Está en la página 1de 130

Reforma Integral de la Educacin Media Superior

Biologa 1

Tercer Semestre

COLEGIO DE BACHILLERES
DEL ESTADO DE SONORA
Director General
Profr. Julio Alfonso Martnez Romero
Director Acadmico
Dr. Manuel Valenzuela Valenzuela
Director de Administracin y Finanzas
C.P. Jess Urbano Limn Tapia
Director de Planeacin
Ing. Ral Leonel Durazo Amaya
BIOLOGA 1
Mdulo de Aprendizaje.
Copyright 2014 por Colegio de Bachilleres
del Estado de Sonora
todos los derechos reservados.
Primera edicin 2014. Impreso en Mxico.
DIRECCIN ACADMICA
Departamento de Innovacin y
Desarrollo de la Prctica Docente.
Blvd. Agustn de Vildsola, Sector Sur.
Hermosillo, Sonora, Mxico. C.P. 83280

COMPONENTE:

CAMPO DE CONOCIMIENTO:

HORAS SEMANALES:

CRDITOS:

FORMACIN BSICA

04

CIENCIAS
EXPERIMENTALES

08

COMISIN ELABORADORA
Elaboradores:
Julia Isabel Ramos de los Ros
Francisco Javier Reprieto Rodrguez
Correccin de estilo:
Hctor Matilde BarrerasVelasco
Diseo Grfico:
Yolanda Yajaira Carrasco Mendoza
Edicin:
Mara Jess Jimnez Duarte
Coordinacin Tcnica:
Rubisela Morales Gispert
Supervisin Acadmica:
Vanesa Guadalupe Angulo Bentez

DATOS DEL ALUMNO


Nombre:
Plantel:

Coordinacin General:
Dr. Manuel Valenzuela Valenzuela

Grupo:

Esta publicacin se termin de imprimir durante el mes de octubre de 2014.


Diseada en Direccin Acadmica del Colegio de Bachilleres del Estado de Sonora.
Blvd. Agustn de Vildsola, Sector Sur. Hermosillo, Sonora, Mxico.
La edicin consta de 10,000 ejemplares.

Domicilio:

Turno:

Telfono:

E-mail:

PRELIMINARES

Joven estudiante del COBACH:

Emprender este nuevo reto educativo que se encuentra ante ti, es una oportunidad virtuosa para
tu formacin como ser humano comprometido con su entorno, para construir tu proyecto de
vida con bases acadmicas slidas y una visin que ample tus horizontes.
Como joven adolescente y miembro activo de esta sociedad que se transforma, vives la bsqueda
de trascender y ser reconocido por tus logros, y para ello el Colegio de Bachilleres ser tu mejor
aliado, ofrecindote no slo la atencin cercana de nuestros docentes y personal administrativo,
sino tambin, la infraestructura necesaria para desarrollar tus talentos y habilidades.
Tu decisin de ser parte de una institucin de educacin media superior que forma campeones
en las diversas ramas de conocimiento, el arte, la cultura y el deporte, es un gran mrito y te
felicito por pertenecer a esta preparatoria lder en el Estado de Sonora.
Te invito a que te apliques con entusiasmo y verdadero compromiso en esta etapa fundamental
en tu formacin, en donde se requiere del esfuerzo de todos: tu familia, tus maestros y el tuyo
propio, para construir el Sonora Educado que no merecemos y que podemos juntos hacer posible.
El Colegio de Bachilleres tiene especial inters en ofrecerle los medios necesarios para formarte
como un estudiante ntegro y competente. Nos interesa proveerte de herramientas tiles, ya que
la educacin no slo es acumular conocimiento, sino tambin implica prepararte para la interaccin humana y social.
La prctica de los valores humanos, el uso de las nuevas tecnologas y tu insercin en la multidisciplinariedad, sern ambiente propicio para construir en ti, un estudiante competitivo, con
mltiples habilidades y destrezas personales, preparado para enfrentar los desafos de la gran
transformacin que vive nuestro Estado.
Te exhorto a aprovechar al mximo esta gran oportunidad que tienes de sumarte a los jvenes
mexicanos que se preparan para asumir otras responsabilidades futuras, orientadas a tu preparacin profesional y que, con entusiasmo y empeo, culmines este ciclo visualizndote triunfador y exitoso.

Una competencia es la integracin de habilidades, conocimientos y actitudes en un contexto especfico.


El enfoque en competencias considera que los conocimientos por s mismos no son lo ms importante, sino el
uso que se hace de ellos en situaciones especficas de la vida personal, social y profesional. De este modo, las
competencias requieren una base slida de conocimientos y ciertas habilidades, los cuales se integran para
un mismo propsito en un determinado contexto.
El presente Mdulo de Aprendizaje de la asignatura de Biologa 1, es una herramienta de suma importancia,
que propiciar tu desarrollo como persona visionaria, competente e innovadora, caractersticas que se
establecen en los objetivos de la Reforma Integral de Educacin Media Superior que actualmente se est
implementando a nivel nacional.
El Mdulo de aprendizaje es uno de los apoyos didcticos que el Colegio de Bachilleres te ofrece con la
intencin de estar acorde a los nuevos tiempos, a las nuevas polticas educativas, adems de lo que demandan
los escenarios local, nacional e internacional; el mdulo se encuentra organizado a travs de bloques de
aprendizaje y secuencias didcticas. Una secuencia didctica es un conjunto de actividades, organizadas en
tres momentos: Inicio, desarrollo y cierre. En el inicio desarrollars actividades que te permitirn identificar
y recuperar las experiencias, los saberes, las preconcepciones y los conocimientos que ya has adquirido
a travs de tu formacin, mismos que te ayudarn a abordar con facilidad el tema que se presenta en el
desarrollo, donde realizars actividades que introducen nuevos conocimientos dndote la oportunidad de
contextualizarlos en situaciones de la vida cotidiana, con la finalidad de que tu aprendizaje sea significativo.
Posteriormente se encuentra el momento de cierre de la secuencia didctica, donde integrars todos los
saberes que realizaste en las actividades de inicio y desarrollo.
En todas las actividades de los tres momentos se consideran los saberes conceptuales, procedimentales y
actitudinales. De acuerdo a las caractersticas y del propsito de las actividades, stas se desarrollan de forma
individual, grupal o equipos.
Para el desarrollo del trabajo debers utilizar diversos recursos, desde material bibliogrfico, videos,
investigacin de campo, etc.
La retroalimentacin de tus conocimientos es de suma importancia, de ah que se te invita a participar de
forma activa cuando el docente lo indique, de esta forma aclarars dudas o bien fortalecers lo aprendido;
adems en este momento, el docente podr tener una visin general del logro de los aprendizajes del grupo.
Recuerda que la evaluacin en el enfoque en competencias es un proceso continuo, que permite recabar
evidencias a travs de tu trabajo, donde se tomarn en cuenta los tres saberes: el conceptual, procedimental
y actitudinal con el propsito de que apoyado por tu maestro mejores el aprendizaje. Es necesario que realices
la autoevaluacin, este ejercicio permite que valores tu actuacin y reconozcas tus posibilidades, limitaciones
y cambios necesarios para mejorar tu aprendizaje.
As tambin, es recomendable la coevaluacin, proceso donde de manera conjunta valoran su actuacin, con
la finalidad de fomentar la participacin, reflexin y crtica ante situaciones de sus aprendizajes, promoviendo
las actitudes de responsabilidad e integracin del grupo.
Nuestra sociedad necesita individuos a nivel medio superior con conocimientos, habilidades, actitudes y
valores, que les permitan integrarse y desarrollarse de manera satisfactoria en el mundo laboral o en su
preparacin profesional. Para que contribuyas en ello, es indispensable que asumas una nueva visin y actitud
en cuanto a tu rol, es decir, de ser receptor de contenidos, ahora construirs tu propio conocimiento a travs
de la problematizacin y contextualizacin de los mismos, situacin que te permitir: Aprender a conocer,
aprender a hacer, aprender a ser y aprender a vivir juntos.
6

PRELIMINARES

EVALUACIN DIAGNSTICA
Representa la Evaluacin Diagnstica, la que te
permitir estar consciente de tus conocimientos acerca
del tema a abordar.

COEVALUACIN
cono de Coevaluacin, donde debers evaluar a tu
compaero y l te evaluar a ti.

EVALUACIN DE LA ACT. INT.


ACTIVIDAD INTEGRADORA
En esta seccin realizars la Actividad Integradora,
la cual ser tu proyecto durante todo el semestre,
pondrs en prctica tus conocimientos y fortalecers tu
aprendizaje.

Con este cono reconocers la Evaluacin de la Actividad


Integradora, donde se valorar tu desempeo.

PORTAFOLIO DE EVIDENCIAS
El Portafolio de Evidencias lo encontrars al finalizar
cada bloque, aqu se especifican cules actividades
debes incluir y entregar a tu profesor para que te evale.

ACTIVIDAD 1
SD1-B1

Con este grfico identificars las Actividades de


Aprendizaje dentro del texto, con las cuales optimizars
los conocimientos aprendidos. Debajo del cono sabrs
la secuencia y bloque al que pertenece y arriba se indica
si dicha actividad es individual, en equipo o grupal.
conos para indicar si una actividad es:
Individual

En Equipo

REACTIVOS DE CIERRE
En este espacio encontrars los Reactivos de Cierre, con
los cuales reforzars los conocimientos que adquiriste
durante el bloque y desarrollars tus habilidades.

GLOSARIO
Grupal

Con esta ilustracin localizaremos el Glosario, ya sea


dentro del texto o al final del libro. Ser tu ayuda para
conocer nuevos conceptos y comprender mejor las
lecturas.

EVALUACIN DE ACTIVIDADES
En este apartado encontrars la Evaluacin de
Actividades, donde tu profesor calificar tu desempeo.

FUENTES DE INFORMACIN
til para tener referencias sobre el contenido de tus libros,
adems que podrs utilizar las Fuentes para tener ms
herramientas que perfeccionen tu desempeo acadmico.

AUTOEVALUACIN
cono de Autoevaluacin en este espacio tendrs que
evaluarte a ti mismo honestamente y te dars cuenta
de los conocimientos que has adquirido as como de tus
fallas.

NOTA ENFTICA
En Nota Enftica podrs encontrar contenido importante
que complementar tu aprendizaje.

PRELIMINARES

Secuencia didctica 1: Biologa: como ciencia...........................................................................................15


Secuencia didctica 2: Relacin entre la biologa y otras disciplinas ........................................................19
Secuencia didctica 3: Niveles de organizacin de la materia viva............................................................26
Qumico................................................................................................................................................27
Celular...................................................................................................................................................27
Tisular..................................................................................................................................................27
Orgnico...............................................................................................................................................27
Individual..............................................................................................................................................27
Ecolgico..............................................................................................................................................27
Secuencia didctica 4: Caractersticas de la ciencia.....................................................................................30
Sistemtica...........................................................................................................................................32
Metdica.............................................................................................................................................. 32
Objetiva................................................................................................................................................32
Verificable.............................................................................................................................................32
Modificable...........................................................................................................................................32
Secuencia didctica 5: Caractersticas del mtodo cientfico aplicado a la Biologa...................................34

BLOQUE 3

BLOQUE 2

IDENTIFICAS LAS CARACTERSTICAS Y LOS COMPONENTES


DE LOS SERES VIVOS.................................................................................................... 49

Secuencia didctica 1: Caractersticas de los seres vivos...........................................................................52


Estructura............................................................................................................................................53
Organizacin.........................................................................................................................................54
Metabolismo........................................................................................................................................57
Homeostasis.........................................................................................................................................57
Irritabilidad...........................................................................................................................................57
Reproduccin.......................................................................................................................................59
Crecimiento........................................................................................................................................59
Adaptacin.........................................................................................................................................59
Secuencia didctica 2: Propiedades del agua y su relacin con los procesos en los seres vivos................61
Secuencia didctica 3: Estructura y funcin de biomolculas orgnicas....................................................66
Carbohidratos.......................................................................................................................................67
Lpidos..................................................................................................................................................76
Protenas..............................................................................................................................................84
cidos nucleicos....................................................................................................................................88
Secuencia didctica 4: ADN.....................................................................................................................92
Estructura............................................................................................................................................92
Replicacin...........................................................................................................................................96
ARN y sntesis de protenas...................................................................................................................98
Secuencia didctica 5: Cdigo gentico.....................................................................................................105

B3 cont.

DESCRIBES EL METABOLISMO DE LOS SERES VIVOS................................................. 169

Secuencia didctica 1: Tipos de energa..................................................................................................170


Secuencia didctica 2: Reacciones exotrmicas y endotrmicas...........................................................173
Secuencia didctica 3: Adenosintrifosfato (ATP).....................................................................................175
Estructura y funcin.............................................................................................................................175
Ciclo del ATP........................................................................................................................................176
Secuencia didctica 4: Metabolismo.......................................................................................................178
Enzimas..............................................................................................................................................178
Catabolismo y anabolismo...................................................................................................................180
Procesos anablicos............................................................................................................................180
Secuencia didctica 5: Quimiosntesis ......................................................................................................181
Secuencia didctica 6: Fotosntesis .......................................................................................................183
Secuencia didctica 7: Respiracin celular .............................................................................................188
Secuencia didctica 8: Fermentacin .......................................................................................................193
Nutricin auttrofa: quimiosntesis-fotosntesis..................................................................................195
Nutricin hetertrofa: holozoica, sapfita y parsita..........................................................................195

BLOQUE 4

BLOQUE 1

RECONOCES A LA BIOLOGA COMO LA CIENCIA DE LA VIDA............................................ 13

Secuencia didctica 6: Clulas eucariotas................................................................................................151


Clula vegetal......................................................................................................................................152
Clula animal.......................................................................................................................................152
Secuencia didctica 7: Procesos celulares...............................................................................................155

VALORAS LA BIODIVERSIDAD E IDENTIFICAS ESTRATEGIAS PARA PRESERVARLA.......... 207

Secuencia didctica 1: Virus.....................................................................................................................209


Composicin qumica..........................................................................................................................210
Formas de replicacin..........................................................................................................................213
Criterios para clasificarlos....................................................................................................................214
Ejemplos de enfermedades que ocasionan........................................................................................214
Secuencia didctica 2: Clasificacin de los seres vivos .........................................................................216
Linneo.................................................................................................................................................218
Wittaker..............................................................................................................................................219
Wosse.................................................................................................................................................221
Secuencia didctica 3: Dominio Archaea..................................................................................................224
Caractersticas generales.....................................................................................................................224
Secuencia didctica 4: Dominio Eubacteria...............................................................................................226
Estructura...........................................................................................................................................227
Reproduccin.....................................................................................................................................228
Respiracin.........................................................................................................................................230
Nutricin............................................................................................................................................231
Formas: cocos, bacilos, entre otros.......................................................................................................232
Secuencia didctica 5: Dominio Eukaria...................................................................................................234
Tipos celular........................................................................................................................................234
Forma de nutricin..............................................................................................................................246
Niveles de organizacin (unicelulares o pluricelulares).........................................................................246
Medio en que viven..............................................................................................................................246
Secuencia didctica 6: Clasificacin..........................................................................................................248

BLOQUE 5

Presentacin del libro....................................................................................................................................................... 6


Glosario Icnico............................................................................................................................................................... 7
Competencias Genricas............................................................................................................................................... 10
Competencias Disciplinarias Bsicas........................................................................................................................... 11
Mapa de contenido......................................................................................................................................................... 12

RECONOCES A LA CLULA COMO UNIDAD DE LA VIDA...............................................123


Secuencia didctica 1: La clula................................................................................................................125
Secuencia didctica 2: Teora Celular.........................................................................................................126
Secuencia didctica 3: Teoras de la evolucin celular...............................................................................130
Secuencia didctica 4: Tipos celulares......................................................................................................139
Procariota...........................................................................................................................................140
Eucariota............................................................................................................................................141
Secuencia didctica 5: Estructura y funcin de las clulas procariota y eucariota..................................144

PRELIMINARES

PRELIMINARES

10

Se conoce y valora a s mismo y aborda problemas y retos teniendo en cuenta


los objetivos que persigue.

Es sensible al arte y participa en la apreciacin e interpretacin de sus


expresiones en distintos gneros.

Establece la interrelacin entre la ciencia, la tecnologa, la sociedad y el


ambiente en contextos histricos y sociales especficos.

Elige y practica estilos de vida saludables.

Fundamenta opiniones sobre los impactos de la ciencia y la tecnologa en su


vida cotidiana, asumiendo consideraciones ticas.

Escucha, interpreta y emite mensajes pertinentes en distintos contextos


mediante la utilizacin de medios, cdigos y herramientas apropiados.

Identifica problemas, formula preguntas de carcter cientfico y plantea las


hiptesis necesarias para responderlas.

Desarrolla innovaciones y propone soluciones a problemas a partir de mtodos


establecidos.

Obtiene, registra, sistematiza la informacin para responder a preguntas de


carcter cientfico, consultando fuentes relevantes y realizando experimentos
pertinentes.

Contrasta los resultados obtenidos en una investigacin o experimento con


hiptesis previas y comunica sus conclusiones.

Sustenta una postura personal sobre temas de inters y relevancia general,


considerando otros puntos de vista de manera crtica y reflexiva.

5
6

Valora las preconcepciones personales o comunes sobre diversos fenmenos


naturales a partir de evidencias cientficas.

Aprende por iniciativa e inters propio a lo largo de la vida.

Explicita las nociones cientficas que sustentan los procesos para la solucin
de problemas cotidianos.

Participa y colabora de manera efectiva en equipos diversos.

Explica el funcionamiento de mquinas de uso comn a partir de nociones


cientficas.

Participa con una conciencia cvica y tica en la vida de su comunidad, regin,


Mxico y el mundo.

Disea modelos o prototipos para resolver problemas, satisfacer necesidades


o demostrar principios cientficos.

10

Mantiene una actitud respetuosa hacia la interculturalidad y la diversidad de


creencias, valores, ideas y prcticas sociales.

10

Relaciona las expresiones simblicas de un fenmeno de la naturaleza y


los rasgos observables a simple vista o mediante instrumentos o modelos
cientficos.

11

Contribuye al desarrollo sustentable de manera crtica, con acciones


responsables.

11

Analiza las leyes generales que rigen el funcionamiento del medio fsico y
valora las acciones humanas de riesgo e impacto ambiental.

PRELIMINARES

BLOQUES DE APRENDIZAJE

COMPETENCIAS DISCIPLINARES BSICAS


DEL CAMPO DISCIPLINAR DE HUMANIDADES

II

PRELIMINARES

III

IV

11

BIOLOGA 1




RECONOCES A LA
BIOLOGA COMO
LA CIENCIA DE LA
VIDA

IDENTIFICAS LAS
CARACTERSTICAS
Y LOS
COMPONENTES DE
LOS SERES VIVOS

RECONOCES A LA
CLULA COMO
UNIDAD DE LA
VIDA

DESCRIBES EL
METABOLISMO DE
LOS SERES VIVOS

VALORAS LA
BIODIVERSIDAD
E IDENTIFICAS
ESTRATEGIAS PARA
PRESERVARLA

12

BIOLOGA: COMO CIENCIA


RELACIN ENTRE LA BIOLOGA Y OTRAS DISCIPLINAS
NIVELES DE ORGANIZACIN DE LA MATERIA VIVA
CARACTERSTICAS DE LA CIENCIA
CARACTERSTICAS DEL MTODO CIENTFICO APLICADO A LA BIOLOGA

CARACTERSTICAS DE LOS SERES VIVOS


PROPIEDADES DEL AGUA Y SU RELACIN CON LOS PROCESOS EN LOS

SERES VIVOS

ESTRUCTURA Y FUNCIN DE BIOMOLCULAS ORGNICAS


ADN
CDIGO GENTICO

LA CLULA
TEORA CELULAR
TEORAS DE LA EVOLUCIN CELULAR
TIPOS CELULARES
ESTRUCTURA Y FUNCIN DE LAS CLULAS PROCARIOTA Y EUCARIOTA
CLULAS EUCARIOTAS
PROCESOS CELULARES
RESPIRACIN CELULAR
FERMENTACIN

TIPOS DE ENERGA
REACCIONES ENDO Y EXOTRMICAS
ADENOSINTRIFOSFATO (ATP)
METABOLISMO
QUIMIOSNTESIS
FOTOSNTESIS
RESPIRACIN CELULAR
FERMENTACIN

VIRUS
CLASIFICACIN DE LOS SERES VIVOS
DOMINIO ARCHAEA
DOMINIO EUBACTERIA
DOMINIO EUKARIA
CLASIFICACIN

PRELIMINARES

BLOQUE 1

Reconoces a la biologa como la ciencia de la vida

Desempeo del estudiante


al finalizar el bloque
Identifica el campo de estudio de la biologa y

su interrelacin con otras ciencias.


Reconoce las aplicaciones de la biologa en
su vida cotidiana y el impacto ambiental,
social y econmico de sus aplicaciones.
Reconoce el carcter cientfico de la biologa.

Tiempo asignado: 6 horas

Objetos de aprendizaje
Biologa: como ciencia
Relacin entre biologa y otras disciplinas
Niveles de organizacin de la materia viva:

Qumico
Celular
Tisular
Orgnico
Individual
Ecolgico
Caractersticas de la ciencia:
Sistemtica
Metdica
Objetiva

Competencias a desarrollar
Elige las fuentes de informacin ms relevantes

para establecer la interrelacin entre la ciencia,


la tecnologa, la sociedad y el ambiente en
contextos histricos y sociales especficos.
Fundamenta opiniones sobre los impactos de
la ciencia y la tecnologa en su vida cotidiana,
asumiendo consideraciones ticas.
De manera general o colaborativa, identifica
problemas, formula preguntas de carcter
cientfico y plantea las hiptesis necesarias para
responderlas.
Utiliza las tecnologas de la informacin y
la comunicacin para obtener, registrar y
sistematizar informacin para responder a
preguntas de carcter cientfico, consultando
fuentes relevantes y/o realizando experimentos
pertinentes.
Contrasta los resultados obtenidos en una
investigacin o experimento con hiptesis
previas y comunica sus conclusiones aportando
puntos de vista con apertura y considerando los
de otras personas de manera reflexiva.
Define metas y da seguimiento a sus procesos
de construccin del conocimiento explicitando
las nociones cientifcas para la solucin de
problemas cotidianos.
Relaciona los niveles de organizacin qumica,
biolgica, fsica y ecolgica de los sistemas vivos.
Aplica normas de seguridad en el manejo
de sustancias, instrumentos y equipo en la
realizacin de actividades de su vida cotidiana.

Biologa 1

EVALUACIN DIAGNSTICA

Instruccin: La siguiente actividad tiene el propsito de que identifiques los conocimientos que posees antes de
aventurarte en este interesante curso. Contstalas de forma individual y una vez concluida participa en la dinmica
grupal que realizar tu maestro.
1.- Cules son los vocablos que forman a la palabra Biologa?
__________________________________________________________________________________________
_______________________________________________________________________________
2.- Por qu crees que el hombre se interes por el estudio de la Biologa?
__________________________________________________________________________________________
_______________________________________________________________________________
3.- Anota tres seres vivos presentes en tu entorno que causen dao a tu salud.
__________________________________________________________________________________________
_______________________________________________________________________________
4.- Define con tus propias palabras el significado de ciencia.
__________________________________________________________________________________________
_______________________________________________________________________________
5.- La Biologa es una ciencia factual o formal? Por qu?

Inicio

Secuencia didctica 1
BIOLOGA COMO CIENCIA

ACTIVIDAD 1
SD1-B1

1. Define qu es un ser vivo.


__________________________________________________________________________________________
__________________________________________________________________________________________
_______________________________________________________________________________
2. Mencionen tres descubrimientos cientficos que correspondan al campo de estudio de la Biologa.
__________________________________________________________________________________________
__________________________________________________________________________________________
_______________________________________________________________________________
3. Es necesario conservar la naturaleza? Por qu?
__________________________________________________________________________________________
__________________________________________________________________________________________
_______________________________________________________________________________

__________________________________________________________________________________________
_______________________________________________________________________________
6.- Por qu es importante la Biologa en nuestra vida cotidiana?
__________________________________________________________________________________________
_______________________________________________________________________________
7.- Explica cmo se aplica el mtodo cientfico para resolver problemticas de nuestro entorno.
__________________________________________________________________________________________
_______________________________________________________________________________
8.- Se le llama as a la unidad fundamental que constituye a todo ser vivo.
__________________________________________________________________________________________
_______________________________________________________________________________
9.- Anota la rama de la Biologa que estudia a las plantas y animales.
__________________________________________________________________________________________
_______________________________________________________________________________
10.- Cul es la diferencia entre adaptacin y evolucin?
__________________________________________________________________________________________
_______________________________________________________________________________

14

Colegio de Bachilleres del Estado de Sonora

Desarrollo

Desde tiempos inmemoriales, el ser humano ha tenido la inquietud de conocer, describir y


explicar los fenmenos relacionados con la vida; por esta razn naci la Biologa. En un
principio, fue una disciplina predominantemente descriptiva que consista en hacer un largo
inventario de todas las especies de plantas y animales del planeta.
La palabra Biologa se deriva de los vocablos griegos bios, que significa vida y logos,
que significa estudio o tratado; por lo tanto, etimolgicamente hablando Biologa es el
estudio o tratado de la vida. No obstante, su concepto es complejo, se le define como la
ciencia encargada del estudio de los seres vivos, a partir de su estructura, origen, desarrollo
y funciones especficas.
Es una disciplina que forma parte de nuestra vida diaria. Por ejemplo, hoy camino a la
escuela seguro viste una variedad de rboles y animales, o bien, escuchaste sobre grupos de
investigadores que estn trabajando sobre vacunas contra el virus de la influenza AH1N1.
Con todo esto, concebimos que la biologa, por lo tanto, naci de la curiosidad del ser
humano por entender los fenmenos relacionados con la vida y por describir todo el mundo
vivo que tena a su alrededor.
A travs del tiempo, la biologa ha ido avanzando hasta posicionarse como una ciencia de
vanguardia gracias a los grandes avances tecnolgicos. Esto ha permitido tener grandes

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

15

Biologa 1

descubrimientos como conocer a las molculas de la vida, controlar enfermedades que


antes nos asolaban, desarrollar nuevas estrategias para la produccin de alimentos, entre
otros ejemplos. Debido a estos avances la Biologa resulta indispensable en el desarrollo de
muchas actividades humanas y para el ejercicio de varias profesiones cientficas.
Uno de los ms grandes avances dentro del rea de la biologa fue el descubrimiento de la
estructura y la replicacin del cido desoxirribonucleico (ADN), que es la molcula de la
vida ya que guarda toda la informacin hereditaria. Este descubrimiento fue hecho por los
investigadores James D Watson (1928) y Francis Crick (1916-2004) y que gracias a esa
aportacin fueron galardonados con el premio Nobel en el ao de 1953.

ACTIVIDAD 3
SD1-B1

Instruccin: Realiza una investigacin sobre los antecedentes histricos de la Biologa y elabora una lnea del
tiempo.

ACTIVIDAD 2
SD1-B1

Instruccin: Organzate en equipo de tres integrantes y contesten los siguientes cuestionamientos. Al concluirla
participen en la dinmica grupal y atiendan la retroalimentacin guiada por tu maestro.
1. Anoten y describan tres situaciones de nuestra vida cotidiana que sean estudiadas por la Biologa.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
_______________________________________________________________________________
2. Describe algn descubrimiento de la biologa que haya mejorado la vida de las personas.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
_______________________________________________________________________________
3. Anota y describe algn aspecto relacionado con la biologa que an falta por ser comprendido o solucionado
en beneficio de nuestra sociedad.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
_______________________________________________________________________________

16

Colegio de Bachilleres del Estado de Sonora

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

17

Biologa 1

Cierre

Inicio

Secuencia didctica 2
RELACIN ENTRE LA BIOLOGA Y OTRAS DISCIPLINAS

ACTIVIDAD 4

ACTIVIDAD 1

Lee con atencin la siguiente informacin: Actualmente, una de las caractersticas de las nuevas formas de
representar e interpretar nuestro mundo es el lenguaje audiovisual y sus distintas manifestaciones. Youtube es un
sitio web en el cual los usuarios pueden subir y compartir este lenguaje por medio de videos personales, videos
musicales, clips de pelculas, entre otros.

Instruccin: Intgrate en un equipo de seis personas y asuman cada uno, una de las siguientes profesiones:
gegrafo, historiador, matemtico, qumico, bilogo e informtico.

SD2-B1

SD1-B1

Si exploras en los videos temas como la multiplicacin del virus VIH, la fotosntesis, la observacin al microscopio
de un organismo que produce alguna enfermedad, la evolucin de las iguanas en las islas galpagos o un mono
recin nacido que imita a una persona, pueden servirte para entender los innumerables tpicos que estudia la
biologa.
Luego de analizar algunos de estos videos, responde las siguientes preguntas:

Imaginemos que se encuentran frente al problema que surgi recientemente en Mxico, en relacin con la epidemia
de influenza AH1N1, que despus se convirti en pandemia al esparcirse por distintos pases del mundo.
Cada uno de los integrantes del equipo, de acuerdo a su profesin, deber discutir y plantear las posibles alternativas
de solucin o atencin a esta problemtica.
Finalmente escribirn sus alternativas en la siguiente tabla y compartirn su trabajo con los dems equipos.
Profesin

Alternativas de solucin o atencin

1. Cmo se relaciona la tecnologa con la biologa?


__________________________________________________________________________________________
__________________________________________________________________________________________

Gegrafo

__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

Historiador

__________________________________________________________________________________________
__________________________________________________________________________________________
_______________________________________________________________________________

Bilogo

2. Por qu la biologa es capaz de englobar fenmenos naturales tan diferentes?


_________________________________________________________________________________________
_________________________________________________________________________________________

Qumico

__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

Matemtico

__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________

Informtico

Fuente: Gama (2011)

18

Colegio de Bachilleres del Estado de Sonora

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

19

Biologa 1

Desarrollo

Como se ha mencionado anteriormente, la Biologa estudia a los seres vivos y lo que


con ellos se relaciona, mostrando la amplitud y complejidad que caracteriza a nuestro
planeta. Derivando con ello una amplia gama de conocimientos, por lo que ha sido
necesario crear diversas ramas o divisiones, independientemente de que el constante
progreso de la ciencia vaya desplazando los lmites de la biologa, propicindose con
cierta frecuencia, la aparicin de nuevas ramas, como es el caso de la ingeniera gentica,
que surgi gracias al avance que tuvieron los conocimientos principalmente de gentica,
biologa molecular y biofsica.

Asimismo, cada una de estas subdivisiones vuelve a dividirse en ramas ms concretas, que se integran a los grupos
mencionados.
Con base al criterio de unidad y continuidad, surgen otras ramas, las cuales se integran considerando que unidad
se refiere a todo aquello que es comn a las diversas formas de vida, como por ejemplo su organizacin qumica,
estructural y funcional, su origen y evolucin, entre otras. La continuidad hace referencia a la capacidad de los
seres vivos de perpetuar su especie, mediante el proceso de reproduccin.

Principales divisiones de la Biologa.


Actualmente se le divide a la Biologa con base a dos criterios, a saber:
1) Diversidad Taxonmica
2) Unidad y continuidad
Con referencia al primer criterio, las principales ramas se mencionan a continuacin:
Rama o divisin

Objeto de estudio

Zoologa

Animales

Botnica

Plantas

Micologa

Hongos

Protozoologa

Protozoarios

Bacteriologa

Bacterias

ACTIVIDAD 2
SD2-B1

A su vez, cada una de estas ramas se subdivide en grupos ms especficos, de acuerdo al


tipo de individuos estudiados. Por ejemplo en el caso de la zoologa tenemos:
Subrama

20

Objeto de estudio

Mastozoologa

Mamferos

Ornitologa

Aves

Herpetologa

Anfibios y reptiles

Ictiologa

Peces

Entomologa

Insectos

Carcinologa

Crustceos

Malacologa

Moluscos

Helmintologa

Gusanos planos y cilndricos

Colegio de Bachilleres del Estado de Sonora

Instrucciones: Intgrate en equipo con tres compaeros y consulta fuentes de informacin que te permitan realizar
las siguientes actividades.
1.- Investiga acerca de las subramas que componen a la Botnica, define el campo de estudio al que se enfocan,
realiza un esquema representativo de estas y antalas en la siguiente tabla.
Subrama

Objeto de estudio

Esquema representativo

Criptogmica

Fanerogmica

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

21

Biologa 1

2.- Describe el enfoque de estudio de las siguientes ramas en las que se divide la Biologa, de acuerdo al criterio
de unidad y continuidad.
Rama o divisin

Por otra parte, tambin la biologa se interrelaciona con muchas otras ciencias. Ejemplos de estas interrelaciones,
se muestran en el siguiente esquema:

Objeto de estudio

Anatoma

Citologa

Embriologa

Etologa

A estas ciencias se les conoce como auxiliares.

Evolucin

Es importante sealar que los conocimientos generados por la biologa tienen aplicacin en numerosas actividades
humanas, como por ejemplo en la medicina, veterinaria, investigacin agrcola, ganadera, pesca, conservacin de
la biodiversidad, aprovechamiento natural de los recursos naturales renovables y acuticos, problemas ecolgicos,
salud pblica, zoolgicos, jardines botnicos, museos de historia natural, acuarios, avicultura, apicultura, entre
otras.

Fisiologa

Gentica

A nivel personal, los conocimientos biolgicos nos integran como parte de los seres vivos y nos dan las bases para
comprender:
El funcionamiento de nuestro organismo.
El mecanismo de la reproduccin.
La forma de evitar enfermedades.
La accin de las vacunas.
El beneficio de practicar algn deporte.
La importancia de una buena alimentacin.
El mecanismo de la herencia.
El problema de la contaminacin.
La importancia de las plantas verdes.

Histologa

Paleontologa

Taxonoma

22

Colegio de Bachilleres del Estado de Sonora

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

23

Biologa 1

Con base a la lectura anterior, contesta los siguientes cuestionamientos:

Cierre

1. Anota las ramas de la biologa mencionadas en el texto.


__________________________________________________________________________________________
__________________________________________________________________________________________

ACTIVIDAD 3

______________________________________________________________________

SD2-B1

2. Se menciona alguna ciencia auxiliar? Cul?

Instruccin. Lee con atencin el siguiente texto:


Desarrolla la UNAM insecticida ecolgico
Muchas especies de mosquitos y otras especies de artrpodos transmiten enfermedades que afectan tanto al ser
humano como a los cultivos. A nivel mundial, las plagas destruyen aproximadamente 30% de los sembrados.
Para controlarlas se han utilizado insecticidas sintticos, pero algunas de sus propiedades, como su permanencia y
toxicidad para un amplio espectro de organismos, han provocado serios problemas ambientales. Esto ha propiciado
el desarrollo de mtodos alternos, como el control biolgico, que consiste en utilizar especies que atacan de
manera natural a organismos considerados como dainos, pero respetan a los benficos (como las abejas o las
mariposas monarca) y no afectan a los vertebrados.
El grupo que dirige la doctora Alejandra Bravo de la Parra, del Departamento de Microbiologa Celular del
Instituto de Biotecnologa de la UNAM, estudia insecticidas con estas caractersticas. Uno de los agentes de
control muy utilizados desde hace dcadas es el Bacillus thuringiensis (Bt), una bacteria usada como ingrediente
activo en insecticidas biolgicos, pero no se haban realizado estudios para entender cmo afecta la bacteria a los
insectos a nivel molecular. Bravo de la Parra ha dedicado ms de 20 aos a este fin. Descubri que el Bt produce
una serie de toxinas que ingresan al tracto digestivo del insecto y ah se solubilizan. Esto no ocurre en las aves,
peces, mamferos ni reptiles. Por lo que este agente no representa un riesgo para ellos. Dentro del organismo del
insecto, una pequea parte de las toxinas Bt, la fraccin txica, se desprende y se une a protenas que estn en el
insecto. Varias toxinas se unen y forman molculas conocidas como oligmeros, que se pegan a la membrana de
las clulas del intestino del insecto y perforan las clulas.
Bravo detect que muchos insectos se hacen inmunes a las toxinas Bt porque sus protenas carecen de un fragmento
que provoca que se desprenda la fraccin txica. La investigadora y su equipo cortaron ese segmento de la toxina
y se la administraron a insectos que ya eran resistentes al Bt. Haban encontrado la clave para crear un nuevo
bioinsecticida. Los resultados de esta investigacin se publicaron en noviembre del 2007 en la revista Science.
Alejandra Bravo de la Parra obtuvo por ello el premio LOral-UNESCO 2010, que ser entregado el 4 de marzo
prximo. Este insecticida orgnico fue patentado por la UNAM, y ya son varias las empresas en comercializarlo.
Fuente: (2009). Desarrolla la UNAM insecticida ecolgico. Cmo ves? Revista de Divulgacin UNAM. Ao 12, No. 133.

__________________________________________________________________________________________
__________________________________________________________________________________________
______________________________________________________________________
3. Cules subdivisiones se mencionan y de qu manera?
__________________________________________________________________________________________
__________________________________________________________________________________________
______________________________________________________________________
4. Por qu crees que sea importante sintetizar bioinsecticidas?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
______________________________________________________________________
5. Investiga y describe brevemente alguna investigacin semejante a la analizada en este artculo.
_______________________________________________________________________________________
______________________________________________________________________________________
______________________________________________________________________________________
______________________________________________________________________________________
______________________________________________________________________________________
______________________________________________________________________________________
______________________________________________________________________________________
______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
______________________________________________________________________________________

24

Colegio de Bachilleres del Estado de Sonora

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

25

Biologa 1

Inicio

Secuencia didctica 3
NIVELES DE ORGANIZACIN DE LA MATERIA

Nivel de
organizacin
de la materia

ACTIVIDAD 1
SD3-B1

Qumico
Instrucciones: Contesta de forma individual los siguientes cuestionamientos que a continuacin se te presentan.
1. De qu est formado todo lo que nos rodea?
__________________________________________________________________________________________
______________________________________________________________________

Celular

2. Menciona tres sistemas que formen parte de tu cuerpo.


__________________________________________________________________________________________

El inicio de la clula est


determinado en el arreglo y
organizacin de partculas
subatmicas,
tomos
y
molculas. Estos arreglos
se organizaron debido a las
fuerzas fsicas y qumicas
que actuaron sobre ellos. Tal
organizacin, desencaden el
inicio de la vida.

Subatmico: la materia se organiza en protones, neutrones


y electrones.
Atmico: las caractersticas qumicas de cada tomo que se
puedan unir a otros y formar sustancias.
Molecular: la combinacin de dos o ms tomos da origen
a la formacin de molculas sencillas o complejas como son
los carbohidratos, protenas, lpidos, cidos nucleicos, etc.
Estas biomolculas son las constituyentes de las estructuras
celulares.

Como resultado de la organizacin estructural de las sustancias se formaron las clulas. La


clula es la unidad funcional de todo ser vivo, ya sea unicelular (constituido por solo una clula)
o pluricelular (constituido por miles de clulas). Cada clula posee su propio metabolismo y
reproduccin.

Tisular

Las clulas se especializan y conjuntan para formar una funcin especfica dando como
resultado los tejidos.

Orgnico

En los organismos pluricelulares evolucionados, los tejidos se agrupan y organizan de acuerdo


con sus caractersticas propias, para dar origen a los rganos (partes del organismo formadas
por varios tejidos que trabajan con una misma finalidad, por ejemplo el estmago).

______________________________________________________________________
3. Describe brevemente cmo se relacionan estos sistemas para que tu cuerpo funcione adecuadamente.

Descripcin

__________________________________________________________________________________________
______________________________________________________________________

Individual

El organismo pluricelular
est constituido por una
gama de tejidos, aparatos y
sistemas que le permiten vivir
como un todo dentro de una
diversidad biolgica.
El
individuo establece jerarquas y
relaciones con otros seres vivos
y su medio ambiente.

La principal diferencia entre aparato y sistema, se debe a


los tipos de tejidos que los constituyen.
En los rganos que integran a un sistema predomina un
mismo tipo de tejido, mientras que en un aparato, los rganos
que lo integran se encuentran formados por diferentes tipos
de tejidos.

Poblacin: es el conjunto de individuos de la misma especie


que habitan en una zona geogrfica determinada.

Desarrollo

El estudio de los seres vivos es muy complejo, por eso se han determinado distintos niveles
de organizacin, con el propsito de que permitan un estudio detallado y sistemtico
del mundo vivo. En la materia viva se distinguen grados de complejidad estructural al
presentar una mayor organizacin; es decir, cada nivel manifiesta propiedades de dicha
materia que no se encuentran en los niveles inferiores.

Ecolgico

Es el mximo nivel en
donde podemos apreciar la
interaccin que tienen los
diferentes individuos, ya sea
con los de su misma o diferente
especie y que interactan y
forman los diferentes niveles
de organizacin ms complejo.

Colegio de Bachilleres del Estado de Sonora

Ecosistema: est conformado por comunidades que


interactan entre ellas y el medio ambiente fsico.
Biosfera: incluye todos los ecosistemas comprendidos
entre la litosfera, la hidrosfera y la troposfera.

La complejidad de la materia es progresiva, inicia desde lo subatmico, hasta


componentes mayores. Estos niveles de organizacin de la materia, se describen a
continuacin:
26

Comunidad: es el conjunto de poblaciones que habitan un


rea determinada.

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

27

Biologa 1

2. Relaciona la rama de la biologa con el respectivo nivel de organizacin de la materia que enfoca su estudio.
Rama de la biologa

Nivel de organizacin

) Citologa

1. Molculas

) Histologa

2. Clulas

) Anatoma

3. Tejidos

) Bioqumica

4. Mamfero

) Zoologa

5. Respiracin

) Fisiologa

6. Aparatos y sistemas

Como te has dado cuenta, la materia viva, presenta diversos de organizacin, de los cuales percibimos solo los
macroscpicos. Sin embargo, los niveles microscpicos como tomo, molcula, organelo y clula, presentan
gran importancia, tal que sin su estudio no podramos comprender el fenmeno de la vida.

Cierre

ACTIVIDAD 3

Niveles de organizacin de la materia.

SD3-B1

Instruccin: Elige un organismo de tu entorno, por ejemplo un perro, un conejo, una rosa, etc. Elabora un cartel
donde a travs de recortes o imgenes representes los distintos niveles de organizacin de la materia de los que
est conformado. Finalmente presntalo y explcalo en clases.

ACTIVIDAD 2
SD3-B1

Instruccin: Renete en diadas, analicen y contesten los siguientes cuestionamientos.


1. Imaginen que realizaron un estudio de algunos aspectos de las abejas, tales como alas, enjambre, molculas de
veneno, sistema digestivo, clulas nerviosas, tomos de carbono, abeja reina y tejido muscular.
Ordena estos aspectos de menor a mayor complejidad
1.___________________________________

5.___________________________________

2.___________________________________

6.___________________________________

3.___________________________________

7.___________________________________

4.___________________________________

8.___________________________________

28

Colegio de Bachilleres del Estado de Sonora

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

29

Biologa 1

Inicio

Secuencia didctica 4
CARACTERSTICAS DE LA CIENCIA

Por otra parte, el conocimiento cientfico se obtiene a travs de una investigacin


metdica rigurosa, que permite descubrir relaciones constantes acerca de hechos
y fenmenos. Este conocimiento es el resultado de la ciencia.
Las ciencias se clasifican como ciencias formales y factuales segn la naturaleza
de los enunciados y el mtodo de comprobacin.

ACTIVIDAD 1

Ciencias Formales: utilizan el mtodo deductivo para establecer relaciones entre


enunciados y variables. La comprobacin se establece mediante la demostracin
lgica y consecuentemente se tiene completa garanta acerca de sus resultados.

Instruccin: Lee y contesta los siguientes cuestionamientos. Al concluir participa en la dinmica grupal guiada
por tu maestro.

Ciencias Factuales: se refieren a hechos que ocurren en el universo. Sus enunciados


se basan en la observacin, son de carcter emprico y comprobable; es decir,
requieren de la experiencia para verificar sus frmulas. Se les subdivide en:

SD4-B1

1. En qu consiste la actividad cientfica?


______________________________________________________________________

Naturales y fsicas: se enfocan en el estudio de fenmenos propios de la naturaleza,


es decir, aquellos que ocurren sin necesidad de la conciencia o de un cambio
intencional, como los fenmenos fsicos, qumicos y biolgicos.

2. Anota una investigacin o descubrimiento cientfico que hayas escuchado o ledo con fecha reciente.

Culturales y humanas: se enfocan a estudiar al hombre como ser social.

__________________________________________________________________________________________

__________________________________________________________________________________________
______________________________________________________________________

En el siguiente cuadro sinptico se muestra la clasificacin de la ciencia con base


en la naturaleza de los enunciados y mtodos de comprobacin.

3. Por qu los conocimientos cientficos no son definitivos ni totalmente exactos?


__________________________________________________________________________________________
______________________________________________________________________

Desarrollo

Las personas suelen cuestionarse acerca de los fenmenos que suceden en su entorno.
En ocasiones la curiosidad y la necesidad de resolver problemticas concretas, las lleva
a investigar las respuestas, utilizando un nivel de rigurosidad para obtener pruebas
contundentes y comprobables que nos permiten aproximarnos al conocimiento.
La ciencia es un conjunto de conocimientos objetivos y exactos de las cosas, obtenidos por
medio del razonamiento ordenado al aplicar mtodos de observacin y experimentacin.
Los filsofos la describen como un conocimiento racional, sistemtico, exacto, verificable
y por lo tanto falible. Gracias a la ciencia, el hombre ha sido capaz de transformar la
naturaleza para satisfacer sus necesidades.
Existen diversos tipos de conocimiento. Sin embargo, solo se tratarn el emprico y
cientfico, debido a la estrecha relacin que tienen con las ciencias biolgicas.
El conocimiento emprico es producto de la experiencia; se adquiere cuando los
rganos de los sentidos establecen contacto con el mundo exterior. Algunos ejemplos
de estos conocimientos, transmitidos de generacin a generacin son el uso del fuego,
surgimiento de la agricultura y la domesticacin de plantas y animales. La validez de
conocimientos sobre medicina, astronoma, agricultura, navegacin, entre otros, ha sido
demostrada con la prctica diaria.

30

Colegio de Bachilleres del Estado de Sonora

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

31

Biologa 1

Cierre

ACTIVIDAD 2
SD4-B1

Instruccin: A continuacin se te presentan temas de relevancia cientfica en nuestra actualidad.




Calentamiento global
Clonacin
Alimentos transgnicos

Terapia gnica
Genoma humano
Xenotransplantes

En equipo de tres integrantes seleccionen uno de ellos y realicen una investigacin. El trabajo de investigacin
deber comprender:
a)
b)
c)
d)
e)
f)
g)

ACTIVIDAD 3
SD4-B1

Instruccin: realiza un mapa conceptual sobre los puntos tratados en la presente secuencia didctica.

Portada
Introduccin
Descripcin del tema de estudio
Disciplinas que le dieron origen o permitieron estudiarla
Avances y contribuciones logrados en nuestra vida diaria
Conclusiones
Fuentes de informacin consultadas.

Nota: El reporte de investigacin se entregar en hojas tamao carta, letra arial 12, interlineado 1.15 y texto
justificado. La evaluacin de este producto se realizar tomando en cuenta la rbrica que aparece al final del
bloque.

Caractersticas de la ciencia:
Existen ciertas caractersticas que distinguen a la ciencia, entre estas podemos mencionar las siguientes:
Sistemtica: se refiere a que todo trabajo cientfico debe llevar un orden. Se deben normalizar ideas y observaciones
que se realizan para la comprensin de los hechos o fenmenos que se estudien.
Metdica: la ciencia se basa en un mtodo para llegar a establecer sus teoras o explicaciones de los fenmenos
que se observan. Se basa en el mtodo cientfico experimental para cumplir el objetivo determinado.
Objetiva: la ciencia se basa en hechos observables, es decir el investigador no debe ser influido por ideas
preconcebidas, que en un momento dado ajuste sus resultados a lo esperado. En otras palabras, debe reportar lo
que especficamente observ, sin dejar que sus expectativas modifiquen sus datos.
Verificable: los conocimientos pueden ser verificados en todo momento, por cualquier sujeto, en cualquier parte
del mundo. Para ello es imprescindible llevar un registro detallado de todos los pasos de la investigacin para
poder repetirla bajo las mismas condiciones cuando sea necesario.
Modificable: los conocimientos cientficos no son definitivos ni totalmente exactos. Estos pueden cambiar a
travs del tiempo, conforme la ciencia avanza y surgen nuevos conocimientos, tcnicas y aparatos cientficos. Los
nuevos conocimientos obligan a revisar los anteriores, y en ocasiones estos deben ser descartados o modificados
por nuevos conocimientos mejor fundamentados, porque la ciencia es la bsqueda constante de la verdad.

32

Colegio de Bachilleres del Estado de Sonora

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

33

Biologa 1

Inicio

Secuencia didctica 5
CARACTERSTICAS DEL MTODO CIENTFICO APLICADO A LA
BIOLOGA

Un ejemplo de mtodo cientfico experimental se muestra en el siguiente esquema:

ACTIVIDAD 1
SD5-B1

Instruccin: contesta los siguientes cuestionamientos y participa en la dinmica grupal desarrollada por el
maestro.
1. Cundo hacemos uso del mtodo cientfico?
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________
2. Qu es una hiptesis?
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________
3. Define con tus propias palabras los conceptos observacin y experimentacin.
__________________________________________________________________________________________
__________________________________________________________________________________________

En el siguiente esquema se plantea la propuesta de Mario Bunge sobre el mtodo cientfico aplicado a la Biologa.

_________________________________________________________________

Mtodo es el procedimiento a seguir para alcanzar un propsito o finalidad. Retomando este concepto y de acuerdo
con Mario Bunge (1983), el mtodo cientfico es el procedimiento que se realiza en una investigacin cientfica,
de la cual se obtienen finalmente conocimientos confiables, comprobables y verdicos.
No obstante la forma en que se realiza una investigacin cientfica no se basa en un mtodo rgido, se requiere
entre otros aspectos creatividad, capacidad de observacin, usos de la lgica e integracin de conocimientos
previos con las evidencias obtenidas.
Dado que la biologa es una ciencia factual, su investigacin se desarrolla a travs del mtodo cientfico
experimental, ya que le permite reproducir y controlar las condiciones que existen en la naturaleza y, de este
modo, poder establecer relaciones entre los fenmenos naturales y sus causas.
Aunque el desarrollo de este mtodo puede variar, existen etapas bsicas a saber: observacin del fenmeno,
planteamiento del problema, enunciado y comprobacin de hiptesis. Estas etapas pueden fusionarse o subdividirse,
segn el criterio del investigador.

34

Colegio de Bachilleres del Estado de Sonora

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

35

Biologa 1

Segn Bunge, la aplicacin del mtodo cientfico en Biologa es un ciclo y no una recta. Lo anterior significa que
la hiptesis se puede replantear; puede modificarse por factores ajenos a la investigacin y, consecuentemente,
proporcionar nuevos conocimientos.

Con base a la lectura anterior, contesten los siguientes cuestionamientos.

Cuando se valida una hiptesis se convierte en una teora y cuando esta es aprobada por diferentes investigadores,
se le conoce como ley.

__________________________________________________________________________________________

1.Cul era la hiptesis que se haba planteado antes de llegar al descubrimiento que se seala en la lectura?

__________________________________________________________________________________________
__________________________________________________________________________________________
______________________________________________________________________

ACTIVIDAD 2
SD5-B1

2. Identifiquen para este experimento:

Instruccin: intgrate en equipo con cuatro compaeros y lean el siguiente texto:

a) Planteamiento del problema.

Para migrar, las mariposas monarca utiliza una especie de GPS natural.

__________________________________________________________________________________________
______________________________________________________________________
b) Formulacin de hiptesis.
__________________________________________________________________________________________
______________________________________________________________________
c) Diseo experimental o experimentacin.
__________________________________________________________________________________________
______________________________________________________________________
d) Resultados.
__________________________________________________________________________________________
______________________________________________________________________
e) Conclusiones.

[]

__________________________________________________________________________________________

Hasta el momento se crea que la clave para que las mariposas monarca mantuvieran el sentido de la orientacin
estaba en el cerebro. A travs de su reloj circadiano - el sistema que controla rutinas biolgicas como el sueo
podan corregir su orientacin y mantener el rumbo sur de acuerdo con el desplazamiento del sol. Pero el estudio
comandado por los neurobilogos de la Universidad de Massachusetts, Steven Reppert, Christine Merlin y Robert
Gegear, demostr que, en realidad, son las antenas las que funcionan como una suerte de GPS o navegador satelital.
Las antenas de los insectos son un rgano extraordinario, no slo capaces de captar las seales olfativas, sino que
tambin pueden detectar la direccin del viento e incluso el sonido, seal Steven Reppert en la investigacin.
Como parte de este estudio, los cientficos hicieron una prueba con mariposas a las que les extrajeron las antenas.
El resultado era siempre el mismo, se perdan. Una segunda parte de la comprobacin consisti en pintar las
antenas de negro, y tambin perdieron la ruta. Ah fue cuando descubrieron que a travs de las antenas podan
seguir la orientacin solar, hecho que termino de comprobarse cuando luego pintaron las antenas con esmalte
transparente. Las mariposas mantenan la ruta al sur porque podan captar la luz solar.
[]

3. Expliquen por qu fue necesario hacer un experimento en el que pintaron las antenas de las mariposas con
esmalte transparente.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________
Nota: Esta actividad se evaluar con la rbrica que aparece al final del bloque.


36

______________________________________________________________________

Colegio de Bachilleres del Estado de Sonora

Fuente Velzquez M, 2010.

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

37

Biologa 1

En Biologa la experimentacin es superficial, porque el problema nos define que el objeto de estudio se asla del
medio y es casi imposible repetir las experiencias en un solo individuo, y si se trabaja con varios individuos se
presentan variaciones. Por ello, se utilizan tcnicas de comprobacin; si los resultados nos permiten comprobar la
hiptesis, es necesario volver a experimentar; sino funciona, es necesario analizar de nuevo los datos y determinar
si es necesario replantear o cambiar la hiptesis, como se mencion antes.
Es importante sealar que en biologa no siempre es posible recurrir al mtodo experimental, ya que existen
fenmenos en los que solamente es posible observar y comparar, como es el caso de los procesos evolutivos, en
los que no se pueden introducir variables ni modificar las condiciones. No obstante, la observacin ordenada y
detallada permite obtener resultados confiables.

AUTOEVALUACIN
Instruccin: De manera individual, realiza la siguiente actividad que integra los conocimientos analizados
en el presente bloque; es sumamente importante que la realices a conciencia, pues te permitir autoevaluar tu
aprendizaje.
I. Relaciona a los siguientes cientficos con su respectiva aportacin al campo de la biologa.

La ciencia no es una coleccin esttica de conocimientos establecidos, ni una serie de leyes y teoras que hay que
memorizar y aplicar, sino que es dinmica y cambiante.

) Eduardo Jenner

1. Descubri las leyes de la herencia biolgica.

La naturaleza de la ciencia es el cambio, la actualizacin permanente. Los conocimientos vigentes son una
pequea fraccin de la realidad en su conjunto ya que forman la base de lo que ser maana.

) Louis Pasteur

2. Estableci el mecanismo de seleccin natural.

) Alejandro Fleming

3. Estableci el sistema de nomenclatura binomial


para clasificar a los seres vivos.

) Alexander Oparin

4. Acuaron el trmino biologa

) James Watson y Francis Crick

5. Establecieron la teora celular

) Jean B. Lamarck y Gottfried Treviranus

6. Descubri la penicilina

) Carl Von Linneo

7. Descubri la vacuna contra la rabia

) Gregorio Mendel

8. Descubrieron la estructura del ADN

) Matas Schleiden y Teodoro Schawn

9. Descubri la vacuna contra la viruela

) Carlos Darwin

10. Desarroll una teora sobre el origen de la vida.

Cierre

ACTIVIDAD 3
SD5-B1

Instruccin: Se realizar un debate acerca de los beneficios y riesgos de las nuevas tecnologas que se han
desarrollado en el campo de la biologa.
Para lo anterior la mitad de los equipos del grupo estarn a favor de todos los avances en tecnologas biolgicas.
La otra mitad estar en contra, destacando que estos avances generan considerables riesgos a nuestra sociedad.
Cada equipo argumentar sus razones y defender sus puntos de vista, respetando siempre las opiniones de los
dems.
Al final se generar una conclusin grupal guiada por el maestro.
Nota: Esta actividad ser evaluada con una rbrica que aparece al final del bloque.

II. Subraya la respuesta que conteste correctamente los siguientes cuestionamientos.


1. Es todo lo que ocupa un lugar en el espacio y tiene peso.
a) Masa
b) Energa
c) Materia
2. Son subramas o subdivisiones de la zoologa
a) Mastozoologa y ornitologa
b) Anatoma y etologa

d) Vida

c) Herpetologa y fisiologa
d) Embriologa y malacologa

3. Luis desea saber cmo est organizada su piel. Cul es la rama de la biologa que le permitir conocer
dicha estructura?
b) Fisiologa
c) Gentica
d) Histologa
a) Anatoma

38

Colegio de Bachilleres del Estado de Sonora

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

39

Biologa 1

4. La estructura biolgica de una neurona, un eritrocito y un espermatozoide, por su complejidad son


estudiadas por
a) Embriologa
b) Patologa
c) Citologa
d) Anatoma
5. Cul de los siguientes niveles de organizacin de la materia viva presenta mejor complejidad?
a) Comunidad
b) Tejido
c) Biosfera
d) Poblacin
6. Cul de los siguientes ejemplos de la materia corresponden al mismo nivel de organizacin?
a) Cerebro, neurona
b) Clula, piel
c) Estmago, pulmn
d) Acuario, pez
7. En la organizacin jerrquica de los seres vivos el orden que se sigue es:
a) Clulas, Tejidos, rganos, Organismos, Poblacin, Comunidad, Ecosistema, Biosfera.
b) Clulas, rganos, Tejidos, Organismos, Poblacin, Comunidad, Biosfera.
c) rganos, Clulas, Tejidos, Poblacin, Biosfera, Ecosistema.
d) Clulas, Tejidos, Organismos, rganos, Poblacin, Ecosistema, Comunidad.
8. El
a)
b)
c)
d)

mtodo cientfico es:


Un mtodo que indica que toda verdad es ley.
Un conjunto de mtodos, reglas para llegar a la verdad.
Un conjunto de pasos que pueden aplicarse a todas las ramas de la ciencia.
El planteamiento de preguntas basadas en la observacin de experimentos.

9. Son ejemplos de ciencias formales.


a) Qumica y lgica
b) Lgica y matemticas

b) Biogeografa:
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________
c) Bioqumica:
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________
d) Biotecnologa:
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

c) Fsica y matemticas
d) Matemticas y psicologa

10. El orden que guardan las ideas e informacin que constituyen los conocimientos cientficos, caracterizan
a la ciencia como:
a) Objetiva
b) Sistemtica
c) Analtica
d) Metdica

REACTIVOS DE CIERRE

_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________
2. Realiza un recorrido por tu colonia o comunidad e identifica problemticas que pueden resolverse aplicando
los conocimientos de la biologa.
De estas problemticas detectadas, anota dos de ellas, describiendo cmo intervendra la biologa, sus ramas y
subdivisiones para su atencin o resolucin.
a) Problemtica 1:

Contesta las preguntas que a continuacin se te presentan.


1. Describe el campo de estudio de las disciplinas que a continuacin se presentan:
a) Biofsica:
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________

40

Colegio de Bachilleres del Estado de Sonora

__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
b) Problemtica 2:
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

41

Biologa 1

3. Menciona los pro y los contra del uso de las plantas transgnicas
__________________________________________________________________________________________

RBRICA DE EVALUACIN DE ACTIVIDAD INTEGRADORA

__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

Criterio

Excelente
90-100

4. Qu entiendes de la frase La ciencia puede ser til y benfica, pero tambin peligrosa
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

Enfoque

________________________________________________________________________

El tema principal
se presenta en el
centro, de donde
se desprenden
las dems
ramificaciones.

Muy bien
80-89

Bueno
70-79

El tema
principal se
presenta en
el centro,
utilizando
una palabra o
imagen con
poca relacin.

El tema
principal es
presentado por
una palabra
en el centro,
es difcil de
identificar que
se trata del
tema principal,
ya que no
se presenta
de forma
enfatizada.

La informacin
presentada
corresponde
a cada una de
las secuencias
didcticas que
conforman el
bloque.

La mayor
parte de la
informacin
corresponde a
la presentada
en cada una de
las secuencias
didcticas que
conforman el
bloque.

ACTIVIDAD INTEGRADORA
Elabora un mapa mental donde integres los conocimientos de cada una de las secuencias didcticas analizadas
en el presente bloque.

Informacin

La informacin
presentada
corresponde
a cada una de
las secuencias
didcticas que
conforman el
bloque.
La informacin
presentada es
completamente
clara y precisa.
completamente
clara y precisa.

Palabras claves

Se manejan
conceptos
importantes,
destacando y
diferenciando las
ideas principales
de las
secundarias por
medio de colores
diferentes,
subrayados,
recuadros u otras
formas.

La mayor
parte de la
informacin es
clara y precisa.

Las palabras
clave se
destacan por
medio de
recuadros o
colores.

Solo alguna
parte de la
informacin es
clara y precisa.

Slo algunas
palabras clave
aparecen
resaltadas para
destacar su
importancia.

Regular
60-69

Insuficiente
NA

El tema principal
no se presenta en
el lugar correcto
y exhibe poca
relevancia.

El tema
principal no se
presenta en el
lugar correcto
ni de forma
enfatizada,
por lo que
no existe
representacin
y organizacin
de la
informacin.

Solo una parte de


la informacin
corresponde a
la presentada
en cada una de
las secuencias
didcticas que
conforman el
bloque.
La informacin
presenta errores y
falta de claridad.

No se distinguen
los conceptos
principales de los
secundarios, ya
que presentan el
mismo formato.

Puntos

La
informacin
presentada no
corresponde
a la mostrada
en cada una de
las secuencias
didcticas del
bloque.

Los conceptos
no tienen
ninguna
relacin con
el tema, por lo
que el mapa
pierde su
concordancia
y relacin con
ste.

Nota: Esta actividad se evaluar con la rbrica que aparece al final del bloque.

42

Colegio de Bachilleres del Estado de Sonora

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

43

Biologa 1

Organizacin

Imgenes

Creatividad

Nivel Logrado

44

Los elementos
que componen
el mapa mental
se encuentran
organizados
de forma
jerrquica con
conectores que
hacen fcil su
comprensin.

Los elementos
o imgenes
contenidas
estn
organizados
de forma
jerrquica,
pero los
conectores
no estn del
todo bien
estructurados.

Los elementos
del mapa
estn poco
dispersos,
ya que no
aparecen
organizados
segn su
relevancia.

Las imgenes
son ntidas y
claras, adems
de que son
representativas
del concepto
a comprender.
stas aparecen
colocadas
como el
movimiento de
las manecillas
de un reloj,
segn su
importancia.

Las imgenes
son ntidas y
claras, adems
de que son
representativas
del concepto
a comprender,
pero no estn
acomodadas
correctamente.

Las imgenes
son ntidas
pero no estn
relacionadas
con el tema y
aparecen poco
desordenadas.

Se utilizan
imgenes,
trazos y colores
diferentes en
su elaboracin,
as como
elementos
decorativos
que le hacen
ser ms
atractivo y
entendible.

Son utilizados
diferentes
imgenes,
trazos, colores
y elementos
decorativos.
Se exponen
las ideas de
forma original,
por lo que se
observa gran
imaginacin.
Se puede
caer en la
exageracin,
evitando
comprender la
informacin.

Contiene
muy pocas
imgenes,
trazos, colores
y elementos
decorativos
o son casi
nulos, por lo
que carece de
imaginacin y
no permiten la
comprensin
total de la
informacin
que se desea
transmitir.

Muy bien

Bueno

Excelente

Colegio de Bachilleres del Estado de Sonora

No hay
organizacin de
ideas, por lo que
su comprensin
es mnima.

Los
elementos
estn mal
organizados,
por lo que el
mapa pierde
sentido
lgico y no
se puede
comprender.

Las imgenes
no se perciben
completamente,
aparecen
de forma
desordenada y
con poca o sin
relacin con el
tema.

Las imgenes
no presentan
nitidez,
aparecen
de forma
desordenada
y sin relacin
con el tema,
por lo que
no se puede
comprender
la
informacin
que se desea
presentar.

No contiene
imgenes,
colores ni
elementos
decorativos o
son casi nulos,
por lo que la
informacin
que se pretende
transmitir no se
comprende.

Las
imgenes,
trazos,
colores y
elementos
decorativos
no tienen
ninguna
relacin
con el tema,
por lo que
el mapa
pierde su
creatividad
y el objetivo
para el que
fue diseado.

Regular

COEVALUACIN
Formato de Coevaluacin para Evaluar el Trabajo en Equipo
Evaluador:____________________________________________________Equipo: _______
Instrucciones: En la primera columna escribe el nombre de cada uno de tus compaeros de equipo sin incluir el
tuyo. Asgnales una puntuacin del 0 al 10 a cada uno de los aspectos a evaluar y al final justifica la puntuacin
asignada.
Aspectos a evaluar*:
1. Su actitud fue de apoyo para la elaboracin del trabajo.
2. Particip activamente en las diferentes actividades del equipo.
3. Cumpli con lo acordado.
4. Fue tolerante ante las ideas de otros y tomaba en cuenta las opiniones.
5. Sus aportaciones las realiz pensando en el beneficio de todo el equipo.
ASPECTOS A EVALUAR*
Compaero

Justificacin

Insuficiente

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

45

Biologa 1

EVALUACIN DE ACTIVIDADES

RBRICA PARA EVALUAR EL REPORTE DE INVESTIGACIN

Rbrica para Evaluar la Participacin en el Debate


Evaluacin/
aspecto

Informacin

Comprensin y
manejo del tema

Forma de debatir

Actitud

Cualidades de la
voz

1
La informacin
presenta varios
errores y les falta
claridad.

Toda la
informacin
presentada es
clara y precisa.

La mayor parte de
la informacin es
clara y precisa.

Comprenden
claramente el
tema y el manejo
de ste.

Entienden el
tema, pero no
se les observa
totalmente
convencido
acerca del tema
desarrollado.

Parecen entender
el tema, con
algunos errores.

No comprenden
totalmente el tema.

Todos los
argumentos
presentados
durante el debate
son precisos y
relevantes.

La mayora de
los argumentos
presentados
en el debate
son precisos y
relevantes.

Algunos de los
argumentos
utilizados durante
el debate son
relevantes y otros
son dbiles.

No establecen
contraargumentos
precisos ni
relevantes.

Solo alguna parte


de la informacin
es clara y precisa.

Aportan
numerosos
puntos de vista
con apertura y
respetan las ideas
de los dems.

Aportan
suficientes ideas y
respetan las ideas
de los dems.

No hacen muchas
aportaciones,
pero respetan
las ideas de los
dems.

No se muestran
respeto ante alguna
de las participaciones
de los compaeros.

Exponen sus
mensajes con
volumen, diccin
y velocidad
adecuada.

Exponen sus
mensajes
con diccin
y velocidad
adecuadas, pero el
volumen es muy
alto.

Exponen sus
mensajes con
buen volumen,
pero falla la
diccin porque
hablan muy
rpido.

Exponen sus
mensajes con
volumen, diccin
y velocidad
inadecuados, por lo
que no se entiende
nada de lo que dicen.

Puntos
obtenidos

Nombre del docente:__________________________________________________


Fecha:________________
Criterios

Presentacin
del trabajo

En la hoja de
presentacin, el
equipo anot:
nombre de la
institucin, nombre
completo del
trabajo, integrantes,
docente
responsable.
Presentan texto
justificado,
letra arial 12
e interlineado
1.15, sin faltas de
ortografa, como
les fue solicitado.

En la hoja de
presentacin el
equipo anot:
nombre de la
institucin,
nombre
completo
del trabajo,
integrantes,
docente
responsable.
Se observan
menos de
cinco faltas de
ortografa.

En la hoja de
presentacin, el
equipo anot:
nombre de la
institucin,
nombre
completo
del trabajo,
integrantes,
docente
responsable.
Se observan
cinco faltas de
ortografa y
no se respeta
el formato
solicitado.

Introduccin

Redactan la
presentacin
general del trabajo,
propsitos y
conclusin de la
investigacin en
una cuartilla.

Redactan la
presentacin
general y
propsitos
del trabajo de
investigacin.

Redactan la
presentacin
general del
trabajo.

Redactan una
introduccin
de slo uno de
las temticas
abordadas.

Presentan una
introduccin
de otro autor.

Desarrollo
del tema

Desarrollan
completamente
todos los puntos
solicitados, en tres
cuartillas.

Desarrollan
completamente
todos los
puntos
solicitados,
en menos o
ms de tres
cuartillas.

Desarrollan
incompletamente
los puntos
solicitados,
con algunos
errores en la
informacin.

Desarrollan
incompletamente
todos los puntos
solicitados, con
demasiados
errores en la
informacin

Desarrollan
un contenido
cercano
al tema
de forma
incorrecta e
imprecisa.

Conclusiones

Concluye con
ideas claras y
sintetizadas,
aspectos
relevantes de la
investigacin para
su aprendizaje.

Concluyen con
ideas claras y
sintetizadas
aspectos
irrelevantes
de la
investigacin.

Escribe
ideas sobre
algunos puntos
desarrollados en
la investigacin.

Escribe
percepciones de
algn aspecto
investigado.

Escribe
percepciones
irrelevantes y
desordenadas
de algn
aspecto
investigado.

Total

46

Colegio de Bachilleres del Estado de Sonora

Niveles de desempeo
3

Grupo:____________
Equipo:___________
2

Le falta
informacin
solicitada a
la hoja de
presentacin. Se
observan ms
de cinco faltas
de ortografa
y no respetan
el formato
solicitado.

Puntaje

Le falta
informacin
solicitada a
la hoja de
presentacin.
Se observan
graves faltas
de ortografa
y no respetan
el formato
solicitado.

Total

BLOQUE 1

Reconoces a la Biologa como la Ciencia de la Vida

47

PORTAFOLIO DE EVIDENCIAS
Criterio/
Puntuacin

Falta un elemento
en la presentacin
del trabajo

Faltan dos elementos


en la presentacin
del trabajo.

Carece de tres o
ms elementos
para la correcta
presentacin del
trabajo.

El objetivo
del portafolio
considera slo
parcialmente
los contenidos
estudiados.

El objetivo del
portafolio no es
congruente con
los contenidos o
lecciones estudiadas.

No tiene objetivo
explcito.

Incluye nombre del


alumno, Institucin y
curso.
Portada

Incluye ttulo
sugerente en la
portada.

Puntaje

Considera fecha y
lugar

Objetivo

El objetivo representa
el aprendizaje
obtenido y la razn
por la cual se
estructuran de esa
forma las evidencias.

Identificas las caractersticas y los componentes de los seres vivos

Incluye la mayora
de las evidencias
solicitadas. Sin
embargo no todas
las evidencias
demuestran
claramente el
avance en los
aprendizajes
esperados.

Incluye algunas
de las evidencias
solicitadas.

Organizacin

Todos los documentos


estn correctamente
presentados: constan
de encabezado, son
claros y limpios.

A los documentos
les falta algn
elemento de la
presentacin.

A los documentos
les faltan ms de
dos elementos de
presentacin.

El documento solo
tiene un elemento
o ninguno de
presentacin.

Ortografa

El portafolio de
evidencias est
elaborado sin errores
ortogrficos.

Se observan hasta
cinco errores
ortogrficos.

Se observan de
6 a 10 errores
ortogrficos en el
portafolio

Se observan ms
de 10 errores
ortogrficos.

Incluye todos los


tipos de evidencias
solicitadas.
Evidencias

Las evidencias
demuestran los
avances en los
aprendizajes
esperados.

Estas evidencias
demuestran
mnimamente el
avance en los
aprendizajes
esperados.

BLOQUE 2

Incluye slo uno


o ninguna de
las evidencias
solicitadas,
sin demostrar
avance en los
aprendizajes.

Desempeo del estudiante


al finalizar el bloque
Comprende las caractersticas distintivas de

los seres vivos.


Explica la conformacin qumica de los
seres vivos a travs del conocimiento de la
estructura y funcin de los bioelementos
y de las biomolculas. Valora el papel de
los bioelementos y las biomolculas como
componentes importantes en la nutricin
humana.

Total

48

Colegio de Bachilleres del Estado de Sonora

Tiempo asignado: 16 horas

Objetos de aprendizaje
Caractersticas de los seres vivos.

Estructura.
Organizacion.
Metabolismo.
Homeostasis.
lrritabilidad.
Reproduccion.
Crecimiento.
Adaptacin.
Propiedades del agua y su relacin con los
procesos en los seres vivos.
Estructura y funcin de biomolculas
orgnicas.

Competencias a desarrollar
Fundamenta opiniones sobre los impactos de

la ciencia y la tecnologa en su vida cotidiana,


asumiendo consideraciones ticas de sus
comportamientos y decisiones.
De manera general o colaborativa, identifica
problemas, formula preguntas de carcter
cientfico y plantea las hiptesis necesarias
para responderlas.
Utiliza las tecnologas de la informacin y
la comunicacin para obtener, registrar y
sistematizar informacin para responder a
preguntas de carcter cientfico, consultando
fuentes
relevantes
y/o
realizando
experimentos pertinentes.
Contrasta los resultados obtenidos en una
investigacin o experimento con hiptesis
previas y comunica sus conclusiones
aportando.
puntos de vista con apertura y considerando
los de otras personas de manera reflexiva.
Define metas y da seguimiento a sus
procesos de construccin del conocimiento
explicitando las nociones cientficas para la
solucin de problemas cotidianos.
Trabajando en equipo, disea modelos
o prototipos para resolver problemas,
satisfacer necesidades o demostrar principios
cientficos relativos a las ciencias biolgicas.

Biologa 1

5. Qu son las biomolculas?

PRESENTACIN DEL PROYECTO

__________________________________________________________________________________________
__________________________________________________________________________________________

La actividad integradora del presente bloque consiste en una serie de cuestionamientos de las secuencias didcticas
analizadas, para realizarla, contestars reactivos de opcin mltiple, completars espacios en blanco, resolvers
crucigramas y sopa de letras; as mismo, organizars informacin en cuadros sinpticos y cuadros comparativos.

__________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________

EVALUACIN DIAGNSTICA

6. Menciona dos enfermedades que podemos adquirir los seres humanos debido al consumo excesivo de carbohidratos y lpidos.
__________________________________________________________________________________________

Instruccin: La siguiente actividad tiene el propsito de que identifiques los conocimientos que posees antes de
iniciar el presente bloque. Contstalas de forma individual y una vez concluida participa en la dinmica grupal
que realizar tu maestro.
1. Menciona tres caractersticas que diferencian a los seres vivos de la materia inanimada.
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________
2. Cules son los principales elementos qumicos que constituyen a los seres vivos?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
7. Anota dos alimentos ricos en protena.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
8. Es el elemento qumico que constituye a las molculas orgnicas.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

________________________________________________________________________

9. Cul crees que sea la importancia de los cidos nucleicos en la composicin y permanencia de la vida en
nuestro planeta?

3. Cmo crees que se han originado las diversas formas de vida existentes en la actualidad?

__________________________________________________________________________________________

__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________

__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
10. Cmo se llama el carbohidrato de mayor importancia nutricional y energtica para los seres humanos?
__________________________________________________________________________________________

__________________________________________________________________________

__________________________________________________________________________________________

4. Cul es el porcentaje de agua en los seres humanos?

________________________________________________________________________

_________________________________________________________________________________________
50

Colegio de Bachilleres del Estado de Sonora

__________________________________________________________________________________________

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

51

Biologa 1

Inicio

Secuencia didctica 1
CARACTERSTICAS DE LOS SERES VIVOS

Desarrollo

Al consultar el concepto Vida en un diccionario, encontraremos definiciones semejantes


como la cualidad que distingue a un ser vital y funcional, de un cuerpo muerto, espacio
de tiempo que transcurre desde el nacimiento hasta la muerte. Definir esta palabra resulta
difcil debido a:

ACTIVIDAD 1
SD1-B2

Instruccin: De manera individual analiza las siguientes imgenes y contesta las preguntas que posteriormente
se te plantean. Al concluir participa en la dinmica grupal guiada por tu maestro.
1. Qu caractersticas
individuos?

comunes

presentan

estos

La variedad de formas, tamaos, aspectos, texturas, colores, entre otras


caractersticas que presentan los distintos grupos de seres vivos y a

la gran diversidad de ambientes en los que stos se desarrollan.

Desde la perspectiva biolgica, la vida es el resultado de antiguos eventos por los cuales la
materia sin vida se organiz para dar origen a las primeras clulas.
Por lo antes descrito, resulta ms conveniente definir la vida por medio de las caractersticas
distintivas de los seres vivos. Estas caractersticas se presentan en el siguiente esquema:

____________________________________________
____________________________________________
____________________________________________
_______________________________________
2. En qu son diferentes?
____________________________________________
____________________________________________
____________________________________________
_______________________________________
3. Si pudieras agruparlos de acuerdo a sus caractersticas.
Cuntos grupos formaras y que individuos los
integraran?
____________________________________________
____________________________________________
____________________________________________
____________________________________________
_______________________________________
4. Qu nivel de organizacin de la materia ejemplifican
cada uno de ellos?
____________________________________________
____________________________________________
____________________________________________
_______________________________________

52

Colegio de Bachilleres del Estado de Sonora

A continuacin se describen cada una de estas caractersticas distintivas.


Estructura: todos los seres vivos estn formados por clulas. sta caracterstica da unidad a todos los organismos,
ya que no hay uno solo que no est formado por ellas; algunos son unicelulares (formados por solo una clula),
mientras que otros son pluricelulares (formados por dos o ms clulas).
Como recordars, en el bloque anterior estudiamos que todos los seres vivos son materia y presentan una
organizacin qumica, a nivel subatmico, atmico y molecular. Lo antes descrito nos permite comprender que los
seres vivos estn constituidos por veintisiete de los elementos qumicos que existen en la naturaleza, a los cuales
se les denomina bioelementos o elementos biogensicos.

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

53

Biologa 1

Los seres vivos que habitan el planeta poseen una composicin qumica muy similar, lo que da lugar a una
diversidad bioqumica entre los distintos grupos de seres vivos. No obstante, los elementos biogensicos
desempean en stos tres funciones bsicas: constituir su estructura, aumentar la velocidad de las reacciones
qumicas y transportar sustancias a travs de las membranas.

Por otra parte, no debemos olvidar que el universo se encuentra en un nivel superior a la biosfera terrestre, y en l
est contenida toda tipo de materia, incluyendo los cuerpos del espacio exterior.

Los bioelementos se clasifican en tres grupos: bioelementos primarios, bioelementos secundarios y


oligoelementos o elementos trazas. A continuacin se te presenta una breve descripcin de estos con sus
respectivos ejemplos.

ACTIVIDAD 2

Bioelementos

Descripcin

Ejemplos

Primarios

Constituyen el 99% de la materia viva. La


mayora de las biomolculas estructurales
y funcionales que forman a la clula, estn
compuestas por estos elementos.
Los primeros cuatro que se mencionan en la
siguiente columna son los ms abundantes en la
naturaleza y materia viva.

Carbono (C)
Hidrgeno (H)
Oxgeno (O)
Nitrgeno (N)
Fsforo (P)
Azufre (S)

Representan el 1% restante de la materia viva.


Son requeridos por la mayora de las clulas,
pero en cantidades mnimas.

Sodio (Na)
Potasio (K)
Calcio (Ca)
Cloro (Cl)
Magnesio (Mg)

Representan en 0.1% de la materia viva, por lo


que la cantidad de estos en los seres vivos es
insignificante.

Fierro (Fe)
Cobre (Cu)
Zinc (Zn)
Cobalto (Co)
Manganeso (Mn)
Litio (Li)
Silicio (Si)
Yodo (I)
Flor (F)
Molibdeno (Mo)
Cromo (Cr)

Secundarios

Oligoelementos o trazas

SD1-B2

Instruccin: Consulta las fuentes bibliogrficas recomendadas por tu maestro y realiza una investigacin sobre
las caractersticas e importancia de los bioelementos primarios. Organiza la informacin en la siguiente tabla.
Bioelemento

Principales caractersticas

Importancia para los seres vivos

Oxgeno

Carbono

Hidrgeno

Nitrgeno

Organizacin: los seres vivos presentan una organizacin, sin importar su tamao y complejidad, ya que todas las
estructuras celulares estn constituidas por molculas orgnicas e inorgnicas. Las primeras constituyen el total
de sustancias y estructuras de los organismos, por lo que reciben el nombre de biomolculas.
Las biomolculas tienen la caracterstica comn de estar formadas por carbono, hidrgeno, oxgeno y nitrgeno,
adems de azufre y fsforo. stas a su vez se organizan para dar origen a componentes qumicos ms complejos,
como lo son los carbohidratos, lpidos, protenas y cidos nucleicos.

Fsforo

Hasta el momento nos hemos abocado solo al nivel qumico de organizacin de la materia, pero como habrs de
recordar existen otros niveles, conocidos como celular, tisular, orgnico e individual en los cuales tambin los
seres vivos estn organizados.
As mismo estudiamos que los niveles de mayor organizacin biolgica son los de especie, poblacin, comunidad
y ecosistema. Tambin debes tener presente que el mayor nivel de organizacin biolgica del planeta corresponde
a la biosfera, el cual incluye a todos los niveles antes mencionados.
54

Colegio de Bachilleres del Estado de Sonora

Azufre

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

55

Biologa 1

ACTIVIDAD 3

Metabolismo: es la suma de todas las funciones que realizan los seres vivos por medio de reacciones qumicas
reguladas por enzimas, a travs de las cuales se lleva a cabo una transformacin de materiales y energa necesarios
para conservar la estructura y el funcionamiento celular.

Instruccin: Consulta las fuentes bibliogrficas recomendadas por tu maestro y realiza una investigacin sobre
los fuentes naturales (alimentos) y funcin de los oligoelementos que constituyen a los seres vivos. Organiza la
informacin en la siguiente tabla.

El metabolismo comprende dos etapas: el anabolismo y el catabolismo. La primera est representada por
reacciones qumicas de sntesis de molculas complejas a partir de molculas sencillas, para lo cual se requiere un
gasto de energa. La segunda comprende las reacciones qumicas mediante las cuales las molculas complejas son
degradadas a molculas simples, acompaadas de liberacin de energa.

SD1-B2

Oligoelemento

Fuentes naturales

Hierro

Funcin

El catabolismo y el anabolismo, ocurren en forma simultnea y son interdependientes. Las reacciones metablicas
se enlazan en una secuencia rigurosa, si se altera alguna de ellas, provoca que se suspendan algunos de los
procesos biolgicos de los seres vivos.
Homeostasis: Es la capacidad de los seres vivos de mantener constante, hasta cierto lmite, el equilibrio biolgico
de su ambiente interno, en forma independiente a las variantes externas e internas por medio de sus mecanismos
homeostticos.

Nquel

Este proceso es de vital importancia para los seres vivos, ya que les permite mantener su cuerpo en funcionamiento.
En la mayora de las clulas los principales mecanismos homeostticos estn regulados por:
Cobre

Cromo

La permeabilidad selectiva de la membrana celular, que permite solo el paso de sustancias necesarias
para la clula o de aquellas que deben ser desechadas.
La funcin de sus vacuolas, que principalmente intervienen en la excrecin de productos de desecho, el
balance hdrico y la tonicidad citoplasmtica.

El ambiente interno de los organismos pluricelulares, plantas y animales est representado por fluidos corporales
extracelulares que contienen nutrientes que baan a las clulas, y adems excretan desechos metablicos. Estos
fluidos deben conservar sus propiedades, porque aunque no se encuentran dentro de la clula, cuando presentan
alteraciones en su composicin o volumen, afectan en mayor o menor medida las actividades normales de las clulas.

Yodo

Los mecanismos homeostticos en estos organismos pluricelulares, se describen brevemente a continuacin:


Manganeso

En las plantas, el movimiento generalmente es lento y poco perceptible, y est determinado, por las reacciones
relacionadas con la irritabilidad y homeostasis que desarrollan en respuesta a los estmulos recibidos. Mientras
que en los animales, estos mecanismos son controlados por los rganos especializados internos y externos
como la vista, el odo, el olfato, etctera; que tambin son conocidos como receptores, y contienen estructuras
especializadas con terminaciones nerviosas.

Selenio

Irritabilidad: Es la capacidad de los seres vivos para responder ante ciertos estmulos del medio ambiente. La
irritabilidad pone de manifiesto el movimiento de los individuos, el cual puede presentarse en todo el organismo
en conjunto o en algunas de las estructuras respecto al medio. Por ejemplo, una abeja es atrada por el color de una
flor, o bien un ciervo corre velozmente al escuchar cualquier sonido extrao. Incluso organismos unicelulares como
los protozoarios, responden a los estmulos del medio, movindose en el agua al detectar partculas alimenticias.
En el caso de las plantas, la irritabilidad, se manifiesta a travs de movimientos citoplasmticos, como se observa
en el movimiento de ciclosis, que consiste en corrientes citoplasmticas rotatorias que arrastran organelos como
los cloroplastos adems de inclusiones citoplasmticas. La ciclosis puede ser provocada por estmulos externos
qumicos, luminosos, trmicos, entre otros.

Cobalto

Flor

Otra forma de respuesta hacia los estmulos del ambiente son los casos de tropismo, los cuales consisten en la
orientacin o rechazo ante ciertos estmulos como la luz (fototropismo), el agua (hidrotropismo), el grado de humedad
(higrotropismo) o los movimientos de orientacin positiva o negativa hacia la gravedad terrestre (geotropismo).

Silicio

56

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

57

Biologa 1

Reproduccin: es el proceso biolgico a partir del cual se producen nuevos individuos. Este proceso es sumamente
necesario para la supervivencia de la especie, ya que cada uno de sus miembros se multiplicar y producir nuevos
individuos para conservarla.

ACTIVIDAD 4
SD1-B2

Instruccin: Intgrate en equipo con tres compaeros y contesta los siguientes cuestionamientos.
1. Menciona tres procesos metablicos que realizamos los seres humanos. Diferncialos como catabolismo o
anabolismo, segn corresponda.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
2. La temperatura promedio del cuerpo humano es de 36.5C. Describe tres mecanismos homeostticos que
desarrollamos, para mantener esta temperatura, cuando la temperatura ambiental vara.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

Los individuos en la naturaleza pueden experimentar reproduccin de tipo asexual y/o sexual.
En la reproduccin asexual participa un solo progenitor, el cual se divide o fragmenta, produciendo dos clulas
hijas genticamente idnticas a su progenitor y entre s. Algunos organismos unicelulares o poco evolucionados,
como los protozoos, ciliados, flagelados, bacterias y arqueos, desarrollan este tipo de reproduccin.
En la reproduccin sexual son necesarias clulas especializadas, llamadas gametos, que se fusionan para formar
un huevo o cigoto, que dar origen a un nuevo individuo. Este tipo de reproduccin, le permite a los seres vivos
un intercambio de material gentico, y por ende variabilidad gentica. Cuanto mayor sea la variabilidad, mayor
ser la capacidad de adaptacin de los individuos en su medio ambiente.
Con algunas excepciones, la mayora de los seres vivos necesitan alcanzar su madurez biolgica para poder
reproducirse.
Algunos organismos como los hongos, musgos, helechos y celenterados son capaces de presentar ambos tipos de
reproduccin.
Crecimiento: es el aumento de la masa viva, producto de las reacciones metablicas producidas por el flujo de
sustancias a travs del cuerpo de los individuos. Esta caracterstica se manifiesta por el incremento de peso y talla
en los seres vivos, debido principalmente a la fabricacin de protenas, que elaboran los organismos a expensas de
los nutrientes adquiridos por medio de los alimentos.

3. En qu consiste y qu individuos desarrollan los siguientes mecanismos homeostticos:

El crecimiento en los seres vivos ocurre de adentro hacia afuera, ya que crecen a medida que las clulas individuales
aumentan su masa y el nmero total de clulas.

a) Nastas o respuestas nsticas

El perodo de crecimiento en los organismos abarca desde el nacimiento hasta la edad reproductiva. No obstante
hay organismos que nunca dejan de crecer, por ejemplo, los rboles, que pueden llegar a vivir cientos de aos y
siguen creciendo y engrosando su tronco con nuevos anillos de crecimiento.

__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________
b) Quimiotactismo
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

58

Colegio de Bachilleres del Estado de Sonora

Adaptacin: Es la serie de transformaciones que experimentan los seres vivos para adecuarse a las condiciones
de su medio ambiente. Dichas transformaciones no se presentan de forma inmediata, sino a lo largo de los aos.
La adaptacin se presenta a nivel fisiolgico, morfolgico y conductual.
Los seres vivos, se encuentran adaptados a su medio ambiente, como resultado de millones de aos de evolucin.
La enorme diversidad biolgica que existe en el planeta se ha ido constituyendo a travs de una serie sucesiva
de cambios que han dado lugar a los seres que hoy vemos y a muchos ms que vivieron en el pasado y ya se han
extinguido.
La adaptacin es posible a travs de las variaciones genticas que transmiten padres a hijos y, si estas se ven
favorecidas por el mecanismo de la seleccin natural, las especies entonces evolucionan como se mencion
anteriormente. Generalmente, este mecanismo preserva los genes que ms favorecen a los organismos para su
sobrevivencia y reproduccin.
Para finalizar esta secuencia, es importante sealar que algunas veces no es fcil determinar un lmite entre lo vivo
y lo inerte. Un ejemplo muy claro es el caso de los virus, los cuales son partculas que causan enfermedades y se
multiplican al invadir a un organismo, pero no se consideran seres vivos porque no cumplen con las caractersticas
antes descritas. Se podra decir que los virus y otras partculas como los priones y viroides, se encuentran en la
frontera de lo vivo y lo no vivo.

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

59

Biologa 1

Inicio

ACTIVIDAD 5
SD1-B2

Instruccin: en equipo de cinco integrantes siguiendo el procedimiento descrito, identifiquen:

Secuencia didctica 2
PROPIEDADES DEL AGUA Y SU RELACIN CON LOS PROCESOS EN LOS
SERES VIVOS

Qu caractersticas poseen los seres vivos?


Sustancias

Material

Polvo de hornear
Sal de cocina
Levadura
Azcar

Cubre y portaobjetos
Matraz erlenmeyer o vaso de precipitado
4 tubos de ensayo
Gradilla
Cinta adhesiva (maskin tape)
Microscopio
Marcadores
Agitador
Gotero

ACTIVIDAD 1
SD2-B2

Instruccin: De manera individual responde los siguientes cuestionamientos y una vez que la concluyas, participa
en la dinmica guiada por tu maestro.
1.

__________________________________________________________________________________________
________________________________________________________________________
2.

Procedimiento:

Anota tres propiedades del agua

Por qu se dice que el agua es el solvente universal?

__________________________________________________________________________________________

1. Prepara una solucin de azcar, agregando en 100 ml de agua, 6 cucharadas pequeas de azcar.

________________________________________________________________________

2. Coloca los cuatro tubos de ensayo en la gradilla. Rotlalos del nmero 1 al 4.

3.

Dibuja un puente de hidrgeno.

3. Agrega a cada tubo de ensayo, 30 gotas de la solucin de azcar.


4. Agrega a los tubos de ensayo una cucharadita de las sustancias que a continuacin se indican.
Tubo N1 solucin de azcar
Tubo N2 una cucharadita de sal
Tubo N3 una cucharadita de polvo para hornear
Tubo N4 una cucharadita de levadura
5. Toma una gota del tubo N1, colcala en el portaobjeto y cbrela con un cubreobjetos. Observa la muestra
al microscopio, escribe y dibuja tus observaciones.
6. Repite el paso anterior en los tubos 2, 3 y 4.
7. Realiza una nueva observacin en cada uno de los tubos despus de 15 minutos. Anota tus observaciones.
8. Realiza el paso 7, en dos ocasiones ms.
9. Comenta con tus compaeros tus observaciones.
10. Elaboren en equipo un reporte escrito de la actividad experimental de acuerdo a lo solicitado por tu
maestro.
Nota: La evaluacin de este producto se realizar tomando en cuenta la rbrica que se presenta al final del bloque.
60

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

61

Biologa 1

Desarrollo

El agua es la molcula inorgnica de mayor importancia para los seres vivos, adems
de ser la ms abundante en los seres vivos, es indispensable para el desarrollo de la vida
en el planeta.

3. Por qu el agua no disuelve a los hidrocarburos?

Este lquido vital cubre dos terceras partes de la superficie de nuestro planeta
(aproximadamente el 71%). De tal porcentaje, solo el 3% es agua dulce, que por cierto
en gran parte se encuentra congelada y el resto es agua salada.

__________________________________________________________________________________________

Como bien lo sabes, la molcula de agua est compuesta por dos tomos de hidrgeno
y uno de oxgeno y su frmula molecular es H2O. Esta molcula se forma a travs de
un enlace de tipo covalente; es decir, los tomos se atraen con la misma fuerza sin que
ninguno gane o pierda electrones, sino que comparten electrones.
La molcula de agua es polar debido a que su carga interna se encuentra distribuida
de manera desigual, observndose que en el extremo donde est el oxgeno es un
tanto negativo y el extremo donde se localizan los hidrgenos, es un tanto positivo.
Esta polaridad favorece la atraccin entre una molcula de agua y otra, de manera
que se forman entre estas molculas enlaces de breve duracin, llamados Puentes de
Hidrgeno.

__________________________________________________________________________________________
_________________________________________________________
4. La formula H2O no corresponde realmente al agua lquida. Por qu?
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________
II. En la siguiente tabla se presentan propiedades fsico-qumicas del agua. Describe detalladamente cada una de
estas en la columna correspondiente.
PROPIEDADES FSICO-QUMICAS

DESCRIPCIN

Tensin Superficial elevada

Calor especfico elevado

ACTIVIDAD 2

Calor de vaporizacin elevado

SD2-B2

Instruccin: Consulta las fuentes de informacin recomendadas por tu maestro y realiza lo que a continuacin
se indica.
I. Contesta detalladamente los siguientes cuestionamientos.

Constante dielctrica elevada

1. Siendo el agua (H2O) y el dixido de azufre (SO2), compuestos qumicos y en cuya estructura molecular, ambos
constituidos por oxgeno. Por qu el agua a temperatura ambiente es lquida, mientras que el SO2 un gas?
__________________________________________________________________________________________

Densidad en estado lquido

__________________________________________________________________________________________
_________________________________________________________
2. Por qu el agua es el solvente universal?

Bajo grado de Ionizacin

__________________________________________________________________________________________
_________________________________________________________

62

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

63

Biologa 1

Porcentaje de agua en los seres vivos.

Cierre

En los seres humanos adultos, el agua representa el 63% de su peso, en el embrin humano el 94%, y en las
algas el 95%. Existe una relacin directa entre el contenido de agua y actividad fisiolgica de los individuos,
observndose menores porcentajes en seres con vida latente como las semillas, en las cuales representa un 20%
aproximadamente.
El agua se encuentra en la materia viva en tres formas:

ACTIVIDAD 4
SD2-B2

a) Agua circulante: como por ejemplo en la sangre y en la savia.


b) Agua intersticial: entre las clulas a veces fuertemente adheridas a la sustancia intracelular, como
sucede en el tejido conectivo.

Instruccin: en equipo de cinco integrantes, determinen:

c) Agua intracelular: en el citosol y en el interior de los organelos celulares.

Material

Los seres vivos pueden obtener el agua directamente a partir del agua exterior o a partir de otras biomolculas
mediante diferentes reacciones bioqumicas. Un ejemplo de ello, es el agua que se obtiene de la oxidacin de la
glucosa:
C6H12O6 + 6 O2
6CO2 + 6H2O
Funciones del agua en los seres vivos
Dado las propiedades del agua, sta desempea funciones de gran relevancia en los seres vivos. Dichas
funciones se describen a continuacin:
Disolvente de sustancias: prcticamente todas las reacciones biolgicas se desarrollan en un medio
acuoso.
Bioqumica: el agua interviene en muchas reacciones qumicas; por ejemplo, en la hidrlisis durante la
digestin de alimentos y como fuente de hidrgenos en la fotosntesis, etc.
Transporte: el agua es el medio de transporte de las sustancias desde el exterior al interior de los
organismos y en el propio organismo, a veces con un gran trabajo como en la ascensin de la savia bruta
en los rboles.
Estructural: el volumen y forma de las clulas que carecen de membrana rgida se mantienen gracias a la
presin que ejerce el agua en el interior de estas.

Por qu es importante el agua en los procesos vegetales?

5 flores grandes de color blanco


1 florero o recipiente para colocar las flores en agua
20 gramos de colorante vegetal en polvo
Procedimiento:
1. Realiza un corte diagonal a los tallos de las flores y colcalas en el recipiente con el colorante vegetal
disuelto en agua. Djenlas reposar hasta el da siguiente.
2. Observen las diferencias de teido del tallo y los ptalos.
3. Realicen un corte del tallo y observen los cambios presentados.
4. Discutan y concluyan sus resultados, en el siguiente espacio.
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________
Esta actividad ser evaluada con la rbrica que se presenta al final del presente bloque.

Termorreguladora: se debe al elevado calor especfico y calor de vaporizacin. Por ejemplo, los
animales, al sudar, expulsan agua, la cual para evaporarse toma calor del cuerpo y, como consecuencia,
ste se enfra.

64

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

65

Biologa 1

Inicio

Secuencia didctica 3
ESTRUCTURA Y FUNCIN DE BIOMOLCULAS ORGNICAS

9. Cientficos que propusieron el modelo de la molcula del ADN.


__________________________________________________________________________________________
10. Por qu son importantes las biomolculas para los seres vivos?
__________________________________________________________________________________________
__________________________________________________________________________________________

ACTIVIDAD 1

________________________________________________________

SD3-B2

Instruccin: De manera individual responde los siguientes cuestionamientos y una vez que la concluyas,
participa en la dinmica guiada por tu maestro.
1. Cules elementos qumicos comparten los carbohidratos, protenas, lpidos y cidos nucleicos?
__________________________________________________________________________________________
________________________________________________________

Desarrollo

Las biomolculas son otro principio unificador de la vida en el sentido de que todos los
organismos elaboran molculas especializadas, que les permiten realizar todas las reacciones
qumicas relacionadas con la vida.
Estas biomolculas, se clasifican en cuatro grupos de acuerdo a su estructura qumica y
presentan una funcin especfica. Dichos grupos y sus funciones se mencionan enseguida:
a) Carbohidratos: estructura y energa

2. Es el enlace qumico que mantiene unidos a los compuestos orgnicos


__________________________________________________________________________________________

b) Lpidos: almacenamiento de energa

________________________________________________________

c) Protenas: funcionamiento celular

3. Qu es un grupo funcional? Menciona tres ejemplos de ellos.

d) cidos nucleicos: reproduccin y codificacin de protenas

__________________________________________________________________________________________
________________________________________________________

En estas biomolculas el carbono forma su esqueleto molecular debido a su gran potencial


de variabilidad estructural.

4. Diferencia entre monmero y polmero

A continuacin se detallar sobre cada una de estas biomolculas.

__________________________________________________________________________________________

CARBOHIDRATOS:

__________________________________________________________________________________________

Biomolculas ms abundantes en la naturaleza

_______________________________________

Tambin se les denomina, glcidos, azcares e hidratos de carbono

5. Anota ejemplos de cuerpos presentes en tu entorno, que estn constituidos o contengan carbohidratos.
__________________________________________________________________________________________

Estn constituidos por C, H y O

________________________________________________________

Frmula qumica (CH2O)n

6. Anota un alimento rico en lactosa y otro en fructosa

Se clasifican en monosacridos, oligosacridos y polisacridos.

__________________________________________________________________________________________
________________________________________________________

Principales funciones de los carbohidratos en los seres vivos:

7. Es una biomolcula, que se caracteriza por ser la principal fuente de energa para los seres vivos.

1. Son fuente de energa qumica, por lo que son fundamentales en el metabolismo


energtico de los seres vivos.

__________________________________________________________________________________________

2. Intervienen en la formacin de estructuras como la membrana y pared celular.

________________________________________________________

3. Forman parte de cartlagos, huesos y tendones.

8. Anota el nombre de los cidos nucleicos.

4. Forman parte de los cidos nucleicos.

__________________________________________________________________________________________

5. Se originan durante la fotosntesis

________________________________________________________
66

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

67

Biologa 1

6. Son transformados por los organismos en otros productos para que participen en su metabolismo, aunque
tambin pueden ser convertidos en grasas, y a la inversa.

La estructura lineal de algunos monosacridos se muestra en la siguiente figura:

Estas biomolculas se definen como derivados aldehdicos o cetnicos de alcoholes polivalentes, segn el grupo
funcional presente en su estructura molecular.
Grupo funcional

Frmula

Aldehdo

R C (=O)H

Estructura
O

C
R

C
Cetona

R C (=O) - R

Monosacridos: son monmeros o las unidades ms pequeas de los azcares, ya que estn formados por una
sola molcula, que presenta en su estructura de tres a nueve carbonos. Funcionan como energticos y componentes
de molculas mayores. Son sustancias cristalinas solubles en agua, blancas y de sabor dulce.
El nombre que reciben estos azcares, segn el nmero de carbonos, se presenta en la siguiente tabla:
Nmero de Carbonos

Nombre

Triosas

Tetrosas

Pentosas

Hexosas

Heptosas

Octosas

Nonaosas

68

Colegio de Bachilleres del Estado de Sonora

Entre los monosacridos ms importantes, destacan:


Glucosa o dextrosa: es el monosacrido ms abundante en los seres vivos. La producen las plantas durante
la fotosntesis y es la principal fuente de energa para todos los seres vivos.

Fructosa: es el azcar de las frutas, como naranja, pia y mango. Se encuentra en la miel y se utiliza como
edulcorante de muchos refrescos.

Galactosa: se encuentra como reserva del tejido nutritivo de las semillas y en numerosas gomas vegetales.

Por lo general, los monosacridos con cinco o ms carbonos se encuentran en solucin como estructuras cclicas
en las que el grupo carbonilo no est libre, sino que forma un enlace covalente con un grupo (-OH) de la cadena.
El nuevo enlace genera un hemiacetal, lo que convierte el carbono del carbonilo en un nuevo centro quiral.
La formacin de un hemiacetal surge de la reaccin de un grupo carbonilo con un alcohol, como se ilustra a
continuacin:

El monosacrido cclico existe, entonces, como dos estereoismeros diferentes, llamados anmeros y designados
con las letras
(alfa) y (beta).
Se ha establecido que los grupos que estn orientados hacia la derecha en la estructura de cadena recta se dibujen
hacia abajo en la estructura cclica; los que estn hacia la izquierda en la cadena recta, en la cclica se dibujan hacia
arriba. Por tanto, considerando como referencia el grupo OH, las estructuras cclicas formadas se denominarn,
como se muestra en el siguiente esquema:

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

69

Biologa 1

ACTIVIDAD 2
SD3-B2

Instruccin: consulta las fuentes de informacin recomendadas por tu maestro sobre el tema de monosacridos y
completa la siguiente tabla.
Por ejemplo, para la glucosa, perteneciente al grupo de las aldosas, tenemos:

Tipo de
monosacrido

Nombre

Estructura
lineal

Estructura
cclica

Caractersticas
y/o propiedades

Fuentes
naturales

Ribosa

Desoxirribosa

En el caso de la fructosa, perteneciente al grupo de las cetonas:

Manosa
Aldosas
Galactosa

Glucosa

Fructosa

Cetonas

70

Colegio de Bachilleres del Estado de Sonora

Sorbosa

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

71

Biologa 1

Oligosacridos: son el resultado de la unin de dos a diez molculas de monosacridos. Son energticos,
componentes de molculas mayores y fuente de monosacridos.
Los oligosacridos ms importantes son los disacridos, quienes como su nombre lo dice, se forman a partir
de dos molculas de monosacridos unidas a travs de un enlace glucosdico. Ejemplo de ellos son la maltosa,
sacarosa y lactosa.
El enlace glucosdico, se caracteriza porque un grupo OH de un carbono anomrico, reacciona con un OH de
otro monosacrido, desprendindose una molcula de agua. Se puede decir entonces que en este tipo de reaccin
ocurre una condensacin o deshidratacin; quedando las molculas de monosacridos unidos por un tomo de
oxgeno. Este enlace tambin permite la formacin de molculas ms complejas como los polisacridos.
Maltosa: es el azcar de malta y grano germinado de cebada que se utiliza en la elaboracin de la cerveza. Se
obtiene por hidrlisis de almidn y glucgeno. Posee dos molculas de glucosa unidas por enlace tipo (1-4)
glucosdico.

Polisacridos: se forman por la unin de muchos monosacridos, principalmente molculas de glucosas en forma
lineal o ramificada. Este grupo de biomolculas se caracterizan por presentar peso molecular elevado, no tener
sabor dulce, no poseen poder reductor, pueden ser insolubles o formar dispersiones coloidales.
Por su composicin qumica, se clasifican como homopolisacridos o heteropolisacridos. Los primeros estn
formados por el mismo tipo de monosacridos, ejemplo de ellos son el almidn, el glucgeno, la celulosa y la
quitina; quienes estn constituidos por cientos de molculas de glucosa, unidas por enlaces glucosdicos. Mientras
que las molculas de los heteropolisacridos estn constituidas por diferentes tipos de monosacridos, como el
cido hialurnico, formado por miles de unidades de N-acetil glucosamina que se alternan con unidades de cido
glucurnico.
A continuacin se describen cada uno de estos polisacridos.
Almidn: es el principal polisacrido de reserva de la mayora de los vegetales; se le encuentra principalmente en
semillas, legumbres, cereales, patatas y frutos (bellotas y castaas). Se forma por la unin de cientos de molculas
de glucosa, que forman espirales compactas. Al disolverse en agua caliente forma una solucin coloidal conocida
como engrudo.
El almidn est formado por dos tipos de molculas: la amilasa (20%), polmero lineal de glucosas unidas por
enlaces (1- 4) glucosdicos y la amilopectina (80%), tambin polmero de glucosa pero ramificada, con enlaces
(1- 4) glucosdicos en la cadena lineal y de tipo (1- 6) glucosdico en los puntos de ramificacin.

Sacarosa: es el azcar con la que endulzamos nuestros alimentos; se obtiene a partir de la caa de azcar o del
betabel. Se encuentra en todas las frutas y vegetales, y es usada por las abejas para hacer la miel.
Este disacrido se forma por la unin de una molcula de glucosa y otra de fructosa, a travs de un enlace
glucosdico, como se muestra a continuacin:

(1-2)

Lactosa: se le conoce como azcar de la leche ya que est presente en la leche de las hembras de los mamferos
en una proporcin del 4 al 5 por ciento.
Este disacrido se forma por la unin de una molcula de glucosa y otra de galactosa, a travs de un enlace (1-4)
glucosdico, como se muestra a continuacin:

72

Colegio de Bachilleres del Estado de Sonora

Glucgeno: es un polisacrido de reserva en animales, que se encuentra en el hgado (10%) y msculos (2%).
Est formado por la unin de molculas de glucosa, unidas por enlaces
(1- 4) glucosdicos, que le dan una
estructura muy ramificada, es decir, con muchas cadenas laterales que se desprenden de la cadena principal.
Presenta ramificaciones cada 8-12 glucosas con una cadena muy larga (hasta 300,000 glucosas).

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

73

Biologa 1

Celulosa: se encuentra en las paredes de las clulas vegetales. Se forma a partir de molculas de glucosa, unidas
a travs de enlaces -glucosdicos; dichos enlaces permiten que sta sea fibrosa y por ello cumpla una funcin
estructural.
Asimismo, este tipo de enlace hace que este polisacrido sea indigerible para el ser humano; as que si comemos
cscara de frutas, hojas de plantas y en general la fibra vegetal, no la podemos digerir, sin embargo, se aconseja
incluir fibra en nuestra alimentacin porque nos ayuda a eliminar mejor los desechos.

ACTIVIDAD 3
SD3-B2

Instruccin: en equipo de cinco integrantes siguiendo el procedimiento descrito, identifiquen:


Qu alimentos presentan azcares complejos?

Quitina: es un polisacrido estructural formado por molculas de glucosas, unidas a un grupo amino. Los enlaces
entre las molculas de quitina son como los de la celulosa, de modo que tampoco el ser humano puede digerirla.
Se encuentra en el exoesqueleto de cangrejos, langostas e insectos y tambin forma parte de la pared celular de
los hongos.

Sustancias

Material

Solucin de almidn al 1%
Lugol
5 ml. jugo de naranja
5 ml. jugo de pia
5 ml. refresco light

4 tubos de ensayo
1 gradilla
5 cajas de petri
1 gotero

Procedimiento:
1. Preparen en un tubo de ensayo una solucin de almidn al 1% y agreguen dos gotas de lugol. El color
obtenido es la muestra patrn.
2. Agreguen 2 gotas de lugol a cada una de las muestras de 5 ml.

cido hialurnico: es un polisacrido del tipo de glucosaminoglucanos con enlaces , que presenta funcin
estructural, se le encuentra formando parte de la estructura en los tejidos conectivos de los vertebrados, lquido
sinovial de las articulaciones y en el humor vtreo del ojo.

3. Seleccionen cinco porciones o masas de alimentos slidos (manzana, zanahoria, papa, naranja, pltano,
galleta, tortilla, entre otros).
4. Agrega a cada uno de estos productos 2 gotas de lugol.
5. Anota tus observaciones y completa las siguientes tablas.
Muestra
Glucosa al 1%
Jugo de naranja
Jugo de pia
Refresco light

Color observado

Muestra

74

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Presencia de azcares

Presencia de almidn

Identificas las caractersticas y los componentes de los seres vivos

75

Biologa 1

Discutan sus resultados y con base a ellos, concluyan qu otros productos alimenticios que cada uno usan en su
vida cotidiana contienen azcares complejos, indicando los riesgos que presenta para nuestra salud la ingesta
excesiva de estos.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________
Nota: Esta evidencia de aprendizaje ser evaluada con la gua de observacin que se presenta al final del bloque.

LPIDOS
Son biomolculas formadas bsicamente por una molcula de glicerol
(glicerina) y tres molculas de cidos grasos.
Su estructura qumica es la siguiente:

Algunas caractersticas de los lpidos se mencionan a continuacin:


Tambin se les conoce como grasas.
Presentan el grupo funcional carboxilo.
Estn compuestos de carbono, hidrgeno, oxgeno.
Su frmula molecular es CH3 (CH2)n COOH.
Forman un grupo heterogneo, cuyas caractersticas dependen de la identidad y posicin de los cidos grasos
que lo componen.
Se caracterizan por ser insolubles en agua y solubles en solventes orgnicos como el ter cloroformo y benceno.
Son compuestos ricos en energa potencial.
Se les encuentra en alimentos tales como aceitunas, maz, crtamo, mantequilla, pescado, aguacate, cacahuate,
entre otros.
Presentan molculas apolares, debido a la ausencia de diferencia de electronegatividad, por esta razn son
hidrofbicos, ya que no son capaces de asociarse con molculas de agua.
Se saponifican en contacto con lcalis fuertes como el hidrxido de sodio (NaOH) e hidrxido de potasio
(KOH) a elevadas temperaturas para formar jabn.
Principales funciones de los lpidos en los seres vivos:
Componentes estructurales de membranas y tejidos celulares.
Reserva energtica, por cada gramo de lpido se obtienen 9.3 kcal.
Actan como aislante trmico y protegen a ciertos rganos de golpes fsicos.
Componentes funcionales de las hormonas (cortisona, aldosterona, progesterona), cidos biliares, colesterol, etc.
Actividades catalticas.
76

Colegio de Bachilleres del Estado de Sonora

ACTIVIDAD 4
SD3-B2

Instruccin: A continuacin se te presenta una lectura sobre las grasas. Analzala y reflexiona sobre la informacin
contenida en ella.
LAS GRASAS TRANS: ENEMIGO AL ACECHO
En diciembre de 2006, Nueva York se convirti en la primera ciudad de Estados Unidos donde los fabricantes de
alimentos estn obligados a informar en la etiqueta de sus productos cul es su contenido de grasas trans. Para julio
de 2008, ms de 24,000 restaurantes neoyorquinos debieron haber eliminado las grasas trans de sus mens. Por su
parte, el estado de California ha dado de plazo para la aplicacin de estas medidas el 2010. En Chile ya es obligatoria
la indicacin en las etiquetas, y varios pases en Europa comienzan a establecer las mismas disposiciones.
Por qu tanto revuelo? Qu son estas grasas? Las grasas trans son un aditivo industrial que se agrega a los alimentos
para que stos duren ms sin descomponerse en los estantes de las tiendas. Se encuentran en algunas margarinas,
galletas industrializadas, pan de caja, pasteles procesados, pizzas, botanas, algunos chocolates, frituras, helados de
crema, sustitutos de crema, leche sin colesterol y otros productos. El revuelo se debe al gran riesgo que representan
para la salud.
Ovejas negras
Como en todas las familias, en las grasas hay miembros con diferentes cualidades. Algunos son indispensables para
nuestra buena nutricin; otros tienen inmerecida mala fama, y otros ms son ovejas negras. Revisemos rpidamente
los expedientes de algunos de los principales miembros de esta familia tan diversa.
Las grasas o lpidos que consumimos en nuestra dieta nos aportan energa, transportan dentro de nuestro cuerpo a
las vitaminas que solo se disuelven en aceites (A, D, E, K) y son fuente de compuestos antioxidantes. Se incorporan
estructuralmente a nuestro organismo formado de mielina, sustancia que recubre las fibras nerviosas; otras son parte
fundamental de las membranas celulares; otras ms son precursoras de hormonas muy importantes que regulan la
presin arterial o tienen efectos antiinflamatorios en los tejidos.
La calidad de las grasas de nuestra dieta modula qu compuestos fabrica nuestro cuerpo a partir de ellas, y da como
resultado la produccin de sustancias con efectos fisiolgicos importantes. Dichos efectos pueden ser benficos o
dainos, dependiendo del tipo de grasas que se consuman.
Las grasas que ms conviene consumir son las mono-insaturadas y las poli-insaturadas. Las primeras pueden ayudar
a reducir el llamado colesterol malo en la sangre (lpidos de baja densidad, o LDL), y con ello disminuir el riesgo
de problemas cardiovasculares. Adems nos proporcionan nutrientes que ayudan a desarrollar y mantener nuestras
clulas.
Algunos alimentos que contienen grasas mono-insaturadas son los aceites de oliva, cacahuate y girasol, la mantequilla
de cacahuate y el aguacate.
Las grasas poli-insaturadas tambin ayudan a reducir el colesterol malo, y en ellas se incluyen grasas que nuestro
organismo requiere pero no puede producir por s mismo, como las llamadas omega-6 y omega-3.
Entre los alimentos que contienen grasas poli-insaturadas estn los aceites de maz y soya, pescados como la trucha,
el salmn y el arenque, y las semillas de girasol y las nueces de castilla. Las grasas saturadas elevan los niveles de
colesterol malo en la sangre; por ello hay que consumirlos poco. Estn en muchos alimentos, sobre todo en la carne
roja y los lcteos, y en los aceites de coco y de nuez de palma, entre otros.
Lo que es mejor no consumir son las grasas trans, ms dainas an que las grasas saturadas. No solo elevan los niveles

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

77

Biologa 1

de colesterol malo; tambin reducen los niveles sanguneos de lpidos de alta densidad (HDL) o colesterol bueno,
y elevan los triglicridos (otro tipo de lpidos en la sangre). Estas condiciones estn asociadas con la resistencia a
la insulina, lo que a su vez puede conducir a la diabetes tipo 2, hipertensin y a enfermedades cardiovasculares en
general.

A continuacin se describen cada uno de ellos:


Triglicridos: Se definen como steres de glicerol con tres molculas de cidos grasos. Su estructura qumica se
presenta a continuacin.

Las grasas trans se produjeron industrialmente por primera vez en 1911, pero fue hasta los aos 60 cuando se empez
a sospechar de sus efectos dainos en la salud. En las ltimas dos dcadas se han realizado numerosos estudios sobre
las grasas trans y actualmente la evidencia clnica que relaciona su consumo con las enfermedades cardiovasculares
es ms definitiva. De ah las campaas para lograr restaurantes y alimentos libres de grasas trans.
Si el consumo de grasas trans se inicia desde la infancia, incluso a travs de la leche materna (por las grasas trans que
consume la madre), para la edad madura el grado de acumulacin de estas grasas en los tejidos del cuerpo puede ser
peligroso, pues se metabolizan muy lentamente.
La buena noticia es que muchos de los efectos degenerativos que se asocian con las grasas trans pueden revertirse
si estas se evitan por completo; ms an si son reemplazadas por aceites vegetales poli-insaturados obtenidos a baja
temperatura, por prensado en fro y sin refinar: lo que se conoce como extraccin extra virgen.
Fuente: Gonzlez, C (2009). Las grasas trans enemigo al acecho. Cmo ves? Revista de divulgacin UNAM. Ao 11, N 128.

Con base al anlisis de la lectura del texto anterior, contesta las siguientes preguntas:
1. Consumir grasas no es malo; desarrollar una dieta sin grasas puede ser peor que consumirlas en exceso. Qu
entiendes de esto?
__________________________________________________________________________________________

La importancia de este grupo de lpidos en particular para los seres vivos, es que son principalmente fuente de
energa, componentes de la membrana celular y, en los animales sirven como aislantes contra la prdida de calor
por el cuerpo.
Los cidos grasos son cadenas largas de tomos de carbono con un grupo carboxilo (COOH) en uno de sus
extremos. Las cadenas de cidos grasos pueden ser saturadas, es decir, no contienen dobles enlaces, e insaturadas,
las cuales tienen uno o ms dobles enlaces.
Los principales cidos grasos saturados que se encuentran en las grasas animales son los cidos palmtico y
esterico, cuya estructura qumica se presenta enseguida:
cido palmtico CH3- (CH2)14 COOH

__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
______________________________________________________________________________
2. El rebote en las dietas tiene que ver con la pobre ingesta de grasas o azcares realizado por las clulas, que
como mecanismo de defensa al terminar su abstencin asimilan de ms para tener reserva en caso de una nueva
inanicin. Cmo explicas esto?

cido esterico

CH3- (CH2)16 COOH

Entre los cidos grasos insaturados de importancia, tenemos a los cidos linolico y linolnico. A estos cidos se
les conoce como esenciales, ya que el organismo requiere de ellos, pero no es capaz de sintetizarlos, de manera
que los tiene que adquirir de la dieta diaria. La estructura qumica de estos se muestra a continuacin:
cido linolico

CH3 - (CH2)4 - CH= CH - CH2 - CH= CH - (CH2)7 - COOH

__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________________
Clasificacin de los lpidos:

cido linolnico

CH3 - CH2 - CH= CH- CH2 - CH= CH - CH2 - CH = CH- (CH2)7 COOH

Los triglicridos pueden existir en estado slido o lquido, segn la estructura de los cidos grasos que los
componga. Cuando se presentan en estado slido, se denominan mantecas y cuando su estado es lquido, aceites.
Las mantecas se caracterizan por ser de origen animal y por presentar una gran proporcin de cidos grasos
saturados, tales como el palmtico y el esterico. Un ejemplo es la tripalmitina, cuya estructura qumica se presenta
a continuacin.

Dado la diversidad de compuestos incluidos en este grupo de biomolculas, no existe un criterio nico para la
clasificacin de estos. No obstante, se les puede clasificar como triglicridos o grasas neutras, ceras, fosfolpidos
y esteroides.

78

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

79

Biologa 1

Los aceites son de origen vegetal y contienen una gran proporcin de cidos grasos insaturados del tipo de los
cidos oleico y linolnico; un ejemplo de ellos es la triolena, cuya estructura se muestra enseguida.

Los fosfolpidos forman parte de todos los seres vivos.


Lo antes descrito, permite adems a los fosfolpidos participar en un intercambio de sustancias entre un medio
acuoso y un sistema lipdico, separando y aislando a los dos sistemas y, a la vez, mantenindolos unidos. Tal
condicin, es aprovechada a nivel industrial, de manera que estos compuestos se utilizan como estabilizadores
de la mezcla de grasas con sustancias disueltas en agua, por ejemplo en la elaboracin de galletas, chocolates y
cremas humectantes para la piel.

Ceras: se definen como steres de cidos grasos y alcoholes de cadena muy larga, como ejemplo de ellas podemos
mencionar a la cera producida por las abejas.

Este tipo de biomolculas abundan principalmente en el cerebro y tejido nervioso, aunque se encuentran en
todas las clulas animales y vegetales. En las membranas celulares juegan un papel importante, ya que actan
controlando la transferencia de sustancias tanto al interior como al exterior de la clula; as mismo, facilita el
transporte de triglicridos, de manera que no permiten que se acumulen y obstruyan los vasos sanguneos. Tambin
se consideran molculas esenciales en la digestin y absorcin de las grasas en el intestino.

Las ceras son qumicamente inertes por su insolubilidad en agua. Se consideran lpidos estructurales, ya que
forman cubiertas aislantes que protegen la piel, pelaje, plumaje, hojas y frutos.

Los fosfolpidos ms importantes son la lecitina, cefalina y la fosfaditil serina, quienes se diferencian por la base
nitrogenada que presentan.

Su estructura qumica se muestra en el siguiente esquema:

Esteroides: son lpidos derivados del ncleo del hidrocarburo esterano (o ciclopentanoperhidrofenantrenoson.
Estructuralmente poseen un ncleo comn constituido por cuatro anillos de tomos de carbono unidos entre
s; tres de ellos poseen seis tomos de carbono, mientras que el cuarto posee cinco tomos, como lo podemos
observar en la figura siguiente.

Fosfolpidos: son compuestos que adems de carbono, hidrgeno y oxgeno, contienen fsforo y nitrgeno. Se
forman de igual forma que un triglicrido, solo que en este caso se une un grupo fosfato en el lugar del tercer
cido graso.
Este acomodo qumico le confiere al grupo fosfato ser la cabeza polar, es decir de naturaleza hidrofilica; mientras
que a las dos cadenas de cidos grasos, se convierten en las colas hidrofbicas de la molcula, como se observa
en el siguiente esquema:
Este grupo de lpidos comprenden compuestos que intervienen en diversas actividades fisiolgicas. En los animales
por ejemplo, regulan la funcin y desarrollo sexual y mltiples reacciones metablicas.
En la siguiente tabla se presentan los esteroides de mayor importancia para los seres vivos con su respectiva
estructura.
ESTEROIDE

Esta propiedad, hace que los fosfolpidos al contacto con el agua se siten formando dos capas en las que las
cabezas miran hacia el agua y las colas se esconden en medio; permitindose que se forme la membrana de las
clulas, como se muestra en la siguiente figura.

80

Colegio de Bachilleres del Estado de Sonora

IMPORTANCIA

ESTRUCTURA

Es el ms abundante y se encuentra
principalmente en los tejidos animales;
adems es un componente estructural
de la membrana celular.
Colesterol

BLOQUE 2

En el ser humano la concentracin


normal en sangre debe ser de 150- 200
mg/ 100 ml. Niveles altos se relacionan
con la arterosclerosis, padecimiento
caracterizado por el endurecimiento de
las arterias.

Identificas las caractersticas y los componentes de los seres vivos

81

Biologa 1

Estradiol

Hormona sexual femenina que se


secreta en los ovarios y, tiene la
funcin de estimular el desarrollo de
los rganos sexuales y caractersticas
sexuales secundaras durante la
pubertad. Adems, desempean un
papel importante durante el embarazo y
en la regulacin del ciclo menstrual.

Progesterona

Hormona sexual femenina producida


por los ovarios durante el ciclo
menstrual y participa junto con los
estrgenos en la preparacin de las
paredes del tero, para la implantacin
del vulo fecundado.

Testosterona

Procedimiento:
1. Enumeren los tubos de ensayo del 1 al 12.
Tubos
1-3
4-6
7-9
10-12

Sustancia
Manteca
Glicerina
Aceite vegetal
Mantequilla

2. Agreguen a los tubos media cucharada (pequea), de las sustancias que se indican en la siguiente tabla.
3. Posteriormente agreguen a los tubos 5 ml. de las sustancias que se indican en la siguiente tabla.

Hormona sexual masculina producida


en los testculos. Es responsable del
desarrollo y madurez de los rganos
sexuales, as como de las caractersticas
sexuales secundarias.

Tubos

Sustancia

1, 4, 7, 10

Agua

2, 5, 8, 11

Alcohol

3, 6, 9, 12

Cloroformo

3. Agiten cada uno de los tubos.

Cortisona

Hormona producida por la corteza de


las glndulas suprarrenales. Participa
en el metabolismo de los carbohidratos,
regula la concentracin de sales y agua
en los tejidos; se utiliza en casos de
inflamacin aguda y enfermedades
alrgicas.

4. Registren sus observaciones, discutan y realicen sus conclusiones.


a) Observaciones
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
b) Conclusiones

ACTIVIDAD 5

__________________________________________________________________________________________

SD3-B2

Instruccin: en equipo de cinco integrantes siguiendo el procedimiento descrito, determinen:

Sustancias
20 ml de cloroformo
20 ml de alcohol
Glicerina
Manteca
Aceite vegetal
Mantequilla

82

__________________________________________________________________________________________
__________________________________________________________________________________________

En qu tipo de sustancias se disuelven los lpidos?

_________________________________________________________________________________________

Material
12 tubos de ensayo
Pinzas para tubo

_________________________________________________________________________________________

Colegio de Bachilleres del Estado de Sonora

__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

83

Biologa 1

5. Con base a sus resultados respondan los siguientes cuestionamientos.

Tipos de Aminocidos:

a) En qu sustancias se disuelven los lpidos.

Las protenas animales y vegetales, estn constituidas por 20 tipos de aa distintos, algunos de estos pueden
ser sintetizados por el organismo y reciben el nombre de aminocidos no esenciales; otros, en cambio, deben
obtenerse a travs de la dieta, ya que el organismo no los puede sintetizar, a estos se les denomina aminocidos
esenciales.

__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

En la especie humana 9 de ellos son esenciales y los 11 restantes, son no esenciales, como puede observarse en
la siguiente tabla.
Aminocidos esenciales

Aminocidos no esenciales

Alanina (Ala)

cido asprtico (Asp)

Fenilalanina (Fen)

cido glutmico (Glu)

Isoleucina (Ile)

Arginina (Arg)

________________________________________________________________________

Leucina (Leu)

Asparagina (Asn)

Nota: Esta evidencia de aprendizaje ser evaluada por la rbrica que se presenta al final del bloque.

Lisina (Lis)

Cisteina (Cis)

Metionina (Met)

Glicina (Gli)

PROTENAS:

Tirosina (Tir)

Glutamina (Gln)

Se definen como polmeros formados por aminocidos.

Treonina (Tre)

Histidina (His)

El trmino protena se deriva de la palabra Proteois, que significa de primer orden, ya que son esenciales tanto
para la formacin de estructuras como para las funciones que realizan las clulas.

Triptfano (Trp)

Prolina (Pro)

b) Por qu se disuelven en tales sustancias.


__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

Serina (Ser)

Los aminocidos (aa), como puede observarse en la figura mostrada a continuacin, se caracterizan por presentar
en su estructura qumica un grupo R que vara de un aminocido a otro, acompaado de los grupos funcionales
amino (NH2) y cido carboxlico (COOH).

Valina (Val)
Caractersticas importantes de las protenas:

Los aminocidos se unen entre s a travs de un enlace llamado peptdico, el cual se forma cuando el grupo
carboxilo de un aa, reacciona con el grupo amino del aa siguiente; implicando la prdida de una molcula de
agua, como podemos observar en la siguiente figura.

84

Colegio de Bachilleres del Estado de Sonora

Son las biomolculas ms abundantes en los seres vivos (representan aproximadamente el 50 % de su


peso en seco)

Estn constituidas por carbono, hidrgeno, oxgeno, nitrgeno y en menor cantidad, azufre.

Presentan elevado peso molecular.

Por cada gramo de protena se obtienen 4 kcal de energa.

Algunas de ellas como la ovoalbmina poseen una molcula gigantesca.

Algunas se disuelven en agua, otras se coagulan y otras ms se precipitan por la accin de cidos, bases o
alcoholes a temperaturas superiores a los 70C y soluciones salinas concentradas.

Forman parte de casi todas las estructuras celulares, hormonas, enzimas, anticuerpos, sangre, entre otras.

Las principales fuentes de protena las encontramos en el huevo, carne, productos lcteos, cereales,
leguminosas, nueces, entre otros vegetales.

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

85

Biologa 1

Funcin de las protenas

ACTIVIDAD 6

Los tipos de protenas, funcin especfica y ejemplo respectivo se presentan en la tabla siguiente.

SD3-B2

Instruccin: de manera individual consulta fuentes de informacin apropiadas y documntate sobre el plato del
bien comer. Realiza un informe mximo de dos cuartillas, del porqu se le considera a ste una gua alimentaria.
Esta actividad de aprendizaje ser evaluada con el formato que se presenta al final del bloque.
Estructura de las protenas: la estructura de las protenas suele describirse en relacin con la organizacin de
su molcula. Existen cuatro niveles de estructuras, los cuales se describen y esquematizan en la tabla siguiente.
Estructura

Primaria

Descripcin

Solo describe la secuencia y tipos de aminocidos


que la componen.

Las cadenas polipeptdicas no son planas, algunas


adoptan formas espirales o de hlice para dar una
estructura tridimensional, a esta se le conoce hlice
alfa.
Secundaria

Terciaria

Dicha estructura se conserva gracias a la presencia


de puentes de hidrgeno que se forman entre el
oxgeno del grupo carboxilo y el hidrgeno de los
grupos amino de cada tercer residuo de aminocidos
en la cadena.
La posicin de ciertos aminocidos en la cadena
polipeptdica, hace que cambie la direccin de la
hlice alfa, dando lugar a una estructura compacta
denominada globular o terciaria.
Esta estructura se mantiene por la formacin de
puentes de hidrgeno, de puentes de disulfuro (-SS) y por la interaccin de las cadenas laterales que
contienen funciones de naturaleza cida y bsica.

La presentan aquellas protenas que estn constituidas


por dos o ms subunidades proteicas globulares,
denominadas monmeros. Dichas subunidades estn
Cuaternaria unidas entre s por fuerzas electrostticas.
Cada subunidad por separado no presenta actividad
biolgica, solo mediante la unin de ambas.

86

Colegio de Bachilleres del Estado de Sonora

Esquema

Tipo

Funcin

Ejemplo

Almacenadoras

Reserva

Albminas

Transporte

Transporte de grupos

Hemoglobina

Contrctiles

Contraccin muscular

Miosina

Conectivas

Unin

Colgeno

Toxinas

Venenos

Veneno de vbora

Hormonas

Control

Insulina

Estructurales

Estructura

Queratina

Defensa

Inmunidad

Inmunoglobulina

Enzimas

Catalizadores

Amilasa

Regulan genes

Inhibe genes

Histonas

ACTIVIDAD 7
SD3-B2

Instruccin: en equipo de cuatro integrantes consulten fuentes de informacin seguras e investiguen sobre los
siguientes trastornos alimentarios y completen el siguiente cuadro.
Caractersticas
Enfermedad

Prevencin
Causas

Efectos

Recomendaciones para su
tratamiento

Bulimia nerviosa

Vigorexia

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

87

Biologa 1

A continuacin se presenta un esquema de la estructura de un nucletido

Anorexia nerviosa

A) Nucletido correspondiente al ADN

B) Nucletido correspondiente al ARN

Como puedes observar en el esquema anterior, la pentosa correspondiente al ADN es la desoxirribosa; mientras
que en el ARN, es la Ribosa.

Megarexia

Tanto los nucletidos correspondientes al ADN como los del ARN, se unen por medio de los grupos fosfatos, que
enlazan al carbono nmero cinco de una pentosa con el carbono nmero tres de la pentosa siguiente. Las bases
nitrogenadas se conectan en el primer carbono del azcar.
Las bases nitrogenadas se clasifican como purinas (o pricas) y pirimdicas (o pirimidnicas). A las primeras
corresponden la adenina y guanina; mientras que a las segundas la citosina, timina y uracilo.
Dismorfia corporal

La estructura qumica de las bases nitrogenadas se muestra a continuacin.

Sobreingesta
compulsiva

cidos nucleicos: El descubrimiento de los cidos nucleicos se debe a Friedrich Miescher, quien en el ao
1869 aisl del ncleo de diferentes individuos, una sustancia cida a la que llam nuclena, nombre que
posteriormente se cambi a cido nucleco. En la naturaleza existen solo dos tipos de estos cidos: el ADN (cido
desoxirribonucleico) y el ARN (cido ribonucleico) y estn presentes en todas las clulas.

Las pirimidinas presentan un anillo de carbono y las purinas dos anillos de carbono.
Por lo tanto, los siguientes cinco nucletidos forman parte de la estructura de los cidos nucleicos.

Ambos cidos presentan elevado peso molecular con una estructura muy compleja, formada por cientos o miles de
unidades sencillas, llamadas nucletidos unidos por enlaces ster de fosfato, sin periodicidad aparente.
Son los componentes celulares en los que radica la clave de la transmisin de las caractersticas hereditarias
(ADN) y la sntesis de protenas (ARN). Tambin se les conoce como polinucletidos y se caracterizan por
presentar una estructura helicoidal.
Un nucletido, qumicamente est constituido por una unidad de las siguientes molculas:
Azcar
(Pentosa)

88

Base nitrogenada

Grupo fosfato

(Prica o Pirimdica)

Colegio de Bachilleres del Estado de Sonora

La guanina, citosina y timina son comunes para el ADN y ARN; la adenina es exclusiva para el ADN y el uracilo
para el ARN.

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

89

Biologa 1

La estructura del ADN es de doble cadena, lo que confiere una mayor proteccin a la informacin contenida en
l; mientras que la estructura de los ARN es monocatenaria, aunque puede presentarse en forma lineal como el
ARNm o en forma plegada cruciforme como ARNt y ARNr.
En las clulas eucariotas, el ADN se encuentra en el ncleo formando largas molculas lineales asociadas a
protenas bsicas. Aunque la mayor parte del ADN en estas clulas est confinada en el ncleo, tambin las
mitocondrias y los cloroplastos poseen ADN. El ARN se localiza tanto en el ncleo como en el citoplasma, en
este ltimo, particularmente, en los ribosomas. Todos los ARN (ARN mensajero, ARN ribosmico y ARN de
transferencia), se sintetizan en el ncleo utilizando como molde una de las dos cadenas de polinucletidos del
ADN.
Por otra parte, en las clulas procariotas, al carecer de ncleo todos los cidos nucleicos estn en el citoplasma o
formando parte de los ribosomas.

Cierre

ACTIVIDAD 9
SD3-B1

Instruccin: de manera individual elabora un mapa mental de las biomolculas (Carbohidratos, Lpidos, Protenas
y cidos nucleicos), analizadas en la presente secuencia.

ACTIVIDAD 8
SD3-B1

Instruccin: Lee el texto correspondiente al tema de cidos nucleicos e identifica y escribe las diferencias
sealadas entre el ADN y ARN en el siguiente cuadro.
Aspecto

ADN

ARN

Tipo de cadena

Bases nitrogenadas

Azcar

Ubicacin

Funcin

90

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

91

Biologa 1

Inicio

Secuencia didctica 4
ADN

Estructura secundaria: la secuencia de polinucletidos se dispone en el espacio en forma de una doble hlice,
segn la estructura propuesta por James Watson y Francis Crick en 1953. Dos descubrimientos previos les
permitieron a estos cientficos proponer este modelo de estructura secundaria del ADN aceptado en la actualidad.
En 1950, Erwin Chargaff, despus estudiar muestras de ADN pertenecientes a diversas especies de organismos,
observ que siempre exista la misma cantidad de bases nitrogenadas pricas y pirimidnicas. Descubri, adems,
que el nmero de adenina es siempre es igual al de timina, y el de guanina, al de citosina.

ACTIVIDAD 1
SD4-B2

Instruccin: Lee atentamente los siguientes cuestionamientos, contstalos y comprtelos con tus compaeros.
1. Es la forma que presenta el modelo de la molcula de ADN, que permiti explicar su estructura.
__________________________________________________________________________________________
________________________________________________________________________
2. Cientficos que propusieron el modelo de la molcula de ADN.
__________________________________________________________________________________________

Por otra parte, en esta misma poca, Rosalind Franklin y Maurice Wilkins aplicaron el mtodo de difraccin de
rayos X al ADN y dedujeron que esta molcula posee una estructura helicoidal con dos periodicidades, una cada
0,34 nm y otra cada 3,4 nm.
A partir de estos datos, Watson y Crick elaboraron su modelo de estructura tridimensional del ADN, que presenta
las siguientes caractersticas:

El ADN est constituido por dos cadenas de polinucletidos unidos entre s en toda su longitud.

Las dos cadenas son antiparalelas, lo que significa que el extremo 3 de una de ellas se enfrenta con el
extremo 5 de la otra.

La unin entre las cadenas se realiza por medio de puentes de hidrgeno entre las bases nitrogenadas
de ambas: concretamente, la adenina forma dos de estos puentes con la timina y la guanina tres con la
citosina. Resulta evidente que las dos cadenas no son idnticas, sino complementarias, ya que una de ellas
tiene la secuencia de bases complementaria de la otra.

Las dos cadenas estn enrolladas en espiral formando una doble hlice alrededor de un eje imaginario.

Las cadenas no se pueden separar sin desenrollarlas.

La doble hlice es dextrgira: el enrollamiento gira en el sentido de las agujas del reloj.

La anchura de la hlice es de 2 nm, la longitud de cada vuelta es de 3,4 nm y cada 0,34 nm se encuentra
un par de bases complementarias. Puede deducirse, por tanto, que existen 10 pares de nucletidos por
cada vuelta.

_________________________________________________________________________
3. Menciona qu nombre recibe el enlace que mantiene unidas a las bases nitrogenadas que forman parte de la
molcula de ADN.
__________________________________________________________________________________________
________________________________________________________________________
4. Cul es la utilidad de las pruebas de ADN en nuestra vida cotidiana?
__________________________________________________________________________________________
________________________________________________________________________

Desarrollo

A continuacin se presenta el modelo de la molcula de ADN, propuesto por Watson y Crick.

Estructura del ADN: el cido desoxirribonucleico es el principal componente de los


cromosomas de todos los seres vivos. A su vez, cada cromosoma se encuentra integrado
por unidades de material hereditario llamadas genes.
De igual forma que las protenas, el ADN posee complejidad en su estructura. Los
investigadores han determinado que presenta fundamentalmente estructura primaria y
secundaria.
Estructura primaria: es la secuencia de nucletidos, unidos a travs de enlaces
fosfodister. Dichos enlaces fosfodister se establecen entre el radical fosfato situado en
el carbono 5 de un nucletido y el radical hidroxilo (-OH) del carbono 3 del siguiente
nucletido (enlaces 5-3). Una cadena de ADN presenta dos extremos libres: e unido al
grupo fosfato, y el 3, unido a un hidroxilo.

92

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

93

Biologa 1

Cuestionario

ACTIVIDAD 2

1. Cul es la funcin del ADN en la clula?

SD4-B2

Instruccin: formen un equipo de cinco integrantes y realicen la siguiente actividad experimental.


Obtencin de ADN

__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

Sustancias
taza de chcharos verdes secos
Detergente lquido para trastes
Ablandador de carnes
Alcohol etlico a 70-95%
Azul de metileno
Cloruro de sodio

Procedimiento:

Material
Licuadora
Colador
Vaso de precipitado de 250 ml.
Probeta
Pipeta de 10 ml.
Varilla de vidrio
Tubo de ensayo
Portaobjetos
Cubreobjetos
Microscopio

1. Coloquen en el vaso de la licuadora aproximadamente media taza de chcharos verdes secos, 1.5 gramos
de cloruro de sodio y 200 ml. (una taza) de agua fra.
2. Licen a alta velocidad por 15 segundos.
3. Tamicen la mezcla y colquenla en una probeta.

________________________________________________________________________
2. Qu estructuras de las clulas protegen al ADN?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
3. Qu funcin tiene el detergente para la extraccin del ADN? Recuerda que los detergentes actan sobre los
lpidos.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

4. Midan el volumen obtenido y agreguen 1/6 de ese volumen de detergente lquido (aproximadamente 30
ml.)

________________________________________________________________________

5. Agiten suavemente con el propsito de que se mezcle completamente el licuado con el detergente. Dejen
la mezcla reposar de 7 a 10 minutos.

4. El ablandador contiene enzimas que destruyen protenas. Expliquen para qu se utilizaron en este experimento.

6. Vacen la mezcla en tubos de ensayo a 1/3 de su volumen.


7. Agreguen 0.05 gramos (una pizca) de ablandador de carnes al tubo y agita suavemente. Es importante que
agiten muy suavemente, ya que de lo contrario se romper el ADN y ser difcil observar.
8. Agreguen a los tubos de ensayo que contienen la mezcla, alcohol etlico, procurando que se deslice por
las paredes, de manera que no se mezcle con el contenido del tubo y formen una capa en la parte de arriba
de la mezcla de chcharo. Agreguen alcohol hasta que tengan la misma cantidad de alcohol que la de
mezcla de chcharos.
9. Tomen cuidadosamente (pueden usar un palillo), la muestra que sube poco a poco hacia la capa de
alcohol (es el ADN extrado).
10. Coloquen el material extrado en un portaobjetos. Agreguen una gota de azul de metileno y un cubreobjetos.
11. Observen al microscopio.
Con base al desarrollo de la presente actividad experimental y a la informacin analizada en clases, discutan
sus observaciones, realicen las conclusiones correspondientes y contesten el siguiente cuestionario.

94

Colegio de Bachilleres del Estado de Sonora

__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
5. A qu sustancia es ms afn el ADN, al agua o al alcohol?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
Nota: La evaluacin de este producto se realizar tomando en cuenta la rbrica que aparece al final del bloque.

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

95

Biologa 1

Replicacin del ADN: una vez que se conoci el modelo de la estructura del ADN,
los cientficos tenan ahora resolver el problema de cmo se transmita el mensaje de
la herencia, de tal manera que se mantuviera para la siguiente generacin y que los
hijos conservarn las caractersticas de sus padres.
Llegaron a la conclusin de que cuando una clula se va a reproducir, necesita duplicar
su informacin gentica. Es muy importante que la informacin se mantenga intacta,
para que la clula hija pueda conservar las caractersticas de la clula original. A este
proceso de copia mediante la cual se forma una nueva molcula de ADN, se le llama
replicacin y se esquematiza a continuacin.

La enzima que lleva a cabo la replicacin del ADN es la ADN polimerasa; esta enzima tiene unos requerimientos
especficos para trabajar, que le imponen restricciones:
1. Slo aade nucletidos en la direccin 5 3.
2. Necesita para poder empezar a copiar y unir nucletidos un molde de ADN.
3. Necesita un pequeo trocito de ARN al cual unir los nucletidos, ya que ella no puede empezar a unir los
nucletidos sin tener una pequea cadena ya formada.
4. Utiliza nucletidos trifosfato.
En el modelo de la doble hlice las dos cadenas de ADN estn enrolladas una en la otra, como los hilos de
una cuerda. Si se trata de separar los hilos, la cuerda debe rotar o apretarse ms en las vueltas restantes. Se
esperara que ocurriera algo similar cuando las cadenas complementarias de ADN se separan para la duplicacin.
El desenrollamiento es efectuado por enzimas helicasas de ADN, las cuales recorren la hlice, desenrollando
las cadenas a medida que avanzan. Una vez que las cadenas estn separadas, protenas desestabilizadoras de la
hlice se unen por separado a cada cadena, impidiendo que vuelva a formarse la doble hlice mientras se copian
las cadenas. Enzimas especiales llamadas topoisomerasas producen roturas en la molcula de ADN y despus
vuelven a unir cada cadena, liberando la tensin e impidiendo de manera eficaz la formacin de nudos durante la
replicacin. Lo anterior se muestra en la figura siguiente:

forma de Y que se conoce como horquilla o burbuja de duplicacin. La posicin de


la horquilla de duplicacin est en constante desplazamiento a medida que el proceso
avanza a cargo de dos molculas de polimerasa ADN idnticas. Una agrega nucletidos
al extremo 3 de una de las nuevas cadenas, que siempre crece hacia la horquilla de
duplicacin. Dado que esta cadena puede formarse de manera continua y uniforme, se
le llama cadena directora (tambin conocida como lder o continua).

Una segunda molcula de polimerasa de ADN idntica a la anterior, agrega nucletidos


al extremo 3 de la otra cadena nueva, llamada cadena seguidora (tambin conocida
como rezagada o discontinua), que siempre crece en sentido opuesto a la horquilla de
duplicacin. Por ello, esta cadena se sintetiza en fragmentos cortos, porque la enzima
polimerasa de ADN necesitar desplazarse muy lejos de la horquilla para agregar
segmentos de manera continua al extremo 3 de la cadena. Estos segmentos de 100 a
1000 nucletidos se denominan fragmentos de Okazaki en honor de su descubridor,
Reijii Okazaki.
Cada segmento de Okazaki es iniciado por un ARN cebador distinto y crece hacia el
extremo 5 del fragmento previamente sintetizado por la polimerasa de ADN. Cuando se
alcanza el ARN cebador del fragmento previamente sintetizado, dicho ARN se degrada,
y el espacio resultante es llenado con ADN. Los fragmentos son unidos luego por ligasa
de ADN, una enzima que une el extremo 3 de un fragmento de ADN al extremo 5 de
otro.
Lo antes descrito se presenta en la siguiente figura:

Un obstculo importante para comprender la


duplicacin del ADN era el hecho de que las
cadenas complementarias son antiparalelas (estn
dispuestas en sentidos opuestos). Como la sntesis
del cido procede slo en el sentido 53 (lo cual
significa que la cadena que est siendo copiada
se lee en el sentido 35), al parecer sera
necesario copiar una de las cadenas comenzando
en un extremo de la doble hlice y la otra cadena
comenzando en el extremo opuesto. Sin embargo,
se sabe que eso no ocurre. La duplicacin del ADN
comienza en sitios especficos de la molcula de
ADN, denominados orgenes de la duplicacin
(o punto de crecimiento), y ambas cadenas se
duplican al mismo tiempo en una estructura en
96

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

97

Biologa 1

El proceso de transcripcin en una clula procariota y eucariota se muestra en seguida.


En clulas procariontes, cuando el ADN de doble cadena se separa, se generan dos
horquillas de duplicacin, de manera que la molcula se duplica en ambos sentidos
a partir de la horquilla de duplicacin. Las clulas procariticas suelen tener slo un
origen de duplicacin en cada molcula de ADN circular, de modo que las dos horquillas
avanzan recorriendo el crculo y terminan por encontrarse en el lado opuesto (como se
observa en la siguiente figura), para completar la formacin de dos nuevas molculas
de cido desoxirribonucleico.

Finalmente en este proceso se liberan dos molculas de ADN, cada una conserva una
cadena original y tiene otra cadena nueva. Por este motivo se dice que la replicacin del
ADN es semiconservativa.
ARN y sntesis de protenas: el ADN se encuentra en el ncleo de cada clula y la sntesis
de la protena debe realizarse en unos pequeos corpsculos denominados ribosomas,
que estn en el citoplasma de la misma clula. En otras palabras, la informacin gentica
necesaria para sintetizar una determinada protena debe salir del ncleo y desplazarse
por el citoplasma hasta llegar a los ribosomas.
En la siguiente imagen se resume este proceso:

El cdigo del ADN es el que controla la sntesis de protenas. Pero el ADN se halla en el
ncleo, mientras que los ribosomas, estn en el citoplasma de la clula. Entonces cmo
es transportado el cdigo del ADN a los ribosomas? sta es tarea del ARN, del cual
existen tres tipos de ARN, cada uno complementario entre s.

ARN mensajero (ARNm). Es el encargado de transportar el cdigo gentico al


citoplasma para controlar la formacin de protenas.

ARN ribosmico (ARNr). Junto con protenas constituyen los ribosomas,


estructuras en las cuales se ensamblan las protenas.

ARN de transferencia (ARNt) . Transporta aminocidos activados a los


ribosomas para ser utilizados en el ensamblaje de las molculas proteicas.

En la siguiente figura se muestra la estructura de estos tipos de ARN.

La sntesis de protenas se presentan en dos fases: transcripcin y traduccin. La primera


se define como el proceso mediante el cual el ADN pasa una copia de su informacin
a un ARN mensajero (ARNm). Este proceso se inicia en el interior del ncleo. All el
DNA se abre en sus cadenas laterales y una sola hebra sirve como molde. Se prepara
as un mensajero del trozo del DNA que constituye un gene. Este mensajero es igual al
molde, salvo una excepcin; una base, la Timina, es reemplazada por una nueva, que es
el Uracilo.
Un ejemplo de apareamiento, en la trascripcin es:
Hebra molde de ADN: A-G-T-T-C-G-A-T-G-A-G
ARN mensajero:
U-C-A-A-G-C-U-A-C-U-C
98

Colegio de Bachilleres del Estado de Sonora

Una vez sintetizado, el RNAm sale del ncleo y se dirige hacia los ribosomas para
que, de acuerdo a la informacin que lleva, se sintetice la respectiva protena. Mientras
tanto, en el ncleo el DNA se repara y vuelve a formar la misma doble hebra. El RNA
que sale del ncleo portando la informacin, se ha llamado RNA mensajero. En clulas
procariticas el ADN se encuentra y acta en el citoplasma.
El segundo proceso de la sntesis de protenas es la traduccin, es decir, el proceso de
convertir la informacin de una secuencia de bases nitrogenadas en el ARNm, en una
secuencia de aminocidos que conforman una protena. La traduccin que ocurre en los
ribosomas, incluye al ARNt. Si hay que construir protenas, entonces es necesario traer
los 20 aminocidos diferentes que se encuentran disueltos en el citoplasma hacia los
ribosomas. ste es el papel del ARN de transferencia. El ARNt lleva los aminocidos
hacia los ribosomas para que puedan ser ensamblados como protenas.

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

99

Biologa 1

Cmo sabe la clula cules molculas de ARNt llevan los aminocidos correctos? La respuesta es nuevamente
el apareamiento de las bases. La traduccin correcta del cdigo depende de la unin adecuada de cada codn del
ARNm con el anticodn del ARNt. El resultado final de la traduccin es la formacin de una gran variedad de
protenas que pueden construir la estructura de los organismos y ayudarlos a funcionar.
Los ribosomas utilizan el cdigo gentico para establecer la secuencia de aminocidos que ha sido codificada
por el ARN mensajero. Los aminocidos que van a formar las protenas estn dispersos en el citoplasma celular.
Son acercados por el ARN de transferencia. Uno de los lados del ARNt transporta un triplete de bases llamado
anticodn. En el otro lado se une un aminocido, proceso que demanda gasto de energa.
Este mecanismo se explica en las siguientes figuras:

Cierre

ACTIVIDAD 3
SD4-B2

Instruccin: intgrate en un equipo de cuatro participantes y contesten el siguiente ejercicio de reforzamiento


sobre la sntesis de protenas.
Como apoyo al reforzamiento del tema se les proporciona el siguiente esquema.

1. Con base al esquema realicen un anlisis y discutan las respuestas.


A) Qu nombre recibe la molcula sealada con la letra a?
__________________________________________________________________________________________
B) Dnde tiene lugar el proceso (h) en las clulas eucariotas?
Una vez finalizada la sntesis de una protena, el ARN mensajero queda libre y puede ser ledo de nuevo. De
hecho, es muy frecuente que antes de que finalice una protena ya est comenzando otra, con lo cual, una misma
molcula de ARN mensajero, est siendo utilizada por varios ribosomas simultneamente.

__________________________________________________________________________________________
C) Qu nombre recibe la molcula con la letra (f)?
__________________________________________________________________________________________
D) Qu nombre recibe el proceso (g) desarrollado para la formacin de la molcula (f)?
__________________________________________________________________________________________
E) Cmo se denomina el proceso que ocurre entre las molculas (a) y (b)?
__________________________________________________________________________________________

100

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

101

Biologa 1

F) Qu nombre recibe la molcula sealada con la letra (b)?

2. Es el nmero de cadenas de nucletidos que presenta el ARN.

__________________________________________________________________________________________

__________________________________________________________________________________________

G) Qu nombre recibe la molcula representada con la letra (d)?

________________________________________________________________________

__________________________________________________________________________________________

3. Cul es la diferencia en el material gentico en una clula procariota y una eucariota?

H) Qu nombre recibe la estructura con la letra (c)?

________________________________________________________________________

__________________________________________________________________________________________

__________________________________________________________________________________________
4. Qu pasara si el ADN no se replica antes de la divisin celular?

I) Es el proceso que realiza la clula entre los puntos cdf

__________________________________________________________________________________________

__________________________________________________________________________________________

________________________________________________________________________

J) Es el proceso que desarrolla toda clula anterior a la replicacin


__________________________________________________________________________________________
2. Anota la secuencia complementaria para la siguiente cadena de ADN:
ATTCGACCATCAGCTATGGGTATCCTAGGCAT
__________________________________________________________________________________________

Inicio

Secuencia didctica 5
CDIGO GENTICO

Desarrollo

En el proceso de interpretacin de la informacin del ADN, la clula tiene su propia


clave o cdigo para determinar qu aminocido deben colocarse para armar una protena
determinada. Esa clave est en el mensaje de ADN, ya que de acuerdo a los tripletes o
codones que se van leyendo se van colocando los aminocidos correspondientes.
Por lo anterior, el cdigo gentico se define como el conjunto de normas por las que la
informacin codificada en el material gentico, se traduce en protenas en las clulas. Este
define la relacin entre secuencias de tres nucletidos, llamadas codones, y aminocidos.
Un codn se corresponde con un aminocido especfico.
Los trabajos de los cientficos Marshall Nirenberg y Heinrich Matthaei fueron los que
permitieron descifrar el cdigo gentico.
La siguiente tabla corresponde al cdigo gentico, en el que muestran los 64 codones y los
aminocidos correspondientes a cada triplete.

ACTIVIDAD 1
SD5-B2

Instruccin: de manera individual responde los siguientes cuestionamientos.


1. Define con tus propias palabras:
A) Cdigo gentico
__________________________________________________________________________________________
________________________________________________________________________
B) Codn
__________________________________________________________________________________________
________________________________________________________________________
C) Genoma
__________________________________________________________________________________________
________________________________________________________________________

102

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

103

Biologa 1

ICaractersticas del cdigo gentico:


1. Consiste en 64 tripletes que corresponden a los 20 aminocidos, por lo tanto algunos aminocidos tienen
dos o ms codones que lo codifican. Lo anterior significa que dicho cdigo es degenerado.
2. Cada codn codifica para un aminocido determinado, lo que significa que el cdigo no es ambiguo.
3. Existe un codn de inicio y tres codones de terminacin. Estos ltimos no codifican para ningn
aminocido.
4. El cdigo es universal porque todos los seres vivos responden de la misma manera a las instrucciones
del ADN.
Ejemplo de interpretacin del cdigo gentico, con base a la tabla anterior:
Molde de ADN

TAC AAG

ARNm

AUG UUC (Transcripcin)

Aminocidos

Met Fen

El conocimiento del cdigo gentico ha sido obtenido por experimentaciones que comprueban la hiptesis de
los tripletes. Por ejemplo, en clulas bacterianas se introdujeron mensajes artificiales con secuencias de bases
nitrogenadas conocidas como molculas con solo nucletidos de uracilo y se obtuvo como resultado la sntesis
de una protena formada solo de fenilalanina. As se descubri que la lectura que hace el ribosoma del mensaje es
lineal, y que la clave de la fenilalanina era UUU. Con ese mtodo, y utilizando istopos radiactivos se ha logrado
descifrar el cdigo.
Como se mencion antes, el cdigo gentico es exactamente el mismo en todos los seres vivos que habitan el
planeta. Tal universalidad de este cdigo es una gran evidencia de que hace millones de aos todos los organismos
actuales compartimos un ancestro comn.
La interpretacin del cdigo gentico ha sido un gran avance para la ciencia y en l se basan las aplicaciones
de la biotecnologa actual, ya que ahora podemos saber qu mensaje gentico se necesita para la sntesis de
determinada protena, como la insulina, y as, con tcnicas muy especializadas para desarrollar microorganismos
que la elaboren para usos mdicos.

Metionina Fenilalanina

Cierre
ACTIVIDAD 2
SD5-B2

Instruccin: Intgrate con dos compaeros y resuelvan las siguientes situaciones problmicas relacionadas con
la aplicacin del cdigo gentico.
1. Interpreten el mensaje gentico siguiente anotando la secuencia de ARNm que se obtendra en un proceso
transcripcin para la secuencia:
TAC GAC CAA TTC GCG ACA CCC CAT CTA TCC CTA ACT
__________________________________________________________________________________________
2. Consulta el cuadro correspondiente al cdigo gentico y anota la secuencia de aminocidos que se
obtendra al traducir el mensaje.
__________________________________________________________________________________________
3. Descifra los aminocidos correspondientes a los mensajes siguientes:
4.
a) TAC CGC ACG TTA ATA CAC GGA CCC CAA AAT
__________________________________________________________________________________________
b) TAC CGA GGC ACA CCG AGA CAG CTA CCC AGG ACT
__________________________________________________________________________________________
c) TAC AAC GCT TAC GAC GGA TAA CCT CGC CTA
__________________________________________________________________________________________
________________________________________________________________________

104

Colegio de Bachilleres del Estado de Sonora

ACTIVIDAD 3
SD5-B2

Instruccin: lee con atencin el siguiente texto concerniente al tema Mapa gentico de los mexicanos.
Mapa gentico de los mexicanos
Los investigadores del Instituto Nacional de Medicina Genmica (Inmegen) analizaron la composicin gentica
de 300 pobladores mestizos e indgenas de varias regiones de Mxico.
Descubrieron que la poblacin es sustancialmente diferente de las otras tres poblaciones ancestrales o subgrupos
genticos que se conocen hasta ahora: el yoruba de frica, el chino y el japons de Asia y el caucsico de europeo
Cuando nos preguntamos si podramos incorporar el genoma que estudi el Proyecto Internacional del HapMapque analiz la variacin gentica de las tres poblaciones ancestrales- a nuestra poblacin, la respuesta fue: No,
explic a BBC Ciencia el doctor Gerardo Jimnez- Snchez, quien dirigi el estudio.
Nos dimos cuenta de que sera extraordinariamente costoso utilizar toda esa informacin porque tendramos que
sumar las tres poblaciones para tener una cobertura de suficiente resolucin que nos permitiera encontrar genes
asociados a enfermedades en Mxico, agrega.
Variaciones nicas
Tal como seala la investigacin publicada en Proceedings of the National Academy of Sciences (Actas de la
Academia Nacional de Ciencias de Estados Unidos PNAS, por sus siglas en ingls), los cientficos del Inmegen
decidieron trazar el propio mapa gentico de la poblacin mexicana para poder comparar esa informacin con la

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

105

Biologa 1

de otros genomas conocidos y buscar genes relacionados a enfermedades. El verdadero reto ahora es saber cmo
prevenimos el cncer de mama, como identificamos a personas que tengan mayor predisposicin a la influenza o
la hepatitis. Es decir, cmo cambiamos la vida y mejoramos la salud de los mexicanos.

2. De qu manera ayuda el conocer el mapa gentico de los mexicanos en la prevencin y predisposicin de


las personas a ciertas infecciones y enfermedades, como la influenza AH1N1?
__________________________________________________________________________________________

Por ejemplo, en un estudio reciente llevado a cabo en Asia se identific una caracterstica gentica que revela
la susceptibilidad de los asiticos a la hepatitis. Otros estudios han identificado a personas con predisposicin
gentica al virus VIH1- responsable de la mayora de casos de sida- y a la enfermedad de Kawasaki- un trastorno
infantil que causa inflamacin en los vasos sanguneos-, que se presentan con ms frecuencia en Japn.

__________________________________________________________________________________________

Esta investigacin es un catlogo de las variaciones genticas ms frecuentes en los mexicanos- afirma el doctor
Jimnez-Snchez- y es un instrumento que nos permitira encontrar genes asociados a las enfermedades humanas
con mucho mayor eficacia y menor costo. El enfoque agrega el investigador, ahora se concentrar en dos grupos
de enfermedades: las comunes; es decir, aquellas que padecen un considerable nmero de personas en el mundo,
como diabetes, obesidad, hipertensin y cncer, entre otras; y las enfermedades frecuentes, que son aquellas que
han mostrado alguna particularidad en los mexicanos.

3. Investiga otras aplicaciones a la gentica que han permitido el descubrimiento del cdigo gentico.

Por ejemplo- dice el cientfico- sabemos que el cncer de mama se presenta en promedio en Mxico diez aos
antes que en la poblacin caucsica. Y esto nos permite pensar que hay variaciones genticas en esta poblacin
que predispone a esta enfermedad, agrega.

__________________________________________________________________________________________
________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

ACTIVIDAD INTEGRADORA

Predisposicin e infecciones
Con el reciente brote de gripe porcina, que afect principalmente a Mxico, muchos cientficos se preguntaron
por qu en este pas el brote haba sido mucho ms letal que en otros pases.
Aunque, tal como seala el doctor Jimnez-Snchez, todava es muy pronto para establecer que una variacin
gentica podra ser responsable de la tasa de mortalidad en Mxico, pero quizs algn da se encontrar alguna
explicacin. Las enfermedades infecciosas como la influenza tienen un componente gentico y uno ambiental.
De tal forma que si hemos encontrado genes de la diabetes y la obesidad -como ha ocurrido en otras partes
del mundo- no veo por qu no podamos encontrar variaciones que hacen a las personas ms susceptibles a una
enfermedad viral o que generan un comportamiento diferente, como la muerte en el caso de la influenza AH1N1,
explica el investigador.

De manera individual, realiza la siguiente actividad que integra los conocimientos analizados en el presente
bloque; es sumamente importante que la realices a conciencia, pues te permitir autoevaluar tu aprendizaje.
I. En la siguiente sopa de letras se te presentan nombres de algunos elementos qumicos que constituyen a los seres
vivos. Colorea de azul aquellos que se les clasifica como bioelementos primarios y con verde a los clasificados
como oligoelementos.
H
I
D
R
O
G
E
N
O

Todava faltan muchas ms investigaciones para poder llegar a ese objetivo, dice el cientfico, pero este estudio
sentar la base para pasar de un nivel descriptivo de la poblacin mexicana a un nivel prctico que permita
identificar genes asociados a enfermedades comunes y producir medicinas para tratar esas enfermedades.
Fuente: BBC Mundo En: www.bbc.co.uk/mundo/ciencia_tecnologa/2009/05/090512/_genoma_mexicano_men.shtml

Con base a la lectura anterior, contesta los siguientes cuestionamientos.

Carbohidratos

__________________________________________________________________________________________

Colegio de Bachilleres del Estado de Sonora

B
A
Z
T
O
R
F
A
I

R
O
M
U
P
A
O
S
N

E
L
F
L
U
O
R
U
C

S
E
L
E
N
I
O
G
E

D
G
I
S
U
B
P
A
R

M
A
N
G
A
N
E
S
O

Disacridos
Polisacridos

________________________________________________________________________
106

O
C
D
E
D
T
S
D
Z

Monosacridos

__________________________________________________________________________________________
__________________________________________________________________________________________

C
A
R
B
O
N
O
M
S

II. A continuacin se te presentan los siguientes carbohidratos: glucosa, almidn, sacarosa, fructosa, ribosa,
celulosa, lactosa, quitina, maltosa. Identifcalos y agrpalos segn su estructura, en el siguiente cuadro sinptico.

1. Qu beneficios brinda la obtencin del mapa gentico de los mexicanos?


__________________________________________________________________________________________

X
P
A
O
Y
U
F
U
B

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

107

Biologa 1

VI. Resuelve el siguiente crucigrama.

III. Anota qu carbohidratos hay en los siguientes alimentos.


c) Leche con chocolate ________________________________________________________

1.

7.

8.

d) Pastel de vainilla ___________________________________________________________

9.

e) Jugo de naranja ____________________________________________________________

10.

f) Lechuga __________________________________________________________________

2.

IV. Completa el siguiente cuadro comparativo segn corresponda con las siguientes palabras: aminocidos,
nucletidos, transporte, regulacin, monosacridos, ADN y ARN, almidn y celulosa.
Biomolcula

Monmero

Funciones

Ejemplo

3.

Enzimas, hemoglobina

4.

Estructural y
almacenamiento

Polisacridos
Protenas

Herencia y sntesis de
protenas

cidos nucleicos

5.

V. Identifica en la siguiente sopa de letras nombres de compuestos orgnicos y clasifcalos en la tabla que aparece
abajo, segn el tipo de biomolculas al que corresponden.

6.

3. Lpido esteroide que se encuentra en alimentos como el huevo o la carne grasosa.

4. cido nucleco que participa en la sntesis de protenas.

Horizontales
1. Monosacrido que se encuentra en las frutas.
2. Smbolo qumico de un elemento que debe consumirse en bajas cantidades para evitar el riesgo de la
hipertensin arterial.

5. Componente o monmero de las protenas.


6. Se le llama as a las sustancias solubles en grasas, aceites y otros solventes orgnicos no polares como el
benceno y el tetracloruro de carbono.
Verticales

Carbohidratos

Lpidos

Protenas

7. Polisacrido estructural que forma parte de las hojas de las plantas.


8. Molcula que forma aproximadamente el 70% del cuerpo humano.
9. Tipo de enlace que se forma entre dos aminocidos.
10. Protena que tiene funcin hormonal y controla el nivel de azcar en la sangre.

108

Colegio de Bachilleres del Estado de Sonora

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

109

Biologa 1

VII. Selecciona la opcin que conteste correctamente a cada uno de los siguientes cuestionamientos.

( ) Se le llama as a las reacciones qumicas que permiten obtener molculas simples a partir de otras
molculas ms complejas.
a) Sntesis
b) Anablicas
C) Catablicas
d) Metabolitos
) Es un ejemplo de reaccin anablica.
a) Hidrlisis de agua
b) Degradacin de grasas

c) Degradacin de glucosa
d) Sntesis de protenas

) Proceso biolgico por el cual la clula obtiene la energa necesaria para realizar todas sus funciones:
a) Homeostasis
b) Respiracin
c) Adaptacin
d) Irritabilidad

) Hexosa ms importante por su aportacin energtica a los organismos.


b) Galactosa
c) Ribosa
d) Desoxirribosa
a) Glucosa

) Se le llama as al enlace a travs del cual se unen las molculas de azcar.


b) Ester
c) Puente de Hidrgeno
d) Glucosdico
a) Peptdico

) Polisacrido de reserva energtica en las plantas.


b) Quitina
c) Glucgeno
a) Almidn

) Polisacrido formado por unidades de beta-glucosa, unidas por enlaces -1,4 glucosdico
a) Almidn
b) Quitina
c) Glucgeno
d) Celulosa

) Es la estructura de una protena formada por la asociacin de dos o ms cadenas polipeptdicas.


b) Secundarias
c) Terciarias
d) Cuaternarias
a) Primaria

( ) La replicacin del ADN empieza cuando _______________, rompe los puentes de hidrgeno que
mantienen unidad las cadenas.
a) Una enzima
b) La hlice
c) Un azcar
d) Una protena
( ) La molcula de ADN es repetida cada vez que la clula se reproduce, en un proceso llamado:
a) Traduccin
b) Transcripcin
c) Transferencia d) Replicacin
(

) El enunciado El ADN se duplica por un mecanismo semiconservativo, significa que:


a) Slo se copia una cadena de ADN.
b) Primero se copia una cadena de ADN y luego la otra.
c) Algunas partes de una cadena individual de ADN son antigua, y otras son recin sintetizadas.
d) Cada doble hlice consta de una cadena antigua y otra recin sintetizada.

) Las topoisomerasas:
a) Sintetizan ADN
b) Sintetizan ARN cebador
c) Unen fragmentos de Okazaki
d) Rompen y vuelven a unir el ADN para deshacer los nudos que se han formado

d) Celulosa

) Es el tipo de solvente en el que se disuelven los lpidos.


a) Inorgnicos
b) Inicos
c) Orgnicos

d) Acuosos

) Son steres de glicerol con tres molculas de cidos grasos.


a) Fosfolpidos
b) esteroides
c) Ceras

d) Triglicridos

) Grasas neutras que se caracterizan por contener una gran proporcin de cidos grasos saturados.
b) Aceites
c) Fosfolpidos
d) Ceras
b) Mantecas

) Grupo de lpidos que en su estructura contienen un ncleo formado por cuatro anillos de tomos de
carbono, unidos entre s.
a) Fosfolpidos
b) cidos grasos
c) Esteroides
d) Ceras

REACTIVOS DE CIERRE
Contesta las siguientes preguntas.
1. A qu se le llama colesterol bueno y colesterol malo?
__________________________________________________________________________________________
________________________________________________________________________
2. Considerando que una cadena de ADN, tiene 456 pares de nucletidos. Cuntos codones contiene?
__________________________________________________________________________________________
________________________________________________________________________
3. Cuntos
aminocidos
tendr
el
pptido
derivado
del
siguiente
ARNm?
CUU-CCC-GAG-CUA-AUG-AUU-AAA-CAU-AGC-AUC-AUG-AUC-AAA-CAC-GCC-CUC-AUU

) Hormona sexual que interviene en el desarrollo sexual femenino.


a) cido clico
b) Testosterona
c) Estradiol

) Son las unidades fundamentales que constituyen a las protenas.


a) Aminocidos
b) Nucletidos
c) Monosacridos

d) Pptido

________________________________________________________________________

) Enlace caracterstico de las protenas.


a) Puentes de Hidrgeno
b) Peptdico

d) Glucosdico

4. Qu puede suceder con la sntesis de protenas, si en la transcripcin se cometen errores en el apareamiento


de las bases?

) Protenas que son componentes de la superficie de la piel, cabello y uas.


a) Conectivas
b) Almacenadoras
c) Estructurales
d) Contrctiles

110

c) Covalente

Colegio de Bachilleres del Estado de Sonora

d) Cortisona

__________________________________________________________________________________________

__________________________________________________________________________________________
________________________________________________________________________

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

111

Biologa 1

Formato de Coevaluacin para Evaluar la Actividad 5 de la Secuencia Didctica 3

Gua de Observacin para Evaluar la Actividad 3 de la Secuencia Didctica 3

DATOS INSTITUCIONALES
Unidad de Aprendizaje

Evaluador:__________________________________________________Equipo: ___________________
Nombre de la actividad
experimental

Biologa 1

Instrucciones: En la primera columna escribe el nombre de cada uno de tus compaeros de equipo sin incluir el tuyo.
Asgnales una puntuacin del 0 al 10 a cada uno de los aspectos a evaluar y al final justifica la puntuacin asignada.

Fecha

Nombre del docente


Antes de iniciar las actividades en el grupo de trabajo, lean
ntegramente esta gua de observacin.

Instrucciones:

Para cada integrante del equipo se valorarn cuatro aspectos,


los integrantes evaluarn a cada uno de sus compaeros
y marcarn con una X la casilla que consideren ms
adecuada con base en la siguiente escala:

Con el presente instrumento de evaluacin se


evaluar el trabajo en equipo.

E= Excelente B= Bien NM= Necesita mejorar

Nombre estudiante

Integrantes

Escucha con respeto a


sus compaeros.

NM

Se muestra tolerante
ante los puntos de vista
de sus compaeros.

NM

Su participacin
demuestra conocimientos
y habilidades para la
solucin del problema.

NM

Aspectos a evaluar*:
1. Su actitud fue de apoyo para la elaboracin del trabajo.
2. Particip activamente en las diferentes actividades del equipo.
3. Cumpli con lo acordado.
4. Fue tolerante ante las ideas de otros y tomaba en cuenta las opiniones.
5. Sus aportaciones las realiz pensando en el beneficio de todo el equipo.
ASPECTOS A EVALUAR*
Compaero

Contribuye para que


la participacin de los
integrantes del grupo se d en
un clima de respeto.

NM

Justificacin

.
.
.

.
.
.

.
.
.

.
.
.

.
.
.

.
.
.

EVALUACIN DE ACTIVIDADES
Rbrica para Evaluar la Actividad 5 de la Secuencia Didctica 1
Nombre de la Actividad Experimental:
Secuencia didctica:
Docente:
Grupo
Equipo N
Calificacin:
Nivel
Criterio

Escala
Predomina las E: El estudiante desarroll los atributos
Predomina las B: El estudiante est en proceso de desarrollo de los atributos
Predomina las NM: El estudiante an no desarrolla los atributos

112

Colegio de Bachilleres del Estado de Sonora

Presentacin

Fecha

Observaciones:
4

En la hoja de
presentacin, el
equipo anot:
nombre de la
institucin, nombre
completo del
trabajo, integrantes,
docente responsable.
Presentan texto
justificado,
letra arial 12
e interlineado
1.15, sin faltas de
ortografa, como les
fue solicitado.

BLOQUE 2

En la hoja de
presentacin el
equipo anot:
nombre de la
institucin,
nombre completo
del trabajo,
integrantes, docente
responsable. Se
observan menos
de cinco faltas de
ortografa,

En la hoja de
presentacin, el
equipo anot:
nombre de la
institucin, nombre
completo del trabajo,
integrantes, docente
responsable. Se
observan cinco faltas
de ortografa y no se
respeta el formato
solicitado.

Le falta informacin
solicitada a la hoja
de presentacin.
Se observan graves
faltas de ortografa
y no respetan el
formato solicitado.

Identificas las caractersticas y los componentes de los seres vivos

Puntos

113

Biologa 1

Se redacta la
presentacin
general, propsitos
y conclusin
de la actividad
experimental en una
cuartilla.

Se redacta la
presentacin
general y propsitos
de la actividad
experimental.

Se presentan
completamente y
en forma ordenada
todos los puntos
solicitados, en
mnimo cinco
cuartillas.

Se presentan
completamente y
en forma ordenada
todos los puntos
solicitados, en
menos de cinco
cuartillas.

La respuesta a la
pregunta planteada
est claramente
identificada, bien
estructurada y
presentada con
conclusiones.

La respuesta a la
pregunta planteada
est claramente
identificada, bien
estructurada.

Hiptesis
experimental

La relacin
postulada entre
las variables y
los resultados
anticipados, es
clara, pertinente y
razonable, basado
en lo que se ha
experimentado.

La relacin
postulada entre
las variables y
los resultados
anticipados, es clara
y razonable, basada
en el conocimiento
general y
observaciones.

La relacin postulada
entre las variables
y los resultados
anticipados ha sido
expuesta a partir del
razonamiento lgico
o sentido comn.

No se propuso una
hiptesis.

Soluciones y
materiales

Todos los materiales


usados en el
experimento son
descritos clara
y precisamente.
Las soluciones
se presentan
etiquetados
correctamente.

Casi todos los


materiales usados
en el experimento
son descritos clara
y precisamente.
Las soluciones
se presentan
etiquetados
correctamente.

Algunos de los
materiales usados
estn descritos clara
y precisamente. Las
soluciones no se
presentan etiquetadas
correctamente.

Muchos materiales
estn descritos
sin claridad y
las soluciones
no se presentan
correctamente
etiquetadas.

Se incluyen
esquemas claros
y precisos que
facilitan la
comprensin
de la actividad
experimental.
Los esquemas
estn titulados
correctamente.

Se incluyen
esquemas titulados
de una manera
ordenada y precisa.

Se incluyen
esquemas, algunos
de ellos presentan
titulo.

Faltan esquemas
importantes y los
que se presentan
no estn titulados
correctamente.

Introduccin

Desarrollo

Planteamiento
del problema

Esquemas u
observaciones

114

Solo se redacta la
presentacin general
de la actividad
experimental.
Se presentan
completamente y
en forma ordenada
algunos de los
puntos solicitados,
en menos de cinco
cuartillas.

La respuesta a la
pregunta planteada
est parcialmente
identificada y es
presentada con poca
claridad.

Colegio de Bachilleres del Estado de Sonora

Presentan una
introduccin de otro
autor.

Anlisis de
resultados

La relacin entre
variables es
discutida y analizada
detalladamente,
tomando en cuenta
las observaciones
o resultados
obtenidos.

Conceptos
cientficos

El reporte presenta
un preciso
entendimiento de los
conceptos cientficos
adquiridos en la
presente secuencia
didctica, as
como aquellos que
se enuncian en el
laboratorio es colar,
durante la ejecucin
de la actividad
experimental.

Conclusiones

La conclusin
incluye los
descubrimientos que
apoyan la hiptesis,
expresa posibles
fuentes de errores,
lo que se aprendi
de la actividad
experimental y la
interrelacin con el
entorno y la vida
cotidiana.

Referencias

Todas las referencias


corresponden a la al
tema desarrollado.
Se presentan en
orden alfabtico en
formato APA.

Se presentan
incompletamente
todos los puntos
solicitados en forma
desordenada.

La respuesta a la
pregunta planteada
es errnea e
irrelevante.

La relacin
entre variables
es discutida y
analizada tomando
en cuenta algunas
observaciones o
resultados con base
al razonamiento
lgico o sentido
comn.
El reporte presenta
un preciso
entendimiento
de la mayora
de los conceptos
cientficos
adquiridos en la
presente secuencia
didctica y los
enunciados durante
la ejecucin
de la actividad
experimental.

La relacin entre
variables solamente
es discutida y
analizada con base al
razonamiento lgico
o sentido comn.

La relacin entre
variables no
es analizada ni
discutida.

El reporte presenta
un limitado
entendimiento de los
conceptos cientficos
adquiridos en la
presente secuencia
didctica y los
enunciados durante
la ejecucin
de la actividad
experimental.

El reporte presenta
un errneo
entendimiento
tanto de los
conceptos cientficos
adquiridos en la
presente secuencia
didctica y los
enunciados durante
la ejecucin
de la actividad
experimental.

La conclusin
incluye los
descubrimientos
que apoyan a la
hiptesis y lo
que se aprendi
de la actividad
experimental.

La conclusin solo
incluye lo aprendido
de la actividad
experimental.

No se presenta
conclusin.

La mayora de
las referencias
corresponden al
tema desarrollado.
Se presentan en
formato APA.

Solo algunas de
las referencias
corresponden al tema
desarrollado y se
presentan en orden
alfabtico.

Se presenta
referencias de otro

Total

Puntos

1-4

5-8

9-12

13-16

17-20

21-24

25-28

29-32

33-36

37-40

41-44

Valoracin

10

12

14

16

18

20

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

Total

115

Biologa 1

Rbrica para Evaluar la Actividad 3 de la Secuencia Didctica 2


Nombre de la Actividad Experimental:
Secuencia didctica:
Docente:
Grupo
Equipo N

Alumno: ___________________________________
Grupo:_______________

Calificacin:

Criterios

Nivel
Criterio

Preparacin

Ejecucin de
la actividad

Actitud
de los
integrantes
del equipo

Respuesta
a la
problemtica
planteada

Fecha

Escala de Valoracin para Evaluar el Informe Escrito

Observaciones:
3

Traen el material
necesario en
buen estado para
el desarrollo
de la actividad
experimental
y se muestran
totalmente
dispuestos para
trabajar.

Traen el material
necesario en
regular estado
para el desarrollo
de la actividad
experimental y se
muestran totalmente
dispuestos para
trabajar.

Traen la mayora del


material necesario
en buen estado
para el desarrollo
de la actividad
experimental, pero
esto les impide el
estar completamente
dispuestos para
trabajar.

Traen algunos
de los materiales
necesarios en
regular estado
para el desarrollo
de la actividad
experimental,
lo que les
impide el estar
completamente
dispuestos para
trabajar.

Los integrantes
del equipo, en
todo momento
se mantienen
enfocados en
la realizacin
de la actividad
de manera
autodirigida y
ordenada.

Los integrantes
del equipo, en casi
todo momento se
mantienen enfocados
en la realizacin
de la actividad de
manera ordenada.

Solo dos o tres de los


integrantes se enfocan
en la realizacin
de la actividad.
Estos integrantes
continuamente invitan
a sus compaeros a
realizar la actividad en
conjunto.

Solo dos o tres de


los integrantes
se enfocan en la
realizacin de
la actividad,
sin invitar a sus
compaeros a
realizar la actividad
en conjunto

Todos los
integrantes se
escuchan con
respeto. Comparten
y apoyan el
esfuerzo de los
dems. Trabajan
unidos en todo
momento.
Se recabaron
la totalidad de
las evidencias
adecuadamente por
lo que se responde
correctamente a la
pregunta planteada.

Todos Los
integrantes se
escuchan con
respeto. En
algunas ocasiones,
dependiendo de la
tarea, comparten y
apoyan el esfuerzo
de los dems, por lo
que no se mantienen
unidos en todo
momento.
Se recabaron
la mayora de
las evidencias
adecuadamente por
lo que se responde
parcialmente a la
pregunta planteada.

Puntos

116

1-3
4

Contenido: el tema y la idea central


se presentan en forma clara.
Organizacin: las oraciones y los
prrafos presentan ideas claras;
el escrito, en general, presenta
secuencia lgica de las ideas (inicio,
desarrollo y cierre).
Vocabulario y gramtica: uso
adecuado del vocabulario y reglas
gramaticales.
Ortografa: la escritura de las
palabras y el uso de los signos de
puntuacin son correctos.
Total (Multiplicado por
0.5)

Suma

Excelente

Muy bueno

Bueno

Suficiente

Pobre

Muy pobre

Rbrica para Evaluar la Evidencia de Aprendizaje: Mapa Mental


Solo dos o tres de
los integrantes se
escuchan con respeto
y trabajan en conjunto.
Ocasionalmente
los integrantes
restantes apoyan a sus
compaeros.

Se recabaron algunas
de las evidencias
adecuadamente por
lo que se responde
errneamente a la
pregunta planteada.

Solo dos o tres


de los integrantes
se escuchan con
respeto y trabajan
en conjunto. Los
integrantes restantes
esperan a que
estos desarrollen el
trabajo.

Alumno: _____________________________________
Grupo:_______________
Criterio a
evaluar

No se recab
ningn tipo de
evidencia, por lo
que no se responde
a la pregunta
planteada.

Uso de
imgenes y
colores

Total
Puntos
Valoracin

Docente: ____________________________________
Fecha:_________________________
Valoracin
2
1
0
Observaciones

4-6
6

Colegio de Bachilleres del Estado de Sonora

7-9
8

10-12
10

Docente: ___________________________________
Fecha:_________________________
Niveles de desempeo

Excelente (10)

Muy bueno (8)

Bueno (6)

Suficiente (4)

Insuficiente (0)

Utiliza como
estmulo visual
imgenes para
representar los
conceptos. El
uso de colores
contribuye a
asociar y poner
nfasis en los
conceptos.

Utiliza como
estmulo visual
imgenes para
representar los
conceptos. El uso de
colores contribuye
a asociar los
conceptos.

No hace uso de
colores, pero
las imgenes
son estmulo
visual adecuado
para representar
y asociar los
conceptos.

No hace uso
de colores y
el nmero de
imgenes es
reducido.

No se utilizan
imgenes
ni colores
para asociar
conceptos.

Total

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

117

Biologa 1

Uso del
espacio,
lneas y texto

nfasis y
asociaciones

Claridad de
conceptos

El uso del espacio


muestra equilibrio
entre las imgenes,
lneas y letras.
La composicin
sugiere la
estructura y el
sentido de lo que
se comunica.
El mapa est
elaborado de
forma horizontal.

El uso del espacio


muestra equilibrio
entre las imgenes,
lneas y letras, pero
se observan tamaos
desproporciona-dos.
La composicin
sugiere la estructura
y el sentido de lo
que se comunica. El
mapa est elaborado
de forma horizontal.

La composicin
sugiere la
estructura y el
sentido de lo que
se comunica,
pero se aprecia
poco orden en el
espacio.

El uso de las
imgenes, colores
y el tamao de
la letra permite
identificar
los conceptos
destacables y sus
relaciones.

Se usan pocos
colores e imgenes,
pero el tamao de la
letra y de las lneas
permite identificar
los conceptos
destacables y sus
relaciones.

Se usan pocos
colores e
imgenes, pero
el tamao de
la letra y de las
lneas permite
identificar los
conceptos,
sin mostrarse
adecuadamente
sus relaciones.

Se usan
adecuadamente
palabras clave.
Palabras e
imgenes muestran
con claridad sus
asociaciones.
Su disposicin
permite recordar
los conceptos.
La composicin
evidencia la
importancia de las
ideas centrales.

Se usan
adecuadamente
palabras clave e
imgenes, pero
no se muestran
con claridad sus
asociaciones.
La composicin
permite recordar
los conceptos
y evidencia la
importancia de las
ideas centrales.

Uso poco
provechoso del
espacio y escasa
utilizacin de
las imgenes
y lneas de
asociacin. La
composicin
sugiere la
estructura y el
sentido de lo que
se comunica.

AUTOEVALUACIN
No se aprovecha
el espacio. La
composicin
no sugiere una
estructura ni un
sentido de los
que se comunica.

118

Se usan pocos
colores e
imgenes. Se
aprecian algunos
conceptos,
sin mostrarse
adecuadamente
sus relaciones.

No se observa
nfasis para
identificar
los conceptos
destacables,
ni tampoco se
visualizan sus
relaciones.

Apoy a los integrantes del equipo en el desarrollo e integracin de la actividad


Me comport respetuoso y tolerante con mis compaeros de equipo
Aport el material solicitado para el desarrollo de la actividad
Particip en la exposicin del tema ante el grupo

Las palabras
e imgenes
escasamente
permiten apreciar
los conceptos y
sus asociaciones.

Criterios a Evaluar
Las palabras e
imgenes no
permiten apreciar
los conceptos y
sus asociaciones.

Niveles de Desempeo
1

La actividad se concret a partir de las aportaciones e ideas de los integrantes del


equipo.
La actividad desarrollada fue consensuada y acordada por todos los integrantes de
equipo.
Durante la elaboracin de la actividad cada uno de los integrantes mostr atencin
y disposicin por el desarrollo de sta.
Durante el desarrollo de la actividad, el equipo actu en forma cooperativa, y
responsable.

1-4

5-8

9-12

13-16

17-20

21-24

25-28

29-32

33-36

37-40

10

12

14

16

18

20

Colegio de Bachilleres del Estado de Sonora

Escuch la opinin de los dems

Total

Valoracin

Particip en las actividades desarrolladas por el equipo

Trabajo en equipo
No se asocian
adecuadamente
palabras e
imgenes, pero
la composicin
permite destacar
algunos
conceptos e
ideas centrales.

Aport ideas valiosas en la actividad desarrollada

Subtotal

Puntos

Criterios a Evaluar

Total

Los integrantes del equipo se concretaron en seguir instrucciones y generar un


trabajo de calidad.
El trabajo del equipo se desarroll en un ambiente de respeto y tolerancia.

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

119

Biologa 1

PORTAFOLIO DE EVIDENCIAS

RBRICA DE EVALUACIN DE ACTIVIDAD INTEGRADORA


A continuacin se presentan los criterios a evaluar en la actividad integradora. Marque con una X en la columna
correspondiente, SI cumple o NO con dichos criterios.

INDICADORES

SI

Diferencia de un grupo de elementos qumicos entre


bioelementos primarios y oligoelementos.

Criterio/

Portada

Incluye nombre del


alumno, Institucin
y curso.
Incluye ttulo en
la portada, fecha y
lugar

Falta un
elemento en la
presentacin del
trabajo

Faltan dos
elementos en la
presentacin del
trabajo.

Carece de tres o
ms elementos
para la correcta
presentacin del
trabajo

Objetivo

El objetivo
representa el
aprendizaje
obtenido y la
razn por la cual
se estructuran
de esa forma las
evidencias.

El objetivo
del portafolio
considera slo
parcialmente
los contenidos
estudiados.

El objetivo del
portafolio no es
congruente con
los contenidos
o lecciones
estudiadas.

No tiene objetivo
explcito

Todos los
documentos estn
correctamente
presentados.
Constan de
encabezado, son
claros y limpios.

A los
documentos
les falta algn
elemento de la
presentacin.

A los documentos
les faltan ms de
dos elementos de
presentacin.

El documento
solo tiene un
elemento o
ninguno de
presentacin.

Organizacin

Todos los
documentos estn
correctamente
presentados.
Constan de
encabezados, orden,
claridad y limpieza.

La mayora de
los documentos
estn
correctamente
presentados.
Constan de
encabezados,
orden, claridad
y limpieza.

Algunos de los
documentos estn
correctamente
presentados.
Constan de
encabezados,
no aparecen
ordenados,
se presentan
con desorden,
poca claridad y
limpieza.

Algunos de los
documentos
estn
correctamente
presentados.
No presentan
encabezados, no
guardan orden y
son presentados
con poca claridad
y limpieza.

Ortografa

El portafolio de
evidencias est
elaborado sin
errores ortogrficos.

Se observan
hasta cinco
errores
ortogrficos.

Se observan de
6 a 10 errores
ortogrficos en el
portafolio

Se observan ms
de 10 errores
ortogrficos.

Puntuacin

NO

Distingue las caractersticas estructurales, funciones y


procesos que permiten reconocer a un ser vivo.
Identifica los componentes bsicos de las principales
biomolculas.
Identifica la complejidad estructural de las principales
biomolculas.
Ejemplifica mediante ejemplos la estructura y funciones
de los carbohidratos, lpidos, protenas y cidos
nucleicos.

Evidencias de
aprendizaje

Clasifica a los grupos de compuestos que forman parte de


las biomolculas: carbohidratos, lpidos y protenas.

Distingue la importancia de las distintas biomolculas en


la vida de los seres humanos.

Ejemplifica las fuentes naturales donde se pueden


encontrar las distintas biomolculas que requieren en su
nutricin los seres vivos.
Diferencia entre los procesos de transcripcin y
traduccin.
Reconoce el mecanismo semiconservativo mediante el
cual se duplica el ADN.

120

Colegio de Bachilleres del Estado de Sonora

Total

BLOQUE 2

Identificas las caractersticas y los componentes de los seres vivos

Total

121

FUENTES DE INFORMACIN
Bibliogrficas
Audesirk, T., G, A., & Byers, B. (2004). BIOLOGIA CIENCIA Y NATURALEZA. Naucalpan, Estado de
Mxico: PEARSON Prentice Hall.
Calixto, R. H. (2008). Biologa 1 Mxico: Progreso.
Espinosa, M. G. (2002). Biologa 1. Mxico: McGrawHill.
Fras, M. (2010). Biologa 1. Mxico, D.F: Nueva Imagen.
Gama, A. (2010). Biologa 1 COMPETENCIA+ APRENDIZAJE+VIDA. Mxico: PEARSON.
Gama, A. (2011). Biologa 1 COMPETENCIAS+APRENDIZAJE+ VIDA. Mxico: Pearson.
Garca, F. M. (2007). Biologa 1. Mxico: Bachillerato Santillana.
Potos, C. d. (2008). Biologa 1. San Luis Potos.

BLOQUE 3

Velzquez, M. (2010). Biologa 1. Mxico: ST-Editorial.

Reconoces a la clula como unidad de vida


Desempeo del estudiante
al finalizar el bloque
Reconoce a la clula como la unidad

fundamental de los seres vivos.


Analiza las caractersticas bsicas, el origen, la
evolucin, los procesos y la clasificacin de
las clulas.

Objetos de aprendizaje
La clula
Teora Celular
Teoras de la evolucin celular
Tipos celulares:

Procariota
Eucariota
Estructura y funcin de las clulas procariota
y eucariota.
Clulas eucariotas:
Clula vegetal.
Clula animal.
Procesos celulares.

Competencias a desarrollar
Elige las fuentes de informacin ms relevantes

122

para establecer la interrelacin entre la ciencia,


la tecnologa, la sociedad y el ambiente en
contextos histricos y sociales especficos.
Fundamenta opiniones sobre los impactos de
la ciencia y la tecnologa en su vida cotidiana,
asumiendo consideraciones ticas de sus
comportamientos y decisiones.
De manera general o colaborativa, identifica
problemas, formula preguntas de carcter
cientfico y plantea las hiptesis necesarias para
responderlas.

Colegio de Bachilleres del Estado de Sonora

Tiempo asignado: 16 horas

Utiliza las tecnologas de la informacin y

la comunicacin para obtener, registrar y


sistematizar informacin para responder a
preguntas de carcter cientfico, consultando
fuentes relevantes y/o realizando experimentos
pertinentes.
Contrasta los resultados obtenidos en una
investigacin o experimento con hiptesis
previas y comunica sus conclusiones aportando
puntos de vista con apertura y considerando los
de otras personas de manera reflexiva.
Define metas y da seguimiento a sus procesos
de construccin del conocimiento explicitando
las nociones cientficas para la solucin de
problemas cotidianos.
Trabajando en equipo, disea modelos o
prototipos para resolver problemas, satisfacer
necesidades o demostrar principios cientficos
relativos a las ciencias biolgicas.
Relaciona los niveles de organizacin qumica,
biolgica, fsica y ecolgica de los sistemas vivos.
Aplica normas de seguridad en el manejo
de sustancias, instrumentos y equipo en la
realizacin de actividades de su vida cotidiana
enfrentando las dificultades que se le presentan
siendo consciente de sus valores, fortalezas y
debilidades.
Obtiene, registra, sistematiza la informacin
para responder a preguntas de carcter
cientfico, consultando fuentes relevantes y
realizando experimentos pertinentes.

Biologa 1

2. De las siguientes estructuras biolgicas y organismos, cules de ellas necesitan del microscopio para observarlas
y cules se ven a simple vista: piojo, espermatozoide, vulo y amiba.

EVALUACIN DIAGNSTICA A

Relaciona las columnas que se te presentan a continuacin, anotando en el parntesis el nmero que corresponda
a la definicin del concepto.
1. Capa de aire que rodea a la tierra.

( ) Clula

2. Clula la cual en conjunto forma el tejido nervioso.

( ) Procariotas

3. Gameto femenino fecundado por el espermatozoide.

( ) smosis

4. Unidad fundamental de los seres vivos, generalmente de tamao


microscpico, con reproduccin independiente, con citoplasma y ncleo
con respectivas membranas.

( ) Amiba

5. Clulas rudimentarias sin ncleo definido.

( ) Neurona

6. Ejemplo de organismo unicelular procariota.

( ) Atmsfera

7. Ejemplo de organismo unicelular eucariota.

( ) vulo

8. Fenmeno presente en una membrana celular en el paso de agua de un


gradiente a otro con diferente concentracin.

( ) Algas verde azules

EVALUACIN DIAGNSTICA B

Responde a lo siguiente:

Durante el tiempo en el que estudiars el presente bloque vas a realizar un proyecto de trabajo en el cual se ver
reflejado el conocimiento que has adquirido. Se te va a pedir realizar actividades como el representar mediante
posters los diferentes tipos de clulas y las estructuras celulares de las mismas, maquetas, y algunas otras tareas
correspondientes. Al final del bloque encontrars una rbrica para el desarrollo y evaluacin del proyecto y una
bitcora para que sigas con detenimiento los requerimientos del proyecto integrador.

Inicio

Secuencia didctica 1
LA CLULA

La clula ha atrapado la atencin de muchos investigadores a lo largo del tiempo. Lgicamente, sus investigaciones
han brindado descubrimientos de gran trascendencia que nos han permitido comprender de que estn hechos los
seres vivos, el funcionamiento del cuerpo humano, el origen de las enfermedades, los procesos de la reproduccin,
la forma en que se produce el envejecimiento, por mencionar algunos aspectos de la vida.

ACTIVIDAD 1

1. Proporciona tu definicin de clula y explica su importancia en la formacin de los seres vivos.


__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________

124

PRESENTACIN DEL PROYECTO

Colegio de Bachilleres del Estado de Sonora

SD1-B3

Realiza un mapa de conceptos sobre los contenidos de este Bloque 3 en donde la cabeza del mapa es el objeto de
estudio del bloque: la clula.
Los contenidos son:
(1.) Teora celular.
(2.) Teoras sobre su origen.
(3.) Tipos celulares.
(4). Componentes estructurales.
(5.) Procesos celulares.

Conceptos a evaluar
El mapa presenta los datos ms importantes
El diseo del material es didctico con claridad y
coherencia
Habilidades expositivas
Se trabaj en forma colaborativa y cumple con las
caractersticas sealadas con anticipacin.

BLOQUE 3

Reconoces a la clula como unidad de la vida

NO

125

Biologa 1

Inicio

Secuencia didctica 2
TEORA CELULAR

EVALUACIN DIAGNSTICA

Galileo Galilei (1609) cientfico italiano conocido como el padre de la astronoma moderna y padre de la fsica
moderna, invent el telescopio.
Marcelo Malpighi (1661) observ al microscopio diversos tejidos animales y vegetales.
Robert Hooke (1665) a finales del siglo XVII, observ la clula por primera vez, en un material de corcho. No
comprendi la estructura que observ bajo la lente del microscopio pero le encontr similitud al de un panal de
abejas y describi a la unidad de la estructura observada como celda (clula).

Cuando te enfermas de sarampin el mdico te dice que es una enfermedad viral. Son seres vivos los virus? Por
qu s o por qu no?
__________________________________________________________________________________________
__________________________________________________________________________________________
______________________________________________________________________
Si te enfermas de neumona y se te informa que la enfermedad la provoca una bacteria Esta bacteria es un ser
vivo? Por qu s o por qu no?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________
Qu es una clula? escribe tu definicin.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________

Qu tipos de organismos presentan clulas procariotas?


__________________________________________________________________________________
___________________________________________________________

Desarrollo

126

Antecedentes de la Teora celular


En la actualidad se sabe mucho acerca de las clulas, de sus formas, fisiologa e
importancia, sin embargo, no siempre fue as. En el pasado, cuando fueron descubiertas
(gracias a la creacin del microscopio) la gente vea a las clulas como una mera
curiosidad de la naturaleza pero nadie sospechaba que las plantas, los animales o los
seres humanos estuviesen formados por clulas o que estas tuvieran funciones de inters
para ser analizadas. A continuacin se mencionarn algunas de las contribuciones ms
importantes para la postulacin de la teora celular:

Colegio de Bachilleres del Estado de Sonora

Anton Van Leeuwenhock (1674) Comerciante holands con inclinacin por las ciencias, se interes por la
generacin espontnea y los microorganismos, pero sus trabajos, muy importantes en su poca, sirvieron para
mejoras en los microscopios pero no para explicar sus observaciones microscpicas.
Lorenz Oken (1805) realizando estudios en protozoarios observ que tenan autonoma e individualidad, propuso
que los organismos superiores estaban formados por microorganismos parecidos a los protozoarios. No se le
acredita ser el primero en afirmar que los seres vivos estamos constituidos por clulas ya que l le daba el valor al
conjunto de microorganismos y no a sus elementos integrantes.
Rene Joachim Henri Dutrochev (1824) denomin a las estructuras bsicas de tejidos animales y vegetales
glbulos pero no recibi distincin alguna por parte de la academia francesa.
Robert Brown (1773.1858) denomin ncleo a una estructura constante en sus observaciones microscpicas de
tejido vegetal, nombre utilizado hasta la actualidad.
Matthias j. Schleiden y Theodor Schwann (1839)
Formularon los dos primeros postulados de la teora
celular. Botnico y zologo, respectivamente, ambos de
origen alemn, gracias a sus estudios en clulas vegetales
y animales, lograron que se sentaran las bases de la teora
celular, cada uno a partir de sus propias observaciones.
Schleiden concluye que la clula es el componente
principal de los vegetales y Schwann manifiesta por su lado
que la clula es el componente ms importante de los seres
vivos, despus de haber observado el ncleo y membranas
celulares en tejidos animales. Cuando Schleiden y Schwnan
propusieron la teora celular en 1839, la investigacin de la
biologa celular cambi para siempre.

BLOQUE 3

Reconoces a la clula como unidad de la vida

127

Biologa 1

Como mencionamos anteriormente, hubo investigaciones importantes previas a la formulacin de la teora celular.
Estas investigaciones inconclusas e imprecisas aludan a un tipo de identidad biolgica conocida despus como
clula.
Rudolf Virchow (1858); mdico alemn complement esta teora con el tercer postulado.
Por definicin, un huevo es un cuerpo redondeado, de tamao y
dureza variables, que producen las hembras de las aves o de otras
especies animales, y que contienen el germen del embrin y las
sustancias destinadas a su nutricin durante la incubacin. Por lo
tanto, un huevo es una clula muy grande.

Los principios fundamentales de la teora celular son:




Toda forma de vida est compuesta por clulas, es decir, la clula es la unidad anatmica de los seres
vivos (unidad de estructura).
La clula realiza todas las funciones vitales de los seres vivos (unidad de funcin).
Toda clula nueva se produce de otra clula pre-existente(unidad de origen)

Debido a las limitaciones del ojo humano, muchas de las primeras investigaciones biolgicas se concentraron en
desarrollar herramientas para ayudarnos a ver cosas ms pequeas. Cuando la tecnologa de imgenes se volvi
ms sofisticada, los descubrimientos biolgicos abundaron.
La teora celular tambin nos provee con una definicin operacional de vida. Cuando veas los conceptos de virus,
procariontes y eucariontes explora este concepto con mayor detalle.
Actualmente se pueden realizar dos clasificaciones generales de los seres vivos dependiendo del nmero de clulas
que constituyen a un ser; unicelulares y pluricelulares.
Los seres unicelulares son aquellos que estn constituidos por una clula, tales como las bacterias o virus. Los
seres pluricelulares, como su nombre lo indica, son aquellos organismos vivos formados por muchas clulas
(millones para ser exactos); las plantas y los animales terrestres son ejemplos de ello.

Cierre

ACTIVIDAD 1
SD2-B3

Intgrate en equipo con un mximo de 5 para realizar lo siguiente:


1. Una investigacin sobre los trabajos que sirvieron de base para la teora celular.
2. Tambin realiza una lnea del tiempo con el material colectado, en donde menciones la importancia de los
trabajos realizados por los investigadores, as como la trascendencia de estos en la Teora Celular.
3. Presenten en plenaria la lnea del tiempo generando una discusin del tema.
Conceptos a evaluar

NO

Realiza la investigacin de los conceptos solicitados.


Caractersticas formales de la investigacin.
Figura 3.2
La imagen de una bacteria
(ser unicelular)

Particip en la lluvia de ideas.


Actitud ante la diversidad de opiniones.
Calidad de la redaccin de la conclusin.

128

Colegio de Bachilleres del Estado de Sonora

BLOQUE 3

Reconoces a la clula como unidad de la vida

129

Biologa 1

Inicio

Secuencia didctica 3
TEORA DE LA EVOLUCIN CELULAR

EVALUACIN DIAGNSTICA

En la poca de la conquista de Amrica la atmsfera estaba libre de contaminantes. Cmo crees que era la
atmosfera primitiva?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
Los tipos de organismos unicelulares de esa poca continan existiendo actualmente?
__________________________________________________________________________________________
________________________________________________________________________

Origen del universo, Teora del Big Bang

Menciona a los cientficos que contribuyeron en la formulacin de las diferentes teoras del origen de la vida.

Antecedentes.

__________________________________________________________________________________________

Teora creacionista.

________________________________________________________________________

Desarrollo

Fue una de las principales interrogantes que surgieron cuando se enunci la teora
celular ya que unos de los postulados seala que toda clula proviene de otra clula ya
existente, es decir, la vida procede de la vida.
Se calcula que hace aproximadamente 5 mil millones de aos naci nuestro sistema
solar; asimismo que la Tierra y los dems planetas se formaron hace aproximadamente
4 mil 600 millones de aos. Los registros fsiles ms antiguos datan de hace 600
millones de aos (aunque actualmente se conocen restos de hace aproximadamente 3
mil millones de aos). Existen varias teoras que hablan sobre el origen de la vida, y
algunas por su pobre sustento ya han sido descartadas, por lo que se estudiar en esta
secuencia las ms importantes.

130

Colegio de Bachilleres del Estado de Sonora

Considerada como la primera teora que intenta explicar el origen de la vida. A lo largo de la historia de la
humanidad, el hombre ha intentado explicar el origen de la vida a travs de religiones, mitos y leyendas. La teora
creacionista afirma que la vida surgi por la accin de un dios o un ser supremo fuera de toda comprensin para
la mente humana.
Teora de la generacin espontnea o abiogenista.
Una de las primeras teoras con simples bases cientficas sostena que la vida surgi a travs de la materia
inanimada (es decir sin vida), tal vez de la basura o del lodo. Aristteles, filsofo Griego (384-322 AC) es el
primero en reportar esta teora en la que el mecanismo vital era un soplo divino; entelequia es el trmino usado
por Aristteles.
Uno de los principales cientficos que defenda esta teora fue el mdico alemn Johann Van Helmont que en
el ao 1667 dise un experimento que consisti en mezclar ropa sucia con trigo, en donde al cabo de un tiempo
prolongado aparecan ratones.

BLOQUE 3

Reconoces a la clula como unidad de la vida

131

Biologa 1

Biogenistas

debido a que las fuerzas gravitacionales de la tierra eran muy dbiles para retenerlos, estas se fueron al espacio.

Poco despus, en 1668 el mdico italiano Francesco Redi refut la hiptesis de que los gusanos aparecen a partir
de la carne, en la figura siguiente se muestra el experimento de manera ms ejemplificada, donde en un frasco
se mantienen alejadas las moscas (de cuyos huevecillos salen los gusanos) de la carne no contaminada y el otro
frasco totalmente expuesto.

La segunda atmosfera primitiva estaba carente de oxgeno, por lo que los gases que prevalecan eran el hidrgeno
(H2), metano (CH4), amoniaco (NH3), cido cianhdrico (HCN) y vapor de agua, todas estas sustancias formadas
por las exhalaciones de las fisuras terrestres y de los primeros volcanes. La energa provena de las tormentas
elctricas, rayos ultravioleta, rayos csmicos y las altas temperaturas que prevalecan. A medida que la Tierra se
fue enfriando, el vapor de agua se fue condensando y se formaron las nubes, produciendo as las lluvias que fueron
erosionando las rocas y arrastrando las sales minerales que estas contenan hacia los lugares ms bajos, formando
as los mares primitivos. Llamndose as caldo primigenio, que contena la temperatura y un pH ideal para la
formacin de la vida.
La sntesis abitica plantea el inicio de la vida surgida en la Tierra por la unin de molculas qumicas formadas
por la unin de los siguientes elementos; C, H, O, N, P, S de los cuales se elaboraron molculas ms complejas.

A mediados del siglo XIX, Louis Pasteur en Francia realiz un experimento bastante sencillo (descrito en la
siguiente imagen) para demostrar que la teora de la generacin espontnea era totalmente falsa. Aunque su trabajo
ech por tierra la nocin de la generacin espontnea, no dio respuesta a la pregunta de cmo apareci la vida en
la Tierra por primera vez.

Representaciones de la Tierra antes de que hubiera vida.


Atmsfera primitiva.
(Carbohidratos, Lpidos y protenas vistas en el bloque 2). Por ejemplo, los aminocidos formaron a las protenas
que, al unirse con carbohidratos y lpidos, dieron origen a los primeros compuestos orgnicos que a la postre
formaran las primeras clulas.

Sntesis abitica

Alexander Oparin (1924), bioqumico ruso, elabor


esta teora con bases bien fundamentadas, ya que
tena grandes conocimientos de astronoma, geologa,
biologa y bioqumica.

Esta teora es una de las primeras que se elaboraron para tratar de explicar el origen de la vida en la Tierra.
Esta propone que la materia proviene de la materia no viva, es decir, que la primera clula que se form
provino de la conjuncin de varias biomolculas predecesoras de las actuales. Tambin conocida como la teora
quimiosinttica, sostiene que las primeras clulas tuvieron su origen en una evolucin qumica paulatina.
Durante los inicios del planeta Tierra, la primera atmsfera primitiva estaba formada por hidrgeno y helio, pero

132

Colegio de Bachilleres del Estado de Sonora

BLOQUE 3

Reconoces a la clula como unidad de la vida

133

Biologa 1

Comprobacin de la Teora de Oparin.


Stanley Miller y Harold C Urey (1953), en la Universidad de Chicago, experimentaron mezclando agua,
metano, amoniaco e hidrgeno en un sistema cerrado, calentando la solucin y agregando chispas elctricas a los
vapores emitidos, simulando la atmsfera primitiva. Se obtuvieron compuestos como aminocidos e inclusive
nucletidos, Con estos resultados, a pesar de objeciones, la mayora de los bioqumicos dan su apoyo a la Teora
de Oparin y a los trabajos de Stanley y Urey.

Los elementos y compuestos qumicos que estn presentes en estas chimeneas son; hidrgeno (H), monxido
de carbono (CO), dixido de carbono (CO2), cido sulfhdrico (H2S), componentes muy parecidos a la tierra
primitiva. Es posible que la ausencia de luz, las altas temperaturas y la acidez en esos medios dieran lugar a
diferentes reacciones qumicas que provocaron la generacin de aminocidos, molculas orgnicas ms complejas
para despus dar lugar a las primeras clulas.

Teora de la panspermia.
Previo a la teora de Oparin, en 1908, el qumico sueco
Svante Arrhenius, propuso que la vida haba llegado de la
Tierra del espacio exterior, por medio de esporas resistentes
al calor y a las radiaciones csmicas.
Esta teora tiene como objecin principal el hecho de
que no resuelve el problema del origen de la vida porque
simplemente lo traslada a otro sitio del universo y nos
conduce a preguntarnos cmo surgi la vida en el sitio de
donde provena esa espora.

La teora de la panspermia propone que la vida


lleg mediante un meteorito que transport
microorganismos a la Tierra.

Otras objeciones que se encontraron son que el medio


interestelar es poco favorable para la supervivencia de
la vida adems de que se sabe que cualquier meteorito
de tamao mediano que entra a la atmsfera terrestre es
destruido por el calentamiento y combustin del meteorito
provocados por...
A pesar de todos estos argumentos, esta teora tiene una
evidencia que la sustenta ya que actualmente se sabe que
existen las llamadas bacterias termfilas, que son capaces
de soportar altsimas temperaturas, por ejemplo, se han
encontrado este tipo de bacterias en el magma de los
volcanes.

ACTIVIDAD 1
SD3-B3

En equipo construye un mapa mental que explique las diferentes teoras sobre el origen de la vida, sus investigadores,
as como, lo ms significativo de las diversas teoras. Realiza una exposicin de mapas en el aula.
S

Conceptos a evaluar

Hiptesis Hidrotermal
Cerca de las islas galpagos, aproximadamente a 2400 metros de profundidad, se encontraron los llamados
chimeneas termales. Esto se consider como uno de los mayores hallazgos oceanogrficos que se realiz en el
ao de 1977.
Esta teora plantea la posibilidad de que las primeras molculas orgnicas y los primeros seres vivos se hayan
formado en las chimeneas hidrotermales que se encuentran en el fondo de los ocanos (vase la siguiente figura).
Estas chimeneas se forman por fuertes salidas de agua caliente. Esta hiptesis se basa en los hallazgos de bacterias
que viven cerca de estas chimeneas volcnicas submarinas donde las temperaturas alcanzan hasta los 650 oC. Se
han descubierto mltiples organismos como microorganismos, gusanos y peces que dependen de estas ventilas y
de las condiciones que estas proporcionan.
134

Imagen de una chimenea hidrotermal. Se sabe que pueden


alcanzar temperaturas de hasta 650oC.

Colegio de Bachilleres del Estado de Sonora

NO

El mapa presenta los datos ms importantes.


El diseo del material es didctico con claridad y coherencia.
Habilidades expositivas.
Se trabaj en forma colaborativa y cumple con las caractersticas sealadas
con anticipacin.

BLOQUE 3

Reconoces a la clula como unidad de la vida

135

Biologa 1

Rebatir

Todos los
contraargumentos
fueron precisos,
relevantes y fuertes.

La mayora de los
contraargumentos
fueron precisos,
relevantes y fuertes.

La mayora de los
contraargumentos
fueron precisos,
relevantes pero
algunos fueron
dbiles.

Los contraargumentos
no fueron precisos
y/o relevantes.

Estilo de presentacin

E l equipo
consistentemente
us gestos, contacto
visual, tono de
voz y un nivel de
entusiasmo de
manera que mantuvo
la atencin de la
audiencia

E l equipo por lo
general us gestos,
contacto visual, tono
de voz y un nivel
de entusiasmo de
manera que mantuvo
la atencin de la
audiencia

E l equipo algunas
veces us gestos,
contacto visual, tono
de voz y un nivel
de entusiasmo de
manera que mantuvo
la atencin de la
audiencia

Uno o ms de los
miembros del equipo
tuvieron un estilo de
presentacin, que no
mantuvo la atencin
de la audiencia

ACTIVIDAD 2
SD3-B3

Participa en una lluvia de ideas sobre las caractersticas ms importantes que dieron origen a la vida en la Tierra.
Enlista cinco de ellas.
Caractersticas que hicieron posible la vida en la tierra
1.2.3.4.5.Realiza un debate con esas cinco caractersticas.
Rbrica para evaluar el debate
Criterios

Excelente

Bueno

Regular

Informacin

La informacin
presentada fue clara,
precisa y minuciosa.

La mayor parte
de la informacin
presentada fue clara,
precisa y minuciosa.

La mayor parte
de la informacin
presentada fue clara,
precisa pero no fue
minuciosa.

Comprensin del
tema

Uso de hechos y
estadsticas

136

El equipo claramente
comprendi el
tema a profundidad
y present su
informacin enrgica
y convincente.

Cada punto principal


estuvo bien
apoyado con varios
hechos relevantes,
estadsticas y/o
ejemplos.

El equipo comprendi
claramente el tema
a profundidad
y present su
informacin con
facilidad.

Cada punto
principal estuvo
adecuadamente
apoyado con varios
hechos relevantes.

Colegio de Bachilleres del Estado de Sonora

El equipo pareca
comprender los
puntos principales del
tema y los present
con facilidad.

Cada punto
principal estuvo
adecuadamente
apoyado pero sin
relevancia en los
hechos.

Observaciones
Necesita mejorar
sus habilidades para
el debate

La informacin
presentada no fue
clara.

ACTIVIDAD 3
SD3-B3

El equipo demostr
una adecuada
comprensin del
tema.

Ningn punto
principal estuvo
apoyado.

Escribe un ensayo sobre el origen de la vida y tu inclinacin sobre alguna de las teoras. Incluye tu postura sobre
vida artificial: esto ltimo inicia con los bebs de probeta?
Rbrica para evaluar un ensayo
Indicadores

Introduccin

Deficiente

Satisfactorio

Bueno

Excelente

La introduccin
expresa claramente
el tema y el
objetivo del
ensayo. Igualmente
explica los
captulos que
abarca el ensayo.

La introduccin
no expresa
claramente el
tema y el objetivo
del ensayo.
Igualmente explica
los captulos que
abarca el ensayo.

Parte del contenido


y subtemas o
captulos que
abarca no son
relevantes o faltan
algunos. El tema y
objetivo del ensayo
no se expresan de
manera clara.

La introduccin
expresa claramente
el tema y el
objetivo del
ensayo. Igualmente
explica los
captulos que
abarca el ensayo.

BLOQUE 3

Reconoces a la clula como unidad de la vida

Puntuacin

137

Biologa 1

Desarrollo

Conclusiones

Bibliografa

Las ideas
presentadas no son
propias.

No presenta
conclusiones o no
son coherentes con
el trabajo.

No presenta
referencias.

Ciertas ideas
presentadas
son propias,
sustentadas con
las fuentes de
informacin
necesarias.
Pocas ideas
presentadas tienen
relacin directa
con el tema, pero
les falta claridad y
objetividad.

La mayora de las
ideas presentadas
son propias,
sustentadas con
las fuentes de
informacin
necesarias.
Casi todas las
ideas que se
presentan tienen
relacin directa
con el tema.
Y se presentan
con claridad y
objetividad.

Las ideas
presentadas
son propias,
sustentadas con
las fuentes de
informacin
necesarias.
Todas las ideas
que se presentan
tienen relacin
directa con el tema.
Y se presentan
con claridad y
objetividad.

Integra solo
algunos elementos.

Integra claramente
los principales
elementos
abordados pero
no presenta ideas
propositivas.

Integra claramente
los principales
elementos
abordados y
presenta ideas
propositivas.

Hace una seleccin


pertinente de citas
y referencias en
funcin al tema
abordado.
Las referencias
forman parte en
ciertas secciones
cuerpo del trabajo
y sustentan las
ideas planteadas.

Hace una seleccin


pertinente de citas
y referencias en
funcin al tema
abordado.
Las referencias
forman parte del
cuerpo del trabajo
y sustentan las
ideas planteadas.

Las referencias son


deficientes y no
forman parte del
cuerpo del trabajo
y por lo tanto no
sustentan las ideas
planteadas.

Inicio

Secuencia didctica 4
TIPOS CELULARES

EVALUACIN DIAGNSTICA

Qu tipo de clulas conoces?


__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
Qu diferencia existen entre los diferentes tipos de clulas?
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
Cul es la principal caracterstica de una clula animal y de una vegetal?
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
Nombra al menos 3 componentes de una clula:
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
Describe lo que entiendes por evolucin celular:
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

138

Colegio de Bachilleres del Estado de Sonora

BLOQUE 3

Reconoces a la clula como unidad de la vida

139

Biologa 1

Desarrollo

Diversas evidencias sealan que los organismos unicelulares fueron los primeros en
formarse en los mares de la Tierra primitiva y esto nos muestra las diferentes expresiones
de vida que realizaron cambios y adaptaciones evolutivas a los largo de la historia de
la Tierra.
Las bacterias en la actualidad son los organismos similares a aquellos microorganismos
que realizaban procesos qumicos muy sencillos, como la fermentacin en el fondo de
lagos y charcos. Por lo tanto, las bacterias son la forma de vida ms antigua a pesar de
que ya no son exactamente iguales a sus predecesoras, ya que se han podido adaptar a
todos los ambientes terrestres.
Se identifican dos tipos de clulas, principalmente por sus unidades fundamentales
de estructura y por la forma en que obtienen energa; procariotas y eucariotas. Se
consideran a las clulas procariotas como los antecesores de las clulas eucariotas, es
decir, las clulas procariotas son ms primitivas que las eucariotas. A pesar de sus
diferencias, ambas utilizan el mismo cdigo gentico y una manera similar para la
sntesis de protenas.
Clula procariota
Las clulas procariotas son las ms primitivas, el trmino procariota proviene de dos
palabras de origen griego; pro que significa antes carios que significa ncleo. Como
su nombre lo indica, una de las caractersticas principales es de que carecen de ncleo
verdadero.
Una de las caractersticas ms distintivas de las clulas procariontes es que poseen una
molcula de ADN circular llamada cromosoma bacteriano, que se encuentra libre
en el citoplasma , en una zona llamada nucleoide debido a que como se mencion
anteriormente, estas clulas carecen de ncleo. Todas las bacterias son clulas
procariontes.

Lactobacilos es una bacteria


que ayuda a mejorar la
digestin.

140

Clulas de Borrelia
burgdorferii (espiroqueta
causante de la enfermedad de
Lyme)

Colegio de Bachilleres del Estado de Sonora

Aunque difieren en su morfologa y se agrupan de manera diferente, todas presentan caractersticas comunes;

Miden entre una y diez micras

El ADN que poseen estas clulas es un ADN circular

Se reproducen por fisin binaria.

Presentan una membrana plasmtica que regula la entrada y salida de sustancias

En el citoplasma bacteriano esta la presencia de pequeos ribosomas, que son las unidades productoras
de protenas y enzimas, siendo estas ltimas las que realizan los procesos de metabolismo celular.

Contienen una cpsula gruesa y gelatinosa formada por polisacridos o protenas. Esta cpsula les
sirve de defensa contra otros organismos, pues les permite provocar infecciones.

Otro rasgo significativo es que algunas de las clulas bacterianas poseen flagelos que le permiten desplazarse,
siendo as clulas con mayor movilidad.
Las clulas procariotas pueden presentar pigmentos fotosintticos como los encontrados en cianobacterias.
Igualmente, tienen mltiples formas: cocos (redondas), bacilos (bastones) y espiralada o espiroqueta (clulas
helicoidales).
Clula Eucariota
En algn momento, tal vez hace 1700 millones de aos, las clulas primitivas o procariontes evolucionaron y
dieron lugar a clulas mucho ms complejas, a las que llamamos eucariotas. Las clulas eucariontes, como su
etimologa lo indica, contienen un ncleo verdadero. La caracterstica ms notable de este tipo de clulas es que
ya tienen su material gentico- su ADN- envuelto dentro de una membrana, es decir, un ncleo. Adems, son
mucho ms grandes que las clulas procariontes, ya que miden de 10 a 100 micras de dimetro, hasta 100 veces
ms que una bacteria.

NOTA:
Citoesqueleto;
red organizada de
filamentos de protenas
encargada de dar
soporte y estructura a
la clula.

Cianobacterias.

BLOQUE 3

Reconoces a la clula como unidad de la vida

141

Biologa 1

Hay una gran variedad de tamaos y formas en las clulas eucariotas; a continuacin te mostraremos algunas de
ellas:
Miocito, clula fusiforme que forma el tejido muscular, es multinucleada, se le conoce tambin como fibra
muscular y es sumamente contrctil.

El espermatozoide es la clula sexual masculina. Se distinguen dos regiones:


La cabeza, aloja al acrosoma, contiene enzimas para penetrar la pared celular del vulo y tambin se encuentra el
ncleo de la clula espermtica. La parte media contiene una gran cantidad de mitocondrias para proveer de ATP
para el gasto de energa de la cola o flagelo en su recorrido para tratar de fecundar al vulo.

La membrana celular en los miocitos se denomina sarcolema y el citoplasma, sarcoplasma. Contiene organelos
celulares, ncleos celulares, mioglobina y un complejo proteico entramado de fibras llamadas actina y
miosinacuya principal propiedad, la contractilidad, es la de acortar su propia longitud cuando son sometidas a un
estmulo fsico, qumico, elctrico o mecnico.

Los glbulos rojos conocidos tambin como eritrocitos, son las


clulas de la sangre especializadas en el transporte de oxgeno.
Cuando maduran, expulsan al ncleo, se forman en la mdula sea
con un ciclo de vida de alrededor de 130 das.

Las neuronas son las clulas del tejido nervioso en los animales vertebrados y son las encargadas de transmitir
el impulso nervioso. Estn formadas por el pericarion, regin donde se encuentra el ncleo, un cuerpo celular,
las dendritas, son numerosas y reciben los impulsos nerviosos, y el axn, que es nico y conduce el impulso
nervioso de una clula a otra.

Cierre

La forma y la estructura de cada neurona se


relacionan con su funcin especfica, la que
puede ser:

Recibir seales desde receptores


sensoriales.
Conducir estas seales como
impulsos nerviosos, que consisten en
cambios en la polaridad elctrica de la
membrana celular.
Transmitir las seales a otras neuronas.

ACTIVIDAD 1
SD4-B3

Prctica de laboratorio 1
La prctica de laboratorio consiste en observar clulas. En la punta de una raz de cebolla, realiza un delgado
corte de la raz y la colocas sobre un portaobjeto y la ties para visualizar organelos, la pared celular, inclusive
tendrs la oportunidad de admirar cromosomas. Lo mismo vas a hacer con otros materiales como papa y agua de
charcos. Tomas fotografas digitales para observarlas con ms detalle en la computadora.
Sigue las instrucciones que aparecen en la Gua de prcticas al final del bloque.

142

Colegio de Bachilleres del Estado de Sonora

BLOQUE 3

Reconoces a la clula como unidad de la vida

143

Biologa 1

Cmo crees que fue el cambio evolutivo de procarionte a eucarionte?


__________________________________________________________________________________________
__________________________________________________________________________________________
_____________________________________
Cmo crees que funciona la clula?
__________________________________________________________________________________________
__________________________________________________________________________________________
_____________________________________

Las formas de vida eucarida son muy


variadas.

ACTIVIDAD INTEGRADORA
1. Redacta un documento en el que presentes semejanzas y diferencias entre clulas procariotas y eucariotas.
2. Elabora un poster donde presentes los esquemas de una clula procariota, y de una clula eucariota animal y
vegetal.
3. Participa en una exposicin en el aula con los posters de los equipos.

Inicio

Desarrollo

Componentes de la clula
Membrana celular o plasmtica.
La membrana celular es un complejo de lpidos, protenas y carbohidratos que tiene la
funcin de formar una especie de barrera y presenta sistemas de seales y de transporte. Los
fosfolpidos que la constituyen son glucolpidos, fosfolpidos y colesterol. Los fosfolpidos
son de carcter anfiptico, es decir, presentan regiones hidrofbicas hacia el interior de la
bicapa e hidroflicas hacia el exterior de la bicapa.

Secuencia didctica 5
ESTRUCTURA Y FUNCIN DE LAS CLULAS PROCARIOTA Y
EUCARIOTA

ACTIVIDAD 1
SD5-B3

Contesta las siguientes preguntas.


Cul es la principal diferencia entre una clula procarionte y una eucarionte?
__________________________________________________________________________________________
__________________________________________________________________________________________
_____________________________________
144

Colegio de Bachilleres del Estado de Sonora

BLOQUE 3

Reconoces a la clula como unidad de la vida

145

Biologa 1

La funcin de transporte de la membrana es debido a su permeabilidad, la llevan a cabo las protenas integrales
asociadas con lpidos y las protenas perifricas. La funcin de adhesin a otras clulas y el reconocimiento de
molculas que lleva a cabo la membrana celular se debe a los carbohidratos unidos a protenas o lpidos presentes
en la superficie de la misma. As, la membrana celular es la comunicacin entre la clula y su entorno y esto lo
realiza en dos funciones principales:
1.- Mantiene la integridad de la clula ya que la delimita y protege del medio exterior.
2.- Es selectivamente permeable ya que escoge las sustancias que necesita y excreta aquellas que le
son txicas; todo esto se da en un transporte selectivo. Genera seales elctricas para modificar el
metabolismo y realiza la Adhesin de clulas para formar tejidos.
Citoplasma.
Se le conoce tambin como matriz citoplasmtica. Es la regin celular comprendida entre la membrana celular y
el ncleo. Su apariencia es granulosa debido a la multitud de ribosomas y otros organelos. Est conformado por
agua, protenas, lpidos, carbohidratos, ARN, sales, minerales, entre otros. El citoplasma tambin contiene a una
variedad de organelos: mitocondrias, vacuolas, plastidios, lisosomas, ribosomas, principalmente.
Ncleo.
Es de gran tamao comparado con el resto de los organelos, generalmente esfrico y contiene el material hereditario,
esto es, el ncleo es el portador de la informacin hereditaria. El ncleo ejerce una influencia continua en las
actividades de la clula, asegurando que las molculas complejas que ella requiera se sinteticen en la cantidad y
el tipo necesario. Est formado por las siguientes estructuras celulares:
Membrana nuclear.
Est constituida qumicamente por fosfolpidos y protenas, es de constitucin porosa para favorecer el intercambio
selectivo de materiales entre el ncleo y el citoplasma. La parte interior de la membrana contiene cromatina y la
parte exterior presenta adherencias de ribosomas.
Nuclolo.
Es una masa redondeada dentro del ncleo sin
membrana, formado por fragmentos de ADN
y ARN. Su funcin principal es sintetizar las
subunidades de ribosomas

# Estructuras relacionadas con los procesos energticos.


En las mitocondrias se lleva a cabo la respiracin celular, proceso energtico productor de las molculas de
adenosin trifosfato (ATP).
Las mitocondrias pueden adoptar formas casi esfricas y cilndricas. Presenta dos membranas, una interna que
divide a la mitocondria en dos compartimentos; el ms externo con pliegues llamados crestas y el interno llamado
matriz mitocondrial conteniendo ADN y ribosomas. La otra capa es lisa y delimita a la mitocondria.
# Estructuras de soporte
Citoesqueleto.
Son estructuras de protenas filamentosas dentro del citoplasma de clulas eucariotas. Mantiene la organizacin de
la clula, le permite a la clula moverse, posicionar sus organelos y dirigir el transito intracelular. El Citoesqueleto
presenta tres formas de filamentos:
Microtbulos.
Tubos largos y huecos de protenas globulares conocidas como tubulinas alfa y beta, sus funciones importantes
son el movimiento de centriolos, cromosomas y el movimiento de cilios y flagelos.
Microfilamentos.
Tambin llamados filamentos de actina ya que esta protena es su constituyente principal y forma cadenas
helicoidales.
Filamentos intermedios.
Se llaman as porque son intermedios en tamao entre los microtbulos y los filamentos de actina. Estn dispersos
en una mayor parte del citoplasma y lo presentan principalmente clulas expuestas a una gran tensin mecnica
y clulas de la piel.
En las siguientes imgenes se muestra una representacin grfica de una clula procarionte y de una eucarionte, y
las estructuras que las forman. Organelos con sus principales funciones: membrana celular y el ncleo en la clula
eucarionte.

Cromatina.
La cromatina est constituida por ADN y
protenas llamadas histonas. Cuando se inicia
el proceso de divisin celular la cromatina
se condensa y se empaqueta en estructuras
llamadas cromosomas.

Diagrama de una bacteria, ejemplo


de clula procarionte.

https://www.google.com.mx/search?q=nucleo

146

Colegio de Bachilleres del Estado de Sonora

BLOQUE 3

Reconoces a la clula como unidad de la vida

147

Biologa 1

Cierre

Estructuras en una clula eucariota.

ACTIVIDAD 1
SD5-B3

Lee el siguiente texto titulado Los secretos de la cocana en las neuronas y contesta las siguientes preguntas:
Los secretos de la cocana en las neuronas

FUNCIN

Aumenta la euforia, desaparece la fatiga, se dilatan las pupilas Aunque los efectos inmediatos de la cocana son
bien conocidos, poco se sabe de cmo funcionan sta y otras drogas a un nivel celular. Un estudio publicado por
la revista Science aporta las primeras pistas sobre sus efectos en las neuronas del cerebro.

Ncleo

Contiene y protege el ADN, coordina todas las funciones celulares como


la divisin, el crecimiento y la nutricin celular. Contiene una membrana
externa y una envoltura nuclear por lo que permite la entrada y salida de
nutrientes.

Nucleoide

Se ubica dentro del ncleo, su principal componente es el ARN. Aqu se


producen los ribosomas.

Poco se saba hasta el momento del funcionamiento de esta droga en las clulas nerviosas. Se haban identificado
algunas regiones cerebrales afectadas y se haba visto que determinadas zonas se activan con su consumo, pero
su efecto a nivel ms ntimo es algo que no se conoca, explica Rafael Lujn, profesor titular del Departamento
de Ciencias Mdicas de la Universidad de Castilla.

Ribosomas

Estn hechos de ARN y determinan como se acomodan los aminocidos


para la formacin de protenas.

Mitocondria

Organelo de doble membrana. Es de forma ovalada y su principal


funcin es el de la produccin de energa (ciclo de Krebs) y el proceso de
respiracin celular.

Aparato de Golgi

Organelo que tiene forma de tubos aplanados y presenta vesculas esfricas.


En este lugar se producen los lisosomas.

Lisosomas

Son estructuras esfricas rodeadas de una membrana que son producidas


en el aparato de Golgi. Produce las protenas encargadas de la destruccin
de organelos viejos (enzimas).

Retculo Endoplasmtico
Rugoso (RER)

Se encuentra rodeando al ncleo y est estrechamente unido a su membrana


externa. Se llama rugoso debido a la presencia de ribosomas alrededor
que le da esa apariencia. En este lugar se producen las protenas.

Retculo Endoplasmtico Liso


(REL)

Prolongacin del RER y su aspecto es liso debido a la ausencia de


ribosomas. Su funcin es la produccin de lpidos y la reduccin de
sustancias nocivas para la clula, por ejemplo; alcoholes, cetonas y otras
sustancias txicas.

Principales organelos de una clula eucariota y las funciones que desempea.


ESTRUCTURA

Cada clula de los organismos vivos, de acuerdo a las funciones que realiza, contiene una diversidad de componentes
que le permiten cumplir eficientemente su trabajo. Por ejemplo, las neuronas son clulas fascinantes en cuanto a la
diversidad de formas que presentan de acuerdo a su funcin, su principal objetivo, es mandar impulsos elctricos
del cerebro a las diferentes partes del cuerpo.
148

Colegio de Bachilleres del Estado de Sonora

Investigadores del departamento de Neurociencia Bsica de la Universidad de Ginebra (Suiza), en colaboracin


con Lujn, pusieron sus miras en AMPA, que son los receptores ms comunes dentro del sistema nervioso,
presentes en muchas zonas cerebrales y claves en el dialogo o comunicacin entre las neuronas.

Todas las neuronas tienen algn receptor de glutamato (entre los que se encuentran las protenas que forman los
AMPA). Muchas enfermedades del sistema nervioso, como el Parkinson o la epilepsia, estn relacionadas con una
alteracin en estos receptores, as que tambin cabra esperar que los procesos de adiccin estuviesen relacionados
con ellos explica Lujn.
Al inyectar cocana en los cerebros de roedores, en concreto en una regin cerebral relacionada con las adicciones,
los investigadores vieron que los receptores AMPA cambiaban. Habitualmente, estos receptores estn formados
por 4 protenas, que se agrupan en la superficie de la neurona formando un poro que regula el paso de las diferentes
sustancias, como iones de calcio.

BLOQUE 3

Reconoces a la clula como unidad de la vida

149

Biologa 1

El trabajo de Science ha visto que, al inyectar cocana, una de las protenas


que forma el receptor AMPA (llamada GluR2) se esfuma, es decir, esta
protena se escapa entre compartimientos ms profundos y estrechos
dentro de la misma clula. Entonces las caractersticas funcionales del
receptor cambian totalmente, por lo que el canal deficiente deja de pasar
ms calcio, resume Lujn.
De este modo, ha quedado al descubierto uno de los efectos moleculares
y celulares de esta droga; aumenta la cantidad de calcio en la clula. Este
aumento de calcio produce una serie de cambios celulares que son los
que, posiblemente, intervengan en el proceso de adiccin.

Inicio

Secuencia didctica 6
CLULAS EUCARIOTAS

EVALUACIN DIAGNSTICA

1.- Cuando una persona se droga, Qu tipo de clulas son las ms afectadas?
__________________________________________________________________________________________
_______________________________________________________
2.- Para qu sirven los receptores AMPA?
__________________________________________________________________________________________
_______________________________________________________
3.- Qu enfermedades se pueden presentar cuando se alteran esos receptores?
__________________________________________________________________________________________
_______________________________________________________

Observa detenidamente un animal y una planta, qu diferencias hay entre ambos seres vivos?

4.- Qu elemento qumico aumenta en las neuronas cuando se les inyecta cocana?

__________________________________________________________________________________________

__________________________________________________________________________________________
_______________________________________________________
5.- En tu opinin, qu importancia tiene este tipo de investigaciones?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

_______________________________________________________
Consideras que tiene algo que ver la pared celular para que una planta sea rgida y un animal presente movimiento?
Fundamenta tu respuesta
__________________________________________________________________________________________
_______________________________________________________
Si las clulas son consideradas la unidad de la vida, cmo crees que funcionen?

_________________________________________________________________________________________

__________________________________________________________________________________________

_________________________________________________________________________________________

_______________________________________________________

__________________________________________________________________________________________
__________________________________________________________________________________________

Por qu las clulas eucariotas son importantes para los organismos pluricelulares?

__________________________________________________________________________________________

__________________________________________________________________________________________

_________________________________________________________

_______________________________________________________

150

Colegio de Bachilleres del Estado de Sonora

BLOQUE 3

Reconoces a la clula como unidad de la vida

151

Biologa 1

Desarrollo

Clulas eucariotas
En el estudio de la clula es necesario, en primer trmino, identificar cules son sus
componentes para poder entender cules son las funciones que desempean en los seres
vivos; tanto en los animales como en las plantas.

4. Tienen un tipo de nutricin hetertrofa, es decir obtienen materia y energa a partir de sustancias orgnicas que
han producido otros organismos.

Clula vegetal
Las clulas eucariotas vegetales tienen por lo general los mismos organelos celulares que las eucariotas animales,
mas sin embargo presentan diferencias significativas:
1. Son generalmente de mayor tamao que las clulas eucariotas animales.
2. Estn recubiertas por una estructura rgida de aspecto poligonal, cuyo componente principal es la celulosa en
las plantas y la quitina en los hongos, y que llamamospared vegetal.
3. No tiene centriolos, aunque tenga fibras del citoesqueleto.
4. Las vacuolas, orgnulos membranosos que almacenan sustancias de diverso tipo, estn muy desarrolladas,
llegando a ocupar hasta el 90% del total del volumen de la clula.

Cierre

5. La nutricin de la clula vegetal en las plantas es auttrofa: realiza la fotosntesis en unos orgnulos
especializados llamados cloroplastos, que contienen clorofila, pudiendo as obtener la materia y la energa a
partir de la luz y materia inorgnica (CO2 y agua)

ACTIVIDAD 1
SD6-B3

Observa el siguiente cuadro de los organelos que forman parte de las clulas vegetales y animales. Anota una si
el organelo est presente y una X si est ausente.
Organelo

Clula animal

Clula vegetal

Pared Celular
Membrana plasmtica
Ncleo
Nucleolo
Ribosoma
Retculo endoplsmico liso

Clula animal

Retculo endoplsmico rugoso

1. El exterior y el interior celular estn separados por una membrana plasmtica que interviene en los procesos
de intercambio de sustancias, la regulacin hdrica y osmtica, el reconocimiento celular, etc.

Aparato de Golgi

2. Las clulas animales tienen un esqueleto flexible interno, llamado citoesqueleto, que colabora en dar forma a
la clula y en mantener un orden interno.

Lisosoma

3. Tienen un par de orgnulos no membranosos llamados centriolos, encargados de la regulacin del citoesqueleto
e implicados en la divisin celular.
152

Colegio de Bachilleres del Estado de Sonora

Vacuolas
Mitocondrias
Cloroplastos
Citoplasma

BLOQUE 3

Reconoces a la clula como unidad de la vida

153

Biologa 1

1.- Considerando los organelos presentes en cada tipo celular, anota las diferencias entre una clula animal y una
clula vegetal.

Inicio

Secuencia didctica 7
PROCESOS CELULARES

__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________

EVALUACIN DIAGNSTICA

_________________________________________________________________________________________
__________________________________________________________________________
Contesta las siguientes preguntas.

2. Por qu la biologa es capaz de englobar fenmenos naturales tan diferentes?


__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________

ACTIVIDAD INTEGRADORA
En esta actividad vas a construir una clula en maqueta, la que elija el equipo, animal o vegetal para explicar
alguna de las estructuras y la funcin que realiza.
Materiales:
Plastilinas de colores.
Lmina de clula elegida.
Base de cartn fotogrfico.

Qu relacin hay entre una planta realizando la fotosntesis y una persona que realiza ejercicio?
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________

Procedimiento:
Participa en la construccin apegndote a tu modelo seleccionado y participa en la exposicin de tu maqueta.
Elige un Organelo o el que tu maestro te indique, y explica la funcin celular del mismo.
Concepto a evaluar
Originalidad en el diseo.
La construccin de la clula es correcta.
La explicacin del Organelo celular es correcta.

NO

Por qu crees que las clulas deben de estar en medios acuosos para poder desempear sus funciones?
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________
Cules son los principales bioelementos que componen a los seres vivos?

Resalt la funcin del Organelo celular.

__________________________________________________________________________________________

Trabajo en equipo.

__________________________________________________________________________________________
_________________________________________________________________________

154

Colegio de Bachilleres del Estado de Sonora

BLOQUE 3

Reconoces a la clula como unidad de la vida

155

Biologa 1

Los siguientes esquemas representan a una clula muscular, nerviosa y sangunea respectivamente. Qu
diferencias encuentras entre ellas? Existe una relacin entre la morfologa y su funcin que desempean en el
cuerpo?

Difusin simple. Es el paso de los iones de una regin de mayor concentracin a otra de menor concentracin y
no existe aporte externo de energa.
Difusin facilitada. Es el paso de partculas a travs de la membrana celular por medio de las protenas que
contiene y no requiere de energa para ello.

__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________

Desarrollo

En el tema anterior se describi los diferentes componentes celulares, as que ahora es


importante conocer las funciones y la importancia de cada uno de ellos en los diferentes
procesos biolgicos y las actividades de los seres humanos.
Se puede realizar un proceso celular muy sencillo en tu casa; si tienes un vaso lleno
de agua y le agregas una gota de colorante, poco a poco el colorante se ir disolviendo
hasta lograr formar una solucin homognea. El movimiento de molculas de agua a
travs de la membrana celular tambin es un proceso de transporte, el ms simple, y se
le conoce como smosis.
Transporte celular.
Este mecanismo es a travs de la membrana plasmtica y es hacia el interior de la clula
o del interior de la clula hacia el exterior de la misma. Es transporte pasivo si no
requiere energa (ATP) o Transporte activo si requiere energa (ATP).
Transporte Pasivo. Es el movimiento de partculas o molculas a travs de la membrana
celular, que no requiere energa. Ejemplos de este tipo son la difusin simple, difusin
facilitada y la smosis.

156

Colegio de Bachilleres del Estado de Sonora

smosis. Es el movimiento neto de agua a travs de la membrana celular en la direccin del incremento del soluto
y se da en tres formas:

Una solucin es isotnica cuando la


concentracin del soluto del soluto es la misma
en ambas partes de la membrana celular y el
agua fluye en ambas direcciones por igual.

La solucin es hipotnica cuando disminuye


la concentracin del soluto y un movimiento
neto de agua hacia el interior de la clula
provocndole una hinchazn o rotura.

La solucin es hipertnica cuando la


concentracin del soluto aumenta y el
movimiento del agua es hacia afuera de la
clula provocando que se encoja o disminuya
de tamao.

El fenmeno de la turgencia se da cuando una clula vegetal se pone en una solucin hipotnica, la clula se
hincha, la pared celular impide que la clula se rompa pero esta se llena de agua. La presin interna sobre la pared
celular es lo que se conoce como turgencia. Pero si una clula vegetal se coloca en una solucin hipertnica, su
membrana celular se separar de la pared celular, se reducir la turgencia celular causando plasmlisis y la planta
morir.

BLOQUE 3

Reconoces a la clula como unidad de la vida

157

Biologa 1

ACTIVIDAD 1

2. Exocitosis. Los componentes de la membrana celular se sintetizan en el retculo endoplsmico, transportado


como vesculas al aparato de Golgi donde se modifican, y luego son transportados a la superficie celular donde
entregan sus contenidos a las clulas exteriores y se convierten en una parte de la membrana celular en un proceso
llamado exocitosis

Completa la siguiente tabla:

Elaboracin y transporte de biomolculas.

SD7-B3

El agua se mueve a travs de una membrana semipermeable


Desde una regin de:

Hacia una regin de:

1. Mayor potencial hdrico

Los organelos celulares encargados de estas funciones son los ribosomas, los retculos endoplasmtico liso y
rugoso y el aparato de Golgi, los cuales se describen en el siguiente recuadro.
Retculo endoplasmtico liso

1. Mayor concentracin de soluto


2. Hipotnica (menos soluto)

Es una red de membranas interconectadas que


forman canales dentro de la clula. Es un sitio para
la sntesis y el metabolismo de lpidos.

2. Mayor potencial osmtico

ACTIVIDAD 2
SD7-B3

Prctica de laboratorio 2

Retculo endoplasmtico rugoso


Es una red de membranas interconectadas que
forman canales dentro de la clula. Cubierto con
ribosomas (causando la aparicin irregular) que
estn en el proceso de sntesis de protenas para
la secrecin o su localizacin en las membranas.
Tambin contiene enzimas para desintoxicar
qumicos, incluyendo drogas y pesticidas.

Plasmlisis
Sigue las instrucciones que aparecen en la Gua de prcticas al final del bloque.

Transporte activo. Requiere de energa para llevarse a cabo.


1. Endocitosis. El proceso consiste en traer partculas conteniendo nutrientes, por
medio de vesculas que forma la membrana celular, del exterior de la clula hacia el
interior de la misma. Se lleva a cabo de dos maneras: pinocitosis y fagocitosis.
A. Pinocitosis. Es la ingestin de agua o de pequeas
partculas por medio de una invaginacin de la membrana.
Ocurre en todas las clulas.
B. Fagocitosis. En la fagocitosis la clula toma desechos,
bacterias y otras partculas grandes del medio y las mete en
una especie de bolsa o vescula que forma, y agrega a esta
rea uno o ms lisosomas, estos ltimos, porque contienen
enzimas para que digieran el material colectado. Las clulas
que realizan este tipo de transporte se les llama fagocitos.
Ejemplo de clulas fagocitos son la amiba y los glbulos
blancos.

158

Colegio de Bachilleres del Estado de Sonora

Aparato de Golgi

BLOQUE 3

Lo constituyen una serie de membranas apiladas. Las


vesculas (pequeas membrana rodeada de bolsas)
llevan materiales desde el retculo endoplasmtico
rugoso hasta el aparato de Golgi. Las vesculas se
mueven entre las pilas, mientras que las protenas
se "procesan" a una forma madura. Las vesculas
luego llevan membrana recin formada y protenas
secretadas a sus destinos finales, incluyendo la
secrecin o la localizacin de la membrana.

Reconoces a la clula como unidad de la vida

159

Biologa 1

Estructuras de soporte y movimiento.

Ribosomas

Es un complejo de protenas y ARN encargado de


la sntesis de la sntesis de protenas. Organelos no
membranosos, dispersos o alejados del ncleo. Se
originan en el nuclolo.

Citoesqueleto. Est constituido por protenas del citoplasma que polimerizan en estructuras filamentosas. El
Citoesqueleto le da forma y volumen a la clula y es a la vez responsable del desplazamiento en su conjunto, as
como del movimiento de los organelos en el citoplasma.
Cilios y flagelos. Son extensiones del citoplasma que sobresalen la membrana celular y participan en el movimiento
de la clula, sus estructuras son similares. Los cilios son cortos y abundantes provocando un movimiento
ondulatorio; este movimiento les permite desplazarse y a la vez atraer partculas para su alimentacin, ejemplo:
el paramecio.

Almacenamiento y procesamiento de sustancias.

Los flagelos son ms largos y gruesos que


los cilios, miden 1 micra aproximadamente y
las bacterias lo presentan. Recordars que el
espermatozoide presenta un flagelo, es de las
pocas clulas eucariotas que lo presentan.

Los lisosomas son organelos ligados a la membrana, responsables para la degradacin de protenas y membranas.
Tambin ayudan a degradar materiales ingeridos por las clulas. Esta funcin la puede desarrollar el ribosoma
debido a su contenido de enzimas hidrolticas por lo que digieren carbohidratos, lpidos y protenas
Granulocitos o polimorfo nucleares. Son glbulos blancos circulares que por medio de sus lisosomas eliminan
por medio de enzimas a partculas agresoras.
Peroxisomas. Christian de Duve, citlogo y bioqumico ingls recibi el premio Nbel en fisiologa, en 1974, por
sus estudios sobre la estructura y funcin de algunos organelos celulares entre ellos, los lisosomas y Peroxisomas.
Los Peroxisomas solo estn presentes en eucariotas y contienen enzimas peroxidasas y catalasas para la de
toxificacin celular.

Cierre

Vacuolas. Son vesculas para almacenamiento de sustancias y agua, tambin con funciones de excrecin

ACTIVIDAD 4
SD7-B3

Realiza un mapa sobre las funciones celulares.


Conceptos a evaluar

NO

El mapa presenta los datos ms importantes.


El diseo del material es didctico con claridad y coherencia.
Habilidades expositivas.
Se trabaj en forma colaborativa y cumple con las caractersticas
sealadas con anticipacin.

160

Colegio de Bachilleres del Estado de Sonora

BLOQUE 3

Reconoces a la clula como unidad de la vida

161

Biologa 1

2. Observaste diferencias entre vacuolas en el tejido de la papa y en el de algn protozoario observado?

PRCTICA DE LABORATORIO 1

__________________________________________________________________________________________
________________________________________________________________________

(En equipo mximo de 4 personas)


Observacin de clulas vegetales y animales

3. En qu radica la importancia de la clula vegetal?


__________________________________________________________________________________________

Marco terico:

__________________________________________________________________________________________

La clula es la unidad fundamental de los seres vivos. Hay seres vivos formados por una sola clula como el
paramecio y la euglena que podemos encontrarlos en aguas de charcos. Los tejidos lo forman las clulas en
conjunto. Las vegetales presentan pared celular para delimitarlas y protegerlas y darles el carcter de individualidad,
en cambio las clulas animales lo realizan por medio de la membrana celular. As, todas las clulas presentan su
metabolismo propio y reproduccin.
Objetivo de la prctica:

Equipo:

Material:

Microscopio ptico
Cmara para microscopio
Portaobjetos
Cubreobjetos
Navaja

Una cebolla
Una papa
Agua de charco

Reactivos:


Agua destilada
Lugol
Azul de metileno

Procedimiento:
1. Para examinar las clulas en la punta de una raz de cebollas, un delgado corte de la raz se coloca sobre un
portaobjeto y se tie con azul de metileno para que las estructuras celulares sean visibles. Tomas fotos con la
cmara del microscopio y las digitalizas para verlas en la computadora posteriormente.
2. Realizas la misma operacin con la papa solo que ahora ties con Lugol para observar el almidn en las
vacuolas.
3. Colocas una gota de agua de charco, de preferencia que sea verdosa, en un portaobjeto, lo cubres con un
cubreobjetos y trata de encontrar organismos celulares como los indicados anteriormente.
Cuestionario:
1. Cules son las diferencias encontradas entre clulas animales y vegetales?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
162

________________________________________________________________________

PRCTICA DE LABORATORIO 2

Encontrar semejanzas y diferencias entre clulas vegetales y animales al observarlas al microscopio. Segundo
lograr fotos digitales con la cmara para el microscopio y observarlas en la computadora.




__________________________________________________________________________________________

Colegio de Bachilleres del Estado de Sonora

(En equipos mximo de 5 personas)


Plasmlisis
Marco terico.
La membrana celular se encarga del transporte de sustancias hacia el interior o exterior de la clula, a esta funcin
celular se le conoce como smosis y es importante para el metabolismo celular de los seres vivos.
Una solucin es isotnica cuando la concentracin del soluto del soluto es la misma en ambas partes de la
membrana celular y el agua fluye en ambas direcciones por igual.
La solucin es hipotnica cuando disminuye la concentracin del soluto y un movimiento neto de agua hacia el
interior de la clula provocndole una hinchazn o rotura.
La solucin es hipertnica cuando la concentracin del soluto aumenta y el movimiento del agua es hacia afuera
de la clula provocando que se encoja o disminuya de tamao.
Propsito de la prctica.
Observar la diferencia que existe en la epidermis de una cebolla en solucin hipotnica y en solucin hipertnica.
Observar los fenmenos de turgencia y de plasmlisis.
Equipo.





Microscopio ptico
Portaobjetos
Cubreobjetos
Pinzas
2 Frascos de vidrio
Masking tape

BLOQUE 3

Material.

Reactivos.

Una cebolla

Reconoces a la clula como unidad de la vida

Agua destilada
Agua con sal

163

Biologa 1

Procedimiento.
1. Un da antes coloca varias capas de cebolla en un frasco con 200 ml de agua destilada y lo etiquetas. En otro
frasco coloca igual varias epidermis de cebolla, agregas 200 ml de agua y le agregas 8 g de sal.
2. Al da siguiente, en el laboratorio observas una capa de epidermis de cada muestra en el microscopio.
Cuestionario.

RBRICA DE EVALUACIN DE ACTIVIDAD INTEGRADORA

Aspectos a
evaluar

El trabajo en s, no es una
respuesta clara a la pregunta
realizada.

1. Describe las diferencias encontradas:


__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________

Niveles de desempeo
Resolutivo
(8)

Receptivo
(6-7)

Informacin
obtenida

_________________________________________________________________________________________

Falta alguno de los pasos


importantes en el trabajo,
ya sea la Introduccin,
el Desarrollo o las
Conclusiones.
No informa sobre las
fuentes consultadas

__________________________________________________________________________

Presenta aspectos bsicos


pero no es completamente
satisfactoria la respuesta a
la pregunta planteada.
Contiene los pasos
fundamentales el informe
pero no todos los sustentos
no son confiables o
actuales.

Autnomo
(9-10)

Suma
Parcial

El trabajo es una respuesta


clara a la pregunta
planteada.
Contiene los pasos
fundamentales:
Introduccin, Desarrollo y
conclusiones, sustentados
en bases cientficas.
Las fuentes utilizadas son
confiables y vigentes.

2. Cul epidermis presenta la plasmlisis y cul la turgencia?


__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________

Presentacin

__________________________________________________________________________________________
_________________________________________________________________________________________

No elige grficos: tablas,


imgenes y video. Se
dificulta la lectura por
elegir mal el tipo de letra
y las imgenes no tienen
claridad

__________________________________________________________________________
3. Cul componente de la membrana celular es receptor de las seales entre la solucin acuosa, que es el medio
ambiente y el agua? Son los lpidos, las protenas, los carbohidratos o el colesterol?

Los integrantes del equipo


no trabajaron en forma
equitativa.

__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________

Trabajo
colaborativo

Hubo ausencia de
participacin por algunos
de los integrantes.
Siempre se suscitaron
conflictos durante la
elaboracin del trabajo y en
la presentacin del mismo,
necesitndose la vigilancia
cercana del docente.

Los grficos son


congruentes con el tema
pero o son pocos o estn
en exceso. Hay dificultades
en la lectura por el tipo de
software utilizado
Algunas de las imgenes no
fueron pertinentes.

La eleccin de los grficos


es muy atinada, son
pertinentes y ayuda a
explicar mejor el tema.
Magnfica eleccin del
software y las imgenes
se presentan con excelente
nitidez.

Los integrantes del equipo


a veces trabajaron en forma
equitativa.

Los integrantes del equipo


trabajaron en forma
equitativa.

En ocasiones hubo
ausencia de participacin
por algunos de los
integrantes.

Todos los integrantes del


equipo trabajaron en todas y
cada una de las tareas.

En ocasiones, se suscitaron
conflictos durante la
elaboracin del trabajo y en
la presentacin del mismo,
necesitndose la vigilancia
cercana del docente.

Si se present alguna
observacin por alguno de
los integrantes del equipo
se tom siempre en forma
positiva, estando todo el
equipo conforme con el
informe entregado.

Suma Total
Calificacin del Proyecto

164

Colegio de Bachilleres del Estado de Sonora

BLOQUE 3

Reconoces a la clula como unidad de la vida

165

Biologa 1

PORTAFOLIO DE EVIDENCIAS

REACTIVOS DE CIERRE

Organizador para el portafolio de evidencias

1. Cul de las siguientes afirmaciones no es parte de la teora celular?


A. Todos los animales estn formados por clulas.
B. La reproduccin requiere duplicacin vegetativa o la combinacin sexual de gametos.
C. Las clulas son la unidad de origen.
D. Las clulas animales se autodestruyen por apoptosis.

Biologa 1
Bloque 3
Reconoces a la clula como unidad de la vida
Nombre del alumno:
Marca con una X el desempeo y realizacin de las actividades de aprendizaje
SECUENCIA
DIDCTICA

Caractersticas de las evidencias

No.

Actividad de
aprendizaje

SD1

Mapa de conceptos
sobre los contenidos del
bloque 3

SD2

SD3

SD3

SD3

SD4

SD4

ACT.
INT.

SD6

ACT.
INT.

SD7

SD7

SD7

Puntualidad

Coherencia
y claridad

Lnea del tiempo de las


investigaciones sobre la
teora celular
Mapa mental que
explique las teoras de
la vida
Lluvia de ideas y debate
sobre las caractersticas
que dieron origen a la
vida
Ensayo sobre el
origen de la vida y tu
inclinacin por alguna
de las teora
Prctica de laboratorio 1
Poster con semejanzas
y diferencias entre
procariotas y eucariotas
Clula de plastilina
Complementar tabla
sobre smosis
Prctica de laboratorio 2
Mapa mental de las
funciones celulares

Limpieza

Se desarrollaron los
atributos indicados
Mal

Regular

Bien

2. Cul de los siguientes elementos no est vivo pero requiere vida para poder reproducirse?
A. Eubacteria.
B. Hongo.
C. Protozoos.
D. Virus.
3. Qu prrafo describe mejor la funcin del retculo endoplasmtico rugoso?
A. Sistemas especficos de seales y transportes.
B. Sntesis y ensambles de protenas de membrana y de serecin.
C. Produccin de energa durante la fotosntesis.
D. Procesamiento de protenas de membranas y de secrecin, incluyendo glucosilacin.
4. El siguiente Organelo se encuentra en clulas procariotas pero no en clulas eucariotas de origen animal.
A. Mitocondria.
B. Cloroplastos.
C. Ncleo.
D. Pared celular .
5. Mitocondria y cloroplastos, ambos:
A. Su funcin es de proveer de energa a la clula
B. Estn presentes en las plantas.
C. Contienen ADN.
D. Todo lo anterior.
6. Una muestra de clulas se coloca en una solucin salina. Las clulas se encogen y la membrana se distorsiona.
En relacin a la clula probablemente la solucin es:
A. Isotnica.
B. Hipotnica.
C. Osmtica.
D. Hipertnica.
7. En la membrana celular, el transporte por difusin simple se puede distinguir del proceso por difusin facilitada
porque:
A. La difusin simple no requiere energa: la difusin facilitada requiere una fuente de ATP
B. La difusin simple solo mueve material en la direccin del gradiente de concentracin
C. difusin simple no puede ser saturable, la rapidez de la difusin facilitada se limita al nmero de
membranas funcionales proteicas y puede saturarse
D. La difusin simple se presenta solo en clulas procariotas, mientras que la difusin facilitada se
presenta solo en clulas eucariotas.

Firma del docente

166

Colegio de Bachilleres del Estado de Sonora

BLOQUE 3

Reconoces a la clula como unidad de la vida

167

8. La tasa de transporte de una sustancia en una clula se reduce drsticamente cuando la formacin de ATP es
bloqueado. El sistema de transporte debe de ser una forma de:
A. Transporte activo.
B. Difusin simple.
C. Difusin facilitada.
D. Ambos el transporte activo y la difusin facilitada.
E. Ambas, la difusin simple y la facilitada.
9. El cruce en una membrana por difusin simple se puede distinguir de la difusin facilitada porque:
A. La difusin simple no requiere de energa: la difusin facilitada requiere una fuente de ATP.
B. La difusin simple slo puede mover el material en la direccin de un gradiente de concentracin;
difusin facilitada mueve materiales con y en contra de un gradiente de concentracin.
C. La difusin simple no es saturable; las tasas de difusin facilitada estn limitadas por el nmero de
protenas de membrana funcionales y pueden ser saturados.
D. Difusin simple se encuentra slo en los procariotas, mientras que la difusin facilitada slo se encuentra
en las clulas eucariotas.
10. Los componentes de la membrana celular se sintetizan en el retculo endoplsmico, transportndose como
vesculas al aparato de Golgi donde se modifican, y luego son transportados a la superficie celular donde entregan
sus contenidos a las clulas exteriores y se convierten en una parte de la membrana celular en un proceso llamado
____________. En la inversa de este proceso, se traen nutrientes y partculas del exterior hacia el interior de la
clula, el proceso se denomina _________.
A. Exocitosis; Endocitosis.
B. Transporte activo; Transporte pasivo.
C. Difusin simple; La difusin facilitada.
D. Osmosis; Difusin.

BLOQUE 4

Describes el metabolismo de los seres vivos


Desempeo del estudiante
al finalizar el bloque
Describe

los procesos energticos que


se desarrollan en los seres vivos y que
mantienen la vida.
Reconoce las formas de nutricin que realizan
los seres vivos para obtener su energa.

FUENTES DE INFORMACIN
Fuentes Electrnicas
http://cienciasnaturales1cssa.blogspot.mx/2014/02/diferencias-entre-celulas-eucariotas.html
http://cienciasnaturales1cssa.blogspot.mx/2014/02/diferencias-entre-celulas-eucariotas.html

168

Colegio de Bachilleres del Estado de Sonora

Tiempo asignado: 14 horas

Objetos de aprendizaje
Tipos de energa.
Reacciones ende y exotrmicas.
Adenosntrifosfato (ATP):

Estructura y funcin.
Ciclo del ATP.
Metabolismo:
Enzimas.
Catabolismo y anabolismo.
Procesos anablicos:
Quimiosntesis.
Fotosntesis.
Procesos catablicos:
Respiracin celular.
Fermentacin.
Formas
de
nutricin
auttrofa
(quimiosntesis-fotosntesis) y hetertrofa
(holozoica, saprfita y parsita).

Competencias a desarrollar
Fundamenta opiniones sobre los impactos de

la ciencia y la tecnologa en su vida cotidiana,


asumiendo consideraciones ticas de sus
comportamientos y decisiones.
De manera general o colaborativa, identifica
problemas, formula preguntas de carcter
cientfico y plantea las hiptesis necesarias para
responderlas.
Utiliza las tecnologas de la informacin y
la comunicacin para obtener, registrar y
sistematizar informacin para responder a
preguntas de carcter cientfico, consultando
fuentes relevantes y/o realizando experimentos
pertinentes.
Contrasta los resultados obtenidos en una
investigacin o experimento con hiptesis
previas y comunica sus conclusiones, aportando
puntos de vista con apertura y considerando los
de otras personas de manera reflexiva.
Trabajando en equipo, disea modelos o
prototipos para resolver problemas, satisfacer
necesidades o demostrar principios cientficos
relativos a las ciencias biolgicas.
Analiza las leyes generales que rigen el
funcionamiento del medio fsico y valora
las acciones humanas de riesgo e impacto
ambiental, advirtiendo que los fenmenos que
se desarrollan en los mbitos local, nacional e
internacional; ocurren dentro de un contexto
global interdependiente.
Aplica normas de seguridad en el manejo
de sustancias, instrumentos y equipo en la
realizacin de actividades de su vida cotidiana
enfrentando las dificultades que se le presentan
siendo consciente de sus valores, fortalezas y
debilidades.

Biologa 1

Inicio

Secuencia didctica 1
TIPOS DE ENERGA

EVALUACIN DIAGNSTICA A

Encuentra las definiciones de los trminos descritos a continuacin y presntalas a revisin con tu profesor:
1.
2.
3.
4.
5.
6.
7.

Energa en procesos biolgicos (Calorfica, Cintica, Elctrica, luminosa y Qumica)


Termodinmica, desde el punto de vista biolgico
Reaccin exotrmica
Reaccin endotrmica
ATP
Organismo auttrofo
Organismo hetertrofo

Desarrollo

Como has podido analizar, todos los seres vivos demuestran diversas caractersticas
indispensables que le permiten mantenerse con vida, como por ejemplo buscar sus
alimentos, su crecimiento a lo largo de la vida, la capacidad de reproducirse entre otras
conductas. Estas caractersticas son indispensables para mantenerse con vida por lo
tanto esto requiere un alto costo energtico.

El sol es la principal fuente de


energa del planeta Tierra

En nuestro planeta, la vida depende del flujo de energa procedente del


sol, aunque solo una pequea fraccin de sta puede ser transformada en
la energa que impulsa todos los procesos vitales. En general, todos los
organismos vivos como las plantas, algunas bacterias y protistas, son
los que originan esta transformacin de energa mediante la fotosntesis,
convirtiendo la energa solar en energa qumica. En cambio existen seres
vivos que no contamos con esos pigmentos fotosintticos por lo que no
podemos producir nuestra propia energa, por lo que es necesario consumirla
de otras fuentes. Ponte a pensar, cuando tienes hambre y consumes una
rebanada de pizza, una hamburguesa, alguna fruta, verdura o cualquier
alimento que puedas consumir en tu casa, lo haces porque tienes hambre,
pero lo que realmente sucede (en la mayora de los casos) es que tu cuerpo
te est demandando energa, es decir nutrientes para llevar a cabo todos sus
funcionamientos de una forma correcta.

Los seres vivos estn constituidos por distintos tipos de clulas, los humanos lgicamente no estamos exentos
a esta afirmacin, por lo que cada clula que nos compone requiere de cierta energa para poder desempear su
funcin. Una clula por si sola requiere de mucha energa qumica que esta se obtiene por medio de la degradacin
de nutrientes que provienen de los alimentos, principalmente los carbohidratos y los lpidos. Estos son degradados
para producir el principal combustible, llamado Adenosina Trifosfato (ATP).
170

Colegio de Bachilleres del Estado de Sonora

La clula, como unidad de vida fundamental, es la encargada


de llevar todas estas funciones ya que esta misma se alimenta,
respira, crece, se mueve, trabaja y se reproduce. La suma de
todas las funciones que realiza un organismo o una clula
recibe el nombre de metabolismo y para que todas estas
funciones puedan llevarse a cabo, el ser vivo o la clula
requieren de materia y energa.
El colibr puede agitar sus alas hasta 78 veces por segundo
para mantenerse inmvil en el aire mientras toma el nctar de
una flor. El corazn del colibr late a 500 latidos por minuto
cuando est descansando y el doble cuando est en actividad.
Estas pequeas aves almacenan en su organismo energa en
forma de grasas que se acumulan bajo su piel. El alimento
que consumen es principalmente el nctar de las flores, rico
en azcares y elaborado por procesos de fotosntesis de las
plantas. Estas transforman la energa solar, as que en ltima
instancia, es el sol el que provee de energa a estas aves para
efectuar sus movimientos.

EVALUACIN DIAGNSTICA B

En el ejercicio siguiente relaciona ambas columnas y encuentra los distintos tipos de energa que existen en la
naturaleza y ejemplo de cada uno de ellos.
Tipos de energa

Ejemplos
( ) Se utilizan en procesos de biosntesis para el crecimiento, transporte en las
membranas celulares y la reproduccin de las mismas

1.
2.
3.
4.
5.

Calorfica
Elctrica
Luminosa
Cintica
Qumica

( ) Se manifiesta en los seres vivos al moverse, hacer ejercicio, trepar, etc.


( ) Se produce en todas las actividades realizadas en un ser vivo, ya que todas
las transformaciones de la energa producen calor
( ) Funcionamiento correcto de los rganos de los sentidos como la vista y el
odo y la transmisin de los impulso nervioso del cerebro
( ) Organismos como las lucirnagas y varios tipos de peces

Es importante sealar que todos los procesos de transformacin de energa producen calor, es decir, expresada
qumicamente, cualquier reaccin tiene como producto la liberacin de calor. Por ejemplo, las lagartijas pierden el
calor rpidamente y lo liberan, mientras los mamferos de tierras heladas tienden a guardar este calor para poder
sobrevivir a ese tipo de ecosistemas.

BLOQUE 4

Describes el metabolismo de los seres vivos

171

Biologa 1

Inicio

Secuencia didctica 2
REACCIONES EXOTRMICAS Y ENDOTRMICAS

EVALUACIN DIAGNSTICA A

Contesta las siguientes preguntas


Cmo explicas la termodinmica en trminos biolgicos?
__________________________________________________________________________________________
__________________________________________________________________________________________

Las espinas que presentan algunas plantas son una adaptacin evolutiva de las hojas que
permite la disipacin de calor y les brinda proteccin.

__________________________________________________________________________________________
________________________________________________________________________

NOTA:
La energa se define como la capacidad que tiene un objeto para poder realizar un trabajo.

Cmo obtienen los seres vivos la energa necesaria para desarrollar sus funciones vitales?
__________________________________________________________________________________________
__________________________________________________________________________________________

Cierre

__________________________________________________________________________________________
________________________________________________________________________

ACTIVIDAD 1

Desarrollo

SD1-B4

Investigar en su entorno ejemplos de los distintos tipos de energa que se manifiestan en los seres vivos y con
la informacin recabada realizar un mapa conceptual. Exponerlo en plenaria explicando la importancia de este
proceso en su comunidad. Generen conclusiones.
Conceptos a evaluar

SI

NO

La ciencia encargada de estudiar los procesos energticos se conoce como termodinmica


y sus leyes se aplican tanto en la materia no viva como en la materia viva.
El flujo de energa se define como al proceso de las transformaciones continuas en los seres
vivos, este a su vez se rige por las leyes de la termodinmica, que son bsicamente leyes
fsicas que interpretan las propiedades y el comportamiento de la energa cuando sta fluye
a travs de los cuerpos. Estas se rigen bajo estas dos leyes:

Primera ley de la termodinmica: La energa no se crea ni de destruye,


solo se transforma. El mejor ejemplo que podemos describir es el proceso
de la fotosntesis ya que es una transformacin de la energa luminosa
proveniente del sol y el cual se transforma en energa qumica.

Segunda ley de la termodinmica: la energa fluye del cuerpo con mayor


cantidad de energa, al cuerpo que contenga menor cantidad de energa,
hasta poder alcanzar un equilibrio energtico. Pero durante el flujo de
energa de un cuerpo a otro, una fraccin de esa energa se disipa, por lo
que el proceso nunca es completamente eficiente.

1. Participacin en la elaboracin y contenido del mapa conceptual


2. El mapa conceptual presenta los tipos de energa y ejemplos
3. El mapa conceptual es original
4. El trabajo escrito anexo al mapa, presenta correctamente la informacin solicitada, as
como una claridad en sus ideas

172

Colegio de Bachilleres del Estado de Sonora

BLOQUE 4

Describes el metabolismo de los seres vivos

173

Biologa 1

El mejor ejemplo para poder interpretar estas leyes es mediante el uso de un automvil. La primera ley la podemos
entender como la utilizacin de la gasolina mientras realiza la combustin (energa calorfica) para propiciar el
movimiento del auto (energa cintica). Ahora bien, la segunda ley de la termodinmica, se comprueba porque
una fraccin de la energa de la gasolina se transformar en calor y se disipar (solo basta comprobarlo acercando
la mano al cofre del motor).
Pero no todas las reacciones desprender de calor, existen algunos tipos, dependiendo de las necesidades que
tenga el organismo, de absorber calor para su buen funcionamiento biolgico, estas reacciones se conocen como
exotrmicas y endotrmicas.

Cierre

ACTIVIDAD 1
SD2-B4

A. Busca ejemplos de reacciones endotrmicas y exotrmicas en seres vivos.


B. Forma un equipo y analiza con tus compaeros los ejemplos encontrados y contrasta las caractersticas de
los dos tipos de reacciones.
C. Con la informacin recabada realiza un mapa mental.
Toda transformacin de energa implica la dispersin de una parte de ella, que no ser
aprovechada para el trabajo que se va a realizar.

D. Exponerlo en plenaria.
Conceptos a evaluar
1. Participacin en la elaboracin y contenido del mapa mental

SI

NO

2. El mapa mental presenta las caractersticas idneas


3. El mapa mental es original
4. El trabajo escrito anexo al mapa presenta correctamente sus ideas
Las reacciones endotrmicas son aquellas que necesitan
o absorben energa para llevarse a cabo. Las plantas
necesitan la luz solar para elaborar su alimento, por lo que
la fotosntesis es una reaccin endotrmica.

Inicio
Los alimentos que consumimos durante nuestra
dieta nos proporciona energa que esta se almacena
para despus ser utilizada. Esto es un ejemplo de
una reaccin endotrmica.

Por su parte, las reacciones exotrmicas son aquellas


que liberan o desprenden energa. As, por ejemplo,
una reaccin exotrmica ocurre cuando encendemos
una fogata, la madera libera energa a medida que se
quema. La respiracin celular constituye otro ejemplo
de este tipo de reacciones.
Los relmpagos liberan gran cantidad
de energa que ayuda a la realizacin de
reacciones endotrmicas en la atmsfera.
174

Colegio de Bachilleres del Estado de Sonora

Secuencia didctica 3
ADENOSINA TRIFOSFATO (ATP)

Estructura y funcin

Nuestro cuerpo gasta una gran cantidad de energa cada da. Por el simple hecho ya sea de caminar, estar sentados,
respirar, ver la televisin, podemos gastar alrededor de unas 1500 caloras. Lgicamente, si la persona tiene una
actividad fsica constante, se duplicara o triplicara el gasto energtico dependiendo de la intensidad del ejercicio.
La pregunta es, Cmo hacemos para reponer la energa perdida? Gracias a una serie de procesos, los seres vivos
contamos con una molcula especializada en aportar la energa en todas las reacciones qumicas que se llevan
dentro de nuestro cuerpo: adenosina trifosfato representado por sus siglas ATP.
La adenosina trifosfato o ATP es un compuesto formado por molculas portadoras de energa que se ha obtenido
de las sustancias qumicas que forman los alimentos. Esto quiere decir que los alimentos funcionan en ciertas
ocasiones como combustibles para las clulas, pero a diferencia de como la gasolina aporta energa para un
motor, en las clulas existen mecanismos que evitan las explosiones bruscas de calor. Esta molcula en cada una
de nuestras clulas, se puede obtener a partir de los azcares que ingerimos, del glucgeno que almacenamos
como reserva, o bien, de la grasa que generalmente utilizamos como reserva energtica. La molcula de ATP
est compuesta por tres grupos fosfato, una molcula de ribosa y un grupo nitrogenado.Tambinresulta ser que
cuando pierde dos grupos fosfato se convierte en un nucletido del ARN. El grupo fosfato y adenina reciben el
nombre de adenosin, y con los tres fosfatos se denomina adenosin tri fosfato o ATP para acortar

BLOQUE 4

Describes el metabolismo de los seres vivos

175

Biologa 1

AMP

ADP

ATP

ACTIVIDAD 1
SD3-B4

Prctica de laboratorio1.
Construye la molcula de ATP
Sigue las instrucciones que aparecen en la Gua de prcticas al final del bloque

ATP principal portador de energa


Estructura de adenosina trifosfato ATP

Desarrollo

La energa que la clula no utiliza durante su trabajo se disipa en el ambiente, en


cantidades pequeas, en forma de calor. Esta disipacin se lleva a cabo conforme se
realizan las reacciones qumicas, de modo que se evita una liberacin brusca de grandes
cantidades de energa y calor, ya que esto podra incinerar a la clula.

Es importante tomar en cuenta que el enlace entre el segundo y el tercer fosfato del ATP es un enlace de alta
energa, lo que es de enorme importancia para la realizacin del trabajo y para conservar la energa liberada por
la oxidacin de los nutrimentos durante, la respiracin. Las reacciones del ADP y ATP son frecuentes durante el
metabolismo celular.
En resumen, podemos decir que las plantas, en nuestro planeta, son las encargadas de capturar la energa solar y
transformarla en energa qumica en forma de glucosa. Las clulas metabolizan la glucosa y conservan la energa
en forma de ATP.

Ciclo del ATP

Cierre

El inicio de la cadena energtica en nuestro planeta comienza con la captacin de la luz


solar que lo realizan principalmente las plantas. Esta energa luminosa es transformada
en energa qumica en forma de glucosa. La segunda etapa importante ocurre en cada
una de las clulas, donde se metaboliza la glucosa y el organismo empieza a utilizar o
conservar la energa en forma de ATP. A este ciclo se le conoce como el ciclo del ATP.
Este ciclo se forma a partir de una molcula llamado adenosina mono fosfato (AMP) y
contina con el siguiente proceso:

Mediante un enlace de alta energa, un grupo fosfato se une a la molcula de


AMP y se forma un compuesto llamado adenosina di fosfato (ADP)

Despus, por medio de otro enlace de alta energa, a esta molcula de ADP se
une otro grupo fosfato y se forma adenosina tri fosfato (ATP)

176

Cuando el ATP se descompone, si libera la energa almacenada en los dos


enlaces de alta energa, los cuales se separan de cada una de sus molculas.
Con ello, resulta de nuevo una molcula de AMP, con el que puede reiniciarse
el proceso.

Colegio de Bachilleres del Estado de Sonora

ACTIVIDAD 1
SD1-B1

Forma un equipo y analiza con tus compaeros el ciclo del ATP.


Con la informacin recabada realiza un cartel.
Exponerlo en plenaria.
1.
2.
3.
4.

Conceptos a evaluar
Participacin en la elaboracin y contenido del poster
El poster presenta las caractersticas idneas
El poster es original
El equipo expresa correctamente sus ideas en la plenaria

BLOQUE 4

Describes el metabolismo de los seres vivos

SI

NO

177

Biologa 1

Inicio

Secuencia didctica 4
METABOLISMO

Los sustratos, al reaccionar, cambian de forma y se despegan de la enzima.


La enzima queda libre y entonces esta lista para volver a unirse a otro sustrato.

EVALUACIN DIAGNSTICA A

Tienes alguna idea de los siguientes trminos: enzima, catabolismo, cofactor, modelo llave cerradura y
anabolismo? Coloca los siguientes trminos en la definicin que creas es la correcta:
1. ____________________ Conjunto de reacciones metablicas mediante las cuales, molculas orgnicas
ms o menos complejas, se degradan en otras ms sencillas.

Esquema de una accin enzimtica


NOTA: un catalizador es aquella sustancia que ayuda ya sea a retardar o acelerar una reaccin qumica sin
necesariamente participar en la reaccin misma.

2. ____________________ Es el conjunto de procesos del metabolismo que tiene como resultados la


sntesis de compuestos orgnicos a partir de otros precursores de baja masa molecular.
3. ____________________ Son protenas, que sin consumirse en una reaccin, pueden aumentar
notablemente la velocidad de la misma.

La lactasa es una
enzima producida en el
intestino delgado, que
juega un papel vital
en el desdoblamiento
de la lactosa (proceso
necesario
para
su
absorcin por nuestro
organismo) en sus dos
componentes bsicos:
glucosa y galactosa.

4. _____________________ Es un componente no proteico de baja masa molecular, termo estable, necesario


para la accin de una enzima
5. _____________________ Supone que la estructura del sustrato y del centro activo de la enzima es
complementaria

Desarrollo

Cuando hablamos de metabolismo nos referimos al conjunto de reacciones qumicas que


presentan las clulas de todos los organismos, con el propsito de obtener e intercambiar
materia y energa con el ambiente. Las reacciones metablicas de la clula la obligan a
estar en constante actividad por lo que las concentraciones de innumerables sustancias
cambian continuamente en el interior de la clula
Enzimas
Las enzimas son catalizadores biolgicos de naturaleza proteica (es decir, son
protenas) que estas se sintetizan en los seres vivos. Nosotros producimos cientos de
enzimas diferentes, cada una acoplada a catalizar determinada reaccin qumica. Cada
enzima tiene una forma tridimensional especfica, con un espacio llamado sitio activo,
que embona perfectamente con las molculas de la reaccin en la que participa. La
sustancia en la cual acta una enzima se conoce con el nombre de sustrato.
La forma en que acta una enzima es la siguiente:
El sustrato se una a la enzima, embonando como una llave en su cerradura.
Los sustratos y el sitio activo pueden cambiar de forma por la interaccin que
se da entre ambos. Se promueve la reaccin entre los sustratos.

178

Colegio de Bachilleres del Estado de Sonora

ACTIVIDAD 1
SD4-B4

Prctica de laboratorio 2.
Accin enzimtica.
Sigue las instrucciones que aparecen en la Gua de prcticas al final del bloque

BLOQUE 4

Describes el metabolismo de los seres vivos

179

Biologa 1

Catabolismo y anabolismo

Cierre

En los seres vivos existen dos tipos principales de


procesos metablicos, en uno de ellos se construye y en
el otro se degrada. Estos procesos se llaman anabolismo
y catabolismo respectivamente y se encuentran muy
relacionados entre si.
La parte constructiva del metabolismo es el proceso
anablico. En los seres vivos estas reacciones se
utilizan para construir molculas a partir de otras ms
simples como la formacin de protenas a partir de
amino cidos, la produccin de polisacridos a partir
de monosacridos, la formacin de glucosa a partir del
CO2 y la sntesis de ADN a partir de nucletidos. La
fotosntesis es un ejemplo de un proceso anablico ya que
tiene como fuente de energa al sol; el anabolismo tiene
como particularidad de ser reacciones endotrmicas.

ACTIVIDAD 2
SD4-B4

1. Enlista una serie de ejemplos de situaciones cotidianas en las que se presenten los dos tipos de
metabolismo: anabolismo y catabolismo
2. Realiza un mapa conceptual del metabolismo
3. Concluye cual es la importancia de que existan ambos procesos metablicos
Las reacciones anablicas se caracterizan por
generar biomasa.

Por otra parte, los procesos catablicos corresponden a aquellas reacciones metablicas que tienden a la
degradacin de molculas y se caracterizan por ser reacciones exotrmicas. Estas reacciones tienen que ver como
la utilizacin de los alimentos como fuentes de energa. Por ejemplo la degradacin de la glucosa, de las grasas
y de las protenas que comentos da por resultado la obtencin de energa se que almacena en la molcula de ATP.
El catabolismo se caracteriza por la degradacin de biomasa para
obtener energa, si el cuerpo no la obtiene del exterior entonces
cataboliza su propia biomasa, comenzando por la grasa y terminando
con el msculo.

4. Entrega el mapa a tu profesor acompaado de los puntos 1 y 3


Conceptos a evaluar
1.
2.
3.
4.

SI

NO

Participacin en la elaboracin y contenido del mapa conceptual


El mapa conceptual presenta las caractersticas idneas
El mapa conceptual es original
El trabajo escrito anexo al mapa presenta correctamente sus ideas

Inicio

Secuencia didctica 5
QUIMIOSNTESIS

Algunos organismos auttrofos no requieren de la luz solar, si no que utilizan como fuente de energa ciertas
sustancias qumicas a las que oxidan, por lo tanto se les denomina como quimiosintticos.

El metabolismo de los procariotas es


enormemente variado, a diferencia
de los eucariotas, y muchos resisten
condiciones ambientales sorprendentes
por lo extremas en parmetros como la
temperatura o la acidez.
El ejercicio as como ciertas hormonas estimulan la sntesis
de biomasa corporal.

180

Colegio de Bachilleres del Estado de Sonora

BLOQUE 4

Describes el metabolismo de los seres vivos

181

Biologa 1

Desarrollo

La Quimiosntesis es un proceso por el cual algunas bacterias utilizan compuestos


qumicos para la produccin de energa gracias a sistemas enzimticos muy
especializados. A continuacin se mencionas los organismos procariotas quimiosintticos
ms conocidos:

Procariontes sulfurosos: Oxidan compuestos de azufre con la consecuente


produccin de cido sulfrico. Estos procariontes crecen y se reproducen en
medios muy cidos (donde el pH es cercano a o) como por ejemplo algunos
lagos, en lodos y en sedimentos marinos. Ejemplo de este tipo de organismos
tenemos a las bacterias verdes purpreas que utilizan el sulfuro de hidrgeno
de la siguiente manera:
2H2S

CO2

(CH2O) + H2O + 2S

Procariontes hidrogenosos: Este tipo de bacterias oxida el hidrogeno del aire


mediante la accin de una enzima muy especial que producen, realizando la
siguiente reaccin qumica:
6H2

2O2 + CO2

(CH2O)

5 H2O

Cierre

ACTIVIDAD 1
SD5-B4

Realiza una investigacin sobre caractersticas de bacterias quimiosintticas para que puedas completar el
siguiente cuadro:
Grupo de
procariontes

Fuentes de
energa

Ejemplos

Donde viven

Nitrificantes

Procariotas ferrosos: Estos microorganismos oxidan el fierro y se desarrollan


en medios muy cidos, por lo que frecuentemente conviven con otro tipo de
procariontes sulfurosos. Este tipo de bacterias oxidan al hierro de una manera
muy peculiar ya que pasan de un estado ferroso (Fe+2) a un estado frrico (Fe+3)

Metangenas

Procariontes nitrificantes: Tienen la particularidad de oxidan el amoniaco en


nitritos y los nitritos en nitratos, lo que requiere de condiciones anerbicas en
las que el oxgeno no est presente o en pequeas cantidades, como ejemplo
tenemos a la siguiente reaccin:

Ferrosas

2NO2 + O2

Compuestos que
obtienen

Hidrgeno

Sulfurosas

Pantanos
Fondo del mar

Sulfatos
Ferrobacillus

Hidrotermales

2NO3

Nitrito Nitrato
A muchas procariontes se les ha encontrado en lugares que presentan condiciones
extremas, como la falta de oxgeno, temperaturas muy altas, a grandes profundidades
de la corteza terrestre o soportando enormes presiones, como cierto tipo de procariontes
que existen en las chimeneas volcnicas del ocano Pacfico.
Se saba con anterioridad que las bacterias que viven cerca
de fumarolas hidrotermales utilizan dos fuentes de energa
qumica: el metano y algunos compuestos de azufre.
Ahora, los autores del nuevo estudio han determinado
que las bacterias simbiticas de los mejillones de las
fumarolas hidrotermales en la Dorsal del Atlntico Medio
son tambin capaces de usar el hidrgeno como fuente de
energa para fijar el carbono y producir materia orgnica.

182

Colegio de Bachilleres del Estado de Sonora

Inicio

Secuencia didctica 6
FOTOSNTESIS

ACTIVIDAD 1
SD6-B4

Prctica de laboratorio 3.
Fotosntesis.
Sigue las instrucciones que aparecen en la Gua de prcticas al final del bloque

BLOQUE 4

Describes el metabolismo de los seres vivos

183

Biologa 1

Desarrollo

La vida en el planeta tierra depende del proceso de la fotosntesis que es realiza6o


por los organismos auttrofos fotosintticos. En este proceso las plantas, adems de
aportar el combustible necesario para las dems formas de vida (produccin de glucosa)
exhalan oxgeno a travs de sus estructuras verdes, como las hojas.

NOTA:
Tal vez, cuando pensamos en organismos
fotosintticos, se nos viene rpidamente a la
mente un rbol o el pasto de una pradera.
Sin embargo, pocos nos imaginamos que la
mayor parte de los organismos fotosintticos
se encuentran en el mar y que son algas
microscpicas las que llevan a cabo el 70%
de la fotosntesis del planeta.

La fotosntesis se define como una reaccin qumica el cual es la formacin de alimentos


a partir de la energa luminosa, la cual poseen aquellos organismos foto sintetizadores
que poseen clorofila y este se encuentra dentro de los cloroplastos.

NOTA:
La fotosntesis
proviene de las
races griegas
photo, luz y
sntesis, formacin.

Fotosntesis
Bioqumica de la fotosntesis
Algunas de las reacciones que se llevan a cabo durante el proceso de la fotosntesis son fotoqumicas, es decir,
porque se realizan con la presencia de luz; otras pueden llevarse a cabo en presencia o ausencia de luz. Por esta
razn el proceso fotosinttico se divide en dos fases: luminosa y oscura.

Proceso bsico de la fotosntesis: riegue, el


dixido y la luz de carbono se utilizan para
producir el oxgeno y el azcar.
En este proceso metablico, la energa del sol se convierte en energa qumica mediante
transformaciones fsico-qumicas, de modo que la energa queda contenida en los
nutrimentos que las clulas utilizarn como alimento y del que obtendrn tambin la
materia necesaria para sintetizar nueva materia viva. Para que este proceso se lleve a
cabo adecuadamente, se requiere de todos los reactivos y de su fuente de energa, Esto
es evidente si hemos tenido una planta; sabemos que, aunque le demos agua, sin luz
no va a crecer y viceversa. Observemos que en la fotosntesis se absorbe el dixido de
carbono del aire como lo muestra la siguiente formula.

La fotosntesis se lleva a cabo dentro de los cloroplastos de las clulas de plantas, algas, organismos unicelulares,
o bien, dentro de una bacteria fotosinttica. Los cloroplastos contiene el pigmento llamado clorofila, que capta
y absorbe la luz. En las plantas existen varios pigmentos; la clorofila a y b, los carotenos (que aportan los tonos
amarillos y anaranjados), las xantofilas (que dan colores rojos) y las antocianinas (que proporcionan tonos azules).
Fase luminosa
Durante la fase luminosa podemos encontrarnos con dos etapas; fotosistema II y fotosistema I. La clorofila que
se encuentra en el fotosistema II (PSII) en la membrana del tilacoide captura la energa luminosa proveniente del
sol y la transmite en forma de electrones hacia el agua, con lo que se lleva a cabo el rompimiento de las molculas
del agua.

Formula general de la fotosntesis


6CO2

Dixido de carbono

6 H2O
+

Agua
+ Oxgeno

C6H12O6

Luz y clorofila

6O 2
Glucosa

Las plantas producen alimentos para si mismas y para los dems seres vivos a travs de
la fotosntesis, por lo tanto sin ellas no podramos sobrevivir. Adems, en este proceso
fotosinttico se absorben dixido de carbono, con lo que purifican la atmsfera de los
desechos industriales que producen el ser humano y evitan el calentamiento global,
resultado de los altos niveles de dixido de carbono en la atmsfera.

184

Colegio de Bachilleres del Estado de Sonora

H2O + cloroplasto + fotn

0.5 O2 + 2H+ + 2e-

En este proceso se desprende oxgeno, el cual sale del cloroplasto a la clula y despus a la atmsfera por medio
de los estomas, unas estructuras foliares con pequeos orificios que se especializan en el intercambio de gases
entre la planta y el ambiente.
Por otro lado, los protones H+ que se desprendieron se acumulan en el estroma y los electrones son transportados
hasta el fososistema I (PSI) hasta alcanzar un complejo que transformar el NADP en NADPH. Entonces, estos
protones pasan atraves de la enzima ATP sintetasa hacia el estroma, generando la energa suficiente para agregar
un grupo fosfato a una molcula de ADP y convertirla en ATP.

BLOQUE 4

Describes el metabolismo de los seres vivos

185

Biologa 1

Fases de la fotosntesis

Fase luminosa
Fase oscura
Tambin conocida como la fase biocintica se lleva a cabo en el estroma del cloroplasto y, en la mayora de las
plantas ocurre durante la noche. En este proceso se utilizan el ATP y el NADPH que su obtuvieron durante la fase
luminosa para la fijacin del CO2, mediante el ciclo de Calvin-Benson y la posterior produccin de carbohidratos.
Durante este ciclo se realiza un proceso anablico cuyo principal reactivo es el CO2 en el cual la enzima RuBisCO
(ribulosa 1-5 bifosfato) se encarga de unir los carbonos provistos por el CO2, para formar compuestos ms
complejos como los carbohidratos.
En primera instancia, la RuBisCO origina un compuesto inestable de seis carbonos que se descompone en dos
molculas de cido-3-fosfoglicrico, las cuales son molculas constituidas por tres tomos de carbono, razn por
la que se llama C3 en las plantas que siguen esta va metablica, las cuales comprenden casi el 85% de las plantas
superiores que habitan el planeta.
Este cido-3-fosfoglicrico se reduce a gloceraldehdo-3-fosfato, el cual puede seguir dos alternativas; en una de
ellas se puede regenerar la RuBisCO y en la otra se puede seguir la vida para originar la glucosa y la fructosa. De
esta manera, las Plantas C3 obtienen los carbohidratos necesarios para nutrirse.

Cierre

ACTIVIDAD 2
SD6-B4

Elaboren un mapa conceptual para explicar el proceso de la fotosntesis, sus fases, los reactivos y los productos
de cada una.
Conceptos a evaluar

SI

NO

1. Participacin en la elaboracin y contenido del mapa conceptual


2. El mapa conceptual presenta las caractersticas idneas
3. El mapa conceptual es original
4. El trabajo escrito anexo al mapa presenta correctamente sus ideas

186

Colegio de Bachilleres del Estado de Sonora

BLOQUE 4

Describes el metabolismo de los seres vivos

187

Biologa 1

Inicio

Secuencia didctica 7
RESPIRACIN CELULAR

EVALUACIN DIAGNSTICA A

Responde a las siguientes preguntas para una recuperacin de los saberes previos:
1. Cul es el objetivo de la respiracin celular?
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________
2. De qu tipo de sustancias obtienen su energa los organismos hetertrofos animales?

Desarrollo

Cuando respiramos, llevamos aire a nuestros pulmones, sin embargo este proceso no es til
al organismo hasta que el oxgeno que entra al cuerpo llega a cada una de nuestras clulas;
entonces se inicia la respiracin celular.
Todos los organismos necesitan llevar a cabo procesos de respiracin celular para obtener
la energa que est contenida en enlaces qumicos de los alimentos.
Como recordars, el compuesto que transfiere la energa qumica necesaria para llevar a
cabo todas las actividades de la clula es el ATP, que acta como el pago que se requiere
para iniciar cada actividad del organismo.
Existen dos tipos de respiracin, la aerobia, que se lleva a cabo con la presencia de oxgeno
molecular, y la anaerobia, que se efecta en ausencia de oxgeno. La primera es ms eficiente
que la segunda para la obtencin de energa.
Respiracin aerobia
Lo ms importante de la respiracin aerobia es la produccin de energa que se realiza
en presencia de oxgeno molecular dentro de las mitocondrias de las clulas eucariotas;
esta produccin se efecta a travs de reacciones de xido-reduccin en las que participan
enzimas respiratorias. Este tipo de respiracin se lleva a cabo en las clulas de la mayora
de los seres vivos que utilizan como combustible respiratorio la glucosa, el principal
carbohidrato en los seres vivos.

__________________________________________________________________________________________

La respiracin celular es el proceso


por el cual la energa qumica de las
molculas es liberada y parcialmente
capturada en la forma de Adenosna
Trifosfato (ATP). Los carbohidratos,
grasas y protenas, pueden ser usados
como combustibles en la respiracin
celular, pero la glucosa es el ejemplo
ms comn para examinar las
reacciones y caminos involucrados.

________________________________________________________________________
3. Consideras correcta la ecuacin de la respiracin celular que se anota a continuacin? Por qu si y/o por
qu no?

C6H12O6+ 6O2 6CO2+ 6H2O

__________________________________________________________________________________________
________________________________________________________________________
4. Nombra tres enfermedades causadas por la contaminacin del aire
__________________________________________________________________________________________
__________________________________________________________________________________________

Si partimos de la glucosa como combustible respiratorio, la respiracin aerobia se puede


dividir en tres etapas o procesos: gluclisis, ciclo de Krebs (ciclo del cido ctrico) y la
cadena respiratoria.

__________________________________________________________________________________________

Gluclisis

5. Menciona tres alimentos que se producen mediante el proceso de la fermentacin.

El trmino gluclisis significa romper la glucosa (lisis: romper). Este proceso se realiza en
el citoplasma de la clula. Se inicia cuando la glucosa, molculas de seis carbonos, entra a
travs de la membrana celular. Entonces empiezan a actuar sobre ella diversas enzimas que
la rompen hasta convertirla en dos molculas de tres carbonos, llamadas cido pirvico. El
proceso consiste en 11 reacciones, lo que da como resultado dos molculas de ATP por cada
molcula de glucosa y la liberacin de dos molculas de H+ que se unen al NAD y forman
dos molculas de NADH.

__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

188

Colegio de Bachilleres del Estado de Sonora

BLOQUE 4

Describes el metabolismo de los seres vivos

189

Biologa 1

Imaginemos que el ciclo de Krebs es como un molino en el que los restos de la glucosa se rompen cada vez
ms, hasta dejarlos convertidos en dixido de carbono e hidrgeno. Los hidrgenos son atrapados por molculas
acarreadoras especializadas; el NAD (nicotinamitaadesindinucletido) y el FAD (flavnadenindinucletido). As,
en esta etapa, por los dos piruvatos, se obtienen cuatro molculas de CO2, dos de ATP y, lo ms importante, ocho
molculas de NADH y dos de FADH.
Cadena de transferencia de electrones
La etapa de la cadena de transporte de electrones es la ms provechosa porque en ella se utilizan los electrones
que traen las molculas acarreadoras para la obtencin de ATP. Recordemos cuantas veces se han formado en todo
el proceso:

Fase de la gluclisis.
Ciclo de Krebs
Esta etapa se lleva a cabo en la mitocondria. El piruvato que se ha formado en la fase anterior entra a la matriz
mitocondrial y libera una molcula de CO2. Una coenzima se enlaza con el fragmento de dos carbonos y se
transforma en acetil coenzima A. En este paso se produce una molcula de NADH por cada piruvato.
Se inician varias reacciones que en conjunto se conocen como ciclo de Krebs, en honor a su descubridor, Hans
Krebs (1900-1981), quien las describi en 1930, tambin conoca esta fase como el ciclo del cido ctrico.

2 NADH en la gluclisis

8 NADH en el ciclo de Krebs

2 FADH en el ciclo de Krebs

Este proceso se lleva a cabo en la membrana de las crestas de las mitocondriales y consiste en el bombeo de
iones hidrgeno de un lado a otro de esta membrana, a travs de una serie de molculas aceptores. Se obtienen 32
molculas de ATP, una enorme cosecha de energa.
El ltimo aceptor de iones hidrgeno es el oxgeno, as que el ltimo producto que se forma en este proceso es
el agua (H2O). Si la clula deja de recibir oxgeno, la cadena de transporte de electrones se detiene, y se deja de
producir ATP. Asimismo se detiene el ciclo de Krebs, que es un proceso acoplado a sta.
La eficiencia del proceso respiratorio para la obtencin de energa de una molcula de glucosa es bastante alta si
la comparamos con la eficiencia de las mquinas que el ser humano ha diseado. Por cada molcula de glucosa se
obtienen 36 molculas de ATP, de las cuales dos se producen en la gluclisis, dos en el ciclo de Krebs y 32 en la
fase final, el transporte de electrones.

Esquema de cmo se lleva a cabo el


proceso de transporte de electrones a
travs de la membrana celular.

190

Colegio de Bachilleres del Estado de Sonora

BLOQUE 4

Describes el metabolismo de los seres vivos

191

Biologa 1

Cierre

ACTIVIDAD 1
SD7-B4

Completa la Siguiente Tabla sobre el proceso de respiracin el cual se divide en tres etapas.
Etapa de la respiracin

Se realiza en:

Ciclo de Krebs

ATP que produce

Se realiza en presencia
de oxgeno?

SI

Membrana plasmtica
(procariontes) y membrana
interna mitocondrial
(eucariontes).

ACTIVIDAD 1
SD7-B4

Relaciona los conceptos de ambas columnas y produce oraciones y las anotas en tu cuaderno.
a) Fija CO2

b) La grama est formada por ascos conocidos ( ) El ATP


como:
c) Se encarga de la respiracin celular
d) El ATP
e) La molcula d glucosa es una azcar:
f) El ciclo de Krebs
g) Se forma por una azcar, una base prica
y fosfatos.
h) Aceleran reacciones
i) Clorofilas, xantofilas y carotenos
j) El cloroplasto

Respiracin anaerobia
El trmino de respiracin anaerobia se utiliza para referirse a los organismos que utilizan molculas distintas
del O2 para obtener energa. Este tipo de respiracin tambin se conoce como gluclisis. Se considera que es un
proceso ms antiguo que la respiracin aerobia, ya que la atmsfera de la tierra primitiva contena poco oxgeno.
Esta respiracin no es exclusiva de las bacterias denominadas anaerobias, pues se trata de un proceso comn en
todas las clulas, incluso en las de los organismos homeotermos. Este proceso ocurre en el citoplasma celular.
Durante la respiracin anaerobia o la gluclisis, las molculas de glucosa (6 carbonos) son degradadas en dos
molculas de piruvato (3 carbonos), que es el principal objetivo de este proceso. Una vez que se ha formado el
piruvato, ste puede seguir tres rutas metablicas:

Unin de la respiracin aerobia y respiracin


anaerobia dentro de los procesos bioqumicos.

El piruvato se transforma en etanol mediante la


fermentacin alcohlica. Este proceso es realizado por
bacterias y hongos.

La segunda ruta consiste en transformar el piruvato en


cido lctico. Esta va ocurre en organismos superiores
que viven en bajas concentraciones de oxgeno, como los
parsitos intestinales, aunque tambin ocurre en clulas
musculares cuando se consumen en cantidades adecuadas
de oxgeno durante el ejercicio.

La tercera ruta ocurre cuando el piruvato se convierte


en acetil-coenzima-A en cuyo caso se contina con la
respiracin aerobia.

La respiracin anaerobia produce un rendimiento energtico menor que la respiracin aerobia La produccin de
energa qumica en ausencia de oxgeno es de slo 2 ATP por molcula de glucosa en comparacin con las 38
molculas de ATP que se pueden producir durante la respiracin aerobia.
192

Colegio de Bachilleres del Estado de Sonora

( ) Tambin es conocido como el ciclo de los cidos


tricarboxlicos

Inicio

(
(
(
(
(

)
)
)
)
)

Es un Organelo de organismos auttrofos


Captan la luz solar
La mitocondria
Hexosa
Tilacoides

( ) Es considerado la moneda energtica


( ) Los catalizadores enzimticos
( ) RuBisCO

Secuencia didctica 8
FERMENTACIN

Qu tienen en comn el pan, el vino y la cerveza en su proceso de produccin? Contina con la lectura para que
encuentres la respuesta.
La respiracin anaerbica no utiliza el oxgeno y se conoce tambin como fermentacin. Algunas bacterias y
hongos producen fermentos para obtener su ATP. En este tipo de respiracin se usa la glucosa y otros compuestos
orgnicos, que son los aceptadores finales de electrones. Existen dos tipos de fermentacin:

Fermentacin alcohlica Se lleva a cabo por medio de los hongos, como son las levaduras. Sus clulas
utilizan el azcar de la uva para obtener dos ATP. Tambin se usan para elaborar pan y cerveza. Las levaduras
hacen que la masa del pan crezca y est lista para hornearse. Son muy tiles en la industria alimenticia y
vitivincola

BLOQUE 4

Describes el metabolismo de los seres vivos

193

Biologa 1

Frmula general de la fermentacin

Alcohlica

Reactivos

Productos

C6H12O6

2 CO2 + 2 C2H5OH + 2 ATP

Glucosa

Dixido de carbono mas alcohol mas 2 ATP

Fermentacin lctica: Se sigue exactamente el mismo proceso que la fermentacin alcohlica aunque el
producto final es distinto; cido lctico.
Frmula general de la fermentacin

Desarrollo

Nutricin auttrofa: Quimiosntesis-fotosntesis


Todos los seres vivos de este planeta, como hemos visto, gastan energa en el desarrollo de
sus actividades cotidianas, y para recuperar la energa gastada deben obtener nutrimentos.
Las formas de nutricin varan de unos organismos a otros. As, ya hemos visto que existen
organismos auttrofos y hetertrofos.
Los organismos auttrofos pueden producir sus alimentos a partir de fuentes de carbono
como el CO2 y de la aportacin de alguna fuente de energa; los quimiosintticos obtienen
su energa a prtir de la oxidacin de sustancias inorgnicas como el sulfuro de hidrgeno o
algunos nitritos, mientras que los fotosintticos obtienen su energa del sol.

Lctica

Reactivos

Productos

C6H12O6

2 CH3CHOHCOOH + 2 ATP

Glucosa

Acido lctico + 2 ATP

La fabricacin de pan y productos alcohlicos son los mejores ejemplos para describir los productos que se forman
a partir de una fermentacin alcohlica. En este estos casos, se utiliza la levadura, un organismo unicelular llamado
Sacharomyces, este fermenta y durante el proceso se liberan, en forma de gas, dixido de carbono y alcohol.

La Fotosntesis es la
transformacin de las
sustancias inorgnicas
en sustancias orgnicas
utilizando la luz solar.
Ejemplo de nutricin
auttrofa.

Las cepas de levadura ms empleadas en la fabricacin


del vino, cerveza y pan, son las correspondientes a la
especie Saccharomyces cerevisiae. Esta levadura sigue
un metabolismo fermentativo cuando est en condiciones
anaerobias, pero cuando hay oxgeno hace una respiracin
aerobia y no produce alcohol.
La fermentacin lctica es ampliamente utilizado en la industria
alimentaria, ya que da como resultados productos como yogur, leche
y quesos a partir de bacterias que pueden lograr esta fermentacin;
los lactobacilos. Adems este tipo de fermentacin tambin se lleva
a cabo de manera natural en nuestros msculos. Cuando realizamos
una actividad fsica e intensa como correr a gran velocidad a una corta
distancia, no damos tiempo las clulas de procesar toda la glucosa por
medio de la respiracin para obtener ATP, entonces algunas molculas
de piruvato se acumulan y se transforman en cido lcticos.

Nutricin hetertrofa
Los organismos que no producen sus propios alimentos y necesitan
una fuente ya elaborada de alimentos se conocen como hetertrofos,
los cuales son consumidores de los alimentos que elaboran los
productores. A este grupo pertenecen los hongos, los animales,
muchos tipo de bacterias y protozoarios. La forma en que cada
organismo obtiene sus alimentos puede variar, por eso se clasifican
de la siguiente manera:

La fermentacin lctica, convierte la lactosa presente en la leche en


cido lctico. Esta transformacin permite la precipitacin de las
protenas presentes y por ende la formacin de la cuajada.
194

Colegio de Bachilleres del Estado de Sonora

BLOQUE 4

Describes el metabolismo de los seres vivos

195

Biologa 1

Holozoica

Parsita

El organismo ingiere sus alimentos en forma slida y posteriormente los digiere para obtener los nutrientes que
contienen. Esta nutricin es caracterstica de los animales, en cada uno de ellos se han desarrollado adaptaciones
de acuerdo con la disponibilidad del alimento. As, por ejemplo, algunos son herbvoros por consumir plantas,
otros son carnvoros y tienen dientes afilados para desgarrar a sus presas, otros comen una variedad de ambos y
se les dice como omnvoros.

En este caso, el organismo vive sobre o dentro de otro organismo, al cual perjudica y del que obtiene sus nutrientes
por ingestin o por absorcin. Esto se puede llevar a cabo cuando el parasito obtiene sus nutrientes a partir de los
lquidos o tejidos del hospedero.
Algunos parsitos viven sobre el organismo como las garrapatas, los piojos y las
pulgas, a estos se les conoce como ectoparsitos. Otros, llamados endoparsitos,
viven dentro de nuestro organismo que afectan al husped, como por ejemplo las
amibas, las lombrices intestinales y las bacterias.
Tambin existen parsitos de plantas y estos pueden ser otras plantas o bien
animales que se encuentren dentro o fuera de ellas. Un ejemplo son los nematodos,
que son pequeos gusanos cilndricos que llegan a causar importantes prdidas
en los cultivos que parasitan. En su mayora, estos gusanos se ubican en el suelo,
en la raz de las plantas, que es donde absorben su alimento. Estos lgicamente
causan marchitamiento o daos diversos en los cultivos.

Los leones son ejemplos de llevar una alimentacin


holozoica, ya que estos animales son carnvoros,
es decir, son animales que obtienen energa y sus
requerimientos nutricionales de otros animales.

De manera resumida, en la nutricin hetertrofa se incluyen cuatro procesos


bsicos:
Obtencin de los nutrientes a partir de los alimentos.
Obtencin del oxgeno del aire y eliminacin del dixido de carbono.
Distribucin de los nutrientes a las clulas.
Eliminacin de las sustancias de desecho.

Saprofita
El organismo absorbe los nutrientes del medio y los descompone por medio de enzimas para obtener la energa
que necesita. Los hongos, las levaduras, los mohos y casi todas las bacterias se nutren de esta manera. Estos
organismos cumplen una funcin muy importante en el medio ambiente al reciclar la materia orgnica de plantas
y animales muertos.
Por ejemplo, en un tronco cado podemos observar cmo se desarrollan hongos que poco a poco van descomponiendo
la madera y reincorporan al suelo, o tambin, cuando un alimento se descompone, es porque las bacterias que hay
en el aire llegan a nutrirse de ste y liberan algunos productos de desecho que causan el olor caracterstico que
hace que ese alimento ya no sea apetecible.

Cierre

ACTIVIDAD 1
SD8-B4

1. Identifica las etapas de la respiracin celular aerobia y anaerobia y redacta un texto breve, donde expliques el
proceso de fermentacin.
2. En equipo, con la informacin cotejada y organizada, elaboren un diagrama de flujo que describa los pasos de
la respiracin y la fermentacin. Presenten el diagrama en una plenaria.
La alimentacin saprofita se
basa en restos de animales o
vegetales en descomposicin,
por ejemplo los hongos.

196

Colegio de Bachilleres del Estado de Sonora

Conceptos a evaluar
El diagrama de flujo es claro y presenta los datos correctos
Caractersticas formales del diagrama de flujo
Demostr habilidades para exponer ante el grupo las caractersticas de los procesos de la
respiracin celular y la fermentacin
Mostr participacin y tolerancia ante mis compaeros

BLOQUE 4

Describes el metabolismo de los seres vivos

NO

197

Biologa 1

2. Cul es la relacin del ATP con las reacciones endotrmicas?

PRCTICA DE LABORATORIO 1

__________________________________________________________________________________________
__________________________________________________________________________________________

Construccin de una molcula de ATP en forma estreo.

__________________________________________________________________________________________

Marco terico.

__________________________________________________________________________________________

El ATP es una molcula formada por adenina, ribosa y tres grupos fosfatos. El ATP es una fuente energtica
necesaria para todos los trabajos de tipo biolgico, como la contraccin muscular, la digestin, la transmisin
nerviosa, la secrecin de las glndulas, la fabricacin de nuevos tejidos, la circulacin de la sangre, etc.

________________________________________________________________________
3. Menciona 10 actividades que realices en las que apliques gastos de ATP

Propsito de la prctica

__________________________________________________________________________________________

Familiarizarse con la molcula de ATP principalmente, observar su forma en estreo y practicar los ngulos de los
enlaces. Esto le servir para la construccin de biomolculas ms complejas posteriormente.

__________________________________________________________________________________________

Equipo

Material

Cmara fotogrfica y/o celular.

Palillos
Esferas de unicel
Colores para cartel negro,
azul, rojo y naranja

Procedimiento
1. Pintar de negro las 10 esferas que sern los carbonos.
2. Pintar de rojo las 13 esferas que sern los oxgenos
3. Pintar de azul las 4 esferas que sern los nitrgenos
4. Pintar de naranja las 3 esferas que sern los fsforos
5. Quedan en blanco las 12 esferas que sern los hidrgenos
Para insertar los palillos en las esferas hay que tener en cuenta lo siguiente:

__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

PRCTICA DE LABORATORIO 2
Actividad enzimtica
Marco terico.
Las enzimas son protenas cuya funcin es regular la velocidad de las reacciones qumicas que se llevan a cabo en
las clulas. Cuando comemos los alimentos se degradan a sustancias ms sencillas para que puedan ser absorbidos
por el organismo. Un trozo de pescado al digerirse se transformar en aminocidos, as como, un pedazo de pan
se convertir en glucosa debido a la accin enzimtica.

Cuando los cuatro enlaces del carbono son simples los ngulos de enlace son de 109
Cuando hay un enlace doble son de 120
Cuando hay un enlace triple son de 180

Propsito de la prctica

Nota: No olvides tomar una foto al trabajo terminado para que lo anexes en tu informe.

Equipo
Tubos de ensaye o frascos de vidrio pequeos.

Cuestionario
1. Cmo se desprende la energa de la molcula del ATP?
__________________________________________________________________________________________
__________________________________________________________________________________________

OJO: No hay un propsito de la prctica

Material
Papel secante
Hgado crudo y cosido
Carne cruda y cocida
Manzana, papa y pltano

__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
198

Colegio de Bachilleres del Estado de Sonora

Reactivos
Perxido de hidrgeno (agua oxigenada).

BLOQUE 4

Describes el metabolismo de los seres vivos

199

Biologa 1

Procedimiento
1. Coloca las muestras sobre el papel secante para que se absorba el exceso de humedad e
identifica las muestras.
2. Coloca en dos tubos perxido de hidrgeno y agrega hgado cocido a uno e hgado crudo al
otro,
3. Observa que ocurre en cada uno de los tubos y anota tus observaciones.
4. Lava los tubos y repite la operacin para cada muestra.
Anota en la siguiente tabla tus observaciones de acuerdo con la actividad enzimtica de cada muestra, iluminando
el rengln en donde se haya localizado la muestra con mayor actividad
MUESTRA
Hgado crudo
Hgado hervido
Carne cruda
Carne hervida
Pltano
Manzana
Papa

OBSERVACIONES

GRADO DE ACTIVIDAD

PRCTICA DE LABORATORIO 3
Identificacin de cloroplastos
Marco terico.
Los cloroplastos generalmente contienen tres pigmentos: clorofila, de color verde; xantofila, de color amarillo; y
carotenos de color rojizo. La cromatografa en papel es una tcnica muy til en la separacin e identificacin de
los pigmentos de los vegetales
Propsito de la prctica
Bsicamente, que identifiques clorofila y xantofila.
Equipo
Embudo
Mortero
Tijeras
Vaso de precipitado de 500 ml
Engrapadora

Cuestionario
1. Explica: Porque reaccionan as los tejidos en presencia del perxido de hidrgeno?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
______________________________________________________________________
2. Investiga: Porque cuando se agrega agua oxigenada a una herida se forman burbujas?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
______________________________________________________________________
3. Menciona alguna de las funciones de las enzimas.
__________________________________________________________________________________________

Material
Espinacas o acelgas
Flores de distintos colores
Papel filtro
Papel secante
Reactivos
Acetona
Procedimiento:
1. Lo primero es cortar un puado de hojas de espinacas y colocarlos dentro del mortero.
2. Coloca un poco de acetona y macera hasta obtener el jugo que contienen.
3. Utiliza el embudo y le colocas el papel filtro y vuelca el contenido del mortero en el vaso de
precipitado, pasando por el filtro.
4. Ahora debes cortar una tira de papel secante de unos 5 centmetros de ancho. Enrolla uno de
los extremos en el lpiz y lo engrampas o lo pegas con cinta adhesiva.
5. Para terminar, coloca el papel dentro del vaso, de modo que su extremo se sumerja medio
centmetro aproximadamente dentro del lquido. Espera entre 20 y 30 minutos, quita el papel
del vaso, y espera que se seque.

__________________________________________________________________________________________
__________________________________________________________________________________________
______________________________________________________________________

200

Colegio de Bachilleres del Estado de Sonora

BLOQUE 4

Describes el metabolismo de los seres vivos

201

Biologa 1

Realiza un reporte con tus observaciones del resultado de la prctica, anexando las respuestas del siguiente
cuestionario:

RBRICA DE EVALUACIN DE ACTIVIDAD INTEGRADORA

1. Qu es cromatografa y cules son sus usos?


__________________________________________________________________________________________
__________________________________________________________________________________________

Aspectos a
evaluar

El trabajo en s, no es una
respuesta clara a la pregunta
realizada.

__________________________________________________________________________________________
________________________________________________________________________
2. En qu parte de la actividad se presenta el fenmeno de capilaridad y en qu consiste?

Niveles de desempeo
Resolutivo
(8)

Receptivo
(6-7)

Informacin
obtenida

__________________________________________________________________________________________
__________________________________________________________________________________________

Falta alguno de los pasos


importantes en el trabajo,
ya sea la Introduccin,
el Desarrollo o las
Conclusiones.
No informa sobre las
fuentes consultadas

__________________________________________________________________________________________

Presenta aspectos bsicos


pero no es completamente
satisfactoria la respuesta a
la pregunta planteada.
Contiene los pasos
fundamentales el informe
pero no todos los sustentos
no son confiables o
actuales.

Autnomo
(9-10)

Suma
Parcial

El trabajo es una respuesta


clara a la pregunta
planteada.
Contiene los pasos
fundamentales:
Introduccin, Desarrollo y
conclusiones, sustentados
en bases cientficas.
Las fuentes utilizadas son
confiables y vigentes.

________________________________________________________________________
3. En qu consiste el proceso e cromatografa en papel?
__________________________________________________________________________________________

Presentacin

__________________________________________________________________________________________
__________________________________________________________________________________________

No elige grficos: tablas,


imgenes y video. Se
dificulta la lectura por
elegir mal el tipo de letra
y las imgenes no tienen
claridad

Los grficos son


congruentes con el tema
pero o son pocos o estn
en exceso. Hay dificultades
en la lectura por el tipo de
software utilizado
Algunas de las imgenes no
fueron pertinentes.

La eleccin de los grficos


es muy atinada, son
pertinentes y ayuda a
explicar mejor el tema.
Magnfica eleccin del
software y las imgenes
se presentan con excelente
nitidez.

Los integrantes del equipo


a veces trabajaron en forma
equitativa.

Los integrantes del equipo


trabajaron en forma
equitativa.

En ocasiones hubo
ausencia de participacin
por algunos de los
integrantes.

Todos los integrantes del


equipo trabajaron en todas y
cada una de las tareas.

________________________________________________________________________
Los integrantes del equipo
no trabajaron en forma
equitativa.

Trabajo
colaborativo

Hubo ausencia de
participacin por algunos
de los integrantes.
Siempre se suscitaron
conflictos durante la
elaboracin del trabajo y en
la presentacin del mismo,
necesitndose la vigilancia
cercana del docente.

En ocasiones, se suscitaron
conflictos durante la
elaboracin del trabajo y en
la presentacin del mismo,
necesitndose la vigilancia
cercana del docente.

Si se present alguna
observacin por alguno de
los integrantes del equipo
se tom siempre en forma
positiva, estando todo el
equipo conforme con el
informe entregado.

Suma Total
Calificacin del Proyecto

202

Colegio de Bachilleres del Estado de Sonora

BLOQUE 4

Describes el metabolismo de los seres vivos

203

Biologa 1

PORTAFOLIO DE EVIDENCIAS

REACTIVOS DE CIERRE

Organizador para el portafolio de evidencias

1. Cul de los siguientes enunciados, acerca de las reacciones catalizadas por enzimas, NO es cierto?
A. Las enzimas forman complejos con sus sustratos.
B. Las enzimas rebajan la energa de activacin de las reacciones qumicas.
C. Las enzimas cambian la K de equilibrio de las reacciones qumicas.
D. Muchas enzimas cambian de forma ligeramente cuando se unen al sustrato.
E. Las reacciones ocurren en el centro activo de las enzimas donde una orientacin espacial precisa de los
amino para la catlisiscidos es una cuestin muy importante.

Biologa 1
Bloque 4
Describes el metabolismo de los seres vivos
Nombre del alumno:
Marca con una X el desempeo y realizacin de las actividades de aprendizaje
SECUENCIA
DIDCTICA

Caractersticas de las evidencias


No.

1
2
3
4
5
6
7
8
9
10
11
12

Actividad de aprendizaje

Puntualidad

Mapa conceptual sobre los


distintos tipos de energa
Mapa mental sobre
reacciones endotrmicas y
exotrmicas en seres vivos.
Practica de lab.
Construccin de la molcula
de ATP
Cartel con el ciclo del ATP
Prctica de Lab Accin
enzimtica
Elaboracin de mapa
conceptual sobre el
metabolismo
Tabla sobre las
caractersticas de las
bacterias quimiosintticas
Prctica de lab
Identificacin de clorofila y
xantofila
Mapa conceptual sobre el
proceso de la fotosntesis
Tabla sobre el proceso de la
respiracin celular
Tabla para relacionar
conceptos de la respiracin
celular
Diagrama de flujo de
la respiracin celular y
fermentacin

Firma del docente

204

Colegio de Bachilleres del Estado de Sonora

Coherencia
y claridad

Limpieza

Se desarrollaron los
atributos indicados
Mal

Regular

Bien

2. Para sobrepasar la barrera energtica que existe entre los reactivos y productos se debe de proveer a la reaccin
en el inicio de la misma de la energa necesaria. A esta energa que se recupera en el transcurso de la reaccin se
le llama:
B. Energa de iniciacin
C. Energa de reaccin
A. Energa de activacin
E. Energa cintica
D. Energa Potencial
3. Qu prrafo describe mejor, la funcin del retculo endoplasmtico rugoso?
A. Sistemas especficos de seales y transportes.
B. Sntesis y ensambles de protenas de membrana y de serecin.
C. Produccin de energa durante la fotosntesis.
D. Procesamiento de protenas de membranas y de secrecin, incluyendo glucosilacin.
4. El siguiente Organelo se encuentra en clulas procariotas pero no en clulas eucariotas de origen animal.
A Mitocondria.
B. Cloroplastos.
C. Ncleo.
D. Pared celular.
5. Mitocondria y cloroplastos, ambos:
A. Su funcin es de proveer de energa a la clula.
B. Estn presentes en las plantas.
C. Contienen ADN.
D. Todo lo anterior.
6. Una muestra de clulas se coloca en una solucin salina. Las clulas se encogen y la membrana se distorsiona.
En relacin a la clula probablemente la solucin es:
A. Isotnica.
B. Hipotnica.
C. Osmtica.
D. Hipertnica.
7. En la membrana celular, el transporte por difusin simple se puede distinguir del proceso por difusin facilitada
porque:
A. La difusin simple no requiere energa: la difusin facilitada requiere una fuente de ATP
B. La difusin simple solo mueve material en la direccin del gradiente de concentracin
C. difusin simple no puede ser saturable, la rapidez de la difusin facilitada se limita al nmero de
membranas funcionales proteicas y puede saturarse
D. La difusin simple se presenta solo en clulas procariotas, mientras que la difusin facilitada se presenta
solo en clulas eucariotas.

BLOQUE 4

Describes el metabolismo de los seres vivos

205

8. La tasa de transporte de una sustancia en una clula se reduce drsticamente cuando la formacin de ATP es
bloqueado. El sistema de transporte debe de ser una forma de:
A. Transporte activo.
B. Difusin simple.
C. Difusin facilitada.
D. Ambos el transporte activo y la difusin facilitada.
E. Ambas, la difusin simple y la facilitada.
9. El cruce en una membrana por difusin simple se puede distinguir de la difusin facilitada porque:
A. La difusin simple no requiere de energa: la difusin facilitada requiere una fuente de ATP.
B. La difusin simple slo puede mover el material en la direccin de un gradiente de concentracin;
difusin facilitada mueve materiales con y en contra de un gradiente de concentracin.
C. La difusin simple no es saturable; las tasas de difusin facilitada estn limitadas por el nmero
de protenas de membrana funcionales y pueden ser saturados.
D. Difusin simple se encuentra slo en los procariotas, mientras que la difusin facilitada slo se
encuentra en las clulas eucariotas.
10. Los componentes de la membrana celular se sintetizan en el retculo endoplsmico, transportndose como
vesculas al aparato de Golgi donde se modifican, y luego son transportados a la superficie celular donde entregan
sus contenidos a las clulas exteriores y se convierten en una parte de la membrana celular en un proceso llamado
____________. En la inversa de este proceso, se traen nutrientes y partculas del exterior hacia el interior de la
clula, el proceso se denomina _________.
A. Exocitosis; Endocitosis.
B. Transporte activo; Transporte pasivo.
C. Difusin simple; La difusin facilitada.
D. Osmosis; difusin.
11. Cuando la clorofila, que se encuentra asociada a las protenas embebidas en la membrana tilacoidea absorbe
la luz:
A. La energa se absorbe y se conserva para un uso futuro
B. La energa que la golpea excita a un electrn a un nivel superior
C. La energa se emite como una de longitud de onda ms baja
D. La energa se disipa como calor.
12. En la etapa luminosa la energa se convierte en:
A. ADP y NADP
B. Lpidos
C. Azcar
D. ATP y NADPH
13. En la fase luminosa el agua se descompone a la atmsfera liberando:
A. Hidrgeno
B. Oxgeno
C. Ningn producto ya que la molcula se utiliza en proceso de biosntesis
D. Perxido de hidrgeno

206

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla


Desempeo del estudiante
al finalizar el bloque
Reconoce la biodiversidad a partir de su

clasificacin y caractersticas distintivas de


los organismos.
Valora la importancia social, econmica y
biolgica de la biodiversidad e identifica
acciones que lo lleven a preservar las especies
de su entorno.

Objetos de aprendizaje
Virus:

Composicin qumica.
Forma de replicacin.
Criterios para clasificarlos.
Ejemplos de enfermedades que
ocasionan.
Clasificacin de los seres vivos.
Linneo
Wittaker
Woese
Dominio archaea:
Caractersticas generales
Dominio eubacteria:
Estructura.
Reproduccin
Respiracin.
Nutricin.
Formas: cocos, bacilos, entre otros.

Tiempo asignado: 12 horas

Dominio Eukaria:

Tipo celular.
Forma de nutricin.
Niveles de organizacin (unicelulares o
pluricelulares).
Medio en que viven.
Clasificacin.

Competencias a desarrollar
Elige

las fuentes de informacin ms


relevantes para establecer la interrelacin
entre la ciencia, la tecnologa, la sociedad y
el ambiente e contextos hidtricos y sociales
especficos.
Fundamenta opiniones sobre los impactos de
la ciencia y la tecnologa en su vida cotidiana,
asumiendo consideraciones ticas de sus
comportamientos y decisiones.
De manera general o colaborativa, identifica
problemas, formula preguntas de carcter
cientfico y plantea las hiptesis necesarias
para responderlas.
Utiliza las tecnologas de la informacin y
la comunicacin para obtener, registrar y
sistematizar informacin para responder a
preguntas de carcter cientfico, consultando
fuentes
relevantes
y/o
realizando

experimentos pertinentes.

Contrasta los resultados obtenidos en una

investigacin o experimento con hiptesis


previas y comunica sus conclusiones
aportando puntos de vista con apertura
y considerando los de otras personas de
manera reflexiva.
Trabajando en equipo, disea modelos
o protoripos para resolver problemas,
satisfacer necesidades o demostrar principios
cientficos relativos a las ciencias biolgicas.
Analiza las leyes generales que rigen el
funcionamiento del medio fsico y valora
las acciones humanas de riesgo e impacto
ambiental, advirtiendo que los fenmenos
que se desarrollan en los mbitos local,
nacional e internacional ocurren dentro de
un contexto global interdependiente.
Decide sobre el cuidado de su salud a partir
del conocimiento de su cuerpo, sus procesos
vitales y el entorno al que pertenece.
Relaciona los niveles de organizacin
qumica, biolgica, fsica y ecolgica de los
sistemas vivos.
Aplica normas de seguridad en el manejo
de sustancias, instrumentos y equipo en
la realizacin de actividades de su vida
cotidiana enfrentando las dificultades que
se le presentan, siendo consciente de sus
valores, fortalezas y debilidades.

Biologa 1

9. Anota tres aspectos de la utilidad de las plantas en nuestra vida cotidiana.

EVALUACIN DIAGNSTICA

__________________________________________________________________________________________
________________________________________________________________________
10. Cmo se llama la rama de la Biologa que se encarga de clasificar a los seres vivos?

La siguiente actividad tiene el propsito de que identifiques los conocimientos que posees antes de iniciar el
presente bloque. Contesta de forma individual y, posteriormente, participa en la dinmica grupal que desarrollar
tu maestro.

__________________________________________________________________________________________
________________________________________________________________________

1. Qu entiendes por biodiversidad?


__________________________________________________________________________________________
________________________________________________________________________

Inicio

Secuencia didctica 1
VIRUS

2. Por qu crees que es importante conservar la biodiversidad?


__________________________________________________________________________________________
________________________________________________________________________
3. Menciona tres especies en peligro de extincin en tu localidad.
__________________________________________________________________________________________
________________________________________________________________________
4. Anota dos semejanzas y dos diferencias entre un virus y una bacteria.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
5. Anota las ramas de la Biologa que estudian a las bacterias, hongos y virus.
__________________________________________________________________________________________
________________________________________________________________________
6. Por qu se dice que los virus no son seres vivos?
__________________________________________________________________________________________
________________________________________________________________________
7. Anota tres hbitos de higiene que te pueden proteger del contagio de enfermedades causadas por virus o
bacterias.
__________________________________________________________________________________________
________________________________________________________________________

ACTIVIDAD 1
SD1-B5

De forma individual responde los siguientes cuestionamientos.


1. Define con tus propias palabras el trmino virus.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
2. Por qu se dice que los virus son agentes patgenos?
__________________________________________________________________________________________
________________________________________________________________________
3. Menciona dos componentes qumicos que forman parte de la estructura qumica de los virus.
__________________________________________________________________________________________
________________________________________________________________________
4. Qu relacin existe entre los conceptos virus y vacuna?
__________________________________________________________________________________________
________________________________________________________________________
5. Anota tres enfermedades causadas por virus, que se hayan presentado en tu localidad.

8. Qu importancia tienen los hongos desde el punto de vista medicinal y ecolgico?

__________________________________________________________________________________________

__________________________________________________________________________________________

________________________________________________________________________

________________________________________________________________________
208

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

209

Biologa 1

Composicin qumica.
El trmino virus, en latn significa veneno y fue propuesto por Louis Pasteur en 1884. Los virus fueron
observados por vez primera en el siglo XX, con la invencin del microscopio electrnico; pero no fue hasta 1935
cuando Wendell Stanley y su equipo de colaboradores aislaron por vez primera a un virus que causa la enfermedad
en plantas, conocida como mosaico del tabaco.
Los virus son agentes infecciosos, que se caracterizan por la capacidad de cristalizarse y permanecer en ese estado
indefinidamente; no obstante, en contacto con agua u otros lquidos se activan y atacan a clulas.
Actualmente, se les ha dado gran relevancia debido a las enfermedades que provocan y por su reciente uso en los
procesos de ingeniera gentica, ya que se utilizan para donar e introducir genes provechosos dentro de plantas y
animales.

sobresalen de la cpside. Un ejemplo lo constituyen los adenovirus, entre los que se encuentran los virus de los
resfriados y faringitis.
c) Complejos. Su estructura resulta de combinar las estructuras anteriores. Por ejemplo los bacterifagos (virus
que parasitan bacterias) constan de una cabeza icosadrica con el cido nucleco, una cola helicoidal que por
medio de un cuello se une a una placa basal con espinas basales y fibras caudales por las que se fija a la bacteria.
d) Virus con envoltura. La envoltura de un virus es una membrana constituida por una doble capa lipdica asociada
a glicoprotenas que pueden proyectarse en forma de espculas desde la superficie de la partcula viral hacia el
exterior.
A continuacin se presentan dos esquemas en los que se puede observar, en primer lugar (A), las formas de los
virus antes mencionados y en segundo lugar (B), los elementos que constituyen a dichos virus.

Los virus forman parte de la diversidad presente en nuestro planeta, pero no se consideran seres vivos por carecer
de membranas, de ribosomas sobre los cuales elaborar protenas, de citoplasma y de fuente de energa. No
presentan movimiento y se reproducen a travs de una clula.
El dimetro de estos agentes patgenos es de aproximadamente 0.05 a 0.2 micrmetros y qumicamente estn
constituidos por cidos nucleicos, enzimas, cpsides y en algunos casos envolturas membranosas externas.
En la siguiente tabla se describen cada uno de estos componentes.
cidos nucleicos

Enzimas

Cpsides

Envolturas membranosas

Representa entre el 1-2%


de la estructura del virus,
es de un solo tipo, ADN
o ARN, pudiendo ambos
ser monocatenarios
o bicatenarios, segn
estn formados por una
o dos cadenas. Lo ms
frecuente es que forme una
sola cadena, que puede
estar abierta o cerrada
(circular), pero tambin
hay cidos nucleicos
fragmentados.

Se encuentran
escasamente y,
especficamente las
utiliza para entrar
o salir de la clula
parasitada (lisozima
y neuraminidasa)
o para replicar o
transcribir su cido
nucleco (polimerasas y
transcriptasas).

Es la cubierta proteica
que protege al cido
nucleco. Es una
estructura simtrica
formada por la
repeticin de una
reducida variedad de
protenas globulares
conocidas como
capsmeros.

En los virus envueltos


la nucleocpsida (cido
nucleco ms cpside)
est cubierta por una
membrana, que es un
fragmento de la clula
en la que se reprodujo
el virus, de la que
pueden surgir protenas
o espculas. Los virus
desnudos carecen de estas
membranas.

A
1 y 2.Virus icosadricos, 3. Virus complejos, 4. Virus helicoidales o cilndricos,
1. Virus con envoltura membranosa

En la naturaleza se puede encontrar una gran diversidad de virus, los cuales presentan diferentes formas. A partir
de la forma que presentan, los virus reciben diferentes denominaciones, stas pueden ser:
a) Helicoidales o cilndricos. Sus cpsomeros, dispuestos helicoidalmente, forman una especie de cilindro, en
cuyo interior se aloja el cido nucleico. Ejemplo el virus del mosaico del tabaco.
b) Icosadricos. Los cpsomeros, que suelen ser de varios tipos, se ajustan formando un icosaedro regular (es
decir, 20 caras triangulares y 12 vrtices), y dejando un hueco central donde se sita el cido nucleico fuertemente
apelotonado. Algunos forman poliedros con ms caras que el icosaedro, y algunos presentan fibras proteicas que
210

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

211

Biologa 1

2. Qu tan grave es el problema del virus crvico-uterino en Mxico? Exprsalo en trminos del nmero de
casos.

ACTIVIDAD 2

__________________________________________________________________________________________

SD1-B5

De manera individual y con mucha atencin, lee siguiente texto.


El virus del papiloma humano
El virus del papiloma humano (VPH) es un virus comn que afecta tanto a hombres como mujeres. Existen
ms de cien diferentes tipos de VPH, la mayora los cuales no causan ningn signo o sntoma y desaparecen sin
tratamiento.
Sin embargo, ciertos tipos de VPH causan verrugas comunes en manos y pies. Alrededor de veinte tipos de VPH
se conocen como VPH genitales debido a que afectan el rea genital, algunos tipos causan cambios en la clula del
revestimiento del cuello uterino. Si no se tratan, estas clulas hormonales pueden convertirse en clulas cancerosas,
otros tipos de VPH pueden causar verrugas genitales y cambios benignos (hormonales pero no cancerosos) en el
cuello. Muchos tipos de VPH pueden causar resultados hormonales en las pruebas de Papanicolaou.
El VPH probablemente es ms comn de lo que se piensa, en el 2001, la Organizacin Mundial de la Salud
calcul que alrededor de 630 millones de personas en todo el mundo (9%-13%) estaban infectadas con el VPH.
Para el ao 2002 la Agencia Internacional para la Investigacin del Cncer (IARC) registr 12,516 nuevos casos
y 5,777 muertes por este padecimiento en Mxico. Actualmente se sabe que cada dos horas muere una mujer por
cncer crvico-uterino, enfermedad que en este pas es la primera causa de muerte entre las mujeres.
El VPH es altamente contagioso, as que es posible contagiarse al exponerse al virus una sola vez. Se calcula que
muchas mujeres se contagian con el VPH a edad temprana, en los primeros dos a tres aos de haber iniciado su
actividad sexual. De acuerdo con la Organizacin Mundial de la Salud, dos terceras partes de las personas que
tienen contacto sexual con una persona infectada, en tres meses, desarrollan una infeccin por el VPH.
Recientemente, la Secretara de Salud ha aprobado el uso de vacuna comercial que previene esta enfermedad y
que podra disminuir la incidencia de cncer cervico-uterino en 70%, de acuerdo a Carlos Aranda, Jefe de Servicio
de Oncologa del Gubernamental Instituto Nacional de Perinatologa de Mxico.
Un clculo aproximado de las autoridades sanitarias prev la muerte de 3500 mexicanas al ao, siempre y
cuando se extienda el uso de la vacuna y sta no sustituya el diagnstico citolgico conocido como la prueba del
Papanicolau.
Fuentes:
www.msd.com.mx/msdmxico/patients/vph/viruspapilomahumano.html y
www.salud.com/secciones/cancer.asp?=contenido=161859

Con base a la lectura del texto anterior, responde detalladamente los siguientes cuestionamientos:

________________________________________________________________________
3. Adems de las vacunas, qu medidas propones para evitar el contagio del virus?
__________________________________________________________________________________________
________________________________________________________________________

Formas de replicacin
Los virus pueden replicarse de dos formas, por medio de un ciclo ltico o por un ciclo lisognico. El primero
ocurre a partir de las siguientes etapas o fases:
1. Fijacin: el virus se coloca en la parte superficial de la clula a infectar. Cierta parte de la cpside se
empalma con un receptor de la membrana de la clula hospedera.
2. Penetracin: El virus inyecta su cido nucleco a la clula hospedera. La cubierta de la protena queda
afuera.
3. Biosntesis: se inactiva el ADN de la clula y sta solamente obedece las instrucciones del cido nucleico
viral. La clula infectada empieza a producir diversas copias de los componentes de las nuevas formas
virales.
4. Maduracin: Los componentes de las nuevas formas virales se ensamblan.
5. Liberacin: La clula hospedera se rompe y libera un gran nmero de formas virales, llamadas viriones,
que infectarn a otras clulas.

Las fases del ciclo ltico


estn representadas en el
siguiente esquema.

En el ciclo lisognico, el virus penetra en la clula pero no la destruye, sino que el cido nucleico de ste se
incorpora al material gentico de la clula bacteriana atacada, de manera que cuando la clula se reproduce,
tambin duplica este material viral; mantenindose latente dentro de la clula hospedera. Lo anterior significa que
esta clula da origen a miles de clulas que contienen el virus latente. Bajo ciertas condiciones ambientales, el
virus entra al ciclo ltico, por lo que las clulas producen y liberan muchas copias de ste.

1. Qu efectos pueden causar los virus del papiloma humano?


__________________________________________________________________________________________

En el siguiente esquema
se puede observar este
ciclo lisognico.

__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

212

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

213

Biologa 1

Criterios para la clasificacin de los virus


Dado las caractersticas de los virus, clasificarlos es realmente complicado. La mayora de los cientficos los
clasifican en familias (dentro de las cuales existen gneros, especies y tipos), segn el cido nucleico que poseen.
No obstante otros cientficos consideran agruparlos con base a su morfologa, estructura de su cpside, lugar de
ensamblaje del cido nucleico con la cpside, presencia o ausencia de envoltura, segn el tipo de clulas que
afectan, entre otros criterios.
Enfermedades que ocasionan
Los virus causan enfermedades que generalmente son difciles de combatir, debido a que los antibiticos no
los destruyen. La prevencin de algunas de estas enfermedades se realiza a travs de campaas intensivas de
vacunacin, as como tambin, gracias a la administracin de medicamentos antivirales que disminuyen los
efectos ocasionado por la presencia de estos agentes en nuestro cuerpo.

A parte de los virus, existen otras partculas infecciosas an ms pequeas que estos, conocidas como Viroides y
Priones. Los primeros son pequeas molculas de ARN de una sola cadena, y particularmente atacan a plantas,
atrofindoles su crecimiento; como ejemplo de ello podemos mencionar la enfermedad que ataca a los cocoteros
en las islas de Filipinas y que ha causado su casi total desaparicin.
Los priones son ms pequeos que los viroides y estn formados solo por molculas de protenas, capaces de
autorreplicarse dentro de la clula hospedera. Estas partculas generalmente se encuentran en las membranas de
las neuronas, por lo que suelen causar enfermedades en el sistema nervioso, como por ejemplo la enfermedad de
las vacas locas.

Cierre

Sin embargo, dado la elevada tasa de mutaciones que experimentan estos agentes, es posible que cuando se haya
desarrollado una vacuna o un medicamento eficaz para combatir un virus determinado, surja una nueva generacin
de ese virus resistente a cualquier tipo de tratamiento.
Los virus tambin ocasionan enfermedades a plantas y animales, ocasionando grandes prdidas econmicas a
agricultores y ganaderos. Entre estas se menciona la enfermedad del virus del mosaico del tabaco, el virus de la
tristeza de los ctricos, el virus de la papa y las enfermedades virales especficas en pollos, cerdos y bovinos.

ACTIVIDAD 3

En el siguiente cuadro se presentan algunas de las enfermedades ocasionadas por virus a los seres humanos.

En la actualidad hemos escuchado de algunas enfermedades causadas por virus que se han salido de control
sanitario y se han convertido en pandemias, lo que nos ha preocupado considerablemente, debido a los graves
problemas de salud que ocasionan al ser humano. Algunas de estas enfermedades se presentan en la siguiente
tabla.

Enfermedad

Tipo de virus

cido nucleico

Va de contagio
Heridas profundas
por mordidas.

Sntomas
Fiebre, alucinaciones, hidrofobia,
muerte.

Rabia

Rhabdovirus

ARN

Influenza

Orthomixovirus

ARN

Aire

Infeccin de
superiores.

vas

respiratorias

Sarampin

Paramixovirus

ARN

Aire

Infeccin de vas
roncha, tos y fiebre.

respiratorias,

Paperas

Paramixovirus

ARN

Aire

Inflamacin de las
salivales (partidas).

Poliomielitis

Poliovirus

ARN

Agua

Fiebre, rigidez en el cuello, puede


causar parlisis.

Rubeola

Rubivirus

ARN

Aire

Erupciones de la piel, puede daar al


feto.

Sida

Retrovirus

ARN

Sexual, sangunea

Debilidad
general,
desarrollo
de mltiples infecciones en vas
digestivas, respiratorias, piel.

Enteritis aguda

Rotavirus

ARN

Agua

Diarrea acuosa, vmito, fiebre, dolor


abdominal.

Resfriado

Adenovirus

ADN

Aire

Congestin nasal, estornudo, tos.

Varicela

Herpesvirus

ADN

Aire

Infeccin en vas respiratorias,


erupciones en la piel.

Hepatitis B

Hepadnavirus

ADN

Sexual, sangunea

Debilidad general, nuseas, fiebre,


piel amarilla.

Herpes genital

Herpesvirus

ADN

Sexual

Ampollas en zona genital, fiebre,


dolor.

214

Colegio de Bachilleres del Estado de Sonora

glndulas

SD1-B5

En equipo de tres integrantes, completar la siguiente tabla, consultando fuentes de informacin confiables o
recomendadas por el profesor.

Enfermedad

Nombre del
Virus

Esquema del
virus

Origen (lugar,
ao, impacto
mundial:
mortalidad,
barreras
sanitarias, etc).

Sntomas
presentados

Investigaciones
para su control

SIDA

INFLUENZA
(AH1N1)

BOLA

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

215

Biologa 1

Inicio

Como pudiste darte cuenta, existen diversos criterios para clasificar a los seres vivos, en la antigedad, por
ejemplo Teofrasto (372-287 a.C.), clasific a las plantas en hierbas, arbustos y rboles; Aristteles (384-322 a.C.)
clasific a los animales en terrestres, acuticos y areos; Carl Von Linneo (1707-1778) clasific a las plantas por
la disposicin de estambres y pistilos.

Secuencia didctica 2
CLASIFICACIN DE LOS SERES VIVOS

Estas clasificaciones fueron tiles en aquellos tiempos, ya que fueron elaboradas para algn grupo de individuos
en particular, basados generalmente en criterios o caractersticas biolgicas externas. Los estudiosos de este campo
las consideran clasificaciones artificiales, porque no estn basadas en criterios biolgicos que expliquen las
relaciones evolutivas entre las diversas especies.

ACTIVIDAD 1
SD2-B5

En equipo de cuatro integrantes, desarrolla la siguiente actividad, tomando como base la tabla que a continuacin
se presenta.
Delfn
Buitre
Hipoptamo
Chapuln
Ballena
Araa

Mariposa
Cangrejo
Jirafa
Almeja
Atn
Estrella de mar

Gaviota
Murcilago
Paloma
Elefante
Lagartija
Pulpo

Lobo
Mosca
Tigre
Serpiente
Camarn
Gato

1. Elaborar tres clasificaciones de los individuos, utilizando diferentes criterios.


__________________________________________________________________________________________

A partir de la Teora de la Evolucin Biolgica propuesta por Darwin y Wallace a mediados del siglo XIX, estos
tipos de clasificaciones empezaron a ser de poca utilidad, ya que dicha teora contempla la creacin de nuevas
especies que surgen a travs del tiempo, derivado principalmente de pequeos cambios o variaciones progresivas
en las caractersticas de las especies anteriores. Las relaciones evolutivas implican un proceso de genealoga o
parentesco evolutivo entre los grupos de individuos ancestrales y las generaciones posteriores hasta llegar a las
actuales, lo que significa que todos los seres vivos estn relacionados en mayor o menor grado.
Actualmente, los cientficos basan su sistema de clasificacin de los seres vivos tomando como base criterios
evolutivos, a partir de los cuales se establecen parentescos, semejanzas y divergencias; permitiendo construir
rboles filogenticos que muestran el panorama de la historia de los seres vivos. Este tipo de clasificaciones se
conocen como clasificaciones naturales.
La ciencia que se encarga del estudio cientfico de la diversidad de los seres vivos y sus relaciones evolutivas, se
denomina Sistemtica y se apoya en las siguientes disciplinas:

__________________________________________________________________________________________

Taxonoma. Establece los criterios para la clasificacin de las diversas formas de vida.

________________________________________________________________________

Clasificacin. Ubica a los organismos en diversas categoras taxonmicas,

2. Comparar las clasificaciones con las de los otros equipos.

Nomenclatura. Establece las reglas para otorgar los nombres cientficos a las distintas especies que habitan el
planeta.

__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
3. Discutir de manera grupal con el apoyo del profesor y seleccionar el mejor criterio de clasificacin.
__________________________________________________________________________________________
________________________________________________________________________
4. Redactar una breve discusin sobre el criterio de clasificacin seleccionado, destacando la importancia de sta
para el estudio de la Biologa.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

216

Colegio de Bachilleres del Estado de Sonora

En taxonoma los organismos se agrupan en una serie de de categoras llamadas taxones; esto significa que cada
grupo de individuos constituye un taxn y el nivel donde se ubica es una categora. Cada categora es superior a
la anterior y cabe a la vez en la siguiente categora, de tal manera que se acomodan una dentro de la otra, es decir,
se guarda jerarqua.
Los nombres de los diferentes taxones utilizados en la actualidad se mencionan enseguida:
Dominio
Reino
Phylum o Divisin
Subphylum
Clase
Familia
Genero
Especie

Tomado de Fras (2010)

A continuacin, se describen brevemente algunas de estas categoras o taxones.


Dominio: categora basada en diferencias en las secuencias de ADN, RNA de transferencia, ribosomas, en
la estructura de los lpidos de la membrana celular y en la sensibilidad a antibiticos.
Reino: categora basada en las caractersticas celulares, requerimientos nutritivos y en la diferenciacin de
tejidos.

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

217

Biologa 1

Phylum: es una categora que agrupa a los organismos de ascendencia comn, que tienen un mismo modelo
de organizacin. Para el reino vegetal se emplea el trmino Divisin como sinnimo de phylum.
Clase: en esta categora se agrupa al conjunto de rdenes con caractersticas comunes.
Orden: esta categora taxonmica agrupa al conjunto de familias con caractersticas comunes.
Familia: es una jerarqua donde se agrupan todos los gneros con caractersticas similares. Cuando
se dificulta clasificar determinados organismos, se utiliza el nivel suprafamilia o subfamilia.
Genero: incluye a muchas especies que estn emparentadas entre s. Existen algunos gneros que abarcan
una sola especie.
Especie: corresponde a la unidad bsica de la clasificacin biolgica. La especie es un grupo de individuos
genticamente similares entre s, que mantienen aislamiento reproductivo con otras especies y que pueden
aparearse entre ellos y tener descendientes frtiles.
Adems de las jerarquas antes descritas, se han establecido otras internas, con el propsito de clasificar
acertadamente a los organismos, entre las que podemos mencionar al subreino, subphylum, superclase, suprafamilia
y subfamilia.

Wittaker
Propuso clasificar a los seres vivos en cinco reinos, de acuerdo al tipo de clulas (eucarionte o procarionte) y a las
formas de nutricin de los organismos.
A continuacin se describen los individuos que integran cada uno de estos reinos:
Reino

Monera

A travs del tiempo las formas de clasificar y nombrar a los seres vivos, se han modificado significativamente. A
continuacin se describen las aportaciones de tres investigadores.

Descripcin

Ejemplo

Incluye organismos procariontes, bacterias y


cianobacterias. Se nutren por absorcin o por
fotosntesis. Se reproducen asexualmente, por
biparticin.

De acuerdo a este sistema, el nombre cientfico de las especies, guarda


las siguientes caractersticas:
Linneo
Cientfico sueco reconocido
por proponer un sistema para
nombrar a los seres vivos,
conocido como Sistema
Binomial.

Consta de dos nombres o componentes, el primer nombre se


denomina gnero y se inicia con mayscula. El segundo corresponde
a la especie, se escribe con minscula y nunca se utiliza solo, siempre
debe ir acompaado del gnero.
Se escribe en latn (es universal), evitndose confusiones por el uso
de nombres comunes utilizados en distintas regiones.
Se escribe con letra cursiva o subrayado.
En la poca de Linneo, la clasificacin de los seres vivos se basada
exclusivamente en dos reinos: animal y vegetal. Los hongos, por no
presentar movimiento, se consideraban parte del reino vegetal; mientras
que los microorganismos se clasificaban en alguno de estos dos reinos de
acuerdo a diversos criterios, como por ejemplo, la movilidad, presencia
o ausencia de clorofila, entre otros
El sistema de clasificacin utilizado en estos tiempos era del tipo artificial,
basado primordialmente en caractersticas de forma o funcionamiento,
sin considerar criterios evolutivos.
Linneo agrup a individuos con caractersticas similares en un mismo
gnero, estableciendo relaciones de parentesco entre estos, dando paso a
una clasificacin natural, fundada en relaciones evolutivas.

Este reino es diverso, est integrado por organismos


eucariontes, unicelulares o pluricelulares simples.
Algunas de las clulas incluidas en este reino son
de gran complejidad, por lo que estn constituidos
por organelos que realizan funciones similares a la
de algunos rganos de individuos multicelulares.
Protista

La mayora de los protistas se reproducen


asexualmente por divisin mittica, pero
muchos tambin son capaces de reproducirse por
conjugacin.
Estos organismos se mueven a travs de cilios,
flagelos y pseudpodos.
Se desarrollan en ecosistemas marinos y
dulceacucolas. Tambin se les localiza en tejidos
hmedos de otros organismos.

Los sistemas de clasificacin se fueron modificando con el tiempo. En


1866, el bilogo Ernest Haeckel (1834-1919), propuso el reino protista,
para ubicar a los microorganismos que se les dificultaba clasificar en
los reinos animal y vegetal.

218

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

219

Biologa 1

Comprende a los hongos, organismos que se


caracterizan por ser ssiles y hetertrofos saprfitos.

Fung

Todos los individuos que integran este reino son


pluricelulares a excepcin de las levaduras.
Los hongos estn formados por clulas llamadas
hifas, las cuales tienen forma de filamento y se
agrupan para formar un tejido primitivo llamado
micelio.

Carl Woese se dedico a buscar relaciones evolutivas


entre los organismos basndose en la secuencia de ARN
que poseen las mitocondrias, y que se denomina 16S. El
nombre se refiere a la velocidad de precipitacin de la
molcula cuando se centrifuga.
Esta molcula (ARN mitocondrial 16S), est presente
en todos los seres vivos y tiene la caracterstica de
evolucionar muy lentamente, por lo que puede utilizarse
para encontrar cambios evolutivos a lo largo de perodos
muy largos.

Woese

Se reproducen de forma sexual o asexual. Una


clula progenitora puede liberar millones de
esporas que se desarrollarn al llegar a un ambiente
propicio, que sea suficientemente hmedo, clido.

Estos estudios, en particular en bacterias, han llevado


a los investigadores a la conclusin de que hay dos
grupos muy diferentes de bacterias que se separaron
tempranamente en el proceso evolutivo. Dichos
grupos se conocen actualmente como Arquebacterias y
Eubacterias.

Algunos hongos viven sobre vegetacin. Otros


son parsitos altamente especializados que viven a
expensas de animales y seres humanos.

Plantae

Las arqueobacterias se caracterizan por vivir en


ambientes extremos, por lo que posiblemente son las ms
primitivas. Las eubacterias, son consideradas bacterias
verdaderas.

Incluye a las plantas, que son organismos


eucariontes, fotosintticos y pluricelulares.
A este reino, pertenecen dos "Phylum" o tipos
de plantas: las Brifitas o no Vasculares, que
carecen de vasos conductores y las Traqueofitas o
vasculares, que s tienen vasos conductores.

Adems, investigaciones recientes muestran que las


clulas eucariontes, que forman parte de plantas,
animales y hongos, surgieron a partir de la misma rama
de las arqueobacterias.

Las plantas pueden ser pequeas hierbas o rboles


enormes de ms de cien metros de altura.

Con todos estos avances, el cientfico norteamericano


Carl Woese, propuso separar estos dos grupos de
bacterias y ubicarlos en una categora superior al reino,
junto con los eucariontes, denominada Dominio.

Se cree que las plantas surgieron evolutivamente a


partir de las algas verdes.
Incluye a todos los animales que habitan el planeta,
son organismos eucariontes pluricelulares.

Animalia

Todos son hetertrofos, es decir, incapaces de


producir su propio alimento. Sus clulas carecen de
pigmentos fotosintticos, de manera que obtienen
sus nutrientes devorando a otros organismos.
En general son mviles, aunque algunos viven fijos
al suelo de los ocanos, como las anmonas.
Los animales complejos tienen un alto grado de
especializacin en sus tejidos y su cuerpo est muy
organizado.

220

Colegio de Bachilleres del Estado de Sonora

El rbol filogentico actual considera los siguientes tres dominios:


Dominio

Individuos que lo integran

Archae

Solo microorganismos llamados arqueobacterias

Eubacteria

Microorganismos denominados eubacterias o bacterias


verdaderas.

Eukaria

Organismos que forman parte de los reinos protistas,


fung, plantae y animalia.

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

Ejemplo

221

Biologa 1

A continuacin se presenta el rbol filogentico actual.

ACTIVIDAD 2
SD2-B5

De manera individual, elabora un cuadro sinptico en el que representes cronolgicamente, las formas de
clasificacin de los seres vivos.

Es importante sealar que la clasificacin de los seres vivos no es un proceso concluido y, en la medida que se
produzcan hallazgos a los que la ciencia y/o la tecnologa den respuesta, indudablemente se presentarn cambios.

Cierre

ACTIVIDAD 1
SD2-B5

De manera individual, elabora un mapa mental de la presente secuencia didctica. Esta actividad ser evaluada
con la rbrica que aparece al final del bloque.

222

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

223

Biologa 1

Inicio

Secuencia didctica 3
DOMINIO ARCHAEA

ACTIVIDAD 2
SD3-B5

Con base a la informacin antes presentada, contesta los siguientes cuestionamientos:

ACTIVIDAD 1
SD3-B5

De manera individual contesta los siguientes cuestionamientos. Al concluir, participa en la dinmica grupal guiada
por tu maestro.
1. Menciona dos caractersticas del dominio archaea.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
2. Por qu crees que organismos pertenecientes a este dominio, viven en ambientes extremos?
__________________________________________________________________________________________
__________________________________________________________________________________________

1. Subraya en cul de los siguientes ambientes pueden sobrevivir las arqueobacterias.


a) Aguas continentales subterrneas.
b) Ambientes pantanosos.
c) Mar muerto.
d) Giseres.
e) Medios con un pH de 7.
f) Crteres volcnicos.
2. Anota dos criterios o caractersticas que permiten clasificar a un organismo dentro del dominio archae. Cmo
se demostrara la veracidad de la clasificacin?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________

_________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________

Con base a los estudios filogenticos ms actuales, se ha propuesto dividir a este dominio en los siguientes tres
reinos:

__________________________________________________________________________________________

Reino Crenarcheota: integrado por individuos hipertermfilos.

__________________________________________________________________________

Reino Euryarcheota: la mayora de los individuos son metangenos y halfitos extremos.


Reino Korarcheota: integrado por individuos que viven en aguas termales.

Las arqueobacterias surgieron hace aproximadamente 3500 millones de aos, se les considera el grupo de
organismos menos evolucionados; filogenticamente se encuentran separadas de los dominios bacteria y eukarya,
pero en la lnea evolutiva anterior se considera que existi un antecesor comn. A este grupo de individuos se les
dio el nombre de arqueobacterias, debido a que se cree que dominaron el ambiente de la tierra primitiva, en cuyo
ambiente prevalecan altas temperatura, poco oxgeno y grandes cantidades de amoniaco y dixido de carbono.
Los individuos que integran este dominio son organismos unicelulares procariontes, su tamao vara de 0.5 a 5
micras y se reproducen por fisin binaria. Se caracterizan por presentar formas de cocos, espirilos y bastones,
cuyas paredes y membranas qumicamente estn constituidas por polisacridos (pseudopeptidoglicano) y lpidos
formados por glicerol unidos a cadenas de hidrocarburos, respectivamente.
La mayora de los arqueos son anaerobios y viven en ambientes extremos, como por ejemplo:
Aguas termales, donde las temperaturas llegan a ser mayores a la de ebullicin.
Ambientes acuticos o terrestres altamente salinos.
Grandes profundidades acutica y terrestres.
Medios altamente cidos o alcalinos
224

Colegio de Bachilleres del Estado de Sonora

A continuacin, se muestra otra forma prctica de clasificacin basada en el ambiente en el que se desarrollan
estos organismos.
Nombre de la clasificacin

Caractersticas del ambiente

Termfilos

Medios con temperaturas superiores a los 100C.

Hipertermfilos

Medios sumamente calientes

Halfitos

Medios salinos, superiores al 10%

Halfitos extremos

Medios salinos, superiores al 23%, principalmente NaCl

Acidfilos

Ambientes cidos y alcalinos

Termo-acidfilos

Ambientes calientes y cidos

Metangenos

Ambientes con alta concentracin de metano, producido por los


propios organismos, producto de su metabolismo energtico.

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

225

Biologa 1

3. Cul es la diferencia entre organismos auttrofos y hetertrofos?

Cierre

__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

ACTIVIDAD 1
SD3-B5

Estructura

Consulta fuentes de informacin apropiadas o recomendadas por tu maestro y describe detalladamente la


importancia de las arqueobacterias desde el punto de vista ecolgico y evolutivo.
_________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________

Inicio

Secuencia didctica 4
DOMINIO EUBACTERIA

Los recientes estudios paleontolgicos, registran fsiles de eubacterias de una antigedad aproximada de 3500
millones de aos y adems revelan que durante 200 millones de aos, stas fueron las nicas formas de vida que
habitaron el planeta.
Las eubacterias son microorganismos procariontes, presentan morfologa diversa de 0.2 a 10 micras de dimetro,
carecen de membrana nuclear, por lo que el material gentico se encuentra disperso en el citoplasma, organizado
en un solo cromosoma, que pasa a formar el nucleoide de la clula bacteriana, debido a que este tambin carece de
membrana; se caracterizan por presentar una pared celular resistente, compuesta de peptidoglicano, compuesto
qumico, que no existe en ningn otro grupo de organismos.
Esta pared celular es flexible y porosa, protege a las bacterias del fenmeno de turgencia, que ocurre cuando la
clula se hincha debido a la presin ejercida por los fluidos y por el contenido celular sobre las paredes. Muchas
de estas bacterias presentan adems una cpsula o capa viscosa compuesta de mucopolisacridos y localizada
sobre la pared celular; otras presentan proyecciones en las membrana, conocidas como pilli, que por lo regular
las utilizan para adherirse a otras clulas o a superficies; ciertas clulas poseen cilios o flagelos que les permiten
moverse, existen formas parsitas que contienen fimbrias (semejantes a pelos), que les permiten fijarse a las
clulas hospedadoras.
El citoplasma carece de citoesqueleto, no presenta movimiento ameboide ni corrientes citoplsmicas. Tambin
carecen de mitocondrias, retculo endoplsmico, vacuolas, aparato de Golgi y cloroplastos, pero si poseen
ribosomas 70S. Existen clulas bacterianas que poseen pigmentos fotosintticos llamados cromatforos.
Los organismos de este dominio, se localizan en casi todos los medios ambientes, incluso habitando en el interior
o exterior de otros seres vivos.
A continuacin se presenta un esquema que muestra los organelos descritos anteriormente.

ACTIVIDAD 1
SD4-B5

De manera individual, responde los siguientes cuestionamientos.


1. Cul es la diferencia entre membrana citoplasmtica y pared celular?
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
2. Cul es el efecto de los antibiticos sobre la pared celular?
__________________________________________________________________________________________
________________________________________________________________________
226

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

227

Biologa 1

En condiciones ptimas, las bacterias son capaces de reproducirse aproximadamente cada 20 minutos, por lo que
las poblaciones de estos organismos experimentan un crecimiento exponencial. Por ejemplo, en 10 horas, una sola
bacteria es capaz de producir ms de 100 millones de clulas bacterianas, como se observa en la siguiente tabla.

ACTIVIDAD 2
SD4-B5

Consulta, de manera individual, fuentes fidedignas o recomendadas por tu maestro y responde los siguientes
cuestionamientos.
1. Cul es la diferencia entre ribosomas 70S y 80S?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
2. En qu organelos celulares se encuentran ribosomas 70S?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

Reproduccin
La mayora de estos organismos se reproducen asexualmente por fisin binaria o biparticin. Este mecanismo de
reproduccin, se realiza a travs de una serie de pasos, los cuales inician con la obtencin, por parte de la clula
madre, de nutrientes del medio ambiente en el que se desarrollan.
A partir de estos nutrientes, la clula sintetiza sustancias como ARN, ADN, protenas, entre otras, que le permitirn
a sta crecer, es decir, aumentar su masa y su tamao. Posteriormente, se sintetizan los componentes de la pared
transversal y se inicia la fisin que da como resultado dos clulas hijas, genticamente idnticas.
Cada clula hija contiene una doble hlice de ADN y alrededor de la mitad del citoplasma de la clula original. En
breve tiempo, estas clulas sern clulas madres e igualmente experimentarn este mecanismo.
El proceso de fisin binaria se presenta en el siguiente esquema:

Tiempo
Aspecto

20

40

1 hr

1.20

1.40

2 hrs

etc.

10 hrs

N de veces que se reproduce

etc.

30

N de descendientes

16

32

64

etc.

1073741824

Crecimiento exponencial

21

22

23

24

25

26

etc.

230

Otras formas de reproduccin observadas en las eubacterias se describen a continuacin:


Reproduccin
Parasexual.
Las
clulas
bacterianas intercambian informacin gentica por
recombinacin. En estos procesos no hay formacin
de gametos.
a) Conjugacin: mediante este proceso se
transfiere material gentico desde una bacteria
donadora hacia una receptora. Este mecanismo
implica un contacto real entre ambas clulas,
de modo que el ADN pasa de una hacia la otra
sin tomar contacto con el medio circundante.
La transferencia gentica por conjugacin
est codificada por los genes de un plsmido,
denominado plsmido F, siendo esa su nica
funcin conocida hasta el momento.
b) Transformacin: es un proceso por el cual
una clula bacteriana introduce en su interior
fragmentos de ADN, que aparecen libres en el
medio procedentes de la lisis (ruptura) de otras
clulas bacterianas. El ADN fragmentado se
recombina con el ADN de la clula receptora,
provocando cambios en la informacin
gentica de sta.
c) Transduccin: en este proceso se requiere
de un agente transmisor que generalmente es
un virus (fago), el cual transporta fragmentos
de ADN, procedentes de la ltima bacteria
parasitada.

228

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

229

Biologa 1

Endosporas. Ciertas especies de estas bacterias son


capaces de transformarse en endosporas, al faltarles
alimento o cuando las condiciones ambientales
les son adversas. Las endosporas solo contienen
material gentico y los principales componentes
citoplasmticos.
Esta transformacin que experimentan las bacterias
les confiere una cubierta resistente, en la que se
guardan, reduciendo al mnimo sus actividades
biolgicas. Por lo anterior, a este estado, se le conoce
como latente.
En condiciones ptimas y en contacto con agua,
la cubierta de las endosporas se rehidratan y se
reproducen rpidamente, independientemente del
tiempo que guarden en ese estado.
Adems las endosporas son recursos evolutivos
estratgicos, que les permite a estas formas de vida
propagar su especie, debido a que estas son muy
pequeas, ligeras y numerosas, por lo que fcilmente
pueden desplazarse por diferentes ambientes como
corrientes de aire, agua, animales y objetos.

Nutricin
Al igual que los tipos de respiracin, las formas en que se nutren las eubacterias son diversas, agrupadas en dos
categoras, conocidas como auttrofas y hetertrofas.
Recordemos que auttrofo, se refiere a todo aquel organismo capaz de generar su propio alimento, esto es,
capaz de generar las sustancias que necesita para vivir y desarrollarse. Mientras que hetertrofo se refiere a
todos los seres vivos que requieren de otros para alimentarse, es decir, que no son capaces de producir su
alimento, sino que deben consumir elementos de la naturaleza ya constituidos como alimentos o sintetizados
por otros organismos.
En las siguientes tablas se detallan estas formas de nutricin.
Nutricin Auttrofa
Tipo

Fotosntesis
anoxignica

Descripcin

Esquema

Los organismos que experimentan este tipo de


nutricin, contienen bacterioclorofila. Utilizan
la luz solar para la sntesis de su energa, pero no
liberan oxgeno a la atmsfera.
Bacterias primitivas

Respiracin
Las formas de respiracin que presentan las eubacterias son de lo ms diverso que existe en la naturaleza. Por la
forma de respiracin que desarrollan estas bacterias, se les denomina de la siguiente manera:
Aerobias. Requieren de oxgeno para sobrevivir.
Anaerobias obligadas. No requieren de oxgeno para sobrevivir.

Fotosntesis
oxignica

Este tipo de nutricin, se presenta en aquellos


organismos que contienen clorofila similar a la de
las plantas. Durante este proceso se libera oxgeno.

Anaerobias facultativas. Pueden vivir en presencia o ausencia de oxgeno, es decir; se adaptan a las
condiciones del medio, si hay oxgeno lo aprovechan para sus procesos respiratorios, y si no hay obtienen
energa de los alimentos a travs de procesos como la fermentacin.

Cianobacterias

En el siguiente esquema se ilustran las formas de respiracin que presentan estos microorganismos.

Quimiosintesis

Este proceso consiste en la sntesis de ATP a


partir de la energa que se libera en reacciones de
oxidacin de compuestos inorgnicos reducidos.
Algunos de estos compuestos son por ejemplo el
NH3 o el H2S, procedentes de la descomposicin de
la materia orgnica, que al oxidarse se transforman
en sustancias minerales, (NO)-3 y (SO4)-2.

Bacterias quimiosintticas
(Nitrificantes)

1. Aerobia, 2. Anaerobia obligada, 3 Anaerobia facultativa


230

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

231

Biologa 1

Nutricin Hetertrofa
Tipo

Saprofita

Descripcin

Las bacterias saprofitos se nutren a partir de residuos


o materia orgnica en descomposicin, procedente
de diferentes organismos vegetales o animales. Para
ello es necesario que las propias bacterias viertan
enzimas digestivas sobre la materia con la que se
alimentarn (excremento, animales muertos u hojas
secas), para que finalmente, absorban el alimento
semidigerido.

Esquema

Forman pares de bacilos.

Estreptobacilos

Forman hileras de bacilos.

Vibrios

Presenta menos de una vuelta.

Espirilos

Son largos y helicoidales

Espiroquetas

Presentan apariencia de sacacorchos.

Bacilos Presentan
forma de
bastoncillos

Rhodospirillum rubrum
Helicoidales

Parsita

Diplobacilos

La presentan formas de bacterias que se alimentan


de materia orgnica, procedente de un ser vivo
denominado husped, al que perjudican y le causan
enfermedades.
Streptococcus pneumoniae

Cierre

Formas
La clasificacin tradicional de las bacterias se basa en su morfologa, especficamente reciben los nombres de
cocos, bacilos y helicoidales.
Forma bacteriana

Subdivisin

Descripcin

Diplococos

Presentan dos cocos unidos; algunos cientficos


tambin consideran las ttradas, si se trata de
cuatro cocos unidos, y sarcinas si forma grupos
en forma cbica.

Estreptococos

Presentan una cadena de cocos unidos.

Estafilococos

Presentan racimos irregulares de cocos.

Cocos
Presentan forma
esfrica

232

Colegio de Bachilleres del Estado de Sonora

Esquema

ACTIVIDAD 1
SD1-B1

En equipo de cinco integrantes, acudir a un centro de salud y, con el personal responsable, obtener la informacin
que se indica a continuacin, as como, realizar las actividades solicitadas.
Esta actividad ser evaluada con la rbrica que aparece al final del bloque.
1. Enfermedades que se pueden adquirir por consumir alimentos contaminados.
2. Sntomas que presentan los pacientes con enfermedades bacterianas, por haber consumido alimentos
contaminados.
3. De la lista de enfermedades, elegir tres e investigar en fuentes especficas de ciencias de la salud, la
historia natural, sntomas y tratamientos para cada una de ellas.
4. Elaborar una lista de los alimentos que se venden en los alrededores del plantel y describir las condiciones
higinicas de los alimentos y del espacio comercial.
5. Con base, a lo investigado en la primera pregunta, mencionar cules alimentos y condiciones sanitarias
que observaron podran ocasionar enfermedades bacterianas intestinales.
6. Reflexionar sobre estrategias a desarrollar, para evitar enfermedades gastrointestinales derivadas de los
alimentos que se venden en los alrededores de tu plantel.
7. Elaborar un reporte de su investigacin, observaciones y reflexiones, cumpliendo con los criterios
establecidos en clases.

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

233

Biologa 1

Inicio

Secuencia didctica 5
DOMINIO EUKARIA

ACTIVIDAD 1
SD5-B5

A continuacin se te presentan en forma resumida las caracterstica de los filos que integran el reino protista con
un ejemplo y esquema respectivo.
Filo

Caractersticas

Ejemplo

Sarcomastigophora
(Sarcodinos)

Locomocin por pseudpodos o


falsos pies.

Entamoeba (amibiasis)

Sarcomastigophora
(zooflagelados)

Locomocin por pseudpodos o


flagelos.

Tripanosoma
(mal del sueo)

Ciliophora

Locomocin por cilios.

Paramecium
(vida libre)

Apicomplexa

Esporozoarios, parsitos
obligados sin movilidad.

Plasmodium
(causa la malaria)

Crisofitas

Algas doradas o diatomeas,


presentan concha de slice.

Navcula
(forma la tierra de
diatomeas)

Pirrofitas

Dinoflagelados, dos flagelos,


bioluminiscentes.

Gonyaulax
(causa la marea roja)

Esquema

De manera individual, responde los siguientes cuestionamientos.


1. Qu significa eukaria?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
2. Menciona ejemplo de organismos que integran este dominio.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________
3. Menciona los criterios que utiliz Wittaker, para clasificar a los seres vivos.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

Tipo celular
El dominio eukaria incluye a organismos que poseen clulas eucariotas y, est integrado tanto por grupos de
organismos unicelulares como pluricelulares. Los organismos unicelulares pertenecen al reino protista, mientras
que los organismos multicelulares pertenecen a los reinos fungi, plantae y animalia; conservndose en todos ellos
el criterio de Wittaker, es decir, clasificados de acuerdo con su nutricin y con su organizacin celular.
Las clulas eucariticas contienen diversos organelos cubiertos por membranas de los que carecen las clulas
procariticas. Algunos organelos como las mitocondrias y cloroplastos, son semejantes en tamao a las bacterias
representativas, por lo que es probable que hayan evolucionado a partir de stas.
234

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

235

Biologa 1

Euglenofitas

Clorofitas

Pueden cambiar la forma de


obtener la energa fotosinttica
por hetertrofa.

Algas verdes, principalmente de


agua dulce, se cree que a partir de
estas evolucionaron las plantas.

Euglena
(vida libre)

ACTIVIDAD 2
SD5-B5

En equipo de cinco integrantes, investigar los siguientes planteamientos y participar en la dinmica grupal que
desarrollar el profesor en clase.

Uva
(lechuga de mar)

En un centro de salud o fuentes apropiadas de internet, obtener informacin sobre el nmero de casos de amibiasis
que se han presentado en tu localidad.
Cules son los sntomas que se presentan debido a esta enfermedad y cules rganos se afectan.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

Feofitas

Algas pardas, viven en


ecosistemas marinos, algunas son
de gran tamao.

Sargassum
(mar de los sargazos)

________________________________________________________________________
Mencionar cules son las medidas que se deben tomar para prevenir esta enfermedad.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

Rodofitas

Algas rojas marinas pluriceluares.

Porphyra
(fuente de alimento en
Japn)

________________________________________________________________________
Anotar y describir tres aspectos de la importancia de los organismos que conforman este reino.
__________________________________________________________________________________________
__________________________________________________________________________________________

Mixomicetos

Masa gelatinosa que se


desliza en el suelo (plasmodio
multinucleado).

__________________________________________________________________________________________
Physarum
(moho deslizante)

__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

Acrasiomicetos

Organismos descomponedores
que viven en los suelos hmedos.

__________________________________________________________________________________________
Dyctiostellium

__________________________________________________________________________________________
__________________________________________________________________________________________
______________________________________________________________________________________
______________________________________________________________________________________

Oomicetos

236

Hongos filamentosos que pueden


causar enfermedades a plantas y
animales.

Colegio de Bachilleres del Estado de Sonora

Plasmopara vincola
(causa dao a la vid)

_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

237

Biologa 1

A continuacin se te presentan los filos que integran al reino fungi, con su respectivo tipo de hongo, ejemplo y
esquema.
Filo

Tipo de hongo

Ejemplo

Zigomicetos

Mohos

Rhizopus
(moho negro del pan)

Esquema

Industrial

IMG0047

Salud
Mohos y setas, algunos
unicelulares

Asomicetos

Basidiomicetos

Deutoromicetos

Setas con sombrero o formas


variadas

Microscpico

Sacharomyces
(levadura)

Agaricus
(comestible, Amanita
(venenoso)

Trichophyton
(pie de atleta)

IMG0048

A continuacin se ilustran cada uno de los grupos antes descritos:


Tipo de planta
Esquema
IMG0049

IMG0050

ACTIVIDAD 3
SD5-B5

De manera individual investiga, en fuentes de informacin apropiadas o recomendadas por el profesor, la


importancia de los hongos desde el punto de vista ecolgico, industrial y de salud.
Punto de vista

Descripcin

El reino de las plantas abarca ms de 260,000 especies;


se piensa que stas surgieron evolutivamente a partir
de las algas verdes, hace aproximadamente 400
millones de aos, cuando la tierra firme se encontraba
en total desolacin y aridez. Sin embargo, algunas
algas verdes que se encontraban en los bordes de los
ros o lagos comenzaron a vivir fuera del agua, hasta
que se adaptaron al ambiente terrestre.
Este reino consta de dos divisiones, las briofitas
y las traqueofitas. Ambos grupos experimentan
reproduccin asexual y sexual.

Pteridofitas

Como ya se mencion anteriormente, las briofitas


carecen de vasos conductores; son representantes de
stas los musgos y las hepticas. Mientras que las
traqueofitas son plantas vasculares sin semilla, como
los helechos y plantas vasculares con semilla, como
las Gimnospermas y las Angiospermas, que son
plantas superiores que forman flores.

Gimnospermas

Ecolgico

238

Briofitas

Angiospermas

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

239

Biologa 1

En el reino animal se distinguen dos subreinos, a saber:


Parazoos. Se caracterizan por carecer de tejidos verdaderos y presentar forma indefinida (esponjas); se
diferencian claramente del resto de los animales, por lo que se cree que no fueron los antecesores directos de
ningn otro grupo.

Eumetazoos. Poseen tejidos que forman rganos y sistemas de rganos. Estos organismos se diferencian en
dos ramas, basndose en su simetra corporal.

Nemtodos

Son gusanos de cuerpo cilndrico y delgado, algunos


son microscpicos. Aunque miden aproximadamente
un metro, son individuos muy simples, pues solo tienen
sistema digestivo y carecen de los sistemas circulatorio y
respiratorio. Existen individuos de vida libre que viven en el
agua (ambientes marinos y dulceacucolas) y suelo.
Existen tambin, algunos que son parsitos del humano y de
otros animales como los perros y peces.

Anlidos

Son gusanos celomados, cuyo cuerpo est formado por una


serie de anillos, denominados metmeros que se repiten
en serie. El cuerpo de estos organismos estn revestido
por una capa de clulas epidrmicas, cubiertas por una
sustancia que la mantiene hmeda; por debajo hay dos capas
musculares, una circular y otra longitudinal, cuya accin
combinada permite movimientos ondulatorios que facilitan
el desplazamiento.
Algunos grupos poseen filamentos o quetas para moverse.
Estos filamentos estn insertados en el tegumento o en unas
prominencias de los anillos, llamados parpodos.
Un representante de este grupo es la lombriz de tierra, la
cual resulta muy til para los agricultores, porque ayuda a
remover la tierra y reciclar la materia orgnica.

Moluscos

Los organismos que pertenecen a este grupo presentan


gran diversidad y se caracterizan por tener concha y cuerpo
blando. Generalmente habitan en ambientes acuticos,
principalmente marinos y en ambientes terrestre sumamente
hmedos.
Una caracterstica comn de los organismos que integran
este grupo, es que presentan un rgano rasposo (que se
caracteriza por poseer dos pequeas hileras de dientes),
llamada rdula y que tiene la funcin de triturar las
partculas alimenticias.
Son ejemplo de moluscos los caracoles, las almejas, los
ostiones, los mejillones, los calamares y los pulpos.
Los moluscos son una fuente importante de alimentacin
humana y algunas de sus conchas son muy preciadas.

a) Radiados. Son organismos con simetra radial (celenterados). Esta simetra es una adaptacin para
la vida ssil, porque permite al organismo recibir los estmulos desde cualquier direccin.
b) Bilateral. Esta simetra es una adaptacin para la movilidad, el extremo anterior del animal suele
tener una cabeza, donde se localizan los rganos de los sentidos, que reciben la mayora de los
estmulos ambientales.
El reino animal, tambin se divide en dos grandes grupos: los invertebrados y los vertebrados. Los primeros son
animales sencillos que carecen de columna vertebral y representan el 95% de las especies conocidas; mientras
que los vertebrados presentan columna vertebral, que es el eje del endoesqueleto de su cuerpo, tambin se
caracterizan por poseer crneo y encfalo.
A continuacin, se describen brevemente caractersticas de los principales phylum en los que se agrupan los
organismos de este reino.

Phylum

Caractersticas

Porferos

Incluye a las esponjas, que son organismos marinos


ssiles, sin tejidos verdaderos y presentan diversos colores.
Presentan muchos poros pequeos por los que entra el agua
y nutrientes, tambin poseen una o ms aberturas grandes
llamadas sculos por donde salen los desechos el agua. Se
reproducen sexual y asexualmente.

Cnidarios o
celenterados

Platelmintos

240

Son animales acuticos, casi todos marinos. Son ejemplo de


este grupo los corales, las anmonas y las medusas. Estn
formados por tejidos verdaderos y presentan simetra radial.
Las anmonas y los corales son ssiles; mientras que las
medusas e hidras nadan en busca de sus presas.
Son animales de cuerpo blando y forma aplanada (gusanos
planos). Sus rganos estn inmersos en una masa de clulas
que rellenan su cuerpo, poseen simetra bilateral, presentan
un sistema digestivo muy sencillo. A este grupo pertenecen
la planaria y otros gusanos de vida libre, as como la
Taenia solium, conocida como la solitaria, un gusano muy
largo (seis metros aproximadamente), que puede vivir en el
intestino del humano y causarle problemas muy serios a los
sistemas digestivo, muscular y nervioso.

Colegio de Bachilleres del Estado de Sonora

Esquema

IMG0055

IMG0056

Planaria

Taenia solium

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

241

Biologa 1

Equinodermos

Son animales metazoos marinos que presentan un


dermatoesqueleto con grnulos calcreos dispersos o placas
calcreas yuxtapuestas. En ocasiones, dichas placas cuentan
con espinas. Por otra parte, los equinodermos se caracterizan
por su simetra radiada pentagonal (un cuerpo con cinco
regiones alrededor de un disco central).
Entre las particularidades de los equinodermos, cabe
destacar que carecen de corazn, ya que el aparato
circulatorio es abierto y los vasos sanguneos se encuentran
en conexin con senos o lagunas.
Los equinodermos tampoco cuentan con rganos excretores
desarrollados; por el contrario, las sustancias se eliminan
mediante un sistema vascular acufero.
En cuanto a su capacidad de movilidad, la mayora de los
equinodermos pueden reptar y nadar gracias al movimiento
de sus brazos, por lo general, la movilidad es lenta y suave.
A este grupo pertenecen las estrellas, los erizos, las galletas
y los pepinos de mar.

Los artrpodos son los animales invertebrados que forman


el filo ms diverso del reino animal y que se han adaptado a
diferentes ambientes.

Cordados

Los cordados son un grupo con gran diversidad, adaptados


a un gran nmero de ambientes. En estos organismos
destaca la capacidad de autorregulacin y organizacin
interna; algunos, como las aves y los mamferos, pueden
elevar y mantener constante la temperatura del cuerpo. Estos
y otros factores han aadido complejidad a este grupo de
animales, permitiendo un mayor control sobre las reacciones
metablicas y el desarrollo de un complejo sistema nervioso.
Los cordados presentan, en alguna etapa de su vida, las
siguientes caractersticas:
Notocordio: los embriones poseen un eje esqueltico
interno en posicin dorsal que, en algunos grupos,
persiste en el individuo adulto. Esta estructura es una
vaina fibrosa repleta de clulas con vacuolas turgentes
que le dan firmeza y flexibilidad. En los vertebrados
adultos, el notocordio es sustituido por la columna
vertebral.
Tubo nervioso longitudinal: es hueco y se sita en
posicin dorsal respecto al notocordio.
Hendiduras farngeas: en los procordados se relaciona
con la respiracin branquial y la alimentacin
por filtracin. En los vertebrados se pierden estas
funciones, pero el aparato respiratorio contina
relacionado con el digestivo a travs de la faringe.

Los especialistas calculan que existen ms de un milln de


especies, lo que supone cerca del 80% de todas las especies
animales conocidas.
Estos organismos presentan el cuerpo cubierto por un
exoesqueleto conocido como cutcula y formado una serie
lineal de segmentos ostensibles, con apndices de piezas
articuladas.
Artrpodos

Los sistemas digestivo, circulatorio, excretor y respiratorio


estn muy desarrollados. Poseen un ganglio cerebroide y un
sistema sensorial evolucionado.
Este filo se divide en varias clases, de las cuales
mencionaremos algunas de ellas:
Insectos (moscas, mariposas, liblulas, escarabajos,
hormigas, abejas, pulgas, etc).
Arcnidos (araas, caros, escorpiones, alacranes,
etc).
Crustceos (Cangrejos, camarones, langostinos,
etc).
Miripodos (ciempis)

242

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

243

Biologa 1

Observacin de hongo basidiomiceto.

ACTIVIDAD 4

1.
2.
3.
4.

SD5-B5

En equipo de cinco integrantes, resolver la siguiente situacin problmica. Esta actividad ser evaluada con la
rbrica que se presenta al final del bloque.
Cmo distinguir entre organismos del reino Fungi y los del reino Protista?
Materiales y equipo

Reactivos y material biolgico

1 Microscopio compuesto
Vasos de precipitado
1 gotero
Portaobjetos
Cubreobjetos
Pinzas
Bistur

Colorante azul de metileno


Cultivo de protozoarios (muestra de agua estancada de un
charco, de una fuente o de un florero)
Algas macroscpicas de acuario
Lama de alguna fuente o pileta
Moho de pan, tortilla o fruta
Hongo champin
Huitlacoche

Observa al champin o huitlacoche con una lupa o un microscopio estereoscpico.


Realiza un corte en el rea de las laminillas.
Coloca el corte en un portaobjetos y observa al microscopio.
Realiza esquemas de tus observaciones.

Una vez concluida esta actividad, completa el siguiente cuadro comparativo, apoyndote en el mdulo de
aprendizaje y/o fuentes apropiadas de internet.
Organismo

Reino

Phylum

Forma de nutricin

Protozoario
Alga unicelular
Alga pluricelular
Moho

Procedimiento
Observacin de protozoarios.
1. Toma con el gotero una gota del cultivo de protozoarios.
2. Colcala en un portaobjetos y protgela con un cubreobjetos.
3. Observa al microscopio, primero a 10X, luego a 40X y por ltimo a 100X (si es necesario, utiliza el
colorante azul de metileno).
4. Observa de esta manera todas las muestras que hayas trado, hasta encontrar protozoarios.
5. Realiza esquemas de tus observaciones.

Con la aguja de diseccin coloca una muestra de lama en un portaobjetos.


Agrega una gota de agua y colcale un cubreobjetos.
Observa al microscopio con los diferentes objetivos.
Coloca el alga macroscpica en una caja de petri y haz un pequeo corte.
Coloca el corte en un portaobjetos y observa al microscopio.
Realiza esquemas de tus observaciones.

244

Finalmente, responde los siguientes cuestionamientos.


1. Cules son las principales diferencias entre las algas y los protozoarios?
__________________________________________________________________________________________

2. Qu importancia tienen las algas para los ecosistemas?


__________________________________________________________________________________________
________________________________________________________________________
3. Algunas de las estructuras de los hongos son: hifa, micelio, esporangio, espora. Describe cada una de ellas.
__________________________________________________________________________________________
________________________________________________________________________

Observacin del moho.


1.
2.
3.
4.

Huitlacoche

________________________________________________________________________

Observacin de algas.
1.
2.
3.
4.
5.
6.

Champin

Observa el moho con una lupa o un microscopio estereoscpico.


Con la aguja de diseccin coloca una muestra del moho en un portaobjetos.
Coloca el corte en un portaobjetos y observa al microscopio.
Realiza esquemas de tus observaciones.

Colegio de Bachilleres del Estado de Sonora

4. Explica por qu cuando dejamos un alimento en ciertas condiciones de humedad se llena de hongo del tipo
moho.
__________________________________________________________________________________________
________________________________________________________________________

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

245

Biologa 1

Forma de nutricin
Las formas de nutricin que presentan los organismos que integran este dominio son variadas. Tales formas se
resumen en el siguiente cuadro.
Reino
Protista

Fungi

Descripcin
Dentro de las categoras de este reino, se tienen tres diferentes formas de nutricin, a
saber:
Algas: Autotrfica fotosinttica
Mohos acuticos y mohos deslizantes: heterotrfica
Protozoarios: heterotrfica (algunas formas son parsitas)
La principal forma de nutricin es saprfita y para que se lleve a cabo, es necesario,
que los hongos liberen enzimas, las cuales les permitirn digerir primeramente el
alimento de forma extracelular, es decir, fuera de su cuerpo, para posteriormente
absorber la materia orgnica procesada.
Tambin hay algunos hongos parsitos que causan enfermedades a plantas, animales y
al ser humano. Otros se asocian con individuos de especies diferentes para lograr un
beneficio comn, como es el caso de los lquenes (hongo-alga) y las micorrizas (races
de planta-hongo).

Plantae

Presentan nutricin auttrofa, es decir sintetizan su propio alimento (molculas


orgnicas), a partir de molculas inorgnicas (sales minerales y agua). La energa
necesaria para esta transformacin, es energa luminosa, que captan gracias a los
pigmentos fotosintticos, localizados en los cloroplastos.

Animal

Son hetertrofos, ya que obtienen sus nutrientes a partir de otros seres vivos, es decir,
se alimentan por ingestin.

Fungi. Habitan lugares hmedos, clidos, preferentemente oscuros. La mayora de las especies de este reino
sobreviven en un rango de temperaturas de 20 a 30C, otras pueden vivir a temperaturas inferiores a stas, como
las que sobreviven en los alimentos dentro de un refrigerador.
Plantae. Las plantas viven en diversos entornos, desde los climas ms fros, hasta los desiertos, los acuticos, los
rocosos, etc.
En particular, las briofitas pueden vivir en ambientes donde exista humedad, como por ejemplo las rocas desnudas,
el suelo y la corteza de los rboles. En el suelo de los bosques forman un estrato de naturaleza esponjosa que
retiene gran cantidad de agua; mientras que en las rocas y en el suelo desnudo actan junto con los lquenes, como
primeros colonizadores.
La distribucin de las pteridofitas en el planeta es muy amplia. En este grupo destacan los helechos, quienes
abundan en los pases intertropicales, algunas otras especies son cosmopolitas, como Iscopodium clavation, otras
han vuelto al medio acutico como Salvinia auriculata, una pequea planta herbcea que flota en el agua.
Estos organismos crecen en las fisuras de la roca y entre las piedras de los muros, en zonas sombras y, especialmente,
en las regiones montaosas.
Animalia. Aunque los animales se originaron en el mar, se han adoptado a toda clase de ambientes y a todos los
climas.

Cierre

ACTIVIDAD 1

Niveles de organizacin

SD5-B5

La complejidad u organizacin estructural de los individuos que integran este dominio puede ser unicelular o
pluricelular, de acuerdo con la siguiente tabla.
Reino

Complejidad u organizacin

Protista

La mayora unicelular

Fung

La mayora pluricelular

Plantae

Pluricelular

Animal

Pluricelular

De manera individual resuelve los siguientes crucigramas.


HORIZONTALES:
4. Tipo de nutricin en un organismo que realiza la
fotosntesis.
5. Grupo de animales conocidos como celentreos.
6. Tipo de digestin que se produce fuera de un
organismo.
8. Grupo de animales al que pertenecen los insectos
y araas.
9. Grupo de clulas que realizan una funcin
especfica.

Medio en que viven

VERTICALES:
1. Tipo de organismo formado por una sola clula.
2. Organismo que carece de ncleo.
3. Grupo de plantas al que pertenecen los musgos.
7. Las cinco grandes agrupaciones de seres vivos
existentes en la tierra.

Protistas. El medio ambiente en que viven es variado. Se les encuentra en ambientes hmedos, ambientes
marinos, ambientes de agua dulce y en tejidos acuosos de animales, como por ejemplo en el estmago de los
rumiantes colaborando con la digestin de nutrientes, otros son parsitos y algunas especies viven en simbiosis.
Constituyen la mayor parte del plancton o conjunto de organismos que viven flotando en la superficie del agua de
los ecosistemas acuticos.
246

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

247

Biologa 1

HORIZONTALES
1. Grupo al que pertenecen la mayora de las bacterias.
5. Elemento que es fijado por determinadas bacterias
del suelo.
7. Tipo de bacteria capaz de producir una enfermedad.
8. Compuesto que forma el caparazn de diatomeas
y algunos rizpodos.
9. Nombre cientfico del organismo productor de la
malaria.
VERTICALES
2. Grupo de bacterias fotosintticas que forman gran
cantidad de oxgeno atmosfrico.
3. Pigmento de color rojo tpico de las algas rojas.
4. Estructuras de resistencia que forman algunas
bacterias en condiciones difciles.
6. Tipo de algas pluricelulares que contienen
fucoxantina.

Inicio

La vida se expresa de infinitas formas diferentes, y a la gran variedad de formas de vida la llamamos biodiversidad.
Esta incluye a todos y cada uno de los seres vivos que habitan el planeta tierra.
Los cientficos piensan que hay alrededor de 10 millones de especies diferentes en el planeta, imagina lo difcil
que es estudiar y comprender las caractersticas, comportamiento y evolucin de todas las especies. Por mltiples
razones es necesario e importante ordenar toda esa enorme diversidad, y para hacerlo, primero es importante
clasificarla, lo cual desde el punto de vista biolgico, como ya se mencion en la segunda secuencia didctica de
este mismo bloque, clasificar no es otra cosa que ordenar a los seres vivos en grupos y subgrupos jerrquicamente,
basndose en caractersticas que tengan en comn.
Para entender mejor como se clasifican los seres vivos, te presentamos el siguiente ejemplo:
Todas las variedades de leones
pertenecen a la especie Panthera
Leo.

Los leones, tigres y leopardos


pertenecen al gnero Panthera.

Secuencia didctica 6
CLASIFICACIN
Los gneros Panthera, Felis
(gatos), Linx (linces), pertenecen
a la familia flidos.

ACTIVIDAD 1
SD6-B5

De manera individual contesta los siguientes dos cuestionamientos.


1. Describe brevemente porque es importante clasificar a los seres vivos.
__________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________
__________________________________________________________________________________________
_________________________________________________________________________________________

Las familias de los flidos,


cnidos (perros), rsidos (osos),
pertenecen al orden Carnvoros.

__________________________________________________________________________
2. Menciona porqu es importante que las especies tengan un nombre cientfico.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

248

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

249

Biologa 1

Clasifica a estos organismos con base a lo estudiado en el bloque anterior. Anota tus respuestas en el siguiente
cuadro.
Dominio
Reino
Subreino
Phyllum
Clase

Los rdenes carnvoros, roedores


(ardillas), primates (monos),
pertenecen a la clase mamferos.

La integracin del nivel taxonmico dominio, demand a los sistemticos revalorar los reinos clasificados en
los tres dominios actualmente establecidos, concluyndose que el sistema de clasificacin de los seres vivos, an
no es definitiva. Nuevos sistemas declasificacin van surgiendo y se van modificando a medida que se avanza en
el conocimiento de la diversidad biolgica.
Las investigaciones recientes establecen que ante las considerables diferencias entre plantas, animales y hongos,
ordenados ya jerrquicamente en reinos, es necesario tambin, que se asigne esta categora a grupos que se
derivaron del rbol de la vida antes que estos tres grupos de eucariotas. Los sistemticos reconocen alrededor de
15 reinos entre el dominio bacteria y tres o ms entre el dominio archaea.

Las clases mamferos, reptiles,


anfibios, pertenecen al phylum
cordados.

Estos mismos cientficos tambin reconocen reinos adicionales dentro del dominio eukaria, lo que refleja un
nmero de divisiones evolutivas muy tempranas dentro del conjunto diverso de eucariotas unicelulares antes
agrupados en el reino Protista. Sin embargo, los sistemticos an no llegan a un consenso en torno a las definiciones
precisas de los nuevos reinos procariota y eucariota. De manera que la clasificacin a nivel de reinos se encuentra
en un estado de transicin, en tanto se incorpora la informacin ms reciente.
En las ltimas dos dcadas, se ha realizado diversas investigaciones con la finalidad de resolver las relaciones dentro
del dominio eukaria. Aparentemente,la mayor parte de la diversidad biolgica de los eucariotas se encuentra entre
los protistas, y muchos cientficos creen que es sumamente inadecuado agrupar a todos los protistas en un solo
reino, como lo era en su momento agrupar a todos los procariotas dentro del reino monera, ya que no se trata de
un grupo monofiltico. Aunque se han propuesto muchos sistemas, ninguno de ellos ha ganado total aceptacin.

El phylum cordados y dems


animales, pertenecen al Reino
animal.

As mismo los avances realizados en el campo de la biologa molecular, han proporcionado nuevas tcnicas
e instrumentales que se han convertido en los mtodos ms poderosos para reconstruir la historia evolutiva o
filogenia de los seres vivos. En la actualidad, la filogenia se fundamenta en la secuencia del ADN o en la secuencia
de los aminocidos de las protenas que constituyen a los seres vivos.

ACTIVIDAD 1

La diferencia en el orden de los nucletidos en cada uno de los genes, es utilizada por los bilogos para identificar a
cada una de las especies que habitan el planeta. De aqu surgi la idea de crear una base de datos o de clasificacin,
con relacin al orden de dichos nucletidos, representada como cdigos de barra.

SD1-B1

En equipo de tres integrantes, enlisten 5 organismos vertebrados y 5 organismos invertebrados.


Organismos invertebrados

250

A continuacin, te presentamos ejemplos de estos cdigos de barra.

Organismos vertebrados

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

251

Biologa 1

Actualmente existen cuatro grandes sitios de internet que disponen de informacin actualizada respecto a los
ltimos avances en clasificacin de los organismos, y dos de ellos buscan elaborar un rbol de la vida que incluya
a toda la biodiversidad del planeta. En estos sitios, la clasificacin de los organismos a nivel de los reinos es
relativamente diferente a lo conocida actualmente, en lo que respecta a los 5 reinos. Se trata de clasificaciones
conteniendo solo grupos monofilticos de organismos.

Orden: carnvoros
Subtipo: vertebrados
Familia: flidos
Reino: animal
Tipo: cordados
Clase: mamferos
Superclase: tetrpodos
Especie: felis catus
Gnero: felis

A continuacin se describen estos sitios:


Navegador Taxonmico del NCBI (National Center for Biotechnology Information del Instituto
Nacional de Salud de EEUU -NIH-), donde se puede buscar la clasificacin taxonmica de cualquier ser
vivo conocido.

Sistema Integrado de Informacin Taxonmica (ITIS), diseado para proporcionar informacin


consistente y confiable sobre la taxonoma de las especies biolgicas.

Proyecto colaborativo Tree of life web proyect(TOL), el cual proporciona informacin sobre la diversidad
y la filogenia de la vida en la Tierra. Este proyecto comenz en 1995, y est escrito por bilogos de todo el mundo.
Proyecto Assembling the tree of life (ATOL), que es una iniciativa de la Fundacin Nacional para la Ciencia
(NSF) de EEUU, yque surgi posteriormente al proyecto TOL. Tambin es un proyecto que busca elaborar el
rbol de la vida, sin embargo, la informacin se encuentra organizada de manera diferente al proyecto TOL.

REACTIVOS DE CIERRE
1. Qu criterios se han empleado en el transcurso del tiempo para clasificar a los seres vivos?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

Cierre

2. Cul es la aportacin de Carlos Linneo en el campo de la sistemtica?


__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________

ACTIVIDAD 1

________________________________________________________________________

SD1-B1

3. Qu repercusiones biolgicas se desencadenaran si desaparecieran las plantas del planeta?

En diadas ordenen las categoras taxonmicas de mayor a menor jerarqua, planteadas para los siguientes seres
vivos.
Ser vivos

Categoras taxonmicas
(planteadas)

Categoras taxonmicas
(Ordenadas)

__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

Reino: plantae
Gnero: malus
Familia: rosaceae
Orden: rosales
Subclase: dicotiledonae
Clase: angiospermae
Divisin: tracheophyta

4. Qu acciones se pueden realizar en tu entorno escolar para promover la conservacin de la biodiversidad?


__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
________________________________________________________________________

252

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

253

Biologa 1

RBRICA DE EVALUACIN
Mapa mental
Criterio

Enfoque

Informacin

Organizacin
Excelente
90-100

Regular
60-69

Insuficiente
NA

El tema
principal se
presenta en
el centro,
utilizando
una palabra o
imagen con
poca relacin.

El tema
principal es
presentado por
una palabra
en el centro,
es difcil de
identificar que
se trata del
tema principal,
ya que no
se presenta
de forma
enfatizada.

El tema
principal no se
presenta en el
lugar correcto
y exhibe poca
relevancia.

El tema
principal no se
presenta en el
lugar correcto
ni de forma
enfatizada, por
lo que no existe
representacin
y organizacin
de la
informacin.

La informacin La informacin
presentada
presentada
corresponde
corresponde
a cada una de
a cada una de
las secuencias las secuencias
didcticas que didcticas que
conforman el
conforman el
bloque.
bloque.

La mayor
parte de la
informacin
corresponde a
la presentada
en cada una de
las secuencias
didcticas que
conforman el
bloque.

Solo una
parte de la
informacin
corresponde a
la presentada
en cada una de
las secuencias
didcticas que
conforman el
bloque.

Solo alguna
parte de la
informacin es
clara y precisa.

La informacin
presenta errores
y falta de
claridad.

El tema
principal se
presenta en
el centro,
de donde se
desprenden
las dems
ramificaciones.

Muy bien
80-89

Bueno
70-79

La informacin
La mayor
presentada es
parte de la
completamente informacin es
clara y precisa. clara y precisa.

Palabras
claves

254

Se manejan
conceptos
importantes,
destacando y
diferenciando
las ideas
principales de
las secundarias
por medio
de colores
diferentes,
subrayados,
recuadros u
otras formas.

Las palabras
clave se
destacan por
medio de
recuadros o
colores.

Slo algunas
palabras clave
aparecen
resaltadas para
destacar su
importancia.

Colegio de Bachilleres del Estado de Sonora

No se
distinguen
los conceptos
principales de
los secundarios,
ya que
presentan el
mismo formato.

La informacin
presentada no
corresponde
a la mostrada
en cada una de
las secuencias
didcticas del
bloque.

Los conceptos
no tienen
ninguna
relacin con
el tema, por lo
que el mapa
pierde su
concordancia
y relacin con
ste.

Puntos
Obtenidos

Imgenes

Creatividad

elementos
Los elementos Los
o imgenes
que componen
Los elementos
contenidas
el mapa mental
del
mapa estn
estn
No hay
se encuentran
poco
dispersos, organizacin
organizados
de
organizados
ya que no
de forma
ideas, por lo que
de forma
aparecen
pero
su comprensin
jerrquica con jerrquica,
organizados
conectores
es mnima.
conectores que los
segn
su
no
estn
del
hacen fcil su
relevancia.
todo bien
comprensin.
estructurados.

Los elementos
estn mal
organizados,
por lo que el
mapa pierde
sentido lgico
y no se puede
comprender.

Las imgenes
son ntidas y
claras, adems
de que son
representativas
del concepto
a comprender.
stas aparecen
colocadas
como el
movimiento de
las manecillas
de un reloj,
segn su
importancia.

Las imgenes
son ntidas y
claras, adems
de que son
representativas
del concepto
a comprender,
pero no estn
acomodadas
correctamente.

Las imgenes
son ntidas
pero no estn
relacionadas
con el tema y
aparecen poco
desordenadas.

Las imgenes
no se perciben
completamente,
aparecen
de forma
desordenada y
con poca o sin
relacin con el
tema.

Las imgenes
no presentan
nitidez,
aparecen
de forma
desordenada
y sin relacin
con el tema,
por lo que
no se puede
comprender la
informacin
que se desea
presentar.

Son utilizados
diferentes
imgenes,
trazos, colores
Se utilizan
y elementos
imgenes,
decorativos.
trazos y colores
Se exponen
diferentes en
las ideas de
su elaboracin, forma
original,
as como
por lo que se
elementos
observa gran
decorativos que imaginacin.
le hacen ser
Se puede
ms atractivo y
caer en la
entendible.
exageracin,
evitando
comprender la
informacin.

Contiene
muy pocas
imgenes,
trazos, colores
y elementos
decorativos
o son casi
nulos, por lo
que carece de
imaginacin y
no permiten la
comprensin
total de la
informacin
que se desea
transmitir.

No contiene
imgenes,
colores ni
elementos
decorativos o
son casi nulos,
por lo que la
informacin
que se pretende
transmitir no se
comprende.

Las imgenes,
trazos, colores
y elementos
decorativos no
tienen ninguna
relacin con
el tema, por lo
que el mapa
pierde su
creatividad
y el objetivo
para el que fue
diseado.

Nivel
Logrado

BLOQUE 5

Excelente

Muy bien

Bueno

Regular

Valoras la biodiversidad e identificas estrategias para preservarla

Insuficiente

255

Biologa 1

RBRICA DE EVALUACIN

RBRICA DE EVALUACIN

Reporte de investigacin.

Actividad experimental.
Nombre de la Actividad Experimental:

Nombre del docente:__________________________________________________


Grupo:______________________
Fecha:______________________
Equipo:_____________________
Criterios

Docente:

Niveles de desempeo
5

En la hoja de
presentacin, el
equipo anot:
nombre de la
institucin,
nombre completo
del trabajo,
integrantes,
docente
responsable.
Presentan texto
justificado,
letra arial 12
e interlineado
1.15, sin faltas de
ortografa, como
les fue solicitado.

En la hoja de
presentacin el
equipo anot:
nombre de la
institucin,
nombre
completo
del trabajo,
integrantes,
docente
responsable. Se
observan menos
de cinco faltas
de ortografa.

En la hoja de
presentacin, el
equipo anot:
nombre de la
institucin,
nombre completo
del trabajo,
integrantes,
docente
responsable.
Se observan
cinco faltas de
ortografa y
no se respeta
el formato
solicitado.

Le falta
informacin
solicitada a
la hoja de
presentacin. Se
observan ms
de cinco faltas
de ortografa
y no respetan
el formato
solicitado.

Le falta
informacin
solicitada a
la hoja de
presentacin.
Se observan
graves faltas
de ortografa
y no respetan
el formato
solicitado.

Redactan la
presentacin
general del
trabajo,
propsitos y
conclusin de la
investigacin en
una cuartilla.

Redactan la
presentacin
general y
propsitos
del trabajo de
investigacin.

Redactan la
presentacin
general del
trabajo.

Redactan una
introduccin
de slo uno de
las temticas
abordadas.

Presentan una
introduccin
de otro autor.

Desarrollo
del tema

Desarrollan
completamente
todos los puntos
solicitados, en
tres cuartillas.

Desarrollan
completamente
todos los puntos
solicitados, en
menos o ms de
tres cuartillas.

Desarrollan
incompletamente
los puntos
solicitados,
con algunos
errores en la
informacin.

Desarrollan
incompletamente
todos los puntos
solicitados, con
demasiados
errores en la
informacin

Desarrollan
un contenido
cercano
al tema
de forma
incorrecta e
imprecisa.

Conclusiones
y/o
reflexiones

Presentan
conclusiones o
reflexiones con
ideas claras y
sintetizadas,
aspectos
relevantes de
la investigacin
para su
aprendizaje.

Presentacin
del trabajo

Introduccin

Presentan
conclusiones o
reflexiones con
ideas claras y
sintetizadas
aspectos
irrelevantes de
la investigacin.

Describen
ideas sobre
algunos puntos
desarrollados en
la investigacin.

Colegio de Bachilleres del Estado de Sonora

Preparacin

Ejecucin de
la actividad

Describen
percepciones de
algn aspecto
investigado.

Total

256

Puntaje

Calificacin:
Nivel
Criterio

Describen
percepciones
irrelevantes y
desordenadas
de algn
aspecto
investigado.

Actitud de los
integrantes
del equipo

Respuesta a la
problemtica
planteada

Secuencia didctica:
Grupo

Fecha

Equipo N

Observaciones:
3

Traen el material
necesario en
buen estado para
el desarrollo
de la actividad
experimental y se
muestran totalmente
dispuestos para
trabajar.

Traen el material
necesario en
regular estado
para el desarrollo
de la actividad
experimental
y se muestran
totalmente
dispuestos para
trabajar.

Traen la mayora del


material necesario
en buen estado
para el desarrollo
de la actividad
experimental, pero
esto les impide el
estar completamente
dispuestos para
trabajar.

Traen algunos
de los materiales
necesarios en
regular estado
para el desarrollo
de la actividad
experimental, lo
que les impide el
estar completamente
dispuestos para
trabajar.

Los integrantes
del equipo, en casi
todo momento
se mantienen
enfocados en la
realizacin de
la actividad de
manera ordenada.

Solo dos o tres


de los integrantes
se enfocan en la
realizacin de
la actividad.
Estos integrantes
continuamente
invitan a sus
compaeros a
realizar la actividad
en conjunto.

Solo dos o tres de


los integrantes
se enfocan en la
realizacin de la
actividad, sin invitar
a sus compaeros a
realizar la actividad
en conjunto

Solo dos o tres


de los integrantes
se escuchan con
respeto y trabajan
en conjunto.
Ocasionalmente los
integrantes restantes
apoyan a sus
compaeros.

Solo dos o tres


de los integrantes
se escuchan con
respeto y trabajan
en conjunto. Los
integrantes restantes
esperan a que
estos desarrollen el
trabajo.

Se recabaron algunas
de las evidencias
adecuadamente por
lo que se responde
errneamente a la
pregunta planteada.

No se recab ningn
tipo de evidencia,
por lo que no
se responde a la
pregunta planteada.

Los integrantes
del equipo, en
todo momento se
mantienen enfocados
en la realizacin
de la actividad de
manera autodirigida
y ordenada.

Todos los integrantes


se escuchan con
respeto. Comparten
y apoyan el esfuerzo
de los dems.
Trabajan unidos en
todo momento.

Se recabaron
la totalidad de
las evidencias
adecuadamente por
lo que se responde
correctamente a la
pregunta planteada.

Todos Los
integrantes se
escuchan con
respeto. En
algunas ocasiones,
dependiendo de la
tarea, comparten y
apoyan el esfuerzo
de los dems,
por lo que no se
mantienen unidos
en todo momento.
Se recabaron
la mayora de
las evidencias
adecuadamente por
lo que se responde
parcialmente a la
pregunta planteada.

Puntos

Total

Puntos
Valoracin

BLOQUE 5

1-3
4

4-6
6

7-9
8

10-12
10

Total

Valoras la biodiversidad e identificas estrategias para preservarla

257

Biologa 1

FUENTES DE INFORMACIN

RBRICA DE EVALUACIN
Portafolio de evidencias.
Criterio/
Puntuacin

Bibliogrficas:
4

Faltan dos elementos


en la presentacin
del trabajo.

Carece de tres o
ms elementos
para la correcta
presentacin del
trabajo

Incluye nombre del


alumno, Institucin y
curso.
Portada

Incluye ttulo
sugerente en la
portada.

Puntaje

Calixto, R. H. (2008). Biologa ! Mxico : Progreso.


Falta un elemento
en la presentacin
del trabajo

Considera fecha y
lugar
El objetivo
del portafolio
considera slo
parcialmente
los contenidos
estudiados.

El objetivo del
portafolio no es
congruente con
los contenidos o
lecciones estudiadas.

Incluye todos los


tipos de evidencias
solicitadas.

Incluye algunas
de las evidencias
solicitadas.

Las evidencias
demuestran los
avances en los
aprendizajes
esperados.

Incluye la mayora
de las evidencias
solicitadas. Sin
embargo no todas
las evidencias
demuestran
claramente el
avance en los
aprendizajes
esperados.

Organizacin

Todos los documentos


estn correctamente
presentados: constan
de encabezado, son
claros y limpios.

A los documentos
les falta algn
elemento de la
presentacin.

A los documentos
les faltan ms de
dos elementos de
presentacin.

El documento solo
tiene un elemento
o ninguno de
presentacin.

Ortografa

El portafolio de
evidencias est
elaborado sin errores
ortogrficos.

Se observan hasta
cinco errores
ortogrficos.

Se observan de
6 a 10 errores
ortogrficos en el
portafolio

Se observan ms
de 10 errores
ortogrficos.

Evidencias

Espinosa, M. G. (2002). Biologa 1. Mxico : McGrawHill.


Fras, M. (2010). Biologa 1. Mxico, D.F: Nueva Imagen.
Gama, A. (2010). Biologa 1 COMPETENCIA+ APRENDIZAJE+VIDA. Mxico : PEARSON.

El objetivo representa
el aprendizaje
obtenido y la razn
por la cual se
estructuran de esa
forma las evidencias.

Objetivo

Audesirk, T., G, A., & Byers, B. (2004). BIOLOGIA CIENCIA Y NATURALEZA. Naucalpan, Estado de
Mxico: PEARSON Prentice Hall.

No tiene objetivo
explcito

Gama, A. (2011). Biologa 1 COMPETENCIAS+APRENDIZAJE+ VIDA. Mxico : Pearson.


Garca, F. M. (2007). Biologa 1. Mxico : Bachillerato Santillana.
Potos, C. d. (2008). Biologa 1. San Luis Potos.

Estas evidencias
demuestran
mnimamente el
avance en los
aprendizajes
esperados.

Incluye slo uno


o ninguna de
las evidencias
solicitadas,
sin demostrar
avance en los
aprendizajes.

Velzquez, M. (2010). Biologa 1. Mxico : ST-Editorial.

Total

258

Colegio de Bachilleres del Estado de Sonora

BLOQUE 5

Valoras la biodiversidad e identificas estrategias para preservarla

259