Está en la página 1de 16

MARCADORES GENTICOS Y MEJORAMIENTO DE PLANTAS

Los daos causados por micro-organismos e insectos son extremadamente costosos para
la
humanidad. En Estados Unidos se ha estimado prdidas causadas por enfermedades
microbiales por un valor de US$ 9.1 billones por cada ao, mientras que US$ 7.7
billones
de prdida es causada por insectos. Por otro lado en muchos cultivos de pases
desarrollados, las prdidas por enfermedades y plagas representan aproximadamente el
20% en pre-cosecha. Estas prdidas en pases en desarrollo son frecuentemente cercanas
a
30-45 %. Las prdidas por sanidad pueden ser ms que la capacidad financiera; en
ciertas
ocasiones y lugares, ellas llevan la amenaza de hambre crnico y hambruna. Frente a
estos
desafios, la gente por muchos siglos practic mejoramiento gentico de plantas y
mejoramiento agronmico con la finalidad de reducir prdidas por enfermedades y
plagas.
La biologia molecular es una herramienta poderosa, que puede acelerar la obtencin de
nuevos genotipos ms resistentes, con mayor calidad alimenticia y con altos
rendimientos.
Consecuentemente, ayudar en la reduccin de plagas y enfermedades de cultivos,
convirtiendo a la agricultura ms productiva y eficiente.
4.1. Fitomejoramiento y marcadores
El fitomejoramiento tradicional involucra el cruzamiento repetido de grandes nmeros
de plantas con caractersticas deseables (rendimiento, resistencia a enfermedades y
plagas, tolerancia a sequa, etc.), confiando que tales caractersticas puedan ser
combinadas de manera estable en un solo germoplasma. Emplea rasgos o marcadores
fenotpicos, morfolgicos o fenolgicos para efectuar la seleccin de individuos, lneas
o cultivares. Sin embargo, no existe con frecuencia una relacin clara entre el genotipo
y el fenotipo. Tal desventaja puede eludirse mediante el uso de marcadores bioqumicos
y moleculares; puesto que poseen un control gentico mendeliano, permiten evaluar la
variacin gentica (en funcin de la mutacin, la seleccin o la deriva gentica), y
representan una muestra de la variacin a nivel del DNA, con lo que se obvia el efecto
ambiental.
4.2. Clases de marcadores existentes
Un marcador es considerado como un carcter cuyo patrn de herencia puede definirse
en un nivel morfolgico o fenotpico, bioqumico o molecular. Se le utiliza para
obtener, aunque de manera indirecta, informacin con respecto de las bases genticas
de los caracteres o rasgos de inters en el organismo sujeto a estudio. Strictu sensu, se
asocian marcadores con caracteres.
Las investigaciones iniciales de la herencia de caracteres se condujeron en funcin de
caracteres morfolgicos, los cuales son profundamente afectados por fluctuaciones
ambientales y por las etapas de desarrollo de la planta. En general existe variacin en
los caracteres morfolgicos lo que obliga a analizar un vasto nmero de individuos.
As, surgi la idea de utilizar marcadores genticos para esclarecer la relacin entre un
locus gentico y un carcter determinado.
Los primeros sistemas de marcadores (no fenotpicos) disponibles en plantas fueron
aquellos desarrollados a partir de la electroforesis de polipptidos: isoenzimas o
aloenzimas, y protenas de reserva de semilla.
Marcadores morfolgicos y cariolgicos

Las fluctuaciones ambientales y las etapas de desarrollo de la planta afectan el fenotipo,


debido a que los marcadores morfolgicos son efecto combinado de muchos genes y el
ambiente. Sin embargo, caracteres morfolgicos son los ms antiguos y ampliamente
usados en la gestin de germoplasma y mejoramiento gentico de plantas.
Por otro lado, tambin se utiliza ampliamente caracteres citomorfolgicos,
particularmente
el nmero cromosmico. Este carcter se utiliza en cultivos poliploides, donde ha sido
un
importante herramienta para la elucidacin de la sistemtica y evolucin. Por ejemplo
cambios en el cariotipo como translocaciones no es posible describir por modelos
alelo/locus. Estos son altamente heredable y polimrficos.
Marcadores bioqumicos
Los primeros sistemas de marcadores (no fenotpicos) disponibles en plantas fueron
aquellos
desarrollados a partir de la electroforesis de polipptidos: isoenzimas o aloenzimas, y
protenas
de reserva de semilla. Se define como isoenzima a las multiples formas moleculares de una
enzima que comparten un sustrato y actividad idntica o muy similar, las cuales presentan
un
comportamiento electrofortico distinto (diferentes formas moleculares). Este tipo de
enzimas
difieren en su estructura qumica y, en consecuencia, en algunas de sus propiedades, pues se
encuentran codificadas por distintos genes que pueden ubicarse en diferentes loci o por
diferentes alelos en un mismo locus; aquellas isoenzimas que se originan a partir de las
mutaciones en el mismo locus se denominan aleloenzimas o aloenzimas. Se identifican a las
isoezimas como marcadores bioqumicos por su naturaleza protenica, pero pueden
considerarse como marcadores genotpicos si se trabaja bajo condiciones estandarizadas;
estos
permiten comprender ciertos procesos genticos (e.g. la transformacin de un gen en otro);
la
regulacin de la expresin de genes, el impacto bioqumico de las modificaciones sobre las
rutas metablicas en diferentes tejidos, y la asociacin de la codificacin de un determinado
polipptido con ciertos caracteres fenotpicos. Han sido ampliamente usadas en la
caracterizacin de germoplasma, en el estudio de la variacin protenica e isoenzimtica, en
la
evalucin de la variacin gentica en poblaciones; y en la filogenia entre las especies.
Si bien los estudios isoenzimticos han sido tiles en el anlisis molecular vegetal, existen
varias restricciones con respecto de su uso: el escrutinio de un nmero limitado de loci;
imposibilidad de establecer con acuciosidad la variacin cuantitativa de un locus
determinado;
y la existencia de una alta especificidad de los datos obtenidos en cuanto a tejido y etapa de
desarrollo de la planta.
Marcadores moleculares
Las tecnologas de anlisis molecular de la variabilidad a nivel de DNA permiten
determinar puntos de referencia en los cromosomas, tcnicamente denominados
marcadores moleculares (MM). Los marcadores moleculares o marcadores del DNA se
entienden como regiones o segmentos del DNA cuya funcin codificadora
generalmente se desconoce, pudindose ubicar en las inmediaciones de un gen y
determinar un carcter de inters agronmico que pueda evaluarse en cruzas genticas.
Al asociar un marcador con un determinado locus es posible verificar con gran precisin
la segregacin de los alelos que se ubican en tal locus.

La distribucin uniforme de estos marcadores a todo lo largo del genoma ha permitido


su uso en estimaciones de la contribucin gentica de cada progenitor a cada miembro
de una poblacin segregante. De tal manera, ha sido posible emplear los polimorfismos
de secuencia entre individuos para el mapa gentico. Consecuentemente, se han
transformado de manera radical el estudio y la prctica de la gentica.
En general, las ventajas relativas de los marcadores moleculares sobre los marcadores
morfolgicos para la mayora de las aplicaciones genticas y de mejoramiento son:
1. La mayora de los marcadores morfolgicos slo pueden evaluarse en el nivel
del conjunto de la planta (frecuentemente, en fase de maduracin). En cambio,
con los marcadores moleculares slo se necesitan muestras celulares o tisulares
para el anlisis de los genotipos.
Con marcadores morfolgicos es posible verificar alelos mediante la induccin o
aplicacin de mutgenos exgenos. Para la mayora de las especies vegetales,
diversos alelos que aparecen de manera natural pueden identificarse en la
mayora de los loci marcados molecularmente.
3. Usualmente no existe asociacin alguna de efectos dainos con alelos de
marcadores moleculares. Tal no acontece con los marcadores morfolgicos, los
cuales estn acompaados de efectos fenotpicos indeseados.
4. Las interacciones de dominancia-recesividad entre alelos, impiden con
regularidad discernir todos los genotipos asociados con los caracteres
morfolgicos. Los alelos en la casi totalidad de los loci marcados
molecularmente se comportan de una manera codominante, lo que permite
identificar todos los posibles genotipos en cualquier generacin en segregacin.
5. En cuanto a los marcadores morfolgicos, las interacciones epistticas
desfavorables a menudo aparecen entre los alelos que codifican para los
caracteres marcados morfolgicamente y limitan en gran medida el nmero de
marcadores en segregacin que pueden monitorearse en una sola poblacin. La
amplia mayora de los marcadores moleculares parecen estar libres de efectos
epistticos; por lo tanto, el nmero de loci a evaluar en una sola poblacin es
tericamente ilimitado.
Requerimientos de los marcadores para las aplicaciones en fitomejoramiento. Los
parmetros a considerar para la evaluacin y eleccin del marcador molecular ms
apropiado para la investigacin y manipulacin de caracteres cuantitativos, son:
Base molecular. Los eventos moleculares responsables de los polimorfismos
observados son considerados como la base molecular. La simplicidad o
complejidad de la modificacin de sta se encuentra en funcin de los cambios
en el nivel de la secuencia de nucletidos y del nmero de eventos moleculares.
Polimorfismo. Los marcadores tiles e informativos son aquellos marcadores
que registran el mayor nmero de alelos por locus.
Distribucin genmica. El sistema de marcadores deber detectar el mayor
nmero de loci o de grupos de ligamiento a todo lo largo del genoma.
Mapa. La asociacin y segregacin de dos (o ms) marcadores permite la
construccin de un mapa de ligamiento.
Estabilidad ambiental y experimental. Las fluctuaciones ambientales no
afectan tericamente el anlisis de marcadores moleculares de manera
significativa. La estabilidad experimental y reproducibilidad son
fundamentales para contar con la plena certeza de que las diferencias
observadas son en realidad genticas.
Factibilidad. El anlisis sobre un gran nmero de individuos o lneas requiere

que los mtodos de marcadores moleculares sean rpidos, eficaces y lo menos


costoso posible.
La utilidad relativa y las limitaciones de las diferentes tcnicas de marcadores
moleculares en el fitomejoramiento, mapeo gentico, mapeo comparativa, anlisis de
la diversidad vegetal, estudios de evolucin vegetal, caracterizacin de genealoga o
clonacin de genes, depender del nmero de marcadores disponibles, la
disponibilidad de equipo e instalaciones, las restricciones de los recursos econmicos; y
del sistema biolgico a estudiar, la naturaleza del (los) carcter(es), el tipo de poblacin
a generar, el nmero de individuos a examinar, el tipo de segregacin a analizar, etc.
La metodologa de una gran cantidad de marcadores moleculares, utiliza la reaccin
en cadena de la polimerasa (Polymerase Chain Reaction-PCR, en ingls). Para
comprender la naturaleza de los anlisis actuales con tales marcadores, es de
importancia revisar el concepto terico y ciertas consideraciones tcnicas de la PCR,
herramienta que ha significado una revolucin en la manera de concebir a la biologa y
la gentica molecular.
El desarrollo tecnolgico en el rea de MM ha sido extremadamente rpido. La
tecnologa
de DNA recombinante y la amplificacin de segmentos de DNA via PCR, abrieron el
camino del cambio en el paradigma gentico bsico: de la inferencia del genotipo a
partir
del fenotipo, donde Mendel fue el pionero, para el anlisis gentico directo de la
variacin
en la secuencia de DNA. Este cambio de enfoque de la gentica directa1 a la gentica
inversa2 es la transicin de la gentica mendeliana para la gentica genmica. Las
tecnologas de anlisis molecular ms eficientes y accesibles son constantemente
puestas
en marcha. Tambien se desarrollan mtodos de anlisis estadstico que permiten
manipular
enormes cantidades de datos. La mejora aportada por los marcadores de DNA ha sido
crucial para que se conviertan en una herramienta muy potente para el anlisis gentico
y
sus aplicaciones.
Marcadores genticos
Los caracteres que se han utilizado para observar y detectar la variabilidad presente en
los
seres vivos son numerosos. Los marcadores genticos son una clase de estos; y con ellos
se
espera que reflejen la variabilidad debida principalmente a los genes.
Nosotros tomaremos el trmino marcador en el sentido gentico, es decir un marcador
ser
siempre sinnimo de un locus marcador. Un locus marcador es un locus polimrfico que
informa:
Sobre el genotipo del individuo que lo porta; gracias a esto los marcadores son
utilizados en genetica de las poblaciones.
Sobre el genotipo de un locus vecino (os); las aplicaciones aqui van de clonacin
posicional a la seleccin asistida.
Los marcadores genticos mas corrientes son los morfolgicos, moleculares (a nivel de
DNA) y bioqumicos (isoenzimas, proteinas). Este ultimo trmino, lamentablemente es
ambiguo, ya que en otros contextos es designado como molcula, donde su presencia
indica un estado de diferenciacion o un estado fisiolgico. Entonces, un marcador es

considerado como un carcter cuyo patrn de herencia puede definirse en un nivel


morfolgico, bioqumico o molecular.
Se le utiliza para obtener, aunque de manera indirecta, informacin con respecto de las
bases genticas de otros caracteres o rasgos de inters en los organismos sujetos a
estudios.
Se asocian marcadores con caracteres, para esclarecer la probabilidad de relacin entre
un
locus genticos y un carcter determinado.
Caractersticas principales de un marcador gentico
Un marcador gentico ideal es:
Polimrfico (idealmente alto polimorfismo).
Codominantes (el heterocigota presenta simultaneamente los caracteres de los
parentales homocigotas, entonces puede ser diferenciado de los homocigotas
parentales); es decir hay ausencia de interaccin intralocus.
No espistticos (su genotipo puede ser leido a partir de su fenotipo, al margen de
cualquiera sea el genotipo de otros locus); es decir hay ausencia de interaccion
interlocus.
Neutro, las sustituciones allicas o locus marcador no tienen otros efectos fenotpicos
que aquello que permite de determinar su genotipo.
Insensible al medio ambiente, su expresin fenotpica no es afectado por variabilidad
ambiental o interaccin genotipo-ambiente, es decir el genotipo puede ser inferido a
apartir del fenotipo cualquiera sea el ambiente (alta heredabilidad).
Reproducibles.
Herencia simple, idealmente son genes mendelianos simples con alelos codominantes.
Facilidad de evaluacin.
Deteccin en las primeras etapas de ciclo de vida (embrional).
Ensayos baratos y manejables a gran escala.
Inocuos para el hombre e idealmente para todos los organismos.
Los marcadores morfolgicos responden mal a la mayora de estos criterios, poco
polimorfismo, en general dominantes, ellos interaccionan frecuentemente con otros
caracteres, y pueden ser influenciados por el medio.
Por el contrario los marcadores bioqumicos y moleculares tienen, en la mayora de los
casos las propiedades sealadas. Las limitaciones mayores de los isoenzimas son el bajo
nmero de locus suceptible de ser revelados (raramente mas de 30 a 40 locus en arroz,
maiz, y todos no son siempre polimrficos), hay una cierta especificidad de rganos,
todas
las enzimas no estn presentes o activas en todos los rganos. Por el contrario, los
marcadores al nivel de DNA son en nmero casi ilimitado y son independientes del
estado
o del rgano analizado, ya que el DNA es siempre el mismo en todos los tejidos.
Ademas,
ellos tienen la ventaja de ser mas directamente utilisables para las aplicaciones
posteriores
en biologa molecular.7
Interpretacin gentica
El resultado observable del desarrollo de cualquier tipo de marcadores es un patrn de
bandas o de picos cuando se obtiene con secuenciadores automticos. Cada banda

corresponde a la posicin de un fragmento de DNA separado previamente en funcin de


su
tamao por medio de la electroforesis en una matriz porosa, habitualmente un gel de
agarosa o acrilamida. La hiptesis de partida es que cada banda corresponde a un alelo
de
un locus determinado. Si el marcador estudiado es codominante, cada individuo
heterocigoto tiene otro alelo situado en otra posicin del gel, es decir, correspondiente
generalmente a un fragmento de DNA con un nmero de bases distinto. Si el marcador
es
dominante, solamente existen dos fenotipos: el que presenta una banda y el que no la
tiene.
La presencia de banda es lgicamente dominante sobre su ausencia.
La interpretacin gentica de estos patrones de bandas requiere el estudio de su
segregacin en una o varias poblaciones. Aunque pueden realizarse algunas inferencias
genticas a partir del anlisis de una muestra de individuos no relacionados, sta es
siempre incompleta y provisional. Los estudio de herencia son siempre ms simples
cuando el nmero de loci detectados por sonda (en este caso de los RFLPs o derivados
de
la reaccin PCR) es de uno o dos loci. La interpretacin suele complicarse cuando
aumenta
el nmero de bandas de un patrn determinado porque, aunque algunos loci puedan ser
codominantes, es muy difcil identificar con certeza los alelos y distinguirlos de los
otros
loci, particularmente de los que estn ligados entre s. Por ello, es preferible optar en
estos
casos por un anlisis de presencia o ausencia de banda, que a veces, despus del anlisis
del ligamiento puede permitir la deteccin de marcadores de herencia codominante.
Aspecto importante al momento de elegir un marcador son: el objetivo del estudio y la
disponibilidad tcnica y financiera del laboratorio. Es necesario saber muy bien el
objetivo
que se quiere alcanzar y el perodo del tiempo disponible para lograrlo.
4.3. Reaccin en Cadena de la Polimerasa (PCR, )
Los componentes de amplificacin para la reaccin PCR
Los componentes de la reaccin de PCR son (Figura 4.5):
a. Dos iniciadores sintticos, que son regiones complementarias a las cadenas opuestas
que
flanquean a la regin de DNA blanco que se desea amplificar.
b. Una secuencia blanco en una muestra de DNA que este entre el par de primers, la
cual
puede ser de 100 a 5 000 pares de bases.
c. Una enzima, la DNA Polimerasa termoestable que pueda resistir altas temperaturas de
calentamiento (95C a ms).
d. Los cuatro deoxiribonucletidos (dNTPs).
e. Un buffer para darle las condiciones adecuadas al sistema en conjunto.

Fundamento terico
La reaccin en cadena de la polimerasa es una reaccin cclica dirigida
enzimticamente que permite la amplificacin in vitro de una regin del cido
desoxirribonuclico (DNA), localizada entre dos regiones de secuencia conocida.

Utiliza dos oligonucletidos que funcionan como "iniciadores", que se hibridan a las
cadenas opuestas de DNA de secuencia complementaria, flanqueando a la secuencia de
inters. Los iniciadores, toman diferentes denominaciones, tales como
oligonucletidos,
cebadores, primadores, amplmeros, detonadores o primers. Los iniciadores son
molculas de DNA de cadena individual y longitud corta (10-30 nucletidos), se
hibridan complementariamente a las partes terminales o flancos de una secuencia
especfica de la cadena sencilla del DNA patrn, se efecta la amplificacin (extensin)
por la DNA polimerasa, la enzima que cataliza la sntesis de cadenas largas de
polinucletidos. La sntesis se dirige incorporando monmeros de trifosfato de
desoxinuclesido al grupo libre 3'-hidroxilo del iniciador en direccin 5'>3', la
polimerizacin se efecta siempre del -fosfato 5' del trifosfato de desoxinuclesido
al grupo hidroxilo terminal 3' de la cadena creciente de DNA. Esto resulta en la
sntesis de nuevas cadenas de DNA complementarias a las cadenas patrn iniciales
(Figura 4.5).
En cada ciclo de amplificacin, las cadenas de DNA sintetizadas se convierten en un
patrn (o substrato) para cualquier nuevo ciclo; idealmente, la secuencia de DNA
"objetivo" o DNA blanco se amplificar de manera selectiva ciclo tras ciclo.
Tericamente, los productos de amplificacin (amplicones) del primer ciclo seran
el resultado de la sntesis de DNA del patrn original, de longitud indefinida. La
polimerasa del DNA sintetizara nuevas molculas (a partir de tales moldes o
patrones) hasta que fuese interrumpida por el inicio del siguiente ciclo. A partir del
tercer ciclo, los productos de amplificacin poseeran una longitud definida, pues
nicamente se sintetizan los fragmentos de la secuencia "objetivo", cuya longitud
correspondiera a las posiciones de alineamiento (anillamiento, ensamblaje) de los
iniciadores con el patrn original. En lo consecutivo, la secuencia "objetivo" se
amplificar exponencialmente. Concretamente la amplificacin entendida como el
nmero final de copias de la secuencia "objetivo", se expresa por la frmula:
(2n -2n) x x (2n)
Donde:
n = nmero de ciclos
2n = primer producto obtenido despus del ciclo 1, y productos
obtenidos despus del ciclo 2
2n = productos amplificados que contienen la secuencia objetivo y
salientes en los extremos (no corresponden exactamente a la region
objetivo)
x = nmero de copias del patrn original.
Parmetros de la PCR
La PCR es un evento bioqumico relativamente complicado, donde las cambiantes
interacciones cinticas entre los componentes determina la calidad de los productos a
obtener.17 A pesar de ser extremadamente eficaz, la amplificacin exponencial de los
amplicones no es un proceso infinito. Un gran nmero de factores actan en contra del
proceso, siendo pronunciado su efecto en ciclos posteriores de la PCR.
Ciclos trmicos
Los parmetros de los ciclos de temperatura son considerablemente importantes para
una PCR ptima. Los pasos ms importantes en los perfiles del tiempo y temperatura a
considerar, son:
Etapas del ciclo de amplificacin
Un proceso tpico de PCR, requiere de un nmero de ciclos para amplificar una
secuencia

de DNA, cada ciclo tiene generalmente tres pasos :


Desnaturalizacin. La temperatura entre 90-96 C provoca una desnaturalizacin
completa del DNA genmico para permitir el ensamblaje posterior de los iniciadores.
El dao trmico del DNA conduce a un ndice creciente de mala incorporacin de los
nucletidos, por lo que debe evitarse manejar temperaturas muy altas, y/o
desnaturalizar por perodos prolongados. Limitar la exposicin ayuda tambin a
mantener la actividad mxima de la polimerasa. Sin embargo, existen molculas de
DNA de grandes proporciones o desmedidamente complejas (como plsmidos de DNA
superenrrollado) que son ms difciles de desnaturalizar y que requieren mayor energa
trmica, por lo que se sugiere la inmersin de los tubos de reaccin en agua hirviendo
por algunos minutos o un hot Start (predesnaturalizacin). Por el contrario, el
calentamiento insuficiente deviene en un completo fracaso de la PCR. Tpicamente la
temperatura de desnaturalizacin es entre 92 y 94 C.
Ensamblaje. Perodo trmico que define el ensamblaje (alineamiento, anillamiento,
anclaje) o hibridacin de los iniciadores a la secuencia complementaria; tpicamente,
entre 36 y 70 C. Se calcula en funcin de la longitud y contenido de guanina y citosina
de los iniciadores.
Extensin. La extensin, propiamente la amplificacin o polimerizacin, se efecta
generalmente a 70-85 C, temperatura ptima de actividad para las polimerasas
termoestables. La duracin de los pasos de extensin puede incrementarse si se
polimerizan amplicones de gran longitud, aun cuando la mayor parte de los tiempos de
PCR se restringen a 2 minutos (1 minuto/1000 pb de secuencia "objetivo" o substrato).
A menudo, el tiempo de extensin del ciclo final es mayor (hasta 10 minutos) con la
finalidad de asegurar la total extensin de las molculas. La temperatura de extensin
ptima en los PCR es 72 C, donde la Taq polimerasa tiene su mayor actividad
cataltica.
Nmero de ciclos. Usualmente son 25 a 35. El aumento en el nmero de ciclos
ocasiona un incremento en el nmero de productos no deseados, sin impacto alguno
en el rendimiento del producto de eleccin. As, es poco comn encontrar
protocolos experimentales con ms de 40 ciclos.
Tiempos de declive. Son perodos en los que se realizan los cambios de una
temperatura a la siguiente dentro del termociclador.
DNA patrn
Estas secuencias pueden ser DNA genmico, DNA clonado (a partir de clones
individuales o bancos genmicos: lambda, csmidos o vectores BAC o YAC), y/o
bancos de cDNA (derivado de RNA total, RNA poli(A)+ RNAm). Secuencias patrn,
tambin son conocidos como DNA sustrato, blanco, objetivo o molde.
La muestra de PCR puede ser de una o dos cadenas de DNA o RNA, no siendo
generalmente el tamao del DNA un factor fundamental. De utilizarse DNA genmico
de alto peso molecular, se mejora la amplificacin si se digiere previamente con
enzimas de restriccin. De no conocerse la concentracin de la secuencia "objetivo", se
recomienda optimizar la reaccin con controles positivos de ADN; normalmente, se
utilizan subnanogramos de un patrn clonado y submicrogramos de ADN genmico.
Potencialmente, la PCR puede realizar la amplificacin de una sola molcula de DNA
en grandes nmeros, es factible amplificar una secuencia a partir de cantidades del
orden de picogramos, por lo que debe extremarse el cuidado en el manejo de reactivos
y muestras, as como reducir al mnimo cualquier posibilidad de contaminacin.
Concentracin de enzimas
La introduccin de las polimerasas termoestables del DNA posibilit la automatizacin
de la PCR, pues slo se incorporan al inicio del proceso de amplificacin. La primera

polimerasa del DNA termoestable utilizada fue la Taq polimerasa.


Los resultados obtenidos, en trminos de amplificaciones de alto rendimiento, de uno o
varios fragmentos, o de fragmentos de gran longitud reportan el uso de cantidades
considerables de la enzima (1-4 U/100 l). Utilizar mayores cantidades puede resultar
en la produccin de productos no especficos y/o en la reduccin del rendimiento del
amplicn "objetivo". La concentracin tpica de la enzima usada es de 2U/100 l de
volumen de reaccin.20 Normalmente, la cantidad de la enzima se torna limitante luego
de 25 a 30 ciclos de PCR, debido a un exceso molar de la secuencia "objetivo".
Para el desarrollo de la reaccin, la enzima polimerasa del DNA requiere mnimo 1 mM
de magnesio libre, lo que significa que las concentraciones de magnesio debern ser 1
mM mayores que la concentracin total de los dNTPs (ya que secuestran magnesio).
Esto es, la cantidad de Mg2+ libre disponible para la polimerasa Taq del DNA resulta de
la sustraccin de la concentracin total de dNTPs de la concentracin total de MgCl2.
La concentracin de MgCl2 tiene un efecto fuerte sobre la especificidad y rendimiento
de la PCR. La concentracin ptima de MgCl2 en la mezcla final de reaccin puede
variar dentro del intervalo de 1.0- 2 mM, pero en ciertas ocasiones se ensayan diferentes
concentraciones de Mg2+ (considerando una cantidad individual de dNTP del orden de
200 uM). Los iones Mg2+ estimulan la actividad de la polimerasa e incrementan la
temperatura de fusin (Tm) del DNA de doble hlice, as como la interaccin
iniciador/secuencia patrn. La concentracin insuficiente de Mg2+ deviene en bajos
rendimientos; en tanto que el exceso, en la acumulacin de productos no especficos e
inhibicin de la actividad de la enzima.
Iniciadores
a. Diseo
Para el diseo y seleccin de iniciadores de PCR se deben considerar los siguientes
parmetros esenciales:
a. La hibridacin estable de un iniciador con el sitio especfico en la regin
"objetivo" del DNA patrn o substrato para el cual fue diseado,
b. la estabilidad interna del iniciador,
c. la ausencia de complementaridad interna en el iniciador,
d. la ausencia de complementaridad con otro iniciador,
e. contenido de G + C entre 40-60 %,
f. no deben ser palindrmicos.
La estabilidad del iniciador puede medirse por la longitud (en pares de bases) del duplo
DNA-iniciador, el cociente GC/AT, la energa libre del duplo (kcal/mol), o por la
temperatura de fusin (en C). Para realizar con exactitud los clculos, se deben
considerar varios parmetros termodinmicos, cuestin que se facilita con el uso de
programas computacionales. stos permiten calcular la estabilidad del dplex
DNAiniciador,
la composicin y porcentaje de desoxinucletidos; analizar las posibles
interacciones del par ms cercano, las regiones de complementariedad del DNA, los
sitios de formacin de dmeros de iniciador, o la longitud de amplicones; adems de
contemplar cuestiones como la estructura secundaria, la formacin de palndromas, etc.
En general, los iniciadores utilizados en la PCR constan de 10 a 30 nucletidos de
longitud, lo que permite utilizar altas temperaturas de ensamblaje e incrementar la
especificidad de la reaccin. Cuanto menor sea la longitud de los iniciadores, menor
ser la especificidad de hibridacin con la secuencia patrn. De ser posible, los
iniciadores deben elaborarse con un nmero aproximadamente igual de cada una de las
cuatro bases, evitando regiones de secuencia anormal; i.e. tramos de polipurinas,

polipirimidinas, o patrones de repeticin; y secuencias con estructura secundaria.


simples de DNA se encuentran de forma abundante y uniforme en los genomas de la
mayora de organismos eucariotas. Estas secuencias no se transcriben a RNA y entre la
amplia variedad de funciones que se les atribuye se incluyen la regulacin gentica y la
de
actuar como seales para la conversin gentica y la recombinacin.
Generalmente, las repeticiones de dinucletidos constituyen los microsatlites ms
comunes, que pueden ser de tres tipos: perfectos [ejemplo (CAn)], imperfectos [ejemplo
(CA)n-CCA-(CA)m] y compuestos [ejemplo (CA)n (TG)m], donde n y m son el
nmero
de repeticiones del motivo. Los tri y tetranucletidos son menos habituales. En
particular,
se conoce que la repeticin (GT)n representa el 0,5 % del genoma humano, siendo la
ms
extendida en genomas vegetales el dinucletido (AT)n, aunque existen particularidades
segn la especie vegetal. As, se ha encontrado que en cebada y en arroz el microsatlite
ms abundante es el (GA)n.
El nmero de repeticiones es variable y , en general, el grado de polimorfismo aumenta
con la longitud total del microsatlite, que no suele superar las 0,1 Kb. El mecanismo
mediante el cual los microsatlites mutan es poco conocido. Se han propuesto dos
mecanismos principales no excluyentes: 1) el sobrecruzamiento desigual durante la
meiosis
y 2) el deslizamiento (disociacin y reasociacin incorrecta) de la cadena que est
siendo
sintetizada durante la replicacin del DNA, siendo este ltimo el que se cree tiene una
mayor importancia con relacin a la hipersensibilidad de los microsatlites.
El diseo de iniciadores especficos para las secuencias nicas que flanquean el motivo
repetido, frecuentemente ms conservadas, permite la amplificacin por PCR de la
regin
repetitiva y la visualizacin de todos los alelos posibles para un locus microsatlite,
debido
a la frecuente variacin en el nmero de repeticiones del motivo.
Los microsatlites son marcadores codominantes y altamente reproducibles.
Generalmente
detectan un solo locus. De modo que los individuos heterocigotos muestran patrones
simples de 2 bandas cada una de ellas heredada por uno de sus progenitores, mientras
que
los individuos homocigotos muestran solo una banda (Figura 12).
Figura 4.12. Desarrollo de marcadores SSR. Adaptado de CIMMYT3
ATATATATATATATATATATATAT
ATATATATATATATATAT

AT12
AT9
DNA individuo 1
DNA individuo 2
Regin
Conservada
Iniciador 2
Regin
conservada
Iniciador 1

PCR
Electroforesis
Alelo a1

Alelo a2

268
Marcadores SCAR (Sequence Characterized Amplified Region- Caracterizacin de
producto de amplificacin)
Fragmento de DNA genmica amplificada por PCR con los iniciadores especficos (1420
bases). Estos iniciadores son definidos gracias al conocimiento de la secuencia de un
fragmento RFLP, RAPD, AFLP de inters particular, el que es aislado de un gel,
clonado y
secuenciado. Luego por un PCR simple, usando dos iniciadores elaborados segn la
secuenciacion para ambos extremos, se genera banda simple, de fcil lectura y
especfico.
Estos marcadores especficos son cada vez ms utilizados, entre otros, en los programas
de
mejoramiento gentico de plantas e identificacin de sexo en las plantas, ya que
permiten
discriminar fcilmente, especialmente si estn muy ligado al gen o son parte del gen
(Figura 4.13).
Figura 4.13. Generacin de marcadores tipo SCAR. P1 es el iniciador usado para la
tcnica RAPD, P2 y P3 son iniciadores diseados luego del
secuenciamiento del fragmento para la tcnica SCAR.
PCR
Clonar la banda
polimrfica en un
vector
Secuenciar el fragmento y
disear nuevos cebadores
para amplificar nicamente
la banda de inters.
Despus de la PCR con los nuevos
iniciadores, el resultado es un patrn
de bandas ms fcil de interpretar.
123
Banda Polimrfica
Gel de
RAPD
Bandas
Polimrficas

123

SCAR
RAPD p1 p1
P2 P3
PCR
PCR

269
Marcadores CAPS (Cleaved Amplified Polimorphic Squense - Digestin de
producto
de amplificacin)
Un fragmento de DNA genmico amplificado (STS o SCAR) es digerido por las
enzimas
de restriccin, luego el polimorfismo del tamao de los fragmentos generados es
revelado

por electroforesis. Un problema relacionado con la conversin de RAPDs, RFLPs o


AFLPs
a SCARs es que a veces el resultado de la amplificacin especfica no produce
polimorfismos. Esto ocurre frecuentemente cuando se parte de un clon de RFLP, porque
a
menudo el polimorfismo de tipo RFLP se produce fuera de la regin del DNA usado
como
sonda. Existen varios mtodos para detectar polimorfismo despus de una amplificacin
de
PCR: uno de ellos consiste en digerir los fragmentos amplificados con diversas enzimas
de
restriccin hasta encontrar una enzima que produzcan un polimorfismo de digestin. El
marcador obtenido as, se conoce como CAPS (Figura 4.12). Habitualmente se usan
unos
10-15 enzimas de restriccin con diana (sitio) de reconocimiento de 4 pb, para aumentar
la
probabilidad de encontrar sitios de corte. Se usan normalmente 8 l de producto de PCR
(previamente purificado con cualquier kit de purificacin para productos de PCR), 1 l
de
tampn x 10 de enzima de restriccin y 2,5 U (unidades) de la enzima de restriccin. La
digestin se incuba 1-2 h a la temperatura de corte de la enzima (normalmente 37 C) y
se
separa mediante electroforesis en un gel de agarosa del 2-3 %, segn el tamao del
fragmento original sin digerir (Figura 14).Tambin, ste marcador es ampliamente
usado,
sobretodo tras la conversin de otros tipos de marcadores en marcadores de PCR.
Figura 4.14. Generacion de marcadores tipo CAPS.
SNPs (Single-Nucleotide Polymorphisms- Polimorfismo de nucletidos nicos)
Los SNPs son diferencias entre individuos a nivel de un par de nucletidos, cuando
stos
son comparados en el mismo sector del genoma; esto significa anlisis de polimorfismo
de
alta resolucin (Figura 4.15). Se trata de sustituciones nucleticas que ocurren con una
frecuencia relativamente alta a lo largo del genoma y que son muy tiles en la
confeccin
de mapas fsicos. La existencia de grandes colecciones de SNPs son de elevado inters
para estudios en gentica animal y vegetal, ya que es posible correlacionar el ligamiento
entre SNPs y enfermedades genticas.
Perfil sin digestin (monomrfico)

12341234
Perfil luego de la digestin (polimrfico)

270
El desarrollo de los marcadores de tipo SNP se basa en la secuenciacin extensiva del
genoma, por lo que su utilizacin a gran escala est por ahora restringida a iniciativas de
la
envargadura del proyecto de genomas. Adems de la secuenciacin, otros mtodos de
deteccin de SNPs incluyen otras tcnicas, como la PCR alelo-especfica y los SSCP
(Single strand Conformation profile) entre otras. Cabe destacar que muchos de los
polimorfismos detectados por otros tipos de marcadores, tienen su orgen en SNPs. En

decir, muchos tipos de marcadores son sencillamente distintas metodologas para


detectar
una mutacin puntual o polimorfismo en el genoma, es decir, un SNP.
Pero la utilidad de los SNPs reside en su uso a gran escala, lo que hace que los mtodos
usados para detectarlos sean poco apropiados. Los SNPs son muy abundantes en el
genoma
humano, y se estima que hay uno por cada kb de ADN aproximadamente. Actualmente
existen numerosos kits de casas comerciales para la deteccin de SNPs, aunque en estos
casos no se pretende localizar nuevos SNPs sino centrarse en un SNP determinado
previamente descrito y detectarlo de la manera ms rpida, sencilla y eficiente en un
mayor
nmero de individuos.
Figura 4.15. Comparacin de una secuencia dada del genoma en dos individuos.
indel= se refiere a la insercin o delecin en esa ubicacin.
4.7. Aplicaciones de marcadores moleculares en el mejoramiento de plantas
En general, los marcadores moleculares son utilizados en estudios de enfermedades
genticas, pruebas de paternidad y parentesco, tambin como herramientas en la
seleccin
de plantas o animales, en programas de mejoramiento y finalmente, en estudios de
caracterizacin cuya finalidad son estudios sobre taxonoma, evolucin y conservacin.
Identificacin de origen parental y tests de paternidad.
Identificacin y proteccin de variedades.
Atribucin de lineas a grupos heterticos.
Certificacin de pureza gentica de lineas y hibridos.
Control de fecundacin cruzada y autofecundacin en plantones de semillas forestales.
Evaluacin de germoplasma y poblaciones de mejoramiento (variabilidad, diversidad,
clasificacin, distancia gentica y filogenia).
Construccin de colecciones nucleares (core collections) en bancos de germoplasma
a
partir de estudios sobre diversidad y distancia gentica.
Construccin de mapas genticos de ligamiento.
Mapeamiento gentico de QTL y/o ETL (Quantitative y Economic Trait Loci),
controladores de caractersticas cuantitativas y/o de importancia econmica.
ATGGTAAGCCTGAGCTGACTTAGCGT-ATCGATC
ATGGTAAACCTGAGTTGACTTAGCGTGATCGATC

snp snp indel


Individuo 1
Individuo 2

271
Anlisis de la arquitectura de caractersticas cuantitativas (nmero, posicin, accin
gentica, magnitud de efecto e interacciones de QTLs).
Deteccin de loci homlogos en otras especies o generos a travs de mapas
comparativos (Comparative o Synteny mapping).
Introgresin de caractersticas por retrocuzamiento asistido por marcadores.
seleccin y recombinacin dirigida de genotipos superiores.
seleccin durante el desarrollo de lineas endgamas.
Prediccin de fenotipos esperados.

Seleccin indirecta para caractersticas de difcil evaluacin (resistencia a factores


biticos y abioticos, o para caractersticas industriales).
Seleccin precoz en cultivos perennes.
Aplicacin para estudios de caracterizacin
Los MM tienen un alto poder de discriminacin, no presentan interaccin con el
ambiente,
producen resultados equivalentes entre distintos laboratorios, permiten el clculo de
distancias entre genotipos en forma consistente con otros caracteres, como informacin
de
pedigree. Preferentemente, debe conocerse el control gentico de los descriptores, y ser
posible su localizacin cromosmica. Adems, la metodologa de anlisis de los perfiles
generados, debe ser capaz de traducirlos e interpretarlos. Entre las principales tcnicas
de
marcadores moleculares, la ms adecuada a esos parmetros es la de 0microsatlites.
Actualmente, este tipo de estudio tiene un gran impacto, pues son apuntadas como las
herramientas ms poderosas para identificacin y caracterizacin de variedades, dando
soporte a la propiedad intelectual de las mismas.
Aplicaciones de los marcadores moleculares en programas de mejoramiento
En programas de mejoramiento, los marcadores moleculares pueden ser utilizados con
finalidad de identificacin de individuos, anlisis de diversidad gnica, mapeo gentico,
mapeo de caractersticas cualitativas o cuantitativas heredadas, mapeo comparativo
entre
distintas especies, estudios de evolucin, caracterizacin gentica de especies, gentica
de
poblaciones y clonaje de genes.
La aplicacin de marcadores moleculares para identificacin gentica permite la
optimizacin de bancos de germoplasma y colecciones nucleares para programas de
mejoramiento. Ese tipo de anlisis asociado a evaluacin en software adecuados,
conduce a
los estudios de diversidad gentica que permiten al fitomejorador una base para la
eleccin
de individuos como progenitores, pues analiza la proximidad o divergencia gentica de
los
progenitores. De esa manera, el fitomejorador puede optimizar los cruzamientos y
alcanzar
individuos hbridos con caractersticas mejoradas en tiempo ms corto.
El mapeo gentico es un estudio importante en programas de mejoramiento, pues es
necesario, en un momento dado, saber en cual cromosoma est la caracterstica de
inters y
como sta segrega en la poblacin. El mapeo gentico que se consigue por medio de
trabajos con marcadores moleculares, tambin puede ser utilizado para ubicar en el
genoma de una planta transgnica, el gen que otorg la caracterstica introducida a
travs
de la transformacin.
272
La utilizacin de los marcadores moleculares para mapeo de caractersticas cuantitativas
(Quantitative Trait Loci, QTL), es muy til. Rasgos tales como resistencia a
enfermedades
o produccin, son caractersticas que dependen de ms de un gen y as son de difcil

evaluacin. Por eso, hacer seleccin asistida con marcadores moleculares para
fragmentos
relacionados con QTL, tiene un gran impacto. Adems de eso, tambin se puede hacer
el
mapeo de caractersticas heredadas que sean cualitativas. En esos casos, la tcnica de
SCAR es muy til para hacer seleccin asistida. La seleccin asistida fue sealada como
una tcnica que disminuye el costo de un programa de mejoramiento. La seleccin
asistida
puede tambin ser utilizada para reconocimiento de individuos en una progenie que
contiene un gen introducido por transformacin gentica de plantas.
Los marcadores moleculares ya permitieron el clonaje de un gran nmero de genes
(Mapbased
cloning). As, la tcnica de los marcadores moleculares puede tambin relacionarse
con las del DNA recombinante y transformacin gentica de plantas.
Es conveniente indicar que el estudio utilizando marcadores moleculares en programas
de
mejoramiento con objetivo de anlisis de diversidad gentica, mapeo de caractersticas
cualitativas o cuantitativas o an mapeo gentico, necesita no slo conocimiento tcnico
de
esas metodologas, sino tambin conocimientos para anlisis estadsticos en las
progenies
utilizando mtodos biomtricos de evaluacin.
Actualmente, en el rea de la genmica, los estudios de secuenciacin conducen al
conocimiento de diversas secuencias gnicas nuevas. La caracterizacin de nuevos
genes,
asociados a alguna caracterstica de inters, puede ser una herramienta muy poderosa
para
dar soporte a los programas de mejoramiento y estn asociadas al anlisis con
marcadores
moleculares. Por medio del conocimiento de sus secuencias, se pueden hacer diseos
con
iniciadores especficos y as hacer amplificacin especfica de los genes ms
importantes
que se quieren fijar en una poblacin y analizar su segregacin en sta. An ms. Se
puede
estudiar su presencia gentica (homocigosis o heterocigosis). El mapeo gentico de
organismos utilizando los marcadores moleculares tambin da soporte a los trabajos de
secuenciacin completa de genomas.
Seleccin asistida por marcadores moleculares (MAS)
Los trabajos de ligamiento se realizan con la finalidad de encontrar marcadores
asociados a
ciertos genes de inters, como resistencia a una enfermedad, rendimiento, entre otros.
Para ello se identifican padres muy diferentes para ese gen, por ejemplo uno debe ser
susceptible y el otro resistente. Estos se hibridan y se genera la F1. Luego se hace
generalmente la F2 (por autofecundacin) para observar la segregacin. Este material
(poblacin segregante y junto con los padres) debe ser evaluado con cualquiera de las
tcnicas moleculares, como por ejemplo AFLP, y a la vez se debe evaluar este material
para su respuesta genotpica. Esta comparacin nos lleva a la asociacin de ciertos
fragmentos de DNA (conocidos como marcadores), ya que solo estarn en un parental,
por

ejemplo resistente. Este marcador asociado a la resistencia, cuanto ms cerca est al


gen,
se considera mejor marcador para la seleccin asistida (MAS) o facilitada por
marcadores
moleculares. Se considera mucho mejor cuando es parte del mismo gen, esto significa
que
puede ser del promotor, o de la parte estructural del gen (intron o exon).
273
Luego de encontrar marcadores ligados con el gen de inters, se puede utilizar esos
marcadores para una seleccin en los programas de mejoramiento gentico. Este
marcador
ligado, obtenido ya sea por RAPD, AFLP, se debe convertir en especifico, usando la
tecnica SCAR o CAPs. Para facilitar su lectura, se obtiene uno o pocos fragmentos.
En general la presencia de esta banda en el genotipo nos indicaria que ese genotipo es
resistente. Pero esto no necesariamente ser as. Entonces para evitar eso, hay que
verificar
su respuesta fenotpica en todos aquellos que presentan ese fragmento de resistencia.
Puede
ser que genotipos susceptibles tambien tengan ese marcador, esto significaria por
ejemplo
que ese genotipo tiene el gen, pero seria como pseudogene.