Está en la página 1de 69

CARACTERIZACIN MOLECULAR DE LULO (Solanum quitoense) Y TOMATE

DE RBOL (Solanum betaceum) DEL BANCO DE GERMOPLASMA DE CORPOICA


MEDIANTE EL EMPLEO DE MARCADORES COS II.

FELIX EUGENIO ENCISO RODRGUEZ

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA


FACULTAD DE CIENCIAS BSICAS
ESCUELA DE CIENCIAS BIOLGICAS
TUNJA
2007

CARACTERIZACIN MOLECULAR DE LULO (Solanum quitoense) Y TOMATE


DE RBOL (Solanum betaceum) DEL BANCO DE GERMOPLASMA DE CORPOICA
MEDIANTE EL EMPLEO DE MARCADORES COS II.

FELIX EUGENIO ENCISO RODRGUEZ


Trabajo de grado presentado como requisito parcial para optar al ttulo de
Bilogo.

LUZ STELLA BARRERO, Ph.D. Gentica Molecular Vegetal


Directora

UNIVERSIDAD PEDAGGICA Y TECNOLGICA DE COLOMBIA


FACULTAD DE CIENCIAS BSICAS
ESCUELA DE CIENCIAS BIOLGICAS
TUNJA
2007

Nota de aceptacin
_________________
_________________
_________________
_________________
_________________
_________________

____________________
Firma del jurado

Tunja, ____de Mayo de 2007.

AGRADECIMIENTOS
A Dios.
A mis padres y mi familia por su apoyo desinteresado y compresin.
A la doctora Luz Stella Barrero, por darme la oportunidad de realizar este trabajo de
investigacin y por su orientacin.
A la doctora Silvia Restrepo por las sugerencias y las observaciones hechas a este
trabajo.
Al Doctor Rodrigo Martnez, por su asesora en gentica de poblaciones.
Al Doctor Victor Nuez, por la asesora en laboratorio y correccin del proyecto.
Al Ingeniero Ivan Valbuena, por sus comentarios y asesoras en el anlisis estadstico
Al Doctor Mario Lobo, por sus comentarios y sugerencias.
Al Doctor Germn Cortina (q.e.p.d), docente UPTC, por su colaboracin, apoyo y
correccin del proyecto.
A Yaneth Camargo, por su valioso apoyo en laboratorio.
A Alexandra Olarte, por la orientacin en laboratorio.
A Erika, Ivan, Zulma Cardenas, Natalia, Sandra Barrera, Diana Arias, Silvia, Mauricio y
Jennifer, por su apoyo y colaboracin.
A Sandra Hernndez, Diana Daz, Diana Gonzlez, por su compaa y apoyo.
A mi alma mater, la Universidad Pedaggica y Tecnolgica de Colombia.
A Colciencias por el apoyo financiero para el desarrollo del proyecto.
A CORPOICA, por la facilitacin de las instalaciones y equipos.
Y a todas las personas que de alguna u otra forma contribuyeron al desarrollo de este
proyecto.

CONTENIDO
pg.
RESUMEN........................................................................................................................... 10
INTRODUCCIN ............................................................................................................... 11
1. OBJETIVOS ................................................................................................................ 12
1.1 Objetivo General ....................................................................................................... 12
1.2 Objetivos Especficos................................................................................................. 12
2. MARCO TERICO......................................................................................................... 13
2.1 SOLANCEAS ......................................................................................................... 13
2.1.1 Descripcin. ........................................................................................................ 13
2.1.2 Importancia. ....................................................................................................... 13
2.2 GENERALIDADES DEL LULO Y DEL TOMATE DE RBOL........................... 13
2.2.1
Lulo (Solanum quitoense) Lam.................................................................... 14
2.2.1.1 Origen y distribucin. ................................................................................. 14
2.2.1.2 Clasificacin taxonmica. . ........................................................................ 15
2.2.1.3 Importancia. ................................................................................................ 16
2.2.1.4 Produccin Nacional. ................................................................................ 16
2.2.1.5 Cultivo......................................................................................................... 16
2.2.2
Tomate de rbol (Solanum betaceum) Cav. Sendt...................................... 17
2.2.2.1 Origen y Distribucin.................................................................................. 17
2.2.2.2 Clasificacin taxonmica. ........................................................................... 18
2.2.2.3 Importancia.. ............................................................................................... 19
2.2.2.4 Produccin Nacional. ................................................................................ 19
2.2.2.5 Cultivo. ...................................................................................................... 19
2.3.1 Diversidad Gentica ............................................................................................... 20
2.3.2 Medida de la variacin gentica......................................................................... 20
2.3.2.1 Estructura poblacional................................................................................. 21
2.3.2.2 Endogamia. ................................................................................................. 21
2.3.2.3 ndices de fijacin. ...................................................................................... 21
2.3.3 Distancias gnicas. ............................................................................................. 23
2.4 MARCADORES MOLECULARES ........................................................................ 23
2.4.1 Marcadores COS I. ........................................................................................... 25
2.4.2 Marcadores COS II. ......................................................................................... 25
2.4.2.1 Elaboracin de cebadores Universales COS II. . ....................................... 27
2.4.2.2 Ventajas de utilizar COS II en lulo y tomate de rbol. .............................. 27
2.5 CONOCIMIENTO Y USO DE LA VARIABILIDAD GENTICA DE
COLECCIONES DE GERMOPLASMA. ....................................................................... 28
2.5.1 Estado actual de la investigacin en lulo y tomate de rbol. .......................... 28
3. MATERIALES Y MTODOS ....................................................................................... 30
3.1 Localizacin .............................................................................................................. 30
3.2 Material Biolgico .................................................................................................... 30
3.3 Siembra de semillas.................................................................................................... 30

3.4 Extraccin de ADN ................................................................................................... 31


3.5 Amplificacin de ADN ............................................................................................. 31
3.6 Identificacin de polimorfismos ............................................................................... 32
3.7 Anlisis de datos ....................................................................................................... 32
4. RESULTADOS Y DISCUSIN ..................................................................................... 34
4.1 Premisas del estudio.................................................................................................. 34
4.2 LULO ........................................................................................................................ 34
4.2.1 Extraccin de ADN. ........................................................................................... 34
4.2.2 Deteccin de Loci polimrficos. ........................................................................ 35
4.2.3 Diversidad gentica............................................................................................ 36
4.2.4 Estructura poblacional........................................................................................ 39
4.2.5 Anlisis de componentes principales ................................................................. 40
4.2.6 Distancias gnicas. ............................................................................................. 41
4.3 TOMATE DE RBOL ............................................................................................. 43
4.3.1 Extraccin de ADN en tomate de rbol. ............................................................ 43
4.3.2 Deteccin de loci polimrficos y diversidad gentica. ...................................... 44
4.3.3 Estructura poblacional........................................................................................ 44
4.3.4 Anlisis de componentes principales. ................................................................ 46
4.3.5 Distancias gnicas. ............................................................................................. 48
5. CONCLUSIONES ........................................................................................................... 49
RECOMENDACIONES ...................................................................................................... 50
BIBLIOGRAFA ................................................................................................................. 51
ANEXOS ............................................................................................................................. 57

LISTA DE TABLAS
pg.
Tabla 1. Parmetros agroecolgicos y requerimientos edficos del cultivo de lulo. .......... 16
Tabla 2. Parmetros agroecolgicos ptimos en el cultivo de tomate de rbol. ................ 19
Tabla 3. Principales marcadores moleculares, utilizados actualmente en investigaciones
tanto en animales como en plantas....................................................................................... 24
Tabla 4. Composicin del buffer de extraccin general de ADN. ...................................... 31
Tabla 5. Condiciones de PCR para marcadores COS II utilizadas en este estudio............. 32
Tabla 6. Caractersticas de los loci polimrficos para lulo. ................................................ 37
Tabla 7. ndices de diversidad de acuerdo a Nei (1978) e ndices de fijacin de acuerdo a
Wright (1921) por cada accesin de lulo. ............................................................................ 38
Tabla 8. Aporte a la varianza total en el anlisis de componentes principales por accesiones
y locus en la poblacin de lulo............................................................................................. 41
Tabla 9. Caractersticas de los loci polimrficos para tomate de rbol............................... 45
Tabla 10. ndices de diversidad de acuerdo a Nei (1978) e ndices de fijacin de acuerdo a
Wright (1921) por cada accesin de tomate de rbol........................................................... 46
Tabla 11. Aporte a la varianza total en el anlisis de componentes principales por
accesiones y loci en tomate de rbol. ................................................................................... 47

LISTA DE FIGURAS
pg.
Figura 1. Fruto de lulo (Solanum quitoense) Lam .............................................................. 14
Figura 2. Distribucin de Solanum quitoense en Amrica. Fuente:.................................... 15
Figura 3. Fruto del tomate de rbol (Solanum betaceum) Cav. Sendt. .............................. 17
Figura 4. Distribucin de Solanum betaceum en Amrica.................................................. 18
Figura 5. rbol filogentico mostrando el grupo Euasteridae y plantas de relevancia sobre
las cuales pueden ser implementados los marcadores COSII debido a su proximidad
filogentica........................................................................................................................... 26
Figura 6. Diseo de cebadores Universales para especies de Euasteride I (UPA) en un
grupo COS II. (A)Alineamiento mltiple de especies de Euasteride I y el correspondiente
ortlogo de Arabidopsis. (B) Los iUPAs por lo general amplifican secuencias intrnicas,
mientras que los eUPAs amplifican por lo menos 400 pb de secuencias exnicas con o sin
la intervencin de intrones. .................................................................................................. 27
Figura 7. Bandeja de 124 alveolos con semillas de lulo y tomate de rbol bajo condiciones
de invernadero...................................................................................................................... 30
Figura 8. A. Electroforesis en gel de agarosa al 1 %, visualizando el ADN en lulo. Se
relacionan los 3 ltimos nmeros de cada accesin. B. Electroforesis en gel de agarosa al 2
%, de productos de PCR en accesiones de lulo utilizando un marcador COS II. Se
relacionan los dos ltimos nmeros de cada accesin seguido por el nmero de planta
excepto para las accesiones terminadas en 03 y 028............................................................ 35
Figura 9. Valores acumulados de los 4 componentes principales en Lulo. ........................ 40
Figura 10. rbol consenso de lulo, elaborado a partir de un bootstrap de 10000
repeticiones, utilizando el mtodo de agrupamiento UPGMA. ........................................... 42
Figura 11. A. Electroforesis en gel de agarosa al 1 %, visualizando el ADN en tomate de
rbol. Se relacionan los 2 ltimos nmeros de cada accesin, seguido por el por el nmero
de planta. Se observa que el buffer de extraccin de Fulton et al fue mas apropiado que el
de Partill et al, 2001. B. Electroforesis en gel de agarosa al 2 %, de productos de PCR en
accesiones de tomate de rbol, utilizando 3 marcadores COS II, Se relaciona el ltimo
nmero de cada accesin...................................................................................................... 43
Figura 12. Valores acumulados de los 4 componentes principales en tomate de rbol...... 47
Figura 13. rbol consenso de tomate de rbol, elaborado a partir de un bootstrap de 10000
repeticiones, utilizando el mtodo de agrupamiento UPGMA. ........................................... 48

LISTA DE ANEXOS
pg.
Anexo 1. Accesiones de lulo usadas en el anlisis de diversidad........................................ 57
Anexo 2. Accesiones de tomate de rbol usadas en el anlisis de diversidad. ................... 58
Anexo 3. COSII identificados a partir de geles y secuencia analizados para la seleccin de
marcadores polimrficos en lulo y tomate de rbol. En negrita se relacionan los marcadores
polimrficos para cada especie. ........................................................................................... 59
Anexo 4. Estimacin de la concentracin y calidad del ADN de lulo, a travs de la lectura
de absorbancia de rayos UV (260/280 nm).......................................................................... 60
Anexo 5. Allo (s) presentes en cada accesin de lulo. A cada alelo observado por locus se
le dio una connotacin numrica.......................................................................................... 61
Anexo 6. ndices de diversidad de acuerdo a Nei (1978) e ndices de fijacin de acuerdo a
Wright (1921) por cada loci analizado en lulo..................................................................... 62
Anexo 7. Matriz de distancias gnicas en lulo utilizando la mnima distancia de Nei (1978).
Se relacionan los dos ltimos nmeros de cada accesin. ................................................... 63
Anexo 8. Distribucin espacial de los grupos conformados por las accesiones de lulo en
Colombia. ............................................................................................................................. 64
Anexo 9. Estimacin de la concentracin y calidad del ADN de tomate de rbol, a travs de
la lectura de absorbancia de rayos UV (260/280 nm). ......................................................... 65
Anexo 10. Allo (s) presentes en cada accesin de tomate de rbol. A cada allo observado
por locus se le dio una connotacin numrica. .................................................................... 66
Anexo 11. ndices de diversidad de acuerdo a Nei (1978) e ndices de fijacin de acuerdo a
Wright (1921) por cada loci analizado en tomate de rbol .................................................. 67
Anexo 12. Matriz de distancias gnicas en tomate de rbol utilizando la mnima distancia
de Nei (1978). Se relacionan los dos ltimos nmeros de cada accesin. ........................... 68
Anexo 13. Distribucin espacial de los grupos conformados por las accesiones de tomate de
rbol en Colombia. ............................................................................................................... 69

RESUMEN
Especies frutales de la familia solancea, provenientes de la zona andina, pueden llegar a
convertirse en productos prominentes de consumo nacional y de exportacin. Entre estas, se
destacan el lulo (Solanum quitoense) y el tomate de rbol (Solanum betaceum) (Lobo et al.,
2002). Estas especies representan alternativas productivas para los pequeos agricultores,
poseen un alto valor nutritivo, y pueden ser utilizadas para la conservacin y regeneracin
de ecosistemas de ladera (Lentini, 2003). Peso a esto, su adopcin como cultivo por parte
de agricultores locales, presenta limitantes relacionados con la falta de sustento
tecnolgico, asociado con una oferta casi nula de materiales mejorados. Estos aspectos,
aunados al poco conocimiento de la variabilidad gentica de estas especies, disminuyen las
posibilidades de un mejoramiento gentico eficiente. As, se hace necesario conocer y
complementar la variabilidad gentica para direccionar adecuada y eficientemente su
mejoramiento. El presente estudio pretende contribuir al conocimiento de la variabilidad
gentica de estas especies a travs del uso de marcadores provenientes de Secuencias
Ortlogas Conservadas (COSII) en 32 accesiones de lulo y taxa relacionados y 30
accesiones de tomate de rbol y taxa relacionados. De los 30 marcadores COSII evaluados
para cada especie se seleccionaron 6 para lulo y 5 para tomate de rbol, por su alto nivel de
polimorfismo, con un total de 47 y 39 alelos respectivamente, y un promedio de 7.8 alelos
por especie. Se observ estructura poblacional en cada especie con valores altos de
homocigosis dentro de las accesiones (FIS = 0.46 para lulo y 0.90 para tomate de rbol), y
una alta diferenciacin entre las mismas (FST = 0.93 para lulo y 0.99 para tomate de rbol).
Estos resultados se pueden explicar por las barreras geogrficas entre las accesiones, la
adaptacin a diferentes nichos, modo de reproduccin de las especies, y, el tipo de
marcadores utilizados. El anlisis de componentes principales (ACP) y de distancias
gnicas concuerda con la alta estructura poblacional ya que para ACP la variacin total fue
explicada por bajos porcentajes (32.55% y 35.94% para lulo y tomate de rbol,
respectivamente) y para distancias gnicas se observ un amplio rango de variabilidad entre
accesiones (0.1 1 para lulo y 0.2 1 para tomate de rbol) y agrupamientos con bajos
valores de confiabilidad (bootstrap).

10

INTRODUCCIN
Desde su origen, el ser humano ha domesticado las plantas segn sus necesidades y
posibilidades, convirtindolas en su principal fuente de sustento. Durante este proceso de
domesticacin, el hombre seleccion de manera gradual, caracteres de inters alimenticio
y emprendi, sin saberlo, un proceso microevolutivo que contina hoy. A travs de este
evento se manifiestan algunas de las especies de mayor importancia a nivel global,
destacndose en este, el grupo de las Solanceas, que tiene como foco de diversidad el
neotrpico.
Este grupo representa uno de los taxa de mayor inters econmico, ya que algunas de sus
especies como el lulo (Solanum quitoense) y el tomate de rbol (Solanum betaceum),
constituyen importantes fuentes de alimento y son reconocidas por su gran potencial de
desarrollo y aceptacin. Adems, figuran como una alternativa en la conservacin de
ecosistemas intervenidos y reemplazo de cultivos ilcitos.
Pese a esto, poco se conoce acerca de la variabilidad gentica de estas especies,
disminuyendo las posibilidades de un mejoramiento eficiente en cuanto a caracteres de
resistencia, calidad y produccin. Hasta el momento se han adelantado estudios que
utilizan descriptores morfoagronmicos en lulo (Giraldo, 2005) y tomate de rbol
(Garca et al., 2002) y moleculares como AFLPs en lulo (Fory et al., 2004; Fory 2005;
Charry 2005; Barrera 2006). Dado que los AFLPs son marcadores de tipo dominante, es
decir, no distinguen el homocigoto del heterocigoto, se hace necesario utilizar
marcadores ms informativos (codominantes) que permitan una interpretacin ms
precisa de su diversidad, la identificacin de hbridos intra e inter especficos, o asistan
ms eficientemente los procesos de introgresin gnica.
El presente estudio pretende utilizar marcadores codominantes que permitan
complementar la caracterizacin de la variabilidad gentica de las colecciones
colombianas de lulo y tomate de rbol, la cual se encuentra depositada en el banco de
germoplasma de CORPOICA y cuenta con 153 accesiones de lulo y taxa relacionados y
75 de tomate de rbol y taxa relacionados. De stas, se tomaron 32 accesiones de lulo y
30 accesiones de tomate de rbol y se estudi su variabilidad gentica mediante el uso de
marcadores COSII o Secuencias Ortlogas Conservadas. Los COSII corresponden a un
nuevo tipo de marcadores moleculares, adecuados para estudios de taxonoma,
diversidad, filogenia y genmica comparativa en especies de la familia Solancea y taxa
relacionados.

11

1. OBJETIVOS

1.1 Objetivo General


Estudiar la variabilidad molecular de 62 accesiones de la coleccin Colombiana de lulo y
tomate de rbol mediante el empleo de marcadores que provienen de Secuencias
Ortlogas Conservadas (COS II)

1.2 Objetivos Especficos


Identificar polimorfismos amplificados por marcadores COS II en 32 accesiones de lulo
para estudios de variabilidad molecular
Identificar polimorfismos amplificados por marcadores COS II en 30 accesiones de
tomate de rbol para estudios de variabilidad molecular
Estudiar la variabilidad molecular en germoplasma de lulo, tomate de rbol y taxa
relacionados mediante el empleo de marcadores COSII, con el fin de complementar
estudios previos y dirigir estudios futuros de conocimiento y uso del germoplasma

12

2. MARCO TERICO

2.1 SOLANCEAS
Las solanceas son una de las familias ms grandes de angiospermas, con 147 gneros y
2930 especies (Judd et al., 2002). Esta familia tiene una amplia distribucin mundial,
pero la concentracin ms grande de gneros y especies se encuentra en Sur y Centro
Amrica. Esto sugiere, que la familia se origin en esta parte del planeta, en la porcin
meridional de la Pangea denominada Gondwana (Hawkes, 1999), conformada por
Sudamrica, frica, Australia, India y la Antrtica. El centro de diversidad de este grupo
esta cerca al Ecuador, al acumular variaciones genticas adaptativas en diversos nichos
ecolgicos, durante las glaciaciones.
2.1.1 Descripcin. La familia comprende hierbas, arbustos o rboles, usualmente con
floema interno presente; diversas vellosidades, algunas veces con espinas. Las hojas son
alternas o espiraladas, frecuentemente en pares, simples, algunas veces profundamente
lobadas o incluso compuestas, enteras a aserradas, con venacin pinada, estpulas
ausentes. Inflorescencia generalmente terminal, algunas veces reducidas a una sola flor,
cimosas. Flores perfectas pequeas a muy grandes; cliz gamospalo; corola simptala,
rotada a tubular, (4)5(7) lbulos convolutos, imbricados o valvados; estambres
adheridos a la base del tubo de la corola, en igual nmero y alternos a los lbulos o
reducidos a anteras con dehiscencia longitudinal o por poros; ovario spero, bicarpelar,
generalmente bilocular, numerosos vulos en elaboradas placentas axilares; Fruto en
baya o cpsula (Judd et al., 2002).
2.1.2 Importancia. Las Solanceas han sido una de las familias ms importantes en el
abastecimiento de plantas tiles para la humanidad (Heiser, 1993). La mayora de sus
miembros son venenosos, debido a la presencia de tropano o alcaloides esteroides.
Tambin son fuente para la elaboracin de drogas y algunas poseen poderosos
narcticos, frutos comestibles y tiles en ornamentacin (Judd et al., 2002).

2.2 GENERALIDADES DEL LULO Y DEL TOMATE DE RBOL


El lulo y el tomate de rbol aparentemente son endmicos del norte de los Andes de
Colombia y Ecuador (Hawkes, 1999; Bohs, 2004; Giraldo, 2005), y junto con Per,
comprenden su centro primario de diversidad (Lobo 2000). Estos frutales se consideran
especies promisorias con un alto potencial de desarrollo, ya que por ser frutos exticos y
exclusivos de los andes, representan una alternativa productiva frente a las nuevas
tendencias del mercado.

13

2.2.1

Lulo (Solanum quitoense) Lam.

Figura 1. Fruto de lulo (Solanum quitoense) Lam


Fuente: Colombian Tropical Fruits www.ocati.com.

Tambin llamado Naranjilla (Heiser, 1993; Lentini 2003), Naranjillo entre otras (CCI,
2004), es una fruta tropical extica de clima fro moderado (Figura 1). En Colombia, las
variedades de lulo conocidas son la Septentrionale, que se caracteriza por tener espinas en
ramas y tallos y la Quitoense, conocida comercialmente como lulo de castilla (Ministerio
de Agricultura: Lulo, 2000).
2.2.1.1 Origen y distribucin. El lulo es originario de los bosques hmedos del
subtrpico, en las vertientes oriental y occidental de la cordillera de los Andes (Heiser,
1999). Actualmente este fruto se cultiva en Venezuela, Costa Rica, Ecuador, Nicaragua,
Panam, Per y Colombia (Figura 2), (International Plant Genetic Resources Institute,
2006). En este ltimo, los hbitats caractersticos del lulo generalmente estn en las
plantaciones marginales de caf en la zona cafetera (Eraso, 1991).

14

Figura 2. Distribucin de Solanum quitoense en Amrica. Fuente:


International Plant Genetic Resources Institute, 2006.

2.2.1.2 Clasificacin taxonmica. De acuerdo a la descripcin hecha por Shultes y


Cuatracasas (1953), el lulo se encuentra ubicado en el gnero Solanum en la seccin
Lasiocarpa. Los rangos taxonmicos como subfamilia y tribu, se fundamentan en estudios
de filogenia, basados a partir de secuencias de ADN de cloroplasto (Bohs & Olmstead,
1999; Bohs 2004), as como tambin, en observaciones morfolgicas, en el caso del
subgnero (Millar & Diggie, 2003).
Reino:
Sub-reino:
Superdivisin:
Divisin:
Clase:
Subclase:
Orden:
Familia:
Subfamilia:
Tribu:
Gnero:
Subgnero:

Plantae
Tracheobionta
Spermatophyta
Magnoliophyta
Magnoliopsida
Asteridae
Solanales
Solanaceae
Solanoideae
Solaneae
Solanum
Leptostemonum

15

Seccin:
Lasiocarpa
Especie:
Solanum quitoense
Fuente: United States Department of Agricultura. Natural Resourses Conservation plants
database, International Plant Genetic Resources Institute, 2006.
2.2.1.3 Importancia. El lulo es un fruto comestible con un atractivo sabor agridulce, que
aunados con su apariencia, fragancia, sabor nico (Heiser, 1993), facilidad de cultivo,
produccin continua y altos rendimientos, han permitido que se difunda a lo largo de Sur y
Centroamrica (Bernal et al., 1998). La pulpa de los frutos es utilizada en bebidas como
jugos y yogurt, adems en helados, jaleas y pasteles (Heiser, 1993; Giraldo, 2005:
International Plant Genetic Resources Institute, 2006). El fruto, tambin es rico en
vitaminas A y C (Heiser, 1993) y elementos que confieren propiedades antioxidantes
diurticas, tonificantes, regeneradoras de tejidos y purificadoras de sangre entre otras
(Giraldo, 2005; Ministerio de Agricultura y desarrollo Rural, 2000).
2.2.1.4 Produccin Nacional. En Colombia, el rea sembrada de lulo es de 5.750
hectreas y su produccin es 47.736 toneladas por ao (datos registrados en 2003). No
obstante la produccin anual no suple completamente la oferta del producto, por lo que se
debe importar grandes cantidades (3.935 toneladas, datos registrados en 2003), desde el
Ecuador (CCI 2005).
2.2.1.5 Cultivo. El lulo, se cultiva en diferentes pisos altitudinales, siendo su hbitat ms
caracterstico la zona cafetera. Este crece en forma espontnea en el sotobosque exhibiendo
hojas de gran tamao con ngulos de insercin hacia abajo, para captar la luz que pasa a
travs de los rboles (Lobo, 2000). Este, crece en suelos ricos en materia orgnica,
consumiendo mucho nitrgeno y calcio. Cualquier deficiencia de estos elementos conlleva
a una mayor sensibilidad hacia el ataque de patgenos o disminucin en la produccin
(Eraso, 1991). En la Tabla 1, se citan los principales parmetros agroecolgicos y
requerimientos edficos ptimos para el cultivo de este frutal.
Tabla 1. Parmetros agroecolgicos y requerimientos edficos del cultivo de lulo.

Clima
Altitud
Temperatura
Precipitacin
Humedad
Suelos

Parmetros agroecolgicos
Fro
1600 m. 2400 m.
16 C 24 C
1500 mm 3000 mm.
80% 100%
Requerimientos Edficos
Hmedos, ricos en materia
orgnica, bien drenados.

16

Acidez
Pendiente
Textura

5.4 6
30% - 40%
Media, Franco arcillosa o franco
arenosa.

Fuente: Eraso, 1991; Giraldo, 2005; Ministerio de Agricultura y Desarrollo Rural 2005.

2.2.2

Tomate de rbol (Solanum betaceum) Cav. Sendt.

Figura 3. Fruto del tomate de rbol (Solanum betaceum) Cav. Sendt.


Fuente: Colombian Tropical Fruits www.ocati.com.

Esta especie, representa para Colombia la tercera fruta de exportacin despus de la


uchuva y la granadilla (Figura 3). El pas produce dos tipos de variedades; el tomate de
rbol comn, que produce frutos de color amarillo-naranja y el tomate amarillo, que
produce frutos rojos. La produccin de este ltimo, est orientada hacia la exportacin
(Ministerio de Agricultura y Desarrollo Rural, 2000).
2.2.2.1 Origen y Distribucin. Algunos autores creen que el tomate de rbol est
estrechamente relacionado con un complejo de taxones bolivianos, de acuerdo con
evidencias moleculares, aunadas a estudios morfolgicos y datos de trabajo de campo,
por lo que se cree que el taxn se origin en dicha zona (Garca et al., 2002). As, el
posible centro de origen de esta especie, se localiza en reas boscosas del sur de Bolivia
y norte de Argentina, encontrndose adems, individuos silvestres en Per, Chile,
Ecuador y Colombia (Figura 4). Esta fruta se ha establecido en los andes suramericanos
en lugares ubicados desde 1800 hasta 3000 metros. (Bernal et al., 2003), y actualmente

17

se cultiva en reas subtropicales como Nueva Zelanda, Centroamrica y algunos pases


asiticos.

Figura 4. Distribucin de Solanum betaceum en Amrica.


Fuente: International Plant Genetic Resources Institute, 2006.

2.2.2.2 Clasificacin taxonmica. Anteriormente llamado Cyphomandra betacea, el


tomate de rbol ha sido retransferido a su nombre actual. La ubicacin de esta especie en
el sistema jerrquico vegetal, la sita en el gnero Solanum, al igual que el lulo, pero en
la seccin Pachyphyla.
Reino:
Sub-reino:
Superdivisin:
Divisin:
Clase:
Subclase:
Orden:
Familia:
Subfamilia:
Tribu:
Gnero:

Plantae
Tracheobionta
Spermatophyta
Magnoliophyta
Magnoliopsida
Asteridae
Solanales
Solanaceae
Solanoideae
Solaneae
Solanum

18

Subgnero:
Bassovia
Seccin:
Pachyphylla
Especie:
Solanum betaceum
Fuente: United States Department of Agriculture. Natural Resourses Conservation plants
database;
International
Plant
Genetic
Resources
Institute,
2006
(http://plants.usda.gov/java/name).
2.2.2.3 Importancia. El tomate de rbol se caracteriza por ser una fruta altamente
nutritiva, rica en vitaminas A y C y en minerales como calcio, hierro y fsforo, con bajos
niveles de caloras. Adems, posee un alto contenido de pepsina, pH cido y sabor
agridulce, factores que lo hacen atractivo para el procesamiento industrial (Ministerio de
Agricultura y Desarrollo Rural, 2000). Los frutos maduros enteros se utilizan en la
preparacin de bebidas alcohlicas y la pulpa es utilizada en jugos, helados, tortas, entre
otras (International Plant Genetic Resources Institute, 2006).
2.2.2.4 Produccin Nacional. Segn datos del Ministerio de Agricultura, en el ao
2003, el tomate de rbol particip con el 4,1 % de la produccin de frutas frescas sin
contar el banano. El rea sembrada de este frutal es de 7.686 hectreas y su produccin
es de 140.228 toneladas por ao (Ministerio de Agricultura y Desarrollo Rural, 2005).
2.2.2.5 Cultivo. La zona de concentracin del tomate de rbol, est en la regin cafetera
ya que posee un clima templado y una altura ideal para su cultivo. Adems, este frutal es
considerado en dicha zona como una alternativa en la diversificacin de reas de
amapola, siendo esta un rea ideal para su produccin (Ministerio de Agricultura y
Desarrollo Rural, 2005). En la Tabla 2 se citan los principales parmetros agroecolgicos
y requerimientos edficos ptimos para el cultivo de este frutal.
Tabla 2. Parmetros agroecolgicos ptimos en el cultivo de tomate de rbol.

Clima
Altitud
Temperatura
Precipitacin
Humedad
Suelos
Acidez
Pendiente

Parmetros agroecolgicos
Medio y Fro
2000 m. 2400 m.
9 C 20 C
1500 mm 3500 mm.
70% 80%
Requerimientos Edficos
Buen drenaje interno y externo
5.5 6.5
Hasta 70%

19

Textura

Media, Franco o franco arenosos

Fuente: Ministerio de Agricultura y Desarrollo Rural, 2005.


2.3 GENETICA DE POBLACIONES
2.3.1 Diversidad Gentica. La diversidad gentica es necesaria en las poblaciones para
enfrentar los diferentes cambios a los que estn expuestas. Esta se manifiesta por
diferencias, ya sean a nivel fenotpico o genotpico, y en esta ltima en variaciones a nivel
nucleotdico. As, estos cambios que a su vez producen diferencias en las secuencias
aminoacdicas y por ende variaciones proteicas, pueden resultar en cambios bioqumicos,
morfolgicos o de comportamiento que causan diferencias en la tasa reproductiva,
sobrevivencia o comportamiento individual (Frankham et al., 2004).
Dentro de especies, las diferencias interpoblacionales son bastantes variables. Estas
dependen de la especie, la biologa reproductiva, la diversidad ambiental y los rasgos
especficos de los genes a examinar. La diversidad gentica es tpicamente descrita usando
polimorfismos, promedios de heterocigocidad y diversidad allica (Frankham et al., 2004).
2.3.2 Medida de la variacin gentica. Uno de los principales objetivos de la gentica de
poblaciones, es describir la cantidad de variacin gentica en poblaciones y estudiar los
mecanismos del mantenimiento de dicha variacin (Nei 1987). La variacin gentica puede
ser medida en varios niveles y para tal propsito se recurre a tcnicas como las aloenzimas
o los microsatlites, que permiten medir la diversidad gentica a partir de loci polimrficos
por poblacin, el nmero efectivo de alelos por locus o el nmero de loci heterocigotos por
individuo (Frankham et al., 2004; Hamrick, 2003). Esta informacin, usualmente es
reportada en forma de frecuencias allicas y a partir de estas se puede determinar la
diversidad en cada locus estudiado, expresndola en trminos de heterocigocidad.
Usualmente un locus es llamado polimrfico cuando la frecuencia del alelo ms comn es
igual o menor a 0.99, siempre y cuando el tamao poblacional y el nmero de loci a
analizar sea una muestra representativa o grande (Nei, 1987).
La ms apropiada medida de la variacin gentica es el promedio de hetorocigosis o
diversidad gentica. Esta medida puede ser definida en trminos de frecuencias gnicas, as
la heterocigocidad para cada locus esta definida como:
m

H =1 ix
i =1

Donde m, es el numero de alelos, x, es la frecuencia del alelo i. El promedio de


heterocigocidad (H), es el promedio de la cuanta sobre todos los alelos (Nei 1987).

20

2.3.2.1 Estructura poblacional. La estructura poblacional, es de particular importancia


para la conservacin de los recursos genticos, ya que esta concierne con la forma en la
cual la variacin gentica es dividida entre y dentro de poblaciones (Hamrick, 2003). En
plantas, las caractersticas que podran influenciar la distribucin de la variacin gentica
incluiran:
El tamao efectivo poblacional, la distribucin geogrfica de la especie, el modo primario
de reproduccin, el sistema de cruzamiento, los mecanismos de dispersin de semillas,
factores que junto con el nivel de flujo gnico en algunas especies con poblaciones
fragmentadas, rpidamente conducen a homocigosis y a la perdida de fitness definido
como el nmero de descendientes frtiles que sobreviven a la edad reproductiva y se
reproducen (Hamrick, 2003, Frankham et al., 2004). Especies con pequeas poblaciones,
reproduccin vegetativa y limitada dispersin de polen y semillas, se espera que tuviesen
una variacin relativa baja dentro de las poblaciones y una variacin relativa alta entre
poblaciones (Hamrick, 2003).
2.3.2.2 Endogamia. Una causa del no cruzamiento aleatorio en la endogamia es el cruce
entre individuos cercanos. Este fenmeno ocurre en gran proporcin en especies de plantas
donde la fertilizacin se da por el polen de la misma flor o por el polen de otra flor en el
mismo individuo (Crow, 1986). El principal efecto de la endogamia en una poblacin, es el
incremento de la frecuencia de genotipos homocigotos, efecto visto generalmente en
plantas autgamas, dado que se no se observa un cambio de frecuencias allicas de
generacin en generacin (Nei, 1987; Hartl, 1998; Hartl & Clark, 1997; Crow, 1986).
No solo se considera que la endogamia puede alterar la composicin gentica en plantas
con autopolinizacin sino tambin, puede tener efectos sobre poblaciones naturales en
plantas con polinizacin cruzada. Los efectos detrimentales de la endogamia en dichas
poblaciones se denominan depresin de endogamia y se determinan a travs del coeficiente
de endogamia (Hartl, 1998). Segn esto, para poblaciones de polinizacin cruzada donde
generalmente no existe autopolinizacin, la endogamia representa efectos nocivos en su
estructura gentica poblacional, dada por la reduccin en la heterocigocidad debido a la
deriva gnica aleatoria (Nei, 1987; Hartl, 1988; Hartl & Clark, 1997).
2.3.2.3 ndices de fijacin. En 1926, Wrigth propuso un mtodo para medir las
desviaciones de las frecuencias genotpicas en una poblacin subdividida en trminos de 3
parmetros; FIS, FST y FIT, llamados frecuentemente ndices de fijacin o estadstica F (Nei,
1987).
En una poblacin subdividida, existen tres niveles diferentes de complejidad: Los
individuos (I), las subpoblaciones (S) y la poblacin total (T), los cuales a su vez presentan
sus propios niveles de heterocigosis: HI (heterocigosis observada de un individuo en una
poblacin); HS (heterocigosis esperada de un individuo en una subpoblacin con
apareamientos aleatorios) y HT (heterocigosis esperada de un individuo en la poblacin total

21

que se aparea aleatoriamente). Estos ndices pueden ser usados para medir el grado de
diferenciacin que ha ocurrido entre subpoblaciones (Hartl & Clark, 1997).
La diferenciacin entre estas, est directamente relacionada con los coeficientes de
endogamia, entre y dentro de poblaciones. La endogamia de una poblacin total (FIT) puede
ser dividida en endogamia de individuos con respecto a subpoblaciones (FIS), y endogamia
debido a la diferenciacin entre subpoblaciones relativo al total de la poblacin (FST)
(Frankham et al., 2004). Estos son descritos a partir de la siguiente formula:
1 - FIT = (1 - FIS) (1 - FST).
Nei (1977), demostr que los ndices de fijacin, pueden ser definidos usando las
heterocigocidades esperadas y observadas para la poblacin bajo investigacin (Nei 1987),
usando las siguientes ecuaciones:
FIS = 1- (HI/HS)
FST = 1- (Hs/HT)
FIT = 1- (HI/HT)
Donde HI es el promedio de la heterocigocidad observada en todas las subpoblaciones, HS
es el promedio de la heterocigocidad esperada en equilibrio de Hardy Weinberg, en todas
las subpoblaciones, y HT la heterocigicidad esperada en equilibrio de Hardy Weinberg,
para el total de la poblacin (Frankham et al., 2004).
As, FIS, es el coeficiente de endogamia, promediado a travs de todos los individuos de
toda la subpoblacin. FST, es el efecto de la divisin poblacional o endogamia. Con altos
porcentajes de flujo gnico entre subpoblaciones, el FST es bajo. Con bajos porcentajes de
flujo gnico entre subpoblaciones, la poblacin diverge y llega a ser endogmica,
incrementando los valores de FST (Frankham et al., 2004). As, los valores de FST entre
ciertos rangos, indican el nivel de diferenciacin gnica entre una poblacin:

El rango entre 0 y 0.05 es considerado como un indicativo de poca diferenciacin


gnica.
El rango entre 0.05 y 0.15 indica moderada diferenciacin gentica.
El rango entre 0.15 y 0.25 indica gran diferenciacin gentica.
Valores por encima de 0.25 indican una diferenciacin gnica muy grande.

Los valores de FST generalmente estn inversamente relacionados con la habilidad de


dispersin. Basados en datos de aloenzimas, estos promedian 0.25-0.3 para mamferos,
reptiles y anfibios, pero es ms bajo para peces (0.14), insectos (0.10) y son aun ms bajos
en aves (0.05). Los rangos de valores en plantas van desde 0.5 en especies autgamas hasta
0.1 en algamas. Generalmente los valores de FST por encima de 0.15 se consideran como
indicativos de diferenciacin significativa entre subpoblaciones (Frankham et al. 2004).

22

2.3.3 Distancias gnicas. La distancia gentica es la extensin de las diferencias gnicas


entre poblaciones o especies, medida por alguna cuanta numrica. As, el nmero de
sustituciones nucletidas o el nmero de sustituciones gnicas por locus es una medida de
distancia gnica. No obstante, histricamente se refiere a las diferencias gnicas como
medida, en funcin de las frecuencias gnicas. En la dcada de los 70, y despus de
mtodos realizados preliminarmente por Czekanowski en 1909, Pearson en 1926, Fisher
1936, Caballi-Forza y Edwars en 1964, entre otros, Nei (1971,1972), propuso una medida
de distancia gnica con la que se puede estimar el numero de genes o sustituciones de
codon por locus entre dos poblaciones. Usando dicha medida Nei, prob las relaciones de la
dinmica poblacional de las frecuencias gnicas a la sustituciones de codones en genes
(Nei, 1987).

2.4 MARCADORES MOLECULARES


Los primeros marcadores utilizados por el hombre fueron aquellos basados en una
caracterstica fenotpica hereditaria, controlada por genes, vistos a finales del siglo XIX y
comienzos del XX como entidades abstractas responsables de la transmisin de
caractersticas hereditarias del padre al descendiente. No obstante, dichos rasgos
fenotpicos a pesar de ser muy tiles, sesgaban los resultados de investigaciones realizadas
en esa poca ya que estos son influidos por el ambiente, el estado de desarrollo, entre otros
(Brown, 2002).
Con el descubrimiento de la doble hlice y a partir de estudios basados en su disposicin
nucleotdica, nace un nuevo tipo de marcadores, fcilmente detectables, no influidos por el
ambiente, a lo largo de un genoma. Surgen as, los marcadores moleculares, definidos
simplemente como sitios de algn tipo de variacin neutral del ADN (Griffiths, 1999). En
la actualidad, existen muchos tipos de marcadores, que son producidos por una amplia
variedad de tcnicas y usados en proyectos de diversidad, mapeo genmico y seleccin
asistida por marcadores. Los RFLPs (Polimorfismos de Longitud de Fragmentos de
Restriccin), RAPDs (ADN Polimrfico Amplificado Aleatoriamente), SSRs (Secuencias
Simples Repetidas), AFLPs (Polimorfismos de Longitud de Fragmentos Amplificados),
son los marcadores moleculares ms populares usados en estudios de diversidad y mapeo
gentico (tabla 1). Actualmente es comn el uso de marcadores ms potentes, basados en
secuencia como SNPs (Polimorfismos de un Solo Nucletido), INDELs (Inserciones o
Deleciones de secuencias de ADN) y ms recientemente los COS (Secuencias Ortlogas
Conservadas).

23

Tabla 3. Principales marcadores moleculares, utilizados actualmente en investigaciones tanto en


animales como en plantas.
Marcador
Tcnica

Abrevia tura

RFLP
No
basadas
en PCR

Basadas
en PCR

Uso

Nombre

Polimorfismos de
Longitud de
Fragmentos de
Restriccin

Estudios de
diversidad y
filogenia,
origen y
evolucin
Estudios de
identidad
gentica,
identificacin
de variedades
y cultivares
Estudios de
diversidad
gentica,
filogenia,
regulacin
gnica y
evolucin.

Ventaja

Moderadamente
polimrficos,
especificidad de
locus, codominantes
y alta
reproducibilidad

Desventaja
Requiere
grandes
cantidades de
ADN, pocos loci
detectados por
ensayo,
procedimientos
laboriosos y
exigentes
Requiere
grandes
cantidades de
ADN y
procedimientos
laboriosos

VNTR

Repeticiones en
Tandem de
Numero Variable

SSR

Secuencias
Simples Repetidas

SCAR

Secuencia
Caracterizada de
Regin
Amplificada

Mapeo de
genes y
seleccin
asistida

Rpido, fcil de
utilizar, baja cantidad
de ADN, alta
reproducibilidad

Se necesita
conocer la
secuencia en el
diseo de
primers

CAPS

Secuencia
Polimrfica
Amplificada
Cortada con
Enzimas

Mapeo de
genes

Codominancia, baja
cantidad de ADN y
alta reproducibilidad

Requiere anlisis
con enzimas

Alto polimorfismo y
reproducibilidad

Se encuentran a lo
largo del genoma,
alta especificidad,
codominantes

Alto Costo para


su generacin

Cadena simple con


Conformacin
Polimrfica

Deteccin de
mutaciones en
genes

Alelos codominantes
y se requiere baja
cantidad de ADN

Procedimientos
laboriosos y
conocimiento de
secuencias para
elaborar los
primers

RAPD

ADN Polimrfico
Amplificado
Aleatoriamente

Diversidad
gentica,
caracterizacin
de
germoplasma,
estructura
gentica de
poblaciones

Alto numero de
fragmentos, requiere
poca cantidad de
ADN, procedimiento
rpido

Baja
reproducibilidad

ISSR

Secuencias Inter-

Estudios de

Bajas cantidades de

Al ser multiloci,

SSCP

24

Simples Repetidas

AFLP

Polimorfismos de
Longitud de
Fragmentos
Amplificados

identidad
gentica,
familiar,
taxonmicos

Identidad
gnica y
familiar,
estudios de
filogenia y
mapeo de
genes

ADN, distribucin
aleatoria a travs del
genoma, no se
requiere conocer la
secuencia para
elaborar los
cebadores
Alta abundancia
genmica y
reproducibilidad,
amplia gama de usos,
no se requiere
conocer la secuencia
en la elaboracin de
primers

puede haber una


no homologa
entre fragmentos
similares, baja
reproducibilidad
Se necesita
ADN de buena
calidad - alto
peso molecular,
por el alto
numero de
bandas es
necesario tomar
criterios
subjetivos

Fuente: Spooner et al., 2005.


2.4.1 Marcadores COS I. En la ltima dcada, se han obtenido mapas de ligamiento
gnico utilizando herramientas de genmica comparativa, en especies econmicamente
importantes como las pertenecientes a las Poceas, Leguminosas, Brasicceas, Gramneas
y Solanceas, a travs de un sistema comn de genes ortlogos. Este, se basa en la
identificacin de secuencias altamente conservadas a travs de la evolucin, utilizando
como referencia el genoma de Arabidopsis (Fulton et al., 2002).
Una de estas herramientas son los marcadores COS, los cuales son marcadores universales
que han permanecido estables durante el curso de la especiacin, y pueden ser utilizados
para estudios de genmica comparativa y filogenia entre genomas altamente divergentes
como el tomate y Arabidopsis (Fulton et al., 2002). El primer conjunto de COS (COSI)
esta basado en RFLPs de secuencias de ADN conservadas entre tomate y Arabidopsis
(Fulton et al., 2002).
2.4.2 Marcadores COS II. Los COS II representan un juego de genes ortlogos, de
copia nica y altamente conservados entre diferentes especies de dicotiledneas
estudiadas. Los COSII son marcadores basados en PCR y han sido desarrollados a partir
de exones de unigenes conservados en diferentes especies de la familia Solancea, grupo
Euasteridae como tomate, papa, pimentn, caf (Wu et al. 2006, Figura 5).

25

Figura 5. rbol filogentico mostrando el grupo Euasteridae y plantas de relevancia sobre las
cuales pueden ser implementados los marcadores COSII debido a su proximidad filogentica.
Tomado de Wu et al,. 2006.

Para propsitos prcticos, cada gen COS II, est referido en un locus correspondiente en
Arabidopsis y con base en esto, los cebadores se disean a partir de exones conservados y
amplifican secuencias intrnicas y/o exnicas.
Los COSII poseen ventajas respecto a los COS I, ya que debido a que son basados en PCR
los resultados se pueden visualizar en un tiempo ms corto y pueden ser utilizados para
evaluaciones a gran escala high throughput. Dado su carcter conservado en diferentes
especies de la familia Solancea y especies relacionadas, los marcadores COS constituyen
herramientas tiles para la construccin de mapas genticos comparativos y para la
identificacin de loci conservados de importancia econmica (QTLs).
Los COS II poseen caractersticas que los diferencian de los COSI, tales como:
El mtodo utilizado para establecer ortologa entre las diferentes especies
seleccionadas como el tomate, papa, pimentn y caf, fue ms exhaustivo.
Los anlisis filogenticos soportan su clasificacin como ortlogos.
Se presentan como genes de una sola copia en estas especies.
El diseo de cebadores universales, pueden amplificar contrapartes ortlogas (exones
y/o intrones) de otras especies de solanceas relacionadas (Wu et al., 2006).
En general, los marcadores COS II, constituyen una herramienta que establece redes de
sintenia en especies de Euasteride I (tomate, papa, tabaco, caf, oliva) y dicotiledneas
relacionadas. Adems, representan un valioso apoyo en estudios de filogenia, taxonoma,
diversidad, evolucin y organizacin del genoma en las Solanceas (Wu et al., 2006;
http://www.sgn.cornell.edu/markers/cosii_markers.html).

26

2.4.2.1 Elaboracin de cebadores Universales COS II. Los cebadores universales para
especies del clado Euasteride I (UPA), fueron diseados a partir de una secuencia consenso
de un grupo de genes COS II (Figura 6), los cuales amplificaban tanto regiones intrnicas
(iUPA) como exnicas (eUPA) en la mayora, si no en todas las especies de Solanceas y
taxa relacionados analizados (Wu et al., 2006). Actualmente, se encuentran disponibles
cerca de 2869 genes COSII (http://www.sgn.cornell.edu/markers/cosii_markers.html).

Figura 6. Diseo de cebadores Universales para especies de Euasteride I (UPA) en un grupo


COS II. (A)Alineamiento mltiple de especies de Euasteride I y el correspondiente ortlogo de
Arabidopsis. (B) Los iUPAs por lo general amplifican secuencias intrnicas, mientras que los
eUPAs amplifican por lo menos 400 pb de secuencias exnicas con o sin la intervencin de
intrones. Fuente: Wu et al., 2006.

2.4.2.2 Ventajas de utilizar COS II en lulo y tomate de rbol.


1. Es una alternativa econmica de disponibilidad de marcadores codominantes ya que la
generacin de estos usualmente requiere un alto costo como el caso de los SSRs
2. Los COSII son generados por un laboratorio de alta reputacin a nivel mundial
(Steven D. Tanksley, Universidad de Cornell, www.sgn.cornell.edu), quien provee
directamente estas secuencias como parte de un proyecto internacional colaborativo con
la directora de este proyecto.
3. Los COSII estn distribuidos en los 12 cromosomas del tomate (Lycopersicon
esculentum). Su uso en especies con poco o ningn desarrollo genmico como el lulo y
el tomate de rbol facilitar la ubicacin de cromosomas y QTLs de importancia
econmica como apoyo a programas de mejoramiento gentico.

27

2.5 CONOCIMIENTO Y USO DE LA VARIABILIDAD GENTICA DE


COLECCIONES DE GERMOPLASMA.
Las colecciones de germoplasma preservan ejemplares vegetales in- situ o ex-situ,
albergando los recursos genticos vegetales de una Nacin o una determinada zona
biogeogrfica. En Colombia, Corpoica maneja el banco de germoplasma del estado
Colombiano, el cual contiene colecciones Colombianas de lulo y de tomate de rbol,
entre otras especies de inters. Esta entidad posee 153 accesiones de lulo y 75 de tomate
de rbol (M, Lobo., comunicacin personal). En estas colecciones se requiere llevar a
cabo estudios controlados para entender la importancia y el valor de estos recursos
genticos para su conservacin y uso (Bentez et al., 1991).
2.5.1 Estado actual de la investigacin en lulo y tomate de rbol. La investigacin
en lulo y tomate de rbol, se ha enfocado en la bsqueda de soluciones a las limitantes
que impiden la masificacin y produccin de estos cultivos, y al estudio de su diversidad
y taxa relacionados.
En lulo se han realizado estudios de caracterizacin morfolgica que utilizan variables
cualitativas y cuantitativas, para determinar el grado de polimorfismo entre la especie y
especies relacionadas, contribuyendo as al conocimiento de la variabilidad gentica
(Giraldo, 2005). Complementando los estudios basados a partir del fenotipo de la
especie, se han realizado estudios de variabilidad gentica, desde un enfoque genotpico,
que evalan el grado de polimorfismo de la especie, usando marcadores AFLP (Fory et
al., 2004; Fory 2005; Charry, 2005; Barrera, 2006). A partir de los estudios fenotpicos,
se ha encontrado una posible resistencia a P. infestans en accesiones de la especie
relacionada Solanum hirtum (Lobo et al., 2002). En cuanto a investigaciones en el campo
del mejoramiento gentico, Lobo y Navarro en 1983, entregaron el primer material
mejorado proveniente de un trabajo de hibridacin interespecfica entre Solanum
quitoense y S. hirtum, el cual le permite aumentar la capacidad de rendimiento, periodo
productivo y resistencia al nematodo formador de los nudos radculares (Bernal et al.,
1998).
En tomate de rbol se han realizado estudios de variabilidad morfolgica cualitativa de
una parte de la coleccin Colombiana de esta especie, mediante la aplicacin de
descriptores morfolgicos, encontrando una amplia variabilidad entre estas (Garca et al.,
2002). Adems, se han obtenido hbridos interespecficos entre S. betaceum y S. uniloba,
los cuales se clonaron y se evaluaron en zonas productivas, buscando una posible fuente
de resistencia a la antracnosis, presente S. uniloba (Lobo et al., 2002; Bernal et al.,
2003).
En cuanto a la caracterizacin molecular en lulo y tomate de rbol usando marcadores
COS II, Olarte et al. (2006) y Barrero et al., (comunicacin personal) realizaron
evaluaciones tanto en Corpoica como en la Universidad de Cornell con 460 cebadores
COSII distribuidos en los 12 cromosomas de tomate en diferentes accesiones de lulo y

28

tomate de rbol. Se obtuvo una amplificacin por PCR del 84.4% y 76.5%,
respectivamente, en cada especie, lo cual sugiere una alta homologa de genes COSII en
especies solanceas.

29

3. MATERIALES Y MTODOS

3.1 Localizacin
El trabajo se llev a cabo en el Laboratorio de Gentica Molecular Vegetal del Centro de
Biotecnologa y Bioindustria (CBB), de la Corporacin Colombiana de Investigacin
CORPOICA, sede Tibaitat, ubicada en el municipio de Mosquera, Cundinamarca.
3.2 Material Biolgico
El material biolgico, representa 30 accesiones de lulo y 2 taxa relacionados y 26
accesiones de tomate de rbol y 4 taxa relacionados, de la Coleccin Colombiana
manejada por CORPOICA seleccionados con base en su distribucin geogrfica y
atributos morfoagrnomicos con la asesora del curador y genetista de la coleccin en
CORPOICA, Dr. Mario Lobo (Anexos 1 y 2).
3.3 Siembra de semillas
Se tomaron 15 semillas por accesin, las cuales fueron tratadas con KNO3 al 2% durante
12 horas con el fin de estimular su germinacin. Posteriormente, se trasfirieron a bandejas
de 126 alveolos con turba autoclavada, previamente desinfectadas con hipoclorito de sodio
al 5%. En las bandejas, se sembr cada accesin con 5 repeticiones y 3 semillas por
repeticin. Las bandejas con las semillas fueron mantenidas en condiciones de
temperatura (25oC) luminosidad (12 horas luz, 12 horas oscuridad) constantes (Figura 7).
Para asegurar el xito de germinacin de semillas, la siembra se llev a cabo por
duplicado en dos ambientes. Uno de ellos corresponde a CORPOICA C.I. La Selva en
Rionegro, Antioquia y el otro en CORPOICA C.I. Tibaitat, Mosquera, Cundinamarca.

Figura 7. Bandeja de 124 alveolos con semillas de lulo y tomate de rbol bajo condiciones de
invernadero.

30

3.4 Extraccin de ADN


Se utiliz el protocolo modificado por Fulton et al. (1995), con algunos cambios. Se
tomaron aproximadamente 2 gramos de hoja joven y se maceraron con 1 mL de buffer de
extraccin general (Tabla 4). Posteriormente, la muestra se incub a 65C durante 1 hora.
Se realiz un lavado con 1 volumen de cloroformo-isoamlico (24:1) y se centrifug a
1000 rpm durante 5 minutos. Se extrajo la fase acuosa y se precit el ADN con 700 L
de isopropanol, descartando el sobrenadante y lavando el precipitado con 500 L de
etanol al 70%. El precipitado se sec y se diluy en 100L de buffer TE. Se adiciono
4L de RNAsa a la solucin y se llev a incubadora durante 20 minutos a 37C. La
muestra se almacen posteriormente a -70C.
Tabla 4. Composicin del buffer de extraccin general de ADN.
Buffer de Extraccin
General
Buffer de lisis celular

Buffer de lisis Nucleica


N-Lauril sarcosina
Bisulfito de sodio

Composicin

Concentracin Final

Sorbitol
Tris - HCL
EDTA
Tris - HCL
EDTA
NaCl
CTAB
-

6.4%
0.1M
0.005M
0.2 M
0.05M
4M
20%
5%
0.2%

As, se aisl el ADN de 5 individuos por accesin en cada especie y posteriormente se


formaron pools para cada una de las accesiones. Para verificar y cuantificar la calidad
del ADN, se corri la muestra extrada en gel de agarosa al 1%. Adicionalmente, se
utiliz espectrofotometra UV 260/280. En este caso, la calidad y cantidad de ADN se
estim de acuerdo con Sambrook & Russell (2001).
3.5 Amplificacin de ADN
Las condiciones de PCR para cada una de los marcadores COS II seleccionados, se
optimizaron para un volumen final por reaccin de 25 L, modificando las
concentraciones de cebadores y ADN (Tabla 5), a partir del protocolo de Wu et al.,
(2006).

31

Tabla 5. Condiciones de PCR para marcadores COS II utilizadas en este estudio.


Reactivo
Buffer PCR
MgCl2
dNTPs
Primer
F
R
Taq
ADN

Concentracin
1X
1.5 mM
0.2 mM
0.1 M
0.1 M
1u
25 g/mL

3.6 Identificacin de polimorfismos


Inicialmente, se escogieron 10 accesiones de lulo y 10 accesiones de tomate de rbol,
abriendo el pool en cada una de estas, para verificar los polimorfismos dentro de
accesiones. Se identificaron 30 pares de cebadores COS II, seleccionados a partir de la
informacin de geles y de secuencia generada por Barrero y Olarte (comunicacin
personal, Anexo 3).
Para las dos especies, se seleccionaron los marcadores COS II que permitieron discriminar
individuos entre y/o dentro de accesiones. Esta seleccin se bas en dos criterios; la
presencia de InDels, inserciones o deleciones mayores o iguales a 20 pares de bases, en la
cual el polimorfismo se poda detectar directamente en gel de agarosa, y, la presencia de
SNPs, polimorfismos de un solo nucletido, los cuales se convirtieron a marcadores
CAPs. En este ultimo caso, los SNPs fueron visualizados en geles de agarosa a travs del
uso de enzimas de restriccin que cortan el sitio polimrfico. Se recurri a este ltimo, en
casos en donde los productos de amplificacin por PCR eran monomrficos.
A partir de esta seleccin, se corrieron los marcadores COS II polimrficos, en pools de
todas las accesiones de cada especie, y se visualizaron en geles de agarosa al 2%, con
tincin de Bromuro de Etdio.
3.7 Anlisis de datos
A partir del patrn de bandeo obtenido para cada accesin, se realiz una matriz de datos
brutos de accesiones versus loci, para marcadores codominantes. Los datos se analizaron
para los ndices de diversidad por locus y accesin utilizando el coeficiente de Nei (1978),
los ndices de fijacin utilizando el coeficiente de Wright (1921), y, el anlisis de
componentes principales (PCA). Estos anlisis fueron obtenidos utilizando el programa
Genetix 4.03 versin 5 (Belkhir et al.).
Para calcular las distancias gnicas entre las diferentes accesiones se utiliz el coeficiente
de Nei (1978), el cual es adecuado para marcadores codominantes. Se obtuvo una matriz de
frecuencias allicas para cada especie a partir del programa Genetix 4.03 versin 5 (Belkhir

32

et al.). Se utiliz el mtodo de la media aritmtica no ponderada (UPGMA) para realizar los
agrupamientos. El soporte estadstico del rbol consenso se realizo mediante
Bootstraping de 10000 repeticiones, utilizando los programas Gendist (Nei, 1978),
UPGMA, Seqboot y Consense del paquete PHYLIP 3.5 (Felsenstein, 1989).

33

4. RESULTADOS Y DISCUSIN

Este es el primer estudio de diversidad a nivel molecular utilizando marcadores COS II en


lulo y tomate de rbol, y el primero en utilizar marcadores moleculares en tomate de rbol
en Colombia. A nivel mundial dos grupos estn utilizando estos marcadores en estudios de
diversidad en tomate (Sheffer et al., 2006; Labate et al., 2006) y en papa (Bonierbale M.,
CIP, comunicacin personal).

4.1 Premisas del estudio


Antes de iniciar con los anlisis de diversidad gentica es importante destacar las siguientes
premisas:
1. Se asume que cada marcador COSII representa un locus. En realidad, cada marcador
COSII es el producto de amplificacin de una regin que hace parte de un gen (Figura 6,
Wu et al. 2006).
2. Dada la naturaleza novedosa de los marcadores COSII para anlisis de diversidad, se
trabaj inicialmente con una muestra pequea, lo cual permitir realizar ajustes en anlisis
futuros. Por esto, el tamao poblacional utilizado en el estudio fue bajo, factor que puede
ocasionar un sesgo en la estimacin de la diversidad gentica (Nei, 1987). No obstante, se
analizan los datos obtenidos asumiendo dicha condicin.
3. A lo largo del anlisis se hace la comparacin con SSRs, dado que COSII y SSRs
presentan varias caractersticas similares: Son de naturaleza multiallica, codominante,
pueden presentar alelos nulos, y son basados en InDels. Los COSII tambin son basados en
SNPs; sin embargo, en este estudio se encontraron polimorfismos tipo InDels.
A continuacin se relacionan los resultados obtenidos por especie.

4.2 LULO

4.2.1 Extraccin de ADN.


El protocolo para extraccin de ADN descrito por Fulton et al. (1995), modificado en este
estudio, permiti obtener un ADN de buena calidad y concentracin en lulo (Figura 8A,
Anexo 4). Estos resultados son corroborados con los productos de PCR obtenidos (Figura
8B).

34

A.

B.

Figura 8. A. Electroforesis en gel de agarosa al 1 %, visualizando el ADN en lulo. Se relacionan


los 3 ltimos nmeros de cada accesin. B. Electroforesis en gel de agarosa al 2 %, de productos
de PCR en accesiones de lulo utilizando un marcador COS II. Se relacionan los dos ltimos
nmeros de cada accesin seguido por el nmero de planta excepto para las accesiones terminadas
en 03 y 028.

4.2.2 Deteccin de Loci polimrficos.


De la prueba preliminar donde se trabaj con 10 accesiones de lulo y los 5 individuos de
cada una de estas, se obtuvo un patrn de bandeo polimrfico con 6 de los 30 marcadores
seleccionados para lulo. Estos, se encuentran distribuidos en 4 de los 12 cromosomas y
amplifican secuencias intrnicas (iUPAs). (Tabla 6).

35

El nmero de marcadores polimrficos encontrados en el presente estudio est por encima


de lo reportado en varios estudios de diversidad con SSRs en plantas.
Por ejemplo, solo 3 marcadores polimrficos de 67 utilizados se encontraron en man,
(Moretzsohn et al., 2004), 3 de 27 marcadores utilizados se encontraron en papa (Bornet et
al., 2002), 18 de 156 en la misma especie (Ghislain et al., 2004). Estos estudios reportaron
altos niveles de variabilidad entre las accesiones estudiadas a pesar del bajo nmero de
marcadores utilizados.

4.2.3 Diversidad gentica.


Un total de 47 alelos fueron detectados a lo largo de las 32 accesiones de lulo y especies
relacionadas, con promedio de 7.8 alelos por locus (Tabla 6). El locus C2_At4g37280
present el mayor nmero de alelos (15) y el locus C2_At4g38810 present el menor
nmero de alelos (4) (Tabla 6). El tipo de polimorfismo observado en los 6 loci fue InDels
(Tabla 6).
Estudios realizados con SSRs en especies como el caf reportan un promedio de 4 alelos
por locus para genotipos diploides (Moncada & McCouch, 2004), en trigo, 3.3 alelos por
locus (Dreisigacker et al., 2004), en la misma especie, 6.8 alelos por locus (Bandopadhyay
et al., 2004), y en el tomate comn, 2.7 alelos por locus (He et al., 2003), y coco 4.4 alelos
por locus (Meerow et al., 2003). Teniendo en cuenta que el lulo es una especie algama y
que tambin puede presentar autopolinizacin al ser una especie con andromonoecia
(Miller & Diggle, 2003), los resultados indican que los COS II poseen una buena capacidad
para detectar diferentes formas de alelos.
Con respecto a los ndices de diversidad, para el caso de accesiones, los ndices de
heterocigocidad observado (Hi) y esperado (Hs) fueron bajos en general, oscilando entre 00.23 y 0-0.30, respectivamente (Tabla 7). Diez y ocho accesiones presentaron valores
iguales a 0, indicando que estas son homocigotas para los loci estudiados (Tabla 7, Anexo
5). Para el caso de loci, el ndice Hi en cada uno present valores bajos con un rango de 00.142 y el ndice Hs present valores altos con un rango de 0.18-0.90 (Anexo 6).

36

Tabla 6. Caractersticas de los loci polimrficos para lulo.

Nmero
de
Alelos
10

Rango de
peso en
lulo (pb)
743-1594

Tipo de
polimorfismo
(InDel/Caps )
InDel

iUPA

544-675

InDel

TGGGGTTGGATGGAGTGGAAAG
AGTAGAGGTTACGAATTTCCTCTGC

iUPA

400-548

InDel

TCGATCTCCTCTTTCATGGCG
TTGAGGaCAATAcGAaCAATCTTC
AGGTgATGGACGGTTCAGATATAATG
AACtTCTTTAAAcTCagTCTTGCTTAC

iUPA

943-1067

InDel

iUPA

1679-1898

InDel

AAGAAgCAACTgGttGATGATTGGG
TCCTTtTTgGatCgGTAttCAAGGTA

iUPA

15

758-968

InDel

Primers (5-3)*

Tipo1

Crom.1

C2_At5g66530

ttCAGGaATGgCATTTGCAAGTGTG
aCCATTGAATACAGCATCTGGTCGAAC

iUPA

C2_At2g34470

TTgAGGGAaAAaTACAGTCTTGC
AagAACTCtCCATCtTCTTTCGTG

C2_At3g17040

C2_At2g43360

Locus

C2_At4g38810
C2_At4g37280

Promedio:
7.8
Total:
47
1

Datos obtenidos de la localizacin y anlisis de marcadores COS II en el genoma del tomate (Feinan et al., 2006, www.sgn.cornell.edu).
Datos obtenidos de la pagina www.arabidopsis.org/servlets/TairObject

37

Funcin
del gen2
Protena
de
la
familia aldosa 1epimerasa.
Protena accesorio
de
la
ureasa
(UREG).
Procesamiento de
ARN, regulacin de
la
traduccin,,
organizacin
y
biognesis
de
plastidos
Actividad biotina
sintetasa
Protena
de
la
familia de unin a
Calcio EF
Protena
de
la
familia
de
ensamblaje
de
cromatina MRG

Referencias

Witte, et al.,
2005.
Sane at al.,
2005

Arnal et al.,
2006

Tabla 7. ndices de diversidad de acuerdo a Nei (1978) e ndices de fijacin de acuerdo a


Wright (1921) por cada accesin de lulo.

Accesin

HI1

HS2

H2

P(0.99)

Promedio
de
alelos/locus

FIS4

FIT5

FST6

06L089

0.03

0.30

0.33

0.50

0.34

0.96

0.94

06L080
06L090
06L063
06L061
06L068
05T1688028
06L093
06L054
06L075
06L069
06L070
06L081
06L094
06L053
06L062
06L064
06L066
06L071
06L072
06L074
06L078
06L082
06L084
06L085
06L088
06L091
06L095
06L097
06L098
06L099
04T14203

0.10
0.10
0.23
0.03
0.10
0.17
0.0
0.03
0.0
0.03
0.03
0.03
0.03
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0

0.25
0.21
0.16
0.08
0.08
0.08
0.08
0.08
0.05
0.03
0.03
0.03
0.03
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0

0.27
0.23
0.18
0.09
0.09
0.09
0.09
0.09
0.06
0.03
0.03
0.03
0.03
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0

0.50
0.33
0.33
0.33
0.33
0.17
0.17
0.17
0.17
0.17
0.17
0.17
0.17
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0

2
2
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1

0.66
0.40
0.46
0.41
0.60
0.51
0.40
0.41
0.41
0.42
0.42
0.42
0.42
0.41
0.41
0.41
0.41
0.41
0.41
0.41
0.41
0.41
0.41
0.41
0.41
0.41
0.41
0.41
0.41
0.41
0.41

0.96
0.96
0.97
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.96
0.95
0.96
0.96
0.96
0.96
0.96
0.96
0.95
0.96
0.96

0.94
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.93
0.92
0.93
0.92
0.93
0.93
0.93
0.93
0.92
0.93
0.92

0.46

0.93

0.93

Promedio
1

Heterocigocidad observada, 2Heterocigocidad esperada, 3Indice de diversidad, 4Coeficiente de


endogamia, 5Coeficiente de endogamia total, 6Indice de fijacin subpoblacional

Hartl (1988), adjudica este tipo de resultados al alto ndice de endogamia dentro de
subpoblaciones y al bajo flujo gnico entre las mismas. Esto es consistente con la baja

38

diversidad (H) dentro de subpoblaciones (accesiones) con un rango de 0 - 0.33 (Tabla 7)


y la alta diversidad por locus con un rango de 0.84 - 1.0 (Anexo 8).
4.2.4 Estructura poblacional.
Los individuos dentro de una poblacin y a su vez las poblaciones dentro una especie
difieren en su composicin gentica. La cantidad de diferenciacin entre poblaciones
es relativa a la distancia entre ellas y a su ubicacin geogrfica (Crow, 1986). Las
estimaciones de las diferencias genticas entre las subpoblaciones y la poblacin de
lulo estudiada, estn descritas a travs de los ndices de fijacin (Tabla 7).
Los ndices FIT y FST presentan un promedio por accesin de 0.93 cada uno, y por locus
de 0.95 y 0.92, respectivamente, indicando estructura poblacional, con muy baja
uniformidad en las frecuencias allicas y muy alta diferenciacin gentica entre las
subpoblaciones que integran la poblacin de lulo analizada. Esto corrobora los
resultados de los ndices de diversidad para accesiones y loci (Tabla.7, Anexo 6).
La alta diferenciacin gentica entre subpoblaciones (FST) puede estar relacionada con
la distribucin geogrfica de lulo en el pas. Colombia, por ser uno de los centros de
origen del lulo y a su vez por estar ubicada en la zona andina, posee diversos nichos
ecolgicos apropiados para esta especie (Lobo 2000). El lulo crece en un amplio rango
de pisos trmicos, entre 1500 a 3000 msnm. (Ministerio de Agricultura y Desarrollo
Rural 2005) y zonas geogrficas, ideales para el establecimiento de diferentes nichos
separados entre si por barreras geogrficas, lo que permite la diversificacin de la
especie. As, las barreras geogrficas acompaadas de condiciones ambientales
diferentes (clima, suelo, entre otros), impiden el flujo gnico y acumulan variaciones
genticas adaptativas en los diversos nichos ecolgicos, lo cual puede contribuir a las
diferencias en frecuencias allicas entre poblaciones.
El valor promedio FIS (0.46 y 0.47, para accesiones y para loci, respectivamente)(Tabla
7, Anexo 6), indica una baja heterocigocis dentro de las accesiones que conforman la
coleccin de lulo. As, de acuerdo a Nei (1987) cumplen con la propiedad de Wahlund.
Segn este principio, cuando las poblaciones estn divididas en muchas subpoblaciones,
la frecuencia de homocigotos dentro de una subpoblacin tiende a ser ms alta que la de
la proporcin de Hardy Weinberg. El valor FIS puede estar relacionado con la
autopolinizacin de la especie y su adaptacin a nichos especficos. El lulo es una
especie algama pero tambin puede presentar andromonoecia (presencia de flores
estaminadas y hermafroditas) y autopolinizarse. La andromonoecia constituye un rasgo
caracterstico del genero Solanum y de la seccin Lasiocarpa (Miller & Diggle, 2003;
Hokche & Ramrez, 2006).
En general, los valores FST y FIS se explican por la tendencia a la fijacin de alelos
diferentes (InDels en diferentes regiones de cada locus) en las accesiones analizadas
(Tabla 7, Anexo 5 y 6). Adems de las barreras geogrficas, adaptacin a diferentes
nichos, y modo de reproduccin de la especie, el tipo de marcadores utilizados podran
tambin estar contribuyendo a estos valores por dos razones. Primero, los COS II,
amplifican regiones de genes conservados durante la evolucin (ortlogos), lo cual
implica que pueden estar influenciados por presiones selectivas. Esto se refleja en el

39

hecho que los 6 marcadores analizados han sido asignados por estudios de homologa
con Arabidopsis como genes que codifican para diferentes protenas que participan en
rutas
metablicas
intracelulares
de
plantas
(Tabla
6,
http://www.sgn.cornell.edu/search/direct_search.pl?search=markers). En este estudio se
utilizaron regiones iUPA que amplifican intrones (Tabla 6), los cuales en principio no
son influidos por presiones selectivas; sin embargo, los iUPA pueden tambin
amplificar regiones exnicas que si estaran influenciadas por estas presiones. Segundo,
en 3 de los COSII utilizados se evidenci la presencia de alelos nulos, visualizados
como la no amplificacin del producto de PCR. Estos pueden ser debidos a mutaciones
en el sitio de alineamiento del cebador, a la presencia de grandes intrones o a problemas
inherentes a la reaccin de PCR. Los alelos nulos producen una baja estimacin de
heterocigotos debido a que no permiten su deteccin, lo cual puede contribuir a los altos
ndices de fijacin de alelos dentro de subpoblaciones y diferenciacin entre las mismas.
La presencia de alelos nulos se ha reportado tambin para SSRs (Varshney et al., 2005).

4.2.5

Anlisis de componentes principales.

Cuatro componentes principales solo explican el 32.55% de la varianza total acumulada


(Figura 9), cada uno con porcentajes de varianza individual similar (Tabla 8). El resto
de varianza total es atribuible al azar. Estos resultados se asemejan a los obtenidos por
Sukhotu et al. (2005), quienes obtienen un 6.1% y 3.9% en el primero y segundo
componente principal, en diferentes accesiones de papa utilizando SSRs y RFLP. En el
caso de lulo, Giraldo (2005), en la caracterizacin morfoagronmica de la coleccin,
obtiene un 79.27% de varianza acumulada y el restante atribuible al azar. A diferencia
del presente estudio, Giraldo (2005), utiliza 86 variables (descriptores cualitativos y
cuantitativos).

9.42%

Comp. 1

8.44%

7.6%

Comp. 2

Comp. 3

7.08%

Comp. 4

Figura 9. Valores acumulados de los 4 componentes principales en Lulo.

40

La Tabla 8, muestra que el primer componente aporta el 9.42% del total de la variacin
y est explicada por 5 marcadores y solo una accesin. Los otros 3 factores, muestran
que existe un mayor aporte de las accesiones que de los loci. Dado que el aporte de cada
factor a la variacin total es similar, loci y accesiones estn contribuyendo de manera
similar.
Tabla 8. Aporte a la varianza total en el anlisis de componentes principales por accesiones y
locus en la poblacin de lulo.

Accesiones

Locus *

Aporte a la
Variacin total
(%)

06L082

C2_At3g17040 (3)
C2_At2g43360 (7)
C2_At2g34470 (3)
C2_At4g37280 (7)
C2_At5g66530 (4)

9.42

06L064
06L098
05T1688028

C2_At2g34470 (2)
C2_At3g17040 (2)

8.44

C2_At3g17040 (1)
C2_At2g43360 (1)

7.6

Componente

06L068
06L085
06L098
05T1688028
06L064
06L070
06L071
06L072
06L074
06L075
06L085
06L094
06L097

C2_At4g37280 (9)
C2_At2g34470 (6)
C2_At4g38810 (2)

7.08

Total
32.55
* Cada cifra en parntesis, corresponde al nmero del alelo presente en ese locus.

4.2.6 Distancias gnicas.


A partir de distancias gnicas utilizando el coeficiente de Nei (1978), se obtuvo un
dendograma UPGMA con bootstrap de 10000 repeticiones (Figura 10). Los valores
de bootstrap para el rbol consenso fueron bajos (0.07% - 30%) indicando un bajo
soporte estadstico para los grupos formados, lo cual concuerda con la alta
diferenciacin entre poblaciones. (Tabla 7, Anexo 6). En la Figura 10 se observan 4
grupos:
El grupo A, congreg accesiones oriundas de los departamentos de Cauca (1), Valle
(3), Santander (1), Boyac (1), Nario (1), Huila (1), Costa Rica (1), Antioquia (5) y
desconocido (1).

41

El grupo B, est conformado por accesiones provenientes de Valle (3), Cauca (4), Norte
de Santander (1), Magdalena (1), Santander (2) y Per (1).
El grupo C rene accesiones provenientes de Antioquia (2), Valle (1) y desconocido
(1).
El grupo D est conformado por una sola accesin, proveniente del departamento del
Magdalena (Anexo 1).
No se presenta una relacin de los agrupamientos observados con sitios geogrficos
(Figura 10 y Anexo 8) o con alguna otra caracterstica registrada para estas accesiones.
Como se menciono anteriormente, los bajos valores bootstrap, las altos ndices de
diversidad y estructura poblacional dificultan la posibilidad de establecer grupos de
similitud confiables.
11

0.86

1.16
0.45

0.75

22.5

1.5

0.3

A
20

0.18

0.67

0.07

0.8
0.69

0.8

30

1.4
0.55

1.1

05T16802

0.09
0.57

0.15

16

3
12.1
16.2
26

04T14203

14

15

D
Figura 10. rbol consenso de lulo, elaborado a partir de un bootstrap de 10000 repeticiones,
utilizando el mtodo de agrupamiento UPGMA.

Los resultados observados en el presente estudio difieren de los obtenidos por Fory
(2005), quien reporta una baja variabilidad en las especies cultivadas de lulo (Solanum
quitoense) con un nivel de similaridad del 85 al 100% utilizando el coeficiente de Nei
(1978). En el presente estudio, utilizando el mismo coeficiente, se observa un ndice de
similitud entre 0.1 a 1.0 indicando una alta variabilidad en accesiones de lulo (Anexo 7).
Esta diferencia puede estar relacionada con el tipo de marcadores moleculares
utilizados. Fory utiliza marcadores AFLPs, los cuales son de naturaleza dominante,
mientras los COS II son de carcter codominante y son diseados a partir de exones
conservados para amplificar secuencias intrnicas, lo cual incrementa la probabilidad de
encontrar
mayor
polimorfismo

42

(http://www.sgn.cornell.edu/markers/cosii_markers.html). Maguire et a.l (2002)


compara las tcnicas de AFLP y SSRs y encuentra que esta ltima tiene alto poder en
detectar mayor variacin entre poblaciones (9% versus 19%, respectivamente). Por otro
lado, los resultados del presente estudio concuerdan ms con los obtenidos por Giraldo
(2005), quien utiliz variables morfoagronmicas, en donde se reporta una alta
variabilidad entre accesiones de S. quitoense, con una similitud mnima del 54.72%.

4.3 TOMATE DE RBOL


4.3.1 Extraccin de ADN en tomate de rbol.
El protocolo para extraccin de ADN descrito por Fulton et al. (1995), modificado en
este estudio, permiti obtener un ADN de buena calidad y concentracin en contraste
al protocolo de Partill et al. (2001), donde se obtuvo un ADN de mas baja calidad y
concentracin (Figura 11A, Anexo 9). Los resultados, son corroborados con los
productos de PCR obtenidos (Figura 11B).
A.

Fulton et a., 1995

Partill et
al,.2001

Partill et al,.2001

Fulton et a., 1995

B.

3g28050

1g71810

1g44760

Figura 11. A. Electroforesis en gel de agarosa al 1 %, visualizando el ADN en tomate de rbol.


Se relacionan los 2 ltimos nmeros de cada accesin, seguido por el por el nmero de planta.
Se observa que el buffer de extraccin de Fulton et al fue mas apropiado que el de Partill et al,
2001. B. Electroforesis en gel de agarosa al 2 %, de productos de PCR en accesiones de tomate
de rbol, utilizando 3 marcadores COS II, Se relaciona el ltimo nmero de cada accesin.

43

4.3.2 Deteccin de loci polimrficos y diversidad gentica.


De la prueba preliminar donde se trabajo nicamente con 10 accesiones de tomate de
rbol y los 5 individuos de cada una de estas, se obtuvo un patrn de bandeo
polimrfico con 5 de los 30 marcadores seleccionados para lulo. Estos, se encuentran
distribuidos en 5 de los 12 cromosomas y en su mayora amplifican secuencias
intrnicas (iUPAs), excepto el marcador C2_At3g15430, que amplifica secuencias
exnicas (eUPA) (Tabla 9).
Un total de 39 alelos fueron detectados a lo largo de las 30 accesiones de tomate de
rbol y especies relacionadas, con promedio de 7.8 alelos por locus (Tabla 9). Para
comparacin de estos resultados con los de otras especies ver los tems 4.2.2 y 4.2.3 de
lulo.
Con respecto a los ndices de diversidad, para el caso de accesiones, los ndices de
heterocigocidad observado (Hi) y esperado (Hs) fueron bajos, oscilando entre 0-0.096 y
0-0.08, respectivamente (Tabla 10). Todas las accesiones, excepto 06TA042,
presentaron valores iguales a 0, indicando que son homocigotas para los loci estudiados
(Tabla 10, Anexos 10). Para el caso de loci, el ndice Hi en cada uno present valores
bajos con un rango de 0-0.02 y el ndice Hs present valores altos con un rango de 0.680.81 (Anexo 11).

4.3.3 Estructura poblacional.


En comparacin con lulo, en tomate de rbol se observa una tendencia ms marcada
hacia la fijacin de alelos dentro de subpoblaciones. Esta especie presenta valores
promedio elevados de FIS (0.90), al igual que de FIT (0.99) y FST (0.99), debido a la
ausencia de genotipos heterocigotos (excepto la accesin 06TA042 en el locus
C2_At1g71810) (Tabla 10, Anexos 10 y 11 ). Esto conlleva a la diferenciacin casi total
entre las subpoblaciones seleccionadas de la coleccin de tomate de rbol. En general,
al igual que en lulo, los valores se pueden explicar por las barreras geogrficas,
adaptacin a diferentes nichos, modo de reproduccin de la especie, y, el tipo de
marcadores utilizados (ver tem 4.2.4.).

44

Tabla 9. Caractersticas de los loci polimrficos para tomate de rbol.

C2_At1g71810

tcatGCAGATCCACATCCTGGAAAC
aGTgACaAAaTCCTTGGCCAATGC

iUPA

Rango de
peso en
tomate de
rbol (pb)
1112-1350

C2_At4g00090

AGATATTgGCcaCCAcTCATGGTTC
AGGcGACCATGCCATGTCCG

iUPA

1450-1740

InDel

C2_At4g32930

TCCTCtTcctattGGCAAGGGC
TGGACACTCcCCCTTtTCATCATAC

iUPA

11

1450-2513

InDel

C2_At3g15430

TCGtTTgAGGtCaaCTTtAATGGAGG
aGTTGTtTCaGGCCCaTGACCAAG

eUPA

1146-1210

InDel

C2_At1g44760

TTCTTCaTctgCTgCTcATCTTGC
AGAgGGtTTTTTCTGACCCAAGAC

iUPA

794-1120

InDel

Locus

Primers (5-3)*

Tipo

Crom.

Nmero
de
Alelos

Tipo de
polimorfismo
(InDel/Caps )
InDel

Promedio:
7.8
Total:
39
1

Datos obtenidos de la localizacin y anlisis de marcadores COS II en el genoma del tomate (Feinan et al., 2006, www.sgn.cornell.edu).
Datos obtenidos de la pagina www.arabidopsis.org/servlets/TairObject.

45

Funcin
del gen2
Protena de la
familia ABC1.
Contiene dominio
Pfam.
Protena de la
familia de la
transducina /
repeticin WD-40
Protena expresada
Caenorhabditis
elegans.
Protena de la
familia de
regulacin de
condensacin del
cromosoma
(RCC1)
Protena de la
familia de estrs
universal (USP)

Referencias
Ytterberg et
al.. 2006.

Tabla 10. ndices de diversidad de acuerdo a Nei (1978) e ndices de fijacin de acuerdo a
Wright (1921) por cada accesin de tomate de rbol

Accesin

HI1

HS2

H3

P(0.99)

Promedio
de
alelos/locus

06TA042

0.096

0.11

0.08

0.2

1.2

06TA001
06TA004
06TA007
06TA008
06TA009
06TA010
06TA011
06TA013
06TA014
06TA015
06TA016
06TA018
06TA020
06TA022
06TA023
06TA024
06TA025
06TA026
06TA028
06TA031
06TA032
06TA033
06TA034
06TA035
06TA039
06TA041
06TA045
06TA047
06TA050
Promedio

0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0

0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0

0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0

0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0
0.0

1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1

FIS4

FIT5

FST6

1
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90
0.90

1
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99

1
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99
0.99

Heterocigocidad observada, 2Heterocigocidad esperada, 3Indice de diversidad, 4Coeficiente de


endogamia, 5Coeficiente de endogamia total, 6Indice de fijacin subpoblacional.

4.3.4 Anlisis de componentes principales.


Cuatro componentes principales solo explican el 35.94% de la varianza total acumulada
(Figura 12), cada uno con porcentajes de varianza individual similar (Tabla 11). El resto

46

de varianza total es atribuible al azar. As, al igual que en lulo, el nmero de variables
utilizadas no son suficientes para explicar el total de la variacin. Adems, la
inexistencia de genotipos heterocigotos y la alta diferenciacin entre poblaciones debe
influir en estos resultados.

10.7%

Comp. 1

9.06%

Comp. 2

7.92%

7.82%

Comp. 3

Comp. 4

Figura 12. Valores acumulados de los 4 componentes principales en tomate de rbol.

La Tabla 11, muestra que el primer componente aporta el 10.69% del total de la
variacin y esta explicada por 5 marcadores y 4 accesiones. De la misma forma los otros
3 factores, muestran que existen aportes similares de los loci y de las accesiones.
Tabla 11. Aporte a la varianza total en el anlisis de componentes principales por accesiones y
loci en tomate de rbol.

Componente

Accesiones

06TA001
06TA025
06TA039
06TA045

06TA025
06TA032
06TA045

06TA001
06TA039

06TA025

Locus *
C2_At1g71810 (1)
C2_At4g00090
(1,6,8)
C2_At4g32930 (8)
C2_At3g15430 (1,4)
C2_At1g44760 (8)
C2_At4g00090 (1,6)
C2_At4g32930 (8)
C2_At3g15430 (3)
C2_At1g71810 (8)
C2_At4g00090 (1,8)
C2_At4g32930 (8,9)
C2_At1g71810 (2,6)
C2_At1g44760 (4,5)

Aporte a la
Variacin
total (%)

10.69

9.06

7.92

7.82

Total
35.49
* Cada nmero en parntesis, corresponde al nmero del alelo presente en ese locus.

47

4.3.5 Distancias gnicas.


A partir de distancias gnicas utilizando el coeficiente de Nei (1978), se obtuvo un
dendograma UPGMA con bootstrap de 10000 repeticiones (Figura 13). Los valores
de bootstrap para el rbol consenso fueron bajos (0.2% - 14%), excepto el
agrupamiento dado para la accesin 06TA010 con respecto a las dems, con un valor
del 100%, representando el nico agrupamiento confiable. Esta accesin corresponde a
Solanum betaceum, proveniente del departamento de Antioquia (Anexo 2). Los dems
agrupamientos presentan un bajo soporte estadstico, lo cual, al igual que lulo,
concuerda con la alta diferenciacin entre poblaciones. (Tabla 10, Anexo 11). En el
rbol consenso generado se observan 11 grupos (Figura 13):
A
B
C
D
E

100
14

1.6
5.5

6. 8
2. 1

0.2

7.3

5. 1

0.5
1.6
13

3.6

4. 2

0.2

5. 9
9.1

0.2

3.1
13
8.3

0.14
3.2
13

Figura 13. rbol consenso de tomate de rbol, elaborado a partir de un bootstrap de 10000
repeticiones, utilizando el mtodo de agrupamiento UPGMA.

Los ndices de similitud entre accesiones fueron de 0.2 - 1 (Anexo 12). Los grupos
conformados para esta especie, poseen accesiones de diferentes departamentos dispersas
en los mismos, incluyendo los taxa relacionados. As, al igual que en lulo, no se
presenta una relacin de los agrupamientos observados con sitios geogrficos o con
alguna otra caracterstica registrada para estas accesiones.

48

5. CONCLUSIONES

Se analizaron 6 loci polimrficos para lulo y 5 para tomate de rbol, con un promedio
de 7.8 alelos por locus, indicado que los marcadores COS II poseen una alta capacidad
de detectar variacin allica en estas especies.
Las colecciones de lulo y tomate de rbol estudiados presentan un alto ndice de
diferenciacin entre subpoblaciones y una baja diferenciacin dentro de las mismas
determinado por los valores de diversidad (H) y de fijacin (FIS, FST).
El anlisis de componentes principales (ACP) y de distancias gnicas concuerda con la
alta estructura poblacional ya que para ACP la variacin total fue explicada por bajos
porcentajes y para distancias gnicas se observo un amplio rango de variabilidad entre
accesiones y agrupamientos con bajos valores de confiabilidad (bootstrap).
Los resultados de los anlisis de diversidad para las dos especies se pueden explicar por
las barreras geogrficas, adaptacin a diferentes nichos, modo de reproduccin de las
especies, y, el tipo de marcadores utilizados.
Los resultados indican que los marcadores COS II son ms adecuados para estudios de
diversidad entre poblaciones de lulo y tomate de rbol que dentro de las mismas, e
implican que las labores de colecta sean dirigidas a muestreos interpoblacionales.
Dada la alta diferenciacin gnica (polimorfismo entre accesiones observada con
marcadores COSII) se podra inferir una buena probabilidad de xito en la obtencin de
heterosis (vigor hibrido) en cruces F1 entre accesiones. Adicionalmente, este alto
polimorfismo puede tambin ser utilizado para la generacin de mapas de ligamiento
gentico entre accesiones acoplado con anlisis de QTLs en futuros programas de
seleccin.

49

RECOMENDACIONES

Comparar los anlisis de variabilidad gentica de estudios morfo-agronmicos, con


marcadores AFLPs y con marcadores COSII para lulo y tomate de rbol con los datos
brutos de las mismas accesiones.
Ampliar la muestra de estudio en cuanto a nmero de loci y de accesiones provenientes
de diferentes regiones geogrficas con similar tamao poblacional para evitar el sesgo o
la sobrestimacin de la diversidad.
Utilizar otro tipo de marcadores para confirmacin de estructura poblacional. Estos
pueden ser SSRs y/o COSII basados en secuencia. En tomate, estudios de diversidad
con COSII basados en secuencia indican que son muy apropiados para predecir
estructura poblacional e historial de domesticacin (Sheffer et al. 2006; Labate et al.,
2006).

50

BIBLIOGRAFA
ARNAL, N. et al. 2006. The Arabidopsis Bio2 protein requires mitochondrial targeting
for activity. Plant. Mol. Bio. 62(3).
BANDOPADHYAY, R. et al.2004. DNA polymorphism among 18 species of
TriticumAegilops complex using wheat ESTSSRs. Plant Sci. 166(2): 349356.
BARRERA, S. 2006. Estandarizacin de un protocolo de la tcnica AFLP para
caracterizacin molecular de Palma de aceite (Elaeis guineensis Jacq.) y Lulo (Solanun
quitoense Lam.). Tunja, 81 p. Trabajo de grado (Biloga). Universidad Pedaggica y
Tecnolgica de Colombia. Facultad de Ciencias Bsicas. Escuela de Ciencias
Biolgicas.
BENITEZ, A. et al. 1991. Phenotypic Characterization of certain accessions in the
Lulo (Solanum quitoense) Germplasm Bank. En: HAWKES, J., LESTER, R., NEE, M.
& ESTRADA-R, N. (eds.). Solanaceae III: Taxonomy, Chimestry, Evolution. P. 437450. Royal Botanic Gardens, Kew.
BELKHIR, K. et al. GENETIX, logiciel sous WindowsTM pour la gntique des
populations. Laboratoire Gnome, Populations, Interactions CNRS UMR 5000,
Universit de Montpellier II, Montpellier (France).
BERNAL, J. et al. 2003. Generalidades del cultivo. Pp: 8, 19-20. En: BERNAL, J. &
DAZ, C. (Compiladores). 2003. Tecnologa para el cultivo del Tomate de rbol.
Manual Corporacin Colombiana de Investigacin Agropecuaria, CORPOICA.
________, LOBO, M. & LONDOO, M. 1998. Documento de presentacin del
material Lulo La Selva. Rionegro:Corpoica. pg: 77.
BOHS, L. 2004. A chloroplast AND phylogeny of Solanum section Lasiocarpa.
Systematic Botany, 29(1):177-187.
________ & OLMSTEAD, R. 1999. A reassessment of Normandia and Triguera
(Solanaceae). Plant Systematics and evolution 228:33-48. Citado por: BOHS, L. 2004.
A chloroplast ADN phylogeny of Solanum section Lasiocarpa. Systematic Botany.
29(1):177-187.
BORNET, B. et al. 2002. Genetic diversity in European and Argentinian cultivated
potatoes (Solanum tuberosum subsp. tuberosum) detected by inter-simple sequence
repeats (ISSRs). Genome 45: 481-484.
BROWN, T. Genomes [online]. 3a ed. [Manchester, UK]: Bios Scientific Publishers,
2002. Disponible en:<www.bios.co.uk>

51

Corporacin Colombia Internacional-CCI-. Desarrollo Tecnolgico: Manejo


agronmico del cultivo de lulo [online]. . [Bogot, Colombia]. (s.n.), 2005. Disponible
en: < http://www.drcalderonlabs.com/Cultivos/Lulo/Cultivo_de_Lulo_2.html>.
Corporacin Colombia Internacional-CCI-. Lulo generalidades del producto [online].
Boletn Trpico No. 41. [Bogot, Colombia]. 2004. Perfil de producto, Inteligencia de
mercados. Disponible en: <http://www.cci.org.co>. ISSN 0123-1338.
Corporacin Colombia Internacional-CCI-. Cadena de comercializacin del lulo en
Colombia [online]. Boletn bimestral No. 65. [Bogot, Colombia]. 2005. SIPSA,
sistema de informacin de precios del sector agropecuario. Disponible en:
<http://www.cci.org.co>. ISSN 0123-1812.
CHARRY, C. 2005. Estado actual del cultivo del Lulo Solanum Quitoense y
aplicaciones biotecnolgicas para su desarrollo. Bogot, 74 p. Trabajo de grado
(Especializacin en Horticultura). Universidad Nacional de Colombia. Facultad de
Agronoma. Especializacin en Horticultura.
CROW, J. 1986. Basic concepts in population, quantitative, and evolutionary genetics.
New York: W. H. Freeman and Company. 273p.
DREISIGACKER, S. et al. 2004. SSR and Pedigree Analyses of Genetic Diversity
among CIMMYT Wheat Lines Targeted to Different Megaenvironments. Crop Sci.
44:381-388.
ERASO, B. 1991. Ecological effects on the physiology of the Lulo Solanum quitoense.
En: HAWKES, J., LESTER, R., NEE, M. & ESTRADA-R, N. (eds.). Solanaceae III:
Taxonomy, Chemistry, Evolution. P. 451-453. Royal Botanic Gardens, Kew.
FELSENSTEIN, J. 1989. PHYLIP: Phylogeny inference package (version 3.2).
Cladistics 5: 164-166.
FORY, P. 2005. Caracterizacin y anlisis molecular de la diversidad gentica de la
coleccin Colombiana de Lulo (Solanum quitoense LAM) y seis especies relacionadas
de la seccin Lasiocarpa. Palmira 78 p. Trabajo de Grado (Maestra en Ciencias, rea
de nfasis en recursos filogenticos tropicales). Universidad Nacional de Colombia,
sede Palmira. Facultad de Ciencias Agropecuarias. Escuela de Postgrados.
________, et al. 2004. Caracterizacin molecular de la coleccin Colombiana de Lulo
(Solanum quitoense) LAM. En: SEMINARIO NACIONAL E INTERNACIONAL DE
FRUTALES. (5: 2004: Manizales). Resumen del V Seminario Nacional e
Internacional de frutales. Pg: 443.
FRANKHAM, R., BALLOU, J. & BRISCOE, D. 2004. A primer of Conservation
Genetics. United Kingdom: Cambridge University Press. 220p.

52

FULTON, T., CHUNWONGSE , J. & TANKSLEY, S. 1995. Microprep Protocol for


Extraction of AND from Tomato and other Herbaceous Plants. Plant Molecular
Biology Reporter 13 (3): 207-209.
FULTON, T. et al. 2002. Identification, Analysis, and Utilization of Conserved
Ortholog Set Markers for Comparative Genomics in Higher Plants. The Plant Cell,
Vol. 14, 1457-1467.
GARCA, P. et al. 2002. Variabilidad morfolgica cualitativa en una coleccin de
tomate de rbol Cyphomandra (Solanum) betacea (betaceum). En: SEMINARIO
NACIONAL DE FRUTALES DE CLIMA FRO MODERADO. (4: 2002). Memorias
del IV Seminario Nacional de frutales de clima fro moderado. 2002. p. 49-54.
GHISLAIN, M. et al. 2004. Selection of highly informative and user-friendly
microsatellites (SSRs) for genotyping of cultivated potato. Theor Appl Genet. 108(5):
881-90.
GIRALDO, A. 2005. Caracterizacin de la variabilidad morfolgica y algunos
atributos qumicos de los frutos en una coleccin de lulo (Solanum quitoense Lam) y
especies relacionadas de la seccin Lasiocarpa. Medelln, 41 p. Trabajo de grado
(Ingeniero Agrnomo). Universidad Nacional de Colombia, sede Medelln. Facultad
de Ciencias Agropecuarias. Departamento de Ingeniera Agronmica.
GRIFFITHS, A., et al. 1999. Modern Genetic Analysis. New York: W. H. Freeman
and Company. On line.
HARTL, D. 1988. A primer of Population Genetics. Second edition. Sunderland, Mass:
Sinauer Associates. 303p.
________ & CLARK, A. 1997. Principles of Population Genetics. Third edition.
Sunderland, Mass: Sinauer Associates. 542p.
HAWKES, J. 1999. The economic importance of the family Solanaceae. En: M. NEE,
D.E. SYMON, R.N. LESTER & J.P. JESSOP (editors). Solanaceae IV, Advances in
biology and utilisation, pp. 1-8. Royal Botanic Gardens, Kew.
HE, C., POYSA, V. & YU, K. 2003. Development and characterization of simple
sequence repeat (SSR) markers and their use in determining relationships among
Lycopersicon esculentum cultivars. Theor Appl Genet. 106(2): 363-73.
HEDRICK, P. 2005. Genetics of Populations. Third edition. Sudburry: Jones and Bartlett.

737p.
________. 1993. The Naranjilla (Solanum quitoense), the cocona (Solanum
sessiliflorum) and their hybrid. En: GUSTAFSON, J. (edit.). 1993. Gene Conservation
and Explotation. New York: Plenum Press. p. 29-34.

53

________. & ANDERSON, G. 1999. "New" Solanums. En: JANICK, J. (edit).1999.


Perspectives on new crops and new uses. Alexandria VA.: ASHS Press.
HOKCHE, O. & RAMREZ, N. 2006. Biologa Reproductiva y asignacin de biomasa
floral en Solanum gardneri Sendth. (Solanaceae): Una Especie Andromonoica. Acta
Bot. Venez. 29(1):69-88.
International Plant Genetic Resources Institute. New World Fruits Database [online].
2006. Disponible en:
<www.ipgri.cgiar.org/Regions/Americas/programmes/TropicalFruits/>
JUDD, W. et al. 2002. Plant Systematics: Phylogenetic approach. Massachusetts :
Sinaver Associates : p :115,438.
LABATE, J.A., et al. 2006. DNA polymorphism estimates within domesticated tomato.
PAA/Solanaceae. Madison, WI. Poster.
LENTINI, Z. 2003. Conservacin y transformacin gentica de lulo (solanum
quitoense) y tomate de rbol (cyphomandra betacea) [Online],[Cali, Colombia]. Mayo
de 2003. Disponible en: <www.ciat.cgiar.org/tropical_fruits/pdf/lulo3.pdf -128.6KB.>
LOBO, M. 2000. Estudio de la variabilidad gentica en el desarrollo de los frutales
andinos como alternativa productiva. En: SEMINARIO NACIONAL DE FRUTALES
DE CLIMA FRO (3:2000: Manizales). Memorias del tercer seminario nacional de
frutales de clima fro. 27-35.
________., MEDINA, C. & CARDONA, M. 2000 Resistencia de campo a la
Antracnosis de los frutos (Colletotrichum gloesporoides) en tomate de rbol
(Cphomandra (Solanum) betacea (betaceum) Cav. Sendt.). Rev. Fac. Nal. Agr.
Medelln. Vol.53. No 2. 9. 1129-1142.
________., ________., et al. 2002. Recursos genticos de frutales andinas en le
sistema de bancos de germoplasma del estado Colombiano. En: SEMINARIO
NACIONAL DE FRUTALES DE CLIMA FRO MODERADO. (4: 2002:
Manizales). Memorias del IV Seminario Nacional de frutales de clima de fro
moderado. P. 43-48.
MAGUIRE, T., PEAKALL, R. & SAENGER, P. 2002. Comparative analysis of
genetic diversity in the mangrove species Avicennia marina (Avicenniaceae) detected
by AFLPs and SSRs. En: CASALA, R. 2003. Medicin de distancias genticas en
poblaciones de camarn blanco Litopenaeus vannamei en la costa ecuatoriana.
Guayaquil. 68p. Trabajo de grado (Maestra en Ciencias). Escuela Superior Politcnica
del Litoral. Facultad de Ingeniera Martima y Ciencias del Mar.
MEEROW, A. et al. 2003. Analysis of genetic diversity and population structure within
Florida coconut (Cocos nucifera L.) germoplasma using microsatellite DNA, with
special emphasis on the Fiji Dwarf cultivar. Theor. Appl. Genet. 106: 715-726.

54

MILLER, J. & DIGGIE, P. 2003. Diversification of Andromonoecy in Solanum


section Lasiocarpa (Solanaceae): The roles of phenotypic plasticity and architecture.
American Journal of Botany. 90: 707-715.
Ministerio de Agricultura y Desarrollo Rural. La cadena de los frutales de exportacin
en Colombia [online]. Observatorio Agrocadenas Colombia. [Bogot, Colombia].
Marzo de 2005. Documento de Trabajo No. 67. Una mirada global de su estructura y
dinmica 1991-2005. Disponible en: <http://www.agrocadenas.gov.co>
________. Precios del tomate de rbol en los mercados de Europa y Ecuador [online].
Corporacin Colombia Internacional. [Bogot, Colombia]. 2000. Publicacin Nmero
34. Precios Internacionales, sistema de inteligencia de mercados SIM. Disponible en:
<http://www.cci.org.co>. ISSN 0123-8914.
MONCADA, P. & McCOUCH, S. 2004. Simple sequence repeat diversity in diploid
and tetraploid Coffea species. Genome 47: 501-509.
MORETZSOHN, M. et al. 2004. Genetic diversity of peanut (Arachis hypogoea L.)and
its wild relatives based on the analysis of hypervariable regions of the genome. BMC
Plant Biology. 4:11.
NEI, M. 1987. Molecular Evolutionary Genetics., New York: Columbia University
Press. 512 p.
PARTILL, A. et al. 2001. DNA Isolation Methods for Medicinal and Aromatic Plants.
Plant. Mol. Bio. Re. 19: 273a-f.
SAMBROOK, J. & RUSSELL, D. 2001. Molecular cloning: A laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Vol 1: 6.15.
SANE, A., STEIN, B. & WESTHOFF, P. 2005. The nuclear gene HCF107 encodes a
membrane-associated R-TPR (RNA tetratricopeptide repeat)-containing protein
involved in expression of the plastidial psbH gene in Arabidopsis. The Plant Journal 42
(5): 720730.
SHEFFER, S.M. et al. 2006. DNA polymorphism in tomato, a crop with a history of
selection, bottlenecks and introgression. Annual Meeting of the Society for the Study of
Evolution, Stony Brook, NY. Poster.
SHULTES, R. & CUATRECASAS, J. 1953. Notes on cultivated Lulo. USA:
Cambridge Botanical Museum Leaflets. U.S.A. Harvard University Cambridge. V16
(5): p. 97-105.
SPOONER D., VAN TREUREN, R. & DE VICENTE, M. 2005. Molecular markers
for genebank management. IPGRI Technical Bulletin No. 10. International Plant
Genetic Resources Institute, Rome, Italy. 126 pp.

55

SUKHOTU, T., KAMIJIMA, O. & HOSAKA, K. 2005. Genetic diversity of the


Andean tetraploid cultivated potato (Solanum tuberosum L. subsp. Andigena Hawkes)
evaluated by chloroplast and nuclear DNA markers. Genome 48: 55-64.
VARSHNEY, R., GRANER, A. & SORRELLS, M. 2005. Genic microsatellite markers
in plants: features and applications. TRENDS in Biotechnology 23 No.1.
WITTE, C., ROSSO, M. & ROMEIS, T. 2005. Identification of Three Urease
Accessory Proteins That Are Required for Urease Activation in Arabidopsis. Plant
Physiology 139:1155-1162.
WU, F. et al. 2006. Combining Bioinformatics and Phylogenetics to Identify Large Sets
of Single-Copy Orthologous Genes (COSII) for Comparative, Evolutionary and
Systematic Studies: A Test Case in the Euasterid Plant Clade. Genetics 174: 1407
1420.
YTTERBERG, A., PELTIER, J. & VAN WIJK, K. 2006. Protein Profiling of
Plastoglobules in Chloroplasts and Chromoplasts. A Surprising Site for Differential
Accumulation of Metabolic Enzymes. Plant Physiology 140:984-997.

56

ANEXOS

Anexo 1. Accesiones de lulo usadas en el anlisis de diversidad.


Accesiones
06L053
06L054
06L061
06L062
06L063

Especie
S. quitoense
S. quitoense
S. quitoense
S. quitoense
S. hirtum

06L064

S. quitoense

06L066
06L068

S. quitoense
S. quitoense

06L069
06L070
06L071
06L072
06L074
06L075

S. quitoense
S. quitoense
S. quitoense
S. quitoense
S. quitoense
S. quitoense

06L078
06L080
06L081
06L082
06L084
06L085

S. quitoense
S. quitoense
S. quitoense
S. quitoense
S. quitoense
S. quitoense

06L088

S. quitoense

06L089
06L090
06L091
06L093
06L094
06L095
06L097
06L098

S. quitoense
S. quitoense
S. quitoense
S. quitoense
S. quitoense
S. quitoense
S. quitoense
S. quitoense

06L099

S. quitoense

05T1688028
04T14203

S. hirtum
S. quitoense

57

Origen
Pitalito, Huila
Per
Rionegro, Antioquia
Antioquia
Aguas Calientes,
Santander
San Antionio Sibundoy
Putumayo
Tenjo, Palmira, Valle
Villa Mor,
Pasto,Nario
Meseta Jamundi, Valle
Juntas, Popayn, Cauca
Juntas, Popayn, Cauca
Buenaventura, Valle
Timbo, Cauca, Cauca
La Oculta, Timba,
Cauca
Blgica, Dovio, Valle
Blgica, Dovio, Valle
Blgica, Dovio, Valle
Blgica, Dovio, Valle
Holanda
Palmar, Sierra Nevada,
Magdalena
Santa Rosa de Osos,
Antioquia
Desconocido
Antioquia
Costa Rica
Villa de Leiva, Boyac
Concepcin, Antioquia
Cienaga, Magdalena
Charala, Santander
Lecho, Yarumal,
Antioquia
Cicutilla, Norte de
Santander
Venezuela
Cali, Valle

Anexo 2. Accesiones de tomate de rbol usadas en el anlisis de diversidad.


Accesiones
06TA001
06TA004

Especie
S. betaceum
S. betaceum
S. betaceum

06TA007
S. betaceum
06TA008
S. betaceum
06TA009
06TA010
06TA011
06TA013
06TA014
06TA015
06TA016
06TA018
06TA020
06TA022
06TA023
06TA024
06TA025
06TA026

S. betaceum
S. betaceum
S. betaceum
S. betaceum
S. betaceum
S. betaceum
S. betaceum
S. betaceum
S. betaceum
S. betaceum

S. betaceum
S. betaceum
S. betaceum
S. betaceum

06TA028
S. betaceum
06TA031
06TA032
06TA033
06TA034
06TA035
06TA039
06TA041
06TA042
06TA045
06TA047
06TA050

S. betaceum
S. betaceum
S. betaceum
S. hartwegii var racemosa
S. betaceum
S. betaceum
S. corymbiflora
S. diversifolia
S. betaceum
S. diversifolia

58

Origen
Caractersticas
Santa Rosa de
Osos, Antioquia
Nario
Nario
Fruto grande y sano,
cnico, planta de 2.50
m. Fruto con aristas.
Cauca
Fruto elipsoidal, rojo,
mediano.
Valle
Fruto color rosado,
ciclo vegetativo 12-16
meses, fruto en baya
comestible.
Antioquia
Fruto maduro amarillo.
Caldas
Semilla blanca.
Caldas
Fruto rojo, ovoideo.
Boyac
Tolima
Tolima
Antioquia
Tipo rojo comn.
Antioquia
Tomate amarillo
gigante.
Desconocido
Gigante pulpa roja.
Tolima
Frutos rojizos, con
estras oscuras
elpticas.
Antioquia
Apariencia a un mango.
Nario
Huila
Antioquia
Se cosecho tomate
albino.
Antioquia
Material resistente a la
antracnosis.
Antioquia
2 frutos
Antioquia
10 frutos
Nario
Tolima
Kenia
Ecuador
Brasil
Venezuela
Tesorito, Caldas
Desconocido

Anexo 3. COSII identificados a partir de geles y secuencia analizados para la seleccin


de marcadores polimrficos en lulo y tomate de rbol. En negrita se relacionan los
marcadores polimrficos para cada especie.
Lulo
C2_At1g50575
C2_At2g06530
C2_At2g18710
C2_At2g20860
C2_At2g34470
C2_At2g39690
C2_At2g43360
C2_At3g01160
C2_At3g09920
C2_At3g10020
C2_At3g10220
C2_At3g11210
C2_At3g16150
C2_At3g17040
C2_At3g21610
C2_At3g25590
C2_At3g46780
C2_At3g58470
C2_At3g19630
C2_At3g62940
C2_At4g03210
C2_At4g24830
C2_At4g37280
C2_At4g38810
C2_At5g06430
C2_At5g20180
C2_At5g46630
C2_At5g62390
C2_At5g62440
C2_At5g66530

Tomate de rbol
C2_At1g26520
C2_At1g44760
C2_At1g50575
C2_At1g71810
C2_At2g06530
C2_At2g34470
C2_At2g39690
C2_At2g43360
C2_At3g10220
C2_At3g10020
C2_At3g11210
C2_At3g15430
C2_At3g16150
C2_At3g17000
C2_At3g17040
C2_At3g19630
C2_At3g21610
C2_At3g28050
C2_At3g58470
C2_At3g62940
C2_At4g00090
C2_At4g03210
C2_At4g12230
C2_At4g14110
C2_At4g24830
C2_At5g20180
C2_At4g32930
C2_At4g37280
C2_At5g62390
C2_At5g66530

59

Anexo 4. Estimacin de la concentracin y calidad del ADN de lulo, a travs de la


lectura de absorbancia de rayos UV (260/280 nm).
Accesin
06L053
06L054
06L061
06L062
06L063
06L064
06L066
06L068
06L069
06L070
06L071
06L072
06L074
06L075
06L078
06L080
06L081
06L082
06L084
06L085
06L088
06L089
06L090
06L091
06L093
06L094
06L095
06L097
06L098
06L099
05T1688028
04T14203

Concentracin
(ng/L)
277.12
312.49
375.42
292.89
762.94
921.18
1032.8
587.16
346.96
878.59
265.63
311.51
423.79
402.64
641.95
225.21
567.43
568.92
336.40
329.69
544.83
564
1312.5
747.24
421.77
938.71
264.57
516.37
309.20
285.97
1668.8
2116.4

60

Calidad
(260/280 nm)
2.27
1.94
2.13
2.17
1.94
2.0
1.87
1.95
2.0
1.92
2.1
1.97
1.92
2.1
1.94
2.29
2.1
1.90
1.74
2.0
1.92
1.78
1.38
1.65
1.83
1.75
1.74
1.88
1.92
1.95
1.62
1.7

Anexo 5. Allo (s) presentes en cada accesin de lulo. A cada alelo observado por locus
se le dio una connotacin numrica.
Accesiones
06L089
06L090
06L080
06L068
06L063
06L054
06L069
06L061
06L081
06L075
06L070
06L093
06L094
05T1688028
06L062
06L064
06L066
06L053
06L071
06L072
06L074
06L078
06L082
06L084
06L085
06L088
06L091
06L095
06L097
06L098
06L099
04T14203
Total de
alelos

C2_At4g38810
3
1
3
1
4
4
1
3
2
2
2
1
1
1
1
1
1
1
2
4
2
1
3
2
2
1
1
4
1
3
4
3

C2_At3g17040
4
4
1, 4
4
4
4
4
4
4
4
4
4
4
1
4
4
4
4
4
4
4
4
3
4
4
4
4
4
4
2
4
4

C2_At2g43360
6
4
4
5, 8, 3
3
3
3
3
8
5
5
5
3
1
5
3
4
2
5
5
5
6
7
2
1
7
3
5
4
8
8
4

C2_At2g34470
5, 2
4
3
4
4
4
5
4
4
5
4
4
4
1, 3
4
4
4
4
4
4
5
5
3
4
6
4
4
4
4
2
4
5

C2_At4g37280
3, 8, 5, 13
12, 4, 8, 14, 5
7, 9, 10, 11, 12
15
2, 5
9, 13, 14
7, 11
5, 2
7, 11
4, 9
5, 10
5
13, 10
6
10
6
5
9
4
4
4
10
7
10
9
4
10
5
11
15
3
13

C2_At5g66530
9, 1, 7
10, 8
6
9, 10
3, 8
5
7
6
7
6
6
2, 10
9
9
5
7
7
4
5
6
6
7
4
7
6
7
9
9
9
6
10
10

15

10

61

Anexo 6. ndices de diversidad de acuerdo a Nei (1978) e ndices de fijacin de acuerdo


a Wright (1921) por cada loci analizado en lulo
FIS4
FIT5
Locus
HI1
HS2
H3
C2_At5g66530
0.0
0.70
1.0
0.47
0.95
C2_At2g34470
0.006
0.18
0.97
0.48
0.96
C2_At3g17040
0.006
0.83
0.99
0.48
0.95
C2_At2g43360
0.048
0.52
0.91
0.47
0.96
C2_At4g38810
0.142
0.90
0.84
0.50
0.97
C2_At4g37280
0.079
0.83
0.90
0.42
0.96
0.048
0.66
0.94
0.47
0.96
Promedio
1
Heterocigocidad observada, 2Heterocigocidad esperada, 3Indice de diversidad, 4Coeficiente de
endogamia, 4Coeficiente de endogamia total, 6Indice de fijacin subpoblacional.

62

FST6
0.90
0.92
0.90
0.92
0.95
0.93
0.92

Anexo 7. Matriz de distancias gnicas en lulo utilizando la mnima distancia de Nei (1978). Se relacionan los dos ltimos nmeros de cada
accesin.
Acce.
53
54
61
62
63
64
66
68
69
70
71
72
74
75
78
80
81
82
84
85
88
89
90
91
93
94
95
97
98
99
62
03

53

54

61

62

63

64

66

68

69

70

71

72

74

75

78

80

81

82

84

85

88

89

90

91

93

94

95

97

98

99

62

0.6

0.6
0.4

0.5
0.5
0.6

0.6
0.2
0.3
0.6

0.5
0.5
0.5
0.5
0.4

0.5
0.6
0.5
0.5
0.5
0.3

0.5
0.6
0.6
0.3
0.5
0.5
0.5

0.7
0.6
0.6
0.7
0.6
0.3
0.5
0.6

0.7
0.6
0.3
0.5
0.5
0.7
0.5
0.5
0.8

0.7
0.5
0.6
0.3
0.6
0.7
0.7
0.5
0.8
0.3

0.7
0.5
0.5
0.5
0.4
0.7
0.7
0.5
0.8
0.3
0.3

0.8
0.8
0.6
0.7
0.8
0.8
0.8
0.6
0.7
0.3
0.3
0.3

0.8
0.8
0.6
0.6
0.7
0.8
0.8
0.6
0.6
0.3
0.3
0.3
0.0

0.7
0.8
0.8
0.5
0.8
0.5
0.5
0.6
0.3
0.8
0.8
0.8
0.7
0.6

0.7
0.7
0.3
0.7
0.6
0.7
0.5
0.7
0.6
0.5
0.7
0.5
0.5
0.4
0.6

0.7
0.6
0.6
0.7
0.6
0.5
0.5
0.6
0.6
0.5
0.5
0.7
0.7
0.6
0.7
0.6

0.8
1
0.8
1
0.9
1
1
1
1
1
1
1
1
1
1
0.6
0.8

0.5
0.6
0.6
0.5
0.6
0.5
0.5
0.6
0.7
0.5
0.5
0.7
0.7
0.6
0.5
0.7
0.3
1

0.7
0.8
0.6
0.8
0.8
0.8
0.8
0.8
0.8
0.5
0.7
0.7
0.5
0.4
0.8
0.5
0.7
1
0.7

0.5
0.6
0.6
0.5
0.6
0.3
0.3
0.5
0.5
0.7
0.5
0.5
0.7
0.7
0.5
0.7
0.5
0.8
0.5
0.8

0.7
0.6
0.4
0.7
0.6
0.7
0.6
0.6
0.6
0.6
0.7
0.7
0.6
0.6
0.4
0.4
0.6
0.7
0.7
0.7
0.7

0.4
0.5
0.5
0.4
0.4
0.4
0.2
0.4
0.5
0.5
0.5
0.5
0.7
0.7
0.6
0.4
0.5
0.9
0.6
0.7
0.4
0.5

0.5
0.5
0.5
0.3
0.4
0.3
0.5
0.3
0.5
0.6
0.7
0.7
0.8
0.8
0.5
0.7
0.7
1
0.5
0.8
0.5
0.6
0.4

0.5
0.6
0.5
0.3
0.5
0.5
0.3
0.2
0.6
0.3
0.5
0.5
0.6
0.6
0.6
0.7
0.6
1
0.6
0.8
0.5
0.6
0.3
0.5

0.5
0.4
0.4
0.5
0.4
0.3
0.5
0.3
0.5
0.6
0.7
0.7
0.8
0.8
0.6
0.7
0.6
1
0.6
0.8
0.5
0.5
0.4
0.1
0.4

0.7
0.5
0.5
0.5
0.4
0.7
0.5
0.3
0.8
0.3
0.5
0.3
0.7
0.6
0.8
0.7
0.7
1
0.7
0.8
0.7
0.5
0.5
0.5
0.3
0.5

0.5
0.6
0.6
0.5
0.6
0.5
0.3
0.3
0.5
0.7
0.7
0.7
0.8
0.8
0.7
0.5
0.6
1
0.7
0.8
0.5
0.6
0.2
0.3
0.5
0.3
0.5

1
1
0.6
1
0.9
1
1
0.8
1
0.8
1
0.8
0.8
0.8
1
0.5
0.8
0.8
1
0.8
1
0.6
0.9
1
1
1
1
1

0.7
0.5
0.6
0.7
0.4
0.7
0.7
0.6
0.8
0.7
0.7
0.5
0.8
0.8
0.8
0.7
0.5
1
0.7
0.8
0.7
0.7
0.6
0.7
0.5
0.7
0.5
0.7
0.8

0.8
0.9
0.9
0.8
0.9
0.6
0.8
0.6
0.8
0.9
1
1
1
0.9
0.8
0.8
0.9
0.9
1
0.8
0.8
0.7
0.7
0.6
0.8
0.6
0.8
0.6
1
1

0.8
0.8
0.6
0.8
0.8
0.8
0.7
0.8
0.7
0.8
0.8
0.8
0.7
0.6
0.7
0.3
0.8
0.8
0.8
0.8
0.8
0.4
0.6
0.8
0.7
0.7
0.8
0.7
0.8
0.7
1

63

Anexo 8. Distribucin espacial de los grupos conformados por las accesiones de lulo en
Colombia.

A
B
C
Fuente: www.ub.es/.../Colombia/dades/colombiamap.htm.

64

Anexo 9. Estimacin de la concentracin y calidad del ADN de tomate de rbol, a


travs de la lectura de absorbancia de rayos UV (260/280 nm).
Accesin
06TA001
06TA004
06TA007
06TA008
06TA009
06TA010
06TA011
06TA013
06TA014
06TA015
06TA016
06TA018
06TA020
06TA022
06TA023
06TA024
06TA025
06TA026
06TA028
06TA031
06TA032
06TA033
06TA034
06TA035
06TA039
06TA041
06TA042
06TA045
06TA047
06TA050

Concentracin
(ng/L)
896.10
431.51
318.30
175.04
216.16
522.29
170.23
320.40
967.05
237.47
658.51
148.76
270.06
665.18
503.98
589.93
564.03
380.10
354.31
391.50
630.62
233.12
602.50
611.21
672.34
463.74
228.24
1170.2
248.81
385.77

65

Calidad
(260/280 nm)
1.72
1.64
1.50
1.41
1.70
1.63
1.85
1.46
1.62
1.71
1.72
1.41
1.35
1.47
1.59
1.70
1.71
1.47
1.76
1.64
1.59
1.62
1.52
1.36
1.69
1.44
1.59
1.72
1.58
1.62

Anexo 10. Allo (s) presentes en cada accesin de tomate de rbol. A cada allo
observado por locus se le dio una connotacin numrica.
Accesin
06TA042
06TA001
06TA004
06TA007
06TA008
06TA009
06TA010
06TA011
06TA013
06TA014
06TA015
06TA016
06TA018
06TA020
06TA022
06TA023
06TA024
06TA025
06TA026
06TA028
06TA031
06TA032
06TA033
06TA034
06TA035
06TA039
06TA041
06TA045
06TA047
06TA050
Total de
alelos

C2_At1g71810
1, 6
8
6
5
6
6
6
5
6
7
6
5
5
6
5
4
2
7
5
5
5
4
3
3
8
6
6
7
6
6

C2_At4g00090
1
8
8
8
8
3
8
4
4
3
4
5
3
8
5
3
6
3
3
3
6
3
3
8
8
8
2
7
4
3

C2_At4g32930
8
9
7
9
3
3
3
2
3
3
3
5
2
1
4
3
6
6
3
4
5
4
5
9
9
3
4
4
4
3

C2_At3g15430
1
1
3
1
3
2
1
3
3
4
3
5
4
4
4
5
4
4
6
4
5
5
4
3
6
5
3
3
2
1

C2_At1g44760
8
2
1
4
4
4
4
4
5
6
4
4
4
3
4
4
5
4
4
4
5
4
4
4
8
8
2
7
3
7

66

Anexo 11. ndices de diversidad de acuerdo a Nei (1978) e ndices de fijacin de


acuerdo a Wright (1921) por cada loci analizado en tomate de rbol
FIS1
FIT2
Locus
HI1
HS2
H3
C2_At1g71810
0.02
0.76
0.98
1.0
1.0
C2_At4g00090
0.0
0.77
1.0
0.50
0.99
C2_At4g32930
0.0
0.81
1.0
0.50
0.99
C2_At3g15430
0.0
0.79
1.0
0.50
0.99
C2_At1g44760
0.0
0.68
1.0
0.50
0.99
0.004
0.76
0.99
0.60
0.99
Promedio
1
2
3
4
Heterocigocidad observada, Heterocigocidad esperada, Indice de diversidad, Coeficiente de
endogamia, 4Coeficiente de endogamia total, 6Indice de fijacin subpoblacional.

67

FST3
1.0
0.99
0.99
0.99
0.99
0.99

Anexo 12. Matriz de distancias gnicas en tomate de rbol utilizando la mnima distancia de Nei (1978). Se relacionan los dos ltimos nmeros de cada
accesin.
Acce.
01
04
07
08
09
10
11
13
14
15
16
18
20
22
23
24
25
26
28
31
32
33
34
35
39
41
42
45
47
50

01

04

07

08

09

10

11

13

14

15

16

18

20

22

23

24

25

26

28

31

32

33

34

35

39

41

42

45

47

50

0,8

0,4

0,8

0,6

0,8

0,6

0,4

0,8

0,8

0,75

0,8

0,8

0,4

0,8

0,6

0,8

0,6

0,6

0,6

0,6

0,8

0,6

0,6

0,85

0,8

0,8

0,8

0,6

0,8

0,4

0,6

0,8

0,6

0,6

0,8

0,6

0,8

0,8

0,6

0,6

0,8

0,8

0,8

0,4

0,6

0,8

0,75

0,8

0,4

0,2

0,6

0,4

0,8

0,2

0,8

0,8

0,6

0,8

0,6

0,8

0,6

0,8

0,8

0,8

0,4

0,8

0,4

0,6

0,85

0,8

0,8

0,6

0,4

0,8

0,6

0,6

0,4

0,8

0,6

0,8

0,8

0,4

0,6

0,4

0,6

0,6

0,6

0,8

0,6

0,8

0,85

0,6

0,4

0,6

0,8

0,4

0,8

0,8

0,6

0,8

0,6

0,8

0,6

0,8

0,8

0,8

0,6

0,8

0,4

0,8

0,65

0,8

0,4

0,6

0,4

0,6

0,4

0,6

0,8

0,8

0,6

0,6

0,8

0,8

0,8

0,6

0,8

0,95

0,8

0,8

0,8

0,2

0,8

0,8

0,8

0,8

0,8

0,8

0,6

0,6

0,85

0,8

0,6

0,6

0,6

0,8

0,8

0,6

0,8

0,4

0,6

0,6

0,8

0,6

0,8

0,95

0,8

0,6

0,8

0,8

0,8

0,8

0,6

0,8

0,6

0,8

0,8

0,8

0,6

0,6

0,6

0,85

0,8

0,6

0,6

0,6

0,4

0,6

0,8

0,6

0,6

0,4

0,6

0,6

0,8

0,8

0,95

0,8

0,4

0,6

0,8

0,4

0,4

0,2

0,8

0,6

0,4

0,8

0,95

0,8

0,8

0,8

0,8

0,8

0,8

0,8

0,6

0,8

0,85

0,6

0,8

0,8

0,8

0,6

0,6

0,2

0,8

0,6

0,6

0,8

0,8

0,95

0,8

0,8

0,6

0,4

0,6

0,8

0,2

0,6

0,8

0,6

0,95

0,6

0,8

0,6

0,8

0,95

0,6

0,4

0,6

0,4

0,8

0,95

0,8

0,8

0,4

0,8

0,6

0,6

0,8

0,8

0,8

0,95

0,6

0,8

0,4

0,4

0,8

0,8

0,95

0,8

0,8

0,8

0,8

0,8

0,8

0,95

0,6

0,8

0,8

0,8

0,95

0,8

0,8

0,8

0,8

0,8

0,8

0,6

0,6

0,95

0,8

0,6

0,8
0,6

0,8
1

0,95
0,75

0,8
1

1
1

1
1

0,8

0,65

0,8

0,6

0,85

0,6

0,6

0,8

0,95

0,85

0,65

0,8

0,8
0,8

68

Anexo 13. Distribucin espacial de los grupos conformados por las accesiones de
tomate de rbol en Colombia.

A
B
C
D
E
F
G
H
I
J
K
Fuente: www.ub.es/.../Colombia/dades/colombiamap.htm.

69