- at protein level and normalized to
GAPDH by Western blot analysis. Results were obtained from three animals (n = 3)
from each group. Statistical analysis was done by an unpaired t-test using GraphPad
Prism 5 program and the data were represented as mean SEM. The asterisks show
the level of signicance (p < 0.05 considered to be statistically signicant).
injury in Balb/c mice at the 7th day post DENV infection (Fig. 3B and
C). Both AST and ALT levels in DENV-infected mice increased significantly compared to those of mock control. Moreover, AST level was
higher than ALT level, which is similar to those in DENV-infected
patients (Nguyen et al., 1997; Paes et al., 2005). Histological examination of liver tissues from DENV-infected mice in the present
study also conrmed the signs of liver injury including ballooning
of the hepatocyte, cytoplasmic vacuolization, and cellular necrosis
(Fig. 4A and B). Progressive necrosis in parenchyma (Franca et al.,
2010; Paes et al., 2005) and increased inltrating monocytes surrounding liver portal area, which could induce liver injury, were
previously reported in DENV-infected mice (de-Oliveira-Pinto et al.,
2012; Sung et al., 2012).
DENV altered hematological parameters of Balb/c mice in this
study. The number of white blood cells and platelets in DENVinfected mice were reduced by about 60% and 25%, respectively,
compared to that of mock-infected mice (Fig. 5A and B). In contrast,
hematocrit in DENV-infected mice was increased about 25% compared to that of mock-infected mice (Fig. 5C). Our result validates
the model that could mimic the leucopenia, thrombocytopenia,
and hemoconcentration found in other dengue models in C57BL/6
(Guabiraba et al., 2010) and in DENV-infected patients (Binh et al.,
2009).
Fig. 7. DENV induced the ERK 1/2 phosphorylation and FR180204 treatment
inhibited ERK 1/2 phosphorylation. Protein was extracted from the liver tissue of
mock-infected, DENV-infected, DMSO treated DENV-infected and FR180204 treated
DENV-infected mice. A cock-tail containing phosphatase inhibitors was also added
to maintain the phospho proteins and allowed them to be visualized by Western
blot analysis. (A) Western blot analysis using antibodies to phosphorylated-ERK1/2
(P-ERK 1/2) and total ERK1/2 (t-ERK 1/2) normalized to GAPDH (C) Densitometry
analysis of P-ERK 1, P-ERK 2 and t-ERK at protein level normalized to GAPDH by
Western blot analysis. Results were obtained from three animals (n = 3) from each
group. Statistical analysis was done by One-way ANOVA using GraphPad Prism 5
program and the data were represented as mean SEM. The asterisks show the
level of signicance (p < 0.05 considered to be statistically signicant).
21
Fig. 8. Quantication of viral NS1 and viral titers from liver tissues of DENV- infected FR180204 treated Balb/c mice. DENV-infected mice were either treated with 2% DMSO
(v/v) alone (n = 6) or treated with FR180204, dissolved in 2% DMSO at a dose of 50 mg/kg (n = 6). Treatments were given an hour before infection at a dose of 4 105 FFU and
at one and 24 h post infection. At day 7 post infection, liver tissues were collected and stored in RNA later. Total viral RNA was isolated for viral NS1 quantication, and
viral supernatant from the liver homogenate for the FFU assay. (A) Representative amplication plot for the NS1 copies of 2% DMSO (v/v) treated DENV-infected (pink) and
FR180204 treated DENV-infected mice (green). (C) Viral NS1 copies in 1 g total RNA of 2% DMSO (v/v) treated DENV-infected and FR180204 treated DENV-infected mice.
(D) Viral titers expressed from liver tissue homogenate in FFU per milligram (FFU/mg) of 2% DMSO (v/v) treated DENV-infected and FR180204 treated DENV-infected mice.
All the results were obtained from three animals (n = 3) from each group. For (B) and (C), statistical analysis was done by an un-paired t-test using GraphPad Prism 5 program
and the data were represented as mean SEM. (For interpretation of the references to color in this gure legend, the reader is referred to the web version of the article.)
Expression changes detected using the PCR arrays were subsequently conrmed by quantitative real-time PCR using different
set of primers. Total RNA was extracted from mock or DENVinfected liver and equivalent amounts of RNA from each sample
were converted to cDNA. Amplication was performed by TNF-
and GAPDH-specic primers using the SYBR Green I reaction mix;
the Ct of mRNA of the TNF- and GAPDH control were measured
and the differences between their Ct were calculated. The relative
expression values (2Ct ) were then determined. TNF--mRNA
expression increased dramatically, 30-fold post DENV infection
(Fig. 6A). Western blot analysis was performed and the result shows
that TNF- protein expression was also up-regulated in DENVinfected mice (Fig. 6B and C). Both DENV and TNF- were previously
shown to be critical for endothelium damage in a mouse model of
DENV infection (Chen et al., 2007). Moreover, anti-TNF antibody
22
Fig. 9. FR180204 treatment did not affect DENV production. DENV- infected mice
were either treated with 2% DMSO (v/v) alone (n = 6) and treated with FR180204
dissolved in 2% DMSO at a dose of 50 mg/kg (n = 6). Treatments were given an hour
before infection at a dose of 4 105 FFU and at one and 24 h post infection. At day
7 post infection, liver tissues were collected and stored in RNA later. (A) Western
Blot analysis using antibody to DENV E normalized to GAPDH (B) Densitometric
analysis of DENV E protein normalized to GAPDH by Western bloting. Results were
obtained from three animals (n = 3) from each group. Statistical analysis was done by
an unpaired t-test using GraphPad Prism 5 program and the data were represented
as mean SEM.
and ERK1/2 in Chang liver cells (Lee et al., 2008). However, the
in vivo role of ERK1/2 has not been investigated.
To provide insight into this issue, we rst asked whether
DENV induces phosphorylation of ERK1/2 in a mouse model of
DENV-induced liver injury. Total proteins from liver tissues of
DENV-infected mice were subjected to Western blot analysis using
antibodies against phosphorylated ERK1/2, total ERK1/2, or -actin,
respectively. The results show that DENV infection induced phosphorylation of ERK1/2 in vivo (Fig. 7A and B). To assess the role
of phosphorylated ERK1/2, the effect of FR180204, an inhibitor
of ERK1/2 phosphorylation, was tested by Western blot analysis. Treatment with FR180204 reduced in vivo phosphorylation of
ERK1/2 (Fig. 7A and B).
We next asked whether inhibition of phosphorylated ERK1/2 by
FR180204 treatment decreased DENV infection, apoptosis, and liver
damage. The detected levels of viral RNA, and the infectious viral
particles between DENV-infected Balb/c mice and inhibitor-treated
DENV-infected mice were similar (Fig. 8AC). Western blot analysis was also performed to measure the amount of viral proteins and
the results show that DENV E was detected in both DENV-infected
Balb/c mice and inhibitor-treated DENV-infected mice (Fig. 9A and
B). Therefore, inhibition of phosphorylated ERK1/2 by FR180204
treatment did not decrease DENV production. In contrast, inhibition of phosphorylated ERK1/2 by FR180204 treatment decreased
apoptosis. The result in Fig. 10A and B shows the decreased cleavage
form of caspase-3 in inhibitor-treated DENV-infected mice compared to that of DENV-infected mice. Furthermore, both AST and
ALT levels in inhibitor-treated DENV-infected mice decreased signicantly compared to those of DENV-infected mice (Fig. 11A and
B). The signs of liver injury including ballooning of the hepatocyte,
cytoplasmic vacuolization, and cellular necrosis were decreased in
FR180204 treated DENV-infected mice compared to that of DENVinfected mice (Fig. 12A and B) indicating the decreased liver injury
after FR180204 treatment. This effect was clearly not due to a reduction in DENV replication; therefore, ERK1/2 is likely involved in
23
Table 2
Ratio decreased in gene expression proling of FR180204 treated DENV-infected
mice compared to DENV-infected mice.
Gene name
Gene description
Ratio decreased
Apaf1
Cd40
Tnfsf10
0.824441
0.779302
0.761844
Bid
Bax
Gadd45a
Bcl2l1
Bnip3
Pycard
Fas
Casp4
Bad
Traf1
Bak
Cd40lg
Bnip2
Diablo
Nod1
Cd70
Dad1
Bcl10
Casp12
Tnfrsf11b
Bcl2a1a
Casp14
Tnf
Bnip3l
Fig. 11. FR180204 treatment reduced the liver injury associated with ERK 1/2 phosphorylation. DENV-infected mice were either treated with 2% DMSO (v/v) alone and
treated with FR180204 dissolved in 2% DMSO at a dose of 50 mg/kg. Treatments
were given an hour before infection at a dose of 4 105 FFU and at one and 24 h
post infection. Seven days after DENV infection, blood samples were processed for
serum preparation and subsequent analysis of liver enzymes, ALT (A) and AST (B).
The results were obtained from twelve mice in each group and the exact values of
enzymes are expressed in scatter plot. The line represents the average value from
the total twelve mice from each group. Statistical analysis was done by unpaired ttest using GraphPad Prism 5 program and the data were represented as mean SEM.
The asterisks show the level of signicance (p < 0.05 considered to be statistically
signicant).
0.755140
0.739370
0.724504
0.656121
0.648897
0.641526
0.633968
0.613096
0.599455
0.520360
0.506847
0.485936
0.478805
0.467799
0.456612
0.456596
0.441371
0.413602
0.405413
0.362708
0.358298
0.283076
0.220821
0.198927
Fig. 12. FR180204 reduced pathology in DENV-induced liver injury. DENV infected mice were either treated with 2% DMSO (v/v) alone (n = 6) and treated with FR180204
dissolved in 2% DMSO at a dose of 50 mg/kg (n = 6). Treatments were given an hour before infection at a dose of 4 105 FFU and at one and 24 h post infection. Seven days after
DENV infection, liver tissues were collected in 10% Formalin in PBS for histological examination (H&E staining). (A) The classical liver injury induced by DENV. (B) Recovery
from liver injuries by FR180204 treatment. The data shown is representative for more than three independent experiments.
24
Fig. 14. TNF- expression was decreased in DENV-infected Balb/c mice with
FR180204 treatment. DENV-infected mice were either treated with 2% DMSO (v/v)
alone (n = 6) and treated with FR180204 dissolved in 2% DMSO at a dose of 50 mg/kg
(n = 6). Treatments were given an hour before infection at a dose of 4 105 FFU, and
at one and 24 h post infection. Seven days after DENV infection, liver tissues were
collected, RNA and protein was isolated. (A) The relative mRNA expression of TNF-
by RT-PCR (B) Western blot analysis of TNF- using antibody to TNF-, normalized
to GAPDH (C) Densitometric analysis of TNF- at protein level normalized to GAPDH
by Western blot analysis. Results were obtained from three animals (n = 3) from each
group. Statistical analysis was done by an unpaired t-test using GraphPad Prism 5
program and the data were represented as mean SEM. The asterisks shows the
level of signicance (p < 0.05 considered to be statistically signicant).
These changes are consistent with the decrease in cleaved caspase3 in FR180204 treated DENV-infected mice (Fig. 10) indicating a
role of ERK1/2 signaling in DENV-induced apoptosis in vivo.
Fig. 13. Hematological parameters in DENV-infected Balb/c mice with FR180204
treatment. DENV-infected mice were either treated with 2% DMSO (v/v) alone and
treated with FR180204 dissolved in 2% DMSO at a dose of 50 mg/kg. Treatments
were given an hour before infection at a dose of 4 105 FFU, and at one and 24 h post
infection. Seven days after DENV infection, blood samples were processed immediately for hematological analysis including white blood cells (A), platelets (B) and
hematocrit (C). The results obtained from two independent experiments with n = 6
for individual group. The results were expressed as mean SEM from 12 animals
from each group. The asterisks indicate statistically signicant differences between
groups (p < 0.05).
4. Conclusions
DENV induces phosphorylated ERK1/2 in vivo and inhibition of
ERK1/2 by FR180204 treatment signicantly reduces immune cellinduced liver injury during DENV infection.
Acknowledgements
This work was supported by Siriraj Research and Development
Grant No. R015533001, Mahidol University, Thailand to TL. SG
was supported by Siriraj Graduate Thesis Scholarship. We appreciate the kind assistance from Dr. Amar Nagila for preparing the
viral stock, Professor William A. Fonzi, Professor Guy Haegeman,
for the critical reading and editing of this manuscript. TL and SN
are Thailand Research Fund (TRF) Scholars and PY is a TRF-Senior
Research Scholar.
References
Atrasheuskaya, A., Petzelbauer, P., Fredeking, T.M., Ignatyev, G., 2003. Anti-TNF antibody treatment reduces mortality in experimental dengue virus infection. FEMS
Immunol. Med. Microbiol. 35 (1), 3342.
25
Lee, Y.R., Lei, H.Y., Chen, S.H., Wang, J.R., Lin, Y.S., Yeh, T.M., Liu, C.C., Liu, H.S., 2008.
Signaling pathways involved in dengue-2 virus infection induced RANTES overexpression. Am. J. Infect. Dis. 4 (1), 3240.
Liao, H., Xu, J., Huang, J., 2010. FasL/Fas pathway is involved in dengue virus
induced apoptosis of the vascular endothelial cells. J. Med. Virol. 82 (8),
13921399.
Limjindaporn, T., Netsawang, J., Noisakran, S., Thiemmeca, S., Wongwiwat, W., Sudsaward, S., Avirutnan, P., Puttikhunt, C., Kasinrerk, W., Sriburi, R., Sittisombut,
N., Yenchitsomanus, P.T., Malasit, P., 2007. Sensitization to Fas-mediated apoptosis by dengue virus capsid protein. Biochem. Biophys. Res. Commun. 362 (2),
334339.
Limonta, D., Capo, V., Torres, G., Perez, A.B., Guzman, M.G., 2007. Apoptosis in tissues
from fatal dengue shock syndrome. J. Clin. Virol. 40 (1), 5054.
Lin, C.F., Wan, S.W., Chen, M.C., Lin, S.C., Cheng, C.C., Chiu, S.C., Hsiao, Y.L., Lei, H.Y.,
Liu, H.S., Yeh, T.M., Lin, Y.S., 2008. Liver injury caused by antibodies against
dengue virus nonstructural protein 1 in a murine model. Lab. Invest. 88 (10),
10791089.
Marianneau, P., Steffan, A.M., Royer, C., Drouet, M.T., Kirn, A., Deubel, V., 1998. Differing infection patterns of dengue and yellow fever viruses in a human hepatoma
cell line. J. Infect. Dis. 178 (5), 12701278.
Matsuda, T., Almasan, A., Tomita, M., Tamaki, K., Saito, M., Tadano, M., Yagita, H., Ohta,
T., Mori, N., 2005. Dengue virus-induced apoptosis in hepatic cells is partly mediated by Apo2 ligand/tumour necrosis factor-related apoptosis-inducing ligand.
J. Gen. Virol. 86 (Pt 4), 10551065.
Molthathong, S., Buaklin, A., Senapin, S., Klinbunga, S., Rojtinnakorn, J., Flegel, T.W.,
2008. Up-regulation of ribophorin I after yellow head virus (YHV) challenge
in black tiger shrimp Penaeus monodon. Fish Shellsh Immunol. 25 (12),
4046.
Morchang, A., Yasamut, U., Netsawang, J., Noisakran, S., Wongwiwat, W.,
Songprakhon, P., Srisawat, C., Puttikhunt, C., Kasinrerk, W., Malasit, P., Yenchitsomanus, P.T., Limjindaporn, T., 2011. Cell death gene expression prole:
role of RIPK2 in dengue virus-mediated apoptosis. Virus Res. 156 (12),
2534.
Nagila, A., Netsawang, J., Srisawat, C., Noisakran, S., Morchang, A., Yasamut, U., Puttikhunt, C., Kasinrerk, W., Malasit, P., Yenchitsomanus, P.T., Limjindaporn, T.,
2011. Role of CD137 signaling in dengue virus-mediated apoptosis. Biochem.
Biophys. Res. Commun. 410 (3), 428433.
Nagila, A., Netsawang, J., Suttitheptumrong, A., Morchang, A., Khunchai, S., Srisawat,
C., Puttikhunt, C., Noisakran, S., Yenchitsomanus, P.T., Limjindaporn, T., 2013.
Inhibition of p38MAPK and CD137 signaling reduce dengue virus-induced TNFalpha secretion and apoptosis. Virol. J. 10 (1), 105.
Nasirudeen, A.M., Liu, D.X., 2009. Gene expression proling by microarray analysis
reveals an important role for caspase-1 in dengue virus-induced p53-mediated
apoptosis. J. Med. Virol. 81 (6), 10691081.
Nasirudeen, A.M., Wang, L., Liu, D.X., 2008. Induction of p53-dependent and
mitochondria-mediated cell death pathway by dengue virus infection of human
and animal cells. Microbes Infect. 10 (1011), 11241132.
Netsawang, J., Noisakran, S., Puttikhunt, C., Kasinrerk, W., Wongwiwat, W., Malasit,
P., Yenchitsomanus, P.T., Limjindaporn, T., 2010. Nuclear localization of dengue
virus capsid protein is required for DAXX interaction and apoptosis. Virus Res.
147 (2), 275283.
Nguyen, T.L., Nguyen, T.H., Tieu, N.T., 1997. The impact of dengue haemorrhagic fever
on liver function. Res. Virol. 148 (4), 273277.
Ohori, M., Kinoshita, T., Okubo, M., Sato, K., Yamazaki, A., Arakawa, H., Nishimura,
S., Inamura, N., Nakajima, H., Neya, M., Miyake, H., Fujii, T., 2005. Identication
of a selective ERK inhibitor and structural determination of the inhibitor-ERK2
complex. Biochem. Biophys. Res. Commun. 336 (1), 357363.
Ohori, M., Takeuchi, M., Maruki, R., Nakajima, H., Miyake, H., 2007. FR180204, a novel
and selective inhibitor of extracellular signal-regulated kinase, ameliorates
collagen-induced arthritis in mice. Naunyn. Schmiedebergs Arch. Pharmacol.
374 (4), 311316.
Paes, M.V., Lenzi, H.L., Nogueira, A.C., Nuovo, G.J., Pinhao, A.T., Mota, E.M., Basiliode-Oliveira, C.A., Schatzmayr, H., Barth, O.M., Alves, A.M., 2009. Hepatic damage
associated with dengue-2 virus replication in liver cells of BALB/c mice. Lab.
Invest. 89 (10), 11401151.
Paes, M.V., Pinhao, A.T., Barreto, D.F., Costa, S.M., Oliveira, M.P., Nogueira, A.C., Takiya,
C.M., Farias-Filho, J.C., Schatzmayr, H.G., Alves, A.M., Barth, O.M., 2005. Liver
injury and viremia in mice infected with dengue-2 virus. Virology 338 (2),
236246.
Raman, M., Chen, W., Cobb, M.H., 2007. Differential regulation and properties of
MAPKs. Oncogene 26 (22), 31003112.
Renneson, J., Guabiraba, R., Maillet, I., Marques, R.E., Ivanov, S., Fontaine, J., Paget, C.,
Quesniaux, V., Faveeuw, C., Ryffel, B., Teixeira, M.M., Trottein, F., 2011. A detrimental role for invariant natural killer T cells in the pathogenesis of experimental
dengue virus infection. Am. J. Pathol. 179 (4), 18721883.
Shrestha, B., Pinto, A.K., Green, S., Bosch, I., Diamond, M.S., 2012. CD8+ T cells use
TRAIL to restrict West Nile virus pathogenesis by controlling infection in neurons. J. Virol. 86 (17), 89378948.
Souza, L.J., Alves, J.G., Nogueira, R.M., Gicovate Neto, C., Bastos, D.A., Siqueira, E.W.,
Souto Filho, J.T., Cezario Tde, A., Soares, C.E., Carneiro Rda, C., 2004. Aminotransferase changes and acute hepatitis in patients with dengue fever: analysis of
1585 cases. Braz. J. Infect. Dis. 8 (2), 156163.
Sun, P., Celluzzi, C.M., Marovich, M., Subramanian, H., Eller, M., Widjaja, S., Palmer, D.,
Porter, K., Sun, W., Burgess, T., 2006. CD40 ligand enhances dengue viral infection
of dendritic cells: a possible mechanism for T cell-mediated immunopathology.
J. Immunol. 177 (9), 64976503.
26
Sung, J.M., Lee, C.K., Wu-Hsieh, B.A., 2012. Intrahepatic inltrating NK and CD8T cells
cause liver cell death in different phases of dengue virus infection. PLoS ONE 7
(9), e46292.
Thongtan, T., Panyim, S., Smith, D.R., 2004. Apoptosis in dengue virus infected liver
cell lines HepG2 and Hep3B. J. Med. Virol. 72 (3), 436444.
Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from
polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. U.S.A. 76 (9), 43504354.
Warke, R.V., Martin, K.J., Giaya, K., Shaw, S.K., Rothman, A.L., Bosch, I., 2008.
TRAIL is a novel antiviral protein against dengue virus. J. Virol. 82 (1),
555564.
Yen, Y.T., Chen, H.C., Lin, Y.D., Shieh, C.C., Wu-Hsieh, B.A., 2008. Enhancement by
tumor necrosis factor alpha of dengue virus-induced endothelial cell production
of reactive nitrogen and oxygen species is key to hemorrhage development. J.
Virol. 82 (24), 1231212324.