Está en la página 1de 8

05/04/2016

Nucletidos
OLIGONUCLETIDOS
Bases
pricas

Bases
pirimidnicas

desoxiribonucletidos
Gentica Molecular - 2016

Universidad de Morn

Diferencias entre azcares y


bases de desoxiribonucleotidos
y ribonucleotidos

Oligonucletidos

Secuencia corta de 2 a 50
desoxiribonucletidos o ribonucletidos
unidos covalentemente

UMP

05/04/2016

Unin covalente entre dos nucletidos

Complementaridad de bases

5: fosfato libre
Puente fosfodiester
entre el carbono en
posicin 3 ro arriba
y el carbono en
posicin 5 ro abajo

A - T
C - G

A - U
C - G
OH

5
3

3
5

3: oxhidrilo libre

Diseo de oligonucletidos
Se disean de tal manera que puedan
hibridizar con una determinada regin del
ADN o ARN

Para qu se utilizan?
Como cebadores en la PCR y nested PCR

Como sondas marcadas para la deteccin de fragmentos de


ADN o ARN especficos (Southern blot, Northern blot, Real Time
PCR, microarreglos, etc.)

5 A T G C C A G G T A C C G G G A A C

Pueden ser de ADN o ARN pero los de ADN son ms


convenientes para usos de laboratorio porque tienen mayor
estabilidad (ARN es lbil)
En la naturaleza: primers de ARN participan de la replicacin;

C C A T G G C
3

microARNs: regulacin de la expresin gnica.

05/04/2016

Diseo de primers (cebadores) para PCR


OBJETIVO: Amplificar diferentes regiones de inters. Son el
punto de partida para la replicacin del ADN.

Requisitos de los primers


- Especficos
- 18-24 bases de longitud
- 40-60% de GC
- En lo posible ambos primers deben tener
temperaturas de hibridizacin semejantes
(54 C o ms)
- Conviene que terminen con C o G

Sonda con
temperatura de
hibridizacin de
42 oC

Temperatura de hibridizacin
Es la mxima temperatura a la cual puede ocurrir el
acoplamiento de dos cadenas de nucletidos con
formacin de puentes de hidrgeno.
Hibridizacin a 42oC

4 x (#C + #G) + 2 x (#A + #T) C


A mayor contenido de GC: mayor temperatura de
hibridizacin (ms sensible)
Alto contenido de A-T: la temperatura debe ser muy baja
para que haya hibridizacin: menor especificidad

Hibridizacin a 35oC

Si se usa una
temperatura de
hibridizacin
menor, baja la
especificidad

05/04/2016

Hibridizacin de primers durante la PCR

A T G C C A G G T A C C G GG A A C

T A C

G G T C C A T G G C C C T T G

A T G C C A G G T A C C G GG A A C
3 C C C T T G
F

5
3

3
5

En conclusin:
Primer F: hibridiza con la cadena antisentido; su
secuencia es igual al extremo 5 del segmento
que se va a amplificar
Primer R: hibridiza con la cadena sentido; su
secuencia es el complemento-reverso del
extremo 3 del segmento que se va a amplificar

3
AT G C C A G
T A C G G T C C A T G G C C C T T G

Diseo manual de primers


> MSA-2c, cepa Pullman
ATGGTGTCTTTTAACATAATAACCGTTGCATTCTGCTCCATCCTTTTCAATT
ATGCAGTGGCATCTCCACAAGAGGAGGCTGTACCAACTAAGCAGGTGAA
TGGGAGTCATTTACTGTTTGATGATATGAAAATGTTGTATGATGTAATGCG
CAGCATTGATGAAAGCATGTTGAAAAGCATTCTTGAGAAGAATTTTGAGG
CTGTTGGCATGGAAGCTACATCGGCTACTAAAACACATGACGCTCTGAAG
GCTGTAAAACAATTAATCAAAACCGATGCACCTTTCAACACATCGGACTTT
GACACACTCGATTTGGAATATCTCTCAGGGCAATCTAATGAAGAGCTGTT
GGAGCTTCTGATTGAGGCAATATATGGTATGGAAATCATAATTGAAAAAAC
TAACTCTTTTGTGGGAGGGAGTGCAAAACATTCCGATAAATTGGACACCG
ACTTGAGACAGTACTACTGGGATAATATTTACGATGACCAGAGTGAATATA
ATAAGGACAAATTAAGCAACCTATACAAAGCATTCATCACTGATTCTGGCG
CTTTGAGAATCGCATCGGAGGAACTTATAAAATTCGAAACAAGGAAAGCT
CAAAAGGATGACTACAGATTTATCAATCCTTCTTCAACTTCGGAAGCCGAA
ACACCCTCTCCATCGTCTGGAGAAAATACTGCAGCACAACCTCCCAAAC
CTGCCGAGACCCCTAAGCCTACTGGATCTTCTTTCACCTATGGCGGATTG
ACTGTGGCCACTCTCTGCTACTTCGTTCTCTCTGCATTC

Primer F: como no puedo cambiar el lugar de los primers, debo encontrar


el largo que da una temperatura de hibridizacin adecuada.
5- ATGGTGTCATGGTGTCTTTTAACATAATAACCGTTGCATTCTGCTCCATCCT

Primer R: idem
Pasos para disear el primer R: reverso-complementario
3- CTCTGCTACTTCGTTCTCTCTGCATTC
cadena complementaria
3- GAGACGATGAAGCAAGAGAGACGTAAG
revertir la cadena
5- GAATGCAGAGAGAACGAAGTAGCAGAG

05/04/2016

Diseo de primers degenerados

Ejemplo. Diseo de primers degenerados para los genes SAG


de T. gondii y N. caninum

En lugar de utilizar cebadores especficos de PCR con una


secuencia determinada, se utiliza Mezcla de cebadores de
PCR.

No existen programas ideales. El trabajo debe ser manual

Toxoplasma BSR4, Toxoplasma SAG5 Y Neospora caninum BSR4

CDIGO IUPAC/IUB

NOMENCLATURA

BASES

A, C, G o T

AoC

A, C o G

AoG

AoT

CoG

CoT

GoT

A, C o T

C, G o T

A, G o T

Ejemplo de primer degenerado:

05/04/2016

Nested PCR
Qu es?
Variante de la PCR convencional que comprende dos rondas
de amplificacin con distintos pares de iniciadores o primers
en cada una.
Para que se utiliza?
Para cuando se tienen pequeas cantidades de ADN de
inters.

Cmo se realiza?
Se hace una reaccin con los cebadores
externos para amplificar la regin de ADN mas
extensa y luego, con este producto se ejecuta
una segunda reaccin con los cebadores
internos, para amplificar la regin especifica.

Incrementar la sensibilidad de deteccin. Evitando


amplificaciones inespecficas que a veces se producen en la
PCR convencional.

Ejemplo de primers usados en una NESTED PCR

Oligonucletidos marcados y sus aplicaciones


- Marcacin para deteccin directa: radioistopos,
fluorforos
- Marcacin para deteccin indirecta: digoxigenina,
biotina. Se necesita una molcula que se una al
marcador y que a su vez est conjugada a una enzima.
La deteccin es por la actividad de esta enzima sobre
un sustrato que da un producto coloreado o
quimioluminiscente.

05/04/2016

Southern blot

Southern blot
Tcnica inventada por Sir Edwin Mellor Southern

Se usa un oligonucletido como sonda especfica para el segmento


que se quiere localizar
Si la sonda es radiactiva, por ej. contiene 32P, la deteccin se hace por
exposicin de una placa de rayos X o fotogrfica: autoradiograma

Autoradiograma
del S. blot luego
de transferencia
a membrana y
exposicion a
sonda
radiactiva

Gel de agarosa
teido con
bromuro de
etidio

Reverse Line Blot Hybridization


- Tcnica de diagnostico simultneo, por ej. de distintos microorganismos
- Utiliza dos tipos de oligonucletidos: (i) oligonucletidos especificos de cada
especie a detectar, los cuales se unen a una membrana de nitrocelulosa y
(ii) oligonucletidos conjugados a biotina que se utilizan como primers para
una reaccin de PCR.

Reverse Line Blot Hybridization


Ej. RLBH para piroplasmidos (protozoos parsitos transmitidos por garrapatas)
Sirve para la deteccion simultanea de ADN de distintas especies de Babesia
o Theileria en la sangre de un animal
Regin blanco del ADN: gen codificante de la subunidad 18S de ARNr

Regin hipervariable:
ideal para disear sondas
especificas de especie

18S ARNr

UTP marcado con biotina

Regiones conservadas entre especies:


ideal para el diseo de primers para la PCR: se
amplifican los ADN de todas las especies presentes.
Uno de los primers est biotinilado

05/04/2016

Reverse Line Blot Hybridization

- Se realiza la PCR, uno de


los primers esta marcado con
biotina.
- Se separan las cadenas de
los productos de PCR
- Los productos de PCR
biotinilados hibridizan con los
oligonucleotidos unidos a la
membrana
- Solo hay hibridizacin
cuando hay
complementariedad de bases

Organizacin de una membrana de RLBH

Reverse Line Blot Hybridization

- Se incuba con estreptavidina


(que se une a la biotina)
conjugada a la enzima
peroxidasa
- Al incubar con un sustrato
especial: se produce una
reaccin de luz
(quimioluminiscencia)
- Deteccin en una placa
fotogrfica

Resultados de RLBH

Los distintos
oligonucleotidos (probes =
sondas) se siembran en
calles, todo a lo largo de la
membrana

Los productos de PCR


biotinilados se siembran de
manera perpendicular
-> se incuba a temperatura
adecuada para la
hibridizacin

Luego de la incubacin con estreptavidina conjugada peroxidasa y sustrato


quimioluminiscente, se detectan las reacciones positivas en una placa fotografica
La calle B&T tiene una sonda que hibridiza con una region conservada en
todas las muestras

También podría gustarte