Está en la página 1de 61

INTRODUCCIN A LA GENMICA

Strachan T and Read A. Human Molecular Genetics, 4th edition. Garland Science, 2010

NIVELES DE
COMPACTACIN
DE LA CROMATINA

Caracterstica

Eucromatina

Heterocromatina

Apariencia en interfase

descondensada

condensada

Localizacin
cromosmica

Brazos distales

Peri y centromrica

Replicacin

Fase S temprana

Fase S tarda

Tipo de secuencias

Copia nica

Secuencias repetidas

Densidad gnica

Alta

Baja

Silenciamiento de genes

Genes individuales

Grandes dominios

Metilacin de DNA

Islas CpG hipometiladas

Hipermetilada (cuerpo
de Barr)

Acetilacin de histonas

Alta

Baja

Espaciamiento de
nucleosomas

Irregular

Regular

Qu es un gen?

Gerstein et al.(2007)

Cuadro 2. Caractersticas principales del genoma nuclear y mitocondrial humano.

Del Castillo, 2012

GENOMA HUMANO

(1) Genes codificantes de cadenas polipeptdicas.

(2) Genes que codifican para RNAnc.


(3) Pseudogenes y genes procesados.

(4) DNA no codificante altamente repetido.


(a) DNA repetido en tndem
(b) DNA repetido disperso

Cuadro 2-2. Tipos de


RNA no codificante
(ncRNA) humano y sus
funciones.
Del Castillo, 2012

Del Castillo. 2012

Explique con un ejemplo los siguientes tipos de variaciones

SNPs (single-nucleotide polymorphisms)

INDELS (small insertions and deletions) 1-10 000 pb


CNVs (copy-number variants) Secuencias de >1kb

Duplicaciones segmentales
>3 Mb variantes estructurales microscpicas

Polimorfismo de
nucletido sencillo
(SNP)

ATTGGCCTTAACCCCCGATTATCAGGAT
ATTGGCCTTAACCTCCGATTATCAGGAT

Insercin-delecin
(INDEL)

ATTGGCCTTAACCCCCGATTATCAGGAT
ATTGGCCTTAACCCCC - - TTATCAGGAT

Variacin en nmero
de copias (CNV)

ATTGGCCTTAGGCCTTAA CCCCCGATTATCAGGAT
ATTGGCCTTAA - - - - - - - CCCCCGATTATCAGGAT

Figura 1. Tipo de variaciones genticas observadas en la secuencia y estructura


del genoma humano.

A.
Minisatlite
(VNTR)

5-ACAGGGTGTGGG-3
3-TGTCCCACACCC-3
12
17

B.
Microsatlite
(STR)

5-CACACACACACACAC -3
3-GTGTGTGTGTGTGTG-5
7
4

Figura 2. Variabilidad gentica por secuencias de DNA minisatlite y microsatlites en el genoma humano. (A) Esquema
de una unidad de repeticin minisatlite de 12pb en una muestra heterocigota con 12 y 17 repetidos de longitud (144
y 204pb, respectivamente). (B) Esquema de un microsatlite de clase dinucletida (CA)n en una muestra heterocigota
con 4 y 7 repetidos (8 y 14pb, respectivamente). (VNTR.- repetidos en tndem de nmero variable. STR.- repetidos
cortos en tndem)

POLIMORFISMOS DE NUCLETIDO SENCILLO


(SNP-Single Nucleotide Polymorphisms).

Polimorfismo: es una variacin de DNA en la cual cada


secuencia posible est presente en al menos 1% de la
poblacin
La mayor parte de la variacin gentica consiste en SNPs
Se estima que el genoma humano >10 millones SNPs, hasta hoy
2.8 millones identificados. 1.8% SNPs ubicados en exones

SNP
Tipo SNPs

Consecuencia

En regin codificante que

Causa de la mayora de las

alteren la secuencia de aa

enfermedades
monognicas, e.g:
Fibrosis qustica (CFTR)
Hemofilia (F8)

En regin codificante que NO

Pueden afectar el splicing

alteren la secuencia de aa
En regiones promotoras o de

Pueden afectar el nivel, la

regulacin

localizacin o el tiempo de
la expresin del gen

SNPs en otras regiones

No hay un impacto directo


conocido en el fenotipo.
Muy tiles como
marcadores

Qu diferencias existen entre polimorfismo y mutacin?

Qu es un haplotipo? para qu se hace un anlisis de


haplotipos? Cmo se heredan?

Anlisis de haplotipos
demostr co-segregacin de
tres marcadores polimrficos
con el gen TULP1 en 6p21.31
en una familia con retinitis
pigmentosa.

A partrir de la siguiente secuencia con 3


SNP, diga cules son todos los posibles
haplotipos.

VARIANTES ESTRUCTUTALES
VARIANTES EN NMERO DE COPIA (CNV)
Se pensaba que todos los genes estaban presentes en 2 copias en el genoma. Sin
embargo, se han descubierto grandes segmentos de DNA, que van de miles a millones de
bases de DNA y que pueden variar en el nmero de copias.
En algunas ocasiones, estas variaciones pueden incluir genes y conducir a desbalances de
dosis.

Actualmente se conocen genes que estn en 1, 2, 3 ms copias.


Aproximadamente 12% del genoma humano est compuesto por CNVs (Redon et al., 2006;
Feuk et al., 2006)

Por qu son importantes los CNVs? Qu tipo de genes presentan variaciones en


nmero de copia? Existen cnv especficos de poblacin?

Diga 3 ejemplos de cundo los CNVs no necesariamente tienen efecto negativo en la salud

CNVs

Variaciones comunes en el genoma humano

Diga en qu se basa el mtodo de


CGH y para que se utiliza

Am J Hum Genet 2007, 80: 91-104

Variantes estructurales del genoma


Variantes microscpicas
aneuploidas
rearreglos cromosmicos
heteromorfismos

sitios frgiles
Variantes submicroscpicas entre 1 kb 3 Mb
variantes nmero de copias (CNV)

inversiones
inserciones
translocaciones crpticas

disoma uniparental segmentaria


Nat Rev Genet 2006, 7: 85 - 97

Indels
Tipo ve variante polimorfica se encuentran en promedio cada 7.2 kb de
DNA en el genoma humano.
Su tamao puede ser de 1 a 10000 nt que estn eliminados o insertados
en la secuencia de tipo silvestre.

Los anlisis funcionales de zonas exnicas ricas en indel revelan productos


gnicos con actividades de regulacin a nivel de transcripcin y traduccin.
Se sugiere que las indel contribuyeron a rasgos nicos de nuestra especie
al causar cambios a nivel de RNA o protena.
Explique con un ejemplo qu es un indel y cul es el efecto funcional sobre el
fenotipo de una persona.

GENMICA COMPARATIVA
Estudio de los genomas de diferentes especies para identificar regiones similares
u homlogas.
FILOGENTICA MOLECULAR
Relaciones evolutivas entre individuos, poblaciones y especies utilizando datos
moleculares.

Tcnicas para analizar diversidad en y entre las especies


Reactividad cruzada de Ac, electroforesis de protenas, hibridacin DNA-DNA,
secuenciacin de DNA.
La comparacin de secuencias de DNA o de protenas han sido las ms
informativas.
Secuenciacin de varios genomas.

FILOGENTICA MOLECULAR
Cambios en el N y orden de los genes (A-D) crean diversidad gentica dentro y entre las poblaciones

Repasar el proyecto de los 100 genomas

ALINEAMIENTO DE SECUENCIAS
Secuencias nucleotdicas > ms informativas que las de a
por la redundancia del cdigo gentico.
Las de a son ms fciles si las especies son muy
distantes.
Alineamiento de secuencias: no es trivial.
Pueden diferir en tamao por inserciones y deleciones.
Uso de herramientas y algoritmos bioinformticos.
Resultado: secuencias de igual tamao alineadas en
columnas, c/u representa un sitio homlogo.

ALINEAMIENTO DE SECUENCIAS

An alignment of a portion of the g -fibrinogen gene sequence from five mammals.


Insertiondeletion mutations predicted by sequence alignment are shown with hyphens (-) and the missing
data is shown with question marks (?). Kumar S, Filipski A. (2008) ELS.

Ejemplo. Bsqueda de homologa por conservacin de sitios (ATG) en 11 secuencias


de E. coli

Alineamiento de protenas de unin a ATP. Algunos aa conservados en todas


las familias. Otros presentan patrn de conservacin dependiente de c/familia.
En la superfamilia hay: chaperonas, protenas-formacin del septo bacteriano,
hexocinasas, actina.

RBOLES FILOGENTICOS
Anlisis

estadstico comparativo de secuencias entre


especies permite inferir el rbol fiologentico.
Representacin grfica de la relacin evolutiva entre grupos
taxonmicos (especies).
Raz o nodo basal: punto de partida o base del rbol.
Representa el ancestro comn.
Nodos internos: puntos de ramificacin (evento de
especiacin).
Ramas internodos. Tamao de las ramas es proporcional al
tiempo evolutivo calculado entre organismos o secuencias
relacionadas .

RBOLES FILOGENTICOS

Rooted (a) and unrooted (b) tree of five sequences. Branch lengths are drawn
proportional to evolutionary distance, which can be expressed in the units of time or
the number of substitutions. (?). Kumar S, Filipski A. (2008) ELS.

Relacin filogentica entre miembros de los tres dominios de la vida


celular, basada en el gen 16S rDNA. A su vez en cada dominio
encontramos la clasificacin en otros linajes, como los reinos en
eucariotas o las divisiones en bacterias.

Genes homlogos- derivan de un


ancestro comn.

Ortlogos- genes homlogos con


funcin idntica en diferentes
especies. Pertenecen a 2 especies
que tienen un antepasado comn
por especiacin
Ej: miogloginas del humano y
caballo.

Parlogos- genes homlogos con


diferente funcin en el mismo
organismo. Son copias duplicadas
dentro de un genoma que pueden
ser producidos por duplicaciones
en tndem.
Ej: cadenas y globinas en el
humano.

Una mutacin de corrimiento de fase de lectura distingue a los


humanos de los primates

7 especies de primates poseen versin intacta del gen MYH16, pero los humanos
de todos los continentes tienen una mutacin de corrimiento de marco de lectura
que resulta en una protena truncada.

GENMICA COMPARATIVA
Diga cules son las principales aplicaciones de la genmica
comparativa.

Sintenia: representa la preservacin del orden en pequeas regiones de un


cromosoma.
La organizacin general de un genoma puede haber cambiado durante los aos de
evolucin por rearreglos rupturas cromosmicos, duplicaciones, deleciones, etc. Pero
todava se puede distinguir pequeos bloques sintnicos que mantienen los mismos
genes en ellos.
Genes sintnicos: se localizan en el mismo cromosoma.

Genes ligados: segregan juntos a menos que haya recombinacin.

Recombinacin entre
cromtidas no hermanas
de cromosomas
homlogos

GENES LIGADOS Y SINTNICOS

A1

A,B y C= sintnicos
A y B= ligados

RECOMBINACIN

Tamao de los genomas vs complejidad


Valor

C: cantidad total DNA en genoma haploide de un organismo (Swift, 1950).

Es un valor caracterstico de cada especie.


Existe una gran variacin en el rango de valores C:
Mycoplasma <106 pb >1011 pb en algunas plantas y anfibios.

El valor C aumenta con el grado de complejidad del organismo:


> en eucariontes multicelulares > euc unicelulares > procariontes
Paradoja del valor C: No existe correlacin entre la cantidad de DNA de un
organismo con el nmero de genes y su complejidad (Thomas, 1971).
Xenopus laevis 3.1 x 109 pb y Homo sapiens: 3.3 x 109 pb

DE PARADOJA A ENIGMA DEL VALOR C


- Funciones del DNA no codificante
- Existencia de duplicaciones, genes
que estn en ms de una copia en el
genoma de los individuos

Especie

# genes

Mosca (D. melanogaster)

13.500

Nemtodo (C. elegans)

20.000

Humano (Homo sapiens)

20-25.000

Pez globo (Takifugu rubripes)

21.000

Berro (Arabidopsis thaliana)

25.500

Arroz (Oryza sativa)

40-50.000

TRANSCRIPTOMA Y PROTEOMA

El mundo mico omics


Ciencias micas y su interaccin.

El flujo de informacin biolgica es


bidireccional..

Wu et al., 2014

Transcriptoma
La coleccin completa de transcritos (molculas de RNA) sintetizados en una clula o
un tejido en un momento particular.

Varios tipos RNA: RNAm y RNAnc


(regulacin gnica) .
1 gen = diferentes molculas de
RNAm.
Patrones de expresin diferentes
clulas condiciones
(ejemplo: salud/enfermedad).

TRANSCRIPTMICA
Estudio de las caractersticas y la regulacin de la poblacin de transcritos
de RNA funcionales de una clula/organismo en un momento especfico.
Anlisis global de la expresin gnica.
Expresin gnica.
Anlisis de la expresin gnica (perfil gentico)
Nota: Buscar definicin de expresin gnica y perfil gentico

Enfoques de estudio:

Poblacin de transcritos de RNA funcionales


Mecanismos de regulacin de la produccin de transcritos de RNA.
Dinmica del transcriptoma (tiempo, tipo de clula, genotipo, estmulos
externos)

Qu nos dice el transcriptoma?


Contestar esta pregunta

Mtodos de anlisis del TRANSCRIPTOMA


Mtodos bsicos para analizar expresin (de un gen):
1.
2.
3.
4.
5.
6.
(1) Informacin de la estructura primaria (secuencia de nucletidos)
(2) Nivel del transcrito presente (medicin de la expresin gnica)

Mtodos bsicos para detectar cambios en la transcripcin de genes


mltiples
1. Basados en hibridacin: Microarreglos
2. Basados en secuenciacin: SAGE (Serial Analysis of Gene Expression) y MPSS
(Massively Parallel Signature Sequencing)
3.
4
Completar la diapositiva

PROTEOMA
Conjunto completo de protenas expresado por el genomas en una
clula o un tejido en un tiempo particular y bajo ciertas condiciones
ambientales.
Enfoques de estudio:
(1)
(2)
PROTEMICA
Estudio del proteoma mediante tecnologa de gran escala para el
anlisis de las protenas presentes en una clula o un tejido.
En el humano el proteoma es > que el genoma
Explique por qu hay ms protenas que genes.

PROTEMICA
Explique brevemente, que mtodos existen de acuerdo a los siguientes
principios.
(1) Separacin de protenas
(2) Identificacin y secuencia parcial de protenas
(3) Deteccin interaccin protena-protena

Explique de manera general las diferencias entre GENOMA,


TRANSCRIPTOMA Y PROTEOMA

Busque un artculo donde se aplique la trascriptmica o la


protemica analice lo siguiente:

A. Nombre
B. Objetivo
C. Metodologa
D. conclusiones