Está en la página 1de 124

Captulo 9

Organizacin de las Genoma humano


Elgenomahumanosesubdivideenungrangenomanuclearconmsde26.000
genes, y un muy pequeo genoma mitocondrial circular con slo 37 genes. El
nuclear genoma se distribuye entre 24 molculas de ADN lineales, uno para cada
uno de los 24 diferentes tipos de cromosoma humano.
Losgeneshumanosporlogeneralnosonentidadesdiscretas:sus
transcripcionesconfrecuenciasesuperponenconlas de otros genes, a veces en
ambas cadenas.
Laduplicacindegenesindividuales,regionessubchromosomal,ogenomas
enteroshadadolugara familias de genes relacionados.
LosgenessontradicionalmentevistoscomoARNquecodificaparalaeventual
sntesisdeprotenas,pero muchos miles de genes de ARN no codificantes hacen
ARN funcionales que pueden estar implicados en diversas funciones.
RNAsnocodificantesamenudoregulanlaexpresindegenesdiana
especficosporapareamientodebasescon sus transcritos de ARN.
Algunascopiasdeungenfuncionalllegadoaadquirirmutacionesqueimpiden
suexpresin.
Estos pseudogenes se originan ya sea copiando el ADN genmico o copiando un
procesado Transcrito de ARN en una secuencia de ADNc que reintegra en el
genoma (retrotransposition).
Ocasionalmente,copiasdegenesqueseoriginanporretrotransposition
conservansufuncinporque de presin de seleccin. Estos son conocidos como
retrogenes.
Lostransposonessonsecuenciasquesemuevendeunlugaraotrogenmico
poruncorteypegar o mecanismo de copiar y pegar. Los retrotransposones hacer
una copia de ADNc de un ARN transcripcin, que luego se integra en una nueva
localizacin genmica.
Muygrandesconjuntosdecopiaaltonmeroderepeticionesentndem,
conocidocomoADNsatlite,son asociado con muy condensada
heterocromatina, transcripcionalmente inactiva en humanos cromosomas.
Pgina 2

El genoma humano comprende dos partes: un genoma nuclear complejo con ms


de 26.000 genes, y una muy simple genoma mitocondrial con slo 37 genes
(Figura9.1). El genoma nuclear proporciona el grueso de gentica esencial
informacin y se reparti entre ya sea 23 o 24 tipos diferentes de cromosomas
molcula de ADN Somal (22 autosomas ms un cromosoma X en las mujeres, y
una cromosoma Y adicional en los hombres).

Las mitocondrias poseen su propio genoma un nico tipo de pequea circular


ADN que codifica algunos de los componentes necesarios para la protena
mitocondrial sintesis sobre los ribosomas mitocondriales. Sin embargo, la
mayora de las protenas mitocondriales son codificadas por genes nucleares y
son sintetizadas en los ribosomas citoplasmticos antes siendo importados en la
mitocondria.
Como se detalla en el captulo 10, la comparacin de secuencias con otros
mamferos genomas y genomas de vertebrados indican que alrededor del 5% del
genoma humano ha sido fuertemente conservado durante la evolucin y es
presumiblemente funcionalmente importante. Las secuencias de ADN que
codifican protenas representan slo el 1,1% del genoma.
El otro 4% o secuencias del genoma de manera fuertemente conservadas consiste
en no
Las secuencias de ADN que codifican protenas, incluyendo los genes cuyos
productos finales son funcionalmente importantes molculas de ARN, y una
variedad de secuencias cis-actuando que regular la expresin gnica a nivel de
ADN o ARN. Aunque las secuencias que hacen no codificantes de protenas
ARN generalmente no han sido tan bien conservado durante la evolucin,
algunas de las secuencias reguladoras son mucho ms fuertemente conservadas
de que codifica la protena secuencias.
Secuencias que codifican protenas con frecuencia pertenecen a familias de
secuencias relacionadas que pueden organizarse en grupos de uno o ms
cromosomas o dispersarse todo el genoma. Estas familias han surgido por la
duplicacin de genes durante evolucin. Los mecanismos que dan lugar a la
duplicacin de genes tambin dan lugar a las no secuencias funcionales
relacionadas con el gen (pseudogenes).
Una de las grandes sorpresas en los ltimos aos ha sido el descubrimiento de
que la genoma humano se transcribe para dar decenas de miles de diferentes no
codificante Transcritos de ARN, incluyendo nuevas clases enteras de pequeos
ARN regulador no anteriormente identificadas en el proyecto de secuencias del
genoma humano publicado en 2001.
A pesar de que estamos cerca de obtener un inventario definitivo de la protena
humana codificing genes, nuestro conocimiento de los genes de ARN no se ha
desarrollado. Est muy claro, sin embargo, que el ARN es funcionalmente mucho
ms verstil de lo que previamente sospechado. Adems de una lista cada vez
mayor de genes de ARN humanos, tenemos tambin tomar conciencia de un gran
nmero de copias de genes de ARN pseudogene.
Una gran fraccin del genoma humano y otros genomas complejos, es compuesto
por secuencias de ADN no codificantes altamente repetitivas. Un componente
importante se organiza en repeticiones en tndem de cabeza a cola, pero la

mayora se compone de inter- repite spersed que han sido copiadas de las
transcripciones de ARN en la clula inversa
genoma nuclear
genoma mitocondrial
secuencias altamente conservadas
genes que codifican protenas
Genes de ARN, secuencias reguladoras
secuencias mal conservadas
repeticiones basado en transposn
heterocromatina
otras secuencias
Figura 9.1 Secuenciadeconservaciny
clases de secuencia en el nucleares humana
y genomas mitocondriales. Para tener una
idea de la enorme diferencia de escala entre
la nuclear (izquierda) y mitocondrial
(derecha) genomas, el pequeo punto rojo en el
centro representa el equivalente de
25 El ADN mitocondrial (ADNmt) en los genomas
la misma escala que el genoma nuclear sola
a la izquierda. Tenga en cuenta tambin la diferencia profunda
entre los dos genomas en las fracciones
de ADN altamente conservado y tambin en el
fraccin de ADN no codificante altamente repetitivo.
Pgina 3

257
transcriptasa. Hay una conciencia creciente de la importancia funcional de tales
repite.
En este captulo se considera principalmente la arquitectura del genoma humano.
Describimos las diferentes clases de secuencia de ADN, describimos brevemente
cul es su
funcin es, y debe tener en cuenta la forma en que se organizan en el genoma
humano. en adelante
captulos que describen otros aspectos del genoma humano: cmo se compara
con
otros genomas, y cmo la evolucin ha dado forma (Captulo 10), secuencia de
ADN
variacin y el polimorfismo (Captulo 13), y los aspectos de la expresin de
genes humanos
sin (Captulo 11).
9.1 ORGANIZACIN GENERAL DE LA HUMANA

GENOMA
La secuencia de ADN del genoma mitocondrial humano se public en 1981,
y una comprensin detallada de cmo el ADN mitocondrial (ADNmt) trabaja
tiene
ha construido desde entonces. El genoma nuclear ms complejo ha sido un tanto
desafo ms formidable. Secuenciacin completa de genoma nuclear
comenz en la ltima parte de la dcada de 1990, y en 2004 prcticamente la
totalidad del euchroporcin matic del genoma se ha secuenciado. Nuestro conocimiento de la nuclear
genoma restos fragmentarios, sin embargo. Como veremos ms adelante, todava
no sabemos
cuntos genes hay en el genoma nuclear, y los datos obtenidos son recientemente
cambiando radicalmente nuestra perspectiva sobre cmo se organiza y se
expresa.
El genoma mitocondrial est densamente poblada por gentica
informacin
El genoma mitocondrial humano se compone de un solo tipo de doble circular
ADN de cadena que es de 16,6 kilobases de longitud. La composicin base es en
general
44% (G + C), pero las dos cadenas de ADN mitocondrial tienen
significativamente diferentes compo- base de
siciones: la pesada (H) captulo es rico en guanines, pero la luz (L) es rica en
cadena
citosinas. Las clulas contienen generalmente miles de copias de la hebra doble
molcula de ADNmt, pero el nmero puede variar considerablemente en
diferentes tipos de clulas.
Durante la formacin del cigoto, un espermatozoide aporta su genoma nuclear,
pero
no su genoma mitocondrial, a la clula huevo. En consecuencia, el mitocondrial
genoma del cigoto se determina por lo general exclusivamente por que
originalmente se encuentra en
el vulo no fertilizado. Por consiguiente, el genoma mitocondrial es la madre
inherente
ITED: machos y hembras tanto heredan sus mitocondrias de su madre, pero
los machos no transmiten sus mitocondrias a las generaciones
posteriores. Durante
la divisin celular mittico, las mltiples molculas de ADNmt en una clula que
se divide la segregacin
de una manera puramente aleatoria de las dos clulas hijas.
La replicacin de ADN mitocondrial
La replicacin de las dos hebras H y L es unidireccional y se inicia en concreto

orgenes. Aunque el ADN mitocondrial es principalmente de doble cadena, repita


sntesis de un pequeo segmento de la DNA H-strand produce tercera ADN corto
hebra de ADN llamada 7S. La cadena de ADN 7S puede aparearse con la cadena
Ly
desplazar la hebra H, lo que resulta en una estructura de triple
cadena (Figura9.2). Esta
regin contiene muchas de las secuencias de control del ADNmt (incluyendo el
principal proregiones moter) y por lo que se conoce como la regin CR / D-loop (donde
denota CR
regin de control, y D-loop es sinnimo de bucle de desplazamiento).
El origen de replicacin para la cadena H se encuentra en la regin / D-loop CR,
y
el de la cadena L se intercala entre dos genes tRNA (Figura9.3). Solamente
Despus de aproximadamente dos tercios de la cadena hija H ha sido sintetizado
(mediante el uso de
la cadena L como una plantilla y el desplazamiento de la vieja H hebra) hace el
origen de
La replicacin-L hebra quedaran al aire. A partir de entonces, la replicacin de la
cadena L proCeeds en la direccin opuesta, utilizando la cadena H como una plantilla.
Los genes mitocondriales y su transcripcin
El genoma mitocondrial humano contiene 37 genes, 28 de los cuales estn
codificados
por la hebra H y los otros nueve por la L hebra (vase la figura 9.3). Mientras
genes nucleares a menudo tienen sus propios promotores dedicados, la
transcripcin de
genes mitocondriales se parece al de los genes bacterianos. La transcripcin del
ADN mitocondrial
ORGANIZACIN GENERAL DEL GENOMA HUMANO
L hebra
cadena H
ADN 7S
Figura 9.2 Dloopformacinen
ADN mitocondrial. El mitocondrial
genoma no es un simple doble hebra
ADN circular. Repita la sntesis de una pequea
segmento de la H (pesadas) da como resultado el filamento en un
tercera hebra corta (7S ADN), que puede Baseemparejarse con la cadena L (luz) y as desplazar
la cadena H para formar una triple hebra locales

estructura que contiene numerosas e importantes


secuencias reguladoras y se conoce como el
Regin / lazo D CR (indicada por el sombreado y en
forma ampliada para mayor claridad).
pgina 4

Captulo 9: Organizacin del Genoma Humano


258
comienza a partir de promotores comunes en la regin / lazo D CR y contina
ronda
el crculo (en direcciones opuestas para las dos hebras diferentes), para generar
grandes
transcripciones multigenic. Los ARN maduros se generan posteriormente por
escisin
de las transcripciones multignicas.
Casi dos tercios (24 de 37) de los genes mitocondriales especifican una funcin
ARN no codificante cional como su producto final. Hay 22 genes de ARNt, una
para
cada uno de los 22 tipos de tRNA mitocondrial. Adems, dos genes de ARNr son
dediicated a hacer ARNr 16S y 12S rRNA (componentes de la grandes y pequeos
subunidades, respectivamente, de los ribosomas mitocondriales). Los 13 genes
restantes
codifican polipptidos, que se sintetizan en ribosomas mitocondriales. Estas
13 polipptidos forman parte de los complejos respiratorios mitocondriales, la
enzimas de la fosforilacin oxidativa que se dedican a la produccin de ATP.
Sin embargo, la gran mayora de los polipptidos que componen el mitocondrial
sistema de fosforilacin oxidativa, ms todas las otras protenas mitocondriales
son
codificadas por los genes nucleares (Tabla9.1). Estas protenas se traducen en
cytoplasribosomas micrfono antes de ser importados en las mitocondrias.
A diferencia de su homlogo nuclear, el genoma mitocondrial humano es
extremadamente
compacta: los 37 genes mitocondriales carecen de intrones y estn
hermticamente (en promedio
edad, hay un gen por 0,45 kb). Las secuencias de codificacin de algunos genes
(en particular,
los que codifican las subunidades de sexto y octavo de la ATP sintasa
mitocondrial)

mostrar cierta superposicin (Figura9.4) y, en la mayora de los otros casos, las


secuencias codificadoras de
genes vecinos son contiguas o separadas por una o dos bases no codificantes.
Algunos genes an carecen de codones de terminacin; para superar esta
deficiencia, SAU
codones que se han introducido en el nivel post-transcripcional (vase la Figura
9.4).
El cdigo gentico mitocondrial
Genomas procariotas y los genomas nucleares de eucariotas codifican muchos
HunDreds que por lo general muchos miles de protenas diferentes. Estn sujetos a
una unicdigo gentico versal que se mantiene invariable: mutaciones que podran
potencialmente el cambio
Phe
12S
16S
Val
Leu
ND1
ND2
CO1
CO2
ATP8
ATP6
CO3
ND3
ND4L
ND4
ND5
ND6
CYB
Ile
f-Met
Trp
spid
Gly
Arg
Su
Ser
Ser

Leu
Thr
Lys
Pro
Glu
Tyr
Cys
Asn
Ala
gln
O
L
O
MARIDO
O
MARIDO
O
L
P
L
P
MARIDO
7S
ADN
MARIDO
hebra
L
hebra
P
MARIDO
P
L
orgenes de replicacin y
direccin de la sntesis de
de H y L hebras
promotores y
direccin de la transcripcin
de H y L hebras
rRNA genes
genes de ARNt
genes que codifican protenas

Figura 9.3 Laorganizacindelosrecursoshumanos


genoma mitocondrial. La hebra H
se transcribe a partir de dos estrechamente espaciados
regiones promotoras que flanquean el tRNA
Phe
gen (agrupados aqu como P
MARIDO
); la cadena L es
transcrito a partir del P
L
promotor en la
direccin contraria. En ambos casos, gran
transcritos primarios se producen y
escinde para generar ARN para el individuo
genes. Todos los genes carecen de intrones y son estrechamente
agrupado. Los smbolos para la codificacin de protenas
genes se muestran aqu sin el prefijo
MT- que significa gen mitocondrial. los
genes que codifican subunidades de 6 y 8 de la
ATP sintasa (ATP6 y ATP8) son en parte
superposicin. Otro polipptido que codifica
genes especifican siete NADH deshidrogenasa
subunidades (ND4L y ND1-ND6), tres
citocromo c oxidasa subunidades (CO1-CO3),
y el citocromo b (CYB). tRNA genes son
representado con el nombre de la amino
cido que se unen. La corta cadena de ADN 7S
se produce por sntesis repeticin de un corto
segmento de la cadena H (vase la figura 9.2).
Para ms informacin, consulte la MITOMAP
base de datos en http://www.mitomap.org/.
pgina 5

259
el cdigo gentico son propensos a producir al menos algunos pro- crticamente
misfunctional
protenas y por lo que estn fuertemente seleccionados en contra. Sin embargo, la
mitocondrias mucho menor
genomas drial hacen muy pocos polipptidos. Como resultado, la gentica
mitocondrial
cdigo ha sido capaz de desplazarse por mutacin a ser un poco diferente de lo
universal

codigo genetico.
En el cdigo gentico mitocondrial hay 60 codones que especifican amino
cidos, uno menos que en el cdigo gentico nuclear. Hay cuatro codones de
terminacin:
UAA y UAG (que tambin sirven como los codones de parada en el cdigo
gentico nuclear) y
AGA y AGG (que especifica la arginina en el cdigo gentico nuclear; vase la
figura
1,25). La parada nuclear codn UGA codifica el triptfano en la mitocondria, y
AUA especifica metionina no isoleucina.
El genoma mitocondrial especifica todas las molculas de ARNr y ARNt
necesarios
para la sntesis de protenas en los ribosomas mitocondriales, pero confa en
nucleares
genes codificados para que los otros componentes, tales como los componentes
proteicos
de los ribosomas mitocondriales y sintetasas de aminoacil tRNA. Porque hay
slo 22 diferentes tipos de tRNA mitocondrial humano, las molculas de ARNt
individuales
tenga que ser capaz de interpretar varios codones diferentes. Esto es posible
debido a
bamboleo de tercera base en la interpretacin de codones. Ocho de las 22
molculas de ARNt tienen
anticodones que cada reconocen familias de cuatro codones que slo difieren en
la tercera
base. Los otros 14 tRNAs reconocen pares de codones que son idnticos en la
primera
dos posiciones de base y comparten una purina o una pirimidina en la tercera
base.
Entre ellos, por lo tanto, las 22 molculas de ARNt mitocondriales pueden
reconocer una
total de 60 codones [(8 4) + (14 2)].
ORGANIZACIN GENERAL DEL GENOMA HUMANO
TABLA 9.1 EL autonoma limitada del genoma mitocondrial
componente mitocondrial
codificada por
mitocondrial
genoma
genoma nuclear
Los componentes de la fosforilacin oxidativa
sistema

13 subunidades
80 subunidades
yo
NADH deshidrogenasa
7
42
Reductasa II succinato de CoQ
0
4
III citocromo b - c
1
complejo
1
10
IV citocromo c oxidasa complejo
3
10
V
Complejo ATP sintasa
2
14
Los componentes del aparato de sntesis de protenas
24 ARNs
79 protenas
rRNA
2
0
ARNt
22
0
protenas ribosomales
0
79
Otras protenas mitocondriales
0
Todas
un
un
Incluye polimerasas de ADN y ARN mitocondrial, adems de otras numerosas
enzimas, estructural y
protenas de transporte, etc.

CCAAAATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCT
AGGCCTA
ATG
Acata
Pro
Reuni
1
Lys Trp Thr Lys Ile Cys Ser Leu Su Ser Leu Pro Pro Gln Ser
53
8366
8522
68
Met Asn Glu Asn Leu Phe Ala Ser Phe Ile Ala Pro Thr Ile Leu Gly Leu
Thr
1
17
226
Detener
8577 9202 9206
MT-ATP8
MTATP6
Figura 9.4 El MTATP6 yMTATP8
los genes son transcritos en diferentes
marcos de lectura de la superposicin de
segmentos de la H mitocondrial
hebra. MT-ATP8 se transcribe a partir
nucletidos 8366 a la 8569 y MTATP6
de 8527 a 9204. Despus de la transcripcin,
el ARN que codifica la ATP sintasa 6
subunidad se escinde despus de la posicin 9206
y poliadenilado, resultando en una
Codn UAA C-terminal en el que el primero
dos nucletidos se derivan en ltima instancia
de la TA en las posiciones 9205-9206
y la tercera de nucletidos es la primera A de
el poli (A) de la cola.
Pgina 6

Captulo 9: Organizacin del Genoma Humano


260
Adems de sus diferencias en la capacidad gentica y diferentes cdigos
genticos,

los genomas mitocondriales y nucleares difieren en muchos otros aspectos de su


organizacin y expresin (Tabla9.2).
El genoma nuclear humano se compone de 24 ampliamente diferentes
molculas de ADN cromosmico
El genoma nuclear humano es 3,1 Gb (3.100 Mb) de tamao. Se distribuye entre
24 diferentes tipos de molcula de doble cadena lineal de ADN, cada uno de los
cuales tiene
histonas y protenas nonhistone ligados a ella, que constituyen un
cromosoma. Ah
son 22 tipos de autosoma y dos cromosomas sexuales, X e Y. Humanos
cromosoma
somes puede ser fcilmente diferenciados por bandeo cromosmico (vase la
Figura 2.15), y
se han clasificado en grupos en gran medida en funcin del tamao y, en cierta
medida,
la posicin del centrmero (ver Tabla 2.3).
Hay un solo genoma nuclear en espermatozoides y vulos y slo dos copias en
la mayora de las clulas somticas, en contraste con los cientos o incluso miles
de copias de la
genoma mitocondrial. Debido a que el tamao del genoma nuclear es de
aproximadamente 186.000
veces el tamao de una molcula de ADNmt, sin embargo, el ncleo de una
clula humana tpica
camente contiene ms de 99% del ADN en la clula; el ovocito es una notable
excepcin
cin, ya que contiene hasta 100.000 molculas de ADNmt.
No todo el genoma nuclear humano ha sido secuenciado. El humano
Proyecto Genoma centra principalmente en la eucromatina secuenciacin, el gen
ricos,
transcriptionally regiones activas del genoma nuclear que dan cuenta de 2,9 GB.
El otro 200 Mb se compone de condensado de forma permanente y
transcriptionally
inactiva (constitutivo) heterocromatina. La heterocromatina se compone de
largas series de ADN altamente repetitivo que son muy difciles de secuenciar
con precisin.
Por una razn similar, las largas series de unidades de transcripcin repetidas en
tndem
codificacin de 28S, 18S y 5.8S rRNA tambin no se secuenciaron.
El ADN de los cromosomas humanos vara considerablemente en longitud y
tambin en
las proporciones de eucromatina subyacente y heterocromatina constitutiva

(Tabla9.3). Cada cromosoma tiene algo de heterocromatina constitutiva en el


TABLA 9.2 NUCLEAR HUMANA Y MITOCONDRIAL GENOMAS
genoma nuclear
genoma mitocondrial
tamao
3.1 Gb
16.6 kb
Nmero de diferentes molculas de ADN
23 (en las clulas XX) o 24 (en las clulas XY); todo lineal
una molcula de ADN circular
Nmero total de molculas de ADN por clula
vara en funcin de la ploida; 46 en clulas diploides
menudo varios miles de copias (pero el nmero de copias
vara en diferentes tipos de clulas)
protena asociada
varias clases de histonas y protenas no histona
en gran parte libre de protenas
Nmero de genes21,000 codificantes de protenas
13
Nmero de genes de ARN
incierto, pero> 6000
24
Gen density1 / 120 kb, pero una gran incertidumbre
1 / 0,45 kb
ADN repetitivo
ms de 50% de genoma; vase la Figura 9.1
muy poco
Transcripcin
genes a menudo se transcriben independientemente
transcripciones multignicas se producen a partir tanto
las hebras pesadas y ligeras
Los intrones
encontrado en la mayora de genes
ausente
Porcentaje de ADN codificante de la protena 1,1% 66%
El uso de codones
61 codones de aminocidos ms tres codones de parada
un
60 codones de aminocidos ms cuatro codones de parada
un
La recombinacin

al menos una vez para cada par de homlogos en la meiosis


no es evidente
Herencia
Mendeliana para el cromosoma X y autosomas;
paterno para el cromosoma Y
exclusivamente materna
un
Para ms detalles vase la Figura 1.25.
pgina 7

261
centrmero. Ciertos cromosomas, en particular 1, 9, 16 y 19, tambin tienen
importantes
cantidades de heterocromatina en la regin eucromtica cerca del centrmero
(Pericentromere), y los cromosomas acrocntricos tienen cada uno dos geneidad
considerable
erochromatic regiones. Pero la representacin ms importante est en el
cromosoma Y
algunos, donde la mayor parte del ADN est organizado como heterocromatina.
La composicin de base del componente euchromatic del genoma humano
promedia en 41% (G + C), pero existe una variacin considerable entre los
cromosomas
somes, de 38% (G + C) de los cromosomas 4 y 13 hasta 49% (para el cromosoma
19). Tambin vara considerablemente a lo largo de las longitudes de
cromosomas. Por ejemplo,
de la media (G + C) contenido en el cromosoma 17q es 50% para los distales
10.3 Mb pero
se reduce a un 38% de los 3,9 Mb adyacentes. Hay regiones de menos de 300 kb
con
oscilaciones incluso ms anchas, por ejemplo, de 33,1% a 59,3% (G + C).
La proporcin de algunas combinaciones de nucletidos puede variar
considerablemente.
Al igual que otros genomas nucleares de vertebrados, el genoma nuclear humano
tiene una conescasez conspicuo del dinucletido CpG. Sin embargo, ciertas pequeas regiones
de
transcripcionalmente activo DNA tiene la densidad de CpG esperado y,
significativamente,
son (islas CpG; Box9.1) no metilados o hypomethylated.
El genoma humano contiene al menos 26.000 genes, pero la exacta
el nmero de genes es difcil determinar

Varios aos despus de que el Proyecto del Genoma Humano entreg la primera
referencia
secuencia del genoma, todava hay muy considerable incertidumbre sobre el total
de
nmero de genes humanos. Cuando se informaron los primeros anlisis del
genoma en
2001, el catlogo de genes generadas por la Internacional secuenciacin del
Genoma Humano
ING Consorcio fue muy orientada hacia los genes codificantes de
protenas. Original
estimaciones sugieren ms de 30.000 genes codificadores de protenas humanas,
la mayora de
cuales eran las predicciones de genes sin ninguna evidencia experimental de
apoyo. Esta
nmero fue una sobreestimacin debido a los errores que se hicieron en los genes
que definen
(vase el recuadro 8.5).
Para validar las predicciones de genes evidencia de apoyo se solicit, en su
mayora por lucin
comparaciones revolu-. Comparacin con otros genomas de mamferos, tales
como
ORGANIZACIN GENERAL DEL GENOMA HUMANO
TABLA DE CONTENIDO 9.3 de ADN de cromosomas humanos
Cromosoma
El ADN total
(Megabyte)
eucromatina
(Megabyte)
heterocromatina
(Megabyte)
Cromosoma
El ADN total
(Megabyte)
eucromatina
(Megabyte)
heterocromatina
(Megabyte)
1
249
224
19.5

13
115
96.3
17.2
2
243
240
2.9
14
107
88.3
17.2
3
198
197
15
15
103
82.1
18.3
4
191
188
3.0
diecisis
90
79.0
10.0
5
181
178
0,3
17
81
78.7
7.5
6
171
168
2.3
18

78
74.6
1.4
7
159
156
4.6
19
59
60.8
0,3
8
146
143
2.2
20
63
60.6
1.8
9
141
120
18.0
21
48
34.2
11.6
10
136
133
2.5
22
51
35.1
14.3
11
135
131
4.8
incgnita
155

151
3.0
12
134
131
4.3
Y
59
26.4
31.6
Tamaos cromosmicos se toman de la Ensembl Ver Mapa Humanos
(http://www.ensembl.org/Homo_sapiens/Location/Genome). heterocromatina
cifras son estimaciones abstradas de Internacional de Secuenciacin del Genoma
Humano Consorcio (2004), Nature 431, 931-945. El tamao del total humana
genoma se estima en alrededor de 3,1 Gb, con la contabilidad de la eucromatina
por cerca de 2,9 Gb y heterocromatina que tengan 200 Mb.
pgina 8

Captulo 9: Organizacin del Genoma Humano


262
los del ratn y el perro, fallado en identificar homlogos de muchos de los
originalmente predicho los genes humanos. A finales de 2009, el nmero
estimado de humanos
genes que codifican protenas parecan estar estabilizndose en algn lugar
alrededor de 20.000
21.000, pero se mantuvo una enorme incertidumbre sobre el nmero de genes de
ARN humanos.
Genes de ARN son difciles de identificar mediante el uso de programas
informticos para analizar
secuencias del genoma: no hay marcos de lectura abiertos para detectar el, y
muchos
Genes de ARN son muy pequeas y no suelen estar bien conservado durante la
evolucin. Ahi esta
tambin el problema de cmo definir un gen de ARN. Como se detalla en el
captulo 12, comanlisis integrales han sugerido recientemente que la gran mayora de la
-genoma y, probablemente, al menos el 85% de los nucletidos se transcribe. Es
actualmente
desconocido cunto de la actividad transcripcional es el ruido de fondo y cmo
tanto es funcionalmente significativa.
A mediados de 2009 se haban obtenido evidencia de al menos 6000 genes de
ARN humanos,

incluyendo miles de genes que codifican los ARN no codificantes larga que se
piensa
ser importante en la regulacin de genes. Adems, hay evidencia de decenas de
mil
arenas de diferentes ARNs humanos diminutos, pero en muchos casos bastante
grandes nmeros
de diferentes ARNs pequeos se obtienen mediante el procesamiento de los
transcritos de ARN individuales.
Nos fijamos en los ARN no codificantes en detalle en la Seccin 9.3.
La combinacin de unos 20.000 genes codificadores de protenas y ARN al
menos 6000
genes, aporta un total de al menos 26.000 genes humanos. Esto sigue siendo un
provisional
el nmero total de genes; la definicin de los genes de ARN es un reto y que
pasar algn tiempo
antes de obtener un nmero exacto de genes humanos.
Metilacin del ADN en los animales multicelulares a menudo implica la
metilacin
de una proporcin de residuos de citosina, dando 5-metilcitosina (mC).
En la mayora de los animales (pero no Drosophila melanogaster), el
dinucletido
CpG es un objetivo comn para la metilacin de citosina por citosina especfica
methyltransferases, formando mCpG (Figura1A).
La metilacin del ADN tiene importantes consecuencias para el gen
expresin y permite en particular patrones de expresin gnica que sean de forma
estable
transmitida a las clulas hijas. Tambin se ha implicado en los sistemas
de la defensa del husped contra los transposones. Los vertebrados tienen la
mayor
los niveles de 5-metilcitosina en el reino animal, y la metilacin
se dispersa a lo largo de los genomas de vertebrados. Sin embargo, slo una
pequea
porcentaje de las citosinas estn metiladas (alrededor de 3% en el ADN humano,
sobre todo como mCpG pero con un pequeo porcentaje como mCpNpG, donde
N es
cualquier nucletido).
5-metilcitosina es qumicamente inestable y es propenso a
desaminacin (vase la Figura 1A). Otras bases desaminados producen
derivados que son identificadas como anormales y se eliminan mediante la
Maquinaria de reparacin del ADN (por ejemplo, citosina no metilada produce
uracilo

cuando desaminados). Sin embargo, 5-metil citosina se desamina a


dar timina, una base natural en el ADN que no se reconoce como ser
anormal por los sistemas de reparacin del ADN celular. Durante mucho
evolutivamente
perodos, por lo tanto, el nmero de dinucletidos CpG en vertebrados
ADN ha ido disminuyendo debido a la lenta pero constante
conversin de C a T pG pG (C ya pA en la complementaria
hebra; Figura 1B).
Aunque la frecuencia global de CpG en el genoma de los vertebrados
es baja, hay pequeos tramos de no metilado o hypomethylated
ADN que se caracterizan por tener la normal y esperado CpG
frecuencia. Tales islas de densidad normal (islas CpG GPC) estn
relativamente rica en GC (tpicamente ms de 50% de GC) y se extienden por
encima
cientos de nucletidos. Islas CpG son marcadores de genes porque
estn asociados con regiones transcripcionalmente activas. altamente metilado
Las regiones de ADN son propensos a la adopcin de la cromatina condensada
conformacin, pero para la transcripcin de ADN activamente las necesidades de
la cromatina
estar en una conformacin no metilada ms extendida, abierta que
permite que varias protenas reguladoras que se unen ms fcilmente a los
promotores
y otras regiones de control de genes.
Figura 1 LainestabilidaddedinucletidosCpGdevertebrados. (A)El
citosina
en los dinucletidos CpG es un objetivo para la metilacin en el tomo de
carbono 5 .
El 5-metilcitosina resultante se desamina para dar timina (T), que
se ineficientemente reconocido por el sistema de reparacin del ADN y as tiende
a
persisten (sin embargo, la desaminacin de la citosina no metilada da uracilo
que es fcilmente reconocido por el sistema de reparacin del ADN). (B) El
vertebrado
Dinucletido CpG est siendo sustituida gradualmente por TPG y CPA.
ISLAS CUADRO 9.1 ANIMAL ADN CpG metilacin y VERTEBRADO
O
do
do
norte
CH
CH

NUEVA HAMPSHIRE
NUEVA HAMPSHIRE
2
citosina
5-metilcitosina
timina
(forma desajuste con G;
ineficiente reconocido por
Sistema de reparacin del ADN)
(UN)
(SEGUNDO)
2
1
3
4
5
6
O
do
do
norte
do
CH
NUEVA HAMPSHIRE
NUEVA HAMPSHIRE
2
metilacin
a las 5 de carbono
desaminacin
5
3
C pG
desaminacin
CH
3
O
O
do
do
HN
do

CH
NUEVA HAMPSHIRE
CH
3
metro
3
5
gp C
metro
la duplicacin del ADN
5
3
T pG
3
5
gp C
metro
5
3
T pG
3
5
ApC
5
3
CpG
3
5
gp C
metro
+
pgina 9

263
Los genes humanos estn distribuidos de manera desigual entre y dentro de
cromosomas
Genes humanos estn distribuidos de manera desigual sobre las molculas de
ADN nuclear. La estafaregiones de heterocromatina constitutiva estn desprovistos de los genes y, aun
dentro de la

eucromtica porcin del genoma, la densidad de genes puede variar


sustancialmente entre
regiones cromosmicas y tambin entre los cromosomas enteros.
La primera idea general de cmo los genes se distribuyen a travs de la humana
se obtuvo genoma cuando se purifica fracciones isla CpG se hibrid con
cromosomas en metafase. Islas CpG durante mucho tiempo han sido conocidos
por ser fuertemente
asociado a los genes (vase el recuadro 9.1). Sobre esta base, se concluy que el
gen
densidad debe ser alta en las regiones subtelomricas, y que algunos cromosomas
(por ejemplo, 19 y 22) son ricos en genes mientras que otros (por ejemplo, X y
18) son pobres en genes (vase
Figura 8.17). Las predicciones de la diferencia de densidad isla CpG y
diferenciado
la densidad de genes se confirmaron posteriormente mediante el anlisis del
genoma humano
secuencia.
Esta diferencia en la densidad de genes tambin puede ser visto con la tincin de
Giemsa (G de banda
ing) de cromosomas. Las regiones con un bajo contenido en (G + C) se
correlacionan con la oscuridad
est bandas G, y los que tienen un alto contenido en (G + C) con bandas
plidas. Rica en GC cromosomes (por ejemplo, el cromosoma 19) y regiones (por ejemplo plido bandas
G) son tambin
relativamente rica en genes. Por ejemplo, el gen de leucocitos humanos ricos
antigen (HLA) complejos (180 genes codificadores de protenas en un lapso de 4
Mb) se encuentra dentro de
el plido 6p21.3 banda. Instriking contraste, el gen de la distrofina mamut se
extiende
ms de 2,4 Mb de ADN en una banda oscura en G Xp21.2 sin evidencia de
cualquier otra
gen que codifica la protena en esta regin.
La duplicacin de segmentos de ADN que se ha traducido en el nmero de
copias
familias de genes y la variacin
Genomas pequeos, tales como los de bacterias y mitocondrias, son tpicamente
fuertemente
lleno de informacin gentica que se presenta en extremadamente econmico

formas. Grandes genomas, tales como los genomas nucleares de los eucariotas, y
especialmente de vertebrados genomas, tienen el lujo de no estar tan
restringida. repetitivo
El ADN es una caracterstica llamativa de grandes genomas, tanto en abundancia
y
importancia.
Los diferentes tipos de secuencia de ADN se pueden repetir. Algunos son cortos
no codificante
secuencias que estn presentes en unas pocas copias a millones de copias. Estos
sern
se analiza en la Seccin 9.4. Muchos otros son moderadamente largo a ADN
grande
secuencias que a menudo contienen genes o partes de genes. Tales secuencias
duplicadas
son propensos a diversos mecanismos genticos que dan lugar a la variacin del
nmero de copias
(CNV) en la que el nmero de copias del especfico sequences- moderadamente
larga
a menudo de muchos kilobases a varias megabases largo vara entre las diferentes
haplotipos. Variacin en el nmero de copias genera un tipo de
variacin estructural que
consideramos con ms detalle en el captulo 13, pero vamos a considerar algunos
de los mecameca- a continuacin en el contexto de cmo se duplican genes. Est claro, sin
embargo,
que CNV es bastante extensa en el genoma humano. Por ejemplo, cuando James
Genoma de Watson fue secuenciado, el 1,4% de la secuencia de datos totales
obtenidos hizo
No mapa con la secuencia del genoma humano de referencia. Como genoma
personal
secuenciacin se acelera, las nuevas regiones de la CNV se estn identificando
con importantes
implicaciones para la expresin de genes y la enfermedad.
Repetida la duplicacin de una secuencia que contiene el gen da lugar a una fagen
AIA. Como veremos en las secciones 9.2 y 9.3, muchos genes humanos son
miembros de
multigene familias que pueden variar enormemente en trminos de nmero de
copias y bucin

bucin. Surgen por una o ms de una variedad de diferentes mecanismos que


resultan
en la duplicacin de genes. Las familias de genes tambin pueden contener
evolutivamente relacionados
secuencias que pueden seguir funcionando como trabajan los
genes (pseudogenes).
Mecanismos de duplicacin de genes
La duplicacin de genes ha sido un acontecimiento comn en la evolucin de la
gran nuclear
genomas que se encuentran en eucariotas complejos. Las familias multignicas
resultantes tienen
a partir de dos a muchas copias del gen. Las copias de genes pueden ser
agrupados juntos en
una ubicacin subchromosomal o pueden estar dispersas en varios cromosomas
Somal ubicaciones. Pueden producirse varios tipos diferentes de duplicacin de
genes:
ORGANIZACIN GENERAL DEL GENOMA HUMANO
pgina 10

Captulo 9: Organizacin del Genoma Humano


264
Tandem duplicacin de genes normalmente surge por cruce entre desigualmente
cromtidas alineados, ya sea en los cromosomas
homlogos (entrecruzamiento desigual)
o en el mismo cromosoma (intercambio de cromtidas hermanas
desigual). Figura9.5
muestra el mecanismo general. El segmento repetido puede ser slo unos pocos
kilobases de longitud o pueden ser bastante grandes y contienen de uno a varios
genes. Dos
tales repeticiones se dice que son repeticiones directas si la cabeza de una
repeticin se une a la cola
de su vecino (AEAE) o repeticiones invertidas si hay unin de las cabezas (AE)
colas (AE). Durante un largo (evolutiva) escala de tiempo de las secuencias
duplicadas
se pueden separar en el mismo cromosoma (por una insercin de ADN o
inversin)
o llegar a ser distribuido en diferentes cromosomas por translocaciones.
trasposicin replicativa describe el proceso por el cual una duplicacin de ADN
copia integra en una nueva ubicacin subchromosomal. Generalmente, esto
implica

retrotransposition : transcriptasas inversas celulares hacer una copia de ADNc de


una
Transcripcin de ARN, con lo cual la copia de ADNc se integra en un nuevo
cromosoma
Somal ubicacin. El mismo tipo de mecanismo a menudo puede conducir a gen
defectuoso
copias y se detallan en el apartado 9.2.
duplicacin de genes mediante fusin celular ancestral . Se cree que las clulas
eucariotas aerbicos
que han evolucionado a travs de la endocitosis de un tipo de clula bacteriana
por un eukaryclula precursora tica. El genoma mitocondrial actual se cree que tienen
derivado del genoma de la clula bacteriana, pero ahora es un muy pequeo
remanente
debido a que muchos de los genes bacterianos originales fueron extirpados y
posteriormente
trasladado a lo que hoy es el genoma nuclear. Como resultado, el genoma nuclear
contiene genes duplicados que codifican-citoplasma especfico y mitochondri-isoformas en concreto para ciertas enzimas y otras protenas clave.
duplicaciones subgenmicos a gran escala pueden surgir como resultado del
cromosoma
translocaciones. euchromatic regiones cerca de los centrmeros humanos y a
telmeros (regiones pericentromeric y subtelomricas, respectivamente) son
comcomparativamente inestable y son propensos a la recombinacin con otros
cromosomas.
Como resultado, grandes segmentos de ADN que contiene mltiples genes han
sido duplicacin
cado. Dentro de los ltimos 40 millones de aos de evolucin de los primates,
este proceso tiene
dado lugar a la duplicacin de ADN alrededor de 400 grandes (varias megabases
largo) segmento
mentos, lo que representa ms del 5% del genoma eucromtica. Este tipo de
duplicacin, conocida como duplicacin segmental , dando una elevada (a
menudo
ms de 95%) de identidad de secuencia entre las copias de ADN y puede implicar
ambas duplicaciones intracromosomal y tambin interchromosomal
duplicaciones
ciones ( Figura9.6 ). Duplicaciones segmentarias son importantes
contribuyentes a
variacin en el nmero de copias y reordenamientos cromosmicos que conduce

a las enfermedades y la rpida innovacin gen. Consideramos que la forma en


que se originan en
Captulo 10.
Toda la duplicacin del genoma . Ahora est claro a partir de la genmica
comparativa BORNE
IES toda duplicacin del genoma que se ha producido en varias ocasiones
durante lucin
lucin en una variedad de diferentes linajes eucariotas. Por ejemplo, no es comevidencia convincente de que toda la duplicacin del genoma se produjo a
principios del
evolucin de los cordados. Este tipo de evento podra explicar por qu los
vertebrados tienen
cuatro grupos Hox (vase la Figura 5.5). la duplicacin del genoma completo se
detalla en
Captulo 10 en el contexto de la evolucin del genoma.
UN
UN
UN
+
UN
1
2
3
4
5
6
7
diecisis
10
11
14
15
17 18 19 20
22
Figura 9.5 tndemduplicacindegenes.
Entrecruzamiento entre cromtidas desalineados
puede resultar en un cromosoma con
una duplicacin en tndem de una secuencia
que contiene un gen (por ejemplo, el gen A muestra
aqu por una caja verde) y uno en el que la
gen se pierde. El mal apareamiento de las cromtidas

puede ser estabilizado por estrechamente relacionados


miembros de un ADN repetidas intercaladas
familia tales como repeticiones Alu (como se muestra aqu por
cajas de naranja). El evento de cruce que conduce
a la duplicacin en tndem de genes puede resultar
de la desigualdad de crossover (cruce entre
cromtidas mal alineados sobre homloga
cromosomas) o cromtidas hermanas desigual
de cambio (el proceso por el cual anloga
cromtidas hermanas estn mal alineados; vase la figura
13.3 para una ilustracin).
Figura 9.6 duplicacinsegmental. La
barra horizontal en el centro es un lineal
mapa del ADN del cromosoma humano
16 (el segmento central verde representa
heterocromatina). Las barras horizontales negras
en la parte superior e inferior representan los mapas lineales
otros de 16 cromosomas que contienen grandes
segmentos que son compartidos con el cromosoma
16, con lneas de conexin de color rojo marcado
las posiciones de las secuencias homlogas.
duplicaciones intracromosomal se muestran
por galones azules (^) que unen las posiciones de
grandes secuencias duplicadas en el cromosoma
16. [De Martin J, Han C, Gordon LA
et al. (2004) Naturaleza 432, 988-994. Con
el permiso de Macmillan Publishers Ltd.
Para las coordenadas cromosmicas y ms
informacin sobre duplicaciones segmentarias en
el genoma humano, segmental dedicado
bases de datos de duplicacin se pueden consultar en
http://humanparalogy.gs.washington.edu/
y http://projects.tcag.ca/humandup/]
pgina 11

265
9.2 GENES PROTEINCODING
Durante muchos aos, los genetistas moleculares crean que el final- importante
de funcionamiento
punto de ADN era de protenas. Los estudios de genomas procariotas apoyaron
esta creencia,

en parte porque estos genomas son ricos en ADN que codifica la protena. Lleg
como una superficie
premio al encontrar que los genomas mucho ms grandes de los eucariotas
complejos han comparativa
tivamente poco ADN codificante de la protena. Por ejemplo, la protena de
codificacin de secuencias de ADN
cuenta de cerca de 90% de la E. coli genoma, pero slo un 1,1% de la humana
genoma.
genes que codifican protenas humanas muestran una enorme variacin en
el tamao
y la organizacin interna
La diversidad de tamaos
Los genes en organismos simples como las bacterias son relativamente similares
en tamao y
son por lo general muy corto (tpicamente alrededor de 1 kb de largo). En
eucariotas complejos, genes
puede mostrar gran variacin en el tamao. Aunque en general hay una
correlacin directa
entre los genes y productos tamaos, hay algunas anomalas sorprendentes. Por
ejemplo,
el gigante gen de la distrofina 2.4 Mb es ms de 50 veces el tamao de la
apolipola protena B gen, pero la protena distrofina tiene una longitud lineal
(aminocidos totales
nmero) que es aproximadamente 80% de la de la apolipoprotena B ( Tabla
9.4 ).
Una pequea minora de los genes codificantes de protenas humanas carecen de
intrones y se generan
aliado pequea (vase la nota a la Tabla 9.4 para algunos ejemplos). Para los que
s poseen
TABLA 9.4 variacin estructural en tamao y ORGANIZACIN DE LOS
GENES HUMANOS PROTEINCODING
protena humana
Tamao de la protena (sin.
de aminocidos)
Tamao del gen
(Kb)
No. de
exones
De ADN que codifica (%)
Tamao medio de

exn (pb)
Tamao medio de
intrn (pb)
SRY
204
0,9
1
94
850
b-globina
146
diecisis
3
38
150
490
p16
156
7.4
3
17
406
3064
Albmina de suero
609
18
14
12
137
1100
Colgeno tipo VII
2928
31
118
29
77
190
p53
393
39

10
6.0
236
3076
C3 del complemento
1641
41
29
8.6
122
900
apolipoprotena B
4563
45
29
31
487
1103
La fenilalanina hidroxilasa
452
90
26
3
96
3500
Factor VIII
2351
186
26
3
375
7100
huntingtina
3144
189
67
8.0
201
2361
protena retinoblastoma RB1
928

198
27
2.4
179
6668
CFTR (fibrosis qustica
receptor transmembrana)
1480
250
27
2.4
227
9100
La titina
34350
283
363
40
315
466
utrofina
3433
567
74
2.2
168
7464
La distrofina
3685
2400
79
0,6
180
30.770
Donde isoformas son evidentes, las cifras indicadas representan las isoformas
ms grandes. Como los genes se hacen ms grandes, el tamao exn permanece
bastante constante, pero los tamaos de intrones CAN
llegar a ser muy grande. exones internos tienden a ser bastante uniforme en
tamao, pero el exn terminal o algunos exones cerca del extremo 3 pueden ser
muchos kilobases de largo;

por ejemplo, el exn 26 del APOB gen es de 7,5 kb de longitud. Tenga en cuenta
el extraordinariamente alto contenido de exn y comparativamente pequeos
tamaos de intrones en los genes
codificacin de colgeno tipo VII y titina. Adems de SRY , otros genes que
codifican protenas de un solo exn en el genoma nuclear incluyen retrogenes
(vase
Tabla 9.8) y los genes que codifican otras protenas SOX, interferones, histonas,
muchos receptores acoplados a la protena G, protenas de choque trmico,
muchos ribonucleasas,
y varios receptores de neurotransmisores y receptores de hormonas.
Genes que codifican protenas
pgina 12

Captulo 9: Organizacin del Genoma Humano


266
intrones, existe una correlacin inversa entre el tamao de genes y la fraccin de
codificacin
ADN (ver Tabla 9.4). Esto no se plantea debido a los exones de genes grandes
son ms pequeos
que las de pequeos genes. El tamao medio de exn en los genes humanos est
cerca
300 pb, y el tamao de exn es relativamente independiente de la longitud de
genes. En cambio, hay
es enorme variacin en las longitudes de intrones, genes y grandes tienden a tener
muy grandes intrones
(Ver Tabla 9.4). La transcripcin de largo intrones es, sin embargo, costoso en
tiempo y energa;
la transcripcin del gen de la distrofina de 2,4 Mb toma alrededor de 16
horas. Por lo tanto, muy
los genes altamente expresados a menudo tienen intrones cortos o no intrones en
absoluto.
Las secuencias repetitivas dentro de ADN que codifica
Las secuencias de ADN altamente repetitivas se encuentran a menudo dentro de
intrones y flanqueando
secuencias de genes. Ellos sern detallados en la Seccin 9.4. Adems, repetitivo
secuencias de ADN que se encuentran en diferentes grados en los
exones. Tandem repeticin de muy
secuencias cortas de oligonucletidos (1-4 pb) es frecuente y simplemente
pueden reflejar estacin
estadsticamente esperado frecuencias para ciertas composiciones de base. la
repeticin en tndem

de secuencias que codifican dominios proteicos conocidos o asumidos tambin es


bastante comlun, y puede ser funcionalmente ventajosa al proporcionar un bio- ms
disponibles
objetivo lgico.
Las identidades de secuencia entre los dominios de protenas son a menudo
repetidas
bastante bajo, pero a veces puede ser alto. La lipoprotena Lp (a), codificada por
el LPA
gen en el cromosoma 6q26, es un ejemplo clsico. Contiene mltiples
repetidos en tndem dominios kringle, que son cada uno de aproximadamente
114 aminocidos de longitud
y formar bucles con enlaces disulfuro. Los diferentes dominios kringle son a
menudo casi
idnticos en secuencia de aminocidos. Incluso a nivel de secuencia de
nucletidos del ADN
repeticiones que codifican los dominios kringle muestran niveles muy altos de
secuencia identidad, hacindolos propensos a la desigualdad de crossover. Como resultado,
el LPA gen est sujeta
a polimorfismo de la longitud, y el nmero de dominios kringle en lipoprotena
Lp
(A) vara, pero es generalmente 15 o ms.
Diferentes protenas pueden ser especificados por la superposicin de la
transcripcin
unidades
La superposicin de los genes y los genes dentro de otra genes
genomas simples tienen una alta densidad de genes (aproximadamente uno por
cada 0,5, 1, y 2 kb para el
genomas de las mitocondrias humano, Escherichia coli , y Saccharomyces
cerevisiae , respectivamente) y, a menudo muestran ejemplos de genes que se solapan
parcialmente. Diferente
marcos de lectura se pueden usar, a veces de la misma cadena con sentido. en
complejo
organismos, tales como seres humanos, genes son mucho ms grandes, y hay
menos agrupacin de
secuencias codificantes de protenas ( Tabla9.5 ).
la densidad de genes vara enormemente de un cromosoma en el cromosoma y
dentro de diferentes regiones del mismo cromosoma. En las regiones
cromosmicas con

alta densidad de genes, la superposicin de genes puede ser hallado, por lo


general se transcriben
a partir de hebras de ADN opuestas. Por ejemplo, la regin de la clase III del
complejo HLA
en 6p21.3 tiene una densidad de genes promedio de alrededor de un gen por cada
15 kb y es conocida
para contener varios ejemplos de parte superposicin de genes ( Figura9.7a ).
Todo el genoma anlisis muestran que alrededor del 9% de los genes codificantes
de protenas humanas
solapar otro de tales genes. Ms de 90% de los solapamientos implican genes
trandescrito a partir de hebras opuestas. A veces los solapamientos son parciales,
pero en otra
maletines genes codificadores de protenas se encuentran dentro de los intrones
de los genes ms grandes.
La NF1 gen (neurofibromatosis tipo I), por ejemplo, tiene tres pequeas interna
genes transcritos de la cadena opuesta (Figura 9.7B).
Anlisis recientes tambin han demostrado que los genes de ARN con frecuencia
se pueden superponer progenes protena codificante. El posicionamiento de los genes de ARN se trata en la
Seccin 9.3.
Los genes transcritos de forma divergente o co-transcriben a partir de un
comn
promotor
Algunos genes codificadores de protenas comparten un promotor. En muchos
casos los 5 extremos de los dos
los genes son a menudo separados por unos pocos cientos de nucletidos y los
genes son
transcrito en direcciones opuestas desde el promotor comn. Este tipo de bidiorganizacin de genes direccional puede proporcionar una regulacin comn del
par de genes.
Como alternativa, los genes con un promotor comn se transcriben en la misma
direccin para producir transcripciones multignicas que a continuacin se
escinden para producir una
pgina 13

267
TABLA GENOMA HUMANO Y ESTADSTICA 9.5 de genes humanos
TAMAO DE COMPONENTES GENOMA
genoma mitocondrial
16.6 kb
genoma nuclear

3.1 Gb
un
componente euchromatic
2,9 Gb (93%)
Altamente conservadas fraction150 Mb (5%)
sequences35 ADN codificante de la protena Mb (1,1%)
Otros DNA115 altamente conservada Mb (3,9%)
DNA160 segmentally duplicado Mb (5,5%)
DNA1.6 altamente repetitivo Gb (50%)
heterocromatina constitutiva 200 Mb (7%; Tabla 9.3)
repeats1.4 basado en transposn Gb (45%, Tabla 9.12)
ADN por cromosoma
48 MB-249 Mb (Tabla 9.3)
el nmero de genes
genoma nuclear
> 26.000
genoma mitocondrial
37
genes que codifican protenas 20,000-21,000
genes de ARN
> 6000 (Figura exacta no se conoce)
Pseudogenes relacionados con genes que codifican protenas
> 12.000
la densidad de genes
genoma nuclear
> 1 por 120 kb (pero considerable incertidumbre)
genoma mitocondrial
1 por 0,45 kb
LONGITUD DE LOS GENES PROTEINCODING
Longitud promedio
53.6 kb
Pequesimo
unos pocos cientos de pares de bases de largo (varios ejemplos)
ms grande
2.4 Mb (distrofina)
NMERO DE GENES exn en PROTEINCODING
Promedio del nmero de exones en un gen
segundo
9.8
el nmero ms grande de un gen
363 (en el gen de la titina)

nmero ms pequeo de un gen


1 (no hay intrones-vanse las Tablas 9.4 y 9.7, por ejemplo)
TAMAO DE LOS GENES exn en PROTEINCODING
tamao medio de exn
288 pb (exones pero en 3 final de genes tienden a ser
gran)
Pequesimo
<10 pb (varios, por ejemplo el exn 3 del gen de la troponina I
TNNI1 est a slo 4 pb de longitud)
ms grande
18.2 kb (exn 6 en MUC16 isoforma-201)
Intrn tamao en los genes PROTEINCODING
Pequesimo
<30 pb (varios)
ms grande
1.1 Mb (intrn 5 en kcnip4 )
ARN TAMAO
Ms pequeo ARN no codificante
<20 nucletidos (por ejemplo, muchas de inicio transcripcional
ARN-sitio asociado al menos 18 nucletidos)
ARN no codificante ms grande
Cientos de miles de nucletidos; por ejemplo UBE3A
RNA antisentido es probable que sea cerca de 1 Mb
ARNm ms grande
> 103 kb (ARNm titina, isoforma NF-2A)
TAMAO polipptido
Pequesimo
decenas de aminocidos (varios neuropptidos)
ms grande
34.350 aminocidos (titina, isoforma NF-2A)
un
Tenga en cuenta que el tamao total puede variar entre los haplotipos debido a
variacin en el nmero de copias.
segundo
Para el
isoforma ms larga. Los datos se obtuvieron en gran medida de liberacin
Ensembl 55 conjuntos de datos.
Genes que codifican protenas
pgina 14

Captulo 9: Organizacin del Genoma Humano


268

transcripcin separada para cada gen. Tales genes se dice que formar parte de
un policistrnico (= multignica) unidad de transcripcin. Unidades de transcripcin
polycistronic son
comn en los genomas simples, tales como los de las bacterias y la mitocondrial
genoma (vase la Figura 9.3). Dentro del genoma nuclear, se conocen algunos
ejemplos
de diferentes protenas que se producen a partir de una unidad de transcripcin
comn. Tpicamente,
que se producen por escisin de una protena de precursor hbrido que se traduce
de una transcripcin comn. Las cadenas A y B de la insulina, que son
ntimamente
relacionados funcionalmente, se producen de esta manera (vase la figura 1.26),
as como el relacionado
pptido somatostatina y hormonas neuronostatin. A veces, sin embargo, funcionalmente protenas distintas son producidas a partir de un precursor de la
protena comn. los
UBA52 y UBA80 genes, por ejemplo, tanto generan ubiquitina y un no
relacionado
protena ribosomal (S27a y L40, respectivamente).
Anlisis ms recientes han demostrado que la idea desde hace mucho tiempo que
la mayora
genes humanos son unidades de transcripcin independientes que no es cierto,
por lo que la definicin
tendr que ser revisada radicalmente cin de un gen. transcripcin Multignico es
ahora
conocido por ser bastante frecuente en el genoma humano, y las protenas
especficas y
Noncoding RNAs funcionales se pueden hacer por los precursores de ARN
comunes. Esta voluntad
estudiar ms a fondo en la seccin 9.3.
genes que codifican protenas humanas a menudo pertenecen a familias de
genes
que pueden ser agrupados o dispersos en varios cromosomas
Duplicados genes duplicados y de codificacin de componentes de secuencia son
un comn
caracterstica de los genomas de animales, especialmente grandes genomas de
vertebrados. Como veremos en
Captulo 10, la duplicacin de genes ha sido un factor importante en la evolucin
de

complejidad funcional y el origen de organismos cada vez ms complejos. Los


genes
que operan en las mismas o similares vas funcionales, pero producen protenas
con poca evidencia de la similitud de secuencias estn alejadas en la evolucin, y
que tienden a dispersarse en diferentes localizaciones cromosmicas. Ejemplos
incluyen
genes que codifican la insulina (en el cromosoma 11p) y el receptor de la insulina
(19p); fermentacin
ritin cadena pesada (11q) y la cadena ligera de ferritina (22q); esteroide 11hidroxilasa (8q)
y un esteroide 21-hidroxilasa (6p); y JAK1 (1p) y STAT1 (2q). Sin embargo, los
genes
que producen protenas con similitud estructural y funcional tanto son a menudo
organizada en grupos de genes.
Figura 9.7 Lasuperposicindelosgenesylosgenesdentrodeotros
genes. Losgenes(A)enlaregindeclaseIIIdelcomplejoHLAestn
estrechamenteempaquetadosy
la superposicin en algunos casos. Las flechas muestran la direccin de
transcripcin. (B) El intrn 27b de la NF1 (neurofibromatosis tipo I) gen es de
60,5 kb
de largo y contiene tres pequeos genes internos, cada uno con dos exones, que
se transcriben a partir de la cadena opuesta. Los genes internos (no
dibujado a escala) se OGMP (glicoprotena de mielina de los oligodendrocitos)
y EVI2A y EVI2B (homlogos humanos de los genes murinos piensa que es
implicado en la leucemia y ubicada en los sitios de integracin virales ecotropic).
Notch4
G18
PBX2
RABIA
G16
G15
G14
TN-X
XB-S
YB
CYP
21B
CYP
21Ps
C4B
G8 C2 C9a

G7a
G3a
K18L
G3 G1
G7 G8
G2
G6
G5
G4
C4A
ZB
XA
YA ZA
G11
G10
HOM
Hsp70
G11a
G7B
G5b CKIIB
G7c
BAT5
G7d
RD
bf
G9 2
1C7
B144
LTB
TNF
LTA
NB6
1kBL
BAT1
MICB
PERB6
PERB10
MICA
NOB1
NOB2
P5-6

DHFRPs
17
NOB3
alianzas de inversin pblicoprivada
(UN)
(SEGUNDO)
0
900 kb
exn 27b
exn 28
27b intrn
OGMP
EVI2B
EVI2A
2.2 kb
10 kb
4 kb
cadena con sentido
de NF1 gen
cadena antisentido
de NF1 gen
5
3
3
5
pgina 15

269
Las diferentes clases de las familias de genes humanos pueden ser reconocidos de
acuerdo con la
grado de similitud de secuencia y la similitud estructural de sus productos
proteicos.
Si dos genes diferentes hacen productos de protenas muy similares, que son ms
propensos a
se origin por una duplicacin de genes evolutivamente muy reciente, muy
probablemente
algn tipo de evento tndem duplicacin de genes, y tienden a agruparse
juntos en un lugar especfico subchromosomal. Si hacen protenas que son
ms alejadas en secuencia, que muy probablemente surgieron por una ms
antigua
la duplicacin de genes. Pueden originalmente se han agrupado juntos, pero a lo
largo

evolutivos largas escalas de tiempo de los genes podran haber sido separadas por
translocacin
ciones o inversiones, y que tienden a estar localizados en diferentes cromosomas
ubicaciones.
Algunas familias de genes estn organizados en varios clsteres. El b-, g-, d-, y
genes e-globina se encuentran en un grupo de genes en 11P y estn ms
estrechamente relacionados con
entre s de lo que son para los genes en el a-globina grupo de genes en 16p
( figura
9.8 ).Losgenesenelgrupodegenesdebglobinaen11Poriginadaspor
duplicacingnica
eventos cin que eran mucho ms reciente en la evolucin que el gen temprano
duplicacin caso que dio origen a los antepasados de los genes A y B-globina. Un
excepcional ejemplo de una familia de genes organizado como mltiples grupos
de genes es la
familia de genes de receptores olfativos. Los genes codifican un repertorio
diverso de receptores
que nos permiten discriminar miles de diferentes olores; los genes se encuentran
en grandes racimos en mltiples localizaciones cromosmicas diferentes ( Tabla
9.6 ).
Algunas familias de genes tienen copias de genes individuales en dos o ms
cromosmica
lugares sin la agrupacin de genes (vase la Tabla 9.6). Los genes en los
diferentes localizacin
ciones son por lo general bastante divergentes en secuencia a no ser que se
produjo la duplicacin de genes
hace relativamente poco tiempo o que ha habido una considerable presin de
seleccin para mantener
conservacin de la secuencia. Se espera que los miembros de la familia que se
origin
de duplicaciones de genes antiguos.
Las diferentes clases de familia de genes pueden ser reconocidos de acuerdo
con
la extensin de la secuencia y la similitud estructural de la protena
productos
A medida que se enumeran a continuacin, varias clases de familia de genes se
pueden distinguir segn
el nivel de identidad de secuencia entre los miembros de genes individuales.
En las familias de genes con miembros estrechamente relacionados, los genes
tienen un alto grado de

de homologa de secuencia sobre la mayor parte de la longitud del gen o


secuencia de codificacin.
Los ejemplos incluyen familias de genes de histonas (histonas estn fuertemente
conservados, y
miembros de la subfamilia son prcticamente idnticas), y la A-globina y bglobina
familias de genes.
albmina
clster 4q12
hormona de crecimiento
clster 17q23
a-globina clster 16p13
clster b-globina
11p15
0
0
20
40
60
80
100
120
140
160
180
10
20
30
40
50
60
incgnita
2
mi
gg Ag
YB
re
segundo
un
2
un

1
q
y
x1
y
a2
y
a1
hGH-N CS-L
CS-A
hGH-V CS-B
ALBA
AFP
ALF
GC / PAD
gen expresado
expresado, pero en estado desconocido
pseudogen
Figura 9.8 Ejemplosdehumanoagrupados
familias de genes. Los genes en un grupo son a menudo
estrechamente relacionados en secuencia y son tpicamente
transcrito a partir de la misma cadena. Gene
grupos a menudo contienen una mezcla de expresado
genes y pseudogenes no funcionales. los
el estado funcional de la q-globina y CS-L
genes es incierto. Las escalas superior
(globina y la hormona del crecimiento clusters) y
la parte inferior (cluster albmina) estn en kilobases.
Genes que codifican protenas
pgina 16

Captulo 9: Organizacin del Genoma Humano


270
En las familias de genes definidos por una protena de dominio comn, los
miembros podrn
tienen muy baja homologa de secuencia pero poseen ciertas secuencias que
especificar una o ms especficos dominios de la protena. Los ejemplos incluyen
el gen PAX
familia y SOX familia de genes ( Tabla9.7 ).
Ejemplos de familias de genes definidos por motivos de protenas
funcionalmente similares cortos

son familias de genes que codifican protenas relacionadas funcionalmente con


una DEAD
box motivo (Asp-Glu-Ala-Asp) o la repeticin WD ( Figura9.9 ).
Algunos genes codifican productos que estn en relacin funcional en un sentido
general
pero muestran slo es muy dbil homologa de secuencia sobre un segmento
grande, sin muy
aminocidos conservados motivos importantes. Sin embargo, puede haber alguna
evidencia
dencia para las caractersticas estructurales generales comunes. Tales genes se
pueden agrupar en
un evolutivamente antigua superfamilia de genes con muy muchos miembros de
genes.
Debido a mltiples diferentes eventos de duplicacin de genes se han producido
peridicamente
durante la larga evolucin de una superfamilia de genes, algunos de los miembros
de genes crea
protenas que son muy divergentes en secuencia a las de alguna otra familia
miembros, pero los genes resultantes de duplicaciones ms recientes son ms
fcilmente
visto estar relacionado en secuencia.
TABLA 9.7 Ejemplos de genes humanos con motivos de secuencias que
codifican DOMINIOS altamente conservadas
la familia de genes
Nmero de genes
motivo de la secuencia / Dominio
genes homeobox
38 HOX genes ms 197
genes homeobox hurfanos
homeobox especifica un homeodominio de 60 aminocidos; una amplia variedad
de diferente
subclases se han definido
PAX genes
9
paired box codifica un dominio emparejado de 124 aminocidos; PAX genes a
menudo tambin tienen una
tipo de homeodominio conocido como un homeodominio de tipo apareado
SOX genes
19
cuadro de la HMG-SRY como el que codifica un dominio de 70-80 aminocidos
TBX genes

14
T-Box codifica un dominio de 170 aminocidos
los genes del dominio forkhead
50
el dominio forkhead es de 110 aminocidos de longitud
los genes del dominio POU
diecisis
el dominio POU es de 150 aminocidos de longitud
TABLA 9.6 EJEMPLOS DE agrupados y familias multignicas
ENTREMEZCLADOS
Familia
El ejemplar no.
Organizacin
localizacin cromosmica (s)
Las familias de genes en clster
Crecimiento grupo de genes de la hormona
5
agrupado a menos de 67 kb; un pseudogen (Figura 9.8)
17q24
a-globina grupo de genes
7
agrupado sobre 50 kb (Figura 9.8)
16p13
genes20 cadena pesada de HLA de clase I
agrupado ms de 2 Mb (Figura 9.10)
6p21
genes HOX
38
organizados en cuatro grupos (Figura 5.5)
2q31, 7p15, 12q13, 17q21
familia de genes de histonas
61
racimos de tamao modesto en algunos lugares; dos grandes grupos
en el cromosoma 6
muchos
familia de genes de receptores olfativos
> 900
cerca de 25 grandes grupos dispersos por todo el genoma
muchos
Las familias de genes ENTREMEZCLADOS
aldolasa

5
tres genes funcionales y dos pseudogenes en cinco
diferentes cromosomas
muchos
PAZ
9
los nueve son genes funcionales
muchos
NF1 (neurofibromatosis de tipo I)
> 12
un gen funcional en 22q11; otros estn nonprocessed
pseudogenes o fragmentos de genes (Figura 9.11)
muchos, la mayora pericentromeric
cadena pesada de ferritina
20
un gen funcional en el cromosoma 11; la mayora son
pseudogenes procesados
muchos
pgina 17

271
Dos ejemplos importantes de superfamilias de genes son la Ig (inmunoglobulina)
y GPCR (receptor acoplado a protena G) Superfamilias. Los miembros de la
super-Ig
familia todos tienen dominios globulares se asemejan a los encontrados en las
inmunoglobulinas,
y adems de inmunoglobulinas que incluyen una variedad de superficie de la
clula proprotenas solubles y protenas implicadas en el reconocimiento, unin, o ceso de
adhesin
eses de clulas (vase la Figura 4.22 para ver algunos ejemplos). La superfamilia
GPCR es muy
con al menos 799 miembros de larga duracin en grandes nicas, distribuidos en
todo el
Genoma humano. Todas las protenas GPCR tienen una estructura comn de siete
a-hlice
segmentos transmembrana, pero por lo general tienen una baja secuencia (menos
de 40%)
similitud entre s. Ellos median la sealizacin celular inducida por ligando a
travs de interaccin
cin con las protenas G intracelulares, y la mayor parte del trabajo como
receptores de rodopsina.

la duplicacin de genes que dan lugar a las familias multignicas tambin


crear pseudogenes y fragmentos de genes
Las familias de genes con frecuencia tienen copias de genes defectuosos, adems
de funcional
genes. Una copia del gen defectuoso que contiene por lo menos varios exones de
una funcin
gen cional se conoce como un pseudogen ( Box9,2 ). Otras copias del gen
defectuoso puede
tener partes solamente limitadas de la secuencia del gen, a veces un solo exn, y
tambin lo son
a veces descrito como fragmentos de genes .
familias de genes agrupados a menudo tienen copias de genes defectuosos que
han surgido por
duplicacin en tndem. Estos son ejemplos de pseudogenes no procesados
. Proceso de copiar
se puede ver que se han realizado a nivel de ADN genmico, porque no
pseudogenes procesados contienen homlogos de ambos exones e intrones y
a veces tambin de regiones promotoras aguas arriba. Sin embargo, incluso si la
copia tiene
secuencias que corresponden a la longitud completa del gen funcional, ms cerca
de examen
nacin identificar los codones de terminacin inapropiadas en los exones,
empalme aberrante
uniones, y as sucesivamente. Ejemplos clsicos de pseudogenes no procesados
se encuentran
en la A-globina y grupos de genes b-globina (vase la Figura 9.8). A veces, ms
pequea
copias de genes truncados y copias fragmento de gen tambin son evidentes, ya
que en la clase I
Familia de genes HLA ( Figura9.10 ).
Unas pocas familias de genes que se distribuyen en diferentes localizaciones
cromosmicas
Tambin puede tener copias de pseudogenes no procesados de un gen funcional
nica.
Ciertos tipos de regiones, en particular subchromosomal pericentromeric y
subteloregiones Meric, son relativamente inestables. Son propensos a la recombinacin
eventos que pueden dar lugar a segmentos de genes duplicados (que contiene
tanto exones y
intrones) se distribuye a otras localizaciones cromosmicas. Las copias de genes
son

tpicamente defectuosa porque carecen de algunas de la secuencia del gen


funcional. Dos
ejemplos ilustrativos son secuencias relacionadas con la NF1 (neurofibromatosis
de tipo I)
y la PKD1 (enfermedad renal poliqustica adulta) genes.
La NF1 gen est localizado en 17q11.2. Debido a la inestabilidad
pericentromeric,
mltiples no procesados NF1 copias de fragmentos pseudogene / gen se
distribuyen
ms de siete cromosomas diferentes, nueve se encuentran en regiones
pericentromeric
( Figura9.11A ). La PKD1 gen tiene ms de 46 exones que abarcan 50 kb y se
encuentra
en una regin subtelomrico en 16p13.3. Seis no procesados PKD1 pseudogenes
tienen
ha generado por duplicaciones segmentarias durante la evolucin de los primates
y tienen
insertado en lugares dentro de una regin que es de aproximadamente 13 a 16
proximal a la Mb
PKD1 gen, lo que corresponde a una parte de la banda 16p13.1 (Figura 9.11b). el
pseudo
genes que carecen de secuencias en el extremo 3 de la PKD1 gen, sino que
tenga contra-secuencia
partes de gran parte de la secuencia genmica que abarca los exones 1-32,
mostrando 97,6% a
97,8% de identidad de secuencia con la secuencia de PKD1.
Pseudogenes procesados son copias defectuosas de un gen que contienen slo
exonic
secuencias y carecen de una secuencia intrnica o secuencias promotoras aguas
arriba. Ellos
surgen por retrotransposition : transcriptasas inversas celulares pueden usar gen
procesada
caja DEAD
(UN)
(SEGUNDO)
Un xx G x GKT
ARG x D
HRIGR COOH
PTRELA
GG
TPGR

SBADO
MUERTO
NUEVA HAMPSHIRE
2
22-42
6-94
23-41
19-29
17-29
17-23
19-51
115-192
20-25
repeticin WD
GH
WD
n = 4-14
ncleo
Figura 9.9 Algunasfamiliasdegenescodifican
protenas funcionalmente relacionadas con corta
motivos conservados de aminocidos. (A) MUERTO
motivos cuadro de la familia. Esta familia de genes codifica
productos implicados en los procesos celulares
que implica la alteracin de ARN secundaria
estructura, tal como la iniciacin de traduccin y
empalme. Ocho amino muy altamente conservada
motivos de cido son evidentes, incluyendo el DEAD
caja (Asp-Glu-Ala-Asp). Los nmeros se refieren a
con frecuencia se encuentran rangos de tamao para intervenir
secuencias de aminocidos; X representa cualquier
aminocidos. repetir motivos familiares (B) de WD.
Esta familia de genes codifica productos que
estn involucrados en una variedad de regulador
funciones, como la regulacin de la divisin celular,
la transcripcin, la sealizacin transmembrana,
y la modificacin del ARNm. Los productos gnicos
se caracterizan por 4-16 tndem WD
repite que contienen cada uno una secuencia central de
de longitud fija a partir de una GH (Gly-His)
dipptido y de terminacin en el dipptido
WD (Trp-Asp), precedido por una secuencia de

Longitud variable.
Genes que codifican protenas
pgina 18

Captulo 9: Organizacin del Genoma Humano


272
Pseudogenes se lo suele considerar como copias defectuosas de un funcional
gen a la que muestran homologa de secuencia significativa. Ellos
normalmente surgen por algn tipo de evento de duplicacin de genes que
produce
dos copias del gen. La presin de seleccin para conservar la funcin de
necesidad gen
slo puede ser impuesta a una copia del gen; la otra copia se puede permitir
para mutar con mayor libertad ( deriva gentica ) y puede recoger la inactivacin
mutaciones, produciendo un pseudogen. Sin embargo, algunas secuencias son
se hace referencia como pseudogenes a pesar de que no han originado
mediante la copia de ADN. Por ejemplo, como veremos en el captulo 10, los
seres humanos
tienen raras pseudogenes solitarios que son claramente ortlogos de funcionales
genes en los grandes simios y se convirtieron defectuoso despus de la
adquisicin perjudiciales
mutaciones en el linaje humano.
Diferentes mecanismos de duplicacin de genes puede dar lugar a mltiples
copias de genes funcionales y pseudogenes defectuosos. O bien el
secuencia de ADN genmico se copia o se hace una copia de ADNc (despus de
la transcripcin inversa de un transcrito de ARN procesado) que integra
en el ADN genmico. Para un gen codificante de la protena, la copia en el
genoma
nivel del ADN puede dar lugar a la duplicacin del promotor y aguas arriba
secuencias reguladoras, as como de todos los exones e intrones. Una defectuosa
gen que deriva de una copia de una secuencia de ADN genmico es conocida
como un pseudogen nonprocessed ( Figura1A ). tales pseudogenes
por lo general surgen por la duplicacin en tndem de manera que se encuentran
cerca
homlogos de genes funcionales (ver Figuras 9.8 y 9.10b para ejemplos),
pero algunos estn dispersos como resultado de la recombinacin (vase la figura
9.11
por ejemplo).
Copiado a nivel ADNc produce una copia del gen que normalmente
carece de intrones, elementos promotores, y aguas arriba de reglamentacin
elementos. Muy de vez en cuando, una copia del gen procesada puede retener
alguna

funcin (un retrogene ; vase la Tabla 9.7). Sin embargo, debido a que carecen
secuencias importantes que se necesitan para la expresin, el gen ms procesado
copias degenerar en pseudogenes procesados (a veces llamados
pseudogenes retrotransposed ; Figura 1B).
La prevalencia y la funcionalidad de pseudogenes
genomas eucariotas tienen tpicamente muchos pseudogenes. Un largo
de pie justificacin de su abundancia es que la duplicacin de genes es
evolutivamente ventajosa. Las nuevas variantes de genes funcionales pueden ser
creados por la duplicacin de genes y pseudogenes durante mucho tiempo han
sido vistos
como sin xito subproductos de los mecanismos de duplicacin. A pesar de que
algunos genomas procariotas parecen tener muchos pseudogenes,
pseudogenes son generalmente raros en procariotas porque sus genomas
generalmente estn diseados para ser compacto.
La gran mayora de lo que son reconocidos convencionalmente como
pseudogenes humanos son copias de genes codificadores de protenas,
simplemente
porque es relativamente fcil de identificar ellos (mediante la bsqueda de
frameshifting, las mutaciones del sitio de empalme, y as sucesivamente). Hay
mas que
8000 diferentes copias de pseudogenes procesados de codificacin de protenas
genes en el genoma humano, adems de ms de 4000 nonprocessed
pseudogenes (ver la base de datos en el pseudogen
http://www.pseudogene.org). Slo alrededor del 10% de la 21000 humana
genes que codifican protenas tienen al menos un pseudogen procesado, pero
genes altamente expresados tienden a tener mltiples pseudogenes procesados.
Por ejemplo, la protena ribosomal citoplsmica contiene 95 funcional
genes que codifican 79 protenas diferentes (16 genes se duplican) y
2090 pseudogenes procesados.
pseudogenes ARN son a menudo difciles de identificar como pseudogenes
(No hay un marco de lectura de inspeccionar, y los genes de ARN a menudo
carecen de
intrones). Sin embargo, las copias de pseudogenes de muchos ARNs pequeos
son
comn (vase la tabla siguiente), sobre todo si son transcritos por la ARN
polimerasa III (genes transcritos por la ARN polimerasa III tienen a menudo
promotores internos).
Como se describe en la Seccin 12.4, la repeticin Alu, el ms
abundantes secuencia en el genoma humano, parece haberse originado
por la copia de las transcripciones de ARN 7SL, y otros muchos altamente
repetidas intercaladas familias de ADN en los mamferos son copias de ARNt.

Por lo tanto, en cierto sentido, pseudogenes de ARN han llegado a ser los ms
comunes
elementos de la secuencia de los genomas de mamferos.
Todos los pseudogenes se encuentran en el genoma nuclear, pero
no incluir copias defectuosas de genes que residen en el mitocondrial
genoma ( pseudogenes mitocondriales ). El genoma mitocondrial
originado a partir de un genoma bacteriano mucho ms grande y durante un largo
evolutivo escala de tiempo la mayor parte del ADN de la gran precursor
genoma mitocondrial migr en una serie de integracin independiente
eventos en lo que ahora es el genoma nuclear. pseudogenes ADNmt
Ahora representar al menos el 0,016% del ADN nuclear (o aproximadamente 30
veces las
contenido del genoma mitocondrial).
La funcionalidad de pseudogenes ha sido un debate inconcluso,
y se han previsto diferentes clases de pseudogenes. Un significante
nmero de pseudogenes (pseudogenes procesados en su mayora) son
transcritas, y las transcripciones antisentido pseudogene pueden regular
los genes de los padres. Los pseudogenes tambin se han implicado directamente
en
la produccin de siRNAs endgenos que regulan transposones, como
se describe en la Seccin 9.3. Por ltimo, algunas secuencias pueden ser
pseudogene
cooptado para una funcin diferente. Han sido descritos como exapted
pseudogenes . Un ejemplo es proporcionado por el XIST gen. Se hace una
ARN no codificante que regula la inactivacin del cromosoma X, y dos de
Se conocen sus seis exones que se origin a partir de una copia de pseudogen
un gen codificante de la protena.
(UN)
(SEGUNDO)
la duplicacin de genes
UN
UN
UN
UN
UN
yA
yA
mutacional
restriccin
mutacional
flexibilidad

transcripcin
y el procesamiento
marcha atrs
transcriptasa
mutacin
cromosmico
integracin
ARNm
ADNc
promotor
inactivando
mutacin
no inactivante
mutacin
Figura 1 Orgenesdenonprocessedyprocesado
pseudogenes. (A) La copia de ADN genmico
secuencia que contiene el gen A puede producir duplicado
copias de las necesidades de presin de seleccin Fuerte gen A.
para ser aplicado a una de las copias para mantener
la funcin de genes (flecha en negrita), pero la otra copia
se puede permitir que mutar (flecha discontinua). Si se
recoge inactivacin de las mutaciones (crculos rojos), una
puede surgir pseudogen nonprocessed (YA).
(B) Un procesado pseudogene surge despus celular
transcriptasas inversas convertir una transcripcin de un gen
en un ADNc que luego es capaz de integrarse de nuevo en
el genoma (vase la figura 9.12 para ms detalles). La falta
secuencias de importantes tales como un promotor generalmente
resulta en una copia del gen inactivo.
ARN de la familia
Nmero de
genes humanos
Cantidad de trastornos
pseudogenes
U6 snRNA
49 800
U7 snRNA
1
85
Y ARN
41000

Recuadro 9.2 Los orgenes, la prevalencia y la funcionalidad de pseudogenes


pgina 19

273
transcripciones tales como ARNm para hacer cDNA que luego pueden integrar en
cromosoma
ADN Somal ( Figura9.12 ). Pseudogenes procesados son comunes en
intercaladas
familias de genes (vase la Tabla 9.5).
pseudogenes procesados carecen de una secuencia promotora y por lo general no
son
expresado. A veces, sin embargo, los ADNc copia integra en un cromosoma
sitio de ADN que sucede, por casualidad, ser adyacente a un promotor que puede
conducir
expresin de la copia del gen procesado. La presin de seleccin puede garantizar
que la
de copias de genes procesado contina haciendo un producto gnico funcional,
en cuyo caso
que se describe como un retrogene . Una variedad de retrogenes intronless se
sabe que tienen
Prueba especfica de patrones de expresin y son homlogos tpicamente
autosmicos de una
-intrn que contiene el gen ligado al cromosoma X ( Tabla9.8 ).
Una razn fundamental para retrogenes puede ser un requisito fundamental para
superar la
la falta de expresin de ciertas secuencias ligadas al cromosoma X en los
testculos durante la meiosis masculina.
Durante la meiosis masculina, los cromosomas X e Y se convierten en pares
heterosexuales
la cromatina, la formacin de la altamente condensada y transcripcionalmente
inactiva cuerpo XY .
retrogenes autosmicos pueden proporcionar la sntesis continua de clulas de
testculos de cerTain productos de importancia crucial que ya no son sintetizadas por los genes en
el
muy condensada cuerpo XY.
L
TM CY
un
1
un

2
L una
1
un
2
un
3
TM CY
CY
un
2
un
3
TM CY
un
2
un
2
un
3
TM CY
un
3
un
3
3 UTR
3 UTR
3 UTR
3 UTR
3 UTR
2.2 Mb
segundo
do
mi
UN
GRAMO
F
Y
1
2
3

4
5
67
Y
Y
Y
(UN)
(SEGUNDO)
NF1
17q11.2
10b
(UN)
(SEGUNDO)
13
27b
2q12-q13
15p11.2 (2 copias)
14p11 <> q11
22p11 <> q11
18p11.2
21p11 <> q11
dispersa NF1
pseudogenes
PKD1
16p13.3
Y PKD1
gene
racimo
16p13.11
Y1
Y2
Y3
Y4
Y5
Y6
Figura 9.11 Dispersindenonprocessed
NF1 y PKD1 pseudogenes como consecuencia
de pericentromeric o subtelomrico
inestabilidad. (A) El NF1 neurofibromatosis
gen de tipo I est situado cerca de la
centrmero del cromosoma humano 17. Se

abarca 283 kb y tiene 58 exones. Los exones son


representada por las cajas verticales delgadas; intrones
se muestran por los galones de conexin (^).
copias defectuosas altamente homlogas de la
NF1 genes se encuentran a las nueve o ms de otros
genoma lugares, sobre todo en pericentromeric
regiones. Cada copia tiene una parte de la completa
gen de longitud, con los dos exones e intrones.
Siete ejemplos se muestran aqu, tales como
dos copias, en 15 peniques que tienen genmica intacta
secuencias que abarcan los exones 13 y 27b.
Reordenamientos en ocasiones han causado
la supresin de los exones e intrones (que se muestra
por asteriscos). (B) El 46 kb PKD1 poliqustico
gen de la enfermedad renal se encuentra cerca de la
telmero de 16p y tiene ms de 40 exones. Como
consecuencia de la duplicacin eventos segmentarias
durante la evolucin de los primates, piezas de gran tamao
de este gen se han duplicado y seis
PKD1 pseudogenes se encuentran en 16p13.11,
con grandes bloques de secuencia (que se muestra como el azul
cajas) copiados de la PKD1 gen (asteriscos
representar la ausencia de los homlogos para
PKD1 secuencias).
Figura 9.10 ElIfamiliadegenesHLAdeclase:una
familia de genes agrupados con nonprocessed
pseudogenes y fragmentos de genes.
(A) Estructura de una clase I HLA-cadena pesada
mRNA. El ARNm de longitud completa contiene una
secuencia que codifica un polipptido con una
secuencia lder (L), tres extracelular
dominios (a
1
, un
2
Y una
3
), Una transmembrana
secuencia (TM), una cola citoplsmica (CY), y
una regin no traducida 3 (3 UTR). El tres
dominios extracelulares son cada codificada

esencialmente por un solo exn. La muy pequea


5 UTR no se muestra. (B) La clase I HLA pesada
grupo de genes de cadena se encuentra en 6p21.3 y
comprende aproximadamente 20 genes. Incluyen seis
los genes expresados (cajas azules llenos), cuatro
De larga duracin pseudogenes no procesados
(Cajas abiertas largo rojo etiquetados y), y una
variedad de copias de genes parciales (corto rojo abierto
cajas etiquetadas 1-7). Algunos de estos ltimos son
truncado en el extremo 5 (por ejemplo, 1, 3, 5, y 6),
algunos estn truncados en el extremo 3 (por ejemplo, 7), y
algunos contienen exones individuales (por ejemplo, 2 y 4).
Genes que codifican protenas
pgina 20

Captulo 9: Organizacin del Genoma Humano


274
9.3 genes de ARN
Gran parte de la atencin que se presta a los genes humanos se ha centrado en los
genes codificantes de protenas
porque eran consideradas largo para ser funcionalmente con mucho, el ms
importante
parte de nuestro genoma. En comparacin, los genes cuyos productos finales son
funcionales
ARN no codificante (ncRNA) molculas han sido tan poco apreciado que uno
de
los dos proyectos de secuencias del genoma humano reportados en 2001 no
contenan anlisis
en todos los genes de ARN humanos! El ARN se ve que es importante en la
evolucin muy temprano
( Recuadro9.3 ), pero sus funciones se imaginaron haber sido superado en gran
medida por
ADN y las protenas. En los ltimos tiempos, la gran mayora de molculas de
ARN se
imaginado para servir como molculas accesorias en la fabricacin de protenas.
Los ltimos aos han sido testigos de una revolucin en nuestra comprensin de
la
importancia de ARN y, aunque el nmero de genes que codifican protenas tiene
han revisado de manera constante a la baja desde las secuencias del genoma
humano proyecto fueron
reportado en el ao 2001, el nmero de genes de ARN est en constante revisin
al alza.

El diminuto genoma mitocondrial siempre fue considerado como excepcional, ya


65% (24 de 37) de sus genes son los genes de ARN. Ahora estamos empezando a
darnos cuenta
que el ARN transcrito a partir del ncleo no est dedicado de manera uniforme a
proprotena de sntesis como lo que se pensaba; en cambio, muestra una gran
diversidad funcional.
Lo que ha cambiado nuestra forma de pensar? Las primeras clases,
completamente insospechadas de
NcRNA han sido recientemente descubiertos, incluyendo varias clases prolficos
de la pequea
ARN regulador. En segundo lugar, el reciente anlisis de todo el genoma
utilizando microarrays y
de alto rendimiento de secuenciacin de transcripcin han demostrado que al
menos el 85% y posiBly ms de 90% del genoma humano se transcribe. Es decir, ms de 85%
de las posiciones de nucletidos en el genoma euchromatic estn representados
en pritranscripciones mary producen a partir de al menos una de las dos hebras de
ADN. Otros dos
principales sorpresas fueron la medida de la transcripcin y la multignica
pervasiveNess de la transcripcin bidireccional. Los datos recientes cuestionan la
distincin
entre los genes y el espacio intergnica y han obligado a un replanteamiento
radical de la conconcepto de un gen ( Cuadro9.4 ).
E1
(UN)
(SEGUNDO)
E2
E3
la transcripcin y
procesamiento del ARN
la integracin en
ADN cromosmico
la sntesis de la segunda cadena
y la reparacin del ADN
marcha atrs
transcriptasa
5

AAAA A
norte
3
AAAAAN
norte
AAAAAN
norte
AAAAAN
norte
ARNm
3
TTTT T
norte
5 ADNc
TTTTT TTTT
P
3
5
TTTTTN
norte
5
3
3
5
TTTTTN
norte
5
3
TTTT T
norte
AAAA A
3
5
TTTTTN
norte
AAAAAN
norte
TTTTTN
norte
5
3

Figura 9.12 pseudogenesprocesados


y retrogenes se originan por la inversa
transcripcin a partir de transcritos de ARN.
(A) En este ejemplo, un gen que codifica la protena
con tres exones (E1-E3) se transcribe a partir
un promotor aguas arriba (P), y son intrones
extirpados de la transcripcin para producir un ARNm.
El ARNm se puede convertir entonces naturalmente
en un ADNc de una sola cadena antisentido por
utilizando la funcin de la transcriptasa inversa celular
(Proporcionado por LINE-1 repite). (B) Integracin
del ADNc se prev en escalonada
descansos (indicadas por las flechas rizado) en A-rica
secuencias, pero podran ser asistidos por el
LINE-1 endonucleasa. Si la secuencia A-rica
se incluye en un voladizo 5 , se podra formar
un hbrido con el extremo distal de la poli (T)
del ADNc, facilitando segunda hebra
sntesis. Debido a las pausas escalonadas
durante la integracin, la secuencia insertada
ser flanqueado por repeticiones directas cortas
(Secuencias en caja).
TABLA 9.8 EJEMPLOS DE HUMANO intronless retrogenes Y SUS
PADRES homlogos INTRON CONTAINING
retrogene
Intrn que contiene homlogo
Producto
GK2 en 4q13
GK1 en Xp21
glicerol quinasa
PDHA2 en 4q22
PDHA1 en Xp22
piruvato deshidrogenasa
PGK2 en 6p12
PGK en Xq13
fosfoglicerato quinasa
TAF1L en 9p13
TAF1 en Xq13
caja TATA de unin al factor protena asociada, 250 kD
MYCL1 en 1p34
MYCL2 en Xq22

homlogo de oncogn v-Myc


GLUD1 en 10q23
GLUD2 en Xq25
glutamato deshidrogenasa
RBMXL en 9p13
RBMX en Xq26
ARN-protena de unin importante en el desarrollo del cerebro
pgina 21

275
Sabemos desde hace muchas dcadas que diversas clases ncRNA ubicuas son
esencial para la funcin celular. Hasta hace poco, sin embargo, hemos sido en
gran parte acosbrado a pensar en NcRNA como no mucho ms que una serie de accesorios que
son
necesaria para procesar los genes para producir protenas. ARN de transferencia
son necesarios en el muy
el final de la va, que sirve para decodificar los codones en el ARNm y
proporcionar amino
cidos en el orden en que son necesarias para su insercin en cadenas de
polipptido en crecimiento.
ARN ribosomal son componentes esenciales de los ribosomas, el complejo
ribosoma
fbricas de nucleoprotena de la sntesis de protenas.
Se conocen otros ncRNAs ubicuos para funcionar ms arriba en la va de
garantizar el trabajo de los precursores de ARNm, ARNr, ARNt y. Varios
ARN pequeos son componentes de ribonucleoprotenas complejos involucrados
en diferentes
reacciones de procesamiento, incluyendo corte y empalme, la escisin de rRNA y
tRNA precursores,
y las modificaciones de base que son necesarios para la maduracin del
ARN. Normalmente, estos
ARN funcionan como gua RNAs , por apareamiento de bases con secuencias
complementarias en el
ARN precursor.
Tambin hemos sido siempre consciente de algunas ncRNAs que tienen otras
funciones, tales
como ARN implicados en la inactivacin del cromosoma X y la impresin, y el
componente ARN de
la ribonucleoprotena telomerasa necesaria para la sntesis del ADN de los
telmeros
(Vase la Figura 2.13). Pero estos ARN parecan haber excepciones peculiares.

En la ltima dcada ms o menos, sin embargo, no ha habido una revolucin en


la forma en que vemos
RNA. Muchos miles de diferentes ncRNAs se han identificado recientemente en
aniLas clulas mal. Muchos de ellos estn regulados por el desarrollo y se ha
demostrado que
tienen un papel crucial en toda una variedad de diferentes procesos que ocurren
en especialzados tejidos o etapas especficas del desarrollo. Varios ncRNAs ya han sido
implicado en el cncer y la enfermedad gentica.
Ahora que el genoma humano se sabe que tiene cerca de 20.000 codificacin de
protenas
genes, casi lo mismo que en el de 1 mm nematodo Caenorhabditis elegans , que
slo alrededor de 1000 tiene clulas que la pregunta ahora es si la regulacin
basada en el ARN es
la caracterstica clave en la explicacin de nuestra complejidad. Ciertamente, la
complejidad de ARN
la regulacin de genes basado aumenta notablemente en organismos complejos,
como se describe
en el Captulo 10. Tal vez es hora para ver el genoma ms como una mquina de
ARN
que una simple mquina de protenas.
Las protenas no pueden auto-replicarse, y as muchos genetistas evolutivos
considerar que autocataltico
cidos nucleicos deben haber protenas son anteriores y fueron capaces de
replicarse sin la ayuda de
protenas. La hiptesis del mundo de ARN desarrollado a partir de las ideas
propuestas por Alexander Rich y
Carl Woese en la dcada de 1960. Se imagina que el ARN tena un doble papel en
las primeras etapas de la vida, actuando
ya que tanto el material gentico (con la capacidad de auto-replicacin) y
tambin como molculas efectoras.
Ambas funciones son hoy todava evidente: algunos virus tienen genomas de
ARN y ARN no codificante molculas
puede funcionar como molculas efectoras con actividad cataltica. ARNasa P,
por ejemplo, es una ribozima que
puede escindir ARN sustrato sin ningn requisito para la protena, y ciertos tipos
de intrn
son autocataltico y capaz de empalmar a salir de las transcripciones de ARN sin
la ayuda de

protenas (ver texto). Otra observacin consistente con ARN de ser el primer
cido nucleico es que
desoxirribonucletidos se sintetizan a partir ribonucletidos en vas celulares.
Adems de almacenar informacin gentica, el ARN se ha imaginado que se han
utilizado
posteriormente para sintetizar protenas a partir de aminocidos. Diferentes ARN,
incluyendo rRNA y
tRNA, son esenciales para ayudar a la sntesis de polipptidos. Muchas protenas
ribosomales se pueden eliminar
sin afectar la funcin del ribosoma, y la actividad de la peptidil transferasa
fundamental enzima
que cataliza la formacin de pptidos bonos es una ribozima. Sin embargo, el
ARN tiene una bastante rgido
columna vertebral y por tanto no se adapta muy bien como una molcula
efectora. Las protenas son mucho ms flexibles
y tambin ofrecen variedad ms funcional ya que los 20 aminocidos pueden
tener muy diferentes
estructuras y ofrecer ms posibilidades de combinacin de secuencia (un
decapptido proporciona 20
10
o alrededor
10
13
diferentes secuencias de aminocidos posibles, mientras que un decanucleotide
tiene 4
10
o alrededor de 10
6
diferentes secuencias posibles).
La sustitucin de ARN con ADN como una molcula de almacenamiento de
informacin proporcionado significativa
ventajas. ADN es mucho ms estable que el ARN, y as es ms adecuado para
esta tarea. su azcar
residuos carecen del grupo OH 2 en azcares de ribosa que hace RNA
propensos a la escisin hidroltica.
Mayor eficiencia podra lograrse mediante la separacin del almacenamiento y la
transmisin de gentica
informacin (ADN) a partir de la sntesis de protenas (RNA). Todo lo que se
necesitaba era el desarrollo de una
la transcriptasa inversa de modo que el ADN podra sintetizarse a partir de
desoxinucletidos mediante el uso de un ARN

modelo.
genes de ARN
CUADRO 9.3 EL MUNDO ARN HIPTESIS
pgina 22

Captulo 9: Organizacin del Genoma Humano


276
Hasta que se realizaron los anlisis de todo el genoma, un ser humano tpico
gen codificante de la protena se imagin estar bien definidos y separados
de sus vecinos por espacios intergnicas identificables. El gen hara
suelen ser dividido en varios exones. Dirigida a partir de una corriente arriba
promotor, un transcrito primario complementario a una sola cadena de ADN
sufrira de empalme. La importancia funcional (chatarra) intrnica
secuencias seran descartados, lo que permite la fusin de la importante
exonic secuencias para hacer un ARNm. Expresin se regulara
por secuencias reguladoras cercanos normalmente se encuentra cerca de la
promotor.
Esta imagen, acogedor y cuidado de un gen ha sido afectado por una serie
de complicaciones. Desde hace tiempo se sabe que algunos genes nucleares
coinciden en parte otros o estn incorporadas en su totalidad
dentro de los genes mucho ms grandes. Los diferentes productos
se sabe que es producido a partir de un solo gen
mediante el uso de promotores alternativos, alternativa
empalme, y la edicin de ARN. Muy de vez en cuando,
secuencias de diferentes genes podran ser
empalmados juntos a nivel del ARN, a veces
incluso en el caso de los genes en diferente
cromosomas ( trans-empalme ). De vez en cuando,
Se observaron transcripciones antisentido naturales
que podra ser visto para regular la expresin
de la transcripcin de un gen sentido. Algunos genes
se sabe que tienen elementos reguladores
situado a muchos cientos de kilobases de distancia,
a veces dentro de otro gen.
A pesar de estas complicaciones, los cientficos
no estaban muy dispuestos a renunciar a la sencilla
idea de un gen descrito en el primer prrafo
anteriormente, y mientras todo el genoma anlisis aicos
conceptos errneos anteriores. el significativa
hallazgos que obligaron a una reevaluacin de gen
organizacin fueron:

La transcripcin es un fenmeno generalizado . Ms de 85%


del genoma humano es euchromatic
transcrita, y la transcripcin es multignica
comn, de modo que la distincin entre
genes y intergnicas espacio es ahora mucho
menos aparente ( Figura1 ). Alrededor del 70% de
genes humanos se transcriben a partir tanto
hebras.

Codificacin de las cuentas de ADN por menos de uno


cuarta parte de la altamente conservada (y
presumiblemente funcionalmente importante) Fraccin
del genoma. Esto significaba que no debe
haber muchos ms funcionalmente importante
lo que se esperaba secuencias de ADN no codificantes. Y as
demostrado. Un nmero inesperadamente alto de reglamentacin conservadas
secuencias y numerosos nuevos RNAs no codificantes (ncRNAs) tienen
sido, y seguir siendo, identificados, a menudo dentro o expandir
intrones de los genes codificantes de protenas conocidas.
Como resultado de los anlisis intensivos de transcriptomes de mamferos,
muchos miles de transcripciones de funcin desconocida han sido
descubierto. Por lo general, NcRNA y codificacin de protenas transcripciones
se superponen,
la creacin de patrones complicados de transcripcin ( Figura2 ). En algunos
casos, como en el impreso SNURF-SNRPN transcripcin en 15q12, una
nico transcrito contiene un ARN que codifica ms un ARN no codificante que
son
separados por divisin de ARN.
5
5
5
3
3
5
3
3
gen 1
gen 2
gen 4
gen 3
adelante

hebra
transcripciones
marcha atrs
hebra
transcripciones
anotado exones
novedosas alquitranes
5
(UN)
(SEGUNDO)
3
3
5
5
3
3
5
ARNs cortos
ARNs cortos
ARNs cortos
antisentido
ncRNA
antisentido
ncRNA
ARNs cortos
ARNsno
ncRNA
miARN
que codifica la protena RNA
Figura 1 difuminacindeloslmitesdegenesaniveldetranscripcin. Enel
pasado,loscuatrogenes
en la parte superior sera de esperar que se comporten como unidades discretas
que no se solapan de transcripcin.
Como se muestra mediante anlisis recientes, la realidad es ms complicada. Una
variedad de transcripciones menudo
enlaces exones en los genes vecinos. Las transcripciones incluyen
frecuentemente secuencias de
regiones transcripcionalmente activas antes insospechados (TAR). [De Gerstein
MB, Bruce C,
Rozowsky JS et al. (2007) Genome Res. 17, 669-681. Con el permiso de Cold
Spring Harbor

Laboratory Press.]
Figura 2 Ampliatranscripcional
la complejidad de los genes humanos. (A) Human
genes se transcriben con frecuencia en tanto
hebras, como se muestra en este gen hipottico
racimo. (B) Un solo gen puede tener mltiples
sitios de inicio transcripcional (flechas en ngulo recto)
as como muchos de codificacin entrelazada y
transcripciones no codificantes. Los exones se muestran como
cajas azules. ARNs cortos conocidos como pequea
ARN nucleolar (snoRNAs) y microRNAs
(MiRNAs) pueden ser transformados a base de intrnica
secuencias y nuevas especies de ARN cortas
que se agrupan alrededor principio y al final
de genes se han descubierto recientemente (ver
el texto). [De Gingeras TR (2007) Genome
Res. 17, 682-690. Con el permiso de fro
Spring Harbor Laboratory Press.]
CAJA 9.4 REVISIN DEL CONCEPTO DE UN GEN EN LA ERA
POST GENOME
pgina 23

277
La figura 9.13 daunaperspectivamodernasobreladiversidadfuncionalde
ARN. En
esta seccin se consideran las funciones de genes y las organizaciones de los
diferentes
clases de ARN humano ( Tabla9.9 ). Numerosas bases de datos se han
desarrollado
recientemente para documentar datos sobre ncRNAs ( Tabla9.10 ).
Ms de 1000 genes humanos codifican un rRNA o tRNA, la mayora
dentro de grandes grupos de genes
los genes del RNA ribosomal
Adems de las dos molculas de ARNr mitocondrial (12S y 16S rRNA), hay
cuatro tipos de citoplsmico rRNA, tres asociados con el gran ribosoma subunidad (28S, 5.8S y 5S rRNAs) y otro con la subunidad pequea del ribosoma
(18S
rRNA). Los genes 5S rRNA se producen en pequeos grupos de genes, siendo la
ms grande de un clster
de 16 genes en el cromosoma 1q42, cerca del telmero. Slo unos pocos 5S
rRNA

los genes se han validado como funcional, y hay muchos dispersa


pseudogenes.
Las 28S, 5.8S y 18S ARNr estn codificados por un solo transcripcin multigenic
unidad (ver Figura 1.22) que se repite en tndem para formar tamao de
megabases
ADN ribosomal matrices (alrededor de 30-40 repeticiones en tndem, o
aproximadamente 100 genes rRNA)
en los brazos cortos de cada uno de los cromosomas acrocntricos humanos 13,
14, 15, 21,
y 22. No sabemos el nmero de genes precisos debido a que el ADN ribosomal
arrays fueron excluidos del Proyecto Genoma Humano, como resultado de la
tcnica
dificultades en la obtencin de cal de pedido inequvoca de la superposicin de
clones de ADN para
regiones largas compuestas de repeticiones en tndem muy similares.
protena
sntesis
y exportacin
ARN
maduracin
escote
base
modificacin
ARNm
snRNA
rRNA
ARNt
ARN 7SL
ADN
sntesis
gene
regulacin
general
transcripcin
regulacin
TERC
Y ARN
transposn
controlar
piRNA
endo-siRNA

RNasa
MRP
empalme
RNasa P
de pre-tRNA
scaRNA
de snRNA
ARNsno
de rRNA
RNasa MRP
U1 snRNA
U2 snRNA
basado en RNAi
silenciamiento gnico
miARN
ARNs largos como
trans -actuando
reguladores
AIRE CALIENTE
ARN largos en
cis -antisense
regulacin
TSIX
especfico
empalme
regulador
HBII-52
ARNsno
AIRE
endo-siRNA
epigentica
gene
regulacin
XIST
H19
HBII-85
ARNsno
ARN SRA1
ARN 7SK
de pre-rRNA

Figura 9.13 LadiversidadfuncionaldeARN. VariosARNubicuosfuncionar


ensusactividadesdelimpiezaenlasclulasyenlasntesisdeprotenas
y exportacin de protenas a partir de clulas (usando 7SL ARN, el componente
ARN de la partcula de reconocimiento de seal). ARN implicados en el ARN
la maduracin incluyen spliceosomal pequeos ARN nucleares (snARN),
pequeos RNAs nucleolar (snoRNAs), pequeos RNAs cuerpo Cajal (scaRNAs),
y dos ribonucleasas de ARN. la sntesis de ADN de los telmeros se lleva a cabo
por una ribonucleoprotena que consiste de TERC (el ARN de telomerasa
componente) y una transcriptasa inversa (vase la Figura 2.13). La familia Y
RNA estn implicadas en la replicacin del ADN cromosmico, y RNasa
MRP tiene un papel crucial en la iniciacin de la replicacin del ADNmt, as
como en la escisin de precursores de pre-rRNA en el nucleolo. Diversas clases
de
ARN tienen una funcin reguladora en la expresin gnica. Aunque algunos
tienen funciones accesorias generales en la transcripcin, reguladora
ARN a menudo se componen en su expresin a determinados tipos de clulas y /
o etapas de desarrollo. Tres clases de pequeos ARN uso de ARN
de interferencia (RNAi), los caminos para actuar como reguladores: Piwi ARNprotena interaccin (piRNAs) regulan la actividad de los transposones en
Las clulas de la lnea germinal; microARN (miARN) regulan la expresin de los
genes diana; y corto de interferencia ARN endgenos (endo-siRNAs)
actuar como reguladores de genes y tambin regular algunos tipos de
transposn. Algunos miembros de la familia, tales como ARNsno HBII-85,
ARNsno
estn implicados en la regulacin epigentica de los genes. Un gran nmero de
ARNs largos estn involucrados en la regulacin de varios genes, a menudo en el
nivel de la transcripcin. Algunos se sabe que estn implicados en la regulacin
epigentica de los genes en la impronta, X-inactivacin, y as
sucesivamente. ARN
familias se muestran en tipo negro; ARNs individuales se muestran en rojo.
genes de ARN
pgina 24

Captulo 9: Organizacin del Genoma Humano


278
TABLA 9.9 clases principales de ARN no codificante HUMANO
clase de ARN
o subclase
evolutivo/
funcional
subfamilia

No. de
diferente
tipos
Funcin
organizacin de genes, la biognesis, etc.
ribosomal
RNA (rRNA),
120-5000
nucletidos
12S rRNA, 16S rRNA
1 de cada
componentes de los ribosomas mitocondriales
escindido a partir de transcritos producidos multignicas
por H hebra de ADN mitocondrial (Figura 9.3)
5S rRNA, 5.8S rRNA,
18S rRNA, 28S rRNA
1 de cada
componentes de los ribosomas citoplasmticos
5S rRNA es codificada por mltiples genes en
varios grupos de genes; 5.8S, 18S, y 28S
rRNA se escinden de transcripciones multignicas
(Figura 1.22); los multigenic 5.8S-18S-28S
unidades de transcripcin se repiten en tndem en
cada uno de 13p, 14p, 15p, 21p, 22p y (= ADNr
clusters)
Transferir
RNA (tRNA),
70-80
nucletidos
familia mitocondrial
22
decodificar ARNm mitocondrial para hacer 13
protenas en los ribosomas mitocondriales
los genes de una sola copia. tRNAs se escinden de
transcripciones de ADNmt multignica (Figura 9.3)
familia citoplasmtica
49
mRNA decodificacin producido por genes nucleares
(Figura 9.13)
700 genes y pseudogenes de ARNt dispersado
en mltiples localizaciones cromosmicas con algunos

grandes grupos de genes


Small nuclear
RNA (snRNA),
60-360
nucletidos
familia spliceosomal
con subclases Sm
y Lsm (Tabla 9.10)
9
U1, U2, U4, U5 y U6 proceso ARNsn
intrones estndar GU-AG (Figura 1.19);
U4atac, U6atac, U11, U12 y snARNs
procesar intrones raras AU-AC
aproximadamente 200 genes ARNsn spliceosomal son
encontraron en varios lugares, pero hay
moderadamente grandes grupos de U1 y U2 snRNA
genes; la mayora son transcritos por ARN pol II
no spliceosomal
snARNs
varios
U7 snRNA: 3 procesamiento del ARNm de histonas;
7SK ARN: regulador de la transcripcin general;
Y ARN de la familia: participa en los cromosomas
replicacin del ADN y reguladores de la clula
proliferacin
en su mayora los genes funcionales de una sola copia
Pequea
ARN nucleolar
(SnoRNA),
60-300
nucletidos
clase de cuadro / D C
(Figura 9.15A)
246
maduracin de rRNA, la mayora de nucletidos
site-specific 2 - O -ribose metilaciones
por lo general dentro de intrones de la codificacin de protenas
genes; mltiples localizaciones cromosmicas, pero
algunos genes se encuentran en mltiples copias en
grupos de genes (como el HBII-52 y HBII-85
clsters de la figura 11.22)

clase H / ACA
(Figura 9.15b)
94
maduracin de rRNA por uridines modificadores
en posiciones especficas para dar pseudouridine
Pequeo Cajal
ARN cuerpo
(ScaRNA)
25
la maduracin de ciertas clases snRNA en
los rganos Cajal (cuerpos en espiral) en el ncleo
por lo general dentro de intrones de la codificacin de protenas
genes
ARN
ribonucleasas,
260-320
nucletidos
2
RNasa P escinde pre-tRNA en el ncleo +
mitocondrias; RNasa MRP escinde rRNA
en el nuclolo y est implicado en la iniciacin
la replicacin del ADNmt
los genes de una sola copia
Diverso
pequea
citoplasmtica
ARN,
80-500
nucletidos
FC200
1
RNA neural que regula dendrticas
la biosntesis de protenas; originado de Alu
repetir
1 gen, BCYRN1 , en 2p16
ARN 7SL
3
componente de la seal de reconocimiento de
partculas (SRP) que media la insercin de
protenas de secrecin en el lumen de la
retculo endoplsmico

tres genes estrechamente relacionados agrupados en


14q22
TERC (telomerasa
componente ARN)
1
componente de la telomerasa, la
ribonucleoprotena que sintetiza
ADN telomrico, utilizando TERC como plantilla
(Figura 2.13)
gen de una sola copia en 3q26
ARN bveda
3
componentes de la bveda RNP citoplasmticos
que se han pensado para funcionar en
resistencia a las drogas
VAULTRC1, VAULTRC2 , y VAULTRC3 son
agrupada en 5q31 y compartir secuencia de 84%
identidad
Y ARN
4
componentes de la 60 kD Ro
ribonucleoprotena, un objetivo importante de
respuestas autoinmunes humorales
RNY1, RNY3, RNY4 , y RNY5 se agrupan en
7q36
pgina 25

279
Transferir genes de ARN
Las 22 ARNt mitocondriales diferentes son hechas por 22 genes de ARNt en el
ADNmt. los
listas de bases de datos genmica tRNA ms de 500 genes de ARNt humanos que
hacen que un cytoplasARNt micrfono con una especificidad definida anticodn. Los genes se pueden
clasificar en 49
familias sobre la base de la especificidad anticodn ( Recuadro9.5 ). Slo hay
una correlacin aproximada
relacin de nmero de genes tRNA humana con la frecuencia de
aminocidos. Por ejemplo,
30 genes de ARNt especifican el aminocido cistena comparativamente raros
(que

cuentas para el 2,25% de todos los aminocidos en las protenas humanas), pero
slo 21 genes de ARNt
especificar la prolina ms abundante (que tiene una frecuencia de 6,10%).
Aunque los genes de ARNt parecen estar dispersos por todo el genoma humano,
ms de la mitad de los genes de ARNt humanos (273 de 516) residen en cada
cromosoma
un 6 (con muchas agrupadas en una regin de 4 Mb en 6P2) o el cromosoma 1.
En Adems
cin, 18 de la 30 Cys tRNAs se encuentran en un tramo de 0,5 Mb del
cromosoma 7.
CUADRO 9.10 PRINCIPALES no codificante ARN BASES DE DATOS
Base de datos
Descripcin
URL
NONCODE
base de datos integrada de todos los ncRNAs excepto ARNr y ARNt
http://www.noncode.org
base de datos de ARN no codificante
secuencias y funciones de las transcripciones no codificantes
http://biobases.ibch.poznan.pl/ncRNA/
RNAdb
base de datos completa de ARN no codificante de mamferos
http://research.imb.uq.edu.au/rnadb/
Rfam
familias de ARN no codificante y la secuencia de alineaciones
http://rfam.sanger.ac.uk/
Anticode
base de datos de transcripciones antisentido naturales
http://www.anticode.org
sno / scaRNAbase
nucleolar RNAs pequeos y pequeos RNAs de cuerpo especfico Cajal
http://gene.fudan.sh.cn/snoRNAbase.nsf
ARNsno-LBME-db
snoRNAs humanos integrales
http://www-snorna.biotoul.fr/
Base de datos genmica tRNA
secuencias completas de ARNt
http://lowelab.ucsc.edu/GtRNAdb/
Recopilacin de las secuencias de ARNt
y las secuencias de genes de ARNt
tal y como su nombre indica

http://www.tRNA.uni-bayreuth.de
miRBase
y secuencias de genes miARN genes diana
http://microrna.sanger.ac.uk/
piRNAbank
secuencias conocidas empricamente y otra informacin relacionada
en piRNAs reportados en diversos organismos, incluyendo humanos,
ratn, rata, y Drosophila
http://pirnabank.ibab.ac.in/
TABLA 9.9 cont. clases principales de ARN no codificante HUMANO
clase de ARN
o subclase
evolutivo/
funcional
subfamilia
No. de
diferente
tipos
Funcin
organizacin de genes, la biognesis, etc.
MicroARN
(MiARN),
22 nucletidos
> 70 familias de
miRNAs relacionados
1000
varias funciones importantes en el gen
Reglamento, en particular en el desarrollo,
e implicado en algunos cnceres
vase la figura 9.17 para ejemplos de genoma
organizacin, y la Figura 9.16 para la forma en que son
sintetizado
Po de unin a ARN
(PiRNA), 24-31
nucletidos
89 persona
racimos
> 15.000
menudo derivado de repeticiones; expresada
slo en las clulas de la lnea germinal, donde
limitar el exceso de actividad transposn

89 grandes grupos distribuidos en todo el genoma;


grupos individuales se extienden a partir de 10 kb a 75 kb
con un promedio de 170 piRNAs por racimo
Endgeno
de interferencia corto
RNA (endosiRNA), 21-22
nucletidos
muchos
probablemente
mas que
10.000
un
menudo derivado de pseudogenes,
repeticiones invertidas, etc .; envuelto en
la regulacin de genes en las clulas somticas y
tambin pueden estar involucrados en la regulacin de
algunos tipos de transposn
racimos en muchos lugares en el genoma
de largo no codificante
ARN regulador,
a menudo> 1 kb
muchos
> 3000
involucrados en la regulacin del gen
expresin; Algunos estn involucrados
en la expresin monoallelic
(X-inactivacin, imprinting), y / o como
reguladores antisentido (Tabla 9.11)
por lo general copias de genes individuales; transcripciones menudo
someterse a la limitacin, de empalme y de poliadenilacin
pero ARN antisentido son tpicamente reguladores largo
transcripciones que no sean objeto de empalme
un
Basndose en la extrapolacin de estudios en clulas de ratn.
genes de ARN
pgina 26

Captulo 9: Organizacin del Genoma Humano


280
familias de genes dispersos hacen varios pequeos ARN nucleares que
facilitar la expresin de genes en general

Varias familias de molculas de ARN en lugar pequeos (60-360 nucletidos de


longitud) son
sabe que tiene un papel en el ncleo para ayudar a la expresin de genes en
general, la mayora
en el nivel de procesamiento post-transcripcional. Inicialmente, tales ARN eran
simplemente
etiquetados como pequeos ARN nucleares ( snARN ) para distinguirlos de preARNm.
Muchos de ellos eran conocidos por ser ricos en uridina y fueron nombradas en
consecuencia
(U2 snRNA, por ejemplo, no respeta una famosa banda de rock irlandesa sino
simplemente
indica el segundo ARN nuclear pequeo uridina-rica para ser clasificado). Como
rRNA,
No hay correspondencia uno-a-uno entre los codones en el ARNm citoplsmico y
el tRNA
anticodones que los reconocen. Los 64 codones posibles se muestran en
la Figura1 , junto con el
(no modificados) anticodones. Las lneas horizontales se unen pares codnanticodn. codones alternativos que
difiere en que tiene una C o una U en la tercera posicin de la base puede ser
reconocido por un solo anticodn ( tercera
bamboleo de base , que se muestra por galones). Hay tres reglas para la
descodificacin de los codones de ARNm citoplasmticos:

Los codones en cajas de dos codones. Aquellos codones que terminan en U / C


que codifican un aminocido diferente
de los que terminan con A / G se conocen como cajas de dos codones. Aqu la
posicin de oscilacin T / C
normalmente se decodifica con una G en la posicin de base 5 en el anticodn
de ARNt. Por ejemplo, en el
la parte superior izquierda de Phe, no hay tRNA con una A anticodon AA para
que coincida con la UU U codn, pero el
G AA anticodon puede reconocer tanto UU U y UU C codones en el ARNm (ver
Figura 1).

Codones no glicina en cajas de cuatro codones. Cajas de cuatro codones son


aquellos en los que U, C, A, G y
en la tercera, bamboleo, posicin todos codifican el mismo aminocido. Aqu la
posicin de oscilacin T / C

es decodificada por un adenosina modificados qumicamente, conocida como la


inosina, en el 5 posicin en el
anticodn (cajas sombreadas azules; vase la figura 11.31 para la estructura de la
inosina). inosina puede
par de bases con A, C, o U. Por ejemplo, en la parte inferior izquierda, los
GU U y GU C codones de la
cuadro de valina de cuatro codn se decodifican por un ARNt con un anticodn
de A AC, que es sin duda
modificado para I AC. El I anticodn de CA puede reconocer cada uno de
GU U , GU C , y GU A . Para evitar
posible interpretacin errnea de la traduccin, ARNt con inosina en los
extremos 5 base del anticodn no puede
ser utilizado en cajas de dos codones.

. Codones de glicina El cuadro de glicina de cuatro codn proporciona la nica


excepcin a esta regla:
GGU y GGC codones son decodificados por un G anticodon CC, en vez de la
esperada I CC
anticodn.
Por lo tanto, slo se requieren 16 anticodones a decodificar los 32 codones que
terminan en un T / C. El mnimo
Por lo tanto, conjunto de anticodones es 45 (64 menos 3 codones de terminacin,
menos de 16). Sobre esta base, se podra
predecir un total de 45 clases diferentes de tRNA humano. Sin embargo, a pesar
de la generalidad de la tercera base
bamboleo, tres pares de codones que terminan en T / C son atendidas por dos
anticodones cada uno (ver Figura 1), y
por lo que hay un extra de tres clases de ARNt. Adems, un tRNA especializado
lleva un anticodn para
el codn UGA (que normalmente funciona como un codn de parada). A
concentraciones altas de selenio, este
ARNt ser muy ocasionalmente decodificar UGA para insertar el aminocido 21,
seleniocistena, en un selecto
grupo de selenoprotenas. Por lo tanto, hay 45 + 3 + 1 = 49 clases diferentes de
tRNA humana, codificada
por varios cientos de genes (vase la Figura 1).
UUU
AAA NVND
GAA 12
UUA

UAA 7
UUG
CAA 7
Phe
Leu
UCU
11 AGA
UCC
GGA UCA
UGA 5
UCG
CGA 4
Ser
UAU
AUA 1
UAC
GUA 14
UAA
UUA UAG
CUA Tyr
detener
detener
UG
ACA UGC
ACG 30
UGA
UCA - (3)
UGG
CCA 9
Cys
detener
Trp
CUU
AAG 12
CUC
GAG CUA

UAG 3
CUG
CAG 10
Leu
CCU
AGG 10
CCC
GGG CCA
UGG 7
CCG
CGG 4
Pro
CAU
a AUG CAC
GUG 11
CAA
UUG 11
CAG
CUG 20
Su
gln
UGE
ACG 7
CGC
GCG CGA
UCG 6
CGG
CCG 4
Arg
AUU
AAU 14
AUC
GAU 3
AUA
UAU 5
AGOSTO
CAU 20
Ile

Reuni
ACU
AGU 10
ACC
GGU ACA
UG 6
ACG
UGE 6
Thr
AAU
AUU 2
AAC
GUU 32
AAA
UUU 16
AAG
CUU 17
Asn
Lys
AGU
ACU AGC
GCU 8
AGA
UCU 6
AGG
CCU 5
Ser
Arg
GUU
AAC 11
GUC
GAC GUA
UAC 5
GUG
CAC 16
Val
GCU
AGC 29

GCC
GGC GCA
UGC 9
GCG
CGC 5
Ala
GAU
ABC GAC
GUC 19
GAA
NVND 13
MORDAZA
13 CUC
spid
Glu
GGU
ACC GGC
15 GCC
GGA
UCC 9
GGG
CCC 7
Gly
Figura 1 Msde500diferentehumana
ARNt citoplasmticos decodificar los 61
los codones que especifican el 20 estndar
aminocidos. Las relaciones entre
los 64 codones posibles (posicionado prximo
a los aminocidos de la izquierda de los cuatro
principales columnas) y la correspondiente
anticodones (a la derecha de los cuatro
columnas) se muestran. El nmero al lado de
cada anticodn es el nmero de diferentes
ARNt humanos que se documentan en el
Genmica tRNA base de datos (ver Tabla 9.9)
como en libros que anticodn. Tenga en cuenta que 12
de los 61 anticodones capaces de reconocer
los codones que especifican el 20 estndar

aminocidos no estn representados en el


ARNt (mostrados por guiones). Esto pasa
a causa de oscilacin en la tercera base de
posicin de la mayora de los codones en el que el tercero
base es T o C (las excepciones son para el codn
AU pares U / AU C , AA T / AA C , y UA U /
UA C ). El (3) indicado por un asterisco
significa que hay tres diferentes
tRNAs selenocysteine con un anticodn
que puede reconocer el codn UGA,
que normalmente sirve como un codn de parada.
Las adeninas sombreadas son ms probablemente
una forma modificada de adenina conocida
como inosina, en la que el grupo amino
unido al carbono 6 se sustituye por una
C = O grupo carbonilo.
CAJA DE ESPECIFICIDAD 9,5 anticodn ARNt eucariotas
CITOPLSMICA
pgina 27

281
ARNsn molculas se unen diversas protenas y funcionan como
ribonucleoprotenas
(SnRNPs).
Posteriormente, varios snARNs, entre ellos algunos de los primeros en
clasificarse,
se encontr que estar involucrados en el procesamiento post-transcripcional de
precursores rRNA
en el nuclolo; Por lo tanto, se re-clasificados como pequeos ARN nucleolar
( SnoRNAs ), por ejemplo U3 y U8 snoRNAs. Ms recientemente, miembros de
la
las clases se ha basado en la clasificacin estructural y funcional.
Un tercer grupo de pequeos RNAs han sido identificados pero que se asemejan
a snoRNAs
se limitan a los rganos Cajal (tambin llamados cuerpos en espiral ), estructura
nuclear discreta
turas en el ncleo que estn estrechamente relacionados con la maduracin de
snRNPs.
Se han llamado ARN pequeos de cuerpo Cajal ( scaRNAs ). Cientos de su
mayora
genes humanos dispersos se dedican a hacer snRNA y ARNsno, y hay
muchos cientos de pseudogenes asociados.

Spliceosomal pequeos ARN nucleares (snRNA genes)


Los nueve snARNs spliceosomal humanos varan en longitud de 106 a 186
nucletidos
y obligar a un anillo de siete protenas del ncleo. U1, U2, U4, U5 ARNsn, y U6
operan
dentro de la spliceosome importante para procesar intrones GU-AG
convencionales (vase la figura
1,19). U4atac, U6atac, U11, U12 y snARNs forman parte de la spliceosome
menor
que los impuestos especiales raras intrones AU-AC. Cada uno de los snRNPs
spliceosomal contiene siete
protenas bsicas que son idnticos dentro de una subclase y un conjunto nico
de snRNPprotenas especficas. La subclase Lsm se compone de solo U6 y U6atac
snARNs; el
otros ARNsn spliceosomal pertenecen a la subclase Sm ( Tabla9.11 y lafigura
9,14 ).
Ms de 70 genes especifican snARNs utilizados en el principal
spliceosome. Ellos
incluir 44 genes identificados que especifican U6 snRNA y 16 que especifican
U1 snRNA.
Existe alguna evidencia de la agrupacin. genes ARNsn U2 mltiples se
encuentran en
17q21-q22 pero el nmero de copias vara; un grupo de aproximadamente 30 U1
snRNA genes es
situado en 1p36.1.
TABLA 9.11 LOS Sm y LSM CLASES DE spliceosomal ARNsn
clase sm
un
clase LSM
Componente de gran spliceosome
U1, U2, U4, U5 y ARNsn
U6 snRNA
Componente de spliceosome menor
U11, U12, U4atac y snARNs U5
U6atac snRNA
Estructura
vase la Figura 9.14A
vase la Figura 9.14B
transcrito por
ARN polimerasa II

ARN polimerasa III


protenas del ncleo Bound
protenas Sm (SMB, SmD1, SmD2, SmD3, SME, SMF, por SMG)
siete LSM protenas (LSM2-LSM8)
Ubicacin
sintetizado en el ncleo y luego se exporta a la
citoplasma, donde cada uno de ellos asociado con siete Sm
protenas y someterse a 5 3 y procesamiento final; luego
re-importados en el ncleo para someterse a ms de ARN
procesamiento de los rganos Cajal, antes de acumular en
motas para llevar a cabo la funcin spliceosomal
nunca deje el ncleo; someterse a la maduracin in
el nucleolo y luego se acumulan en motas a
realizar la funcin de spliceosomal
nucletidos especfica del sitio
modificacin
realizado por scaRNAs en los cuerpos de Cajal del ncleo
realizado por snoRNAs en el nuclolo
un
Aunque no es un spliceosomal snRNA, U7 snRNA tiene una estructura similar a
la clase Sm de ARNsn y cinco de sus siete protenas del ncleo son idnticas al
ncleo
protenas unidas por el Sm snARNs.
CH
3
CH
3
CH
3
OCH
3
GpppApNp
AAUUUUUGG
consenso
(UN)
El sitio Sm
3 madre
TMG tope
CH
3
pppGp

UUUUU
(SEGUNDO)
El sitio de LSM
3 madre
casquillo MPG
Figura 9.14 EstructurasdetipoSmysnARNsspliceosomaldetipoLSM.
De tipo Sm (A) snARNs contienen tres elementos de reconocimiento
importantes: una
5 -trimethylguanosine (TMG) gorra, un sitio de unin a protenas Sm (Sm
sitio), y
una estructura de tallo-bucle 3 . Se requieren el sitio Sm y los 3 elementos
madre
para el reconocimiento por el complejo de la supervivencia de las neuronas
motoras (SMN) para el montaje
en ribonucleoprotenas bsicas estables (RNPs). El consenso sitio Sm dirige el
montaje de un anillo de las siete protenas Sm bsicos (vase el cuadro 9.10). El
TMG tope
y se requieren las protenas del ncleo Sm reunidos para el reconocimiento por el
nucleares
maquinaria de importacin. (B) de tipo snARNs Lsm contienen un 5
-monomethylphosphate
guanosina (MPG) gorra y un vstago 3 , y terminan en un tramo de uridina
residuos (el sitio LSM) que est obligado por las siete protenas del ncleo LSM.
genes de ARN
pgina 28

Captulo 9: Organizacin del Genoma Humano


282
No spliceosomal pequeos genes de ARN nuclear
No todos los snARNs dentro de la funcin nucleoplasma como parte de
spliceosomas. Ambos
U1 y U2 snARNs tambin tienen funciones no spliceosomal. Se requiere U1
snRNA
para estimular la transcripcin por la ARN polimerasa II. U2 snRNA se sabe que
estimula
elongacin transcripcional por la ARN polimerasa II. Varios otros pequeos
nuclear
ARN con una funcin no spliceosomal han sido bien estudiados. Ellos tienden a
ser
genes de copia nica, pero hay muchos pseudogenes asociados. Tres ejemplos
se dan a continuacin.

U7 snRNA es un ARNsn de 63 nucletidos que se dedica a las especializadas 3

transformacin realizadas con ARNm de histonas, que, excepcionalmente, no es


poliadenilado.
ARN 7SK es un ARN de 331 nucletidos que funciona como un regulador
negativo de la
ARN polimerasa II del factor de elongacin P-TEFb.
La familia Y RNA consiste en tres ARNs pequeos (menos de 100 nucletidos
de largo)
que estn implicados en la replicacin del ADN cromosmico y funcionan como
reguladores
de la proliferacin celular.
Pequeos ARN nucleolar genes (snoRNA)
SnoRNAs son entre 60 y 300 nucletidos de longitud y fueron identificados
inicialmente en
el nuclolo, en el que guan modificaciones de nucletidos de ARNr en concreto
posiciones. Lo hacen mediante la formacin de dplex cortos con una secuencia
de la rRNA
que contiene el nucletido diana. Hay dos grandes subfamilias. H / ACA
pseudouridylations especficas del sitio gua snoRNAs (uridina se isomeriza para
dar
pseudouridine en 95 posiciones diferentes en el pre-rRNA). / D cuadro snoRNAs
gua C
El sitio-especfica 2 - O -ribose metilaciones (105-107 existen variedades de
este metilacin en rRNA). snoRNAs individuales especifican uno, oa lo sumo dos, tal
modificacin de base
ciones ( Figura9.15 ).
Por lo menos 340 genes humanos snoRNA se han encontrado hasta ahora, pero
puede haber
muchos ms porque snoRNAs son sorprendentemente difciles de identificar con
el uso de
enfoques bioinformticos. La gran mayora se encuentran dentro de los intrones
de
genes que se transcriben ms grandes por la ARN polimerasa II. Estos snoRNAs
son proproducida por el procesamiento del ARN intrnica, por lo que la regulacin de su
sntesis
est acoplado a la del gen de acogida. Muchos genes snoRNA se dispersan de
una sola copia

genes. Otros se producen en racimos. Por ejemplo, la gran estampar SNURFSNRPN


unidad de transcripcin en el 15q12 contiene seis tipos diferentes de casilla C / D
del gen snoRNA,
dos de los cuales estn presentes en grandes grupos de genes: uno contiene
aproximadamente 45 casi
idnticos genes HBII-52 snoRNA y los otros 29 genes HBII-85 snoRNA (vase
Figura 11.22).
La mayora de los snoRNAs se expresan de forma ubicua, pero algunos son de
tejidos especficos. por
ejemplo, los seis tipos de gen snoRNA dentro de la SNURF-SNRPN transcripcin
la unidad se expresa predominantemente en el cerebro de slo el cromosoma
paterno
(UN)
(SEGUNDO)
GRAMO
GRAMO
UN
UN
T
T
R
norte
un
un
gramo
gramo
gramo
u
u
u
u
do
GRAMO
UN
T
do
metro
metro
P
gorra

OH
P
gorra
la casilla D
la casilla D
5
5
5
3
3
3
casilla C
casilla C
Nueva York
Nueva York
Anann
H cuadro
ACANNN
OH
cuadro de ACA
Figura 9.15 Estructurayfuncinde
snoRNAs. (A) / D cuadro snoRNAs gua C
- 2 O modificaciones metilacin. La caja
C y D y motivos a 5 , 3 -terminal
STEM formada por el apareamiento de bases intrastrand
(Que se muestra como una serie de roja horizontal corta
lneas) constituyen un motivo estructural al retorcimiento su vez
que est especficamente reconocido por la
15,5 kD snoRNP. El C y D cajas
representar interna, con frecuencia imperfecta
copias de las cajas C y D. C / caja de D
snoRNAs y sus ARN de substrato forman una
10 a 21 pb de doble hlice en la que el objetivo
residuo a ser metilado (que se muestra aqu por
la letra m en un crculo) se coloca exactamente
cinco nucletidos aguas arriba de la D o D
caja. R representa la purina. (B) la casilla H / ACA
snoRNAs guiar la conversin de uridines
a Pseudouridine. Estos ARN se pliegan en una
horquilla-bisagra-horquilla-cola estructura. Uno
o ambas de las horquillas contiene una interna

lazo, llamado el bolsillo pseudouridylation,


que forma dos (3-10 pb) dplex cortos con
los nucletidos que flanquean el sustrato no apareado
uridina (y) situado a unos 15 nucletidos
Del cuadro de H o de la ACA snoRNA.
Aunque cada casilla C / D y H / ACA snoRNA
podra potencialmente dirigir dos modificacin
reacciones, salvo algunas excepciones, la mayora
snoRNAs poseen slo una funcional
2 - O metilacin o pseudouridylation
dominio.
pgina 29

283
15. algunas funciones no estndar se conocen ni esperan para algunos genes
snoRNA
que no tienen secuencias complementarias a las secuencias de rRNA. Por
ejemplo, el
HBII-52 snoRNA tiene una secuencia de 18 nucletidos que es perfectamente
complementaria
a una secuencia dentro de la HTR2C gen (serotonina 2c receptor) en XP24, y
regula splicing alternativo de este gen. Los vecinos HBII-85 snoRNAs
recientemente han sido implicados en la patognesis del sndrome de PraderWilli
(OMIM 176270).
genes de ARN pequeo cuerpo Cajal
Los scaRNAs asemejan snoRNAs y realizan una funcin similar en la
maduracin del ARN,
pero sus objetivos son snARNs spliceosomal y realizan modifica- especfica del
sitio
cationes de precursores snRNA spliceosomal en los rganos de Cajal del ncleo.
Hay por lo menos 25 genes humanos, cada especificacin de un tipo de
scaRNA. Me gusta
snoRNA genes, los genes scaRNA se encuentran normalmente dentro de los
intrones de los genes
transcrito por la ARN polimerasa II.
Cerca de 1000 microARN humanos diferentes regulan conjuntos complejos
de los genes diana por emparejamiento de bases a las transcripciones de
ARN
Adems de ARNt, hemos conocido desde hace algn tiempo acerca de una
variedad de otros mo-

damente pequeos (80-500 nucletidos) ARN citoplsmicos. Por ejemplo, la


enzima
telomerasa que sintetiza ADN en los telmeros (ver Figura 2.13) tiene tanto un
procomponente protena, de TERT (telomerasa transcriptasa inversa), y tambin un
com- RNA
componente, TERC, que se sintetiza por un gen de una sola copia en 3q26.2
(vase la Tabla 9.8
para otros ejemplos). En la dcada de 2000 se hizo evidente que una nueva
familia de pequea
ARN regulador conocido como microARN ( miARN ) tambin operaban en el
citoplasma.
Los microARN son slo alrededor de 21-22 nucletidos de largo en promedio, y
que eran
inicialmente perdido en los anlisis del genoma humano. Los primeros animales
miRNAs sean
informaron fueron identificados en organismos modelo como el nematodo ( C.
elegans )
y la mosca de la fruta ( Drosophila melanogaster ) por los investigadores que
estudian los fenmenos
relativa a la interferencia de ARN ( Recuadro9.6 ), una forma natural de la
regulacin de genes que
protege las clulas de propagacin perjudicial de los virus y transposones.
Debido a que muchos miRNAs estn fuertemente conservadas durante la
evolucin, vertebrado
miRNAs fueron identificados de forma rpida y se reportaron los primeros
miRNAs humanos en
la dcada de 2000. miRNAs regulan la expresin de conjuntos seleccionados de
genes objetivo de
apareamiento de bases con sus transcripciones. Por lo general, los sitios de unin
estn en el 3 untransRELAClONADAS regin de secuencias de ARNm diana, y el miARN obligado
inhibe la traslacin
cin con el fin de regular a la baja la expresin del gen diana.
Sntesis de miRNAs implica la escisin de precursores de ARN por ncleoespecficas y citoplasma especfica RNasa III ribonucleasas, nucleasas que
especficacamente y se unen a los ARN de doble cadena escinden. El transcrito primario, la
pri-miARN , se ha posicionado estrechamente repeticiones invertidas que pares
de bases para formar un cabello-

RNA pin que se escinde inicialmente a partir del transcrito primario por una
RNasa nuclear
III (conocido como Rnasen o Drosha) para hacer un corto de doble cadena premiARN
que es transportado fuera del ncleo ( Figura9.16 ). A citoplsmica RNasa III
llamado
Dicer corta el pre-miARN para generar un dplex miARN con voladizo
3 dinucletidos.
Un complejo de silenciamiento inducido por ARN especfico (RISC) que
contiene el endoriboArgonaute nucleasa se une el dplex miARN y acta con el fin de desenrollar el
double de cadena miARN. La protena Argonaute entonces degrada uno de los ARN
hebras (la hebra de pasajeros ) para dejar el miARN maduro de una sola cadena
(conocida
como la hebra gua ) unido a Argonaute. Los asociados miRNP maduros con
ARN
transcripciones que tienen secuencias complementarias a la hebra gua. La Unin
de miARN para orientar la transcripcin normalmente implica un nmero
significativo de errores de base
partidos. Como resultado, un miARN tpico puede silenciar la expresin de
cientos de
genes diana en la misma forma que una transcripcin de protena especfica de
tejido
factor puede afectar a la expresin de mltiples genes diana al mismo tiempo ver
la seccin de los objetivos de la base de datos miRBase aparece en la Tabla 9.9.
Para identificar ms genes miARN, nuevos programas de bioinformtica
computacionales
weredeveloped para detectar secuencias del genoma. Bymid-2009, ms de 700
humana
los genes miARN haban sido identificados y validados experimentalmente, pero
comparativa
genmica anlisis indican que el nmero de tales genes es probable que aumente.
Algunos de los genes miARN tienen sus propios promotores individuales; otros
son parte de
genes de ARN
pgina 30

Captulo 9: Organizacin del Genoma Humano


284
La interferencia de ARN ( ARNi ) es un mecanismo evolutivamente antigua que
es

usado en animales, plantas, hongos e incluso unicelulares para proteger a las


clulas
contra virus y elementos de transposicin. Ambos virus y activa
elementos de transposicin pueden producir a largo ARN de doble cadena, por lo
menos transitoriamente durante sus ciclos de vida. Largo ARN de doble cadena
es
normalmente no se encuentran en las clulas y, para muchos organismos, se
dispara un ARN
va de interferencia. Un endorribonucleasa citoplasmtica denominada dicer
corta el ARN de largo en una serie de piezas de doble cadena de ARN corto
conocido como ARN de interferencia corto ( ARNsi ). El siRNA producido es
en
promedio de 21 pb de longitud, pero de corte asimtrico produce de dos
nucletidos
voladizos en sus extremos 3 extremos ( Figura1 ).
Los dplex de siRNA estn obligados por diferentes complejos que
endorribonucleasa contener un tipo Argonaute (Hace) y alguna otra
protenas. A partir de entonces, las dos cadenas de ARN se desenrollan y uno de
las cadenas de ARN es degradado por Argonaute, dejando una sola hebra
ARN unido al complejo Argonaute. El complejo Argonaute es ahora
activado; el ARN de una sola hebra guiar el complejo Argonaute
a su objetivo por apareamiento de bases con secuencias de ARN
complementarias en
las celdas.
Un tipo de complejo Argonaute se conoce como el ARN inducida
silenciar complejo ( RISC ). En este caso, despus de la gua de cadena sencilla
ARN se une a una larga ARN de una sola hebra complementaria, la
enzima Argonaute se escindir el ARN, haciendo que se degrada. Viral
y ARN transposn puede ser inactivado de esta manera.
Otra clase de complejo de Argonaute es el ARN inducida
silenciamiento transcripcional ( RITS ) compleja. A continuacin, el ARN de una
sola hebra
gua se une a las transcripciones de ARN complementarias a medida que surgen
durante
la transcripcin por la ARN polimerasa II. Esto permite que el complejo RITS
posicionarse en una parte especfica del genoma y luego atraer
protenas como las histonas methyltransferases (HMTs) ya veces
metiltransferasas de ADN (DNMTs), que modifican covalentemente las histonas
en
la regin inmediata. Este proceso eventualmente causa la heterocromatina
formacin y propagacin; en algunos casos, el complejo RITS puede

inducir la metilacin del ADN. Como resultado, la expresin gnica puede ser
silenciado durante largos perodos para limitar, por ejemplo, las actividades
de transposones.
Aunque las clulas de mamferos tienen vas de interferencia de ARN,
la presencia de ARN de doble cadena activa una respuesta de interfern
que hace que no especfica de silenciamiento gnico y la muerte celular. Esto es
descrito en el captulo 12 cuando consideramos el uso de ARN de interferencia
como una herramienta experimental para producir el silenciamiento especfico de
preseleccionados genes diana. En tales casos, artificialmente sintetizado corto
ARN de doble cadena se utiliza para desencadenar gnica basada en RNAi
silenciamiento.
Figura 1 RNAdeinterferencia. Largasdedoblecadena(ds)ARNseescinde
porcitoplasmtica
dicer para dar siRNA. ARNsi dplex estn obligados por complejos Argonaute
que desenrollan la
dplex y degradar una hebra para dar un complejo activado con una sola hebra de
ARN. Por
apareamiento de bases con secuencias de ARN complementarias, el siRNA gua
complejos Argonaute
para reconocer secuencias diana. Activado RISC complejos escindir cualquier
cadena de ARN que es
complementaria a su lmite siRNA. El ARN escindido se degrada
rpidamente. Activado
RITS complejos utilizan su siRNA para unirse a cualquier ARN complementaria
recientemente sintetizada
y luego atraer protenas, tales como histonas methyltransferases (HMT) y algunas
veces DNA
metiltransferasas (Dnmt), que pueden modificar la cromatina para reprimir la
transcripcin.
CAJA 9.6 ARN de interferencia COMO MECANISMO DE DEFENSA
CELULAR
ARN largo ds
jugador
siRNA
gorra
poli (A)
gorra
poli (A)
gorra
poli (A)

ADN
ARN degradado
activada RISC
Hace + Otros
protenas RISC
RITS activados
Hace + Otros
protenas RITS
DNMT
HMT
metilacin de las histonas
la metilacin del ADN
la transcripcin reprimidos
pgina 31

285
ARN pol II
compleja RNASEN
complejo Dicer
compleja ARGONAUTE
gorra
poli (A)
pri-miARN
pre-miARN
pre-miARN
dplex miARN
miARN
ncleo
MIR
(UN)
citoplasma
un grupo miARN y se escinde de un multi-miARN transcripcin comn
unidad ( Figura9.17A ). Otra clase de genes miARN formar parte de un
compuesto
unidad de transcripcin que se dedica a hacer otros productos, adems de
miARN, o bien otro tipo de NcRNA (Figura 9.17B) o una protena (Figura
9.17C).
Muchos miles de diferentes piRNAs y siRNAs endgenos
suprimir la transposicin y regular la expresin gnica
El descubrimiento de miRNAs fue inesperado, pero ms tarde se hizo evidente
que los miRNAs

representan un pequeo componente de lo que son un gran nmero de diferentes


minscula regulacin
tory ARN producidas en clulas animales. En los mamferos, dos clases
adicionales de regulacin pequea
reglamen- ARN se inform por primera vez en 2006, y stas estn siendo
estudiados intensivamente.
Debido a que un gran nmero de diferentes variedades de estos ARN se generan
a partir
varias ubicaciones diferentes en el genoma, la secuenciacin a gran escala ha sido
requerido para diferenciarlos.
Po-protena que interacta con el ARN
ARNs Piwi-protena que interacciona (piRNAs) se han encontrado en una amplia
variedad de
eucariotas. Se expresan en las clulas de la lnea germinal en los mamferos y son
tpicamente
24-31 nucletidos de longitud; que se cree que tienen un papel importante en la
limitacin de transposicin
sicin por retrotransposones en las clulas de la lnea germinal de mamferos,
pero tambin pueden REGISTRATION
ular la expresin gnica en algunos organismos. Control de la actividad
transposn es
requerido debido al integrar a nuevos lugares en el genoma, transporte activo
posons pueden interferir con la funcin de genes, causando enfermedades
genticas y el cncer.
(SEGUNDO)
GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUG
GGCCUAUUCUUGGUUACUUGCACGGGGACGC
gorra
AAAAA
AAAAA
gorra
la formacin de horquilla
gug ccucg ucaaguaaccaggauaggcu gu
CGC GGG GCAguucauugguucuaucc ggua
gramo
California
gramo
gramo
u
do
do

do
un
gramo
un
u
do
u
pri-miARN
u caaguaa ccaggauaggcu gu
GCA guucauu gguucuaucc ggua
gramo
California
gramo
gramo
u
do
do
do
un
u
do
u
pre-miARN
u ccaggauaggcu caaguaa
uucaaguaauccaggauaggcu
5
3
3
5
GCA guucauu gguucuaucc
u
do
u
dplex miARN
miARN
compleja RNASEN
complejo Dicer
compleja ARGONAUTE

genes de ARN
Figura 9.16 miARNhumanosntesis. (A)Esquemageneral.Eltranscrito
primario,primiARN,tieneunatapa5
(metro
7
GpppG) y una cola 3 poli (A). precursores miARN tienen un prominente
estructura de doble cadena de ARN (ARN
horquilla), y el procesamiento se produce a travs de las acciones de una serie de
complejos de ribonucleasa. En el ncleo,
Rnasen, el homlogo humano de Drosha, escinde el pri-miARN para liberar el
ARN de horquilla (pre-miARN); esta
a continuacin, se exporta al citoplasma, donde se escinde por la enzima Dicer
para producir un dplex miARN.
El ARN dplex est unido por un complejo Argonaute y la hlice se desenrolla,
con lo cual una hebra (el
de pasajeros ) es degradada por la ribonucleasa Argonaute, dejando el miARN
maduro (la hebra gua ) unido
a Argonaute. MIR, genes miARN. (B) Un ejemplo concreto: la sntesis de miR26A1 humano. repeticiones invertidas
(Muestran como secuencias resaltados overlined por flechas largas) en el primiARN se someten emparejamiento de bases para formar
una horquilla, por lo general con unos pocos desajustes. Las secuencias que van a
formar la hebra gua madura se muestran en la
rojo; las de la hebra de pasajeros aparecen en azul. La escisin por tanto la
Drosha y Dicer humana (verde
flechas) es normalmente asimtrica, dejando un dplex de ARN con
sobresaliendo por 3 dinucletidos.
pgina 32

Captulo 9: Organizacin del Genoma Humano


286
Ms de 15.000 piRNAs humanos diferentes han sido identificados y por lo que la
piRNA familia es una de las ms diversa familia de ARN en las clulas humanas
(vase la tabla
9.8). Los piRNAs mapa Volver a intervalos de 89 genmica de aproximadamente
10-75 kb de longitud (por
ms informacin vase la base de datos piRNAbank; Tabla 9.9). Se cree que sea
troceados de grandes transcripciones multignicas. En los seres humanos, la
multi-piRNA tranguiones contienen secuencias de hasta varios cientos de diferentes piRNAs.

Se cree que piRNAs para reprimir transposicin por transposones a travs de un


RNA
va de interferencia, por asociacin con protenas Piwi, que son evolutivamente
relacionada con las protenas Argonaute ( Figura9.18 ).
siRNAs endgenos
Larga ARN de doble cadena en clulas de mamfero desencadena silenciamiento
de genes no especfica
ing travs de las vas de interfern, pero la transfeccin de ARNsi sinttico
exgeno
dplex o ARN de horquilla corta induce silenciamiento RNAi mediada por la
especfica
genes con elementos de secuencia en comn con el ARN exgeno. A medida que
se
ver en el Captulo 12, esta es una herramienta experimental extremadamente
importante que puede dar
valiosa informacin sobre las funciones celulares de un gen. Muy recientemente,
se ha
quedado claro que las clulas humanas tambin producen de forma
natural siRNAs endgenos ( endo
siRNAs ).
En los mamferos, el ms completo endo-siRNA anlisis han sido performado en ovocitos de ratn. Al igual que piRNAs, endo-siRNAs son de las ms
variadas
poblacin de ARN en la clula (muchas decenas de miles de diferentes endosiRNAs
han sido identificados en los ovocitos de ratn). Surgen como resultado de la
produccin
de cantidades limitadas de ARN de doble cadena natural en la clula. Una forma
en la
que esto sucede consiste en la transcripcin de vez en cuando de algunos
pseudogenes
( Figura9.19 ).
gorra
poli (A)
miR-21
(UN)
gorra
poli (A)
miR-155 en BIC NcRNA
(SEGUNDO)
gorra

poli (A)
miR-192-1-171819a2019b
gorra
poli (A)
miR-198 en FSTL1 ARNm 3 UTR
miR-106b9325 en MCM7 pre-ARNm intrn
(DO)
gorra
poli (A)
miR-15a16-1 en dLEU2 NcRNA intrn
gorra
poli (A)
horquilla de ARN
exonic
ARN codificante
exonic
ARN no codificante
ARN intrnica
Figura 9.17 Laestructuraprimariadelserhumano
miRNAs. (A) Ejemplos de transcripciones que se
utilizado exclusivamente para hacer miRNAs: miR-21
se produce a partir de una sola horquilla dentro de una
dedicado RNA transcrito primario;
una nica transcripcin multignica con seis
horquillas que finalmente se escinde para
dar seis miRNAs, a saber, el miR-17, miR-18,
miR-19a, y as sucesivamente. (B, C) Ejemplos de
miRNAs que son co-transcritos con un gen
codificacin o bien (B) un largo ARN no codificante
(NcRNA) o (C) un polipptido. En cada parte,
el ejemplo superior muestra miRNAs individuales
situado dentro de (B) un exn de un ncRNA
(MiR-155) y (C) en el 3 no traducida
regin (UTR) dentro de un exn terminal de una
ARNm (miR-198). Los ejemplos inferiores muestran
miRNAs mltiples ubicados dentro intrnica
secuencias de (B) un NcRNA (miR-15a y
miR-16-1) y (C) un pre-mRNA (miR-106b,
miR-93 y miR-25). Gorra, m
7
G (5 ) ppp (5 )

G. [Adaptado de Du T & Zamore PD


(2005) Desarrollo 132, 4645-4652. Con
el permiso de la Compaa de Bilogos.]
pgina 33

287
Ms de 3000 genes humanos sintetizan una amplia variedad de
medianas a grandes ARN regulador
Muchos miles de diferente largo ncRNAs, a menudo muchos kilobases de
longitud, son
Tambin cree que tienen un papel regulador en las clulas animales. Incluyen
antisentido transcripts que por lo general no se someten a corte y empalme y que pueden regular
la superposicin
transcripciones sentido, adems de una amplia variedad de largos ncRNAs
mRNA similar a que se someten
nivelacin, corte y empalme y poliadenilacin, pero no parecen codificar
cualquier considerable
polipptido, aunque algunos contienen ncRNAs internos tales como snoRNAs y
piRNAs. Las funciones de la gran mayora de la ARNm como ncRNAs son
desconocido. Algunos, sin embargo, son conocidos por ser especfica de tejido y
que participan en el gen
regulacin. Recientemente, en un esfuerzo sistemtico para identificar ncRNAs
largos, 3300 diferente
ncRNAs largos humanos fueron identificados como la asociacin con la
cromatina modificacin
complejos, lo que afecta la expresin gnica.
Algunos ncRNAs largo de ARNm-como que estn implicados en la regulacin
epigentica tienen
sido ampliamente estudiado. El XIST gen codifica una larga NcRNA que regula
inactivacin del cromosoma X, el proceso bywhich uno de los dos cromosomas
X
se selecciona al azar para ser condensado en mamferos hembras, con grandes
regiones
convertirse en transcripcionalmente inactiva. Muchos otros ncRNAs largos,
como el H19
ARN, estn implicados en la represin de la transcripcin de cualquiera de los
paterno o
alelo materno de muchas regiones autosmicos ( imprinting ). Estos ARNmcomo
ncRNAs son a menudo regulado por los genes que producen lo que puede ser
muy largo anti-

sensoriales ncRNA transcripciones que por lo general no se someten a corte y


empalme ( Tabla9.12 da
ejemplos).
sentido
transposn
antisentido
transposn
?
piRNAs primarias
clster piRNA
(A) Deteccin
(B) la amplificacin
(C) la represin
po cargado
protena
po
po
po
po
po
transposn
transcripcin
troceados
transposn
transcripcin
clster piRNA
transcripcin
DNMT
Yo
me me
po
Yo
HP1
HP1
Yo
HMT
ADN
metilacin
(En mamferos)
histona
modificaciones

Figura 9.18 transposnbasadoenpiRNA


silenciamiento en clulas animales. (A) primaria
piRNAs (po-protenas que interaccionan con los ARN) son
24-31 nucletidos de longitud y son procesados
a partir de precursores de ARN transcritos largos
de loci llamados cmulos Pirna definidos.
Cualquier transposn insertado en el reverso
la orientacin de la agrupacin piRNA puede dar lugar
a piRNAs antisentido (en rojo).
(B) piRNAs antisentido se incorporan en
una protena po y directa su actividad en la mquina de cortar
transcripciones sentido transposn. La escisin 3
el producto est obligado por otra protena po
y se recorta al tamao piRNA. Este sentido piRNA
est, a su vez, se utiliza para escindir clster piRNA
transcripciones y para generar ms antisentido
piRNAs. (C) antisentido piRNAs objetivo del po
complejos a cDNA para la metilacin del ADN
(Izquierda) y / o modificacin de las histonas (derecha).
DNMT, metiltransferasa de ADN; HMT, histona
metiltransferasa; HP1, heterocromatina
1. protena [De Girard A & Hannon GJ (2007)
Trends Cell Biol . 18, 136-148. Con permiso
de Elsevier.]
genes de ARN
pgina 34

Captulo 9: Organizacin del Genoma Humano


288
La participacin generalizada de larga ncRNAs en la regulacin del desarrollo
ceso
eses se ilustra mediante un anlisis exhaustivo (resolucin de 5 pb) de la
transcripcin
cional de salida a los cuatro humanos HOX grupos de genes. Aunque slo hay 39
HOX genes, la salida de la transcripcin de los HOX tambin se encontr racimos
de
incluir un total de 231 ncRNAs largos diferentes. Muchos de estos
son cis regulacin actuacin
res, pero uno de ellos, de aire caliente, se encontr que era un trans reguladoractuando (vase la tabla
9,12).

Algunos de los ARN funcionales, tales como XIST y aire, que no han sido tan
bien
conservado durante la evolucin. Las secuencias funcionales de mayor evolucin
en el
genoma humano incluye componentes de ncRNAs largos primates especficos
que son
fuertemente expresado en el cerebro. Consideramos las implicaciones evolutivas
de tales
genes en el captulo 10.
**
**
**
yA
yA
UN
yA
5
horquilla
UN
+
jugador
21-nucletido
siRNA
RISC
mRNA divisin
duplicacin
y
inversin
duplicacin
retrotransposicin
ARN
ARNm
transcrito antisentido
5
5
ncleo
citoplasma
Figura 9.19 Lospseudogenespuedenregular
la expresin de su gen de la matriz
por vas de siRNA endgenos.

surgen Pseudogenes a travs de la copia


de un gen padre. Algunos son pseudogenes
transcrito y, dependiendo de la genmica
contexto, puede producir un ARN que es la
antisentido equivalente del ARNm producido
por el gen padre. Una transcripcin de ARNm
del gen de la matriz (A) y un antisentido
transcripcin de un pseudogen correspondientes
(YA) se puede formar un doble hebra
RNA que se escinde por Dicer para dar siRNA.
siRNAs endgenos tambin pueden producirse
a partir de secuencias invertidas duplicados tales
como el ejemplo que se muestra aqu de un invertida
la duplicacin de la pseudogen (ya ya) a
el derecho. La transcripcin a travs de ambas copias
de los resultados pseudogene en un largo ARN con
repeticiones invertidas (azul, flechas overlined)
haciendo que el ARN se pliegue en una horquilla que
se escinde por Dicer para dar siRNA. En cualquiera
caso, los siRNAs endgenos son guiados
por RISC para interactuar con, y degradar, la
restantes de ARNm transcritos de genes de los padres.
Las flechas verdes indican reordenamientos de ADN.
[Adaptado de Sasidharan I + Gerstein M
(2008) Naturaleza 453, 729-731. Con permiso
de Macmillan Publishers Ltd.]
TABLA 9.12 EJEMPLOS DE LARGO DE REGULACIN ARN
HUMANOS
ARN
tamao
la localizacin de genes
Gene organizacin
Funcin
XIST
19.3 kb
Xq13
6 exones que abarcan 32 kb
regulador de la inactivacin del cromosoma X
TSIX
37.0 kb
Xq13

1 exn
regulador antisentido de XIST
H19
2.3 kb
11p15
5 exones que abarcan 2,67 kb
involucrado en la impronta en el 11p15 clster impresa
asociado con el sndrome de Beckwith-Wiedemann
KCNQTOT1 (= LIT1)
59.5 kb
11p15
1 exn
regulador de antisentido en el clster impreso en 11p15
PEG3
1,8 kb
un
19q13
nmero variable de exones, pero
hasta 9 exones que abarcan 25 kb
maternalmente impreso y se sabe que la funcin de tumor
supresin por p53 activacin
AIRE CALIENTE
2.2 kb
12q13
6 exones que abarca 6,3 kb
trans gen regulador-actuando; aunque parte de una
regin reguladora en el HOX-C clster en 12q13, HOTAIR
RNA reprime la transcripcin de una regin 40 kb en el
HOX-D grupo en el cromosoma 2q31
un
isoformas mayores.
pgina 35

289
9.4 de ADN altamente repetitivas: HETEROCROMATINA
Y repite transposn
Los genes contienen algunas secuencias repetitivas de ADN, incluyendo el ADN
de codificacin repetitiva.
Sin embargo, la mayora de las secuencias de ADN altamente repetitivas se
producen genes externos.
Algunas de las secuencias estn presentes en ciertas regiones subchromosomal
como gran

matrices de repeticiones en tndem. Este tipo de ADN, conocido como


heterocromatina, sigue siendo
muy condensada en todo el ciclo celular y no contiene generalmente
genes.
Otras secuencias de ADN altamente repetitivas se intercalan en todo el
genoma humano y se obtuvieron mediante la trasposicin replicativa (ver
seccin 9.1).
Las secuencias de este tipo se describen a veces como repeticiones tipo
transposn y que
representan ms del 40% de la secuencia de ADN total en el genoma humano. En
adems de residir en regiones extragenic, que se encuentra a menudo en los
intrones y
secuencias no traducidas y, a veces incluso en las secuencias de codificacin.
heterocromatina constitutiva se define en gran medida por las largas series
de
alto nmero de copias de ADN en tndem se repite
El ADN de la heterocromatina constitutiva da cuenta de 200 Mb o 6,5% de la
genoma humano (vase la Tabla 9.3). Abarca regiones megabase en el Centromeres y longitudes relativamente cortas de ADN en los telmeros de los
cromosomas todo
somes. La mayor parte del cromosoma Y, y la mayor parte de los brazos cortos de
la acrocntrico
cromosomas (13, 14, 15, 21 y 22) consisten en la heterocromatina. En adicin,
hay regiones heterocromatnicas muy sustanciales cerca de los centrmeros de
ciertos cromosomas, en particular chromomosomes 1, 9, 16, y 19.
El ADN de la heterocromatina constitutiva mayora se compone de largas series
de
-nmero de copias de alta tndem repite secuencias de ADN, conocido
como ADN satlite
( Tabla9.13 ). Arreglos ms cortos de repeticiones en tndem se conocen como
minisatlites y
TABLA 9.13 clases principales de HIGHCOPYNUMBER repetidos en
tndem de ADN HUMANO
Clase
un
Tamao total matriz
unidad
Tamao o secuencia de
unidad de repeticin
localizacin cromosmica Major (s)
ADN satlite

segundo
a menudo cientos de
kilobases
asociado con la heterocromatina
un (ADN alfoide)
171 pb
heterocromatina centromrica de todos los cromosomas
b ( Sau familia 3A)
68 pb
en particular, la heterocromatina centromrica de 1, 9, 13, 14, 15,
21, 22, e Y
satlite 1
25-48 pb (rica en AT)
heterocromatina centromrica de la mayora de los cromosomas y
otras regiones heterocromatnicas
satlite 2
formas divergentes de
ATTCC / GGAAT
la mayora de, posiblemente todos, cromosomas
satlite 3
ATTCC / GGAAT
13p, 14p, 15p, 21p, 22p, y heterocromatina en 1q, 9Q,
y Yq12
DYZ19
125 kb bp400 en Yq11
DYZ2
Rica en AT
Yq12; mayor periodicidad de 2470 pb
ADN minisatlite
0,1-20 kb
en o cerca de los telmeros de todos los cromosomas
minisatlite telomrica
TTAGGG
todos los telmeros
minisatlites hipervariables
9-64 pb
todos los cromosomas, asociados a la eucromatina, sobre todo en
regiones sub-telomricas
ADN microsatlite
<100 pb
menudo 1-4 pb

ampliamente dispersa a lo largo de todos los cromosomas


un
La distincin entre el satlite, minisatlite, y de microsatlites se hace sobre la
base de la longitud de la matriz total, no el tamao de la unidad de repeticin.
segundo
arrays de ADN satlite que consisten en unidades de repeticin simples a menudo
tienen composiciones de base que son radicalmente diferente de la media 41% G
+C
(y por lo tanto podran ser aislados por centrifugacin en gradiente de densidad
de flotacin, cuando se diferencian a partir del ADN principal y aparecen
como satlite
bandas -de ah el nombre).
ADN altamente repetitivo: la heterocromatina como transposn REPEATS
pgina 36

Captulo 9: Organizacin del Genoma Humano


290
microsatlites, respectivamente. Grandes extensiones de heterocromatina son
tpicamente complanteada por un mosaico de diferentes secuencias de ADN satlite que son
ocasionalmente internacional
rrumpido por repeticiones tipo transposn, pero estn desprovistos de
genes. repeticiones de transposones son
tambin ampliamente distribuido en eucromatina y se describir a continuacin.
La gran mayora de DNA heterochromatic humana no ha sido secuenciado,
debido a dificultades tcnicas en la obtencin de pedidos inequvoca de
sobreposicin
clones de ADN de ping. As, por ejemplo, componentes representativos
solamente cortos de
ADN centromrica se han secuenciado hasta el momento. Sin embargo, el
cromosoma Y-hetero
cromatina es una excepcin y ha sido bien caracterizado. Hay diferentes
satlite organizaciones de ADN, y la unidad repetida puede ser una secuencia
muy simple
(Menos de 10 nucletidos de largo) o un ser moderadamente complejo que puede
extenderse a
ms de 100 nucletidos de longitud; vase la Tabla 9.13.
En el plano secuencia, ADN satlite es a menudo muy mal conservado
entre las especies. Su funcin exacta an no est claro, aunque algunos humana
ADN satlite estn implicados en la funcin de centrmeros cuyo ADN consiste
gran parte de diversas familias de ADN satlite.

El centrmero es un dominio epigenetically definido. Su funcin es la


independencia
ent de la secuencia de ADN subyacente; en cambio, su funcin depende de su
particular
organizacin de la cromatina lar, que, una vez establecido, tiene que ser
mantenido de forma estable
a travs de mltiples divisiones celulares. De las diversas familias de ADN
satlite asociados
con centrmeros humanos, slo la de un satlite se sabe que est presente en
todos los seres humanos
centrmeros, y sus unidades de repeticin a menudo contienen un sitio de unin
para un cen- especfica
tromere protenas, CENPB. Clonado un satlite arrays se ha demostrado que las
semillas de
novo centrmeros en las clulas humanas, lo que indica que un satlite debe tener
una importancia
papel muy en funcin del centrmero.
El ADN telomrico especializada consiste en matrices de tamao medio slo
algunos
kilobases de longitud y constituye una forma de ADN minisatlite . A diferencia
del ADN satlite,
ADN minisatlite telomrica ha sido extraordinariamente conservado durante la
vertebrate evolucin y tiene un papel integral en funcin de los telmeros. Se
compone de arrays
de repeticiones en tndem de la TTAGGG hexanucleotide que son sintetizados
por el
ribonucleoprotena telomerasa (ver Figura 2.13).
repeticiones transposn derivados constituyen ms del 40% de la
genoma humano y surgi principalmente a travs de intermediarios de ARN
Casi todo el ADN no codificante repetitiva intercalada en el genoma humano es
derivados de transposones (tambin llamados elementos de transposicin ), el
ADN mvil
secuencias que pueden migrar a diferentes regiones del genoma. Cerca de 45%
de
el genoma puede ser reconocido como perteneciente a esta clase, pero gran parte
de los restantes
ing ADN nico, se debe derivar de copias de transposones antiguos que tienen
divergido ampliamente sobre evolutivos escalas de tiempo largos.
En los seres humanos y otros mamferos hay cuatro clases principales de
transposn

repetir, pero slo una pequea minora de repeticiones de transposones son una
transposicin de forma activa.
Segn el mtodo de la transposicin, las repeticiones pueden ser organizados en
dos
grupos:
Los retrotransposones (tambin abreviado como retroposones ). Aqu la copia
nismo
meca- se asemeja a la forma en que procesan pseudogenes y retrogenes son
generado (vase la figura 9.12): transcriptasa inversa convierte un transcrito de
ARN
del retrotransposn en un ADNc copia que luego se integra en el genoma
ADN en una ubicacin diferente. Tres clases principales de mamferos utilizan
transposn
este mecanismo de copiar y pegar: elementos nucleares largos perodos de
actividad (lneas),
elementos cortos intercalados nucleares (Sines), y elementos similares a
retrovirus
que contiene repeticiones terminales largas.
transposones de ADN . Los miembros de esta cuarta clase de transposn migran
directamente
sin ninguna copia de la secuencia; la secuencia se escinde y luego reinsertado en otro lugar en el genoma (un mecanismo de cortar y pegar).
Los elementos transponibles que se incorporen las independiente se describen
como
autnoma ; aquellos que no pueden se conocen como no autnoma ( Figura
9.20 ). De
las cuatro clases de elemento de transposicin, lneas y Sines
predominan; nosotros
describirlos con ms detalle a continuacin. Las otras dos clases se describen
brevemente
aqu.
pgina 37

291
transposones LTR humanos
transposones LTR incluyen elemento autnomo y no autnomo similar a
retrovirus
mentos que estn flanqueadas por repeticiones terminales largas (LTR) que
contienen necesario
elementos reguladores de la transcripcin. secuencias retrovirales
endgenas contienen gag

y pol genes, que codifican una proteasa, la transcriptasa inversa, ARNasa H


inversa, y
integrasa. Por tanto, son capaces de incorporar de forma independiente. Hay tres
principales
clases de secuencia retroviral endgena humana (HERV), con un acumulado
el nmero de copias de aproximadamente 240.000, lo que representa un total de
alrededor de 4,6% de la humana
genoma (ver Figura 9.20).
Muy muchos HERVs son defectuosos, y la transposicin es extremadamente raro
durante los ltimos millones de aos. Sin embargo, el grupo muy pequeo
HERV-K
muestra la conservacin de los genes retrovirales intactos, y algunos miembros
de la HERVK10 subfamilia han sido objeto de transposicin relativamente poco durante
lucin
lucin. Elementos no autnomos similares a retrovirus carecen de la pol gen y, a
menudo tambin
la mordaza del gen (la secuencia interna de haber sido perdido por recombinacin
homloga
cin entre las LTRs flanqueantes). La familia MaLR de tales elementos
representa
casi 4%, o del genoma.
fsiles de transposones de ADN humano
transposones de ADN tienen repeticiones terminales invertidas y codifican una
transposasa que
regula la transposicin. Ellos representan cerca del 3% del genoma humano y
pueden agruparse en diferentes clases que se pueden subdividir en muchas
familias
con orgenes independientes (vase la base de datos de secuencias repetidas
Repbase en
http://www.girinst.org/repbase/index.html). Existen dos grandes familias humana
mentiras, MER1 y MER2, adems de una variedad de familias menos frecuentes
(vase la Figura 9.20).
Prcticamente todas las secuencias de transposones de ADN humano residentes
ya no estn
activo; por lo tanto son los fsiles de transposones. transposones de ADN tienden
a tener corta
esperanzas de vida dentro de una especie, a diferencia de algunos de los otros
elementos de transposicin tales
como lneas. Sin embargo, un buen nmero de genes humanos funcionales
parecen haberse originado

de transposones de ADN, en particular los genes que codifican la RAG1 y RAG2


recombinacin
NASes y la principal protena de unin CENPB centrmeros.
Unos elementos LINE-1 humanos son los transposones activos y permiten
la transposicin de otros tipos de secuencia de ADN
Los LINEs (a largo intercalados elementos nucleares) han sido muy exitosa
transformacin
posons. Ellos tienen una historia evolutiva relativamente largo, que ocurre en otra
mamferos, incluyendo ratones. Como transposones autnomos, pueden hacer
toda la
productos necesarios para retrotransposition, incluyendo la transcriptasa inversa
esencial
criptasa. Humano lneas consisten en tres familias alejadas: LINE-1,
LINE-2, y LINE-3, que comprende colectivamente sobre 20% del genoma (vase
la figura
9,20). Se encuentran principalmente en las regiones euchromatic y se encuentran
preferible
entially en la oscuridad bandas ricas en AT G (Giemsa-positivo) de la metafase
cromosoma
somes.
Lneas
LINE-1 familia
LINE-2 familia
LINE-3 familia
600.000
370.000
44.000
Sines
la familia Alu
MIR
MIR3
1,200,000
450.000
85.000
fsiles de transposones de ADN
MER1 (Charlie)
MER2 (Tigger)
otros
(Incluyendo marina, etc.)
213.000
68.000

60.000
retrovirus (transposones LTR)
familias HERV
MaLR240,000
285.000
autnomo
no autnoma
ORF1 ORF2 ( pol )
(UN)
norte
(UN)
norte
P
P
6-8 kb
100-400 pb
6-11 kb
1,5-3 kb
80 bp-3 kb
2-3 kb
LTR
LTR
LTR
LTR
gag pol (env)
(mordaza)
transposasa
Figura 9.20 transposnmamferos
familias. Slo una pequea proporcin de
miembros de cualquiera de transposn se ilustra
familias pueden ser capaces de transposicin;
muchos han perdido esa capacidad despus de
la adquisicin de mutaciones que inactivan, y muchos
son copias truncadas cortos. Las subclases de
las cuatro familias principales se enumeran, junto con
los tamaos en pares de bases. ORF, el marco de lectura abierto.
[Adaptado de Genoma Humano Internacional
Consorcio de Secuenciacin (2001) Naturaleza 409,
860-921. Con el permiso de Macmillan
Publishers Ltd.]
ADN altamente repetitivo: la heterocromatina como transposn REPEATS

pgina 38

Captulo 9: Organizacin del Genoma Humano


292
De las tres familias lnea humana, LINE-1 (o L1) es la nica familia que concontina tengan miembros que incorporen activamente. LINE-1 es el ms
importante
elemento de transposicin humana y representa una mayor fraccin de ADN
genmico
(17%) que cualquier otra clase de secuencia en el genoma.
De larga duracin LINE-1 elementos son ms de 6 kb de longitud y codifican dos
proprotenas: una protena de unin al ARN y una protena con tanto endonucleasa y
reverso
actividades de la transcriptasa ( Figura9.21A ). Inusualmente, un promotor
interno se encuentra
dentro de la regin no traducida 5 . Por lo tanto, las copias de larga duracin
traen consigo
su propio promotor que se puede utilizar despus de la integracin en una regin
permisiva de
el genoma. Despus de la traduccin, el ARN LINE-1 se rene con su propio
codificada
protenas y mueve al ncleo.
Para integrarse en el ADN genmico, la endonucleasa LINE-1 corta un dplex de
ADN
en una cadena, dejando libre un grupo OH 3 que sirve como cebador para la
transcripcin inversa
cripcin del extremo 3 del ARN LINE. la escisin preferida de la endonucleasa
El sitio es TTTTA; de ah la preferencia por la integracin en las regiones ricas
en AT. Rica en AT
El ADN es comparativamente pobres en genes, y as ya que las lneas tienden a
integrarse en
Rica en AT de ADN que imponen una carga mutacional ms baja, lo que hace que
sea ms fcil para su
anfitrin para acomodarlos. Durante la integracin, la transcripcin inversa a
menudo
deja de proceder al extremo 5 , dando como resultado inserciones truncadas, no
funcionales.
En consecuencia, la mayora de las repeticiones derivado de la lnea son cortos,
con un tamao medio de 900 pb
para todas las copias LINE-1, y slo 1 de cada 100 copias son de larga duracin.

La maquinaria LINE-1 es responsable de la mayora de la transcripcin inversa


en
el genoma, lo que permite retrotransposition de la no autnoma senos y tambin
de copias de mRNA, dando lugar a pseudogenes y retrogenes procesados. Del
6000 o as de larga duracin secuencias LINE-1, aproximadamente 80-100 son
todava capaces de transposando, y ocasionalmente causar la enfermedad mediante la interrupcin de la
funcin de genes despus de
la insercin en un secuencia conservada importante.
repeticiones Alu son los ms numerosos elementos de ADN humano y
originado como copias de ARN 7SL
Sines (elementos nucleares cortos intercalados) son unos retrotransposones
100-400 pb de longitud. Ellos han tenido mucho xito en la colonizacin de los
mamferos
genomas, lo que resulta en diversas familias de ADN intercalados, algunas con
extremadamente
alto nmero de copias. A diferencia de las lneas, Sines no codifican ninguna
protena y
no se puede transponer de forma independiente. Sin embargo, senos y lneas
comparten secuencias en
su extremo 3 , y Sines se han demostrado para ser movilizados por las lneas
limtrofes.
Parasitando en la maquinaria de transposicin elemento de lnea, senos puede
alcanzar
muy alto nmero de copias.
La familia Alu humano es la familia SINE ms destacado en trminos de copia
nmero, y es la secuencia ms abundante en el genoma humano, que se producen
en
promedio ms de una vez cada 3 kb. La larga duracin de repeticin Alu es de
aproximadamente 280 pb
de largo y consiste en dos repeticiones en tndem, cada uno de aproximadamente
120 pb de longitud seguido de
A un corto
norte
/T
norte
secuencia. Las repeticiones en tndem son asimtricos: uno contiene una
interna secuencia de 32 pb que falta en el otro (Figura 9.21B). monmeros,
AAAAAA
TTTTTT
AAAAAA

TTTTTT
UN
segundo
monmero izquierda
elemento de repeticin (B) Alu
5 UTR
3 UTR
ORF1
ORF2
(A) elemento LINE-1 repeticin
monmero derecha
32 pb
p40
endonucleasa
marcha atrs
transcriptasa
Pensilvania
Figura 9.21 ElLINE1humanayAlu
repetir elementos. (A) El 6,1 kb LINE-1
elemento tiene dos marcos de lectura abiertos: ORF1,
un marco de lectura abierto de 1 kb, codifica p40,
una protena de unin al ARN que tiene una nucleico
actividad chaperona de cidos; el 4 kb ORF2
especifica una protena con tanto endonucleasa
y revertir las actividades de la transcriptasa. UN
promotor interno bidireccional se encuentra dentro de
la regin no traducida 5 (UTR). En el
otro extremo, hay una A
norte
/T
norte
secuencia, a menudo
descrito como el 3 poli (A) de la cola (pA). los
LINE-1 endonucleasa corta una hebra de un
Dplex de ADN, preferiblemente dentro de la secuencia
TTTTA, y los usos de la transcriptasa inversa
la largada 3 finales -OH en ADNc de primera
sntesis. Nuevos sitios de insercin estn flanqueadas
por una duplicacin pequeo sitio de destino de
2-20 pb (que flanquean puntas de flecha negras).
(B) Un dmero Alu. Los dos monmeros tienen

secuencias similares que terminan en una


UN
norte
/T
norte
secuencia pero difieren en tamao debido
la insercin de un elemento de 32 pb dentro de la
repita ms grande. monmeros Alu tambin existen en
el genoma humano, adems de diversas truncada
copias de ambos monmeros y dmeros.
pgina 39

293
que contiene slo una de las dos repeticiones en tndem, y varias versiones
truncadas
de dmeros y monmeros tambin son comunes, dando un promedio de todo el
genoma
230 pb.
Mientras que SINE como el MIR (mamferos de toda la repeticin intercalados)
familias
mentiras se encuentran en una amplia gama de mamferos, la familia Alu es de
comparativamente
origen evolutivo reciente y se encuentra solamente en primates. Sin embargo,
sub-Alu
familias de diferentes edades evolutivas pueden ser identificados. En el pasado 5
millones o
por lo aos desde la divergencia de los seres humanos y los simios africanos, slo
alrededor de 5000 cobre
IES de la repeticin Alu han sido objeto de transposicin; la mayora de las
secuencias Alu mviles
son miembros de las subfamilias Y y S.
Al igual que otros mamferos Sines, repeticiones Alu se origin a partir de copias
de ADNc
pequeos ARN transcritos por la ARN polimerasa III. Genes transcritos por la
ARN
polimerasa III tienen a menudo promotores internos, y as copias de ADNc de
transcripciones
llevar con ellos sus propias secuencias promotoras. Tanto la repeticin Alu y,
indetemente, la repeticin del ratn B1 se origin a partir de copias de ADNc de ARN
7SL, la

corta de ARN que es un componente de la partcula de reconocimiento de seal,


utilizando un retromecanismo de transposicin como la mostrada en la Figura 9.12. Otros senos,
tales como la
ratn B2 de repeticin, se retrotransposed copias de secuencias de ARNt.
repeticiones Alu tienen un contenido relativamente alto de GC y, aunque dispersa
principalmente
en todas las regiones del genoma euchromatic, estn preferentemente situado en
las bandas R cromosmicas ricas en GC y rica en genes, en fuerte contraste con
la prelocalizacin diferencial de las lneas en el ADN ricas en AT. Sin embargo, si se
encuentran dentro de los genes
que son, al igual que la lnea 1-elementos, confinados a intrones y las regiones no
traducidas.
A pesar de la tendencia a estar situado en el ADN rico en GC, de nueva
transposicin de Alu
repeticiones muestran una preferencia por ADN rica en AT, pero progresivamente
mayores repeticiones Alu
mostrar un sesgo fuerte hacia progresivamente ADN rico en GC.
El sesgo en la distribucin global de Alu repite hacia rica en GC y, de acuerdo
con ello, las regiones ricas en genes deben ser el resultado de una fuerte presin
de seleccin. Sugiere
Alu repite que no slo son parsitos genoma, pero estn haciendo una
contribucin til
cin a las clulas que los contienen. Algunas secuencias Alu son conocidos por
ser activamente trandescribe y puedan haber sido reclutados a una funcin til. El BCYRN1 gen,
que codifica el ARN citoplsmico FC200 neuronal, surgi a partir de un
monmero Alu
y es una de las pocas secuencias Alu que son transcripcionalmente activo bajo
norcircunstancias mal. Adems, la repeticin Alu se ha demostrado recientemente
para actuar como
una transmisin que acta represor transcripcional durante la respuesta al estrs
celular.
CONCLUSIN
En este captulo, hemos examinado la arquitectura del genoma humano. Cada
clula humana contiene muchas copias de un genoma mitocondrial pequea,
circular y
slo una copia del genoma nuclear mucho ms grande. Considerando que el
mitocondrial

genoma tiene algunas similitudes con los genomas de procariotas compactas, las
genoma nuclear humano es mucho ms complejo en su organizacin, con
solamente
1,1% de las protenas del genoma de codificacin y 95% que comprende
nonconserved, y
a menudo altamente repetitivo, secuencias de ADN.
La secuenciacin del genoma humano ha revelado que, contrariamente a lo
esperado,
hay relativamente pocos genes codificadores de protenas, aproximadamente
20,000-21,000 de acuerdo
ing con las estimaciones ms recientes. Estos genes varan ampliamente en
tamao e interna
organizacin, con los exones de codificacin a menudo separadas por grandes
intrones, que a menudo
contener secuencias de DNA altamente repetitivas. La distribucin de genes a
travs de la
genoma es desigual, con algunos genes relacionados funcionalmente y
estructuralmente encontrados
en grupos, lo que sugiere que surgieron por la duplicacin de genes individuales
o mayor
segmentos de ADN. Los pseudogenes se pueden formar cuando se duplica un gen
y
a continuacin, una del par acumula mutaciones deletreas, impidiendo su
expresin
sin. Surgen otras pseudogenes cuando un transcrito de ARN se transcribi de
forma inversa y
el ADNc se vuelve a insertar en el genoma.
La mayor sorpresa de la era post-genoma es el nmero y la variedad de la no
ARN codificantes de protenas transcritas del genoma humano. Al menos 85% de
la
genoma euchromatic ahora se sabe que se transcribe. El ncRNAs familiarizado
sabe que tienen un papel en la sntesis de protenas se han sumado otros que
tienen
funciones en la regulacin de genes, incluyendo varias clases prolficos de ARN
regulador diminutos
y miles de diferentes ncRNAs largos. Nuestra visin tradicional del genoma es
siendo revisada radicalmente.