Está en la página 1de 329

C O L E C C I N

A N D A L U C A

Pruebas de Acceso a Ciclos Formativos


de Grado Superior

Exmenes Resueltos. Parte Especfica


OPCIN C

Prueba de Acceso
a Ciclos Formativos
de Grado Superior
(ANDALUCA)
EXMENES RESUELTOS

Parte Especfica
Opcin C

Servicios de Editorial MAD por internet


Te ofrecemos el complemento ideal a tu formacin

O N L I N E

EL AULA VIRTUAL DE EDITORIAL MAD

Cursos por internet


Tienes en tus manos un texto para prepararte, fruto de la experiencia de ms de 25 aos de
Editorial MAD en la preparacin de oposiciones. En l vas a encontrar los contenidos que
necesitas para prepararte las pruebas de seleccin.
Adems ahora te ofrecemos la posibilidad de contar con un apoyo extra para tu preparacin
a travs de e-duforma online, un sistema de tutorizacin para nuestros libros que est lleno de
ventajas:
Flexible: A travs de internet y sin horarios, de manera que puedes adaptar tus horarios
de estudio segn tus necesidades
y desde tu de
propia
casa.
(Sevilla, diciembre
2010)

O N L I N E

Personal: Con un Tutor personal que te guiar el estudio en funcin de tu evolucin y


capacidades.
Compromiso de preparacin: Con un sistema de evaluacin enfocado a resultados con
el que obtendrs un ndice de aciertos en el examen final entre un 80% y un 100%.
Con pruebas de evaluacin en tiempo real.
Total garanta de actualizacin mientras ests matriculado.
Con elementos que facilitarn tu aprendizaje: Biblioteca de legislacin, Foro de
discusin, Materiales adicionales, Glosario de trminos, Correo electrnico propio,
Consulta a tutores, Gua didctica, Tabln de noticias y Bases de datos de imgenes.
Economa: Con un precio muy inferior a otros sistemas de formacin presenciales.
Garanta: Con la garanta de Editorial MAD, empresa lder en la publicacin de textos
para oposiciones.

Si dispones de internet, e-duforma online es el apoyo


que esperabas para ayudarte en tu preparacin.
Consulta los cursos disponibles en:

www.eduformaonline.com
El camino hacia una formacin con xito

Solicita GRATIS informacin del curso que te interesa


eduformaonline@mad.es 902 111 163

Servicios de suscripcin gratuita


Informacin sobre oposiciones y sobre novedades editoriales en:
www.mad.es/suscripciones

Recuerda consultar nuestra web:

www.mad.es

Prueba de Acceso
a Ciclos Formativos
de Grado Superior
(ANDALUCA)
EXMENES RESUELTOS

Parte Especfica
Opcin C

C O L E C C I N

COORDINADOR
Miguel Baldomero Ramrez Fernndez

AUTORES
Miguel Baldomero Ramrez Fernndez
Ingeniero Tcnico Industrial/Ingeniero de Organizacin Industrial.
Profesor de Educacin Secundaria en Sevilla. Especialidad
Tecnologa.
Profesor Asociado de Informtica de Gestin y Sistemas de
Informacin de la Universidad Pablo de Olavide de Sevilla.
M. Inmaculada Concepcin Redondo Moreno
Licenciada en Biologa
Profesora de Educacin Secundaria. Especialidad: Fsica y Qumica

Editorial Mad, S.L.


Los autores

Primera edicin, junio 2011.


Derechos de edicin reservados a favor de EDITORIAL MAD, S.L.
Prohibida la reproduccin total o parcial sin permiso escrito del editor.
IMPRESO EN ESPAA.
Diseo Portada: EDITORIAL MAD, S.L.
Edita: EDITORIAL MAD, S.L.
P.E. Merka, c/ Merka Cuatro, 1-15. 41500 ALCAL DE GUADARA (Sevilla).
Telfono: 902 452 900
ISBN: 978-84-676-6425-6.

PRESENTACIN
El coordinador y los autores de este libro desean agradecer la confianza depositada en el mismo a
todos los estudiantes y compaeros que lo utilizarn, al igual que a esta editorial, que ha hecho posible su
publicacin.
Esta obra est basada en la Orden de 23 de abril de 2008, por la que se regulan las pruebas de
acceso a los ciclos formativos de Formacin Profesional y el curso de preparacin de las mismas, en la
Comunidad Autnoma de Andaluca (BOJA n. 90, de 7 de mayo de 2008). Los estudiantes de otras
Comunidades Autnomas debern tener en cuenta las diferentes pruebas en sus respectivas comunidades.
Los autores han pretendido caracterizar esta prueba de acceso de los ciclos de Formacin
Profesional de Grado Superior como un manual general vlido, donde se argumentan las soluciones,
para el repaso y la preparacin con xito de las mismas.
Por ltimo, queremos agradecer a nuestras familias el apoyo y la colaboracin que nos han
prestado para realizar este texto.
El coordinador y los autores

PRLOGO
Desde hace algunos aos tenemos un compromiso con la sensibilizacin y concienciacin de
los estudiantes que desean acceder a los ciclos formativos de grado medio y superior para adquirir
puestos de trabajo ms cualificados. Todo ello desde el convencimiento de la necesidad de encontrar
motivaciones, satisfacciones y oportunidades de crecimiento en lo personal y lo profesional, consistente
en el diseo de situaciones de aprendizaje en las que se desarrollan competencias y capacidades
soportadas por los distintos tipos de conocimiento, que contrastan fuertemente con el desarrollo
profesional que actualmente realizan los estudiantes.
Es una grata satisfaccin para los que iniciamos las primeras clases de preparacin a estas
pruebas de acceso el haber comprobado que existe una gran cantidad de alumnos con un compromiso
activo en la consecucin de una profesionalizacin de calidad en proceso de formacin inicial o
superior. Dicha satisfaccin se hace mucho mayor cuando se tiene conocimiento de textos como el
que tiene en sus manos. El texto que ojea, o cuya lectura pretende acometer, contiene el conocimiento
derivado de una decantada experiencia docente de jvenes profesores de distintas reas que, en un
ejercicio de profesionalidad, ponen al servicio de los estudiantes para, de este modo, facilitar su acceso
de forma exitosa a la condicin de nuevos tcnicos ms cualificados. Tambin, por otra parte, ofrecen
un posible modelo de referencia para el desarrollo de la prctica docente de otros compaeros de estos
cursos que lo necesiten.
La presente obra constituye una contribucin al material para la obtencin de la prueba
de acceso a los ciclos formativos con un cierto grado de xito. Este esfuerzo y compromiso ha de
ser continuado por las personas como usted que se incorporarn en breve en un nuevo proceso de
formacin o a las labores docentes de preparacin de las pruebas (que le darn tono y longevidad
entusiasta a su ciclo profesional).

Miguel Baldomero Ramrez Fernndez


Coordinador del proyecto

NDICE
mbito de Qumica
Examen 1........................................................................................................

15

Examen 2........................................................................................................

27

Examen 3........................................................................................................

35

Examen 4........................................................................................................

45

Examen 5........................................................................................................

53

Examen 6........................................................................................................

64

Examen 7........................................................................................................

73

Examen 8........................................................................................................

82

Examen 9........................................................................................................

94

mbito de Biologa
Examen 1........................................................................................................

111

Examen 2........................................................................................................

124

Examen 3........................................................................................................

137

Examen 4........................................................................................................

148

Examen 5........................................................................................................

160

Examen 6........................................................................................................

169

Examen 7........................................................................................................

184

Examen 8........................................................................................................

199

Examen 9........................................................................................................

216

mbito de Fsica
Examen 1........................................................................................................

237

Examen 2........................................................................................................

244

Examen 3........................................................................................................

253

Examen 4........................................................................................................

262

Examen 5........................................................................................................

270

Examen 6........................................................................................................

278

Examen 7........................................................................................................

293

Examen 8........................................................................................................

307

Examen 9........................................................................................................

318

mbito de
Qumica

EXAMEN N. 1
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: QUMICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente los enunciados antes de contestar a las cuestiones y de


resolver los problemas.
La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.
Podrn utilizarse calculadoras no programables. No se podr utilizar ningn
otro instrumento electrnico.
Es muy importante que expreses los resultados de los problemas en las
unidades correspondientes.

1. Completa la siguiente tabla: (2,5 puntos)

NOMBRE

FRMULA

3-etil-2-hexeno
Al2O3
Hidruro de nquel (III)
H2CO3
cido sulfhdrico
NH3
Trixido de azufre
CH3COOH
Perxido de litio
Ba(OH)2

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

15

PRUEBAS DE ACCESO A CFGS

2. Clasifica las siguientes frases segn se refieran a sustancias moleculares, covalentes, metlicas o inicas. (2,5 puntos)
Estn formadas por cationes y aniones.
Son maleables y dctiles.
A temperatura ambiente se presentan en estado gaseoso..
En estado slido son buenas conductoras elctricas.
Son solubles en disolventes orgnicos y malas conductoras de electricidad.

3. a) El propano, CH3-CH2-CH3, es un gas empleado como combustible.


Calcula el porcentaje de C e H que contiene una molcula de propano. (1,25 puntos)
b) Un compuesto orgnico tiene un 82,75% de carbono y un 17,25% de
hidrgeno. Cul es su frmula molecular si su masa molecular es 58 u?
(1,25 puntos)
Datos: Masas atmicas, C = 12 u ; H = 1 u.

RESULTADO: a)

b)

4. La roca caliza, muy usada en la construccin, est formada por carbonato clcico, el cual se descompone por el calor dando lugar a xido
clcico segn la siguiente reaccin:
Ca CO3 ------> CaO + CO2
Si se descomponen por el calor 2 kg de carbonato clcico, calcula el
volumen que ocupar el dixido de carbono obtenido, medido a 27 C y
0,9 atm de presin. (2,5 puntos)
Datos: R = 0,082 atm L / Kmol Masas atmicas, C = 12 u; O = 16 u; Ca = 40 u; O = 16 u.

16

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. Completa la siguiente tabla: (2,5 puntos)
NOMBRE

FRMULA

3-etil-2-hexeno
Al2O3
Hidruro de nquel (III)
H2CO3
cido sulfhdrico
NH3
Trixido de azufre
CH3COOH
Perxido de litio
Ba(OH)2

Solucin
NOMBRE

FRMULA

3-etil-2-hexeno

CH2 CH3
|
CH3 CH = C CH2 CH2 CH3

(Sist.) Trixido de aluminio


(Stock) xido de dialuminio (III)
(Sist.) Trihidruro de nquel
(Stock) Hidruro de nquel (III)
(Sist.) Trioxocarbonato de dihidrgeno
(Stock) cido trioxocarbnico (IV)
(tradicional) cido carbnico

Al2O3
NiH3

H2CO3
.../...

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

17

PRUEBAS DE ACCESO A CFGS

.../...
(Sist.) Sulfuro de hidrgeno
(Tradicional) cido sulfhdrico

H2S

(Sist.) Trihidruro de Nitrgeno


(Tradicional) Amoniaco

NH3

(Sist.) Trixido de azufre


(Stock) xido de azufre (VI)
(tradicional) Anhdrido sulfrico
(en deshuso)

SO3

cido actico
cido etanoico

CH3COOH

(Stock) Perxido de litio


(tradicional) Perxido de litio
(Stock) Hidrxido de bario

Li2O2
Ba(OH)2

Explicacin
Informacin adicional sobre nomenclatura inorgnica.
a. Nomenclatura sistemtica
a.1. Se utilizan prefijos numerales griegos hasta doce, y de trece en adelante nmeros rabes: mono, di, tri, tetra, penta, hexa, hepta, octa,
enea, deca, endeca, dodeca, 13, 14
a.2. Estn permitidos tambin hemi para la relacin 1:2 y sesqui para 2:3.
a.3. Los grupos de tomos se indican mediante prefijos numricos multiplicativos (bis, tris, tetraquis...) sobre todo si el nombre del grupo
incluye otros prefijos numerales.
En los perxidos no se utiliza la nomenclatura sistemtica.
b. Nomenclatura de Stock
Se coloca la valencia o nmero de oxidacin en nmeros romanos, entre parntesis, a continuacin del nombre del elemento. Cuando sea necesario se utiliza
el nmero rabe cero. Si la valencia es constante no es necesario indicarla.
La nomenclatura de Stock es preferible no utilizarla en los compuestos binarios entre no metales, por eso no se utilizar en los hidruros de los no metales.
En los compuestos metal - no metal, se puede usar la nomenclatura de
Stock, pero se recomienda usar la nomenclatura sistemtica.
18

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

c. Nomenclatura tradicional o clsica


Es el sistema ms antiguo y consiste en designar el estado de mayor valencia
por la terminacin ico y el de menor valencia mediante la terminacin oso; y
cuando existe un solo nmero de valencia puede emplearse la terminacin ico.
Su utilizacin es confusa cuando el elemento tiene ms de dos valencias y
no es aplicable a los compuestos de coordinacin. Adems, exige recordar
todas las valencias. Por tradicin sigue utilizndose, pero la IUPAC ha desaconsejado su uso.

Pregunta
2. Clasifica las siguientes frases segn se refieran a sustancias moleculares, covalentes, metlicas o inicas. (2,5 puntos)
Estn formadas por cationes y aniones.
Son maleables y dctiles.
A temperatura ambiente se presentan en estado gaseoso.
En estado slido son buenas conductoras elctricas.
Son solubles en disolventes orgnicos y malas conductoras de electricidad.

Solucin
Estn formadas por cationes y aniones.

inicas

Son maleables y dctiles.

metlicas

A temperatura ambiente se presentan en estado gaseoso.

moleculares

En estado slido son buenas conductoras elctricas.

metlicas

Son solubles en disolventes orgnicos y malas conductoras de electricidad.

covalentes

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

19

PRUEBAS DE ACCESO A CFGS

Explicacin
Principales caractersticas de las sustancias inicas, covalentes y moleculares.
Las principales caractersticas de las sustancias inicas son:

Estn formados por cationes y aniones.

Son slidos a temperatura ambiente.

En estado slido no conducen la electricidad. Pero son buenos conductores


del calor y la electricidad cuando estn disueltos en agua o cuando se funden.

Tienen altos puntos de fusin y ebullicin.

Son solubles en disolventes polares como el agua.

Son duros y resistentes al rayado.

Los slidos covalentes o redes covalentes:


a. Se diferencian de las sustancias moleculares en que:

Son slidos a temperatura ambiente.

Tienen puntos de fusin y ebullicin muy elevados.

Son muy duros y oponen resistencia al rayado.

b. Tienen tambin similitudes con las sustancias moleculares:

Son malos conductores del calor y la electricidad.

Son insolubles en agua.

Forman enlaces covalentes.

Las sustancias moleculares presentan enlaces covalentes, pero no forman macromolculas. Sus principales caractersticas son:

Tienen puntos de fusin y ebullicin bajos.

Son fundamentalmente lquidos y gases a temperatura ambiente.

No conducen la electricidad.

Son malos conductores del calor.

Son insolubles en agua.

Las principales caractersticas que presentan las sustancias metlicas son:

20

Temperatura de fusin y ebullicin muy elevadas.

Son dctiles y maleables.

Suelen ser slidos a temperatura ambiente, excepto el mercurio.


EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Tienen brillo metlico.

Son generalmente muy duros.

Se oxidan con facilidad.

Son buenos conductores trmicos y elctricos.

Cuando reciben luz tienen efecto fotoelctrico.

Emiten electrones cuando reciben calor.

Pregunta
3. a) El propano, CH3-CH2-CH3, es un gas empleado como combustible.
Calcula el porcentaje de C e H que contiene una molcula de propano. (1,25 puntos)
b) Un compuesto orgnico tiene un 82,75% de carbono y un 17,25% de
hidrgeno. Cul es su frmula molecular si su masa molecular es 58 u?
(1,25 puntos)
Datos: Masas atmicas, C = 12 u; H = 1 u.

Solucin
a) El propano, CH3-CH2-CH3, es un gas empleado como combustible. Calcula el porcentaje de C e H que contiene una molcula de propano.
(1,25 puntos)
La frmula molecular del propano es C3H8.
Conociendo la masa atmica relativa del C =12 u, la masa molar total de
C=36 g/mol.
Si la masa atmica relativa del H=1u, la masa molar total de H=8 g/mol.
Luego la masa molecular relativa del C3H8= 44 g/mol.
Para calcular el porcentaje de C y de H presentes en la molcula, bastar con dividir cada una de las masas atmicas relativas entre la masa molecular relativa.
Luego la cantidad de C presente en una molcula de propano es 36/44, es
decir, el 81,81% en masa, y la cantidad de H presente en la molcula de
propano es 8/44, es decir, el 18,18% en masa.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

21

PRUEBAS DE ACCESO A CFGS

b) Un compuesto orgnico tiene un 82,75% de carbono y un 17,25% de hidrgeno. Cul es su frmula molecular si su masa molecular es 58 u?
(1,25 puntos)
La frmula emprica del compuesto ser CxHy, donde se tiene que determinar los subndices x e y.
Conociendo la masa atmica relativa del C = 12 u y su riqueza igual al
82,75% en masa, y la masa atmica relativa del H igual a 1 u y su riqueza
igual al 17,25% en masa, se divide la riqueza de cada uno de los compuestos entre su masa relativa:
C: 82,75/12 = 6,8
H: 17,25/1 = 17,25
Se toma como referencia el ms pequeo de los resultados para calcular la
proporcionalidad entre ellos:
C: x = 6,8/6,8 = 1
H: y = 7,25/6,8 = 2,5
Luego por cada molcula de C habr 2,5 de H. La frmula emprica de la
molcula ser: (C2H5)n.
Para calcular la frmula molecular se debe averiguar el valor de n. Para
ello se calcula la masa molecular relativa de la molcula suponiendo n=1.
C2H5 que es 12 2 + 5 1 = 29u.
Si la masa molecular relativa de la molcula que se plantea en el enunciado
del problema es 58u, entonces se tiene:
58 / 29 = 2 = n.
Luego la frmula molecular es C4H10, que posiblemente corresponde al Butano.
CH3 - CH2 - CH2 - CH3

Explicacin
Definicin de masa molar
La masa molar de una sustancia pura es una magnitud cuyo valor numrico
coincide con el de la masa correspondiente a un mol de las entidades elementales
que conformen dicha sustancia. Esta magnitud se designa por la letra (M), si
bien la experiencia educativa nos muestra que los alumnos suelen confun22

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

dirla con la Molaridad tambin designada con la letra (M), es por eso que en
este texto, quizs de manera poco ortodoxa, y siempre indicndolo previamente designaremos a la masa molar como (Mn).
La masa molar se suele expresar en g/mol. Su valor numrico coincide con el
de la masa molecular relativa si se trata de molculas o agregados de iones, o con
el valor de la masa atmica relativa en el caso de ser tomos simples.
Determinacin de frmulas empricas y moleculares
La frmula emprica de un compuesto indica la proporcin que existe entre los tomos de los diferentes elementos que lo forman. La frmula molecular indica con exactitud cuntos tomos de cada clase forman la unidad estructural de un compuesto.
En la mayora de los compuestos inorgnicos coinciden las frmulas molecular y
emprica. Sin embargo, no suelen coincidir en la mayora de los compuestos orgnicos.
No obstante, la frmula molecular es un mltiplo (n) de la frmula emprica.
Determinacin de la frmula emprica
De acuerdo con la Ley de las proporciones constantes, cuando dos elementos
se combinan para dar un compuesto, la razn entre las masas que la componen
es siempre constante:
masa del elemento Q
= Constante (C)
masa del elemento R
Segn el modelo atmico-molecular, si se conoce el valor de C y las masas
atmicas de Q y R, es posible determinar los valores ms sencillos de x e y, de
manera que la frmula queda: QxRy.
Si se llama mQ y mR a las masas de un solo tomo de Q y R, se puede decir que para
cualquier cantidad de compuesto que contenga N unidades de QxRy se cumplir que:
C=

masa del elemento Q


mQ x N
=
masa del elemento R
mR y N

Si se deduce la masa del elemento Q como su masa relativa con respecto a la


masa del H (que es el elemento de referencia por ser el ms ligero de todos):
C=

AQ mH x N
AQ x
=
AR mH y N
AR y
x
AR
= C
y
AQ

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

23

PRUEBAS DE ACCESO A CFGS

Dividiendo ahora el numerador y el denominador por el menor de ellos, se


puede obtener la proporcin de nmeros enteros ms sencilla entre x e y y, por
tanto, la frmula emprica.
Una vez conocida la formula emprica QxRy, la frmula molecular ser (QxRy)n.
Sabiendo la masa molecular de cada uno de los componentes y los valores de
x e y, se calcula la masa molecular total y se divide entre el valor de masa total
que plantea el problema, con lo que se obtiene el valor de n.

Pregunta
4. La roca caliza, muy usada en la construccin, est formada por carbonato clcico, el cual se descompone por el calor dando lugar a xido
clcico segn la siguiente reaccin:
Ca CO3 ------> CaO + CO2
Si se descomponen por el calor 2 kg de carbonato clcico, calcula el
volumen que ocupar el dixido de carbono obtenido, medido a 27 C y 0,9
atm de presin. (2,5 puntos)
Datos: R = 0,082 atm L / Kmol. Masas atmicas, C = 12 u; O = 16 u;
Ca = 40 u; O = 16 u.

Solucin
Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

En primer lugar se tiene que calcular la masa molar relativa del CaCO3.
Mm(CaCO3) = 40 + 12 + (16 3) = 100
Adems, se tienen que hacer las siguientes transformaciones:
Tk = Tc + 273; luego: T = 27 C = 300K
m = 2 kg = 2000 g
Para calcular el volumen de CO2, se tiene que usar la ecuacin general de los gases:
PV=nRT
Donde:
V=

24

n R T
P

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Siendo V el volumen de CO2 y n el nmero de moles de soluto.


Dado que:
n=

m
Mn

Y que en la reaccin se formar 1 mol de CO2 por cada mol de CaCO3 se puede
decir que la proporcin entre los moles de soluto del CaO3 y los moles de soluto del
CO2 ser 1/1. Luego, por tanto:
n ( CO2 )

n ( CaCO3 )

= 1 n ( CO2 ) = n ( CaCO3 ) =

m ( CaCO3 )

Mn ( CaCO3 )

n ( CO2 ) =

2000
20 moles de CO2
100

Sustituyendo en la ecuacin general de los gases:


V=

20 moles 0, 082 ( atm L / K mol ) 300 K


0, 9 atm

= 546, 66 L

Explicacin
La ecuacin de los gases perfectos
Se considera que un gas es ideal si se trata de un gas hipottico formado por
partculas puntuales, que no muestran atraccin ni repulsin entre ellas y cuyas
colisiones son perfectamente elsticas, adems el nmero de molculas es despreciable comparado con el volumen total del gas.
Los gases reales que ms se aproximan al comportamiento ideal son los gases
monoatmicos en condiciones de baja presin y alta temperatura. As evitando
temperaturas extremadamente bajas y presiones muy elevadas se puede considerar que los gases reales se comportan como gases ideales.
La ecuacin se basa en las relaciones observadas entre temperatura, presin
y volumen:
PV = nRT
Donde R es la constante universal de los gases ideales (0,082 atm.L/(K.mol));
n es el nmero de moles de gas; P la presin medida en atm; V el volumen; y T la
temperatura medida en la escala Kelvin.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

25

PRUEBAS DE ACCESO A CFGS

Como la cantidad de sustancia puede ser dada en moles, a veces es til usar la
relacin entre el n. de moles (n), la masa (m) y la masa molar (Mm):
n=

m
Mn

De manera que la ecuacin quedara de la siguiente manera:


P V =

m R T
Mn

Si adems se considera que:


d=

m
V

Se puede deducir que:


P=

dRT
Mn

Donde 1 atm es igual a 760 mmHg.


Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

26

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

EXAMEN N. 2
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: QUMICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente los enunciados antes de contestar a las cuestiones y de


resolver los problemas.
La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.
Podrn utilizarse calculadoras no programables. No se podr utilizar ningn
otro instrumento electrnico.
Es muy importante que expreses los resultados de los problemas en las
unidades correspondientes.

1. Completa la siguiente tabla: (2,5 puntos)

NOMBRE

FRMULA

3-Pentanona
LiH
Nitrito de hierro (II)
K2HPO4
cido clorhdrico
Al(OH)3
Perxido de cobre (II)
CH3COOCH2CH3
xido de magnesio
H2SO3

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

27

PRUEBAS DE ACCESO A CFGS

2. Completa la siguiente tabla representando mediante diagramas de Lewis


las siguientes molculas covalentes: (2,5 puntos)
MOLCULAS COVALENTES

DIAGRAMAS DE LEWIS

HI
CH4
Cl2
NH3
O2

3. Juan desea preparar una disolucin de hidrxido de sodio, NaOH, conocido


vulgarmente como sosa. Para ello pesa 8 gramos de hidrxido de sodio y
lo mezcla con agua destilada en un recipiente hasta obtener 250 mL de disolucin. Cul es la concentracin molar de esta disolucin? (2,5 puntos)
Datos: Masas atmicas, Na = 23 u; O = 16 u; H = 1 u.

RESULTADO:

4. Los cidos reaccionan con las rocas calizas desprendiendo dixido de carbono, CO2. Sabiendo que la caliza est formada por carbonato de calcio, CaCO3
e impurezas, calcula la cantidad de caliza del 95% de pureza en CaCO3 que
podr reaccionar con 100 ml de cido clorhdrico 2 M. (2,5 puntos)
La reaccin es: CaCO3 + 2 HCl ----> CaCl2 + CO2 + H2O
Datos de masas atmicas: Ca = 40 u ; H = 1 u ; O = 16 u ; Cl = 35,5 u; C = 12 u.

28

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. Completa la siguiente tabla: (2,5 puntos)
NOMBRE

FRMULA

3-Pentanona
LiH
Nitrito de hierro (II)
K2HPO4
cido clorhdrico
Al(OH)3
Perxido de cobre (II)
CH3COOCH2CH3
xido de magnesio
H2SO3

Solucin
NOMBRE
3-Pentanona
Dietilcetona
(Sist.) Hidruro de litio
(Stock) Hidruro de litio

FRMULA
CH3 CH2 C CH2CH3
||
O
LiH

Nitrito de hierro (II)

Fe(NO2)2

(Sist.) Hidrogenotetraoxofosfato de dipotasio


(Stock) Hidrogenofosfato (V) de potasio
(tradicional) Bifosfato de potasio / fosfato monocido de potasio (en deshuso)

K2HPO4
.../...

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

29

PRUEBAS DE ACCESO A CFGS

.../...
cido clorhdrico

HCl

(Sist.) Trihidrxido de aluminio


(Stock) Hidrxido de aluminio

Al(OH)3

Perxido de cobre (II)

CuO2

Etanoato de etilo
Acetato de etilo

CH3COOCH2CH3

xido de magnesio

MgO

(Sist.) Trioxosulfato (IV) de dihidrgeno


(Stock) cido trioxosulfrico (IV)
(Tradicional) cido sulfuroso

H2SO3

Pregunta
2. Completa la siguiente tabla representando mediante diagramas de Lewis
las siguientes molculas covalentes: (2,5 puntos)

MOLCULAS COVALENTES

DIAGRAMAS DE LEWIS

HI
CH4
Cl2
NH3
O2

30

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: Qumica

Solucin

MOLCULAS COVALENTES

DIAGRAMAS DE LEWIS

HI

CH4
Cl2
NH3
O2

Explicacin
Representacin de Lewis
Con el fin de observar mejor las variaciones que pueden sufrir los electrones de
valencia al unirse unos tomos con otros, se recurre a representar el resto atmico
mediante el smbolo del elemento en cuestin y a los electrones de valencia como
punto, cruces o crculos que le rodean. La posicin de los puntos es arbitraria, pudiendo estar en cualquier lado del smbolo.
A partir de los elementos de la tercera columna de la tabla peridica, se suelen
representar todos los electrones para completar el octeto (pares enlazantes y pares
solitarios o no enlazantes).
A diferencia de los compuestos inicos en los enlaces covalentes, no se produce una transferencia de electrones, sino que el mecanismo base es la comparticin
de electrones, que permite que cada tomo adquiera la distribucin electrnica
estable de un gas noble.
Este enlace se produce mediante la comparticin de electrones sin que se
formen iones.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

31

PRUEBAS DE ACCESO A CFGS

Pregunta
3. Juan desea preparar una disolucin de hidrxido de sodio, NaOH, conocido
vulgarmente como sosa. Para ello pesa 8 gramos de hidrxido de sodio y
lo mezcla con agua destilada en un recipiente hasta obtener 250 mL de disolucin. Cul es la concentracin molar de esta disolucin? (2,5 puntos)
Datos: Masas atmicas, Na = 23 u; O = 16 u; H = 1 u.

Solucin
Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

Para calcular la concentracin molar M de una sustancia en una disolucin, hay


que dividir la cantidad de sustancia de soluto ns (expresada en moles de soluto
puro) por el volumen V de la disolucin (expresada en litros).
Por tanto:
M=

ns
v

El nmero de moles de soluto se puede calcular como:


ns =

m
Mn

Siendo m la masa de soluto (en gramos) y Mm su masa molar (en gramos/mol),


de modo que sustituyendo la ecuacin se tiene:
M=

m Mm
V

Se calcula la masa molar del NaOH, es decir, 23+16+1 = 40 g/mol.


Se transforman las unidades de volumen:
250 ml = 0,25L
Se sustituye en la ecuacin anterior y queda:
M=

32

8 g / 40 g / mol
8g
=
= 0, 8 moles / L
0, 25 L
40 g / mol 0, 25 L
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: Qumica

Clculo de la concentracin de una disolucin mediante la molaridad


Una forma de expresar la concentracin de una sustancia en una disolucin es
mediante la molaridad, cuyo valor coincide con el nmero de moles de soluto
existentes por cada litro de disolucin.
Cuantos ms moles de soluto haya por cada litro de disolucin, mayor ser la
concentracin.
La molaridad se mide en moles de soluto/litro de disolucin y puede designarse
por la letra M.

Pregunta
4. Los cidos reaccionan con las rocas calizas desprendiendo dixido de carbono, CO2. Sabiendo que la caliza est formada por carbonato de calcio, CaCO3
e impurezas, calcula la cantidad de caliza del 95% de pureza en CaCO3 que
podr reaccionar con 100 ml de cido clorhdrico 2 M. (2,5 puntos)
La reaccin es: CaCO3 + 2 HCl ----> CaCl2 + CO2 + H2O
Datos de masas atmicas: Ca = 40 u; H = 1 u; O = 16 u; Cl = 35,5 u; C = 12 u.

Solucin
Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

En primer lugar, se calcula la masa molar Mm del CaCO3 y del HCl, es decir:
Mm(CaCO3) = 40+12+16x3 = 1 00 g/mol
Mm(HCl) = 1+35,5 = 36,5 g/mol
A continuacin, se calcula el nmero de moles de soluto del HCl a partir de la
concentracin y el volumen.
M=

ns
v

Luego, n(HCl) = M V
Se transforman las unidades de volumen, es decir, 100 ml = 0,1 L
N(HCl) = 2 moles/L 0,1 L = 0,2 moles
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

33

PRUEBAS DE ACCESO A CFGS

Por la reaccin se sabe que por cada mol de CaCO3 reaccionan 2 de HCL.
Luego:
n ( HCl )

n ( Ca CO3 )

= 2n ( Ca CO3 ) =

0, 2 moles
= 0,1 moles
2

Por otro lado, se sabe que:


n ( Ca CO3 ) =

m ( Ca CO3 )

Mn ( Ca CO3 )

De donde se puede despejar la masa:


m(CaCO3)=n(CaCO3) Mm(CaCO3) = 0,1 moles 100g/mol = 10 g
Si el CaCO3 forma el 95% de la caliza, entonces se puede calcular la cantidad
de caliza por una simple regla de tres.
mcaliza =

34

10 g 100
= 10, 52 g
95

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

EXAMEN N. 3
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: QUMICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente los enunciados antes de contestar a las cuestiones y de


resolver los problemas.
La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.
Podrn utilizarse calculadoras no programables. No se podr utilizar ningn
otro instrumento electrnico.
Es muy importante que expreses los resultados de los problemas en las
unidades correspondientes.

1. Completa la siguiente tabla: (2,5 puntos)


NOMBRE

FRMULA

Tetracloruro de silicio
MgO2
Butanonitrilo
CH3CH2COCH3
Bromuro niqulico
CH3COOCH3
Dietilter
CH3NHCH2CH3
cido sulfrico
LiOH
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

35

PRUEBAS DE ACCESO A CFGS

2. Marca con X en la casilla correspondiente segn consideres las siguientes frases verdaderas (V) o falsas (F): (2,5 puntos)
V

El enlace que se forma en el KBr es covalente.


Entre las molculas de H2O aparecen puentes de hidrgeno.
En la molcula de H2O el enlace que se forma es covalente.
El KBr es buen conductor en estado slido.
El I2 es una molcula polar.

3. En la reaccin: NaCl + AgNO3 -----> AgCl + NaNO3


a) Qu masa de cloruro de plata puede obtenerse a partir de 100 mL
de nitrato de plata 0,5 M? (1,25 puntos)
b) Calcula los gramos de cloruro de sodio que haran falta para obtener
10 g de nitrato de sodio. (1,25 puntos)
Datos. Masas atmicas: N = 14 u ; O = 16 u ; Na = 23 u ; Cl = 35,5 u; Ag = 108 u.

RESULTADO: a)

b)

4. Indica, marcando con X en la casilla correspondiente, si las siguientes


afirmaciones son verdaderas (V) o falsas (F), y escribe la frase correcta
en las que consideres falsas (tienes que calcular la cantidad correcta y
ponerla). (2,5 puntos)
V

FRASE CORRECTA

El nmero atmico del U es 92, con


lo que tiene 92 protones
.../...
36

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

.../...
El nmero msico del U es 234 y su
nmero atmico 92, con lo que tiene
326 neutrones
El nmero msico del U es 234 y su
nmero atmico 92, con lo que tiene
92 electrones
El F tiene de nmero msico 19 y de
nmero atmico 9, con lo que tiene
19 protones
El F tiene de nmero msico 19 y de
nmero atmico 9, con lo que tiene
19 neutrones
Clculos:

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

37

SOLUCIONES

Pregunta
1. Completa la siguiente tabla: (2,5 puntos)
NOMBRE
Tetracloruro de silicio

FRMULA
MgO2

Butanonitrilo
CH3CH2COCH3
Bromuro niqulico
CH3COOCH3
Dietilter
CH3NHCH2CH3
cido sulfrico
LiOH

Solucin
NOMBRE
Tetracloruro de silicio
(Stock) Perxido de magnesio
(Tradicional) Perxido magnsico
(no se utiliza la nomenclatura sistemtica)
Butanonitrilo
Butanona
Etilmetilcetona
Bromuro niqulico
Acetato de metilo
Dietilter
Etil metil amina
cido sulfrico
Hidrxido de litio
38

FRMULA
SiCl4
MgO2
CH3-CH2-CH2-C{N
CH3CH2COCH3
NiBr3
CH3COOCH3
CH3- CH2- O - CH2- CH3
CH3NHCH2CH3
H2SO4
LiOH

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Pregunta
2. Marca con X en la casilla correspondiente segn consideres las siguientes frases verdaderas (V) o falsas (F): (2,5 puntos)

El enlace que se forma en el KBr es covalente.


Entre las molculas de H2O aparecen puentes de hidrgeno.
En la molcula de H2O el enlace que se forma es covalente.
El KBr es buen conductor en estado slido.
El I2 es una molcula polar.

Solucin

El enlace que se forma en el KBr es covalente.

Entre las molculas de H2O aparecen puentes de hidrgeno.

En la molcula de H2O el enlace que se forma es covalente.

El KBr es buen conductor en estado slido.

El I2 es una molcula polar.

Explicacin

El enlace KBr es inico.


El KBr en estado slido no conduce la electricidad. Pero son buenos conductores del calor y la electricidad cuando estn disueltos en agua o cuando
se funden.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

39

PRUEBAS DE ACCESO A CFGS

El I2 es apolar. En un enlace qumico entre dos tomos o grupos idnticos,


los electrones que forman el enlace estn distribuidos uniformemente entre
ambos tomos o grupos, por lo que el compuesto es apolar o neutro. Por el
contrario, cuando los tomos o grupos tienen una electronegatividad diferente, los electrones estarn desplazados hacia el tomo ms electronegativo
dndoles carcter polar negativo frente al otro que constituye el polo positivo.

La molcula de agua est formada por dos tomos de hidrgeno (H) unidos
a un tomo de oxgeno (O) mediante dos enlaces covalentes. El ngulo que
forman los dos enlaces es de 104,5o. El O es ms electronegativo que el H,
por lo que atrae con mayor fuerza a los electrones de cada enlace.

Como resultado la molcula de agua presenta una distribucin asimtrica aunque su carga total es neutra. Eso lo convierte en una molcula polar, de forma que
alrededor del O se concentra una densidad de carga negativa, mientras que los
ncleos de H presentan una densidad de carga positiva al quedar parcialmente
desprovistos de electrones.
Las molculas de agua se unen mediante puentes de hidrgeno. Se produce debido a las interacciones dipolo-dipolo. La carga parcial negativa del
oxgeno de una de las molculas ejerce una atraccin electrosttica sobre las
cargas parciales positivas de los tomos de hidrgeno de las molculas prximas, formndose grupos de 3, de 4 y de hasta unas 9 molculas. Con ello
el agua alcanza pesos moleculares elevados y se comporta como un lquido.
Las agrupaciones duran fracciones de segundo (de 10-10 a 10-21 s). Pero esto
confiere al agua todas las propiedades de un fluido. Los polmeros coexisten
con molculas sueltas que rellenan los huecos.

Figura 1. Enlaces covalentes polares

Figura 2. Molcula polar

40

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Pregunta
3. En la reaccin: NaCl + AgNO3 -----> AgCl + NaNO3
a) Qu masa de cloruro de plata puede obtenerse a partir de 100 mL de
nitrato de plata 0,5 M? (1,25 puntos)
b) Calcula los gramos de cloruro de sodio que haran falta para obtener 10 g
de nitrato de sodio. (1,25 puntos)
Datos de masas atmicas: N = 14 u; O = 16 u; Na = 23 u; Cl = 35,5 u; Ag = 108 u.

Solucin
Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

a) Qu masa de cloruro de plata puede obtenerse a partir de 100 mL de


nitrato de plata 0,5 M? (1,25 puntos)
En primer lugar, se calcula la masa molar Mm del AgNO3 y del AgCl.
Mm (AgNO3) = 108 + 14 + 16 3 = 170
Mm (AgCl) = 108 + 35,5 = 143,5
A continuacin, se calcula el nmero de moles de soluto del AgNO3 a partir de
la concentracin y el volumen.
M=

ns
V

Luego:
n(AgNO3)= M V
Se transforma las unidades de volumen 100 ml = 0,1 L.
n(AgNO3) = 0,5 moles / L 0,1 L = 0,05 moles.
Por la reaccin, se sabe que cada mol de AgNO3 proporciona 1 mol de AgCl. Luego:
n ( AgNO3 )
n ( AgCl )

= 1 n ( AgCl ) =

0, 05 moles
= 0, 05 moles
1

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

41

PRUEBAS DE ACCESO A CFGS

Por otro lado se sabe que:


nAgCl =

m ( AgCl )

Mm ( AgCl )

De donde se puede despejar la masa.


m(AgCl) = n(AgCl) Mm(AgCl) = 0,05 moles 143,5 g/mol = 7,175 g

b) Calcula los gramos de cloruro de sodio que haran falta para obtener 10 g
de nitrato de sodio. (1,25 puntos)
Para calcular los gramos de NaCl que haran falta para obtener 10 gramos de
NaNO3 se tendra que proceder de la misma manera que en el apartado anterior. Para
ello, primero se tiene que calcular la Mm (masa molar de ambas molculas). Es decir:
Mm (NaNO3) = 23 + 14 + 16 3 = 85 g/mol
Mm (NaCl) = 23+ 35,5 = 58,5 g/mol
Luego, se calcula el nmero de moles:
n ( NaNO3 ) =

m ( NaNO3 )

Mm ( NaNO3 )

10 g
= 0,12 moles
85 moles

Se sabe que por cada molcula de NaCl que reacciona se produce otra molcula de NaNO3, luego la razn de proporcionalidad es:
n ( NaNO3 )
n ( NaCl )

= 1 n ( NaCl ) =

0,12 moles
= 0,12 moles
1

De aqu se puede deducir que:


n ( NaCl ) =

m ( NaCl )

M ( NaCl )

Por tanto:
m(NaCl) = n(NaCl) Mm(NaCl) = 0,12 moles 58,5 g/mol = 7,02g

42

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Pregunta
4. Indica, marcando con X en la casilla correspondiente, si las siguientes afirmaciones son verdaderas (V) o falsas (F), y escribe la frase correcta en las
que consideres falsas (tienes que calcular la cantidad correcta y ponerla).
V

El nmero atmico del U es 92, con lo que


tiene 92 protones
El nmero msico del U es 234 y su nmero
atmico 92, con lo que tiene 326 neutrones
El nmero msico del U es 234 y su nmero
atmico 92, con lo que tiene 92 electrones
El F tiene de nmero msico 19 y de nmero
atmico 9, con lo que tiene 19 protones
El F tiene de nmero msico 19 y de nmero
atmico 9, con lo que tiene 19 neutrones

Solucin
V
El nmero atmico del U es 92, con lo que
tiene 92 protones

El nmero msico del U es 234 y su nmero


atmico 92, con lo que tiene 326 neutrones

Tiene 142 neutrones

El F tiene de nmero msico 19 y de nmero


atmico 9, con lo que tiene 19 protones

Tiene 9 protones

El F tiene de nmero msico 19 y de nmero


atmico 9, con lo que tiene 19 neutrones

Tiene 10 neutrones

El nmero msico del U es 234 y su nmero


atmico 92, con lo que tiene 92 electrones

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

43

PRUEBAS DE ACCESO A CFGS

Explicacin
Clculos necesarios:
a. Si el N. atmico (A) es 92, el elemento tiene 92 protones.
b. Si el n. msico (Z) es 234 y tiene 92 protones, entonces el nmero de
neutrones ser 234-92 = 142.
c. En estado neutro el n. de electrones debe ser igual al de protones, es decir, 92.
d. Si el nmero atmico (A) es 9, tiene 9 protones.
e. Si el nmero msico (Z) es 19 y el nmero atmico (A) es 9, el nmero de
neutrones ser 19-9=10.
Nmero atmico. Nmero msico. Masa atmica.
El nmero atmico de un elemento (A) es el nmero de protones de un tomo
de dicho elemento. Se representa por la letra Z e identifica a los elementos qumicos. Los tomos de un mismo elemento tienen el mismo nmero de protones.
El nmero msico es la suma del nmero de protones y de neutrones de un
tomo. Los tomos de un mismo elemento que se diferencian en el nmero de
neutrones se llaman istopos.
En la tabla peridica aparecen representados los nmeros atmicos y msicos
de los elementos. Delante del smbolo se escribe el nmero atmico como subndice y el nmero msico como superndice.
La unidad de masa atmica (uma) o (u) es una unidad de medida que corresponde a la doceava parte de la masa de un tomo de C-12 (6 protones, 6 neutrones, 6 electrones). La masa atmica de un elemento es el promedio de la masa de
los distintos istopos de ese elemento, teniendo en cuenta la abundancia relativa
de cada uno de ellos.
La masa atmica o molecular (segn se trate de tomos o molculas) es equivalente a la masa molar (masa de un mol de sustancia expresada en gramos).

44

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

EXAMEN N. 4
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: QUMICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente los enunciados antes de contestar a las cuestiones y de


resolver los problemas.
La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.
Podrn utilizarse calculadoras no programables. No se podr utilizar ningn
otro instrumento electrnico.
Es muy importante que expreses los resultados de los problemas en las
unidades correspondientes.

1. Completa la siguiente tabla: (2,5 puntos)

NOMBRE

FRMULA
NaClO

cido trioxontrico (V)


CH3CH2OCH2CH3
Fluoruro de bario
CuO
Triclorometano
PbCl3
3-metil-2-pentanol
CH3COCH2CH3
Nitroetano

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

45

PRUEBAS DE ACCESO A CFGS

2. Clasifica las siguientes sustancias como elementos, compuestos, mezclas homogneas o mezclas heterogneas: (2,5 puntos)
SUSTANCIA

TIPO DE SUSTANCIA

Agua destilada
Sal comn (cloruro de sodio)
Agua de mar
Fe
Arena de la playa

3. Dada la reaccin de descomposicin del clorato de potasio:


2 KClO3 -----> 2 KCl + 3 O2
Calcula:
a) Los gramos de clorato de potasio necesarios para obtener 12 litros
de oxgeno, medidos en condiciones normales. (1,25 puntos)
b) Los gramos de cloruro de potasio que se obtienen a partir de 10 g de
clorato de potasio. (1,25 puntos)
-

Datos: R = 0,082 atm L/ K mol . Masas atmicas: Cl = 35,5 u ; K = 39 u ; O = 16 u.

RESULTADO: a)

b)

4. Se prepara una disolucin disolviendo 3 g de NaOH en la cantidad de


agua necesaria hasta tener 250 mL de disolucin. Calcula la concentracin de la disolucin expresada en molaridad. (2,5 puntos)
Datos. Masas atmicas, del Na = 23 u ; del O = 16 u; del H = 1 u.

46

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. Completa la siguiente tabla: (2,5 puntos)
NOMBRE

FRMULA
NaClO

cido trioxontrico (V)


CH3CH2OCH2CH3
Fluoruro de bario
CuO
Triclorometano
PbCl3
3-metil-2-pentanol
CH3COCH2CH3
Nitroetano

Solucin
NOMBRE

FRMULA

(Sist.) Oxoclorato de sodio


(Stock) Oxoclorato (I) de sodio
(Tradicional) Hipoclorito de sodio

NaClO

cido trioxontrico (V)

HNO3

Dietil ter

CH3CH2OCH2CH3

Fluoruro de bario

BaF2

(Sist.) Monxido de cobre


(Stock) xido de cobre (II)
(Tradicional) xido cprico

CuO

Triclorometano

CHCl3
.../...

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

47

PRUEBAS DE ACCESO A CFGS

.../...
(nomenclatura sustitutiva)
Triclorofosfano

PbCl3

3-metil-2-pentanol

CH3CH2CH(CH3)CH(OH)CH3

Butanona
Etil metil cetona

CH3COCH2CH3

Nitroetano

CH3CH2NO2

Pregunta
2. Clasifica las siguientes sustancias como elementos, compuestos, mezclas homogneas o mezclas heterogneas: (2,5 puntos)

SUSTANCIA

TIPO DE SUSTANCIA

Agua destilada
Sal comn (cloruro de sodio)
Agua de mar
Fe
Arena de la playa

Solucin
SUSTANCIA

TIPO DE SUSTANCIA

Agua destilada

Compuesto (es agua pura cuya frmula es H2O).

Sal comn (cloruro de sodio) Compuesto de ClNa.


Agua de mar
Fe
Arena de la playa

48

Mezcla homognea, sales en disolucin.


Elemento.
Mezcla heterognea.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Explicacin
Concepto de elemento, compuesto, sustancias puras y mezclas
Sustancia pura es un sistema material homogneo de composicin qumica fija
e invariable. Pueden ser elementos o compuestos.
Elementos qumicos son las sustancias que no pueden descomponerse en
otras ms sencillas (a nivel atmico), es decir, son todos los elementos de la tabla
peridica.
Compuestos son dos o ms elementos que se combinan.
Los compuestos son homogneos, los elementos o compuestos que lo forman
pierden sus propiedades particulares y dan lugar a nuevas caractersticas, propias
del compuesto formado, no se pueden separar fsicamente de forma sencilla y la
composicin es fija.
Mezcla es un sistema material de composicin variable (formado por los agrupamientos de elementos y/o compuestos). Se denomina disolucin o mezcla homognea si es homogneo y mezcla si es heterogneo.
En la disolucin o mezcla homognea los componentes que la forman mantienen sus propiedades, se pueden separar fcilmente por mtodos fsicos y las
cantidades de los componentes que la forman son variables pero con lmites.
En la mezcla heterognea los componentes que lo forman mantienen sus propiedades, se pueden separar fcilmente por mtodos fsicos y las cantidades de los
componentes que la forman son totalmente variables.

Pregunta
3. Dada la reaccin de descomposicin del clorato de potasio:
2 KClO3 -----> 2 KCl + 3 O2
Calcula:
a) Los gramos de clorato de potasio necesarios para obtener 12 litros
de oxgeno, medidos en condiciones normales. (1,25 puntos)
b) Los gramos de cloruro de potasio que se obtienen a partir de 10 g de
clorato de potasio. (1,25 puntos)
-

Datos: R = 0,082 atm L/ K mol . Masas atmicas: Cl = 35,5 u ; K = 39 u ; O = 16 u.


EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

49

PRUEBAS DE ACCESO A CFGS

Solucin
Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

En primer lugar, se tiene que calcular la masa molar relativa del KClO3
Mm(KClO3) = 39+35,5+16 3 = 122,5 g/mol
Mm(KCl) = 39 + 35,5 = 74,5 g/mol
Adems, se tienen que hacer las siguientes transformaciones:
Las condiciones de normalidad son 0 C y 1 atmsfera de presin. Luego:
T = 273 K
P = 1 atm
V = 12 L
a) Los gramos de clorato de potasio necesarios para obtener 12 litros de
oxgeno, medidos en condiciones normales. (1,25 puntos)
Para calcular los gramos de KClO3 previamente se calcular los gramos de O2 a
travs de la ecuacin general de los gases:
PV=nRT
De donde:
n ( O2 ) =

P V
RT

Por tanto:
n ( O2 ) =

1 atm 12 L
12 atm L
=
= 0, 53 moles
0, 082 atm L / K mol 273 K
22, 386 atm L / mol

Sabiendo que en la reaccin se formarn 3 moles de O2 por cada 2 moles de


KClO3, se puede decir que la proporcin entre los moles de soluto del CaO3 y los
moles de soluto del CO2 ser 2/3.
Luego, por tanto:
n ( KClO3 )
n ( O2 )

50

=2 3

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Es decir:
0,6 n (KClO3) = 0,6 n(O2) = 0,6 0,53 moles = 0,318 moles
Dado que:
nKClO3 =

m ( KClO3 )

Mm ( KClO3 )

Se obtiene:
m(KClO3) = n(KClO3) Mm(KClO3 )= 0,31 moles 122,5 g / mol=37,97g

b) Los gramos de cloruro de potasio que se obtienen a partir de 10 g de


clorato de potasio. (1,25 puntos)
Para calcular los gramos de KCl que se obtienen a partir de 10 g de KClO3, se
procede igual que en el caso anterior, sabiendo que la razn de proporcionalidad
es 2/2. Por tanto:
n ( KClO3 )
n ( KCl )

= 2 2=1n ( KCl )=1 n ( KClO3 ) = 1 0,31 moles = 0,31 moles

Dado que:
n ( KCl ) =

m ( KCl )

Mm ( KCl )

m ( KCl ) = n ( KCl ) M ( KCl ) = 0,31 moles 74,5 g mol = 23,09 g

Condiciones de normalidad y condiciones estndar


Las condiciones de normalidad se refieren a los valores de presin y temperatura
que imperan en un laboratorio. La IUPAC (Unin Internacional de Qumica Pura y
Aplicada), establece como condiciones normales una temperatura de 0 oC = 273,15
K y una presin absoluta de 0,986 atmsferas (273K y 1 atm). (Para estado gas).
El trmino condiciones estndar se suele usar para medidas termoqumicas, y
tienen como referencia 25 C = 298 K y 1 atm de presin.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

51

PRUEBAS DE ACCESO A CFGS

Pregunta
4. Se prepara una disolucin disolviendo 3 g de NaOH en la cantidad de
agua necesaria hasta tener 250 mL de disolucin. Calcula la concentracin de la disolucin expresada en molaridad. (2,5 puntos)
Datos. Masas atmicas, del Na = 23 u; del O = 16 u; del H = 1 u.

Solucin
Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

Para calcular la concentracin molar M de una sustancia en una disolucin, hay


que dividir la cantidad de sustancia de soluto ns (expresada en moles de soluto)
por el volumen V de la disolucin (expresada en litros). Por tanto:
M=

ns
V

El nmero de moles de soluto se puede calcular como:


ns=

m
Mm

Siendo m la masa de soluto (en gramos) y Mm su masa molar (en gramos/mol),


de modo que sustituyendo la ecuacin se tiene:
M=

m Mm
V

Se calcula la masa molar del NaOH = 23+16+1 = 40 g/mol.


Se transforman las unidades de volumen: 250 ml = 0,25L
Se sustituye en la ecuacin anterior y se tiene:
Mm=

52

3g / 40g / mol
3g
=
=0,3 moles / L
0,25L
40g / mol 0,25L

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

EXAMEN N. 5
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: QUMICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente los enunciados antes de contestar a las cuestiones y de


resolver los problemas.
La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.
Podrn utilizarse calculadoras no programables. No se podr utilizar ningn
otro instrumento electrnico.
Es muy importante que expreses los resultados de los problemas en las
unidades correspondientes.

1. Completa la siguiente tabla: (2,5 puntos)

NOMBRE

FRMULA

Etanol
NaNO3
Tricloruro de aluminio
CH3COOH
Hidrxido sdico
SO3
Tetraoxosulfato(VI) de hidrgeno
CH3OCH3
xido de hierro (II)
H2O2
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

53

PRUEBAS DE ACCESO A CFGS

2. Marca con X, en el casillero correspondiente, si consideras verdadera (V)


o falsa (F) cada una de las siguientes afirmaciones, y escribe correctamente las que consideres falsas: (2,5 puntos)
V

FRASE CORRECTA

En el modelo atmico de Rutherford los electrones giran en rbitas elpticas.


Si dos tomos tienen distinto nmero atmico Z,
se trata de dos elementos qumicos distintos.
El nmero msico de un elemento se obtiene
sumando el nmero de protones y de electrones.
La carga de un protn es mayor que la de un
neutrn.
Un catin se forma cuando un tomo neutro
gana electrones.

3. Hoy Eva ha ido a hacerse un anlisis de sangre con su madre para determinar su concentracin de glucosa en sangre. La sangre es una disolucin de densidad 1,06 g/cm3, uno de cuyos solutos es la glucosa. El volumen total de sangre de una persona es de unos 5 L y la concentracin
normal de glucosa, de 0,8 g/L.
Calcula:
a) La masa total de glucosa presente en la sangre. (1,25 puntos)
b) La concentracin de glucosa en tanto por ciento en peso. (1,25 puntos)
Realiza los clculos correspondientes y escribe el resultado obtenido.

RESULTADO: a)

54

b)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

4. Un combustible muy empleado en los hogares es el gas butano (C4H10),


que es el gas que contienen las denominadas bombonas de butano. Al
quemarlo, se combina con el oxgeno del aire formndose CO2 y H2O y
desprendindose gran cantidad de energa calorfica que se utiliza para
cocinar, o calentar agua en un termo de gas.
a) Ajusta la siguiente reaccin que representa la combustin del butano.
(1,25 puntos)
C4H10 + O2 ------> CO2 + H2O
b) Calcula el volumen de O2 que ser necesario para reaccionar con 15
litros de C4H10 medidos en condiciones normales.
Dato: R = 0,082 atm L / K mol.

Realiza los clculos correspondientes y escribe el resultado obtenido. (1,25


puntos)

RESULTADO:

a)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

b)

55

SOLUCIONES

Pregunta
1. Completa la siguiente tabla: (2,5 puntos)
NOMBRE
Etanol

FRMULA
NaNO3

Tricloruro de aluminio
CH3COOH
Hidrxido sdico
SO3
Tetraoxosulfato (VI) de hidrgeno
CH3OCH3
xido de hierro(II)
H2O2

Solucin
NOMBRE
Etanol
(Sistemtica) Trioxonitrato de sodio
(Stock) Trioxonitrato (V) de sodio
(Tradicional) Nitrato de sodio
Tricloruro de aluminio
cido actico

FRMULA
CH3CH2OH

Hidrxido sdico

NaOH

(Sist.) Trixido de azufre


(Stock) xido de azufre (VI)
Tetraoxosulfato (VI) de hidrgeno
Dimetileter
xido de hierro(II)
(Stock) Perxido de hidrgeno
(tradicional) Agua oxigenada

56

NaNO3
AlCl3
CH3COOH

SO3
H2SO4
CH3OCH3
FeO
H2O2

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Pregunta
2. Marca con X, en el casillero correspondiente, si consideras verdadera (V)
o falsa (F) cada una de las siguientes afirmaciones, y escribe correctamente las que consideres falsas: (2,5 puntos)
V

FRASE CORRECTA

FRASE CORRECTA
En el modelo atmico de Rutherford los
electrones giran en rbitas circulares.

En el modelo atmico de Rutherford los


electrones giran en rbitas elpticas.
Si dos tomos tienen distinto nmero
atmico Z, se trata de dos elementos
qumicos distintos.
El nmero msico de un elemento se
obtiene sumando el nmero de protones y de electrones.
La carga de un protn es mayor que
la de un neutrn.
Un catin se forma cuando un tomo
neutro gana electrones.

Solucin

En el modelo atmico de Rutherford los


electrones giran en rbitas elpticas.

Si dos tomos tienen distinto nmero


atmico Z, se trata de dos elementos X
qumicos distintos.
El nmero msico de un elemento se
obtiene sumando el nmero de protones y de electrones.

El nmero msico de un elemento se


obtiene sumando el nmero de protones y de neutrones.

La carga de un protn es mayor que


la de un neutrn.

La masa de un protn es ligeramente


menor que la de un neutrn. Los neutrones no tienen carga elctrica.

Un catin se forma cuando un tomo


neutro gana electrones.

Un catin se forma cuando un tomo


neutro pierde electrones.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

57

PRUEBAS DE ACCESO A CFGS

Explicacin
Modelo atmico de Rutherford
Rutherford imagin el tomo como un sistema planetario de electrones girando
alrededor de un ncleo atmico pesado y con carga elctrica positiva. Su modelo
atmico puede resumirse de la siguiente manera:
-14

El tomo posee un ncleo central pequeo con un dimetro del orden de 10


m y con carga elctrica positiva, que contiene casi toda la masa del tomo. Los
electrones giran a grandes distancias alrededor del ncleo en rbitas circulares. La
suma de las cargas elctricas negativas de los electrones debe ser igual a la carga
positiva del ncleo, ya que el tomo es elctricamente neutro. El tamao total del
tomo sera unas 10.000 veces mayor que el ncleo, con un dimetro del orden
-14
de 10 m, lo que supone una gran cantidad de espacio vaco.

Pregunta
3. Hoy Eva ha ido a hacerse un anlisis de sangre con su madre para determinar su concentracin de glucosa en sangre. La sangre es una disolucin de densidad 1,06 g/cm3, uno de cuyos solutos es la glucosa. El volumen total de sangre de una persona es de unos 5 L y la concentracin
normal de glucosa, de 0,8 g/L.
Calcula:
a) La masa total de glucosa presente en la sangre. (1,25 puntos)
b) La concentracin de glucosa en tanto por ciento en peso. (1,25 puntos)
Realiza los clculos correspondientes y escribe el resultado obtenido.

Solucin
a) La masa total de glucosa presente en la sangre. (1,25 puntos)
Si la concentracin en gramos/l de glucosa es 0,8 g/L, se puede calcular la
masa total de glucosa por una simple regla de tres o bien usando la frmula de la
concentracin en g/L.
M=

58

masa de glucosa
V

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

De aqu se puede deducir que:


masa de glucosa total=

Mglucosa 0,8 g L
=
=4 g
V
5L

b) La concentracin de glucosa en tanto por ciento en peso. (1,25 puntos)


Para calcular la concentracin de glucosa en tanto por ciento en peso se aplica
la frmula de clculo de concentracin en tanto por ciento.
%p =

masa de soluto 100


masa de disolucin

Para saber la masa de disolucin se tiene que recurrir a los datos que aporta la
densidad, que en este caso es de 1,06 g/cm3.
Se tiene que igualar las unidades de medida, por lo que se convierten los litros
en cm3: (5L = 5000 cm3).
Se sabe que:
d=

m
V

De donde:
m = d V = 1,06 g cm3 5000 cm3=5300 g
Ahora se puede sustituir en la ecuacin del % en peso:
%p =

4g 100
= 0,075
5300g

Explicacin
Formas de expresar la concentracin
Existen diferentes formas de expresar la concentracin de una disolucin. Las
que se emplean con ms frecuencia son:
1. Molaridad.
2. Gramos por litro: Indica la masa en gramos disuelta en cada litro de disolucin. En este caso la concentracin puede medirse directamente en
laboratorio, por lo que resulta sencillo y de gran utilidad.
Concentracin en g L =

n. de gramos de soluto
volumen de la disolucin en litros

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

59

PRUEBAS DE ACCESO A CFGS

3. Tanto por ciento en peso: Expresa la masa en gramos de soluto disuelta por
cada cien gramos de disolucin. Su clculo requiere considerar separadamente la masa del soluto y la del disolvente. Siendo la masa de la disolucin la suma de la del soluto y la del disolvente.
%p =

masa de soluto 100


masa de disolucin

4. Molalidad: Indica el nmero de moles de soluto disuelto en cada kg de disolvente.


molalidad =

n. de gramos de soluto n. de gramos de su mol


Kg de disolvente

El resultado se expresa en forma similar a la molaridad, pero en este caso la


concentracin ser molal m (minscula).
Clculo de la densidad
Aunque toda la materia posee masa y volumen, la misma masa de diferentes
sustancias ocupa volmenes diferentes. La propiedad que permite medir la ligereza
o pesadez de una sustancia es la densidad.
d=

m
V

La densidad se define como el cociente entre la masa de un cuerpo y el volumen


que ocupa. En el Sistema Internacional, la medida ser en kg/m3. Aunque esta unidad se
usa muy poco ya que es muy pequea. As, la unidad que suele usarse es g/cm3, o g/ml.

Pregunta
4. Un combustible muy empleado en los hogares es el gas butano (C4H10),
que es el gas que contienen las denominadas bombonas de butano. Al
quemarlo, se combina con el oxgeno del aire formndose CO2 y H2O, y
desprendindose gran cantidad de energa calorfica que se utiliza para
cocinar o calentar agua en un termo de gas.
a) Ajusta la siguiente reaccin que representa la combustin del butano.
(1,25 puntos)
C4H10 + O2 ------> CO2 + H2O
60

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

b) Calcula el volumen de O2 que ser necesario para reaccionar con 15


litros de C4H10 medidos en condiciones normales.
Dato: R = 0,082 atm L / K mol.
Realiza los clculos correspondientes y escribe el resultado obtenido.
(1,25 puntos)

Solucin
a) Ajusta la siguiente reaccin que representa la combustin del butano.
(1,25 puntos)
C4H10 + O2 ------> CO2 + H2O
Para ajustar la reaccin se utilizar el mtodo algebraico. De manera que se
asigna un coeficiente a cada una de las molculas.
X (C4H10) + Y (O2) o Z (CO2) + T (H2O)
Se establecen las ecuaciones para relacionar los tomos de los reactivos y los
productos.
Carbono: 4X = Z; Hidrgeno: 10X = 2T; Oxgeno: 2Y = 2Z+T
Se da un valor arbitrario a uno de los coeficientes. Por ejemplo: X=1.
De manera que:
Z = 4X = 4;
2T = 10X =10;
T = 5;
2Y = 2Z+T = 8+5 = 13;
Y=13/2;
Para eliminar la fraccin se multiplica por dos, de manera que:
X = 2;
Z = 8;
T = 10;
Y = 13;
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

61

PRUEBAS DE ACCESO A CFGS

La reaccin ajustada sera:


2 C4H10 + 13 O2 ------> 8 CO2 +10 H2O
b) Calcula el volumen de O2 que ser necesario para reaccionar con 15 litros
de C4H10 medidos en condiciones normales.
Dato: R = 0,082 atm L / K mol.
Realiza los clculos correspondientes y escribe el resultado obtenido.
(1,25 puntos)
Las condiciones de normalidad son 0 C y 1 atmsfera de presin. Luego:
T = 273 K
P = 1 atm
Para calcular el volumen de O2 que ser necesario para reaccionar con 15 L de
C4H10 se aplicar la ecuacin general de los gases:
PV=nRT
De donde:
n ( C4 H10 )=
n ( C4 H10 ) =

PV
RT

1 atm 15 L
15 atm L
=
= 0,67 moles
0,082 atmL K mol 273K
22,38 atm L mol

Sabiendo que en la reaccin se formarn 13 moles de O2 por cada 2 moles de


C4H10 se puede decir que la proporcin entre los moles de soluto del C4H10 y los
moles de soluto del CO2 ser 2/13.
Luego por tanto:
n ( C4 H10 )
n ( O2 )

n ( O2 )=

62

n ( C4 H10 )
0,15

=2 13= 0,15

0,67 moles
= 4,46 moles
0,15

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Se utilizar de nuevo la ecuacin de los gases para calcular el volumen de O2:


V ( O2 )=

n ( O2 ) R T
P

4,46 moles 0,082 atm L/Kmol 273K


= 99,84 L de O2
1atm

Explicacin
Ajuste de reacciones qumicas
En una reaccin qumica a nivel macroscpico desaparecen unas sustancias
y aparecen otras nuevas en unas cantidades determinadas. Esto se debe a una
reorganizacin de los tomos formando nuevos agregados.
Lo primero que se debe tener en cuenta es que en un ambiente cerrado se
cumplir que la masa total habr de conservarse durante todo el proceso. Adems,
el nmero de tomos de cada elemento deber ser el mismo en ambos lados.
Para ajustar una reaccin qumica se puede usar el mtodo de tanteo o el mtodo algebraico.
El mtodo de tanteo consiste en observar que cada miembro de la ecuacin
tenga los tomos en la misma cantidad, por lo que slo habr que ir agregando coeficientes a las frmulas que lo necesiten y comprobar que la cantidad de tomos
cumple el principio de conservacin de la masa.
El mtodo algebraico consiste en plantear una serie de ecuaciones. Para ello
se ponen smbolos delante de cada una de las molculas que correspondern a los
coeficientes que se tienen que determinar.
Partiendo del principio de conservacin de la masa se procede a establecer
ecuaciones que conduzcan a determinar los valores de los coeficientes.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

63

EXAMEN N. 6
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: QUMICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1. El ozono es un gas cuyas molculas estn constituidas por tres tomos


de oxgeno. Esta sustancia nos protege de la radiacin ultravioleta solar.
Sabiendo que cada tomo de oxgeno est constituido por un ncleo con
ocho protones y ocho neutrones, responda a las siguientes preguntas.
(2,5 puntos)
Nota: La masa atmica relativa del oxgeno es 16. Constante de los gases
R=0,082 atm litro/kelvin mol.
a) Determina el nmero msico y atmico de esos tomos, as como el
nmero de electrones que tienen si son neutros.
SOLUCIN:

b) Calcula los moles de ozono que hay en 250 gramos de dicho gas.
SOLUCIN:

c) A qu presin estar el ozono si dos moles de dicho gas, a una temperatura de 298 kelvin ocupan un volumen de 16,3 litros.
SOLUCIN:

64

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

2. El oro y el oxgeno son un metal y un no metal. (2,5 puntos)


a) Completa la tabla siguiente, indicando en cada celda la propiedad correspondiente al compuesto formado por la combinacin de tomos
indicado en la celda de la primera columna.
Enlace
(inico,
covalente o
metlico)

Estado fsico
a temperatura
ambiente
(slido, lquido o gas)

Conductividad
elctrica

Conductividad
trmica

Fragilidad,
ductilidad,
maleabilidad...

tomos de
oro unidos
entre s.
tomos de
oxgeno unidos
entre s.
tomos de
oro unidos
con tomos
de oxgeno.

b) Sabiendo que el tomo de oxgeno tiene seis electrones en su ltima


capa, representa el diagrama de Lewis de la molcula de oxgeno.

3. Completa la tabla siguiente escribiendo en la celda de su derecha el


nombre o la frmula de los siguientes compuestos, segn corresponda:
(2,5 puntos)

PbO2
CH3-CHO
BrCH2-CH2-CH2-CH3
Hidrxido de estroncio
Dietilamina

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

65

PRUEBAS DE ACCESO A CFGS

4. En la combustin del gas propano, (C3H8), este reacciona con el oxgeno


del aire produciendo dixido de carbono y agua, adems de desprender
calor segn la reaccin: (2,5 puntos)
C3H8+O2 o CO2+ H2O
Datos: Las masas atmicas relativas del hidrgeno, del carbono y del oxgeno
son 1, 12 y 16 respectivamente.
a) Escribe la reaccin ajustada, analiza si esta reaccin es endotrmica
o exotrmica.

b) Si disponemos de un depsito de 20 litros que contiene 220 gramos


de propano mezclado con otras sustancias, halla la concentracin
molar del propano.
SOLUCIN:

c) Calcula los gramos de agua que se producirn con el propano consumido en la reaccin anterior, si cada mol de C3H8 produce cuatro
moles de H2O.
SOLUCIN:

66

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. El ozono es un gas cuyas molculas estn constituidas por tres tomos de
oxgeno. Esta sustancia nos protege de la radiacin ultravioleta solar. Sabiendo que cada tomo de oxgeno est constituido por un ncleo con ocho
protones y ocho neutrones, responde a las siguientes preguntas. (2,5 puntos)
Nota: La masa atmica relativa del oxgeno es 16. Constante de los gases
R=0,082 atm litro/kelvin mol.
a) Determina el nmero msico y atmico de esos tomos, as como el
nmero de electrones que tienen si son neutros.
b) Calcula los moles de ozono que hay en 250 gramos de dicho gas.
c) A qu presin estar el ozono si dos moles de dicho gas, a una temperatura de 298 kelvin ocupan un volumen de 16,3 litros.

Solucin
Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

a) Determina el nmero msico y atmico de esos tomos, as como el


nmero de electrones que tienen si son neutros.
El nmero atmico del oxgeno es 8 y su masa atmica es 16. Luego, su nmero msico es 16. Se compone de 8 protones, 8 neutrones y 8 electrones.
La molcula de ozono est formada por 3 tomos de oxgeno, luego su masa
molecular (Mm) es 48u (masa molar 48 gramos/mol).
b) Calcula los moles de ozono que hay en 250 gramos de dicho gas.
El nmero de moles viene dado por la siguiente frmula:
n=

m
Mn

Donde m es la masa medida en gramos y Mm la masa molar medida en g/mol.


n=

250g
= 5,2 moles
48g/mol

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

67

PRUEBAS DE ACCESO A CFGS

c) A qu presin estar el ozono si dos moles de dicho gas, a una temperatura de 298 kelvin ocupan un volumen de 16,3 litros.
Para calcular la presin se aplica la ecuacin general de los gases:
PV=nRT
De donde:
P=

nRT
5,2 moles 0,082 atm L K mol 298 K
=
= 7,79 atm
V
16
6,3L

Pregunta
2. El oro y el oxgeno son un metal y un no metal. (2,5 puntos)
a) Completa la tabla siguiente, indicando en cada celda la propiedad correspondiente al compuesto formado por la combinacin de tomos
indicado en la celda de la primera columna.
Enlace
(inico,
covalente o
metlico)

Estado fsico
a temperatura
ambiente
(slido, lquido o gas)

Conductividad
elctrica

Conductividad
trmica

Fragilidad,
ductilidad,
maleabilidad...

tomos de
oro unidos
entre s.
tomos de
oxgeno unidos
entre s.
tomos de
oro unidos
con tomos
de oxgeno.

b) Sabiendo que el tomo de oxgeno tiene seis electrones en su ltima


capa, representa el diagrama de Lewis de la molcula de oxgeno.

68

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Solucin
a) Completa la tabla siguiente, indicando en cada celda la propiedad correspondiente al compuesto formado por la combinacin de tomos
indicado en la celda de la primera columna.

tomos de
oro unidos
entre s.
tomos de
oxgeno unidos
entre s.
tomos de
oro unidos
con tomos
de oxgeno.

Enlace
(inico,
covalente o
metlico)

Estado fsico
a temperatura
ambiente
(slido, lquido o gas)

Conductividad
elctrica

Conductividad
trmica

Fragilidad,
ductilidad,
maleabilidad...

Metlico

Slido

Alta

Alta

Dctiles
y maleables

Covalente

Gas

Baja

Baja

Inico

Slido

Baja

Baja

Duros y
resistentes

b) Sabiendo que el tomo de oxgeno tiene seis electrones en su ltima


capa, representa el diagrama de Lewis de la molcula de oxgeno.

Figura 3. Diagrama de Lewis


de la molcula de oxgeno

Pregunta
3. Completa la tabla siguiente escribiendo en la celda de su derecha el
nombre o la frmula de los siguientes compuestos, segn corresponda:
(2,5 puntos)
PbO2
CH3-CHO
BrCH2-CH2-CH2-CH3
Hidrxido de estroncio
Dietilamina
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

69

PRUEBAS DE ACCESO A CFGS

Solucin

PbO2

(Sist.) Dixido de plomo


(Stock) xido de plomo (IV)
(tradicional) xido plmbico

CH3-CHO

Etil aldehdo
Aldehdo actico
Etanal

BrCH2-CH2-CH2-CH3

1 Bromo butano

Hidrxido de estroncio

Sr(OH)2

Dietilamina

CH3-CH2-NH-CH2CH3

Pregunta
4. En la combustin del gas propano (C3H8), este reacciona con el oxgeno
del aire produciendo dixido de carbono y agua, adems de desprender
calor segn la reaccin: (2,5 puntos)
C3H8+O2 o CO2+ H2O
Datos: Las masas atmicas relativas del hidrgeno, del carbono y del oxgeno
son 1, 12 y 16, respectivamente.
a) Escribe la reaccin ajustada, analiza si esta reaccin es endotrmica
o exotrmica.
b) Si disponemos de un depsito de 20 litros que contiene 220 gramos
de propano mezclado con otras sustancias, halla la concentracin
molar del propano.
c) Calcular los gramos de agua que se producirn con el propano consumido
en la reaccin anterior, si cada mol de C3H8 produce cuatro moles de H2O.
70

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Solucin
Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

a) Escribe la reaccin ajustada, analiza si esta reaccin es endotrmica o


exotrmica.
Se usa el mtodo algebraico para ajustar la reaccin:
C3H8+O2 o CO2+ H2O
Se asigna un coeficiente a cada una de las molculas:
X (C3H8) + Y (O2 ) o Z (CO2) + T (H2O)
Se establecen las ecuaciones para relacionar los tomos de los reactivos y los
productos.
Carbono: 3X = Z; Hidrgeno: 8X = 2T; Oxgeno: 2Y = 2Z + T
Se da un valor arbitrario a uno de los coeficientes, por ejemplo, X=1, de manera que:
Z = 3X = 3;
Z = 3;
2T = 8X = 10;
T = 4;
2Y = 2Z+T = 6+4 = 10;
Y = 5;
La reaccin ajustada sera:
C3 H8+5 O2 o 3 CO2 + 4 H2O
La reaccin sera exotrmica, ya que se trata de una combustin de un compuesto orgnico.
b) Si disponemos de un depsito de 20 litros que contiene 220 gramos de propano mezclado con otras sustancias, halla la concentracin molar del propano.
Para calcular la concentracin molar M de una sustancia en una disolucin, hay
que dividir la cantidad de sustancia de soluto ns (expresada en moles de soluto)
por el volumen V de la disolucin (expresada en litros).
Por tanto:
ns
M=
V
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

71

PRUEBAS DE ACCESO A CFGS

Sabiendo que:
ns=

m
Mm

Siendo m la masa de soluto en gramos y Mm su masa molar en gramos/mol.


La Mm (masa molar) se calcula sumando las masas de los elementos que
componen la molcula, es decir:
Mm(C3H8) = 12 3 + 1 8 = 44 g/mol
A continuacin se calcula:
n ( C3 H8 ) =

m ( C3 H8 )

Mm ( C3 H8 )

220 g
= 5 moles de molculas de C3 H8
44 g / mol

Sustituyendo los valores en la ecuacin, se tiene:


M ( C3 H8 ) =

m Mm 5 moles
=
= 0, 25 moles/litro
V
20 L

c) Calcula los gramos de agua que se producirn con el propano consumido


en la reaccin anterior, si cada mol de C3H8 produce cuatro moles de H2O.
Sabiendo que en la reaccin se formarn 4 moles de H2O por cada mol de
C3H8, se puede decir que la proporcin entre ambos ser 4/1. Luego:
n ( H2 O )

n ( C3 H8 )

=4

n(H2O) = 4 n(C3H8 )=4 5 = 20 moles de molculas de H2O


Sabiendo que:
n(H2 O)=

m ( H2 O )

Mm ( H2 O )

mH2 O=

72

= 20 moles

20 moles
=360 g
18 g/mol

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

EXAMEN N. 7
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: QUMICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1. El dixido de carbono es un gas cuyas molculas estn formadas por


carbono y oxgeno. Esta sustancia, entre otras, es responsable del calentamiento global de la Tierra.
Nota: las masas atmicas relativas del carbono y del oxgeno son 12 y 16 respectivamente. Constante de los gases R = 0,082 atm litro/kelvin mol.
a) El carbono y el oxgeno son los elementos qumicos que forman el
dixido de carbono, que es un compuesto qumico. Define elemento
qumico y compuesto qumico. (0,5 puntos)
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
b) A qu temperatura estar ese gas si dos moles ocupan un volumen
de 30 litros medidos a una presin de 2 atmsferas? (1 punto)
SOLUCIN:

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

73

PRUEBAS DE ACCESO A CFGS

c) Determina la frmula molecular del dixido de carbono si tiene un


27,27% en masa de carbono y un 72,73% de oxgeno y su masa molecular relativa es 44. (1punto)
SOLUCIN:

2. Sabiendo que elcobre es un metal, responde a las siguientes cuestiones.


a) Describe el tipo de enlace que se forma cuando se unen tomos de
cobre entre s. (1 punto)
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................

b) Si el cobre se une con el oxgeno que es un no metal, qu tipo de


enlace formarn? Indica su estado fsico a temperatura ambiente y las
siguientes propiedades fsicas del compuesto formado: conductividad
elctrica, conductividad trmica, dureza y fragilidad. (1,5 puntos)
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................

74

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

3. Completa la tabla siguiente escribiendo en la celda de su derecha el


nombre o la frmula de los siguientes compuestos segn corresponda:
(2,5 puntos)
NaNO3
CH3-COO-CH3
cido sulfuroso
2-buteno
Cloroetano

4. El cido clorhdrico ataca al cinc convirtindolo en cloruro de cinc y desprendiendo hidrgeno segn la reaccin:
HCl +Zn o ZnCl2+H2
Datos: Las masas atmicas relativas del hidrgeno, del cloro y del cinc son
1,35,5 y 65,4 respectivamente.
Responde a las siguientes cuestiones:
a) Escribe la reaccin ajustada. (0,5 puntos)

b) Si como resultado de la reaccin se producen 34,1 gramos de ZnCl2 recogidos en 0,5 litros de disolucin, qu molaridad tendr esa disolucin?
(1 punto)
SOLUCIN:

c) Calcula los gramos de HCl que se consumirn para producir el ZnCl2 indicado en el apartado anterior si dos moles de HCl producen un mol de ZnCl2.
(1 punto)
SOLUCIN:
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

75

SOLUCIONES

Pregunta
1. El dixido de carbono es un gas cuyas molculas estn formadas por
carbono y oxgeno. Esta sustancia, entre otras, es responsable del calentamiento global de la Tierra.
Nota: las masas atmicas relativas del carbono y del oxgeno son 12 y 16, respectivamente. Constante de los gases R = 0,082 atm litro/kelvin mol.
a) El carbono y el oxgeno son los elementos qumicos que forman el
dixido de carbono, que es un compuesto qumico. Define elemento
qumico y compuesto qumico. (0,5 puntos)
b) A qu temperatura estar ese gas si dos moles ocupan un volumen
de 30 litros medidos a una presin de 2 atmsferas? (1 punto)
c) Determina la frmula molecular del dixido de carbono si tiene un
27,27% en masa de carbono y un 72,73% de oxgeno y su masa molecular relativa es 44. (1 punto)

Solucin
a) El carbono y el oxgeno son elementos qumicos que forman el dixido
de carbono, que es un compuesto qumico. Define elemento qumico y
compuesto qumico. (0,5 puntos)
Elemento qumico: Es una sustancia que por ningn procedimiento, ni fsico ni
qumico, puede separarse o descomponerse en otras sustancias ms simples. Est
constituido por tomos de la misma clase. En su forma ms simple est formado
por un nmero determinado de protones en su ncleo que se denomina nmero
atmico (A), y puede tener diferentes masas atmicas (Z) en funcin del nmero
de neutrones que posea en el ncleo. No existen dos tomos de un mismo elemento con caractersticas distintas, y en caso de que tengan diferente masa, son
el mismo elemento, pero diferentes istopos.
Compuesto qumico: Es una sustancia formada por la unin de dos o ms elementos de la tabla peridica, en una razn fija. Una caracterstica esencial es que
tiene una frmula qumica. Un compuesto est formado por molculas o iones con
enlaces. Los elementos de un compuesto no se pueden dividir o separar por procesos fsicos (decantacin, filtracin, destilacin, etc.), sino slo mediante procesos
qumicos. En eso se diferencian de las mezclas o aleaciones.
76

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

b) A qu temperatura estar ese gas si dos moles ocupan un volumen de


30 litros medidos a una presin de 2 atmsferas? (1 punto)
Para calcular la temperatura de 2 moles de CO2 que ocupan un volumen de 30
L a una presin de 2 atm, se aplicar la ecuacin general de los gases:
PV=nRT
De dnde se deduce que:
PV
T =
nR
T ( CO2 )=

2 atm 30 L
=365,85 K = 92,85 C
2 moles 0,082 atmL K mol

c) Determina la frmula molecular del dixido de carbono si tiene un 27,27%


en masa de carbono y un 72,73% de oxgeno y su masa molecular relativa es 44. (1 punto)
Conociendo la masa atmica relativa del C = 12 u, su riqueza de 27,27% en
masa, la masa atmica relativa del O = 16 u y su riqueza de 72,73% en masa. Se
divide la riqueza de cada uno de los compuestos entre su masa relativa:
C o 27,27/12 = 2,27
O o 72,73/16 = 4,5
Se toma como referencia el ms pequeo de los resultados para calcular la
proporcionalidad entre ellos:
C o x = 2,27/2,27 = 1
O o y = 4,5/2,27 = 1,98
Luego, por cada molcula de C habr 2 de O. La frmula emprica de la molcula ser: (CO2)n.
Para calcular la frmula molecular se debe averiguar el valor de n. Para ello,
se calcula la masa molecular relativa de la molcula de CO2, suponiendo n=1.
Masa molecular del (CO2) = 12 + 16 2 = 44 u
Si la masa molecular relativa de la molcula que plantea el enunciado del problema es 44,1 u, entonces:
44 / 44 = 1 = n
Luego, la frmula molecular es: CO2
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

77

PRUEBAS DE ACCESO A CFGS

Pregunta
2. Sabiendo que el cobre es un metal, responde a las siguientes cuestiones:
a) Describe el tipo de enlace que se forma cuando se unen tomos de
cobre entre s. (1 punto)
b) Si el cobre se une con el oxgeno que es un no metal, qu tipo de enlace formarn? Indica su estado fsico a temperatura ambiente y las
siguientes propiedades fsicas del compuesto formado: conductividad
elctrica, conductividad trmica, dureza y fragilidad. (1,5 puntos)

Solucin
a) Describe el tipo de enlace que se forma cuando se unen tomos de cobre entre s. (1 punto)
Los tomos de cobre se unen mediante enlaces metlicos, las caractersticas
de este enlace son las siguientes:

Temperatura de fusin y ebullicin muy elevadas.

Son dctiles y maleables.

Suelen ser slidos a temperatura ambiente, excepto el mercurio.

Tienen brillo metlico.

Son generalmente muy duros.

Se oxidan con facilidad.

Son buenos conductores trmicos y elctricos.

Cuando reciben luz tienen efecto fotoelctrico.

Emiten electrones cuando reciben calor.

b) Si el cobre se une con el oxgeno que es un no metal, qu tipo de enlace


formarn? Indica su estado fsico a temperatura ambiente y las siguientes propiedades fsicas del compuesto formado: conductividad elctrica,
conductividad trmica, dureza y fragilidad. (1,5 puntos)
Cuando se unen el oxgeno y el cobre forman un enlace de tipo inico que tiene
las siguientes caractersticas:

78

Estn formados por cationes y aniones (red cristalina).

Son slidos a temperatura ambiente.


EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

En estado slido no conducen la electricidad, pero son buenos conductores


del calor y la electricidad cuando estn disueltos en agua o cuando se funden (los iones quedan en libertad).

Tienen altos puntos de fusin y ebullicin.

Son solubles en disolventes polares como el agua.

Son duros y resistentes al rayado.

Pregunta
3. Completa la siguiente tabla escribiendo en la celda de su derecha el
nombre o la frmula de los compuestos segn corresponda: (2,5 puntos)

NaNO3
CH3-COO-CH3
cido sulfuroso
2-buteno
Cloroetano

Solucin

NaNO3

(Sistemtica) Trioxonitrato de sodio


(Stock) Trioxonitrato (V) de sodio
(Tradicional) Nitrato de sodio

CH3-COO-CH3

Etanoato de metilo
Acetato de metilo

cido sulfuroso

H2SO3

2-buteno

CH3-CH=CH-CH3

Cloroetano

CH3-CH2Cl

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

79

PRUEBAS DE ACCESO A CFGS

Pregunta
4. El cido clorhdrico ataca al cinc convirtindolo en cloruro de cinc y desprendiendo hidrgeno segn la reaccin:
HCl + Zn

ZnCl2 + H2

Datos: Las masas atmicas relativas del hidrgeno, del cloro y del cinc son 1,
35,5 y 65,4, respectivamente.
Responde a las siguientes cuestiones:
a) Escribe la reaccin ajustada. (0,5 puntos)
b) Si como resultado de la reaccin se producen 34,1 gramos de ZnCl2 recogidos en 0,5 litros de disolucin, qu molaridad tendr esa disolucin?
(1 punto)
c) Calcula los gramos de HCl que se consumirn para producir ZnCl2 indicando en el apartado anterior si dos moles de HCl producen un mol de ZnCl2.
(1 punto)

Solucin
Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

a) Escribe la reaccin ajustada. (0,5 puntos)


Se ajusta la reaccin por el mtodo de tanteo, ya que es un ajuste sencillo:
2 HCl + Zn o ZnCl2 + H2
b) Si como resultado de la reaccin se producen 34,1 gramos de ZnCl2 recogidos en 0,5 litros de disolucin, qu molaridad tendr esa disolucin?
(1 punto)
Para calcular la concentracin molar M de una sustancia en una disolucin, hay
que dividir la cantidad de sustancia de soluto ns (expresada en moles de soluto)
por el volumen V de la disolucin (expresada en litros).
Por tanto:
M=
80

ns
V

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

El nmero de moles de soluto se puede calcular mediante la siguiente ecuacin:


ns =

m
Mm

Siendo m la masa de soluto (en gramos) y Mm su masa molar (en gramos/mol),


se tiene sustituyendo en la ecuacin:
M=

m Mm
V

Se calcula seguidamente la masa molar del ZnCl2, es decir, 65,4 + 35,5 2 =


136,4 g/mol. Si se sustituye en la ecuacin anterior:
M ( ZnCl2 ) =

34,1 g 136, 4 g mol


34,1 g
=
= 0, 5 moles L
0, 5 L
136, 4 g mol 0, 5 L

c) Calcula los gramos de HCl que se consumirn para producir ZnCl2 indicando en el apartado anterior si dos moles de HCl producen un mol de
ZnCl2. (1 punto)
Sabiendo que en la reaccin 2 moles de HCl producen un mol de ZnCl2, se
puede decir que la proporcin entre ambos ser 2/1. Luego, por tanto:
n ( HCl )

n ( ZnCl2 )

=2

n(HCl)=2 n(ZnCl2) = 2 0,5 = 1 mol de molculas de HCl


Sabiendo que:
n ( HCl ) =

m ( HCl )

Mm ( HCl )

= 1 mol

Se calcula la masa molar del HCl = 1 + 35,5 2 = 36,5 g/mol. Por tanto:
mHCl =

1 mol
= 36,5g
36,5 g mol

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

81

EXAMEN N. 8
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: QUMICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1. El oxgeno es el octavo elemento de la tabla peridica, su nmero atmico es Z = 8 y su masa atmica relativa es 16. El oxgeno elemental se
encuentra en la naturaleza en forma de molculas diatmicas.
a) Se conocen varios istopos, pero el ms abundante es el de nmero
msico A = 16. Cuntas partculas de cada clase lo constituyen?
(0,5 punto)

b) Explica, brevemente, cmo es un tomo de oxgeno, segn el modelo


atmico de Bohr (0,5 punto)
.........................................................................................................
.........................................................................................................
.........................................................................................................
.........................................................................................................
c) Cuntos moles hay en 100 g de oxgeno elemental? (1 punto)

d) Cuntos tomos de oxgeno hay en un mol de oxgeno elemental?


(1 punto)
R = 0,082 atm L / K mol
82

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

2. A continuacin se muestran los tres primeros periodos del sistema peridico. Se representan con fondo oscuro los elementos metlicos y con
fondo claro los no metlicos.

II

II

IIV

VI

VII

VIII

He

10

Li

Be

Ne

11

12

13

14

15

16

17

18

Na

Mg

Al

Si

Cl

Ar

a) Cmo ser el enlace en el NaCl? (0,5 punto)

b) Representa el diagrama de Lewis para el CH4. (0,5 punto)

c) En alguna de las sustancias anteriores se forman puentes de hidrgeno?


(0,5 punto)

d) De las sustancias anteriores (NaCl, H2O, CH4): (1 punto)


i) Cul presenta una mayor dureza?
ii) Cul es la ms voltil?
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

83

PRUEBAS DE ACCESO A CFGS

3. Formula o nombra los siguientes compuestos qumicos (2 puntos)


 +2SO4:
 7HWUDR[RIRVIDWR 9 GHKLGUyJHQR
 1+4)2S:
 +LSRFORULWRGHVRGLR
 3E22:
 1+3:
 %XWDQR
 &+3-CO-CH3:
 0HWDQRDPLGD
 &+3-CH2-NH2:
4. El cido clorhdrico (HCl) se utiliza como desincrustante para eliminar
residuos de caliza (CaCO3) produciendo cloruro de calcio (CaCl2) dixido
de carbono (CO2) y agua (H2O).
H: 1
C: 12

O: 16
Cl: 35,5

Ca: 40,1

a) Escribe la correspondiente ecuacin ajustada (1 punto)

b) Para llevar a cabo la reaccin, disponemos en el laboratorio de cido


clorhdrico del 15% y densidad 1,05 g/mL. Cul es la concentracin
molar de este cido? (0,5 punto)

c) Con 1 L del cido anterior, qu cantidad de caliza podra limpiarse? (0,5 punto)

d) Qu volumen de dixido de carbono, medido en condiciones normales (0 C


y 1 atm), se produce por cada gramo de caliza que reacciona? (0,5 punto)
84

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. El oxgeno es el octavo elemento de la tabla peridica, su nmero atmico es Z = 8 y su masa atmica relativa es 16. El oxgeno elemental se
encuentra en la naturaleza en forma de molculas diatmicas.
a) Se conocen varios istopos, pero el ms abundante es el de nmero msico A = 16. Cuntas partculas de cada clase lo constituyen? (0,5 punto)
b) Explica, brevemente, cmo es un tomo de oxgeno, segn el modelo
atmico de Bohr (0,5 punto)
c) Cuntos moles hay en 100 g de oxgeno elemental? (1 punto)
d) Cuntos tomos de oxgeno hay en un mol de oxgeno elemental? (1
punto)
R = 0,082 atm L / K mol

Solucin
Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

a) Se conocen varios istopos, pero el ms abundante es el de nmero msico A = 16. Cuntas partculas de cada clase lo constituyen? (0,5 punto)
El nmero atmico del oxgeno es 8 y su nmero msico es 16. Luego se
compone de 8 protones, 8 neutrones y 8 electrones.
b) Explica, brevemente, cmo es un tomo de oxgeno, segn el modelo
atmico de Bohr (0,5 punto)
Segn el modelo de Bohr, el tomo de oxgeno tendra un ncleo con 8
protones y 8 neutrones, y sus 8 electrones estaran describiendo rbitas a
su alrededor. Dispone de 2 niveles de energa. El primero (capa K), con 2
electrones y el segundo nivel (capa L) con 6 electrones.
c) Cuntos moles hay en 100 g de oxgeno elemental? (1 punto)
El nmero de moles viene dado por la siguiente frmula:
n=

m
Mm

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

85

PRUEBAS DE ACCESO A CFGS

Donde m es la masa, medida en gramos, y Mm la masa molar medida en


g/mol. El oxgeno elemental est compuesto de dos tomos de O, es decir,
O2 luego su masa atmica es 32.
n=

100g
=3,125 moles
32 g mol

d) Cuntos tomos de oxgeno hay en un mol de oxgeno elemental?


(1 punto)
Se define mol como la cantidad de sustancia de un sistema que contiene el
nmero de Avogadro de las entidades elementales caractersticas de dicha
sustancia. Es decir, en un mol de molculas hay NA molculas, siendo NA el
nmero de Avogadro igual a 6,02 1023.
En una molcula de O2 (oxgeno elemental) hay dos tomos de oxgeno,
luego, en un mol de oxgeno elemental habr 2 6,02 1023 = 1,2 1024
tomos de oxgeno.

Explicacin
El tomo de Bohr
Basndose en las teoras de Rutherford y en la teora cuntica de Planck, Bohr
elabor un modelo atmico que tiene las siguientes caractersticas:
Primer postulado. Los electrones giran alrededor del ncleo en rbitas estacionarias sin emitir energa. Mientras el electrn gira en una rbita, no absorbe ni
emite energa alguna.
Segundo postulado. Los electrones solo pueden girar alrededor del ncleo
en aquellas rbitas para las cuales el momento angular del electrn es un mltiSORHQWHURGHK/RVHOHFWURQHVVRORSXHGHQGHVFULELUFLHUWDVyUELWDVFLUFXODUHV
de manera estable. En cada una de estas rbitas al electrn le corresponde una
energa bien determinada. No puede encontrarse a cualquier distancia del ncleo.
Slo hay ciertos valores de energa permitidos, de modo que a cada uno de ellos le
corresponde un radio de rbita estable.
mvr=n

86

h
2

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Siendo h la constante de Planck, m la masa del electrn, v su velocidad, r el radio de la rbita y n un nmero entero (n=1,2,3,), llamado
nmero cuntico principal, que vale 1 para la primera rbita, 2 para la segunda, etc.
Tercer postulado. Cuando un electrn pasa de una rbita externa a otra ms
interna, la diferencia de energa entre ambas rbitas se emite en forma de radiacin electromagntica. Tan solo cuando el electrn absorbe energa suficiente
puede pasar de una rbita a otra de mayor energa (mayor radio), y solo vuelve a
una rbita permitida si emite la diferencia de energa en forma de radiacin electromagntica. La energa emitida o absorbida sera:
E2 E1 = h v
El modelo de Bohr podra explicar la existencia de espectros discontinuos de
emisin de los elementos en estado gaseoso e incandescente. As poda explicar
el espectro de emisin del H, pero no poda hacer lo mismo con los espectros de
otros tomos, todo esto llev a la elaboracin del modelo cuntico actual.

Pregunta
2. A continuacin se muestran los tres primeros periodos del sistema peridico. Se representan con fondo oscuro los elementos metlicos y con
fondo claro los no metlicos.
a) Cmo ser el enlace en el NaCl? (0,5 puntos)
b) Representa el diagrama de Lewis para el CH4 (0,5 puntos)
c) En alguna de las sustancias anteriores se forman puentes de hidrgeno?
(0,5 puntos)
d) De las sustancias anteriores (NaCl, H2O, CH4): (1 punto)
i) Cul presenta una mayor dureza?
ii) Cul es la ms voltil?

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

87

PRUEBAS DE ACCESO A CFGS

Solucin
a) Cmo ser el enlace en el NaCl? (0,5 punto)
El enlace de NaCl es inico.
b) Representa el diagrama de Lewis para el CH4 (0,5 punto)
El diagrama de Lewis para el CH4 es el siguiente:

Figura 4. Diagrama de Lewis del CH4

c) En alguna de las sustancias anteriores se forman puentes de hidrgeno? (0,5 punto)


El agua, que presenta puentes de hidrgeno entre sus molculas.
d) De las sustancias anteriores (NaCl, H2O, CH4): (1 punto)
i) Cul presenta una mayor dureza?
De los tres compuestos y, en condiciones estndar (25 oC y 1 atm de
presin), el que presenta ms dureza es el ClNa, que es slido, seguido
del H2O, que es lquido, y del CH4, que es gas.
ii) Cul es la ms voltil?
El ms voltil de los tres ser por tanto el CH4 que es un gas.

Pregunta
3. Formula o nombra los siguientes compuestos qumicos. (2 puntos)






88

+2SO4:
7HWUDR[RIRVIDWR 9 GHKLGUyJHQR
1+4)2S:
+LSRFORULWRGHVRGLR
3E22:
1+3:
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA






%XWDQR
&+3-CO-CH3:
0HWDQRDPLGD
&+3-CH2-NH2:

Solucin

H2SO4
Tetraoxofosfato (V) de hidrgeno
(NH4)2S
Hipoclorito de sodio

(Sist.)Tetraoxosulfato de dihidrgeno
(Stock) cido tetraoxosulfrico (VI)
(Tradicional) cido sulfrico
H3PO4
Sulfuro de amonio
NaClO

PbO2

(Sist.) Dixido de Plomo


(Stock) xido de Plomo (IV)

NH3

(Sist.) Trihidruro de hidrgeno


(Stock) Amoniaco

Butano
CH3-CO-CH3

CH3-CH2-CH2-CH3
Dimetilcetona
Propanona

Metanoamida

H-CONH2

CH3-CH2-NH2

Etilamina

Pregunta
4. El cido clorhdrico (HCl) se utiliza como desincrustante para eliminar
residuos de caliza (CaCO3) produciendo cloruro de calcio (CaCl2) dixido
de carbono (CO2) y agua (H2O).
a) Escribe la correspondiente ecuacin ajustada (1 punto).
b) Para llevar a cabo la reaccin, disponemos en el laboratorio de cido
clorhdrico del 15% y densidad 1,05 g/mL. Cul es la concentracin
molar de este cido? (0,5 punto).
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

89

PRUEBAS DE ACCESO A CFGS

c) Con 1 L del cido anterior, qu cantidad de caliza podra limpiarse? (0,5 punto).
d) Qu volumen de dixido de carbono, medido en condiciones normales
(0 C y 1 atm), se produce por cada gramo de caliza que reacciona?
(0,5 punto).
Datos:
H: 1
C: 12
O: 16
Cl: 35,5
Ca: 40,1

Solucin
Para evitar que el estudiante la confunda con la Molaridad (M), designaremos a la masa molar (Mn),
aunque su designacin correcta sera (M).

a) Escribe la correspondiente ecuacin ajustada (1 punto)


Se ajusta la reaccin por el mtodo de tanteo, ya que es muy sencilla.
CaCO3 + 2 HCl o CaCl2 + CO2 + H2O
b) Para llevar a cabo la reaccin, disponemos en el laboratorio de cido
clorhdrico del 15% y densidad 1,05 g/mL. Cul es la concentracin molar de este cido? (0,5 punto)
Previamente se necesita realizar la transformacin de las unidades de densidad: 1,05 g/mL = 1050 g/L.
Y se calcula la masa molar del HCl, es decir, 36,5 g/mol.
Para calcular la concentracin molar M de una sustancia en una disolucin, hay
que dividir la cantidad de sustancia de soluto ns (expresada en moles de soluto)
por el volumen V de la disolucin (expresada en litros). Por tanto:
M=

ns
V

El nmero de moles de soluto se puede calcular como:


ns =
90

m
Mn

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Siendo m la masa de soluto (en gramos) y Mm su masa molar (en gramos/mol).


Como la masa de soluto est relacionada con la masa total de la disolucin
mediante la riqueza porcentual de la misma, se puede decir que:
ms =

r
m
100

Y teniendo en cuenta que la densidad es igual a:


d=

m
V

Incluyendo todas las transformaciones anteriores, se obtendra la siguiente expresin:


M=

M=

r d
Mn 100

15 1050 g / L
= 4, 31 moles / L
36, 5 g / mol 100

c) Con 1 L del cido anterior, qu cantidad de caliza podra limpiarse? (0,5


puntos)
Una vez que se ha calculado la concentracin, se aplica la frmula inicial:
M=

ns
V

n (HCl) = M V = 4,3 moles /L 1 L = 4,3 moles


Sabiendo que en la reaccin se producirn 2 moles de HCl por cada mol de
CaCO3, se puede decir que la proporcin entre ambos ser 2/1.
Luego, por tanto:
n ( HCl )

n ( CaCO3 )
n ( CaCO3 ) =

=2

n ( HCl ) 4, 3 moles
=
= 2,15 moles
2
2

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

91

PRUEBAS DE ACCESO A CFGS

Para continuar se debe calcular la masa molar de la caliza, es decir:


Mm(CaCO3)= 40,1 + 12 + 16 3 = 100,1 g/mol
Como:
ns =

m
Mn

Se deduce que:
m(CACO3) = n(CaCo3) Mm(CaCo3) = 2,15 moles 100,1 g/mol = 215,2 g
d) Qu volumen de dixido de carbono, medido en condiciones normales (0 C
y 1 atm), se produce por cada gramo de caliza que reacciona? (0,5 punto)
Para calcular el volumen de CO2 que se produce por cada gramo de caliza, primero, se tiene que hacer una sencilla regla de tres:
1g
= 9, 99 10 3 moles
100,1 g
Se aplica ahora la ecuacin general de los gases:
PV=nRT
De donde:
V=

n R T
P

Siendo V el volumen de CO2 y n el nmero de moles de soluto. Dado que:


n=

m
Mm

Y que en la reaccin se formar 1 mol de CO2 por cada mol de CaCO3, se puede
decir que la proporcin entre los moles de soluto del CaCO3 y los moles de soluto
del CO2 ser 1/1. Por tanto:
n(CO2 )
= 1 n(CO2 ) = n(CaCO3 ) = 9, 99 10 3 moles
n(CaCO3 )
Y sabiendo que 0 oC corresponde a 273 K, se sustituye en la ecuacin general
de los gases:
V (CO2 ) =

92

9, 99.10 3 moles 0, 082 atm L / K mol 273K


= 0, 223L
1 atm
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Explicacin
Clculo del Volumen de un gas mediante el volumen molar
Existe otro modo de realizar el apartado D de este problema. Sabiendo que el
volumen molar de un gas es el volumen ocupado por 1 mL de cualquier gas en
condiciones normales de presin y temperatura, y que su valor es 22,4 L/mol, se
puede establecer la siguiente relacin:
Mm Vm
=
m
V
Entonces:
g
de CaCO3 22,4 L CO /mol
2
mol
=
1 g de CaCO3
V

100,1

De donde:
V=

1g 22,4 g/mol
=0,223 L
100,1 g/mol

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

93

EXAMEN N. 9
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: QUMICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1. El amoniaco a temperatura ambiente es un gas incoloro y de olor picante


caracterstico. Est formado por molculas en las que se unen un tomo
de nitrgeno y tres de hidrgeno. El nitrgeno tiene un nmero atmico
Z=7 y su masa atmica relativa es 14. El hidrgeno tiene un nmero
atmico Z=1 y su masa atmica relativa es 1. (3 puntos)
Datos R= 0,082 atm.L/ K.mol.
a) El istopo ms abundante del nitrgeno tiene un nmero msico A=14. Explica brevemente cuntas partculas fundamentales lo constituyen y dnde
se sita cada una de ellas siguiendo el modelo atmico de Bohr. (0,5 puntos)
........................................................................................................
........................................................................................................
........................................................................................................
........................................................................................................
b) Indica, razonadamente, si el sistema constituido por amoniaco gaseoso es un elemento, un compuesto o una mezcla. (0,5 puntos)
........................................................................................................
........................................................................................................
........................................................................................................
........................................................................................................

94

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

c) Cuntos tomos de hidrgeno hay en 2 moles de amoniaco? (1 punto)

d) Qu volumen ocupan 3,4 g de amoniaco gaseoso, a la temperatura de


25 C y 1 atm de presin? (1 punto)

2. A continuacin se muestran los tres primeros periodos del sistema peridico. Se representan con fondo oscuro los elementos metlicos y con
fondo claro los elementos no metlicos. (2,5 puntos)
I

II

III

IV

VI

VII

VIII

He

10

Li

Be

Ne

11

12

13

14

15

16

17

18

Na

Mg

Al

Si

Cl

Ar

a) Qu tipo de enlace tiene lugar en el LiF? (0,5 puntos)

b) Qu tipo de enlace tiene lugar en el amoniaco NH3? Representa el


diagrama de Lewis. (0,5 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

95

PRUEBAS DE ACCESO A CFGS

c) Indica dos consecuencias de la formacin de puentes de hidrgeno


en el agua. (0,5 puntos)

d) De las sustancias anteriores (LiF, NH3, H2O): (1 punto)


i) Cul presenta mayor dureza?
ii) Cul es ms voltil?

3. Formula o nombra los siguientes compuestos qumicos. (2 puntos)


 +2MnO4
 7HWUDR[RVLOLFDWR ,9 GHFDOFLR ,,
 1+4Cl
 6XOIDWRSRWiVLFR
 6L22
 &DUERQDWRGHFDOFLR
 3URSDQR
 &+3-COOH
 (WLODPLQD
 &+3-CH2-OH
4. El isooctano (2,2,4-trimetilpentano, C8H18) es un buen combustible, fue
seleccionado como punto de referencia 100 en la escala de octanaje de
la gasolina. En la combustin reacciona con el oxgeno (O2) produciendo
dixido de carbono (CO2) y agua (H2O), liberando adems una gran cantidad de energa que se utiliza en la propulsin de vehculos. (2,5 puntos)
Datos: Masas atmicas relativas: H:1; C:12; O:16
a) Escribe la correspondiente ecuacin ajustada. (1 punto)

96

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

b) Si disponemos de 2 L de combustible que tiene 1,311 Kg de isooctano mezclado con otras sustancias no combustibles, cul ser la
concentracin molar de la disolucin? (0,5 puntos)

c) El isooctano del 95% tiene una densidad de 0,69 g/mL. Qu volumen


de oxgeno, medido en condiciones normales (0 C y 1 atm), se necesitar para la combustin completa de 1 L de isooctano del 95%?
(0,5 puntos)

d) Calcula los gramos de agua que se producen en la combustin de 1


mol de isooctano. (0,5 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

97

SOLUCIONES

Pregunta
1. El amoniaco a temperatura ambiente es un gas incoloro y de olor picante
caracterstico. Est formado por molculas en las que se unen un tomo
de nitrgeno y tres de hidrgeno. El nitrgeno tiene un nmero atmico
Z=7 y su masa atmica relativa es 14. El hidrgeno tiene un nmero
atmico Z=1 y su masa atmica relativa es 1. (3 puntos)
Datos R= 0,082 atm.L/ K.mol.
a) El istopo ms abundante del nitrgeno tiene un nmero msico A=14.
Explica brevemente cuntas partculas fundamentales lo constituyen y
dnde se sita cada una de ellas siguiendo el modelo atmico de Bohr.
(0,5 puntos)
b) Indica, razonadamente, si el sistema constituido por amoniaco gaseoso es un elemento, un compuesto o una mezcla. (0,5 puntos)
c) Cuntos tomos de hidrgeno hay en 2 moles de amoniaco? (1 punto)
d) Qu volumen ocupan 3,4 g de amoniaco gaseoso, a la temperatura de
25 C y 1 atm de presin? (1 punto)

Solucin
a) El istopo ms abundante del nitrgeno tiene un nmero msico A=14. Explica brevemente cuntas partculas fundamentales lo constituyen y dnde se
sita cada una de ellas siguiendo el modelo atmico de Bohr. (0,5 puntos)
En el ncleo nos encontramos 7 protones y 7 neutrones y girando a su alrededor 7 electrones.
b) Indica, razonadamente, si el sistema constituido por amoniaco gaseoso
es un elemento, un compuesto o una mezcla. (0,5 puntos)
El NH3 es un compuesto, ya que se trata de dos elementos combinados. En
los compuestos los elementos que lo forman pierden sus propiedades particulares dando lugar a nuevas caractersticas, propias del compuesto formado. Son
homogneos y no se pueden separar fsicamente de forma sencilla. Adems su
composicin es fija.
98

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

c) Cuntos tomos de hidrgeno hay en 2 moles de amoniaco? (1 punto)


Se define mol como la cantidad de sustancia de un sistema que contiene el Nmero de Avogadro de las entidades elementales caractersticas de dicha sustancia.
En un mol de molculas hay NA molculas, siendo NA el Nmero de Avogadro
igual a 6,02 1023. En una molcula de NH3 (amoniaco) hay 1 tomo de nitrgeno y 3 tomos de hidrgeno.
1 molcula NH3 o N + 3 H
Por tanto:
1 mol de NH3 o 3 6,02 1023 tomos de H.
De tal forma que:
2 moles de NH3 o 6 6,02 1023
Es decir:
3,61 1024 tomos de H
d) Qu volumen ocupan 3,4 g de amoniaco gaseoso, a la temperatura de
25 C y 1 atm de presin? (1 punto)
Para calcular el volumen de NH3 gaseoso tendremos que usar la ecuacin general de los gases:
n u R u T
P
Siendo V el volumen de NH3 y n el nmero de moles de soluto.
P V = n R T de donde: V=

Dado que n =

m
3, 4
=
= 0, 34 moles
Mm
10

Donde:

nmero de moles es n.
la masa es m, igual a 3,4 g.
la masa molar (Mm) del NH3 es 14+3=17 g/mol (a 25 oC corresponde a 298 K)

Luego:
n(NH3 ) =

m(NH3 ) 3, 4
=
= 0,2 moles
Mm
17

Sustituimos en la ecuacin general de los gases:


V (NH3 )=

0,2 moles0,082 atm L K mol298 K


=4, 89 L
1 atm

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

99

PRUEBAS DE ACCESO A CFGS

Pregunta
2. A continuacin se muestran los tres primeros periodos del sistema peridico. Se representan con fondo oscuro los elementos metlicos y con
fondo claro los elementos no metlicos. (2,5 puntos)
I

II

III

IV

VI

VII

VIII

He

10

Li

Be

Ne

11

12

13

14

15

16

17

18

Na

Mg

Al

Si

Cl

Ar

a) Qu tipo de enlace tiene lugar en el LiF? (0,5 puntos)


b) Qu tipo de enlace tiene lugar en el amoniaco? Representa el
diagrama de Lewis. (0,5 puntos)
c) Indica dos consecuencias de la formacin de puentes de hidrgeno
en el agua. (0,5 puntos)
d) De las sustancias anteriores (LiF, NH3, H2O): (1 punto)
i) Cul presenta mayor dureza?
ii) Cul es ms voltil?

Solucin
a) Qu tipo de enlace tiene lugar en el LiF? (0,5 puntos)
Se trata de un enlace inico.
100

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

b) Qu tipo de enlace tiene lugar en el amoniaco? Representa el diagrama


de Lewis. (0,5 puntos)
Se trata de un enlace covalente.

c) Indica dos consecuencias de la formacin de puentes de hidrgeno en el


agua. (0,5 puntos)
Elevada constante dielctrica, elevada fuerza de cohesin entre sus molculas,
elevada tensin superficial, elevado calor especfico, elevado punto de vaporizacin, mayor densidad en estado lquido que slido y bajo grado de ionizacin.

Explicacin
Las molculas de agua se unen mediante puentes de hidrgeno. Se produce
debido a las interacciones dipolo-dipolo. La carga parcial negativa del oxgeno de
una de las molculas ejerce una atraccin electrosttica sobre las cargas parciales
positivas de los tomos de hidrgeno de las molculas prximas. Se pueden formar
grupos desde 3,4 y hasta unas 9 molculas. Con ello el agua alcanza pesos moleculares elevados y se comporta como un lquido. Las agrupaciones duran fracciones
de segundo (de 10-10 a 10-21 s). Pero esto confiere al agua todas las propiedades
de un fluido. Los polmeros coexisten con molculas sueltas que rellenan los huecos.
El agua es un lquido muy especial con un comportamiento anmalo. Ello se
debe a su estructura y a los enlaces que forma. Algunas caractersticas muy importantes son:
Elevada constante dielctrica. Por ello es un disolvente universal. El proceso
de disolucin se debe a que las molculas de agua, al ser polares, se disponen
alrededor de los grupos polares de soluto, llegando a desdoblarlos en aniones
y cationes, como en el caso de los compuestos inicos, que de esta manera
quedan rodeados por molculas de agua. Este fenmeno se llama solvatacin
inica. Tambin es disolvente de los compuestos covalentes polares.
Elevada fuerza de cohesin entre sus molculas. Esto se debe a los puentes
de hidrgeno. Por ello el agua es un lquido prcticamente incompresible.
Esto tambin explica la elevada tensin superficial, por lo que su superficie
opone una gran resistencia a romperse.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

101

PRUEBAS DE ACCESO A CFGS

Elevado calor especfico. Es decir, hace falta mucho calor para elevar su
temperatura.
Elevado calor de vaporizacin. Hace falta elevar mucho su temperatura para
romper los puentes de hidrgeno.
Mayor densidad en estado lquido que en estado slido.
Bajo grado de ionizacin. La proporcin de molculas ionizadas es de
1/551.000.000. Esto explica que la concentracin de (H3O+) y de (OH-)
sea muy baja, y que si al agua se le aade un cido o una base, los niveles
varen bruscamente.

d) De las sustancias anteriores (LiF, NH3, H2O): (1 punto)


i) Cul presenta mayor dureza?
El LiF. Bajo las condiciones normales de presin y temperatura es una sal
slida, inorgnica, cristalina e inica de color blanco.
ii) Cul es ms voltil?
El NH3. En condiciones normales se trata de un gas incoloro de olor muy
penetrante y nauseabundo, se disuelve fcilmente en agua y se evapora
rpidamente.

Pregunta
3. Formula o nombra los siguientes compuestos. (2 puntos)
NOMBRE

FRMULA
H2MnO4

Tetraoxosilicato (IV) de calcio (II)


NH4Cl
Sulfato potsico
SiO2
Carbonato de calcio
Propano
CH3-COOH
Etilamina
CH3-CH2-OH
102

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Solucin
NOMBRE

FRMULA

(Sist.) Tetraoxomanganato (VI) de hidrgeno


(tradicional) cido mangnico
(Stock) cido tetraoxomangnico (VI)

H2MnO4

Tetraoxosilicato (IV) de calcio (II)

Ca2SiO4

(Sist.) Cloruro de amonio


(tradicional) Cloruro amnico

NH4Cl

Sulfato potsico

K2SO4

(Sist.) Dixido de silicio


(Stock y trad.) xido de silicio

SiO2

Carbonato de calcio

CaCO3

CH3-CH2-CH3

Propano

CH3-COOH

cido actico
cido etanoico

CH3-CH2-NH2

Etilamina

CH3-CH2-OH

Etanol

Pregunta
4. El isooctano (2,2,4-trimetilpentano, C8H18) es un buen combustible, fue
seleccionado como punto de referencia 100 en la escala de octanaje de
la gasolina. En la combustin reacciona con el oxgeno (O2) produciendo
dixido de carbono (CO2) y agua (H2O), liberando adems una gran cantidad de energa que se utiliza en la propulsin de vehculos. (2,5 puntos)
Datos: Masas atmicas relativas: H:1; C:12; O:16
a) Escribe la correspondiente ecuacin ajustada. (1 punto)
b) Si disponemos de 2 L de combustible que tiene 1,311 Kg de isooctano mezclado con otras sustancias no combustibles, cul ser la
concentracin molar de la disolucin? (0,5 puntos)
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

103

PRUEBAS DE ACCESO A CFGS

c) El isooctano del 95% tiene una densidad de 0,69 g/mL. Qu volumen de


oxgeno, medido en condiciones normales (0 C y 1 atm), se necesitar
para la combustin completa de 1 L de isooctano del 95%? (0,5 puntos)
d) Calcula los gramos de agua que se producen en la combustin de 1
mol de isooctano. (0,5 puntos)

Solucin
a) Escribe la correspondiente ecuacin ajustada. (1 punto)
Para ajustar la reaccin utilizamos el mtodo algebraico. De manera que se
asigna un coeficiente a cada una de las molculas.
X (C8H18)+ Y (O2) o Z (CO2) + T (H2O)
Establecemos las ecuaciones para relacionar los tomos de los reactivos y los
productos.
Carbono: 8X = Z
Hidrgeno: 18X = 2T
Oxgeno 2Y = 2Z + T
Damos un valor arbitrario a uno de los coeficientes. Por ejemplo: X = 1
De manera que:
Z = 8X = 8
2T = 18X = 18; T = 9
2Y = 2Z + T = 16 + 9 = 25;

Y = 25 / 2

Para eliminar la fraccin multiplicamos por dos, de manera que:


X = 2;

Z = 16;

T = 18;

Y = 25

La reaccin ajustada sera:


2(C8H18) + 25 (O2) o 16(CO2) + 18(H2O)
b) Si disponemos de 2L de combustible que tiene 1,311 Kg de isooctano
mezclado con otras sustancias no combustibles, cul ser la concentracin molar de la disolucin? (0,5 puntos)
Para calcular la concentracin molar M de una sustancia en una disolucin, hay
que dividir la cantidad de sustancia de soluto ns (expresada en moles de soluto)
por el volumen V de la disolucin (expresada en litros).
104

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

Por tanto:
M=

ns
V

Sabiendo que:
ns =

m
Mm

Siendo m la masa de soluto en gramos y Mm su masa molar en gramos/mol.


La Mm (masa molar) la calculamos sumando las masas de los elementos que
componen la molcula:
Mm(C8H18) = 12 8 + 1 18 = 114 g/mol.
A continuacin calculamos
n (C8H18 ) =

m (C8H18 )

Mm (C8H18 )

1311g
= 11,5 moles de molculas de C3H8
114 g mol

Sustituyendo los valores en la ecuacin:


M (C8H18 ) =

m Mm
11,5 moles
=
= 5,75 moles litro
2L
V

c) El isooctano del 95% tiene una densidad de 0,69 g/mL Qu volumen de


oxgeno, medido en condiciones normales (0 C y 1 atm), se necesitar
para la combustin completa de 1 L de isooctano del 95%? (0,5 puntos)
Previamente necesitamos realizar la transformacin de las unidades de densidad:
0,69 g/mL= 690 g/L
Y calculamos la masa molar del O2 = 32 g/mol
Ya conocemos la masa molar del C8H18 por el ejercicio anterior= 114 g/mol
Para calcular la concentracin molar M de una sustancia en una disolucin, hay
que dividir la cantidad de sustancia de soluto ns (expresada en moles de soluto)
por el volumen V de la disolucin (expresada en litros).
Por tanto:
M=

ns
V

El nmero de moles de soluto se puede calcular como:


ns =

m
Mm

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

105

PRUEBAS DE ACCESO A CFGS

Siendo m la masa de soluto (en gramos) y Mm su masa molar (en gramos/mol).


Como la masa de soluto est relacionada con la masa total de la disolucin
mediante la riqueza porcentual de la misma, podemos decir que:
ms =

r
m
100

Y teniendo en cuenta que:


d=

m
V

Incluyendo todas las transformaciones anteriores obtendramos la siguiente expresin:


M=
M=

rd
Mm 100

95 6 90 g L
= 5,75 moles L
114 g mol 100

Una vez que hemos calculado la concentracin, aplicamos la frmula inicial:


M=

ns
V

n(C8H18)= M V = 5,75 moles/L 1 L = 5,75 moles


Sabiendo que en la reaccin combustionan 2 moles de C8H18 por cada 25 moles de O2 podemos decir que la proporcin entre ambos ser 2/25.
Luego, por tanto:
n(O2 )
25
= =12,5
2
n(C8H18 )
n(O2)= 12,5. n(C8H18)= 12,5. 5,75= 71,87 moles
Para calcular el volumen de O2 aplicamos ahora la ecuacin general de los gases:
nR T
P
o
Y sabiendo que 0 C corresponde a 273 K, sustituimos en la ecuacin general
de los gases:
P V = n R T de donde: V =

V (O2 )=

106

71, 87 moles 0, 082 atm L / K mol 273 K


=1608, 99 L
1 atm
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: QUMICA

d) Calcula los gramos de agua que se producen en la combustin de 1 mol


de isooctano. (0,5 puntos)
Dado que:
n=

m
Mm

Y que en la reaccin se formarn 18 moles de H2O por cada 2 moles de C8H18


podemos decir que la proporcin entre los moles ser de 18 / 2 = 9
Por tanto, como:
n (H2 O)=

m (H2 O)
Mn

= 9 moles

Y sabiendo que la masa molecular del H2O es= 2+16=18 g /mol, se tiene:
m(H2O) = 9 moles 18 g/mol = 162 gramos

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

107

mbito de
Biologa

EXAMEN N. 1
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

En las preguntas donde se proponen varias soluciones, slo una es correcta.

Revisa cuidadosamente la prueba antes de entregarla.

1. Indica de qu orgnulo celular se trata (0,25 puntos) y los criterios en


los que te has basado para deducirlo. (0,5 puntos)
a) Menciona los componentes sealados. (0,75 puntos)

b) Comenta el proceso celular, de gran importancia para la obtencin de


ATP (energa qumica utilizable por la clula), que ocurre en dicho orgnulo. (1 punto)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

111

PRUEBAS DE ACCESO A CFGS

2. Durante la profase mittica, una clula humana presenta:


a) 92 molculas de ADN (46 cromosomas de 2 cromtidas cada uno).
b) 46 molculas de ADN (46 cromosomas de 1 cromtida cada uno).
c) 46 molculas de ADN (23 cromosomas de 2 cromtidas cada uno).
d) 23 molculas de ADN (23 cromosomas de 1 cromtidas cada uno).
Indica la respuesta correcta (1 punto) y argumenta tus razones. (1,5 puntos)

3. Observa el dibujo e identifica si se trata de una respuesta humoral o celular. Razona tu respuesta (1 punto). Respecto del proceso representado:
a) Cmo actan las clulas presentadoras de antgenos? Se trata de
que comentes lo que ocurre en 1, 2 y 3 (0,5 puntos). Cita un ejemplo
de clula presentadora de antgenos. (0,25 puntos)
b) Qu son las linfoquinas? (0,25 puntos)
c) Qu diferencia hay entre una clula B y una clula plasmtica? (0,5 puntos)

112

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

4. Haz corresponder los conceptos a sus definiciones:

CONCEPTO

DEFINICIN

Nucletido

Molcula que es la base de las membranas celulares. Presenta


una parte hidrfila y otra hidrfoba
..

Meiosis

Cada uno de los monmeros que forma un cido nucleico. Est


formado por una pentosa, una base nitrogenada y una molcula
de cido fosfrico

Fosfolpido

Proceso de divisin celular en el que de una clula madre diploide, se obtienen cuatro clulas hijas con un nmero de cromosomas haploide
..

Esterilizacin

Conjunto de genes que posee un individuo


..

Genotipo

Es la eliminacin total de los microorganismos de los medios de


cultivo, del material y de los utensilios de laboratorio
..

(Cada respuesta correcta vale 0,5 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

113

SOLUCIONES

Pregunta
1. Indica de qu orgnulo celular se trata (0,25 puntos) y los criterios en
los que te has basado para deducirlo. (0,5 puntos)
a) Menciona los componentes sealados. (0,75 puntos)
b) Comenta el proceso celular, de gran importancia para la obtencin de ATP
(energa qumica utilizable por la clula), que ocurre en dicho orgnulo.
(1 punto)

Solucin
Se trata de una mitocondria. Las mitocondrias son orgnulos citoplasmticos
fcilmente identificables. En el dibujo se observa un esquema de seccin transversal de una forma alargada, que es su representacin ms tpica, aunque pueden
tener desde forma esfrica hasta alargada en forma de bastoncillo.
Adems, se trata de un orgnulo de doble membrana, con un espacio entre
ambas y la membrana interna, y aparece replegada formando crestas y dejando un
espacio interior.
a) Menciona los componentes sealados. (0,75 puntos)

Figura 1. Dibujo y componentes de la mitocondria

114

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

b) Comenta el proceso celular, de gran importancia para la obtencin de ATP


(energa qumica utilizable por la clula), que ocurre en dicho orgnulo.
(1 punto)
La principal funcin de las mitocondrias es la respiracin aerobia, tambin conocida como respiracin mitocondrial, respiracin celular o simplemente respiracin. Su misin es generar energa a partir de los nutrientes consumidos para
mantener la actividad celular.
A partir de una molcula de glucosa se producen:

En el citoplasma gracias a la gluclisis 2 ATP.

En la mitocondria: 34 ATP
A partir del NADH+ + H+ procedente de la gluclisis, 6 ATP.
A partir del Acetil-CoA, 6 ATP
A partir del ciclo de Krebs 18 ATP + 2 GTP + 2 (FADH2)

Explicacin
La respiracin celular
Los nutrientes penetran en la clula y se transforman en el citoplasma en un proceso llamado gluclisis que oxida la glucosa y otros azcares produciendo cido pirvico.
El cido pirvico se transporta hacia la membrana mitocondrial interna y se oxida
dentro de la matriz, transformndose en Acetil-CoA, que es el primer sustrato del
ciclo de Krebs (tambin llamado ciclo del cido ctrico o Ciclo del cido tricarboxlico). El Acetil-CoA tambin puede provenir de la E-oxidacin de los cidos grasos.
El balance energtico de la gluclisis en el citoplasma y del ciclo de Krebs en
la mitocondria es bastante reducido, formndose solamente 2ATP y 2 GTP, sin embargo, durante estos ciclos se reducen los coenzimas NAD y FAD convirtindose en
NADH + H+ y FADH2.
Entonces comienza la segunda y ltima etapa de la respiracin el llamado
transporte de electrones en la cadena respiratoria que, bsicamente, consiste en
una cadena de molculas orgnicas que se reducen y se oxidan, a medida que se
van traspasando los protones y electrones procedentes del NADH + H+ y FADH2.
Estas molculas se llaman cadena transportadora de electrones o cadena respiratoria y se encuentran en las crestas de la membrana interna mitocondrial.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

115

PRUEBAS DE ACCESO A CFGS

Cada una de las molculas transportadoras de electrones se oxida al ceder


electrones y la siguiente se reduce al aceptarlos. La energa que se libera en la
oxidacin es mayor que la consumida para la reduccin, por lo que en cada paso
hay un sobrante de energa.
Segn la hiptesis quimiosmtica de Mitchell, esta energa se invierte en provocar un bombeo de protones (H+) desde la matriz mitocondrial hasta el espacio
intermembranal, esto origina una diferencia de carga elctrica a ambos lados de
la membrana interna. De esta manera, cuando los protones (H+) en exceso en el
espacio intermembranoso vuelven a la matriz mitocondrial, lo hacen a travs de
las partculas F o complejos enzimticos ATP-sintetasa, suministrndoles la energa
necesaria para la sntesis del ATP. Este proceso se denomina fosforilacin oxidativa.
Este complejo de protenas de membrana permite a los protones volver a la
matriz slo si se aade un grupo fosfato al compuesto difosfato de adenosina (ADP)
para formar ATP en un proceso llamado fosforilacin.
El ATP se libera en el citoplasma de la clula, que lo utiliza prcticamente en
todas las reacciones que necesitan energa. Se convierte en ADP, que la clula
devuelve a la mitocondria para volver a fosforilarlo.

Pregunta
2. Durante la profase mittica, una clula humana presenta:
a) 92 molculas de ADN (46 cromosomas de 2 cromtidas cada uno).
b) 46 molculas de ADN (46 cromosomas de 1 cromtida cada uno).
c) 46 molculas de ADN (23 cromosomas de 2 cromtidas cada uno).
d) 23 molculas de ADN (23 cromosomas de 1 cromtidas cada uno).
Indica la respuesta correcta (1 punto) y argumenta tus razones. (1,5 puntos)

Solucin
La respuesta correcta es la A. 92 molculas de ADN 46 cromosomas de 2
cromtidas cada uno.
La clula humana tiene 23 pares de cromosomas, es decir 46 en total. Durante
la fase S de la interfase mittica se produce la duplicacin del ADN, por lo que al
condensarse durante la profase se formarn los 46 cromosomas cada uno de ellos
con dos cromtidas unidas entre s por un centrmero.
116

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Explicacin
La mitosis
El ciclo celular o ciclo vital de una clula consiste en el periodo de tiempo que
va desde que se forma la clula, hasta que se divide generando nuevas clulas. En
el ciclo se diferencian dos etapas:

La interfase o etapa de no divisin, que tiene tres fases:


*

Fase G1. Durante la cual se produce la sntesis de ARNm y por tanto de


protenas. Esta fase puede durar desde pocas horas a la totalidad de la
vida de las clulas (en el caso de clulas muy especializadas que pierden
la capacidad de dividirse como las neuronas). Al final de la fase G1 se llega
a un punto de no retorno llamado punto de restriccin o punto R, a partir
del cual ya es imposible que la clula detenga el proceso de divisin.

Fase S. En esta fase se produce la duplicacin del ADN, continuando


la sntesis de ARNm y de protenas, especialmente histonas. Empieza a
formarse el procentriolo.

Fase G2. Finaliza la sntesis de ADN y empiezan a distinguirse los cromosomas. En esta fase la clula ya tiene doble cantidad de ADN. Contina
la sntesis de ARNm y por tanto de protenas, especialmente Histona
H1, esencial para la formacin del huso mittico.

La divisin celular o fase M es el proceso celular por el cual a partir de una


clula madre se originan dos clulas hijas con idntica dotacin cromosmica que la progenitora. Comprende la divisin del ncleo, llamada mitosis
o cariocinesis y la divisin del citoplasma llamada citocinesis. La mitosis es
un proceso continuo que se ha dividido en 4 fases para facilitar su estudio:
1. Profase. En esta fase empiezan a visualizarse los cromosomas, las fibras
de cromatina de 100 se enrollan sobre s mismas formando estructuras de 300, y las dos cromtidas producidas durante la fase S por
duplicacin permanecen unidas a nivel del centrmero constituyendo el
cromosoma profsico. Desaparece el nucleolo o nucleolos.
En los animales (no en vegetales), los diplosomas inmaduros rodeados
de su material pericentriolar forman un complejo centriolar a partir del
cual se forman microtbulos que se disponen radialmente formando las
fibras del ster. El conjunto se denomina ster o centrosfera. Los dos
steres continan formando microtbulos y constituyen unas fibras polares o continuas cuyo alargamiento produce la separacin de los steres hacia polos opuestos formando el huso mittico, durante el proceso
el procentriolo se alarga y acaba formando el centriolo.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

117

PRUEBAS DE ACCESO A CFGS

Posteriormente el ncleo se hincha por la entrada de agua y la envoltura


nuclear se rompe derramndose el nucleoplasma por el citoplasma.
Paralelamente en los cromosomas se empieza a formar a nivel de los
centrmeros el cinetocoro o placa cinetocrica que se comporta como
un centro organizador de microtbulos y a partir de los cuales se forman
los microtbulos cinetocricos, que al alargarse van separando los cromosomas y se unen al huso mittico dejando cada una de las cromtidas orientada hacia un polo de la clula.
2. La Metafase. Al irse alargando los microtbulos cinetocricos los cromosomas quedan en el centro de la clula disponindose en mitad del
huso mittico y constituyendo la placa ecuatorial. Es en este momento
cuando los cromosomas se visualizan con mayor claridad.
3. La anafase. Se inicia con la separacin de las cromtidas hermanas y a
partir de este momento cada cromatida se considera un solo cromosoma llamado cromosoma anafsico.
Cuando cada juego de cromosomas anafsico llega a un polo de la clula empiezan a condensarse de forma que ya no pueden diferenciarse
unos de otros y desaparecen los cinetocoros.
4. Telofase. Las dotaciones cromosmicas se agrupan en cada uno de los
polos de la clula y empieza a formarse la envoltura nuclear, a partir de
sculos del retculo endoplsmtico. Los cromosomas se desenrollan y
se forman las regiones organizadoras de los nucleolos.
Los microtbulos polares se sueltan del material pericentriolar, se aproximan entre s y forman haces entre los dos ncleos, Estos microtbulos
interzonales se rodean de protenas formando los cilindros de sustancia
densa que sern importantes en la citocinesis.
La citocinesis o citodiresis es la divisin del citoplasma celular. En los
animales se produce por estrangulamiento del citoplasma en los vegetales por tabicacin intracelular.
En animales se produce invaginacin de la membrana plasmtica a nivel
del plano ecuatorial del huso, aparece el surco de divisin que rodea
todo el citoplasma. Internamente se forma un anillo contrctil constituido de molculas de actinas que se unen a la cara interna de la membrana plasmtica y con los extremos libres unidos a moleculas de miosina.
Cuando la membrana del surco de divisin se une con el haz de microtbulos intezonales de la sustancia densa el citoplasma se divide y se
forman dos clulas hijas.

118

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Pregunta
3. Observa el dibujo e identifica si se trata de una respuesta humoral o celular. Razona tu respuesta (1 punto). Respecto del proceso representado:
a) Cmo actan las clulas presentadoras de antgenos? Se trata de
que comentes lo que ocurre en 1, 2 y 3 (0,5 puntos). Cita un ejemplo
de clula presentadora de antgenos. (0,25 puntos)
b) Qu son las linfoquinas? (0,25 puntos)
c) Qu diferencia hay entre una clula B y una clula plasmtica? (0,5 puntos)

Solucin
Se trata de una respuesta humoral. En el esquema aparecen los linfocitos B,
las clulas presentadoras de antgenos, los linfocitos T colaboradores, los linfocitos
B, las clulas plsmticas y los anticuerpos producidos por ellas, por lo que se trata
de una respuesta de tipo humoral y no por la accin directa de las clulas.
a) Cmo actan las clulas presentadoras de antgenos? Se trata de que
comentes lo que ocurre en 1, 2 y 3 (0,5 puntos). Cita un ejemplo de clula presentadora de antgenos. (0,25 puntos)
Las clulas presentadoras de antgenos (antigen presenting cell) son clulas capaces
de activar los linfocitos T al presentarlos unidos a las macromolculas de su membrana.
Estas clulas son capaces de captar molculas de antgeno solubles y hacerlos
entrar en su interior mediante endocitosis. A ellos se unen molculas hidrolticas de
los lisosomas encargados de convertir las protenas antignicas en pptidos ms
sencillos, parte de estos pptidos va a parar a la membrana plasmtica, donde se
asocian al MHC complejo principal de histocompatibilidad, de manera que quedan
expuestos al exterior de las clulas presentadoras.
La presentacin de estos pptidos antignicos hace que los linfocitos T colaboradores (Th2 helper cell) reconozcan a los pptidos gracias a sus receptores de
membranas, y se activen. Una vez activados los linfocitos T secretan interleucinas
que estimulan la proliferacin de linfocitos T y la conversin de linfocitos B (B cell)
en clulas plasmticas (plasma cell).
Unos ejemplos de clulas presentadoras son los macrfagos sanguneos, las
clulas de Langerhans de la piel y las clulas dendrticas de los rganos linfoides.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

119

PRUEBAS DE ACCESO A CFGS

b) Qu son las linfoquinas? (0,25 puntos)


Las linfoquininas son polipptidos sintetizados por los linfocitos T colaboradores
que pueden activar o inhibir diferentes aspectos de la respuesta inmune. La interleucina activa los linfocitos B e inicia la proliferacin de los linfocitos T, el interferon
gamma activa los macrfagos sanguneos aumentando su capacidad de fagocitosis.
Los linfocitos B al activarse en contacto con un antgeno, se convierten en clulas
plasmticas. Estas son de mayor tamao, con un retculo endoplasmtico ms desarrollado, ya que son muy activas en la produccin de anticuerpos libres especficos.
c) Qu diferencia hay entre una clula B y una clula plasmtica? (0,5 puntos)
Los linfocitos B se producen en la mdula sea de los mamferos o en la bolsa
de Fabricio en las aves. Son las responsables de la inmunidad humoral. Tienen
anticuerpos de superficie en la parte externa de la membrana plasmtica que reaccionan con antgenos especficos. Cuando se activan en contacto con el antgeno
se convierten en clulas plasmticas.
Las clulas plasmticas son ms grandes, con un retculo endoplasmtico muy
desarrollado y se encargan de producir anticuerpos libres especficos.

Pregunta
4. Haz corresponder los conceptos a sus definiciones:

Nucletido

Molcula que es la base de las membranas celulares. Presenta


una parte hidrfila y otra hidrfoba.

Meiosis

Cada uno de los monmeros que forma un cido nucleico. Est


formado por una pentosa, una base nitrogenada y una molcula
de cido fosfrico.

Fosfolpidos

Proceso de divisin celular en el que de una clula madre diploide se obtienen cuatro clulas hijas con un nmero de cromosomas haploide.

Esterilizacin

Conjunto de genes que posee un organismo.

Genotipo

Es la eliminacin total de los microorganismos de los medios de


cultivo, del material y de los utensilios de laboratorio.

(Cada respuesta correcta vale 0,5 puntos)


120

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Solucin

Fosfolpido

Molcula que es la base de las membranas celulares. Presenta


una parte hidrfila y otra hidrfoba.

Nucletido

Cada uno de los monmeros que forma un cido nucleico. Est


formado por una pentosa, una base nitrogenada y una molcula
de cido fosfrico.

Meiosis

Proceso de divisin celular en el que de una clula madre diploide se obtienen cuatro clulas hijas con un nmero de cromosomas haploide.

Genotipo

Conjunto de genes que posee un organismo.

Esterilizacin

Es la eliminacin total de los microorganismos de los medios de


cultivo, del material y de los utensilios de laboratorio.

Explicacin
Fosfolpidos, nucletidos, meiosis, genotipo, esterilizacin
Fosfolpido. Los fosfolpidos son lpidos polares compuestos por una molcula de glicerol, a la que se unen dos cidos grasos (1,2-diacilglicrido) y un grupo
fosfato. El fosfato se une a otros grupos que suelen contener nitrgeno, como la
colina, serina o etanolamina y en muchas ocasiones poseen carga elctrica. Las
membranas activas celulares poseen en su estructura una bicapa lipdica.
Los fosfolpidos, debido a su carcter anfiptico, al situarse en un medio polar
como el agua, se orientan disponiendo sus radicales polares hacia el medio acuoso, y sus radicales lipoflicos enfrentados entre s, por autoensamblaje.
Los fosfolpidos, al igual que los glucolpidos de la bicapa tienden a girar sobre
s mismos y a desplazarse lateralmente por su monocapa, pero solo ocasionalmente cambian de capa lipdica. Esta movilidad de la membrana le permite adaptarse
y le proporciona fluidez, de ah que se le llame al modelo estructural de membrana
plasmtica Modelo de mosaico fluido (propuesto por Singer y Nicholson en 1972).
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

121

PRUEBAS DE ACCESO A CFGS

Nucletido. Los nucletidos se forman mediante la unin de tipo ster fosfrico de una molcula de cido fosfrico y un nuclesido, que se forma con ribosa o
desoxiribosa y con una base nitrogenada prica o pirimidnica. Por tanto, tienen un
fuerte carcter cido debido a la ionizacin del grupo fosfato.
En la molcula de ADN hay presentes cuatro nucletidos: (llevan desoxirribosa)
dAMP. desoxiadenosin-5-monofosfato.
dTMP. desoxitimidn-5-monofosfato.
dGMP. desoxiguanosn-5-monofosfato.
dCMP.desoxicitidn-5-monofosfato.
En la molcula de ARN estn presentes: (llevan ribosa)
AMP. adenosin-5-monofosfato.
UMP. uridn-5-monofosfato.
GMP. guonosn-5-monofosfato.
CMP. citidn-5-monofosfato.
Meiosis. Es el proceso por el cual, a partir de una clula madre diploide (2n)
se originan clulas hijas con la mitad de la dotacin gentica(n).
La meiosis comprende dos divisiones sucesivas llamadas primera divisin meitica (meiosis I) y segunda divisin meitica (meiosis II). La primera es una divisin
reduccional y la segunda una divisin ecuacional. Entre ambas divisiones no se
produce la duplicacin del material gentico, por lo que el resultado global sera de
4 clulas hijas con la mitad de la dotacin gentica de la clula original.
La meiosis I. Comprende las siguientes fases:

Profase I. Las molculas de ADN se enrollan y condensan, formando los


cromosomas. A diferencia de la mitosis los cromosomas homlogos se
aproximan y forman pares bivalentes o ttradas, entre los que se produce
un intercambio de fragmentos de ADN. Este proceso puede durar incluso
hasta aos. La Profase I tiene 5 etapas:
1. Leptoteno. Los filamentos se condensan y forman los cromosomas, ya
duplicados pero no separados, por lo que muestran las cromtidas y se
pueden diferenciar 4 brazos.
2. Zigoteno. Cada cromosoma se asocia a su homlogo y ambos se juntan
estrechamente por sinapsis. El emparejamiento es gen a gen gracias al
complejo sinaptomrico.

122

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

3. Paquiteno. Una vez acabada la sinapsis empieza la separacin. Los cromosomas presentan cuatro cromtidas y las que estn ms juntas se
entrecruzan al menos en un punto. Los entrecruzamientos consisten en
la ruptura de las dobles hlices producindose recombinacin gentica.
4. Diploteno. Finaliza la sinapsis y los cromosomas homlogos empiezan a
separarse, se observan los puntos de unin llamados quiasmas.
5. Diacinesis. Se produce una condensacin de los cromosomas, por lo
que pueden observarse adems de los cromosomas homlogos, las cromtidas de cada uno de ellos y los quiasmas.
*

Metafase I. La envoltura nuclear y los nucleolos han desaparecido y


se observan los bivalentes en el plano ecuatorial.

Anafase I. Los cromosomas homlogos constituidos por dos cromtidas se separan y migran hacia polos opuestos. A diferencia de la mitosis, las dos cromtidas se dirigen hacia el mismo polo, no se separan.

Telofase I. En algunas especies los cromosomas se desenrollan un


poco, y se forma la envoltura nuclear brevemente.

La meiosis II. Est precedida de una breve interfase, intercinesis, en la cual no


hay duplicacin del ADN. La meiosis II es similar a una mitosis salvo que slo hay un
cromosoma homlogo de cada tipo en lugar de dos. Tiene las siguientes fases:

Profase II. Se rompe la envoltura nuclear y se duplican los diplosomas formando el huso mittico.

Metafase II. Los cromosomas se hacen visibles en la regin ecuatorial.

Anafase II. Las dos cromtidas de cada cromosoma se separan y los nuevos
cromosomas migran hacia polos opuestos.

Telofase II. Los cromosomas se despiralizan y se forma la envoltura nuclear.


Posteriormente se produce la citocinesis.

Genotipo. Toda la informacin gentica contenida en los genes se constituye el


genotipo aunque no se manifieste en el individuo. En los eucariotas el genotipo o
genoma se considera toda la informacin contenida en el ADN del ncleo y que forma los cromosomas. Aunque no se debe olvidar que tambin hay ADN mitocondrial.
Esterilizacin. Se llama as a la eliminacin de toda forma de vida de un medio
o material, lo que se lleva a cabo generalmente por medios fsicos, por ejemplo,
filtracin o por muerte de los organismos por calor, productos qumicos u otra va.
Esta definicin excluye por lo tanto cualquier tcnica que resulte solamente en un
dao a los microorganismos o atenuacin de la actividad de cualquier tipo.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

123

EXAMEN N. 2
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

En las preguntas donde se proponen varias soluciones, slo una es correcta.

Revisa cuidadosamente la prueba antes de entregarla.

1. La molcula representada se llama tambin adenosn monofosfato o AMP.


a) Puedes decir de qu tipo de biomolculas forma parte y por qu?
(0,5 puntos)
b) Reconoce cada uno de sus componentes (0,5 puntos), y los enlaces
mediante los que se unen. (0,5 puntos)
c) Representa una macromolcula de la que pueda formar parte el AMP.
(1 punto)

124

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

2. Completa el siguiente dibujo, rellenando toda la informacin que se ha


eliminado (1 punto). Define los procesos representados mediante flechas (1 punto), y el que tiene lugar en el citoplasma (0,5 puntos), mediante el que se obtiene la ltima molcula sealada.

3. De qu ciclo vrico se trata? (0,25 puntos), por qu? (0,25 puntos).


a) Qu tipos de virus describen este ciclo? (0,25 puntos)
Cita algn ejemplo. (0,25 puntos)
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

125

PRUEBAS DE ACCESO A CFGS

b) Indica a qu fase del ciclo corresponde cada nmero (0,75 puntos), y comenta los hechos ms relevantes que ocurren en dicha fase. (0,75 puntos)

4. Haz corresponder los conceptos a sus definiciones:

CONCEPTO

DEFINICIN

Micosis

Son clulas del sistema inmunitario que se localizan en los tejidos, procedentes de la emigracin desde la sangre a partir de un
tipo de leucocito llamado monocito .

Priones

Son protenas que disminuyen la energa de activacin necesaria para que se produzca una reaccin qumica en un ser vivo
.

Anabolismo

Infeccin producida por hongos ..

Enzima

Partcula subviral, constituida exclusivamente por protenas. Se


asocian a enfermedades degenerativas del sistema nervioso central de desarrollo lento .

Macrfago

Es el conjunto de reacciones qumicas de sntesis que tienen lugar


en la clula

(Cada respuesta correcta vale 0,5 puntos)


126

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. La molcula representada se llama tambin adenosn monofosfato o AMP.
a) Puedes decir de qu tipo de biomolculas forma parte y por qu?
(0,5 puntos)
b) Reconoce cada uno de sus componentes (0,5 puntos), y los enlaces
mediante los que se unen. (0,5 puntos)
c) Representa una macromolcula de la que pueda formar parte el AMP.
(1 punto)

Solucin
a) Puedes decir de qu tipo de biomolculas forma parte y por qu?
(0,5 puntos)
El adenosn-5-monofosfato (AMP) es un nucletido que se encuentra presente
en los cidos nuclicos, y concretamente en el ARN. Adems en la molcula de
ARN estn presentes:

UMP. uridn-5-monofosfato.

GMP. guonosn-5-monofosfato.

CMP. citidn-5-monofosfato.

Estos elementos forman conjuntamente el esqueleto de la molcula de ARN.


b) Reconoce cada uno de sus componentes (0,5 puntos), y los enlaces mediante los que se unen. (0,5 puntos)
Est compuesto por una molcula de cido fosfrico y un nuclesido de adenina.
El nuclesido de adenida se forma mediante la unin de una molcula de
ribosa con la adenina que es una base nitrogenada prica, mediante un enlace Nglucosdico entre el carbono 1 de la pentosa y el nitrgeno 1 de la adenina.
El nuclesido se une al cido fosfrico a travs del grupo hidroxilo del quinto
carbono 5 de la pentosa, mediante un enlace ster fosfrico, adquiriendo un fuerte carcter cido debido a la ionizacin del grupo fosfato.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

127

PRUEBAS DE ACCESO A CFGS

c) Representa una macromolcula de la que pueda formar parte el AMP.


(1 punto)
Representa una macromolcula de la que pueda formar parte el AMP. La
molcula representada es el ATP adenosn trifosfato, est formada por el monofosfato de adenosina al que se le unen dos grupos fosfricos unidos por enlaces
ricos en energa.

Figura 2. Macromolcula

Explicacin
El ATP
Para formar la cadena de ARN, los nucletidos se unen entre s a travs del
radical fosfato situado en el carbono 5 del nucletido, y del radical hidroxilo (-OH)
del carbono 3 del otro nucletido. Se trata de un enlace fosfodister.
Se dice que el ATP es la moneda energtica de la clula, pues almacena
energa fcil y rpida de usar. Esta molcula es de gran importancia en los organismos al ser capaz de almacenar y ceder energa gracias a sus dos enlaces ster
fosfricos que contienen cada uno de ellos 7,3 Kcal/mol.
Cuando el ATP se hidroliza se rompe el enlace ster fosfrico del extremo en un
proceso llamado desfosforilacin, producindose ADP y liberndose fsforo inorgnico (Pi). El ADP puede volver a desfosforilarse y se convierte en AMP, liberando de
nuevo energa y dejando libre otro Pi.

128

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

El proceso de formacin del ATP a partir de AMP o ADP ms Pi requiere menor


energa y puede obtenerse de dos maneras:

Por fosforilacin a nivel de sustrato. Usando la energa liberada por las biomolculas durante el proceso de la gluclisis o el ciclo de Krebs (gracias a
las enzimas quinasas).

Por fosforilacin oxidativa. Mediante enzimas ATP-sintetasas, que se encuentran en las crestas mitocondriales o en los tilacoides de los cloroplastos y que funcionan gracias al flujo electrnico de protones (H+). Mitchell
explic el proceso mediante la hiptesis quimiosmtica, que establece que
la energa liberada por la cadena respiratoria en las mitocondrias provoca
un bombeo de protones desde la matriz mitocondrial al espacio intermembrana. Esto induce al establecimiento de un gradiente electroqumico, es
decir, origina una diferencia de carga elctrica a ambos lados de la membrana interna. Cuando los protones en exceso vuelven a la matriz lo hacen
atravesando los complejos enzimticos ATP sintetasa o partculas F, suministrndole la energa necesaria para la sntesis de ATP.

Figura 3. Proceso de formacin de ATP

Pregunta
2. Completa el siguiente dibujo, rellenando toda la informacin que se ha
eliminado. (1 punto)
Define los procesos representados mediante flechas (1 punto), y el que
tiene lugar en el citoplasma (0,5 puntos), mediante el que se obtiene la
ltima molcula sealada.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

129

PRUEBAS DE ACCESO A CFGS

Solucin

Figura 4. Procesos en el citoplasma

Explicacin
La transcripcin es el proceso por el que una molcula de ADN destinada a la
sntesis de una protena se copia pasando a ser una molcula de ARNm (mensajero), tambin puede tratarse de fragmentos de ARNr (ribosmico) o ARNt (transferente). En el proceso intervienen el ADN, los nucletidos AMP, UMP, CMP y CMP, las

130

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

ARN polimerasas (ARNp) y los cofactores sigma (V) y rho (U). Este proceso ocurre
dentro del ncleo celular (en eucariotas), y consta de varias fases: iniciacin, elongacin o alargamiento, finalizacin y maduracin.
El proceso se produce de maneras diferentes segn se trate de clulas eucariotas o procariotas. La salida del ARNm hacia el citoplasma se realiza a travs de
los poros nucleares.
La traduccin consiste en la sntesis de las protenas en los ribosomas que pueden encontrarse libres o asociados a membranas en el citoplasma celular. Consta
de varias fases:
1. Iniciacin de la sntesis.
2. Elongacin o alargamiento de las cadenas polipeptdicas.
3. Finalizacin de la sntesis.
La traduccin viene precedida por la activacin de los aminocidos y puede
continuar con la asociacin de varias cadenas polipeptdicas, o de grupos prostticos para formar protenas. En el proceso de traduccin intervienen el ARNm, el
ARNt y el ARNr.

Pregunta
3. De qu ciclo vrico se trata? (0,25 puntos), por qu? (0,25 puntos)
a) Qu tipos de virus describen este ciclo? (0,25 puntos). Cita algn
ejemplo. (0,25 puntos)
b) Indica a qu fase del ciclo corresponde cada nmero (0,75 puntos), y comenta los hechos ms relevantes que ocurren en dicha fase. (0,75 puntos)

Solucin
a) Qu tipos de virus describen este ciclo? (0,25 puntos). Cita algn ejemplo. (0,25 puntos)
Se trata de un ciclo ltico. Se observa claramente porque los virus destruyen la
clula husped (lisis) en lugar de incorporar su genoma al de la clula husped y
permanecer en estado latente (lisogenia).

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

131

PRUEBAS DE ACCESO A CFGS

b) Indica a qu fase del ciclo corresponde cada nmero (0,75 puntos), y comenta los hechos ms relevantes que ocurren en dicha fase. (0,75 puntos)
Es tpico de los bacterifagos (fagos), como el fago T4 o el fago T7 o de algunos
otros virus como el del papiloma humano o herpes. Los hechos ms relevantes son:
1. Fase de fijacin o absorcin. La cpside viral proteica se une con los receptores especficos de la superficie de la clula husped. Se trata de una
unin muy especfica.
2. Fase de penetracin. El virus penetra en la clula, en este caso se trata
de endocitosis, pero en otros tipos de virus la penetracin puede producirse
por fusin de la membrana plasmtica con la envoltura del virus o por inyeccin directa del genoma en la clula husped.
3. Fase de desnudamiento. El cido nucleico del virus se desprende de la
cpsula y es liberado dentro de la clula husped, la cpside es degradada
por enzimas del husped y en ocasiones por enzimas del propio virus.
4. Fase de transcripcin inversa. Se produce en los ARN virus. Estos virus
contienen ARN monocatenario en lugar de ADN, por lo que deben sacar una
copia en ADN. El proceso lo realiza un enzima llamado transcriptasa inversa.
5. Fase de eclipse. Se produce la biosntesis de los elementos necesarios para
la formacin de nuevos virus: ARNm, protenas y cidos nucleicos. Esto incluye
la expresin gnica (transcripcin y traduccin) y la replicacin del genoma. La
transcripcin es la sntesis de ARN mensajero (ARNm) a partir del genoma del
virus. La traduccin es la sntesis, en los ribosomas del husped, de las protenas virales, tanto las que componen la cpsida como las protenas enzimticas.
6. Fase de ensamblaje. En esta etapa los capsmeros se renen formando
la cpside viral y el genoma se repliega y penetra en la cpside.
7. Fase de lisis o liberacin. Los virus salen de la clula husped por lisis o por
gemacin. Los virus sin envoltura se acumulan por algn tiempo en la clula
hasta que esta se rompe (lisis). Los virus con envoltura como es el caso del dibujo suelen ser liberados por gemacin, proceso durante el cual el virus adquiere su envoltura de fosfolpidos en la que se insertan las glicoprotenas virales.

Explicacin
El ciclo vital de los virus
El ciclo vital de los virus puede ser de dos tipos: ltico, que se ha descrito anteriormente y el lisognico.
Los virus lisognicos no destruyen la clula husped, sino que incorporan su ADN
al del hospedador permaneciendo en estado latente. A estos virus se les denomina
virus atenuados o profagos y a la clula receptora se le denomina clula lisognica.
132

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

El ADN del virus puede permanecer as durante varias generaciones en la clula


husped, hasta que un estmulo desencadene su comportamiento ltico. Lo curioso
es que, mientras el organismo est infectado por un virus lisognico, ser inmune
al ataque de este mismo virus. Esta inmunidad se hereda de generacin en generacin ya que el ADN vrico se hereda junto con el ADN de la clula lisognica. Sin
embargo, pueden resultar muy peligrosos, ya que al desencadenarse el estmulo
que induce el ciclo ltico, el nmero de clulas infectadas ser muy alto.
En el caso que se expone, se trata de un retrovirus. Los virus pueden tener ADN
monocatenario o ARN monocatenario como material gentico, que pueden ser
cadenas circulares o abiertas.
La cpsida es la cubierta proteica que envuelve al virus. Protege al cido nucleico
y en los casos de virus sin cubierta membranosa contiene las molculas necesarias
para el reconocimiento celular de la clula que parasita. Al complejo de genoma y
cpsida se le denomina nucleocpsida. Algunos virus presentan envoltura membranosa, como por ejemplo el del SIDA, la viruela, la gripe, la hepatitis y la rabia. Esta
envoltura de doble capa lipdica procede de las clulas parasitadas por lo que tiene
glucoprotenas, lo que les facilita el reconocimiento y fagocitosis de la clula husped.

Pregunta
4. Haz corresponder los conceptos a sus definiciones:

Micosis

Son clulas del sistema inmunitario que se localizan en los tejidos, procedentes de la emigracin desde la sangre a partir de un
tipo de leucocito llamado monocito.

Priones

Son protenas que disminuyen la energa de activacin necesaria


para que se produzca una reaccin qumica en un ser vivo.

Anabolismo

Infeccin producida por hongos.

Enzima

Partcula subviral, constituida exclusivamente por protenas. Se


asocian a enfermedades degenerativas del sistema nervioso
central de desarrollo lento.

Macrfago

Es el conjunto de reacciones qumicas de sntesis que tienen


lugar en la clula.

(Cada respuesta correcta vale 0,5 puntos)


EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

133

PRUEBAS DE ACCESO A CFGS

Solucin

Macrfago

Son clulas del sistema inmunitario que se localizan en los tejidos,


procedentes de la emigracin desde la sangre a partir de un tipo
de leucocito llamado monocito.

Enzima

Son protenas que disminuyen la energa de activacin necesaria


para que se produzca una reaccin qumica en un ser vivo.

Micosis

Infeccin producida por hongos.

Priones

Partcula subviral, constituida exclusivamente por protenas. Se


asocian a enfermedades degenerativas del sistema nervioso central de desarrollo lento.

Anabolismo

Es el conjunto de reacciones qumicas de sntesis que tienen lugar


en la clula.

Explicacin
Macrfagos, enzimas, micosis, priones, anabolismo
Los macrfagos proceden de los monocitos fabricados en la mdula sea roja.
All permanecen unas 24 horas hasta que pasan a la circulacin sangunea y se distribuyen por todo el cuerpo. Una vez que llegan a los tejidos los monocitos aumentan de tamao, aumenta su complejidad y actividad, adquieren capacidad fagoctica, producen grandes cantidades de enzimas lticas y se convierten en macrfagos.
Los macrfagos son activados por una gran variedad de estmulos durante la
respuesta inmune. La fagocitosis puede servir de estmulo inicial pero la citocinas
secretadas por los linfocitos T colaboradores y el interfern gamma son sus mayores activadores.
Las principales funciones de los macrfagos son la fagocitosis, la presentacin
de antgenos, la inflamacin y la hemostasia.
Las enzimas son molculas de protenas que tienen la capacidad de facilitar
y acelerar las reacciones qumicas que tienen lugar en los tejidos vivos, disminuyendo el nivel de la energa de activacin propia de la reaccin. Generalmente,
134

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

las enzimas se nombran aadiendo la terminacin asa a la raz del nombre de la


sustancia sobre la que actan.
Las enzimas no reaccionan qumicamente con los sustratos, ni alteran el equilibrio de la reaccin. Solamente aumentan la velocidad con que estas se producen,
actuando como catalizadores. La velocidad de las reacciones enzimticas depende
de la concentracin de la enzima, de la concentracin del sustrato y de la temperatura y el PH del medio.
Hay enzimas que necesitan la participacin de otros compuestos qumicos no
proteicos, denominados cofactores, para poder actuar realmente como enzimas. Estos compuestos pueden ser: un grupo prosttico o una coenzima. A la parte proteica
sin el cofactor se le llama apoenzima, y al complejo enzima-cofactor holoenzima.
Las enzimas actan generalmente sobre un sustrato especfico o sobre un conjunto de compuestos con un grupo funcional especfico. La parte de la enzima que
encaja con el sustrato para activarlo es denominada centro activo, y es el responsable de la especificidad de la enzima. En algunos casos, compuestos diferentes
actan sobre el mismo sustrato provocando una misma reaccin, por lo que se les
llama isoenzimas.
La micosis es la infeccin producida en animales o vegetales por organismos
del Reino Fungi. En el ser humano pueden localizarse en cualquier parte del cuerpo
y pueden ser superficiales, subcutneas o profundas, y suelen manifestarse como
caspa, dermatitis, manchas ms o menos pigmentadas, enrojecimientos, inflamaciones, picores, olores desagradables, secreciones, etc.
La fuente de contaminacin puede provenir de otro ser humano o de animales.
Los hongos forman esporas y pueden permanecer meses en un ambiente poco
propicio hasta que encuentran un lugar en donde desarrollarse.
Para su reproduccin los hongos requieren lugares hmedos y clidos y uno de
sus principales nutrientes es la queratina que se encuentra en la capa crnea de la
piel, en el pelo, uas, plantas de los pies y manos. Las micosis ms conocidas son
la llamada pie de atleta, la tia o la candidiasis.
Los priones son protenas con la misma o casi la misma secuencia de aminocidos de una protena normal, pero con una forma espacial diferente y capaces de
inducir a una protena normal a adquirir su forma espacial.
Generalmente son protenas de membrana de las neuronas, por lo que suelen
provocar enfermedades neurodegenerativas. Su tamao es unas 100 veces menor
que un virus y no se reproducen, sino que, como se ha mencionado antes, inducen
a protenas normales a adoptar su configuracin espacial.
Los priones producen enfermedades muy conocidas como la enfermedad de
Creutzfeldt-Jakob, el mal de las vacas locas o la tembladera de las ovejas.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

135

PRUEBAS DE ACCESO A CFGS

El anabolismo es la va constructiva del metabolismo, es decir, la ruta de sntesis de molculas complejas a partir de otras ms sencillas. Puede ser de dos tipos
diferentes: auttrofo y hetertrofo.
El anabolismo auttrofo es tpico de los seres auttrofos que no necesitan
materia orgnica para subsistir y fabrican su propia materia orgnica a partir de
inorgnica. En funcin de la energa utilizada puede ser anabolismo fotosinttico, si
utilizan la luz solar como fuente de energa, como es el caso de las plantas, algas,
cianobacterias, y bacterias fotosintticas, o anabolismo quimiosinttico, si utilizan
la energa procedente de las reacciones de oxidacin de compuestos inorgnicos.
Este anabolismo es tpico de bacterias quimiosintticas.
El anabolismo hetertrofo es comn a los organismos auttrofos y hetertrofos,
y se realiza de forma muy similar en todos ellos. La finalidad es la sntesis de macromolculas con funcin de reserva o estructural.

136

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

EXAMEN N. 3
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

En las preguntas donde se proponen varias soluciones, slo una es correcta.

Revisa cuidadosamente la prueba antes de entregarla.

1. Describe la estructura de una de las dos molculas representadas en el


dibujo. (0,75 puntos)
a) Menciona el tipo de enlace que une las dos molculas representadas
y comenta las caractersticas de dicho enlace. (0,75 puntos)
b) Describe a qu se debe la capacidad de esta molcula como disolvente
de compuestos inicos, como el cloruro sdico o sal comn. (1 punto)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

137

PRUEBAS DE ACCESO A CFGS

2. La grfica representa la variacin del contenido de ADN durante el ciclo


celular. Responde a las preguntas que se formulan a continuacin:
a) La grfica corresponde a un ciclo meitico o mittico? por qu?
(0,75 puntos)
b) Cmo se denomina a la fase que transcurre entre 4 y 5? (0,5 puntos)
c) Si la cantidad de ADN no se ha modificado al final del ciclo, qu
utilidad tiene este proceso? (0,5 puntos)
d) Cules son las diferencias fundamentales entre mitosis y meiosis?
(0,75 puntos)

3. Reconoce de qu tipo de ciclo vrico se trata; en qu te basas? (0,5 puntos)


a) Indica cmo se llama cada una de las etapas representadas. (0,5
puntos)
b) Nombra los componentes que aparecen en cada una de ellas. (0,75
puntos)
c) Comenta los sucesos ms relevantes que se producen en cada etapa. (0,75 puntos)

138

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

4. La lactancia materna proporciona al beb inmunidad natural pasiva.


a) Distingue en qu consiste, en este caso, este tipo de inmunidad.
(0,75 puntos)
b) Pon otro ejemplo diferente de inmunidad natural pasiva. (0,75 puntos)
c) Distingue en qu consiste la inmunidad artificial pasiva y cundo
debe utilizarse. (1 punto)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

139

SOLUCIONES

Pregunta
1. Describe la estructura de una de las dos molculas representadas en el
dibujo. (0,75 puntos)
a) Menciona el tipo de enlace que une las dos molculas representadas
y comenta las caractersticas de dicho enlace. (0,75 puntos)
b) Describe a qu se debe la capacidad de esta molcula como disolvente de compuestos inicos, como el cloruro sdico o sal comn. (1
punto)

Solucin
La estructura representada es la unin mediante puentes de hidrgeno de dos
molculas de agua. La molcula de agua est formada por dos tomos de hidrgeno (H) unidos a un tomo de oxgeno (O) mediante dos enlaces covalentes. El
ngulo que forman los dos enlaces es de 104,5o. El O es ms electronegativo que
el H, por lo que atrae con mayor fuerza a los electrones de cada enlace.
Como resultado la molcula de agua presenta una distribucin asimtrica aunque su carga total es neutra. Eso lo convierte en una molcula polar, de forma
que, alrededor del O se concentra una densidad de carga negativa, mientras que
los ncleos de H presentan una densidad de carga positiva al quedar parcialmente
desprovistos de electrones.
a) Menciona el tipo de enlace que une las dos molculas representadas y
comenta las caractersticas de dicho enlace. (0,75 puntos)
Las molculas de agua se unen mediante puentes de hidrgeno. Se produce debido a las interacciones dipolo-dipolo. La carga parcial negativa del
oxgeno de una de las molculas ejerce una atraccin electrosttica sobre
las cargas parciales positivas de los tomos de hidrgeno de las molculas
prximas, formndose grupos de 3, 4 y hasta unas 9 molculas. Con ello el
agua alcanza pesos moleculares elevados y se comporta como un lquido. Las
agrupaciones duran fracciones de segundo (de 10-10 a 10-21 s). Pero esto confiere al agua todas las propiedades de un fluido. Los polmeros coexisten con
molculas sueltas que rellenan los huecos.
140

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

b) Describe a qu se debe la capacidad de esta molcula como disolvente


de compuestos inicos, como el cloruro sdico o sal comn, (1 punto)
El agua es considerada un disolvente universal. Esto se debe a una de las caractersticas fundamentales del agua, que se llama elevada constante dielctrica.
El proceso de disolucin se debe a que las molculas de agua, al ser polares,
se disponen alrededor de los grupos polares de soluto, llegando a desdoblarlos en
aniones y cationes, como en el caso de los compuestos inicos. De esta manera
quedan rodeados por molculas de agua. Este fenmeno se llama solvatacin inica. Tambin es disolvente de los compuestos covalentes polares como los glcidos.
El agua es, por su poder de disolucin, el medio en el que se realizan las reacciones metablicas de los seres vivos. Tambin interviene en muchas reacciones
qumicas como la hidrlisis durante la digestin de los alimentos o como fuente de
hidrgeno en la fotosntesis. Adems, es el medio de transporte de las sustancias
desde el exterior al interior de los organismos, de la captacin de sales minerales
por las plantas y la ascensin de savia bruta.

Explicacin
Caractersticas del agua
El agua es un lquido muy especial con un comportamiento anmalo. Ello se
debe a su estructura y a los enlaces que forma. Adems del poder de disolucin,
tiene otras caractersticas muy importantes:
Elevada fuerza de cohesin entre sus molculas. Esto se debe a los puentes de
hidrgeno. Por ello, el agua es un lquido prcticamente incompresible, lo que es
muy til para dar volumen a las clulas, provocar la turgencia de las plantas y constituir el esqueleto hidrosttico de algunos seres vivos como los celentreos y anlidos.
Esto tambin explica la elevada tensin superficial, por lo que su superficie opone una gran resistencia a romperse. Esto permite la vida de muchos organismos
en la superficie del agua y la ascensin de savia por capilaridad, este fenmeno
depende tanto de la cohesin de las molculas de agua entre s como de la adhesin a las paredes de los conductos.
Elevado calor especfico. Es decir, hace falta mucho calor para elevar su temperatura. Esto lo convierte en un estabilizador trmico muy importante para el
organismo frente a los cambios bruscos ambientales. Y es un regulador climtico
de gran importancia.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

141

PRUEBAS DE ACCESO A CFGS

Elevado calor de vaporizacin. Hace falta elevar mucho su temperatura para romper los puentes de hidrgeno. Esto hace que los organismos al sudar y expulsar agua
tomen calor del cuerpo y como resultado se produzca su enfriamiento del organismo.
Mayor densidad en estado lquido que en estado slido. Debido a esta propiedad el hielo flota sobre el agua, por lo que se forma una capa termoaislante que
permite que la vida contine debajo de la capa helada.
Bajo grado de ionizacin. La proporcin de molculas ionizadas es de
1/551.000.000. Esto explica que la concentracin de (H3O+) y de (OH-) sea muy
baja y que si al agua se le aade un cido o una base los niveles varen bruscamente.

Pregunta
2. La grfica representa la variacin del contenido de ADN durante el ciclo
celular. Responde a las preguntas que se formulan a continuacin:
a) La grfica corresponde a un ciclo meitico o mittico? Por qu?
(0,75 puntos)
b) Cmo se denomina a la fase que transcurre entre 4 y 5? (0,5 puntos)
c) Si la cantidad de ADN no se ha modificado al final del ciclo, qu
utilidad tiene este proceso? (0,5 puntos)
d) Cules son las diferencias fundamentales entre mitosis y meiosis?
(0,75 puntos)

Solucin
a) La grfica corresponde a un ciclo meitico o mittico? Por qu? (0,75
puntos)
Se trata de un ciclo mittico ya que al principio y al final del ciclo la cantidad de
material gentico es la misma. Si se tratase de una meiosis, la cantidad final de material gentico sera la mitad de la inicial, ya que la meiosis es una divisin reduccional.
b) Cmo se denomina a la fase que transcurre entre 4 y 5? (0,5 puntos)
La fase que transcurre entre 4 y 5 es la citocinesis. La citocinesis o citodiresis
es la divisin del citoplasma celular. En los animales se produce por estrangulamiento del citoplasma y en los vegetales por tabicacin intracelular.
En animales se produce invaginacin de la membrana plasmtica a nivel del
plano ecuatorial del huso, donde aparece el surco de divisin que rodea todo el
142

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

citoplasma. Internamente se forma un anillo contrctil constituido de molculas de


actinas que se unen a la cara interna de la membrana plasmtica y con los extremos libres unidos a molculas de miosina.
Cuando la membrana del surco de divisin se une con el haz de microtbulos interzonales de la sustancia densa, el citoplasma se divide y se forman dos clulas hijas.
c) Si la cantidad de ADN no se ha modificado al final del ciclo, qu utilidad
tiene este proceso? (0,5 puntos)
La mitosis tiene como fin generar dos clulas con igual nmero de cromosomas
que la clula madre. En los organismos diploides que portan dos juegos cromosmicos, uno de la madre y otro del padre (2n), el resultado final sern dos clulas
con (2n) cada una de ellas. En los organismos haploides (n) el resultado ser 2
clulas con (n) cada una.
La importancia de la mitosis es simple: es vital. Sin mitosis no hay divisin
celular, sin divisin celular, no hay crecimiento del individuo. Si no hubiera mitosis,
adems de no haber crecimiento celular, las clulas que mueren no seran reemplazadas por lo que el individuo morira y se extinguira la especie.
d) Cules son las diferencias fundamentales entre mitosis y meiosis?
(0,75 puntos)
Las principales diferencias entre mitosis y meiosis son:
MITOSIS

MEIOSIS

Se produce una cariocinesis (divisin


nuclear) y una citocinesis (divisin del
citoplasma).

Se producen dos cariocinesis (divisiones nucleares) y una citocinesis (divisin del citoplasma).

La mitosis da lugar a dos clulas con la


misma dotacin gentica que la clula
madre.

La meiosis da lugar a cuatro clulas


con la mitad de dotacin gentica que
la clula madre.

Durante la profase no se produce sinapsis, ni entrecruzamiento, ni hay quiasmas.

Durante la profase I hay sinapsis, entrecruzamiento y quiasmas.

Durante la anafase se separan las cromtidas hermanas.

Durante la anafase I no se separan las


cromtidas hermanas sino que migran
juntas hacia uno de los polos.

Los cromosomas de las clulas hijas


son idnticos a los de la clula madre.

Los cromosomas de las clulas hijas


son producto de la recombinacin gentica entre las cromtidas de los cromosomas homlogos.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

143

PRUEBAS DE ACCESO A CFGS

Pregunta
3. Reconoce de qu tipo de ciclo vrico se trata; en qu te basas? (0,5 puntos)
a) Indica cmo se llama cada una de las etapas representadas. (0,5 puntos)
b) Nombra los componentes que aparecen en cada una de ellas. (0,75
puntos)
c) Comenta los sucesos ms relevantes que se producen en cada etapa. (0,75 puntos)

Solucin
a) Indica cmo se llama cada una de las etapas representadas. (0,5 puntos)
Se trata de un ciclo ltico. Se observa claramente porque los virus destruyen la
clula husped (lisis) en lugar de incorporar su genoma al de la clula husped y
permanecer en estado latente (lisogenia).
b) Nombra los componentes que aparecen en cada una de ellas. (0,75 puntos)
c) Comenta los sucesos ms relevantes que se producen en cada etapa.
(0,75 puntos)
Se van a dar las dos respuestas en una sola. Es decir, tanto los sucesos como
los componentes de cada una de ellas. Se trata de no repetirse ya que finalmente
se describe el ciclo ltico del virus, sus componentes y sus fases.
1. Fase de fijacin o absorcin. La cpside viral proteica se une con los receptores especficos de la superficie de la clula husped. Se trata de una
unin muy especfica.
2. Fase de penetracin. El virus penetra en la clula, en este caso se trata
de endocitosis, pero en otros tipos de virus la penetracin puede producirse
por fusin de la membrana plasmtica con la envoltura del virus o por inyeccin directa del genoma en la clula husped.
3. Fase de desnudamiento. El cido nucleico del virus se desprende de la
cpsula y es liberado dentro de la clula husped, la cpside es degradada
por enzimas del husped y en ocasiones por enzimas del propio virus.
4. Fase de transcripcin inversa. Se produce en los ARN virus, estos virus
contienen ARN monocatenario en lugar de ADN, por lo que deben sacar una
copia en ADN, el proceso lo realiza una enzima llamada transcriptasa inversa.
144

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

5. Fase de eclipse. Se produce la biosntesis de los elementos necesarios para


la formacin de nuevos virus: ARNm, protenas y cidos nucleicos. Esto incluye
la expresin gnica (transcripcin y traduccin) y la replicacin del genoma. La
transcripcin es la sntesis de ARN mensajero (ARNm) a partir del genoma del
virus. La traduccin es la sntesis, en los ribosomas del husped, de las protenas virales, tanto las que componen la cpsida como las protenas enzimticas.
6. Fase de ensamblaje. En esta etapa los capsmeros se renen formando
la cpside viral y el genoma se repliega y penetra en la cpside.
7. Fase de lisis o liberacin. Los virus salen de la clula husped por lisis o por
gemacin. Los virus sin envoltura se acumulan por algn tiempo en la clula
hasta que esta se rompe (lisis). Los virus con envoltura, como es el caso del dibujo, suelen ser liberados por gemacin, proceso durante el cual el virus adquiere su envoltura de fosfolpidos en la que se insertan las glicoprotenas virales.

Pregunta
4. La lactancia materna proporciona al beb inmunidad natural pasiva.
a) Distingue en qu consiste, en este caso, este tipo de inmunidad.
(0,75 puntos)
b) Pon otro ejemplo diferente de inmunidad natural pasiva. (0,75 puntos)
c) Distingue en qu consiste la inmunidad artificial pasiva y cundo
debe utilizarse. (1 punto)

Solucin
a) Distingue en qu consiste, en este caso, este tipo de inmunidad. (0,75
puntos)
Se trata de inmunidad natural pasiva materna proporcionada a travs de la transferencia de anticuerpos de Inmunoglobulina A que se encuentran en la leche materna y que son transferidos al aparato digestivo del beb, protegindolo contra las
infecciones bacterianas hasta que el recin nacido puede sintetizar sus anticuerpos.
b) Pon otro ejemplo diferente de inmunidad natural pasiva. (0,75 puntos)
La inmunidad pasiva materna puede adquirirse tambin de forma natural por
medio de los anticuerpos que pasan a travs de la placenta de la madre al feto por
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

145

PRUEBAS DE ACCESO A CFGS

un receptor Fc neonatal de las clulas de la placenta. Esto ocurre alrededor del


tercer mes de gestacin. La inmunoglobulina G es el nico anticuerpo isotipo que
puede pasar a travs de la placenta.
c) Distingue en qu consiste la inmunidad artificial pasiva y cundo debe
utilizarse. (1 punto)
La sueroterapia es un tipo de inmunidad artificial pasiva con sueros que llevan
anticuerpos (IgG) preformados. Este tratamiento solo debe efectuarse en casos de
extrema necesidad, puesto que el paciente que recibe el suero ajeno puede presentar respuestas inmunolgicas.
Por ejemplo, si el suero procede de animales como el caballo, el receptor puede forma IgE especficas contra esos anticuerpos, que pueden activar la liberacin
de mediadores qumicos como las histaminas y provocar una reaccin anafilctica.
El suministro de IgG humanas tiene menor riesgo. La sueroterapia se utiliza en
enfermedades como la difteria, el botulinismo, las picaduras de serpientes, la hepatitis A y B, el ttanos, la rabia o el sarampin.

Explicacin
La inmunidad natural y artificial
La inmunidad es el estado de invulnerabilidad a una determinada enfermedad
infecciosa. Presenta dos caractersticas fundamentales:

Es especfica, ya que la reaccin Ag-Ac supone una reaccin especfica entre ambos.

Produce memoria en el organismo animal, mantenindose desde unos das


hasta toda la vida.

La resistencia es diferente a la inmunidad, ya que no es especfica. La inmunologa es la ciencia que estudia todo lo referente a la inmunidad y al sistema inmunitario.
Inmunidad natural
Los animales pueden adquirir inmunidad natural de dos maneras, dependiendo
de la procedencia de los anticuerpos.
Activa. Se debe a los propios mecanismos inmunolgicos que se van produciendo ante la invasin de un agente antignico. El organismo produce anticuerpo
que permanece en la sangre durante la infeccin inmunizando al organismo durante este periodo.
146

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Pasiva. En este caso, los anticuerpos no proceden del propio organismo sino
del exterior. Por ejemplo, el feto de los mamferos adquiere inmunidad natural
mientras se encuentra en el tero materno, ya que a travs de la placenta llegan
anticuerpos del cuerpo de la madre.
Inmunidad artificial o adquirida
La inmunidad se puede adquirir artificialmente mediante la vacunacin o la
sueroterapia.
La vacunacin es un mtodo preventivo de inmunidad activa. Consiste en inyectar
a un organismo microorganismos muertos o atenuados de la enfermedad contra la que
se le quiere prevenir, de manera que el organismo produzca anticuerpos especficos.
La sueroterapia es un mtodo de inmunidad pasiva. Consiste en suministrar al organismo que est infectado anticuerpos especficos producidos externamente. Estos anticuerpos suelen producirse por tcnicas de clonacin a partir de linfocitos (anticuerpos
monoclonales) o a partir de suero de caballo, previamente vacunado con el antgeno.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

147

EXAMEN N. 4
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

En las preguntas donde se proponen varias soluciones, slo una es correcta.

Revisa cuidadosamente la prueba antes de entregarla.

1. A la vista del siguiente dibujo, deduce si se trata de una clula procariota o eucariota. (0,5 puntos)
a) Comenta las razones por las que has llegado a una conclusin. (0,5
puntos)
b) Indica el nombre de las estructuras sealadas (0,75 puntos), y la
funcin que realizan dichas estructuras. (0,75 puntos)

148

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

2. Los hijos varones de una pareja cuya madre es daltnica y padre no daltnico sern:
a) Todos daltnicos.
b) El 50% daltnicos y el otro 50% no daltnicos.
c) El 50% daltnicos y el otro 50% portadores.

Indica la respuesta correcta. (0,5 puntos)

Justifica la respuesta realizando el cruzamiento. (2 puntos)

3. Reconoce y explica el proceso representado. (1 punto)


a) Qu es un alrgeno? Cita algn ejemplo. (0,5 puntos)
b) Qu efectos producen la histamina y las prostaglandinas? (0,5 puntos)
c) Qu son mastocitos? Dnde se encuentran? (0,5 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

149

PRUEBAS DE ACCESO A CFGS

4. Haz corresponder los conceptos a sus definiciones:

CONCEPTO

DEFINICIN

Catabolismo

Proceso de transferencia de un plsmido de una bacteria a


otra mediante un pelo sexual o pili ..

Replicacin del
ADN

Enfermedad autoinmune que afecta al sistema nervioso central y ocasiona la prdida de mielina en las fibras nerviosas
.

Conjugacin

Trmino que indica colonizacin de un organismo husped


por microorganismos patgenos .

Esclerosis mltiple

Proceso de obtencin de dos nuevas hebras de cido nucleico a partir de dos hebras que actan como molde
..

Infeccin

Conjunto de reacciones degradativas que ocurren en la clula


y en las que se obtiene ATP

(Cada respuesta correcta vale 0,5 puntos)

150

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. A la vista del siguiente dibujo, deduce si se trata de una clula procariota o eucariota (0,5 puntos).
a) Comenta las razones por las que has llegado a una conclusin. (0,5
puntos)
b) Indica el nombre de las estructuras sealadas (0,75 puntos), y la
funcin que realizan dichas estructuras. (0,75 puntos)

Solucin

Figura 5. Clula procariota

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

151

PRUEBAS DE ACCESO A CFGS

a) Comenta las razones por las que has llegado a una conclusin. (0,5 puntos)
Se trata de una clula procariota, la diferencia ms significativa es la ausencia
de envoltura nuclear.
b) Indica el nombre de las estructuras sealadas (0,75 puntos), y la funcin
que realizan dichas estructuras. (0,75 puntos)
Cpsula bacteriana. Es una capa rgida formada por polisacridos que envuelven a la pared bacteriana y est adherida a ella. Cuando esta capa absorbe agua
aumenta su espesor y se vuelve gelatinosa, motivo por el cual se le denomina capa
mucosa. Esta cpsula solo est presente en algunas bacterias, especialmente en
las patgenas.
Pared bacteriana. Es una cubierta rgida que da forma a las clulas bacterianas. Presenta una capa de murena y es permeable a las sales y molculas orgnicas de baja masa molecular. Existen dos tipos de pared en funcin de su reaccin
al ser tratadas con la tincin de Gram. Son las Gram-positivas (Gram +), que se
tien de color azul y las Gram-negativas (Gram ) que se tien de rojo.
Membrana plasmtica. Es una envoltura de tipo unitario de 75 A de grosor
que rodea al citoplasma. Su estructura y composicin es idntica a la de las clulas eucariotas, pero no tiene colesterol. Delimita y regula el paso de sustancias
nutritivas y contiene numerosos sistemas enzimticos que intervienen en muchas
funciones como la respiracin bacteriana, dirigir la replicacin del ADN, realizar la
fotosntesis, en las bacterias fotosintticas y asimilacin de nitrgeno.
Ribosomas. Se encuentran en gran nmero en el citoplasma bacteriano
ya sea libres, o asociadas, formando largas cadenas llamadas polirribosomas.
Son algo ms pequeos que los de las clulas eucariotas y realizan la sntesis
de protenas.
Cromosoma bacteriano. Se trata de una doble cadena circular de ADN situada en la regin nucleolar o nucleoide del citoplasma. Tiene protenas y ARN
asociado y est altamente enrollado sobre s mismo y anclado a las protenas
de la membrana plasmtica. Las bacterias tambin pueden contener pequeas
molculas de ADN circular bicatenario denominadas plsmidos o plasmidios, con
capacidad de replicarse independientemente.
Flagelos. Son prolongaciones cuya longitud puede superar en varias veces
la longitud de la clula. Su nmero es variable, pudiendo llegar a ser hasta 100.
Segn el nmero de flagelos las bacterias pueden ser, monotrficas, con un solo
flagelo, lofotrficas con varios flagelos en un solo polo de la clula, peritricas si rodean a la bacteria o atrias si no tienen flagelos. Los flagelos tienen un movimiento
giratorio que confiere movilidad a la bacteria.

152

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Pelos. Solo estn presentes en las bacterias Gram. Son estructuras alargadas
y huecas mediante las cuales se adhieren a diferentes superficies, su composicin
es proteica y el principal componente es la pilina. Hay dos tipos de pelos, los de
conjugacin o pelos sexuales y los de unin o fimbrias.
Citoplasma. El medio interno de la clula procariota es el citoplasma. Es un
medio acuoso en el que se encuentran grnulos de sustancias de reserva (inclusiones), que sirven de reserva energtica como los grnulos de almidn o los
depsitos de lpidos. Tambin se puede encontrar en el citoplasma otros orgnulos
como los tilacoides, que contienen pigmentos fotosintticos en las cianobacterias,
vacuolas de gas, clorosomas que contienen pigmentos fotosintticos o carboxisomas que son los responsables de la fijacin de CO2 atmosfrico.
Cromosoma bacteriano. Est constituido por una doble cadena de ADN circular
situado en la regin nuclear o nucleoide del citoplasma. Tiene protenas ARN asociadas
y est muy enrollado. Se encuentra anclado a las protenas de la membrana plasmtica.
Las bacterias pueden contener pequeas molculas de ADN circular bicatenario llamados plsmidos o plasmidios, con capacidad de replicarse por s mismos.

Pregunta
2. Los hijos varones de una pareja cuya madre es daltnica y padre no daltnico, sern:
a) Todos daltnicos.
b) El 50% daltnicos y el otro 50% no daltnicos.
c) El 50% daltnicos y el otro 50% portadores.
- Indica la respuesta correcta. (0,5 puntos)
- Justifica la respuesta realizando el cruzamiento. (2 puntos)

Solucin

Indica la respuesta correcta. (0,5 puntos)


La respuesta correcta es la C.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

153

PRUEBAS DE ACCESO A CFGS

Justifica la respuesta realizando el cruzamiento. (2 puntos)

El daltonismo se caracteriza por una ceguera parcial a los colores, que dificulta
distinguir el color verde del rojo. Est regido por tres genes ginndricos recesivos,
es decir, sus genes estn situados en un segmento diferencial del cromosoma X,
que provocan diferentes alteraciones en la percepcin de los colores.
Uno de los genes da lugar a la ceguera para el rojo (protanopa), otro provoca la
ceguera para el color verde (deuteranotopa) y el tercero da lugar a la ceguera para
los dos colores (tritanotopa).
En cualquiera de los casos, se trata de una herencia ligada al sexo y de carcter
recesivo, por tanto:
Si la madre es daltnica su genotipo ser XDXD
Si el padre es de fenotipo normal su genotipo es XY.
Luego:

Figura 6. Cruzamiento

Explicacin
La hemofilia
El daltonismo sigue el mismo patrn de herencia que la hemofilia, por lo que es
frecuente que en los problemas aparezca este caso.
154

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

La hemofilia es una enfermedad hereditaria que se caracteriza porque la sangre


no coagula y en la mayora de los casos es debida a una herencia ginndrica, es
decir, sus genes estn situados en un segmento diferencial del cromosoma X.
Hasta hace muy poco, los nios hemoflicos moran jvenes y, por tanto, sin
descendencia. La enfermedad est regida por tres genes que determinan tres tipos
diferentes de enfermedad.
Tipos:

La hemofilia A. Se produce por la escasez del factor de coagulacin VIII,


que depende de un gen ginndrico, y es la ms frecuente.

La hemofilia B. Es la segunda en frecuencia y tambin se produce por un


gen ginndrico que produce la escasez del factor IX.

La hemofilia C. Se debe a la escasez del factor XI, y depende de un gen


autosmico, por tanto, no ligado al sexo. Pero solo es el 2% de los casos.

Pregunta
3. Reconoce y explica el proceso representado. (1 punto)
a) Qu es un alrgeno? Cita algn ejemplo. (0,5 puntos)
b) Qu efectos producen la histamina y las prostaglandinas? (0,5 puntos)
c) Qu son mastocitos? Dnde se encuentran? (0,5 puntos)

Solucin
a) Qu es un alrgeno? Cita algn ejemplo. (0,5 puntos)
Se trata de una reaccin e hipersensibilidad.
b) Qu efectos producen la histamina y las prostaglandinas? (0,5 puntos)
Un alrgeno es una sustancia que puede provocar una reaccin alrgica. Es
decir, el sistema inmunitario de algunas personas las reconoce como extraas
o peligrosas, pero que, en la mayora de las personas, no causan ninguna
respuesta.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

155

PRUEBAS DE ACCESO A CFGS

Los alrgenos ms comunes son: bacterias, virus, polvo, alimentos, productos


qumicos, polen, frmacos, perfumes y humo. Los efectos del alrgeno pueden
aparecer en pocos minutos o pasadas varias horas o das. Se denomina hipersensibilidad inmediata o retardada.
c) Qu son mastocitos? Dnde se encuentran? (0,5 puntos)
Los mastocitos o clulas cebadas se originan en las clulas madre de la
mdula sea, son clulas de tejido conectivo que contiene grnulos ricos en histamina y heparina. Tienen una importante misin en la curacin de las heridas y
en la defensa contra los patgenos, aunque se conocen ms por su papel en las
alergias y la anafilaxis.
En la respuesta alrgica, un alrgeno estimula la liberacin de anticuerpos, los
cuales se unen a la superficie de los mastocitos. Estos pueden liberar de golpe
todo su contenido endocrino provocando el conocido shock anafilctico.

Pregunta
4. Haz corresponder los conceptos a sus definiciones:

CONCEPTO

DEFINICIN

Catabolismo

Proceso de transferencia de un plsmido de una bacteria a otra


mediante un pelo sexual o pili.

Replicacin
del ADN

Enfermedad autoinmune, que afecta al sistema nervioso central


y ocasiona la prdida de mielina en las fibras nerviosas.

Conjugacin

Trmino que indica colonizacin de un organismo husped por


microorganismos patgenos.

Esclerosis
mltiple

Proceso de obtencin de dos nuevas hebras de cido nucleico a


partir de dos hebras que actan como molde.

Infeccin

Conjunto de reacciones degradativas que ocurren en la clula y


en las que se obtiene ATP.

156

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Solucin

CONCEPTO

DEFINICIN

Conjugacin

Proceso de transferencia de un plsmido de una bacteria a otra


mediante un pelo sexual o pili.

Esclerosis
mltiple

Enfermedad autoinmune, que afecta al sistema nervioso central


y ocasiona la prdida de mielina en las fibras nerviosas.

Infeccin

Trmino que indica colonizacin de un organismo husped por


microorganismos patgenos.

Replicacin
del ADN

Proceso de obtencin de dos nuevas hebras de cido nucleico a


partir de dos hebras que actan como molde.

Catabolismo

Conjunto de reacciones degradativas que ocurren en la clula y


en las que se obtiene ATP.

Explicacin
Catabolismo, replicacin del ADN, conjugacin, esclerosis mltiple. Infeccin
Catabolismo. Es la transformacin de molculas orgnicas complejas en otras
ms sencillas. En el proceso se libera energa que se almacena en enlaces fosfato
del ATP.
Las reacciones catablicas son degradativas y se trata de reacciones de oxidacin con desprendimiento de energa. Pueden producirse a partir de muchos
sustratos diferentes y casi siempre se forman los mismos productos, principalmente dixido de carbono, cido pirvico y etanol. Se trata de un conjunto de vas
metablicas convergentes.
Replicacin del ADN. Consiste en la duplicacin de la molcula de ADN para
obtener dos molculas iguales a partir de la molcula inicial. Esta rplica es semicorservativa, es decir, la nueva cadena se sintetiza utilizando una de las hebras
preexistentes como molde. Las molculas de ADN hijas estn formadas por una
cadena nueva y una original que sirve como molde. Para este proceso, la clula
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

157

PRUEBAS DE ACCESO A CFGS

debe abrir la doble cadena de ADN en una secuencia especfica denominada origen de replicacin en bacterias o secuencia de replicacin autnoma en eucariotas
y copiar cada cadena.
En la replicacin participan varias enzimas. Las ADN polimerasas sintetizan una
nueva cadena de ADN. Para esto utilizan como molde una de las hebras y un segmento corto de ADN, al que se le agregan los nuevos nucletidos. Este segmento
funciona como cebador. La ADN polimerasa agrega nucletidos al extremo 3 de la
cadena en crecimiento. La ADN polimerasa copia la cadena patrn. Sin embargo,
introduce en promedio un error cada 107 nucletidos incorporados. Tiene, adems,
la capacidad de corregir sus propios errores, ya que puede degradar ADN que acaba de sintetizar.
En el proceso participa otras enzimas, como la ARN-polimerasa llamada primasa, que sintetiza el primer de ARN. la ADN ligasa que une extremos 5 con 3 que
hayan quedado despus de la sntesis, la ADN helicasa y las ADN topoisomerasas
que evitan que el ADN se enrede en el proceso, y las protenas de unin al ADN
que facilitan la apertura de la doble hebra.
Conjugacin. Generalmente la reproduccin bacteriana es de tipo asexual mediante biparticin o fisin binaria. Sin embargo, las bacterias poseen mecanismos
parasexuales, mediante los que intercambian informacin gentica con otras bacterias sean o no de la misma especie. Estos mecanismos son la conjugacin, la
transduccin y la transformacin.
En la conjugacin, la bacteria donadora transmite ADN por medio de un pelo
sexual a la bacteria receptora. Las bacterias donadoras (F+) tienen un plsmido F
que contienen los genes que informan de la produccin de pelos sexuales. En la
transmisin del plsmido de una bacteria a otra solo pasa una de sus hebras.
Cuando este plsmido se intercala en el ADN bacteriano se denomina episoma.
Las bacterias que lo poseen tienen una alta frecuencia de recombinacin (Hfr) y
son capaces de aportar ADN a las bacterias F-. Las bacterias Hfr transmiten parte
de su plsmido y los genes adyacentes, que se recombinan con el ADN de la bacteria receptora quedando integradas en l. Finalmente la bacteria receptora tambin
pasa a ser F+.
La esclerosis mltiple. Enfermedad neurodegenerativa y crnica del sistema
nervioso central. No se conocen con exactitud las causas que producen la desmielinizacin ni se ha encontrado una cura eficaz, aunque existen tratamientos paliativos. Se cree que en su gnesis actan mecanismos autoinmunes.
En estado normal existe una barrera entre el sistema nervioso central y la
sangre llamada barrera hematoenceflica. Por causas desconocidas, en los
pacientes de esclerosis, esta barrera no funciona bien, y las clulas T autorreactivas la cruzan.

158

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

A partir de ese momento, aparece un proceso inflamatorio. La inflamacin es


facilitada por otras clulas inmunitarias y elementos solubles, como la citocina
y los anticuerpos. Al parecer, un subtipo especial de linfocitos, llamados clulas
CD4-Th1-T, que en circunstancias normales pueden distinguir entre clulas propias
y ajenas, en las personas con esclerosis mltiple reconocen partes sanas del sistema central como ajenas y las atacan como lo haran con un virus. La parte atacada
es la mielina, una sustancia grasa que cubre los axones de las clulas nerviosas y
que es importante para una transmisin nerviosa ya que actan a modo de aislante. La inflamacin provoca la apertura de la barrera hematoenceflica, provocando
edemas y la activacin de macrfagos, metaloproteinasas, y otras proteasas y
citocinas. Finalmente llevar a la destruccin de la mielina, proceso llamado desmielinizacin. El proceso produce dao en los axones y prdida irreversible de las
neuronas que se manifiesta desde el principio de la enfermedad.
Los sntomas de la esclerosis son causados por lesiones mltiples en el cerebro
y la espina dorsal y pueden variar mucho entre individuos. Los primeros sntomas tpicos son adormecimiento, cosquilleo, espasmos, parlisis, fatiga y alteraciones en
la vista, y con el tiempo puede tener como consecuencia una movilidad reducida e
invalidez en los casos ms severos. Quince aos tras la aparicin de los primeros
sntomas, si no es tratada, al menos 50% de los pacientes conservan un elevado
grado de movilidad. Menos del 10% de los enfermos mueren a causa de las consecuencias de la esclerosis mltiple o de sus complicaciones.
La infeccin. Es la invasin por parte de organismos patgenos en un ser
vivo que se denomina hospedador y al que puede causar una enfermedad o no.
Muchas enfermedades infecciosas pueden suponer una amenaza para la salud de
las personas.
La infeccin activa es el efecto de una lucha en la cual el organismo infectante
trata de utilizar los recursos del husped para multiplicarse. Casi todo organismo,
en las condiciones adecuadas, puede volverse patgeno y casi ningn organismo,
si est presente en pequeas cantidades y en reas bien protegidas por el sistema
inmunitario del husped, puede llevar a cabo una infeccin de importancia.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

159

EXAMEN N. 5
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

En las preguntas donde se proponen varias soluciones, slo una es correcta.

Revisa cuidadosamente la prueba antes de entregarla.

1. En el siguiente dibujo aparece una clula tipo con algunos de los principales componentes que la forman. La tabla adjunta muestra las funciones que desempean estos componentes celulares.

CLOROPL

NCLEO

MITOCONDR

CITOPLASMA

160

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

a) Completa la tabla, asignando a cada componente su funcin. Escribe


los nombres completos de los componentes. (1 punto)

Proporciona la energa que necesita la clula para desarrollar sus


funciones.
Contiene todas las instrucciones necesarias para mantener viva a
la clula.
Permite a las clulas que lo poseen realizar el proceso de la fotosntesis.
Es medio en que alberga todas las estructuras internas de la clula.

b) Para finalizar, responde a las siguientes preguntas:

Qu componente se debera eliminar si esta clula fuese del tipo


animal? (0,75 puntos)

Qu componente, que mantiene la forma de la clula, se debera


aadir para que sta fuese la de un vegetal? (0,75 puntos)

2. En la purificacin de un fragmento de ADN se ha perdido una porcin de


una de las dos hebras, quedando la secuencia de bases nitrogenadas
como se indica a continuacin. Reconstruye la porcin que falta (1,25
puntos) y explica en qu te basas para reconstruirla. (1,25 puntos)

3 ATTACCC...................
5 TAATGGGCCGAATTCGGCTAAGCT 3

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

161

PRUEBAS DE ACCESO A CFGS

3. En la industria alimentaria existen procesos en los que se utilizan levaduras.


a) Pon un ejemplo de proceso industrial relacionado con la industria alimentaria en el que se utilicen levaduras e indica cmo se denomina
el proceso metablico que tiene lugar. (1,25 puntos)
b) Realiza un esquema de la organizacin celular de las levaduras. (1,25
puntos)

4. La grfica siguiente representa la produccin de anticuerpos (unidades


arbitrarias) a lo largo de casi dos meses de haber inyectado a un animal
dos antgenos. El antgeno 1 se inyecta en los das 0 y 28. El antgeno 2
slo el da 28.

a) Interpreta las curvas A y B. A qu tipo de respuesta inmunitaria se


refieren? (1 punto)
b) Qu es la memoria inmunolgica? Est representada en la grfica?
(0,75 puntos).
c) Si el animal hubiese estado vacunado frente a un virus portador del
antgeno 2, cmo habra sido la evolucin de la curva B? Por qu?
(0,75 puntos)

162

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. En el siguiente dibujo aparece una clula tipo con algunos de los principales componentes que la forman. La tabla adjunta muestra las funciones que desempean estos componentes celulares.
a) Completa la tabla, asignando a cada componente su funcin. Escribe
los nombres completos de los componentes. (1 punto)
Proporciona la energa que necesita la clula para desarrollar sus funciones.
Contiene todas las instrucciones necesarias para mantener viva a la clula.
Permite a las clulas que lo poseen realizar el proceso de la fotosntesis.
Es medio en que alberga todos las estructuras internas de la clula.
b) Para finalizar, responde a las siguientes preguntas:

Qu componente se debera eliminar si esta clula fuese del tipo


animal? (0,75 puntos)
Qu componente, que mantiene la forma de la clula, se debera
aadir para que sta fuese la de un vegetal? (0,75 puntos)

Solucin
a) Completa la tabla, asignando a cada componente su funcin. Escribe los
nombres completos de los componentes. (1 punto)
mitocondria

Proporciona la energa que necesita la clula para desarrollar sus funciones.

ncleo

Contiene todas las instrucciones necesarias para mantener viva a la clula.

cloroplasto

Permite a las clulas que lo poseen realizar el proceso de la fotosntesis.

citoplasma

Es medio en que alberga todos las estructuras internas de la clula.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

163

PRUEBAS DE ACCESO A CFGS

b) Para finalizar, responde a las siguientes preguntas:

Qu componente se debera eliminar si esta clula fuese del tipo


animal? (0,75 puntos)

Si la clula fuese animal no tendra cloroplastos, ya que los cloroplastos son orgnulos exclusivamente vegetales y encargados de
realizar la fotosntesis.
Qu componente, que mantiene la forma de la clula, se debera
aadir para que sta fuese la de un vegetal? (0,75 puntos)
Un componente imprescindible en la clula vegetal es la pared celular, que
en las clulas vivas tiene un papel importante en actividades celulares tan
importantes como absorcin, transpiracin, secrecin y reacciones de reconocimiento, como en los casos de germinacin de tubos polnicos y defensa
contra bacterias u otros patgenos. Las paredes celulares son funcionales.
As, en los rboles, la mayor parte de la madera y la corteza est formada
slo de paredes celulares, ya que el protoplasto muere y degenera. En la
corteza, las paredes celulares contienen materiales que protegen las clulas subyacentes de la desecacin. En la madera, las paredes celulares son
gruesas y rgidas y sirven como soporte mecnico de los rganos vegetales.

Explicacin
La pared celular
Presenta varias capas que se desarrollan con la maduracin celular. De afuera
hacia dentro son: la lmina media, la pared primaria y la pared secundaria.
Su funcin es principalmente estructural, ya que constituye una capa rgida que
da forma a la clula, la protege de tracciones mecnicas y forma un armazn con
las clulas adyacentes que da consistencia a la planta. Adems, crea una presin
de turgencia en el interior de la planta que es muy importante en el crecimiento y
los movimientos de apertura y cierre de los estomas.
La lmina media es la capa ms externa, en muchos casos compartida por
ms de una clula. Se compone principalmente de cido pptico, que la unin de
molculas de cido galacturnico.
La pared primaria es ms gruesa que la lmina media. Se forma inmediatamente despus de la divisin celular, antes de que la clula complete su crecimiento.
Est asociada a protoplastos vivos, por lo tanto, los cambios que experimenta son
164

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

reversibles. Normalmente es delgada, pero puede alcanzar un grosor considerable


mostrando una clara laminacin. Solo est presente en algunos tipos celulares.
La pared secundaria es mucho ms gruesa que la primaria, sigue a sta en
orden de aparicin y tiene una alta proporcin de celulosa y lignina, y de otras molculas como suberina, cutina, sales minerales, etc.

Pregunta
2. En la purificacin de un fragmento de ADN se ha perdido una porcin de
una de las dos hebras, quedando la secuencia de bases nitrogenadas
como se indica a continuacin. Reconstruye la porcin que falta (1,25
puntos) y explica en qu te basas para reconstruirla. (1,25 puntos)

Solucin

3 ATTACCCGGCTTAAGCCGATTCGA 5
5 TAATGGGCCGAATTCGGCTAAGCT 3
Las cadenas de cidos nucleicos presentan dos extremos: el extremo 5, en
donde hay un grupo fosfato unido al carbono 5 del primer nucletido y el extremo
3 donde hay un radical hidroxilo unido al carbono 3 del ltimo nucletido.
En la molcula de ADN hay presentes cuatro nucletidos: (llevan desoxirribosa)
Adenina (A) dAMP. desoxiadenosin-5-monofosfato.
Timina (T) dTMP. desoxitimidn-5-monofosfato.
Guanina (G) dGMP. desoxiguanosn-5-monofosfato.
Citocina (C) dCMP. desoxicitidn-5-monofosfato.
Las purinas y pirimidinas son complementarias entre s, es decir, forman parejas de igual manera que lo haran una llave y su cerradura; son los denominados
apareamientos de Watson y Crick. La adenina y la timina son complementarias
(A=T), unindose gracias a dos puentes de hidrgeno, mientras que la guanina y

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

165

PRUEBAS DE ACCESO A CFGS

la citosina (G{C) se unen mediante tres puentes de hidrgeno. La complementariedad de las bases es la clave de la estructura del ADN y tiene importantes implicaciones, pues permite procesos como la replicacin del ADN, la transcripcin de
ADN a ARN y la traduccin del ARN en protenas.

Pregunta
3. En la industria alimentaria existen procesos en los que se utilizan levaduras.
a) Pon un ejemplo de proceso industrial relacionado con la industria alimentaria en el que se utilicen levaduras e indica cmo se denomina
el proceso metablico que tiene lugar. (1,25 puntos)
b) Realiza un esquema de la organizacin celular de las levaduras. (1,25
puntos)

Solucin
a) Pon un ejemplo de proceso industrial relacionado con la industria alimentaria en el que se utilicen levaduras e indica cmo se denomina el
proceso metablico que tiene lugar. (1,25 puntos)
Una de las levaduras ms utilizadas en la industria alimentaria es la Saccharomyces cereviciae, que se desarrolla en forma anaerobia realizando la fermentacin alcohlica. Es muy usada en la elaboracin de la cerveza, el vino, el pan y los antibiticos.
b) Realiza un esquema de la organizacin celular de las levaduras (1,25 puntos).
Las levaduras son hongos y, por tanto, tienen estructura celular eucariota.
La forma puede ser desde esfrica a ovoide e incluso alargada. Se puede observar la pared celular, el citoplasma, las vacuolas, los glbulos de grasa y los grnulos
de albumina o de almidn. No tienen sistema fotosinttico. La pared rgida se caracteriza por la presencia en su composicin de dos polisacridos: manano y glucano.
Algunas levaduras producen una cpsula constituida por fosfomanos. El ncleo est
rodeado de una membrana que persiste durante la divisin celular. El nmero de
cromosomas puede variar de unas levaduras a otras, no tienen movilidad.
Al igual que el resto de las clulas eucariotas contienen mitocondrias, retculo
endoplasmtico, aparato de Golgi, vacuolas, membrana nuclear, vesculas de secrecin y ribosomas. No contienen cloroplastos.
166

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Pregunta
4. La grfica siguiente representa la produccin de anticuerpos (unidades
arbitrarias) a lo largo de casi dos meses de haber inyectado a un animal
dos antgenos. El antgeno 1 se inyecta en los das 0 y 28. El antgeno 2
slo el da 28.
a) Interpreta las curvas A y B. A qu tipo de respuesta inmunitaria se
refieren? (1 punto)
b) Qu es la memoria inmunolgica? Est representada en la grfica?
(0,75 puntos)
c) Si el animal hubiese estado vacunado frente a un virus portador del
antgeno 2, cmo habra sido la evolucin de la curva B? Por qu?
(0,75 puntos)

Solucin
a) Interpreta las curvas A y B. A qu tipo de respuesta inmunitaria se refieren? (1 punto)
Se trata de una respuesta inmune o de memoria inmunolgica.
b) Qu es la memoria inmunolgica? Est representada en la grfica?
(0,75 puntos)
La deteccin de molculas extraas de tipo inmunogentico, como las que poseen
los microorganismos patgenos, pone en marcha todo un mecanismo de multiplicacin y maduracin de clulas inmunocompetentes y de produccin de anticuerpos.
En una primera fase conocida como respuesta inmune primaria se produce
el primer contacto con el antgeno. Al cabo de varios das empiezan a aparecer
anticuerpos IgM y IgG en la sangre del individuo infectado, cuya produccin va en
aumento exponencial hasta una fase estacionaria, y empieza a disminuir hasta casi
desaparecer sus niveles en sangre.
Si el sistema inmunolgico detecta por segunda vez la presencia del mismo
antgeno, origina una respuesta diferente, es la llamada respuesta inmune secundaria. La aparicin de anticuerpos es ms rpida y son principalmente IgG, las
concentraciones en sangre son tambin mayores y su persistencia mayor.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

167

PRUEBAS DE ACCESO A CFGS

c) Si el animal hubiese estado vacunado frente a un virus portador del


antgeno 2, cmo habra sido la evolucin de la curva B? Por qu?
(0,75 puntos)
Si el animal hubiese estado vacunado frente al antgeno 2, habra desarrollado
directamente una respuesta inmune secundaria, ya que la funcin de las vacunas
es desarrollar una respuesta inmune primaria frente a un antgeno determinado.

168

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

EXAMEN N. 6
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

En las preguntas donde se proponen varias soluciones, slo una es correcta.

Revisa cuidadosamente la prueba antes de entregarla.

1. a) Completa el cuadro siguiente. (0,2 puntos cada respuesta correcta)

BIOMOLCULA

GRUPO AL
QUE
PERTENECE

FUNCIN

UNIDADES
CONSTITUYENTES

Reserva
animal

GLUCGENO
ALMIDN

Glicerina + c. grasos
+ c. fosfrico

FOSFOLPIDO
INMUNOGLOBULINA

Lpidos

ADN

b) De las pistas que se ofrecen, una de ellas es falsa. De cul se trata?


(0,6 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

169

PRUEBAS DE ACCESO A CFGS

2. El albinismo es una alteracin gentica que bloquea la sntesis de melanina produciendo falta de pigmentacin. Al cruzar un ratn de pelaje normal, hijo de ratn albino, con una hembra albina, la mitad de la camada
tena pelaje normal y la otra mitad era albina.
a) Indica qu tipo de relacin se da entre los alelos normal y albino.
(0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
b) Indica los genotipos de los progenitores de esos dos ratones. Indica
tambin los genotipos de la descendencia que han tenido. Razona
ambas respuestas. (0,5 puntos)

c) Si se cruza el mismo ratn con una hembra de pelo normal hija de


madre albina, cmo sera la descendencia? Realiza el cruzamiento
e indica las proporciones fenotpicas. (1 punto)

3. La biotecnologa ha sido utilizada por los humanos desde siempre, por


supuesto mucho antes de que se le diera ese nombre. Hoy con el desarrollo de la Biologa Molecular que permite la manipulacin gentica, las
aplicaciones biotecnolgicas abren numerosas posibilidades que antes
estaban fuera de nuestro alcance o eran muy laboriosas.
a) Define biotecnologa en el sentido amplio del trmino. (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
170

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

b) Indica cinco aplicaciones clsicas y cinco modernas de la biotecnologa.


(0,1 puntos cada una, mximo 1 punto)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
c) Define qu es un organismo transgnico. (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
d) Describe brevemente cmo la industria farmacutica es capaz de
producir insulina humana masivamente. (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

4. El SIDA, despus de25 aos, sigue siendo una enfermedad que afecta a millones de personas en el mundo y, aunque los tratamientos han mejorado,
an es incurable y la mejor manera de luchar contra ella es la prevencin.
a) Qu tipo de agente causa esta enfermedad y cmo se llama? (0,25
puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

171

PRUEBAS DE ACCESO A CFGS

b) A qu clulas humanas ataca este agente patgeno? (0.25 puntos)


...............................................................................................................
...............................................................................................................
...............................................................................................................

c) Qu diferencias hay entre SIDA y seropositivo? (0,5 puntos)


...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

d) Cmo se transmite la enfermedad? (0,5 puntos)


...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

e) Cmo se puede prevenir la enfermedad? (0,75 puntos) qu papel


tiene el preservativo en este campo? (0,25 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

172

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. a) Completa el cuadro siguiente. (0,2 puntos cada respuesta correcta)

BIOMOLCULA

GRUPO AL
QUE
PERTENECE

FUNCIN

UNIDADES
CONTITUYENTES

Reserva
animal

GLUCGENO

ALMIDN
Glicerina + c. grasos
+ c. fosfrico

FOSFOLPIDO

INMUNOGLOBULINA

Lpidos

ADN

b) De las pistas que se ofrecen, una de ellas es falsa. De cul se trata?


(0,6 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

173

PRUEBAS DE ACCESO A CFGS

Solucin
1. a) Completa el cuadro siguiente (0,2 puntos cada respuesta correcta)

BIOMOLCULA

GRUPO AL
QUE
PERTENECE

FUNCIN

UNIDADES
CONTITUYENTES

GLUCGENO

Glcido

Reserva
animal

Cadenas de glucosa
ramificadas

ALMIDN

Glcido

Reserva
vegetal

Amilosa y
amilopeptina

FOSFOLPIDO

Lpido

Forman la
membrana
plasmtica
celular

Glicerina + c. grasos
+ c. fosfrico

INMUNOGLOBULINA

Protenas

Defensa
inmune

Cuatro cadenas
polipeptdicas

ADN

cido nucleico

Informacin
gentica

Nucletidos

b) De las pistas que se ofrecen, una de ellas es falsa. De cul se trata?


(0,6 puntos)

Explicacin
Glucgeno, almidn, fosfolpido, inmunoglobulina, ADN
El glucgeno es un polisacrido de reserva energtica en los animales. Se encuentra en abundancia en las clulas del hgado, y en las clulas musculares, por lo que es
una reserva energtica para todo el organismo o para los msculos en general.
Se trata de un polmero de maltosas unidas mediante enlaces D(1o4) con muchas
ramificaciones en posicin D(1o6). Contiene hasta unas 15000 molculas de maltosa.
La amilasa es el enzima que acta sobre el glucgeno dando maltosas y dextrinas lmite, que son fragmentos de amilopeptina, posteriormente con las enzimas
R-desramificantes y las maltasas se obtienen glucosas libres.
174

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

El almidn es el polisacrido de reserva de los vegetales. Est formado por


cientos o miles de molculas de glucosa. Los polmeros constituyentes son la amilosa en un 30% y la amilopeptina en un 70%.
La amilosa son maltosas unidas mediante enlaces D (1o4). Tiene una estructura helicoidal con seis molculas de glucosa por vuelta. La hidrlisis con cidos o
la accin de la amilasa las descompone en dextrinas y posteriormente en maltosas,
que por la accin de la maltasa pasan a D-glucosas.
La amilopeptina es un polmero de maltosas unidas mediante enlaces D(1o4) con
ramificaciones en posicin D(1o6). Las ramas tienen alrededor de doce glucosas, unidas mediante enlaces D(1o4), y aparecen aproximadamente cada 25 o 30 glucosas.
Por lo tanto, la amilopeptina tiene estructura ramificada. Por la accin de cidos o amilasas da lugar a maltosas y dextrinas lmite que slo pueden ser degradadas por enzimas
R-ramificantes. Posteriormente, por accin de maltasas producen glucosas libres.
El almidn se acumula en el citoplasma en forma de grnulos insolubles en agua
fra, pero en agua caliente los polmeros ms pequeos se dispersan (almidn soluble), mientras que los grnulos mayores (almidn insoluble) se hinchan y rodean a las
molculas de agua formando una pasta pegajosa que se llama engrudo de almidn.
El almidn se encuentra en grandes cantidades en las semillas de cereales
(trigo, arroz, maz), de las legumbres y en los tubrculos (patata).
Fosfolpidos. Las inmunoglobulinas o anticuerpos son protenas del grupo de las
globulinas que se unen a los antgenos especficamente. Son producidos por los linfocitos B y se difunden por la sangre, la linfa, las secreciones y los tejidos intersticiales.
Segn su localizacin pueden dividirse en anticuerpos de superficie y anticuerpos libres. Los primeros son receptores de antgenos adheridos a la membrana de
los linfocitos B, los segundos son segregados por las clulas y circulan en sangre
llegando a constituir el 20% de las protenas plasmticas.
Las inmunoglobulinas estn integradas por 4 molculas polipeptdicas, dos pesadas y dos ligeras, que se combinan para formar una molcula en forma de Y, En
ellas se pueden diferenciar varias zonas:

Figura 7. Zonas de las inmunoglobulinas


EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

175

PRUEBAS DE ACCESO A CFGS

La porcin variable cambia en cada tipo de anticuerpo. Se llama paratopo a la


porcin variable que encaja con cada antgeno especfico.
La porcin constante no puede unirse a los antgenos.
Existen los siguientes tipos de inmunoglobulina, en funcin de la cadena H que
presentan:
1. IgG. Son las ms numerosas en sangre. Sus cadenas H son de tipo J, a las
que se unen molculas de oligosacridos. Adems de unirse a los Ag, son
capaces de activar los complementos, macrfagos y micrfagos. Adems
son capaces de atravesar la barrera placentaria y penetrar en el feto.
2. IgM. Son las primeras que se producen ante la presencia de un Ag, y son
el 10% de las Ig presentes en sangre. Sus cadenas H son del tipo . Estas
Ig tienen 10 lugares de unin a los Ag y una gran capacidad de unin con
moleculas y antgenos polivalentes como los virus. Tambin se encargan de
activar los macrfagos y el sistema complementario.
3. IgA. Son un 10% del total circulante. Las cadenas H son del tipo D, aunque
pueden asociarse con otras cadenas dando dmeros o trmeros. Adems
poseen una cadena polipeptdica llamada componente secretor. Se originan
en estructuras subepiteliales, y se encuentran en secreciones como la leche, el mucus, la saliva o las lgrimas. Son un mecanismo muy importante
en las defensas primarias en animales.
4. IgE. Tiene la cadena H de tipo H. Se encuentran en los tejidos y son las
causantes de los principales fenmenos de alergia. Su concentracin en
sangre es baja.
5. IgD. Tienen la cadena H de tipo G. Son anticuerpos de superficie de los
linfocitos B y sirven como receptores especficos de Ag.

Pregunta
2. El albinismo es una alteracin gentica que bloquea la sntesis de melanina produciendo falta de pigmentacin.
Al cruzar un ratn de pelaje normal, hijo de ratn albino, con una hembra
albina, la mitad de la camada tena pelaje normal y la otra mitad era albina.
a) Indica qu tipo de relacin se da entre los alelos normal y albino.
(0,5 puntos)

176

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

b) Indica los genotipos de los progenitores de esos dos ratones. Indica


tambin los genotipos de la descendencia que han tenido. Razona
ambas respuestas. (0,5 puntos)
c) Si se cruza el mismo ratn con una hembra de pelo normal hija de
madre albina, cmo sera la descendencia? Realiza el cruzamiento
e indica las proporciones fenotpicas. (1 punto)

Solucin
a) Indica qu tipo de relacin se da entre los alelos normal y albino. (0,5 puntos)
La herencia del albinismo es autosmica recesiva. El alelo dominante es normal
y el alelo albino es recesivo.
La mutacin consiste en la ausencia de melanina en los ojos, piel y pelo de los
seres humanos y animales. Tambin puede aparecer en vegetales cuando faltan
pigmentos del tipo carotenos. Es una mutacin gentica hereditaria.
En los individuos normales, los melanocitos transforman la tirosina en melanina por accin del enzima tirosinasa. La melanina se distribuye por todo el cuerpo
dando color y proteccin a la piel, iris de los ojos y cabello. En los individuos albinos
la tirosinasa no acta o lo hace deficientemente, dando lugar a diferentes condiciones de albinismo.
b) Indica los genotipos de los progenitores de esos dos ratones. Indica
tambin los genotipos de la descendencia que han tenido. Razona ambas respuestas. (0,5 puntos)
Gen: color del pelaje.
Alelos: A=normal, a=albino
Fenotipos y genotipos posibles:
Ratn pelaje normal puede ser AA o Aa. El ratn albino es aa.
Si un individuo es fenotpicamente normal, entonces su genotipo tiene que
ser AA o Aa, sin embargo, si su padre o madre era albino (aa), entonces habr
recibido obligatoriamente uno de los alelos mutantes, por lo que, en este caso,
el individuo es hbrido, es decir, Aa. No manifiesta la enfermedad pero es portador de la misma.
En el caso del problema, se cruza un ratn fenotpicamente normal pero hijo de un
ratn albino. Luego su genotipo es AA con una hembra albina, cuyo genotipo es aa.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

177

PRUEBAS DE ACCESO A CFGS

Si se representa el cruzamiento, se tiene:

Figura 8. Representacin del cruzamiento 1

c) Si se cruza el mismo ratn con una hembra de pelo normal hija de madre
albina, cmo sera la descendencia? Realiza el cruzamiento e indica las
proporciones fenotpicas. (1 punto)
En este caso, se cruza el ratn normal portador (del apartado anterior), Aa, con una
hembra hija de madre albina, por lo que ser tambin Aa. Si se procede al cruzamiento:

Figura 9. Representacin del cruzamiento 2

178

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Pregunta
3. La biotecnologa ha sido utilizada por los humanos desde siempre, por
supuesto mucho antes de que se le diera ese nombre. Hoy con el desarrollo de la Biologa Molecular que permite la manipulacin gentica, las
aplicaciones biotecnolgicas abren numerosas posibilidades que antes
estaban fuera de nuestro alcance o eran muy laboriosas.
a) Define biotecnologa en el sentido amplio del trmino. (0,5 puntos)
b) Indica cinco aplicaciones clsicas y cinco modernas de la biotecnologa. (0,1 puntos cada una, mximo 1 punto)
c) Define qu es un organismo transgnico. (0,5 puntos)
d) Describe brevemente cmo la industria farmacutica es capaz de
producir insulina humana masivamente. (0,5 puntos)

Solucin
a) Define biotecnologa en el sentido amplio del trmino. (0,5 puntos)
La biotecnologa es el conjunto de tcnicas mediante las cuales se obtienen productos tiles para las personas a partir de seres vivos, sus partes o sus productos.
b) Indica cinco aplicaciones clsicas y cinco modernas de la biotecnologal.
(0,1 puntos cada una, mximo 1 punto)
La biotecnologa se emplea desde la Antigedad y algunas de sus aplicaciones ms frecuentes son la seleccin de plantas para el cultivo, la seleccin de
animales para la domesticacin, la fabricacin de alcoholes como el vino o la
cerveza, la fabricacin del pan y la fermentacin de la leche para la fabricacin
de queso o yogurt.
Las tcnicas actuales permiten aplicaciones muy variadas como por ejemplo,
la produccin de protenas terapeticas como la insulina, la hormona del crecimiento, el interfern o el factor VIII de coagulacin. Se usa para la produccin de
vacunas y de enzimas para la industria alimentaria, y la terapia gnica con clulas
germinales o somticas.
Tambin existen muchas aplicaciones en la agricultura, por ejemplo, para la
obtencin de plantas resistentes a los herbicidas, a los insectos o a los cambios
ambientales, o para modificar las caractersticas de la planta retrasando su maduracin o incrementando sus cualidades nutritivas.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

179

PRUEBAS DE ACCESO A CFGS

En cuanto a la ganadera, se usa para la obtencin de animales transgnicos


de consumo humano, clonacin de plantas, animales, clulas embrionarias o de
clulas madre pluripotenciales, totipotenciales o multipotenciales.
Por ltimo, es muy usada la biotecnologa en la obtencin de anticuerpos.
c) Define que es un organismo transgnico. (0,5 puntos)
El trmino transgnico significa la introduccin de un gen extrao en un organismo.
En agricultura estos organismos suponen un aumento de la productividad de
los cultivos, o se consiguen prcticas agrcolas ms ecolgicas y se obtienen productos con caractersticas mejoradas.
Para introducir genes en las clulas vegetales y obtener plantas transgnicas se
emplea el plsmido Ti de la bacteria Agrobaterium tumefaciens, aunque tambin se
puede usar microinyeccin o las microbalas de metal recubiertas de ADN. Se emplea
para obtener plantas ms resistentes a los herbicidas sin perjudicar a los cultivos y
controlar mejor las malas hierbas. Tambin se usa para conseguir plantas ms resistentes a los insectos, por lo que se limita el uso de los plaguicidas, lo que es beneficioso para el medio ambiente. Otra aplicacin es conseguir plantas que resistan
mejor a las heladas o las sequas, retrasar o adelantar la maduracin de las plantas o
aumentar su contenido en vitaminas o aminocidos para su mejor comercializacin.
Los transgnicos ms usados hoy son el maz Bt, que produce un insecticida
que le hace resistente a algunas plagas. Tambin la soja resistente a los herbicidas,
lo que hace que se puedan usar herbicidas en su cultivo para eliminar las malas
hierbas. Se usa tambin en el tomate de maduracin tarda, que madura lentamente por lo que no es necesario cogerlo verde.
Tambin estn en investigacin el arroz dorado que produce vitamina A y los
cultivos con genes nif que pueden asimilar directamente el nitrgeno atmosfrico.
En animales esta tcnica est menos desarrollada, pero ya se han obtenido carpas
que crecen ms rpidamente o salmones que resisten mejor las bajas temperaturas.
d) Describe brevemente cmo la industria farmacutica es capaz de producir insulina humana masivamente. (0,5 puntos)
La insulina es una hormona segregada por el pncreas que regula la concentracin de glucosa en sangre. Sin ella, la glucosa se acumula en sangre hasta alcanzar niveles que pueden causar serios problemas en el organismo. Esta enfermedad
es conocida como diabetes mellitus. Cuando la diabetes es causada por bajos o
nulos niveles de insulina, se pueden regular los niveles de glucosa (glucemia) mediante la administracin de insulina en dosis especficas para cada paciente.
Inicialmente la insulina se obtena de tejidos pancreticos de perros, vacas o
cerdos, pero sta no es idntica a la humana y puede producir reacciones adversas.
180

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

La insulina es una hormona proteica de 51 aminocidos. Para su secrecin


pasa por diferentes etapas, primero como preproinsulina, que se transforma en
proinsulina al cortarse sus extremos. Posteriormente se separa en dos partes, el
pptido C y la insulina que est formada por dos cadenas polipeptdicas de 21 y 30
aminocidos unidas por puentes disulfuro.
La insulina recombinante es el primer caso de protena producida por ingeniera
gentica para uso humano. Se produce a partir de bacterias y levaduras y es inocua
para la salud humana.
La tcnica consiste en insertar el gen de la insulina humana en el plsmido
bacteriano. Ya sea entero, con lo que se obtiene proinsulina, o en secuencias de
ADN separadas correspondientes a las cadenas A y B de la insulina, que se insertan separadamente en el plsmido. Los plsmidos recombinantes se introducen en
bacterias Escherichia coli donde se multiplican, una vez purificadas las dos cadenas, y se unen mediante puentes disulfuro. El producto final es insulina humana
biosinttica, que es igual que la producida por el pncreas humano.

Pregunta
4. El SIDA, despus de 25 aos, sigue siendo una enfermedad que afecta a
millones de personas en el mundo y, aunque los tratamientos han mejorado,
an es incurable y la mejor manera de luchar contra ella es la prevencin.
a) Qu tipo de agente causa esta enfermedad y cmo se llama? (0,25
puntos)
b) A qu clulas humanas ataca este agente patgeno? (0,25 puntos)
c) Qu diferencias hay entre SIDA y seropositivo? (0,5 puntos)
d) Cmo se transmite la enfermedad? (0,5 puntos)
e) Cmo se puede prevenir la enfermedad? (0,75 puntos) Qu papel
tiene el preservativo en este campo? (0,25 puntos)

Solucin
a) Qu tipo de agente causa esta enfermedad y cmo se llama? (0,25 puntos)
El Sida o Sndrome de inmunodeficiencia adquirida es una grave enfermedad
producida por un virus el VIH que ataca a las clulas de sistema inmunolgico reduciendo su capacidad y provocando su destruccin.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

181

PRUEBAS DE ACCESO A CFGS

En la actualidad se conocen dos cepas del virus VIH:


1. Retrovirus VIH-1, es el ms comn y es el que produce efectos ms graves.
2. Retrovirus VIH-2, que se encuentra en poblaciones de frica occidental. Es
menos virulento y se diferencia de la otra cepa en algunas protenas de la
envoltura.
b) A qu clulas humanas ataca este agente patgeno? (0,25 puntos)
El virus del Sida ataca a los linfocitos T, ya que tiene receptores especficos
GP120, que se unen a los receptores CD4 de los linfocitos.
Los linfocitos T intervienen en la inmunidad celular, por lo que la persona infectada queda prcticamente indefensa ante las infecciones microbianas y aumenta
su propensin a padecer cncer.
c) Qu diferencias hay entre SIDA y seropositivo? (0,5 puntos)
El trmino seropositivo hace referencia a la reaccin serolgica que produce un
organismo frente a la entrada de un antgeno. Es decir, una persona es seropositiva
con respecto al virus VIH si ha entrado en contacto con el virus y se ha producido
una reaccin inmune en su organismo de manera que presenta Ac especficos
contra ese virus. Esto no significa que la persona vaya a desarrollar la enfermedad,
pero s est infectado y, por tanto, puede transmitirlo y debe tomar todas las precauciones posibles y comenzar todos los tratamientos necesarios.
d) Cmo se transmite la enfermedad? (0,5 puntos)
1. Por contagio directo sangre-sangre. Transfusiones, compartir jeringuillas, incluso por el flujo menstrual.
2. A travs de fluidos y secreciones. Cuando el virus est en concentraciones
suficientemente elevadas aparece en fluidos como el semen o las secreciones vaginales. El contagio a travs de la saliva es prcticamente nulo.
Pero se puede contagiar durante las relaciones sexuales si el virus entra
en contacto con la circulacin sangunea. Esto se puede producir a travs
de pequeas erosiones o heridas, incluso las que son inapreciables y que
pueden estar en los rganos sexuales, regin anal o boca.
3. Por transmisin vertical durante el embarazo o gestacin. Durante este perodo, la sangre de la madre infectada puede llegar a contactar con la del
feto y transmitir el virus. Aunque la placenta acta como un filtro eficaz, la
mayora de los contagios de este tipo se producen en la fase expulsiva del
parto, que es el momento en que existe un mayor riesgo de contacto de
lquidos corporales, incluida la sangre, entre madre e hijo.
4. Tambin puede transmitirse a travs de la leche materna.
182

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

e) Cmo se puede prevenir la enfermedad? (0,75 puntos) Qu papel tiene el preservativo en este campo? (0,25 puntos)
Compartir material de inyeccin es un riesgo muy alto, por lo que nunca deben
compartirse jeringuillas, ni objetos punzantes o cortantes que puedan contener
restos sanguneos. Tambin es posible el contagio a travs de heridas.
Siempre que se tengan relaciones sexuales con penetracin y se desconozca
si alguna de las personas es seropositiva o no, debe usarse el preservativo como
mtodo preventivo.
En caso de embarazo de mujeres seropositivas, debe llevarse un riguroso control mdico y seguir los tratamientos ms adecuados para evitar la transmisin, por
ejemplo, evitar la lactancia.
Hoy en da los controles sanitarios son muy altos, por lo que prcticamente se
descarta el contagio hospitalario.

Explicacin
El virus del SIDA. VIH
Se trata de un retrovirus, es decir, su material gentico consiste en dos hebras
de ARN, con unos 9000 nucletidos y que se encuentran ligadas a la transcriptasa
inversa. Su tamao es muy pequeo (120 m) y su forma es esfrica. Se compone
de una bicapa lipdica externa a la que se asocian diferentes protenas algunas de
las cuales se proyectan hacia fuera (GP120). Tiene una envoltura esfrica formada
por una capa de protena (P7). La nucleocpsida es icosadrica y contiene en su
interior protenas del tipo integrasa y proteasa.
El virus puede penetrar a travs de heridas de la piel o de las mucosas, pasa a
la circulacin sangunea y se distribuye por todo el organismo. Las protenas GP120
se unen a los receptores CD4 de los linfocitos T, se produce la fusin de la envoltura del virus con la membrana celular del linfocito y la entrada de la nucleocpsida.
Una vez reabsorbida la nucleocpsida se libera el ARN vrico y la transcriptasa inversa que forma cadenas hbridas de ARN-ADN vrico, posteriormente se duplica el ADN
vrico y se dirige hacia el ncleo del linfocito en donde se integra. All puede quedar
inactivo en forma de provirus durante mucho tiempo, multiplicndose junto con el material de la clula hospedadora (ciclo lisognico), hasta que un determinado estmulo
hace que el ADN del profago y el ADN celular se separen y se inicie el ciclo ltico.
Entonces empieza a formarse ARNm de la cpsida y ARN viral, que migran
hacia el citoplasma y empiezan a sintetizar las protenas del virus gracias a los
ribosomas del los linfocitos. Posteriormente las nuevas molculas se reordenan y
ensamblan y salen al exterior.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

183

EXAMEN N. 7
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

Revisa cuidadosamente la prueba antes de entregarla.

1. La respiracin, a partir del catabolismo de los glcidos, es una funcin


comn de la mayora de los seres vivos. Responde a las siguientes cuestiones sobre este proceso:
a) Qu sustancias se utilizan como materia prima? (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

b) Qu productos de desecho se liberan? (0,5 puntos)


...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

184

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

c) Para qu se realiza esta funcin? (0,5 puntos)


...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

d) Dnde tiene lugar? (0,5 puntos)


...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

e) Es cierto que los vegetales sustituyen la respiracin por la fotosntesis? Razona la respuesta (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

2. El ADN es una biomolcula cuya estructura fue descrita por J. Watson y F.


Crick en 1953. Es un polmero constituido por la repeticin de cuatro monmeros denominados nucletidos. Responde a las siguientes cuestiones:
a) Componentes de los nucletidos (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

185

PRUEBAS DE ACCESO A CFGS

b) Nombra los cuatro nucletidos componentes del ADN (0,5 puntos)


...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

c) Indica la complementaridad entre las bases (0,5 puntos)


...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

d) Cul es la funcin del ADN? (0,5 puntos)


...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

e) Dnde se encuentra localizado el ADN en las clulas eucariotas? Y


en las procariotas? (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

186

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

3. Completa el siguiente cuadro con el tipo de microorganismo (bacterias, virus, protozoos u hongos) responsable de la enfermedad y la va de contagio
(heridas, aire, agua y alimentos, piel, animales, sexual). (2,5 puntos)

Enfermedad

Microorganismo

Va de contagio

Sfilis
Ttanos

heridas

Sarampin

aire

Malaria o Paludismo

animales

Tuberculosis
Botulismo

bacteria

Poliomielitis

agua y alimentos

Candidiasis
Clera

bacteria

Gripe
SIDA

virus

Enfermedad del sueo

protozoo

Hepatitis B

sexual

Gonorrea
Salmonelosis
Herpes genital

virus

Faringitis
Tia

hongo

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

187

PRUEBAS DE ACCESO A CFGS

4. El sistema inmunitario est constituido por un conjunto de rganos, tejidos, clulas y molculas que, de forma coordinada, defienden al organismo de todo aquello que pueda ser potencialmente nocivo. Define los
siguientes conceptos:
a) Antgeno. (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
b) Anticuerpo. (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
c) Autoinmunidad. (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
d) Hipersensibilidad. (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
e) Inmunodeficiencia. (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
188

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. La respiracin, a partir del catabolismo de los glcidos, es una funcin
comn en la mayora de los seres vivos. Responde a las siguientes cuestiones sobre este proceso:
a) Qu sustancias se utilizan como materia prima? (0,5 puntos)
b) Qu productos de desecho se liberan? (0,5 puntos)
c) Para qu se realiza esta funcin? (0,5 puntos)
d) Dnde tiene lugar? (0,5 puntos)
e) Es cierto que los vegetales sustituyen la respiracin por la fotosntesis? Razona la respuesta. (0,5 puntos)

Solucin
a) Qu sustancias se utilizan como materia prima? (0,5 puntos)
En las clulas animales, la glucosa se obtienen mediante la digestin de los
alimentos que contienen azcares. Estos se hidrolizan en el tubo digestivo y se convierten, primero en disacridos, y posteriormente en monosacridos, que pasan a
la sangre y finalmente terminan por convertirse en glucosa que pasar a las clulas
por difusin facilitada.
Tambin puede obtenerse glucosa a partir de glucgeno muscular y heptico
mediante la gluconeognesis.
En las clulas vegetales se puede obtener la glucosa a partir de la materia inorgnica mediante la fotosntesis, o por hidrlisis del almidn. Tambin se puede
obtener por gluconeognesis a partir de otros compuestos orgnicos.
La respiracin de los glcidos utiliza como materia prima el cido pirvico obtenido en la gluclisis. Este entra por transporte activo en la mitocondria donde el
sistema piruvato hidrogenasa los transforma en Acetil-CoA que se incorpora al ciclo
de Krebs y posteriormente a la cadena transportadora de electrones.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

189

PRUEBAS DE ACCESO A CFGS

b) Qu productos de desecho se liberan? (0,5 puntos)


A partir de una molcula de glucosa, la respiracin a partir del catabolismo de
los glcidos tiene el siguiente balance:
Glucosa + 6 O2 o 6 CO2 + 6 H2O + 36 ATP + 2 GTP
Las molculas de ATP, una vez formadas, se exportan a travs de las membranas de las mitocondrias para que sean utilizadas en toda la clula.
c) Para qu se realiza esta funcin? (0,5 puntos)
La respiracin aerobia, tambin conocida como respiracin mitocondrial, respiracin celular o simplemente respiracin, tiene como misin generar energa a
partir de los nutrientes consumidos para mantener la actividad celular.
A partir de una molcula de glucosa se producen:

En el citoplasma gracias a la gluclisis: 2 ATP.

En la mitocondria: 34 ATP.
*

A partir del NADH+ + H+ procedente de la gluclisis 6 ATP.

A partir del Acetil CoA: 6 ATP.

A partir del ciclo de Krebs: 18 ATP + 2 GTP + 2 (FADH2).

d) Dnde tiene lugar? (0,5 puntos)


Este proceso se produce en la mitocondria. La mitocondria es un orgnulo citoplasmtico de la clula eucaritica, tanto animal como vegetal. Son muy abundantes, especialmente en los tejidos que requieren mucha energa, como por ejemplo
el tejido muscular.
e) Es cierto que los vegetales sustituyen la respiracin por la fotosntesis? Razona la respuesta. (0,5 puntos)
No es cierto. Los vegetales son auttrofos, es decir, fabrican su propia materia
orgnica mediante la fotosntesis y, posteriormente, la utilizan como fuente de
energa, degradndola hasta compuestos sencillos gracias a la respiracin mitocondrial. Esto es, las plantas realizan los dos procesos: fotosntesis y respiracin.

190

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Explicacin
La respiracin a partir del catabolismo de los glcidos.
1. En la gluclisis:
a) De una molcula de 6 carbonos se obtienen 2 de 3 carbonos:
1 Glucosa + 2 NAD+ + 2 ADP + 2 P o 2 cido pirvico + 2 NADH + 2 H+ + 2 ATP
b) De 2 molculas de 3 carbonos se obtienen 2 de 2 carbonos:
2 cido pirvico + 2 HS-CoA + 2 NAD+ o 2 CO2 + 2 NADH + 2 H+ + 2 Acetil-CoA
2. En el ciclo de Krebs:
2 AcetilCoA + 3H2O + 3NAD+ + FAD + ADP + P o 4CO2 + 6NADH + 6H+
+ 2FADH2 + 2ATP + 2SH - CoA
3. En la cadena respiratoria:
10 NADH+H+ + 30ADP + 30P + 5O2 o 10 NAD+ + 30ATP + 10 H2O
2 FADH2 + 4 ADP + P + O2 o 2 FAD + 4 ATP + 2 H2O
Por lo que el balance final es:
C6H12O6 + 6 O2 o 6 CO2 + 6 H2O + 36 ATP + 2 GTP
Mitocondrias
Las mitocondrias son orgnulos polimorfos que pueden variar desde formas
esfricas o alargadas hasta bastoncillos. Estn formadas por una doble membrana
que delimita dos cavidades:

La membrana mitocondrial externa. Es lisa y su estructura es la misma


de todas las membranas celulares, es decir, una doble capa lipdica con
protenas asociadas. Contiene muchas protenas transmembranosas que
actan como canales, lo que permite que molculas de gran tamao pasen
libremente hacia el espacio intermembranoso. El espacio intermembranoso
tiene un contenido parecido al del citosol.

La membrana interna. Presenta muchos repliegues, denominados crestas


mitocondriales, que aumentan su superficie y, por tanto, su capacidad metabolizadora. Es muy impermeable y contiene las molculas encargadas de la res-

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

191

PRUEBAS DE ACCESO A CFGS

piracin mitocondrial como los citocromos, las permeasas y las ATP-sintetasas.


No contiene colesterol como lpido de membrana, al igual que las membranas
procariotas. La cadena respiratoria se produce en la membrana interna.
La matriz mitocondrial es rica en enzimas, en ella se desarrollan un gran nmero de reacciones bioqumicas. Adems presenta:
1. Ribosomas mitocondriales, similares a los bacterianos.
2. Molculas de ADN mitocondrial, circular, doble, como el ADN bacteriano.
3. Enzimas necesarias para la replicacin, transcripcin y traduccin del ADN
mitocondrial.
4. Enzimas implicadas en el ciclo de Krebs y en la E-oxidacin de los cidos
grasos.
5. Iones de calcio, fosfato, etc.
La teora endosimbionte propone que las mitocondrias se originaron a partir de
bacterias fagocitadas que no fueron digeridas y quedaron en simbiosis con la clula
eucariota primitiva. Las mitocondrias tienen la importante funcin de llevar a cabo
la respiracin mitocondrial.
En la matriz mitocondrial se realiza el ciclo de Krebs, la oxidacin de los cidos grasos, la fosforilacin oxidativa, la duplicacin del ADN mitocondrial y la acumulacin de
sustancias como protenas, lpidos, hierro, fosfatos y partculas semejantes a los virus.

Pregunta
2. El ADN es una biomolcula cuya estructura fue descrita por J. Watson y
F. Crick en 1953. Es un polmero constituido por la repeticin de cuatro monmeros denominados nucletidos. Responde a las siguientes cuestiones:
a) Componentes de los nucletidos. (0,5 puntos)
b) Nombra los cuatro nucletidos componentes del ADN. (0,5 puntos)
c) Indica la complementariedad entre las bases. (0,5 puntos)
d) Cul es la funcin del ADN? (0,5 puntos)
e) Dnde se encuentra localizado el ADN en las clulas eucariotas? Y
en las procariotas? (0,5 puntos)

192

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Solucin
a) Componentes de los nucletidos. (0,5 puntos)
Los nucletidos se forman mediante la unin de tipo ster fosfrico de una molcula de cido fosfrico y un nuclesido, que se forma con ribosa o desoxirribosa, y
con una base nitrogenada prica o pirimidnica. Por tanto, tienen un fuerte carcter
cido debido a la ionizacin del grupo fosfato.
En la molcula de ADN hay presentes cuatro nucletidos: (llevan desoxirribosa)

dAMP. desoxiadenosin-5-monofosfato.

dTMP. desoxitimidn-5-monofosfato.

dGMP. desoxiguanosn-5-monofosfato.

dCMP. desoxicitidn-5-monofosfato.

En la molcula de ARN estn presentes: (lleva ribosa)

AMP. adenosin-5-monofosfato.

UMP. uridn-5-monofosfato.

GMP. guonosn-5-monofosfato.

CMP. citidn-5-monofosfato.

b) Nombra los cuatro nucletidos componentes del ADN. (0,5 puntos)


Los cuatro nucletidos componentes del ADN son, por tanto:

Adenina (A) dAMP.

Timina (T) dTMP.

Guanina (G) dGMP.

Citocina (C) dCMP.

c) Indica la complementariedad entre las bases. (0,5 puntos)


Las cadenas de cidos nucleicos presentan dos extremos: el extremo 5, en
donde hay un grupo fosfato unido al carbono 5 del primer nucletido, y el extremo
3, donde hay un radical hidrxilo unido al carbono 3 del ltimo nucletido.
Las purinas y pirimidinas son complementarias entre s, es decir, forman parejas de igual manera que lo haran una llave y su cerradura; son los denominados
apareamientos de Watson y Crick. La adenina y la timina son complementarias
(A=T), unindose gracias a dos puentes de hidrgeno, mientras que la guanina y
la citosina (G{C) se unen mediante tres puentes de hidrgeno.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

193

PRUEBAS DE ACCESO A CFGS

La complementariedad de las bases es la clave de la estructura del ADN y tiene


importantes implicaciones, pues permite procesos como la replicacin del ADN, la
transcripcin de ADN a ARN y la traduccin del ARN en protenas.
d) Cul es la funcin del ADN? (0,5 puntos)
El ADN es la molcula portadora de la informacin gentica usada en el desarrollo y funcionamiento de los organismos vivos conocidos y de algunos virus,
siendo la responsable de la transmisin hereditaria. El material gentico completo
de un organismo se denomina genoma, y es caracterstico de cada especie.
e) Dnde se encuentra localizado el ADN en las clulas eucariotas? Y en
las procariotas? (0,5 puntos)
En las clulas eucariotas se encuentra en el interior del ncleo de la clula, organizado en unas estructuras llamadas cromosomas, que durante el ciclo celular se
duplican y dividen. Tambin se puede encontrar ADN en las mitocondrias y plastos
de las clulas vegetales y en los centros organizadores de microtbulos y centriolos.
Los organismos procariotas contienen el ADN en el citoplasma de la clula, ya
que carecen de envoltura nuclear.

Explicacin
La estructura del ADN
El ADN est constituido por dos cadenas de nucletidos enrolladas formando
una doble hlice. Cada cadena est formada por un polmero de desoxirribonucletidos de adenina, guanina, citocina y timina (el uracilo solo se encuentra en el ARN).
La estructura del ADN es comn para todas las clulas excepto en algunos virus.
En las clulas eucariotas se pueden encontrar el ADN en el ncleo, las mitocondrias y los cloroplastos.
El ADN nuclear aparece unido a las histonas, unas protenas bsicas y a una pequea cantidad de protenas no histnicas. Esta asociacin forma la fibra de cromatina.
El ADN de mitocondrias y cloroplastos es similar al de las clulas procariotas.
En las clulas procariotas, el ADN est asociado a unas protenas similares a las
histonas, a ARN y a protenas no histnicas, formando el nucleoide, que no est
rodeado de membrana. Los virus tambin presentan protenas asociadas al ADN.
El ADN presenta diferentes niveles de complejidad o niveles estructurales:
La estructura primaria es la secuencia de nucletidos de una sola cadena, o hebra. El nmero de hebras diferentes de ADN que pueden formarse por la combina194

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

cin de los cuatro nucletidos es tan alto que resulta prcticamente imposible que
dos organismos presenten la misma secuencia de nucletidos. Aunque la similitud
entre ellas depender de la proximidad evolutiva.
La estructura secundaria es la doble hlice. En 1953 Watson y Crick establecieron el modelo de la doble hlice. Se trata de una estructura de 20 de dimetro
formada por dos cadenas de polinucletidos enrolladas. Los grupos hidrfobos
(CH3 y CH=) de las bases, se disponen hacia el interior establecindose interacciones hidrofbicas, que junto con los puentes de hidrgeno confieren estabilidad
a las molculas. Los grupos fosfato y las pentosas quedan hacia el exterior, y esto
proporciona carcter cido a la molcula.
Las dos cadenas que forman la hlice son antiparalelas, con los enlaces 3 y 5
orientados en sentidos contrarios. Adems, son complementarias, y a cada adenina le corresponde una timina, y a cada citosina una guanina.
El enrollamiento de la doble hlice es dextrgiro y plectonmico, es decir, que
para que las dos cadenas se separen deben girar una con respecto a la otra.
La estructura terciaria, o ADN superenrollado, surge de la torsin de la doble hlice
sobre s misma. Aparece en el ADN bacteriano y de las mitocondrias, y cloroplastos.
En las clulas eucariotas, esta estructura puede llegar a una superespirilizacin
presentando diferentes niveles de empaquetamiento.
El primer nivel de empaquetamiento es de las fibras de cromatina de 100 ,
tambin llamada collar de perlas, filamento nucleosmico o nucleofilamento. La
fibra de ADN de doble hlice se asocia con las protenas histnicas. Esta estructura
aparece durante la interfase del ciclo celular, a excepcin de los espermatozoides
(los espermatozoides se asocian con unas protenas llamadas protaminas).
La fibra aparece constituida por una sucesin de nucleosomas que se componen de un octmero de histonas (ocho molculas de cuatro tipos diferentes) y por
una fibra de ADN de 200 pares de bases de longitud. Entre ellos se encuentra el
ADN espaciador. Cuando esta fibra de 100 se asocia con una molcula de histona H1, se acorta y se condensa.
El segundo nivel de empaquetamiento son fibras de 300 , llamado tambin
solenoide. Se forma por enrollamiento sobre s misma de la fibra de 100 condensada. En cada vuelta se encuentran 6 nucleosomas y 6 histonas que se agrupan y
forman el eje central de la fibra 300 .
El tercer nivel de empaquetamiento, o dominios en forma de bucle, est formado
por fragmentos que alcanzan los 600 de espesor. Se trata de dominios de entre
20000 y 70000 pares de bases de longitud, estabilizados por un armazn proteico.
Niveles superiores de empaquetamiento. En el momento de la divisin, el empaquetamiento es de, entre 100 y 10000 veces, y se producen gracias a protenas SMC, que
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

195

PRUEBAS DE ACCESO A CFGS

contienen histonas y topoisomerasas. En la metafase, la cromatina alcanza su mximo


grado de empaquetamiento y pueden observarse los cromosomas con total claridad.
Unidades de medida en microscopa
Los organismos microscpicos son ms pequeos que el milmetro (1 mm =
10-3 m). Por ello, se usan unidades mucho ms pequeas, como son:
El micrmetro o micra (m = 10-6 m), el nanmetro (nm = 10-9 m) y el angstrm ( = 10-10 m).

Pregunta
3. Completa el siguiente cuadro con el tipo de microorganismo (bacterias,
virus, protozoos u hongos) responsable de la enfermedad y la va de contagio (heridas, aire, agua y alimentos, piel, animales, sexual). (2,5 puntos)
ENFERMEDAD

MICROORGANISMO

VA DE CONTAGIO

SFILIS

TTANOS

HERIDA

SARAMPIN

AIRE

MALARIA O PALUDISMO

ANIMALES

TUBERCULOSIS
BOTULISMO

BACTERIA

POLIOMIELITIS

AGUA Y ALIMENTOS

CANDIDIASIS
CLERA

BACTERIA

GRIPE
SIDA

VIRUS

ENFERMEDAD DEL SUEO

PROTOZOO

HEPATITIS B

SEXUAL

GONORREA

SALMONELOSIS
HERPES GENITAL

VIRUS

FARINGITIS
TIA

196

HONGO

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Solucin
ENFERMEDAD

MICROORGANISMO

VA DE CONTAGIO

SFILIS

Bacteria

Sexual

TTANOS

Bacteria

HERIDA

SARAMPIN

Virus

AIRE

MALARIA O PALUDISMO

Protozoo

ANIMALES

TUBERCULOSIS

Bacteria

Aire

BOTULISMO

BACTERIA

Heridas o alimentos

POLIOMIELITIS

Virus

AGUA Y ALIMENTOS

CANDIDIASIS

Hongo

Sexual

CLERA

BACTERIA

Agua y alimentos

GRIPE

Virus

Aire

SIDA

VIRUS

Sexual, heridas

ENFERMEDAD DEL SUEO

PROTOZOO

Animales

HEPATITIS B

Virus

SEXUAL

GONORREA

Bacteria

Sexual

SALMONELOSIS

Bacteria

Alimentos

HERPES GENITAL

VIRUS

Sexual

FARINGITIS

Bacteria o virus

Aire

TIA

HONGO

Piel

Pregunta
4. El sistema inmunitario est constituido por un conjunto de rganos, tejidos, clulas y molculas que, de forma coordinada, defienden el organismo de todo aquello que pueda ser potencialmente nocivo. Define los
siguientes conceptos:
a) Antgeno. (0,5 puntos)
b) Anticuerpo. (0,5 puntos)
c) Autoinmunidad. (0,5 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

197

PRUEBAS DE ACCESO A CFGS

d) Hipersensibilidad. (0,5 puntos)


e) Inmunodeficiencia. (0,5 puntos)

Solucin
a) Antgeno. (0,5 puntos)
Se llama antgeno (AG) o inmungenos a las sustancias capaces de inducir una
respuesta inmune, unindose especficamente a una molcula de anticuerpo (Ac).
b) Anticuerpo. (0,5 puntos)
Las inmunoglobulinas o anticuerpos son protenas del grupo de las globulinas
que se unen a los antgenos especficamente. Son producidos por los linfocitos B y
se difunden por la sangre, la linfa, las secreciones y los tejidos intersticiales.
Segn su localizacin, pueden dividirse en anticuerpos de superficie y anticuerpos libres. Los primeros son receptores de antgenos adheridos a la membrana de
los linfocitos B, y los segundos son segregados por las clulas y circulan en sangre
llegando a constituir el 20% de las protenas plasmticas.
c) Autoinmunidad. (0,5 puntos)
La autoinmunidad es un fallo del sistema inmunitario que consiste en la incapacidad de reconocer como propias determinadas molculas, dando lugar a enfermedades autoinmunes en las que se generan gran cantidad de anticuerpos y
linfocitos autorreactivos.
Las molculas que provocan la autoinmunidad se denominan autoantgenos.
Puede venir originada por factores genticos, o por otros como el sexo, ya que
afecta ms a mujeres que a hombres. Tambin puede haber factores ambientales,
nutricionales o de estrs.
d) Hipersensibilidad. (0,5 puntos)
Es la reaccin excesiva del sistema inmunitario de una animal ante la exposicin a un antgeno poco peligroso o inocuo. Generalmente, se refiere a ella como
alergia, mientras que el alrgeno es el antgeno que provoca la hipersensibilidad.
e) Inmunodeficiencia. (0,5 puntos)
Es la incapacidad del sistema inmune de actuar contra las infecciones microbianas. Las causas pueden ser muy variadas, desde trastornos genticos, fallos en
el normal desarrollo de los rganos linfoides primarios o secundarios, o infecciones
vricas. Las personas que presentan est enfermedad se dice que tienen sndrome
de inmunodeficiencia. Estos sndromes pueden ser primarios o congnitos (cuando
se nace con ellos), o secundarios o adquiridos.
198

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

EXAMEN N. 8
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

Revisa cuidadosamente la prueba antes de entregarla.

1. Todos los seres vivos, desde los ms sencillos organismos unicelulares


hasta los organismos superiores complejos, estamos constituidos por
clulas: unidades bsicas funcionales y estructurales de la vida. La mayor parte de los tipos celulares sigue un ciclo vital comn, aunque no
todas ellas llevan a cabo los mismos procesos metablicos.
a) Observa el siguiente esquema del ciclo celular y rellena el cuadro que
se te proporciona a continuacin indicando en cules de las fases del
ciclo se producen los fenmenos descritos en la tabla. (1 punto)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

199

PRUEBAS DE ACCESO A CFGS

Proceso

Fase

Desaparece la membrana nuclear


Aparecen de nuevo los nuclolos
Se duplican los centriolos
El ADN, ya duplicado, empieza a condensarse
Se produce la duplicacin del ADN
Se repara el ADN
El nuclolo desaparece paulatinamente
Comienzan a desespiralizarse los cromosomas
Se separan los centrmeros llevando unidas sus correspondientes cromtidas
Los cromosomas, en su mximo grado de empaquetamiento, se disponen en el plano ecuatorial

b) Escribe el concepto correspondiente a cada una de las definiciones


sobre distintos procesos metablicos que se hacen a continuacin.
(1 punto)

El conjunto de reacciones metablicas, cuya finalidad consiste en proporcionar a la clula ATP, poder reductor y precursores metablicos se llama...
El conjunto de procesos bioqumicos mediante los cuales
las clulas sintetizan la mayora de las sustancias que lo
constituyen se denomina
El orgnulo responsable de la respiracin celular se llama
El orgnulo directamente implicado en la fotosntesis se denomina
La fijacin de CO2 en la fotosntesis se lleva a cabo en la
fase

200

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

2. Los cidos nucleicos son las molculas que contienen la informacin sobre las caractersticas biolgicas de los seres vivos. Para la transmisin
y manifestacin de esta informacin son necesarios varios procesos celulares, en los cuales, a veces se producen errores.
a) Indica si las siguientes afirmaciones son verdaderas (V) o falsas (F).
Reconstruye correctamente en la casilla inferior las que estn mal
formuladas. (1 punto)
VoF
El proceso de transcripcin consiste en copiar una parte del mensaje gentico desde su forma original (ADN) a otra (ARN) que se pueda utilizar
para la sntesis de protenas.

La recombinacin gentica tiene lugar en las primeras etapas de la meiosis.

Las clulas de cada especie tienen su propio cdigo gentico.

Una caracterstica del cdigo gentico es que existe el mismo nmero de


seales codificadoras en el ARN qu aminocidos van a ser codificados.

b) Una mutacin en el gen que controla el tipo de alas en una raza de


pollos de granja provoca atrofia de las alas. Un pollo con las alas
atrofiadas es hijo de una pareja de animales de alas normales. Responde a las preguntas que se realizan a continuacin:

Cul es el modo de herencia de la mutacin? Justifica tu respuesta. (1 punto)


.....................................................................................................
.....................................................................................................
.....................................................................................................

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

201

PRUEBAS DE ACCESO A CFGS

Cules seran los genotipos para ese carcter del pollo mutante
y de ambos progenitores? Dibuja el esquema correspondiente.
(1,5 puntos)

3. El zologo y fisilogo britnico Peter B. Medawar, Premio Nobel de Fisiologa y Medicina de 1960, defini los virus como un fragmento de malas
noticias envuelto en una protena
a) Indica si las siguientes afirmaciones son verdaderas (V)o falsas (F).
Reconstruye correctamente en la casilla inferior, las que estn mal
formuladas. (1 punto)
VoF
Los virus son las formas celulares ms pequeas que existen.

Los virus slo pueden ser parsitos de animales.

Todos los virus contienen ADN.

La cpsida de los virus est constituida por ADN.

b) Describe brevemente el ciclo ltico de un virus. (1,5 puntos)

202

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

4. La inmunologa estudia los procesos implicados en el rechazo de los


organismos a las sustancias extraas o potencialmente dainas. Este
rechazo se lleva a cabo gracias a la accin del sistema inmunitario. En
algunas ocasiones se producen inmunodeficiencias, siendo uno de los
casos ms graves el SIDA.

a) Define inmunidad humoral. (0,5 puntos)


...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
b) Define antgeno. (0,5 puntos)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
c) Enumera y describe las vas de contagio del VIH. (1 punto)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

203

SOLUCIONES

Pregunta
1. Todos los seres vivos, desde los ms sencillos organismos unicelulares
hasta los organismos superiores complejos, estamos constituidos por
clulas; unidades bsicas funcionales y estructurales de la vida. La mayor parte de los tipos celulares sigue un ciclo vital comn, aunque no
todas ellas llevan a cabo los mismos procesos metablicos.
a) Observa el siguiente esquema del ciclo celular y rellena el cuadro que
se te proporciona a continuacin indicando en cules de las fases del
ciclo se producen los fenmenos descritos en la tabla. (1 punto)

Proceso

Fase

Desaparece la membrana nuclear


Aparecen de nuevo los nuclolos
Se duplican los centriolos
El ADN, ya duplicado, empieza a condensarse
Se produce la duplicacin del ADN
Se repara el ADN
El nuclolo desaparece paulatinamente
Comienzan a desespiralizarse los cromosomas
Se separan los centrmeros llevando unidas sus correspondientes cromtidas
Los cromosomas, en su mximo grado de empaquetamiento, se disponen en el plano ecuatorial
* Se ha omitido el cuadro que apareca adjunto al enunciado por contener errores
204

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

b) Escribe el concepto correspondiente a cada una de las definiciones sobre


distintos procesos metablicos que se hacen a continuacin. (1 punto)
El conjunto de reacciones metablicas cuya finalidad consiste en
proporcionar a la clula ATP poder reductor y precursores metablicos se llama...
El conjunto de procesos bioqumicos mediante los cuales las clulas sintetizan la mayora de las sustancias que lo constituyen
se denomina
El orgnulo responsable de la respiracin celular se llama
El orgnulo directamente implicado en la fotosntesis se denomina
La fijacin de CO2 en la fotosntesis se lleva a cabo en la fase

Solucin
a) Observa el siguiente esquema del ciclo celular y rellena el cuadro que se
te proporciona a continuacin indicando en cules de las fases del ciclo
se producen los fenmenos descritos en la tabla. (1 punto)
Proceso

Fase

Desaparece la membrana nuclear

Profase

Aparecen de nuevo los nuclolos

Telofase

Se duplican los centriolos


El ADN, ya duplicado, empieza a condensarse

Interfase (S) (G)


Profase

Se produce la duplicacin del ADN

Interfase (S)

Se repara el ADN

Interfase (S)

El nuclolo desaparece paulatinamente

Profase

Comienzan a desespiralizarse los cromosomas

Telofase

Se separan los centrmeros llevando unidas sus correspondientes cromtidas

Anafase

Los cromosomas, en su mximo grado de empaquetamiento, se disponen en el plano ecuatorial

Metafase

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

205

PRUEBAS DE ACCESO A CFGS

b) Escribe el concepto correspondiente a cada una de las definiciones sobre


distintos procesos metablicos que se hacen a continuacin. (1 punto)

El conjunto de reacciones metablicas cuya finalidad consiste


en proporcionar a la clula ATP poder reductor y precursores
metablicos se llama...

Catabolismo

El conjunto de procesos bioqumicos mediante los cuales las


clulas sintetizan la mayora de las sustancias que lo constituyen
se denomina

Anabolismo

El orgnulo responsable de la respiracin celular se llama

Mitocondria

El orgnulo directamente implicado en la fotosntesis se denomina

Cloroplasto

La fijacin de CO2 en la fotosntesis se lleva a cabo en la fase

Oscura

Explicacin
Los cloroplastos y la fotosntesis
Los cloroplastos son los orgnulos tpicos de las clulas vegetales. Contienen
un pigmento llamado clorofila, gracias al cual pueden llevar a cabo la fotosntesis.
Son orgnulos polimorfos de color verde, que miden entre 3 y 19 m de dimetro
mayor, y de 1 a 2 m de dimetro menor. Est constituido por una doble membrana, que tiene estructura tpica de membrana celular, excepto que no contienen
colesterol, al igual que mitocondrias y bacterias.
La membrana plastidial externa es muy permeable. Mientras que la membrana
plastidial interna es casi impermeable, presentando gran cantidad de protenas
permeasas, denominadas protenas traslocadoras.
El estroma es el espacio interior y contiene:

206

ADN plastidial, que es circular y de doble hlice, como las mitocondrias y


bacterias.

Plastorribosomas, diferentes de los restantes de la clula.

Enzimas. Especialmente destacan los que transforman el CO2 en materia


orgnica, que permiten la transcripcin, traduccin y replicacin de su ADN.

Inclusiones de granos de almidn y lpidos.


EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Tilacoides o lamelas. Son sculos aplanados, o cisternas que presentan


una membrana, llamada membrana tilacoidal, que contienen pigmentos
fotosintticos y una cavidad interior llamada lumen o espacio tilacoidal. Los
tilacoides pueden ser de estroma (alargados y extendidos por todo el estroma) o de grnulos o grana (pequeos y en forma de discos apilados como
si fuesen monedas). En las membranas de los tilacoides se encuentran los
sistemas enzimticos que captan la luz solar y efectan el transporte de
electrones y forman ATP. La funcin principal de los cloroplastos es realizar
la fotosntesis. Se puede distinguir dos fases:
1. Fase luminosa. Los pigmentos fotosintticos que se encuentran en las
protenas de membrana tilacoidal captan energa luminosa, que usan
para romper las molculas de agua y obtener de ellas sus hidrgenos,
en forma de protones (H+) y electrones (e-). Como resultado se libera
O2 como producto de desecho. El transporte de electrones es llevado a
cabo por los enzimas de la cadena transportadora y el de los protones
por los enzimas ATP-sintetasas, todos ellos englobados en la membrana
tilacoidal. Todo esto produce como resultado ATP.
2. Fase oscura. Se realiza en el estroma y en ella se captan las molculas
de CO2 del aire, que se aaden a los hidrgenos obtenidos en la fase luminosa, y gracias al ATP generado se transforman en materia orgnica.

Existen errores importantes y muy extendidos acerca de la fotosntesis:


La fase luminosa es de da y la oscura de noche
La fase luminosa requiere obligatoriamente la luz del sol, pero la fase oscura se
desarrolla siempre que el cloroplasto cuente con la energa en forma de ATP y los
productos para realizar las reacciones. Esto no quiere decir que se desarrolle de
noche, sino que no requiere la energa luminosa.
Las plantas hacen la fotosntesis y los animales respiran
Las plantas, gracias a la fotosntesis, realizan el proceso anablico de la fotosntesis. Los productos obtenidos son utilizados por la planta para nutrirse y obtener
energa de ellos. Este proceso lo hacen en las mitocondrias de las clulas vegetales, y es idntico a la respiracin mitocondrial de los animales.
Dormir en una habitacin cerrada con plantas no es sano, porque las plantas nos roban el oxgeno
Mientras la planta est recibiendo energa luminosa est realizando la fase luminosa de la fotosntesis, es decir, est realizando entre otros procesos, la fotolisis del agua
y liberando oxgeno como producto residual. Sin embargo, las plantas, como cualquier
otro ser vivo, respiran y lo hacen durante todo el da y la noche. Para ello, consumen
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

207

PRUEBAS DE ACCESO A CFGS

oxgeno de la atmsfera. La enorme importancia de la fotosntesis es que el consumo


de O2 es menor que la produccin, por lo que el resultado global es muy positivo.
Efectivamente, las plantas a lo largo de la noche no producen oxgeno, aunque lo
consumen, pero lo hacen como cualquier otro ser vivo del planeta, por lo que no es ms
peligroso dormir en una habitacin con plantas que con otras personas o animales.

Pregunta
2. Los cidos nucleicos son las molculas que contienen la informacin sobre las caractersticas biolgicas de los seres vivos. Para la transmisin
y manifestacin de esta informacin, son necesarios varios procesos
celulares, en los cuales, a veces, se producen errores.
a) Indica si las siguientes afirmaciones son verdaderas (V) o falsas (F).
Reconstruye correctamente en la casilla inferior las que estn mal formuladas. (1 punto)
VoF
El proceso de transcripcin consiste en copiar una parte del mensaje
gentico desde su forma original (ADN) a otra (ARN) que se pueda utilizar para la sntesis de protenas.

La recombinacin gentica tiene lugar en las primeras etapas de la


meiosis.

Las clulas de cada especie tienen su propio cdigo gentico.

Una caracterstica del cdigo gentico es que existe el mismo nmero de


seales codificadoras en el ARN que aminocidos van a ser codificados.

208

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

b) Una mutacin en el gen que controla el tipo de alas en una raza de


pollos de granja provoca atrofia de las alas. Un pollo con las alas
atrofiadas es hijo de una pareja de animales de alas normales. Responde a las preguntas que se realizan a continuacin:
Cul es el modo de herencia de la mutacin? Justifica tu respuesta. (1 punto)
Cules seran los genotipos para ese carcter del pollo mutante
y de ambos progenitores? Dibuja el esquema correspondiente.
(1,5 puntos)

Solucin
a) Indica si las siguientes afirmaciones son verdaderas (V) o falsas (F).
Reconstruye correctamente en la casilla inferior las que estn mal formuladas. (1 punto)
VoF
El proceso de transcripcin consiste en copiar una parte del mensaje
gentico desde su forma original (ADN) a otra (ARN) que se pueda utilizar para la sntesis de protenas.

La recombinacin gentica tiene lugar en las primeras etapas de la


meiosis.

Las clulas de cada especie tienen su propio cdigo gentico.

Las clulas de cada especie tienen su propio genoma. El cdigo gentico


es universal.
Una caracterstica del cdigo gentico es que existe el mismo nmero de
seales codificadoras en el ARN que aminocidos van a ser codificados.

Una caracterstica del cdigo gentico es que no existe el mismo nmero


de seales codificadoras en el ARN que aminocidos van a ser codificados. Existen 60 combinaciones diferentes y solamente 20 aminocidos.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

209

PRUEBAS DE ACCESO A CFGS

Explicacin
Caractersticas del cdigo gentico
El cdigo gentico est organizado en tripletes o codones, y cada tres nucletidos (triplete) determina un aminocido. En el ADN hay cuatro nucletidos diferentes, luego se pueden formar 64 tripletes diferentes para codificar 20 aminocidos.
El cdigo gentico es degenerado. Al existir ms tripletes que aminocidos,
un aminocido puede estar codificado por ms de un triplete. Esto se debe a que
algunos aminocidos pueden ser transportados por diferentes tipos de ARN transferentes que contienen distintos anticodones.
El cdigo gentico es no solapado o sin superposiciones, esto significa que un
nucletido pertenece a un nico triplete, por lo que se evitan errores en la lectura.
La lectura del cdigo gentico es sin comas. La lectura se hace de tres en
tres bases, a partir de un punto de inicio, y se lleva a cabo sin interrupciones o espacios vacios. Esto supone que la adicin de un solo nucletido altera totalmente
la secuencia de aminocidos a partir de ese punto de lectura.
El cdigo gentico es universal. El mismo triplete, en diferentes especies, codifica
para el mismo aminocido. La nica excepcin es el cdigo gentico mitocondrial.
b) Una mutacin en el gen que controla el tipo de alas en una raza de pollos
de granja provoca atrofia de las alas. Un pollo con las alas atrofiadas es
hijo de una pareja de animales de alas normales. Responde a las preguntas que se realizan a continuacin:

Cul es el modo de herencia de la mutacin? Justifica tu respuesta.


(1 punto)
Se trata de una herencia mendeliana en un gen somtico (no ligado al
sexo), en la que el gen forma de las alas presenta dos alelos. El alelo
alas normales (A) es dominante y el alelo alas atrofiadas (a) es recesivo.
Si los padres son fenotpicamente normales y el hijo presenta el fenotipo alas
atrofiadas, quiere decir que ambos padres son portadores de la mutacin.

Cules seran los genotipos para ese carcter del pollo mutante y de
ambos progenitores? Dibuja el esquema correspondiente. (1,5 puntos).

El genotipo de los padres es Aa y el del hijo que presenta la mutacin en su


fenotipo es aa.
210

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Figura 10. Esquema del cruzamiento

Pregunta
3. El zologo y fisilogo britnico Peter B. Medawar, Premio Nobel de Fisiologa y Medicina de 1960, defini los virus como un fragmento de malas
noticias envuelto en una protena
a) Indica si las siguientes afirmaciones son verdaderas (V) o falsas (F).
Reconstruye correctamente en la casilla inferior, las que estn mal
formuladas. (1 punto)
VoF
Los virus son las formas celulares ms pequeas que existen.

Los virus solo pueden ser parsitos de animales.

Todos los virus contienen ADN

La cpsida de los virus est constituida por ADN.

b) Describe brevemente el ciclo ltico de un virus. (1,5 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

211

PRUEBAS DE ACCESO A CFGS

Solucin
a) Indica si las siguientes afirmaciones son verdaderas (V) o falsas (F).
Reconstruye correctamente en la casilla inferior, las que estn mal formuladas. (1 punto)
VoF
Los virus son las formas celulares ms pequeas que existen

Los virus son las formas acelulares ms pequeas que existen.


Los virus solo pueden ser parsitos de animales.

Los virus pueden parasitar a todos los organismos vivos.


Todos los virus contienen ADN.

Los virus pueden contener ADN o ARN como material gentico.


La cpsida de los virus est constituida por ADN.

La cpsida de los virus est constituida fundamentalmente por protenas.

b) Describe brevemente el ciclo ltico de un virus. (1,5 puntos)


1. Fase de fijacin o absorcin. La cpside viral proteica se une con los receptores especficos de la superficie de la clula husped.
2. Fase de penetracin. El virus penetra en la clula, en este caso, se trata de
endocitosis.
3. Fase de desnudamiento. El cido nucleico del virus se desprende de la cpsula y es liberado dentro de la clula husped.
4. Fase de Transcripcin inversa. En los ARN virus, la transcriptasa inversa
realiza una copia del ARN vrico en ADN.
5. Fase de eclipse. Se produce la biosntesis de ARNm, protenas y cidos
nucleicos. Esto incluye la expresin gnica (transcripcin y traduccin) y la
replicacin del genoma.
6. Fase de ensamblaje. Los capsmeros se renen formando la cpside viral y
el genoma se repliega y penetra en la cpside.
7. Fase de lisis o liberacin. Los virus salen de la clula husped por lisis o por
gemacin.

212

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Pregunta
4. La inmunologa estudia los procesos implicados en el rechazo de los
organismos a las sustancias extraas o potencialmente dainas. Este
rechazo se lleva a cabo gracias a la accin del sistema inmunitario. En
algunas ocasiones se producen inmunodeficiencias, siendo uno de los
casos ms graves el SIDA.
a) Define inmunidad humoral. (0,5 punto)
b) Define antgeno. (0,5 punto)
c) Enumera y describe las vas de contagio del VIH. (1 punto)

Solucin
a) Define inmunidad humoral. (0,5 punto)
Es una respuesta inmune producida por los anticuerpos o inmunoglobulinas
formadas por los linfocitos B.
b) Define antgeno. (0,5 punto)
Se llama antgeno (AG) o inmungenos a las sustancias capaces de inducir una
respuesta inmune, unindose especficamente a una molcula de anticuerpo (Ac).
c) Enumera y describe las vas de contagio del VIH. (1 punto)

Por contagio directo sangre-sangre. Transfusiones, compartir jeringuillas, incluso por el flujo menstrual.
A travs de fluidos y secreciones. Cuando el virus est en concentraciones
suficientemente elevadas aparece en fluidos como el semen o las secreciones vaginales. El contagio a travs de la saliva es prcticamente nulo. Pero
se puede producir contagio durante las relaciones sexuales si el virus entra
en contacto con la circulacin sangunea. Esto se puede producir a travs
de pequeas erosiones o heridas, incluso las que son inapreciables y que
pueden estar en los rganos sexuales, regin anal o boca.
Por transmisin vertical durante el embarazo o gestacin. Durante este perodo, la sangre de la madre infectada puede llegar a contactar con la del
feto y transmitir el virus. La placenta acta como un filtro eficaz y la mayora
de los contagios de este tipo se producen en la fase expulsiva del parto,
que es el momento en que existe un mayor riesgo de contacto de lquidos
corporales, incluida la sangre, entre madre e hijo.
Tambin puede transmitirse a travs de la leche materna.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

213

PRUEBAS DE ACCESO A CFGS

Explicacin
Formas en las que no se transmite el SIDA
El virus no se transmite a travs de la saliva, transpiracin, lgrimas, heces u
orina, ni compartiendo platos, comida, o bandose en el mismo lugar, ni a travs
de picaduras de insectos. Tampoco se transmite a los animales, ni hay riesgo cuando se trata de donar sangre ya que se usan jeringuillas desechables.
Antgenos (Ag)
Como se ha dicho anteriormente, se llama antgeno (AG), o inmungenos, a las
sustancias capaces de inducir una respuesta inmune, unindose especficamente
a una molcula de anticuerpo (Ac).
Prcticamente cualquier molcula biolgica puede unirse a los anticuerpos,
pero no todas pueden provocar su sntesis, es decir, no son inmunognicos.
Los Ag son macromolculas que poseen en su superficie uno o ms fragmentos reconocibles por los Ac. Estas regiones son los epitopes o determinantes antignicos. Pueden ser los Ag mono, di, tri, tetra, o polivalentes. Si estos
estn separados pueden unirse a varios Ac a la vez. Estos epitopes estn en
la superficie de la membrana, luego su configuracin espacial es fundamental
en la reaccin Ag-Ac. Existe una complementariedad entre las regiones del Ag
(epitopes) y la del Ac (paratopes).
La capacidad de provocar una respuesta va a depender de varios factores:

214

La composicin qumica. Las protenas tienen un gran carcter antignico,


sus eptopes estn formados por cuatro o cinco aminocidos. Las glucoprotenas y heterolpidos tambin son antignicos. Los mejores son las molculas grandes, que pueden tener cierta flexibilidad en su estructura y que
no se parecen a las del organismo.

Cantidad de Ag. Aunque las dosis son muy variables, se sabe que la administracin repetida inhibe la respuesta inmune.

Va de entrada en el organismo. La respuesta es mayor si la va de entrada es


intradrmica o subcutnea. Los Ag en este caso quedan localizados, producen
una pequea inflamacin local que atrae a las clulas accesorias que presentan el Ag a los linfocitos T. La presencia de citocinas aumenta la eficacia de los
Ag. Sin embargo, la va intravenosa u oral frena la respuesta inmune.

Tipo de linfocito que acta. Los linfocitos B reconocen Ag nativos, y esto


es importante ya que los Ac se encuentran en el lquido extracelular para
reaccionar con los Ag.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Los linfocitos T, mediante los receptores de los linfocitos T (TCR), solo reconocen a los pptidos lineales que les presentan las clulas presentadoras de Ag
(APC), una vez procesado y digerido el Ag, y asociado a sus antgenos de histocompatibilidad. Los antgenos de histocompatibilidad son una familia de glucoprotenas
de membrana que poseen casi todas las clulas corporales, codificadas por un
grupo de genes llamado complejo mayor de histocompatibilidad (CMH). Su misin
es unirse a los pptidos en el interior celular, migrar a la superficie y presentar los
pptidos a los linfocitos T.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

215

EXAMEN N. 9
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN C: BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

Revisa cuidadosamente la prueba antes de entregarla.

1. Todos los seres vivos, desde los ms sencillos organismos unicelulares


hasta los organismos superiores complejos, estamos constituidos por
los mismos tipos de molculas. Cada uno de estos tipos de molculas
tienen funciones especficas en la clula; unidad funcional y estructural
de los seres vivos. (2,5 puntos).
a) Completa la siguiente tabla sobre las biomolculas y sus funciones,
siguiendo el ejemplo que se proporciona. (0,1 puntos cada tem)

Tipo de biomolcula:
Grupo del que es subunidad:
Principal funcin:

Tipo de biomolcula:

Principal funcin:
.../...
216

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

.../...
Tipo de biomolcula:

Principal funcin:

Tipo de biomolcula:

Grupo del que es subunidad:

b) Completa los nombres que faltan en la representacin del ciclo celular. (0,2 puntos cada concepto)

2. La molcula que contiene la informacin de las caractersticas biolgicas de los seres vivos es el ADN. A continuacin, se representa un fragmento de cadena de ADN simple. Realiza los ejercicios que se proponen
sobre ella. (2,5 puntos)
- A-T-A-C-G-C-G-T-C-G-C-T-G-C-C-G-G-T-A-A-C-C-A-T-T-C-A-A-C-G-T-T-G-.
a) Escribe la secuencia completa de su cadena complementaria (ADN).
(0,5 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

217

PRUEBAS DE ACCESO A CFGS

b) Escribe la cadena resultante del proceso de transcripcin del fragmento enunciado (0,5 puntos). De qu tipo de molcula se trata?
(0,5 puntos)

Tipo de molcula:
c) Usando la tabla que se aporta a continuacin escribe la secuencia resultante de la traduccin del fragmento del apartado B (0,5 puntos).
De qu tipo de molcula se trata? (0,5 puntos)
Segunda base
U

b
a
s
e

Phe
Phe
Leu
Leu

UUU
UUC
UUA
UUG

Ser
Ser
Ser
Ser

UCU
UCC
UCA
UCG

Tyr UAU
Tyr UAC
Stop UAA
Stop UAG

Cys UGU
Cys UGC
Stop UGA
Trp UGG

U
C
A
G

Leu
Leu
Leu
Leu

CUU
CUC
CUA
CUG

Pro
Pro
Pro
Pro

CCU
CCC
CCA
CCG

His
His
Gln
Gln

CAU
CAC
CAA
CAG

Arg
Arg
Arg
Arg

CGU
CGC
CGA
CGG

U
C
A
G

Ile AUU
Ile AUC
Ile AUA
Met AUG

Thr
Thr
Thr
Thr

ACU
ACC
ACA
ACG

Asn
Asn
Lys
Lys

AAU
AAC
AAA
AAG

Ser
Ser
Arg
Arg

AGU
AGC
AGA
AGG

U
C
A
G

Val
Val
Val
Val

Ala
Ala
Ala
Ala

GCU
GCC
GCA
GCG

Asp
Asp
Glu
Glu

GUU
GUC
GUA
GUG

Gly
Gly
Gly
Gly

GGU
GGC
GGA
GGG

U
C
A
G

U
P
r
i
m
e
r
a

GUU
GUC
GUA
GUG

T
e
r
c
e
r
a
b
a
s
e

Las abreviaturas usadas en el cuadro significan lo siguiente: Phe=Fenilalanina,


Leu=Leucina, Ile=Isoleucina, Met=Metionina, Val=Valina, Ser=Serina, Pro=Prolina, Thr
Treonina, Ala= Alanina, Tyr=Tirosina, His=Histidina, Gln= Glutamina, Asn Asparagina,
Lys=Lisina, Asp=cido Aspartico, Glu=cido Glurmico, Cys=Cisteina, Trp=Triptfano,
Arg=Arginina y Gly=Glicina.

SECUENCIA:

218

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

3. Los microorganismos componen un grupo muy heterogneo, algunos poseen una estructura tpicamente procariota, otros tienen una organizacin eucariota y otros una organizacin acelular. (2,5 puntos)
a) En la tabla que aparece a continuacin, responde las cuestiones que
se realizan acerca de los microorganismos que aparecen en las imgenes. (1 punto)

Tipo de microorganismo:
Tipo de organizacin celular:
Alguna enfermedad producida por microorganismos de este grupo:

Tipo de microorganismo:
Subtipo segn su estructura:
Tipo de organizacin celular:
Alguna enfermedad producida por virus:

Tipo de microorganismo:

Tipo de organizacin celular:

Alguna enfermedad producida por microorganismos de este grupo:

b) Define brevemente el ciclo lisognico de los virus atemperados. (1,5 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

219

PRUEBAS DE ACCESO A CFGS

4. La inmunologa estudia los procesos implicados en el rechazo de los


organismos a las sustancias extraas o potencialmente dainas. Este
rechazo se lleva a cabo gracias a la accin del sistema inmunitario. En
algunas ocasiones, se producen inmunodeficiencias; uno de los casos
ms graves lo constituye el SIDA (2,5 puntos).
a) Describe brevemente las barreras externas o defensas pasivas. (1 punto)
........................................................................................................
........................................................................................................
........................................................................................................
........................................................................................................

b) Enumera y distingue los distintos tipos de inmunidad. (1 punto)


........................................................................................................
........................................................................................................
........................................................................................................
........................................................................................................
........................................................................................................

c) Explica brevemente en qu consiste el SIDA. (0,5 puntos)


........................................................................................................
........................................................................................................
........................................................................................................
........................................................................................................
........................................................................................................
........................................................................................................
220

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. Todos los seres vivos, desde los ms sencillos organismos unicelulares
hasta los organismos superiores complejos, estamos constituidos por
los mismos tipos de molculas. Cada uno de estos tipos de molculas
tienen funciones especficas en la clula; unidad funcional y estructural
de los seres vivos. (2,5 puntos).
a) Completa la siguiente tabla sobre las biomolculas y sus funciones,
siguiendo el ejemplo que se proporciona. (0,1 puntos cada tem)
b) Completa los nombres que faltan en la representacin del ciclo celular. (0,2 puntos cada concepto)

Soluciones

a) Completa la siguiente tabla sobre las biomolculas y sus funciones, siguiendo el ejemplo que se proporciona. (0,1 puntos cada tem)

Tipo de biomolcula: monosacrido (D-Dglucopiranosa) (glucosa cclica)


Grupo del que es subunidad: Glcidos
Principal funcin: Tiene funcin de reserva
energtica, es el monosacrido ms abundante en el medio interno y puede atravesar
la membrana plasmtica sin necesidad de
ser transformado en molculas ms pequeas. A partir de un mol de glucosa y despus
de sucesivas reacciones metablicas pueden
obtenerse 266 Kcal.

.../...
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

221

PRUEBAS DE ACCESO A CFGS

.../...
Tipo de biomolcula: Triacilglicrido, (triglicrido). (Lpido simple saponificable u hololpido)
Funcin: Son la principal reserva energtica del
organismo animal (grasas) o en los vegetales (aceites). En los animales se almacenan en los adipositos y su combustin produce 9,4 Kcal/gramo.
Adems son buenos aislantes trmicos, por ejemplo
se acumulan en los tejidos subcutneos de los animales de climas fros, como el oso polar o la ballena.
En otras zonas del organismo como la planta de
los pies, la palma de la mano o rodeando a rganos como el rin, sirven de proteccin mecnica.
Tipo de biomolcula: La lecitina o fosfatidilcolina es un fosfoglicrido (lpido complejo saponificable)
Principal funcin: Es el componente fundamental de la bicapa lipdica de la membrana
plasmtica. Otra funcin es la de contribuir a la
solubilidad de los cidos biliares y participar en
la esterificacin del colesterol (HDL), que acta
tambin como surfactante pulmonar.

Tipo de biomolcula: aminocido


Grupo del que es subunidad: protenas.

Explicacin
Las biomolculas o principios inmediatos son compuestos o grupos de compuestos que se pueden extraer de una muestra biolgica por mtodos exclusivamente fsicos, tales como centrifugacin, dilisis, filtracin, etc.
Se pueden distinguir dos tipos de biomolculas:
a) Inorgnicas: agua y sales minerales.
b) Orgnicas: glcidos, lpidos, protenas y cidos nucleicos.
Cada una de las biomolculas incluyen compuestos que derivan de unidades,
que son monmeros o eslabones estructurales. Estos forman habitualmente polmeros llamados macromolculas.
222

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Todas estas molculas estn compuestas bsicamente por carbono. Luego, la


base qumica de la materia orgnica es la cadena hidrocarbonada, los hidrocarburos:
CH3-CH2-CH2-CH2...
El resto de los compuestos orgnicos pueden considerarse derivados, a efectos
de formulacin y nomenclatura.
Los cambios en la cadena se producen al sustituir los hidrgenos por ramas
hidrocarbonadas o por uno o varios tomos, lo que se denomina grupo funcional.
Los diferentes grupos funcionales determinarn los tipos de compuestos.
GRUPO FUNCIONAL
OH

C=0

O
C

COMPUESTO

HIDROXILO

ALCOHOLES

CARBONILO

ALDEHDOS

O
C

CARBOXILO

CIDOS
ORGNICOS

COOH

AMINO

AMINAS

|
C NH2
|

OH

NH2

|
C OH
|

CARBOXILO + AMINO

AMIDAS

O
C
NH2

C=N

CIANO

CH3

FENILO

NITRILOS

C=N

HIDROCARBUROS Y COMPUESTOS
DIVERSOS

METILO

En el caso de los glcidos, los monosacridos son polialcoholes (C-OH), con


un grupo carbonilo (C=O), que puede estar unido al primer carbono (polihidroxialdehdo) o al segundo carbono (polihidroxicetonas).
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

223

PRUEBAS DE ACCESO A CFGS

POLIALCOHOL
|
HCOH
|
HCOH
|
HCOH
|
HCOH
|

ALDOSA
H

O
?

CETOSA
CH2OH
|

HCOH
|

HC=O
|

HCOH
|

HCOH
|

HCOH
|

HCOH
|

HCOH
|

HCOH
|

En disolucin se puede observar que algunos monosacridos (los de ms de 5 carbonos) adoptan formas cclicas debido a la formacin de un hemiacetal o un hemicetal.
En los hemiacetales esto se produce por la reaccin de un grupo alcohol y un aldehdo. En los hemicetales se produce por la reaccin de un grupo alcohol y grupo cetona.
Las molculas resultantes adquieren una conformacin cclica que se puede
representar segn la llamada proyeccin de Hawort. Los ms caractersticos son
la glucosa y la ribosa.

En cuanto a los lpidos a las largas cadenas hidrocarbonadas se unen grupos


fosfato, aminas, alcoholes, monosacridos, etc.
224

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Hay dos tipos de lpidos:


Saponificables: Compuestos principalmente por steres de cidos grasos y
alcohol. Cuando son tratados con una base (KOH, NAOH) forman jabones en una
reaccin denominada saponificacin. Son las grasas neutras o acilglicridos, las
ceras, los fosfolpidos (fosfoacilglicridos y esfingolpidos) y los glucolpidos (ganglisidos y cerebrsidos).
Insaponificables: Son steres de cidos grasos y no dan reacciones de saponificacin. Son los terpenos y esteroides.
Los cidos grasos son la base constituyente de los lpidos saponificables. Son
cidos orgnicos, normalmente lineales que por lo general presentan un nmero
par de carbonos entre 12 y 24.

Las grasas neutras o acilglicridos son steres de cidos grasos y glicerina,


la mayor parte de las grasas naturales son los triacilglicridos o triglicridos.

Las ceras o cridos son steres de cidos grasos de cadena larga y monoalcoholes de cadena larga que sustituyen a la glicerina de los triglicridos.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

225

PRUEBAS DE ACCESO A CFGS

Los fosfolpidos son un grupo especial de lpidos en los que el radical fosfato
entra a formar parte de su estructura. Los esfingolpidos se componen de un cido
fosfrico, un alcohol y una molcula de cido graso unida mediante enlace amida
a una molcula de esfingosina, que es un amino alcohol de cadena larga. Los
fosfoglicridos son ms abundantes y proceden de la esterificacin de la glicerina,
cidos grasos y cido fosfrico.

Los glucolpidos incluyen azcares en su estructura.


Las protenas por su parte, son polmeros de aminocidos, es decir, los eslabones estructurales de las protenas son los aminocidos (aa). Un aminocido es
una molcula orgnica que contiene una funcin amina (-NH2) y una funcin cido
(-COOH). Existen 20 aminocidos diferentes.

226

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

b) Completa los nombres que faltan en la representacin del ciclo celular.


(0,2 puntos cada concepto)

Pregunta
2. La molcula que contiene la informacin de las caractersticas biolgicas
de los seres vivos es el ADN. A continuacin, se representa un fragmento
de cadena de ADN simple. Realiza los ejercicios que se proponen sobre
ella. (2,5 puntos)
- A-T-A-C-G-C-G-T-C-G-C-T-G-C-C-G-G-T-A-A-C-C-A-T-T-C-A-A-C-G-T-T-G-..
a) Escribe la secuencia completa de su cadena complementaria (ADN). (0,5
puntos)
b) Escribe la cadena resultante del proceso de transcripcin del fragmento
enunciado (0,5 puntos). De qu tipo de molcula se trata? (0,5 puntos)
c) Usando la tabla que se aporta a continuacin escribe la secuencia resultante de la traduccin del fragmento del apartado B (0,5 puntos). De
qu tipo de molcula se trata? (0,5 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

227

PRUEBAS DE ACCESO A CFGS

Segunda base
U

b
a
s
e

Phe
Phe
Leu
Leu

UUU
UUC
UUA
UUG

Ser
Ser
Ser
Ser

UCU
UCC
UCA
UCG

Tyr UAU
Tyr UAC
Stop UAA
Stop UAG

Cys UGU
Cys UGC
Stop UGA
Trp UGG

U
C
A
G

Leu
Leu
Leu
Leu

CUU
CUC
CUA
CUG

Pro
Pro
Pro
Pro

CCU
CCC
CCA
CCG

His
His
Gln
Gln

CAU
CAC
CAA
CAG

Arg
Arg
Arg
Arg

CGU
CGC
CGA
CGG

U
C
A
G

Ile AUU
Ile AUC
Ile AUA
Met AUG

Thr
Thr
Thr
Thr

ACU
ACC
ACA
ACG

Asn
Asn
Lys
Lys

AAU
AAC
AAA
AAG

Ser
Ser
Arg
Arg

AGU
AGC
AGA
AGG

U
C
A
G

Val
Val
Val
Val

Ala
Ala
Ala
Ala

GCU
GCC
GCA
GCG

Asp
Asp
Glu
Glu

GUU
GUC
GUA
GUG

Gly
Gly
Gly
Gly

GGU
GGC
GGA
GGG

U
C
A
G

U
P
r
i
m
e
r
a

GUU
GUC
GUA
GUG

T
e
r
c
e
r
a
b
a
s
e

Las abreviaturas usadas en el cuadro significan lo siguiente: Phe=Fenilalanina,


Leu=Leucina, Ile=Isoleucina, Met=Metionina, Val=Valina, Ser=Serina, Pro=Prolina, Thr
Treonina, Ala= Alanina, Tyr=Tirosina, His=Histidina, Gln= Glutamina, Asn Asparagina,
Lys=Lisina, Asp=cido Aspartico, Glu=cido Glurmico, Cys=Cisteina, Trp=Triptfano,
Arg=Arginina y Gly=Glicina.

Solucin
a) Escribe la secuencia completa de su cadena complementaria (ADN). (0,5
puntos)
T-A-T-G-C-G-C-A-G-C-G-A-C-G-G-C-C-A-T-T-G-G-T-A-A-G-T-T-G-C-A-A-C

Explicacin
Las cadenas que forman la doble hlice de ADN son antiparalelas y complementarias. Las molculas de Adenina establecen dos puentes de hidrgeno con
las molculas de Timina, y las molculas de Citosina establecen tres puentes de
Hidrgeno con las molculas de Guanina. Luego la cadena complementaria se
obtiene sustituyendo la Adenina por Timina, la Timina por Adenina, la Guanina por
Citocina y la Citosina por Guanina.
228

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

b) Escribe la cadena resultante del proceso de transcripcin del fragmento


enunciado (0,5 puntos). De qu tipo de molcula se trata? (0,5 puntos)
U-A-U-G-C-G-C-A-G-C-G-A-C-G-G-C-C-A-U-U-G-G-U-A-A-G-U-U-G-C-A-A-C
Tipo de molcula: ARNm

Explicacin
La transcripcin es el paso de una secuencia de ADN a una secuencia de ARN.
La secuencia de ARN transcrita sigue el mismo principio de complementariedad de
las bases que existe en el ADN, salvo que para la Adenina la base complementaria
es el Uracilo en lugar de la timina.
c) Usando la tabla que se aporta a continuacin escribe la secuencia resultante de la traduccin del fragmento del apartado B (0,5 puntos). De
qu tipo de molcula se trata? (0,5 puntos)
Segunda base
U

b
a
s
e

Phe
Phe
Leu
Leu

UUU
UUC
UUA
UUG

Ser
Ser
Ser
Ser

UCU
UCC
UCA
UCG

Tyr UAU
Tyr UAC
Stop UAA
Stop UAG

Cys UGU
Cys UGC
Stop UGA
Trp UGG

U
C
A
G

Leu
Leu
Leu
Leu

CUU
CUC
CUA
CUG

Pro
Pro
Pro
Pro

CCU
CCC
CCA
CCG

His
His
Gln
Gln

CAU
CAC
CAA
CAG

Arg
Arg
Arg
Arg

CGU
CGC
CGA
CGG

U
C
A
G

Ile AUU
Ile AUC
Ile AUA
Met AUG

Thr
Thr
Thr
Thr

ACU
ACC
ACA
ACG

Asn
Asn
Lys
Lys

AAU
AAC
AAA
AAG

Ser
Ser
Arg
Arg

AGU
AGC
AGA
AGG

U
C
A
G

Val
Val
Val
Val

Ala
Ala
Ala
Ala

GCU
GCC
GCA
GCG

Asp
Asp
Glu
Glu

GUU
GUC
GUA
GUG

Gly
Gly
Gly
Gly

GGU
GGC
GGA
GGG

U
C
A
G

U
P
r
i
m
e
r
a

GUU
GUC
GUA
GUG

T
e
r
c
e
r
a
b
a
s
e

Las abreviaturas usadas en el cuadro significan lo siguiente: Phe=Fenilalanina,


Leu=Leucina, Ile=Isoleucina, Met=Metionina, Val=Valina, Ser=Serina, Pro=Prolina, Thr
Treonina, Ala= Alanina, Tyr=Tirosina, His=Histidina, Gln= Glutamina, Asn Asparagina,
Lys=Lisina, Asp=cido Aspartico, Glu=cido Glurmico, Cys=Cisteina, Trp=Triptfano,
Arg=Arginina y Gly=Glicina.

Tyr-Ala-Gln-Arg-Arg-Pro-Leu-Val-Ser-Cys-Asn
Tipo de molcula: protena.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

229

PRUEBAS DE ACCESO A CFGS

Explicacin
La traduccin es la sntesis de la secuencia de aminocidos de una protena
siguiendo el mensaje contenido en el ARNm. La correspondencia entre los tripletes
de nucletidos del ARNm y los aminocidos que forman las protenas reciben el
nombre de cdigo gentico. Se trata de un cdigo universal, es decir, la correspondencia es la misma en todos los seres vivos.

Pregunta
3. Los microorganismos componen un grupo muy heterogneo, algunos poseen una estructura tpicamente procariota, otros tienen una organizacin eucariota y otros una organizacin acelular. (2,5 puntos)
a) En la tabla que aparece a continuacin, responde las cuestiones que
se realizan acerca de los microorganismos que aparecen en las imgenes. (1 punto)
b) Define brevemente el ciclo lisognico de los virus atemperados. (1,5 puntos)

Soluciones
a) En la tabla que aparece a continuacin, responde las cuestiones que se realizan acerca de los microorganismos que aparecen en las imgenes. (1 punto)
Tipo de microorganismo: bacteria
Tipo de organizacin celular: procariota.
Alguna enfermedad producida por microorganismos de este grupo son muy numerosas; algunas
de ellas son: botulismo, clera, difteria, faringitis,
gangrena gaseosa, gastroenteritis, lepra, gonorrea,
meningitis, peste, neumona, sfilis, ttanos, tifus,
tos ferina, tuberculosis...
Tipo de microorganismo: virus
Subtipo segn su estructura: virus de cpsida helicoidal
Tipo de organizacin celular: los virus no tienen
organizacin celular.
Alguna enfermedad producida por virus: son
muy numerosas, por ejemplo, fiebre amarilla, gripe,
hepatitis vrica, herpes genital, paperas, poliomielitis, rabia, sarampin, SIDA, varicela, viruela...

.../...
230

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

.../...

Tipo de microorganismo: protozoo.


Tipo de organizacin celular: eucariota.
Alguna enfermedad producida por microorganismos de este grupo: disentera amebiana, enfermedad de Chagas, enfermedad del sueo, Malaria,
Kala-azar.

Explicacin
Los microorganismos o microbios son seres de tamao microscpico por lo que
para ser observados es necesario el microscopio. Este trmino es muy impreciso,
ya que incluye organismos unicelulares y pluricelulares. Adems estos organismos
pueden ser auttrofos y hetertrofos. Muchos de ellos carecen de ncleo definido,
por lo que se trata de clulas procariotas, otros tienen ncleos y orgnulos citoplasmticos, es decir, son eucariotas.
Los virus son partculas microscpicas, pero no se consideran seres vivos por lo
que su clasificacin como microorganismos o microbios es incorrecta. Se trata de
partculas constituidas por cido nucleico (genoma vrico) que puede ser ADN o ARN,
envueltas por una cpsula proteica y en ocasiones por una envoltura membranosa.
Cuando los virus se encuentran fuera de la clula (fase extracelular), se suelen
denominar viriones. Son totalmente inertes, ya que no pueden desarrollar su metabolismo al carecer de enzimas.
Los virus son capaces de adherirse a la superficie de otras clulas, introduciendo en ellas su genoma viral. En ellas se reproducen y son capaces de sintetizar
las envolturas de nuevos virus, utilizando para ello la materia, energa y el sistema
enzimtico de la clula (fase intracelular). Por ello los virus son parsitos obligados.
Se considera a los virus como pequeas estructuras encargadas de transportar
cidos nucleicos desde una clula husped a otra. El tamao de los virus es aproximadamente unas 10 veces menor que una clula procariota y unas 100 veces
menor que una clula eucariota.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

231

PRUEBAS DE ACCESO A CFGS

Segn cul sea el husped, los virus se clasifican en virus bacterianos o bacterifagos, virus vegetales y virus animales. Otro criterio de clasificacin es en funcin
de su material gentico, ya que algunos contienen ADN y otros ARN. Tambin pueden clasificarse por la forma de su cpsula proteica, por la presencia de envoltura
o por la presencia de enzimas especficas como la transcriptasa inversa.
b) Define brevemente el ciclo lisognico de los virus atemperados. (1,5 puntos)
Los virus atemperados, atenuados o profagos, son aquellos que al infectar a
una clula husped no la destruyen, pero su genoma pasa a incorporarse al ADN
de la clula husped, permaneciendo en estado de vida latente. La clula receptora se llama clula lisognica.
El ADN del profago o virus atemperado puede permanecer latente durante varias generaciones de la clula husped, hasta que un estmulo induzca la separacin del virus y se inicie un ciclo ltico tpico. Mientras la clula posea el ADN
del profago, ser inmune a las infecciones de este mismo virus. Esta inmunidad
se heredar de generacin en generacin en la clula lisognica, ya que el virus
atemperado, atenuado o profago se hereda junto con el ADN celular.

Pregunta
4. La inmunologa estudia los procesos implicados en el rechazo de los
organismos a las sustancias extraas o potencialmente dainas. Este
rechazo se lleva a cabo gracias a la accin del sistema inmunitario. En
algunas ocasiones, se producen inmunodeficiencias; uno de los casos
ms graves lo constituye el SIDA (2,5 puntos).
a) Describe brevemente las barreras externas o defensas pasivas. (1 punto)
b) Enumera y distingue los distintos tipos de inmunidad. (1 punto)
c) Explica brevemente en qu consiste el SIDA. (0,5 puntos)

Solucin
a) Describe brevemente las barreras externas o defensas pasivas. (1 punto)
Las barreras externas pueden ser mecnicas, qumicas o biolgicas.
Entre las barreras mecnicas ms importantes se encuentran la piel, el pelo de
la nariz o de los conductos auditivos, el mucus que recubre las vas respiratorias, digestivas o urogenitales y los cilios que presentan las clulas de las vas respiratorias.
232

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: BIOLOGA

Entre las defensas qumicas podemos destacar el sudor y las glndulas sebceas (que dan un carcter cido a la piel, perjudicial para los microorganismos), la
lisozima presente en la saliva, las secreciones cidas del estmago, las secreciones cidas del epitelio vaginal o la espermina del esperma.
Por su parte la defensa biolgica la llevan a cabo por ejemplo las bacterias que
forman parte de la flora intestinal, vaginal o de la piel, ya que compiten con los microorganismos patgenos por el espacio y los nutrientes dificultando su reproduccin.
b) Enumera y distingue los distintos tipos de inmunidad. (1 punto)
Bsicamente podemos diferenciar entre:
Inmunidad natural e inmunidad artificial. La inmunidad natural puede ser activa
o pasiva. La inmunidad artificial ser diferencia entre vacunacin y sueroterapia.
La inmunidad natural activa. Cuando un organismo se ve sometido a una
infeccin microbiana, su sistema inmunolgico empieza a actuar produciendo anticuerpos especficos contra esos microbios. Si se consigue vencer la infeccin los
anticuerpos permanecen un tiempo en el organismo, periodo durante el cual el
organismo se encuentra inmunizado contra ese microbio.
Inmunidad natural pasiva. Los mamferos pueden adquirir esta inmunidad mientras
se encuentran en el tero materno, ya que recibimos constantemente anticuerpos procedentes de la sangre materna a travs de la placenta. De esta forma los mamferos consiguen inmunidad hasta que sus mecanismos inmunolgicos se desarrollan totalmente.
Inmunidad artificial activa, vacunacin. Es un mtodo preventivo de inmunidad activa. Consiste en inyectar a un organismo microorganismos muertos o
atenuados de la enfermedad contra la que se le quiere prevenir, de manera que el
organismo produzca anticuerpos especficos.
Inmunidad artificial pasiva, sueroterapia. Consiste en suministrar al organismo
que est infectado anticuerpos especficos producidos externamente. Estos anticuerpos suelen producirse por tcnicas de clonacin a partir de linfocitos (anticuerpos
monoclonales) o a partir de suero de caballo, previamente vacunado con el antgeno.
c) Explica brevemente en qu consiste el SIDA. (0,5 puntos)
El Sida o Sndrome de inmunodeficiencia adquirida es una grave enfermedad
producida por un virus el VIH que ataca a las clulas de sistema inmunolgico reduciendo su capacidad y provocando su destruccin.
En la actualidad, se conocen dos cepas del virus VIH:
1. Retrovirus VIH-1, es el ms comn y es el que produce efectos ms graves.
2. Retrovirus VIH-2, que se encuentra en poblaciones de frica occidental. Es menos virulento y se diferencia de la otra cepa en algunas protenas de la envoltura.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

233

PRUEBAS DE ACCESO A CFGS

El virus del Sida ataca a los linfocitos que intervienen en la inmunidad celular,
por lo que la persona infectada queda prcticamente indefensa ante las infecciones microbianas y aumenta su propensin a padecer cncer.
La enfermedad puede contagiarse de diversas maneras:
1. Por contagio directo sangre-sangre. Transfusiones, compartir jeringuillas, incluso por el flujo menstrual.
2. A travs de fluidos y secreciones. Cuando el virus est en concentraciones
suficientemente elevadas aparece en fluidos como el semen o las secreciones vaginales. El contagio a travs de la saliva es prcticamente nulo.
Pero se puede contagiar durante las relaciones sexuales si el virus entra
en contacto con la circulacin sangunea. Esto se puede producir a travs
de pequeas erosiones o heridas, incluso las que son inapreciables y que
pueden estar en los rganos sexuales, regin anal o boca.
3. Por transmisin vertical durante el embarazo o gestacin. Durante este perodo, la sangre de la madre infectada puede llegar a contactar con la del
feto y transmitir el virus. Aunque la placenta acta como un filtro eficaz, la
mayora de los contagios de este tipo se producen en la fase expulsiva del
parto, que es el momento en que existe un mayor riesgo de contacto de
lquidos corporales, incluida la sangre, entre madre e hijo.
4. Tambin puede transmitirse a travs de la leche materna.

234

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

mbito de
Fsica

EXAMEN N. 1
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN B Y C: FSICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente los enunciados antes de contestar a las cuestiones y de


resolver los problemas.
La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.
Podrn utilizarse calculadoras no programables. No se podr utilizar ningn
otro instrumento electrnico.
Es muy importante que expreses los resultados de los problemas en las
unidades correspondientes.

1. Un automvil toma una curva de 100 m de radio con una rapidez constante de 36 km/h. Marca con X en la casilla correspondiente si consideras cada una de las siguientes afirmaciones verdadera (V) o falsa (F), y
escribe la frase correcta en las que consideres falsas: (2,5 puntos)
a) El coche no tiene aceleracin porque su velocidad es constante.
b) El coche tiene aceleracin normal y no tiene aceleracin tangencial.
c) El coche tiene aceleracin tangencial al variar el mdulo de la velocidad.
d) La aceleracin del coche vale 1 m/s2.
d) El movimiento del coche mientras describe la curva es circular y uniforme.
V

RESPUESTA CORRECTA

A
B
C
D
E

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

237

PRUEBAS DE ACCESO A CFGS

2. Marca con X en la casilla correspondiente si consideras cada una de las


siguientes frases verdadera (V) o falsa (F): 2,5 puntos)
V

En una onda longitudinal la direccin de vibracin de las partculas es


perpendicular a su direccin de propagacin.
El sonido es una onda transversal.
En una onda transversal la longitud de onda representa la distancia que
hay entre dos crestas o dos valles consecutivos.
La unidad de longitud de onda es el Hz.
La velocidad de propagacin de una onda en un medio determinado vara si aumenta la frecuencia.

3. Un nio hace girar en un plano vertical una piedra de 100 g atada a una
cuerda de 1 m de longitud y masa despreciable, de modo que la piedra
da 120 vueltas por minuto. Cul es la tensin de la cuerda cuando la
piedra pasa por el punto ms alto? Realiza los clculos correspondientes
y escribe el resultado obtenido. (2,5 puntos)

4. Determina el peso de una persona de 70 kg:


a) En la superficie de la Tierra. (1,25 puntos)
b) En la superficie de la Luna. (1,25 puntos)
Realiza los clculos correspondientes y escribe el resultado obtenido.
Datos: G = 6,67 1011 Nm2/kg2; masa de la Tierra = 6 1024 kg; masa de
la Luna = 7,4 1022 kg; radio medio de la Tierra = 6400 km; radio medio de la
Luna = 1740 km.

238

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. Un automvil toma una curva de 100 m de radio con una rapidez constante de 36 km/h. Marca con X en la casilla correspondiente si consideras cada una de las siguientes afirmaciones verdadera (V) o falsa (F), y
escribe la frase correcta en las que consideres falsas: (2,5 puntos)
a) El coche no tiene aceleracin porque su velocidad es constante.
b) El coche tiene aceleracin normal y no tiene aceleracin tangencial.
c) El coche tiene aceleracin tangencial al variar el mdulo de la velocidad.
d) La aceleracin del coche vale 1 m/s2.
e) El movimiento del coche mientras describe la curva es circular y uniforme.
V

RESPUESTA CORRECTA

a
b
c
d
e

Solucin
V
a
b

RESPUESTA CORRECTA

El coche tiene aceleracin centrpeta

El coche no vara el mdulo de la velocidad y, por tanto, no tiene


aceleracin tangencial

c
d

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

239

PRUEBAS DE ACCESO A CFGS

Explicacin
La aceleracin del coche vale 1 m/s2.
3
v = 36 km 10 m 1 h = 10 m
h 1 km 3600 s
s
2
2
100 m2
10 m
2
s
v
s =1 m
an = =
=
r
100m
100m
s2

Pregunta
2. Marca con X en la casilla correspondiente si consideras cada una de las
siguientes frases verdadera (V) o falsa (F): (2,5 puntos)
V

En una onda longitudinal la direccin de vibracin de las partculas es


perpendicular a su direccin de propagacin.
El sonido es una onda transversal.
En una onda transversal la longitud de onda representa la distancia que
hay entre dos crestas o dos valles consecutivos.
La unidad de longitud de onda es el Hz.
La velocidad de propagacin de una onda en un medio determinado vara si aumenta la frecuencia.

Solucin

En una onda longitudinal la direccin de vibracin de las partculas es


perpendicular a su direccin de propagacin.

El sonido es una onda transversal.

En una onda transversal la longitud de onda representa la distancia que


hay entre dos crestas o dos valles consecutivos.

La unidad de longitud de onda es el Hz.


La velocidad de propagacin de una onda en un medio determinado vara si aumenta la frecuencia.
240

X
X

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Explicacin

En una onda longitudinal la direccin de vibracin de las partculas es paralela a su direccin de propagacin.

El sonido es una onda longitudinal.

La unidad de longitud de onda es el metro, m.

La afirmacin dice: La velocidad de propagacin de una onda en un medio


determinado vara si aumenta la frecuencia. Por tanto, esta afirmacin no
es del todo correcta, ya que la velocidad de propagacin de una onda se
relaciona con la frecuencia con la siguiente frmula:
O=v
f

Por tanto, si la longitud de onda en ese medio es constante y si aumenta la frecuencia, se puede decir que la velocidad de propagacin disminuye, es decir, vara
la velocidad de propagacin. Luego, se interpreta esta afirmacin como correcta
atendiendo a este razonamiento explicado.

Pregunta
3. Un nio hace girar en un plano vertical una piedra de 100 g atada a una
cuerda de 1 m de longitud y masa despreciable, de modo que la piedra
da 120 vueltas por minuto. Cul es la tensin de la cuerda cuando la
piedra pasa por el punto ms alto? Realiza los clculos correspondientes
y escribe el resultado obtenido. (2,5 puntos)

Solucin
El diagrama de fuerzas verticales de la piedra en el punto ms alto es el siguiente:

Figura 1. Diagrama de fuerzas de la piedra


EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

241

PRUEBAS DE ACCESO A CFGS

Donde:
uur
FC ; Es la fuerza centrfuga de la piedra.
ur
P ; Es el peso de la piedra.
r
T ; Es la tensin de la cuerda.
La velocidad de la piedra es:
v = Y r = 120 vueltas 1m = 120 vueltas 2S rad 1 min 1m = 12,57 m
min
min 1vuelta 60 s
s
Aplicando las ecuaciones de equilibrio en la vertical o eje y, se tiene:
uur
Fy =0
Se trabajar escalarmente por estar en la misma direccin.
FC - P - T = 0;

2
2
T = FC - P = mv - mg = m v - g ;
r
r
2

12,572 m2

1 kg
s - 9,81 m = 14,82N

T = 100 g

1000 g
1m
s2

Pregunta
4. Determina el peso de una persona de 70 kg:
a) En la superficie de la Tierra. (1,25 puntos)
b) En la superficie de la Luna. (1,25 puntos)
Realiza los clculos correspondientes y escribe el resultado obtenido.
Datos: G = 6,6710-11 Nm2/kg2; masa de la Tierra = 61024 kg; masa de la
Luna = 7,41022 kg; radio medio de la Tierra = 6400 km; radio medio de la
Luna = 1740 km.

242

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Solucin
a) En la superficie de la Tierra. (1,25 puntos)
La fuerza que ejerce la tierra sobre la persona ser, escalarmente:
PT =FT =G

MT m
RT2

G = 6,67 10-11 N m
; Constante de gravitacin universal.
kg 2
MT = 6 1024 kg ; Masa de la Tierra.
m = 70 kg ; Masa de la persona.
RT = 6400 km; Radio medio de la Tierra.
PT = FT = G

2
2
MT m
6 1024 kg 70kg
= 6,67 10-11 N m

1 km2 2 = 683,93N
2
2
2
2
RT
kg
6400 km
1000 m

b) En la superficie de la Luna. (1,25 puntos)


La fuerza que ejerce la luna sobre la persona ser, escalarmente:
PL = FL = G

ML m
RL2

G = 6,67 10-11 N m
; Constante de gravitacin universal.
kg 2
ML = 7,4 1022 kg ; Masa de la Luna.
m = 70 kg; Masa de la persona.
RL = 1740 km; Radio medio de la Luna.
PL=FL=G
= 6,6710-11

ML m
=
RL2

Nm2 7,41022 kg 70 kg 1 km2

=114,12N
kg 2
17402 km2
10002 m2

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

243

EXAMEN N. 2
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN B: TECNOLOGA INDUSTRIAL
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente los enunciados antes de contestar a las cuestiones y de


resolver los problemas.
La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.
Podrn utilizarse calculadoras no programables. No se podr utilizar ningn
otro instrumento electrnico.
Es muy importante que expreses los resultados de los problemas en las
unidades correspondientes.

1. Marca con X en la casilla correspondiente si consideras cada una de las


siguientes frases verdadera (V) o falsa (F), y escribe la frase correcta en
las que consideres falsas: (2,5 puntos)
a) En la reflexin, el ngulo de incidencia es menor que el ngulo reflejado.
b) Segn el principio de Huygens, todo punto alcanzado por el frente de
onda se convierte en foco emisor de nuevas ondas elementales.
c) Una onda estacionaria resulta de la interferencia de dos ondas distintas que se propagan en la misma direccin pero en sentido contrario.
d) La velocidad de propagacin de una onda electromagntica vara si
se duplica la frecuencia.
E) Slo se pueden polarizar las ondas transversales, las longitudinales no.
V

RESPUESTA CORRECTA

a
b
c
d
e
244

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

2. Se dejan caer desde la misma altura y al mismo tiempo dos bolas de


distinta masa, siendo igual para ambas la fuerza de rozamiento. De las
siguientes frases, indica las que consideres que son verdaderas encerrando en un crculo la letra correspondiente: (2,5 puntos)
a) Cae ms rpido la bola de menor masa.
b) Ambas llegan al suelo con la misma velocidad, pero la de mayor
masa tarda menos.
c) Las dos tardarn el mismo tiempo en llegar al suelo.
d) La bola de mayor masa cae con una aceleracin mayor que la de
menor masa.
e) Cae ms rpido la bola de mayor masa y llega antes al suelo.

3. Un insecto se mueve sobre el cristal de una ventana siguiendo una trayectoria definida por las siguientes ecuaciones: x = t2; y = t + 2, en
unidades SI.
a) Calcula el desplazamiento realizado en el intervalo de tiempo comprendido entre t = 1 s y t = 3 s. (1,25 puntos)
b) Calcula la velocidad media con que se ha desplazado el insecto durante ese intervalo de tiempo. (1,25 puntos)
Realiza los clculos correspondientes y escribe el resultado obtenido.
Resultado:

a)

b)

4. Se lanza verticalmente y hacia abajo desde un globo aerosttico suspendido en el aire una bola con una velocidad de 10 m/s. Si llega al suelo
con una velocidad de 150 km/h, calcula la altura a la que estaba situado
el globo. Realiza los clculos correspondientes y escribe el resultado
obtenido. (2,5 puntos)
Dato: g = 9,8 m/s2.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

245

SOLUCIONES

Pregunta
1. Marca con X en la casilla correspondiente si consideras cada una de las
siguientes frases verdadera (V) o falsa (F), y escribe la frase correcta en
las que consideres falsas: (2,5 puntos)
a) En la reflexin, el ngulo de incidencia es menor que el ngulo reflejado.
b) Segn el principio de Huygens, todo punto alcanzado por el frente de
onda se convierte en foco emisor de nuevas ondas elementales.
c) Una onda estacionaria resulta de la interferencia de dos ondas distintas que se propagan en la misma direccin pero en sentido contrario.
d) La velocidad de propagacin de una onda electromagntica vara si
se duplica la frecuencia.
e) Slo se pueden polarizar las ondas transversales, las longitudinales no.
V

RESPUESTA CORRECTA

a
b
c
d
e

Solucin
V
a
b
c

RESPUESTA CORRECTA

El ngulo formado entre el rayo incidente y la recta normal es igual


al ngulo que existe entre el rayo reflejado y la recta normal.

Una onda estacionaria se forma por la interferencia de dos ondas


de la misma naturaleza con igual amplitud, longitud de onda (o frecuencia) que avanzan en sentido opuesto a travs de un medio.

.../...
246

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

.../...
d
e

La velocidad de propagacin de las ondas electromagnticas en


el vaco es constante e igual a la velocidad de la luz, es decir,
c = O f . Luego, si se duplica la frecuencia, se tendr que reducir
a la mitad la longitud de onda.

Pregunta
2. Se dejan caer desde la misma altura y al mismo tiempo dos bolas de
distinta masa, siendo igual para ambas la fuerza de rozamiento. De las
siguientes frases, indica las que consideres que son verdaderas encerrando en un crculo la letra correspondiente: (2,5 puntos)
a) Cae ms rpido la bola de menor masa.
b) Ambas llegan al suelo con la misma velocidad, pero la de mayor
masa tarda menos.
c) Las dos tardarn el mismo tiempo en llegar al suelo.
d) La bola de mayor masa cae con una aceleracin mayor que la de
menor masa.
e) Cae ms rpido la bola de mayor masa y llega antes al suelo.

Explicacin
Cuando se dejan caer al suelo dos cuerpos de caractersticas idnticas excepto en
la masa, la Fsica dice que caen a la vez; as lo indican las ecuaciones del Movimiento
Rectilneo Uniformemente Acelerado, que es el que tiene un cuerpo en cada libre, en
las que no influye la masa. Aun as, cuando existe rozamiento, no sucede esto.
En el enunciado se tiene en cuenta que para hacer el experimento se fijan las
dems variables, buscando dos cuerpos que tengan el mismo volumen, forma y
textura, cambiando nicamente la masa. Es decir, se utilizan dos bolas que tienen
el mismo volumen y son idnticas, y se aumenta la masa de una de ellas. La primera bola no se modifica y en la segunda bola se rellena de algn material.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

247

PRUEBAS DE ACCESO A CFGS

El experimento consistir en dejar caer las pelotas simultneamente desde un


lugar alto y observar cul llega antes al suelo. En la realidad, se puede observar
que la bola ms pesada cae antes que la ms ligera. Eso es debido al aire, dado
que el aire ejerce un empuje sobre las pelotas y las frena, es decir, la fuerza de
rozamiento.
Las bolas estn sometidas a la accin de su peso y de una fuerza de rozamiento
proporcional al cuadrado de la velocidad, es decir, Fr = kv 2 .

Figura 2. Diagrama de fuerzas en la cada de las bolas

La constante de rozamiento K es la misma para ambas, ya que el rozamiento


que puedan experimentar debido a la forma de las pelotas es la misma. Ambas son
idnticas excepto en la masa.
La explicacin a esto la da el Principio de Arqumedes. El aire de la atmsfera es
un fluido, y las pelotas estn sumergidas en l. El Principio de Arqumedes dice que
todo cuerpo sumergido en un fluido experimenta un empuje vertical y ascendente
igual al peso del volumen de fluido desplazado por dicho cuerpo. Ambas pelotas
tienen el mismo volumen, por lo que desplazarn el mismo aire y experimentarn
el mismo empuje, pero al ser una ms pesada que la otra, la misma fuerza de
empuje no la consigue frenar tanto. Por eso, la bola ligera se va frenando mientras
la pesada cae antes.
Es el mismo principio por el que unos cuerpos flotan en el agua (y los dems
fluidos) y otros no, dependiendo de si el empuje hidrosttico que experimentan es
suficiente o no para mantenerlos a flote, lo que depende de su densidad (debe
pesar ms el volumen de fluido que desplazan que lo que pesa su propio volumen).
Por tanto, al final se deduce que la bola pesada cae primero por ser ms densa
(tener el mismo volumen pero mucha ms masa que la pelota sin alterar) y flotar
menos en el aire.
Sin embargo, si el aire es lo que hace que la pelota pesada caiga antes, se
puede pensar que en el vaco, sin la influencia del aire, todos los cuerpos caern a
la vez tal como predice la teora, que dice que la masa no influye.
248

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Solucin
En este caso, ambas fuerzas de rozamiento son iguales para cada bola. Luego, como independientemente de la masa, las dos tienen la misma fuerza de
rozamiento, no se puede aplicar el Principio de Arqumedes y se puede simular el
problema a una cada libre en el vaco, es decir, sin rozamiento.

a) Cae ms rpido la bola de menor masa. FALSO


Las dos bolas caen con la misma velocidad, ya que la fuerza de rozamiento es
la misma para las dos bolas.

b) Ambas llegan al suelo con la misma velocidad, pero la de mayor masa


tarda menos. FALSO
Las dos bolas caen con la misma velocidad y, por tanto, las dos tardan el mismo tiempo hasta llegar al suelo. Luego, se contradice este enunciado.

c) Las dos tardarn el mismo tiempo en llegar al suelo. VERDADERO


Las dos bolas caen con la misma velocidad y, por tanto, las dos tardan el mismo tiempo hasta llegar al suelo.

d) La bola de mayor masa cae con una aceleracin mayor que la de menor
masa. FALSO
Como la fuerza de rozamiento es la misma para ambas bolas y, debido a
esto, se ha simulado el problema como cada libre sin rozamiento, se puede
decir que la aceleracin con la que caen los cuerpos es independiente de su
peso, por lo que todos los cuerpos caen al mismo tiempo si son soltados desde
una misma altura.

e) Cae ms rpido la bola de mayor masa y llega antes al suelo. FALSO


Las dos bolas caen con la misma velocidad y, por tanto, las dos tardan el mismo tiempo hasta llegar al suelo.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

249

PRUEBAS DE ACCESO A CFGS

Pregunta
3. Un insecto se mueve sobre el cristal de una ventana siguiendo una trayectoria definida por las siguientes ecuaciones: x = t2; y = t + 2, en
unidades SI.
a) Calcula el desplazamiento realizado en el intervalo de tiempo comprendido entre t = 1 s y t = 3 s. (1,25 puntos)
b) Calcula la velocidad media con que se ha desplazado el insecto durante ese intervalo de tiempo. (1,25 puntos)
Realiza los clculos correspondientes y escribe el resultado obtenido.

Solucin
a) Calcula el desplazamiento realizado en el intervalo de tiempo comprendido entre t = 1 s y t = 3 s. (1,25 puntos)

x = t2 ;
y = t + 2;
t1 = 1 s;
t2 = 3 s;
Los vectores de posicin sern:
ur
r1 = (1,3)m
ur
r2 = (9,5)m
El vector desplazamiento ser:
ur ur ur
' r = r2 - r1 = (9,5) - (1,3) = (8,2)m

250

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

En mdulo quedara:
ur
d = ' r = rx2 + ry2 = 64 + 4 = 8,25m

b) Calcula la velocidad media con que se ha desplazado el insecto durante


ese intervalo de tiempo. (1,25 puntos)
La velocidad media ser:
ur ur ur
'r
r -r
(8,2) (8,2)
vm =
= 2 1 =
=
= (4,1) m
't
3-1
2
t2 - t1
s
En mdulo quedara:
uur
2
= 16+1 = 4,12 m
v m = v m = v m2x + v my
s

Pregunta
4. Se lanza verticalmente y hacia abajo desde un globo aerosttico suspendido en el aire una bola con una velocidad de 10 m/s. Si llega al suelo
con una velocidad de 150 km/h, calcula la altura a la que estaba situado
el globo. Realiza los clculos correspondientes y escribe el resultado
obtenido. (2,5 puntos)
Dato: g = 9,8 m/s2.

Solucin
v 0 =10 m ;
s
v f =150 km 1000 m 1 h =41,67 m ;
1 km
3600 s
h
s

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

251

PRUEBAS DE ACCESO A CFGS

Se aplica la ley de conservacin de energa mecnica en el punto inicial y el


punto final, es decir:
E m0 = E mf ;
E c0 + E p0 = E cf + E pf ;
1 m v2 + m g h = 1 m v2 + m g h ;
0
f
0
f
2
2
En el suelo, la energa potencial es nula ya que no hay altura. Por tanto:
1 m v 2 + m g h = 1 m v 2 + 0;
0
0
f
2
2
2
2
v 0 + 2 g h0 = v f ;
h0 =

v f2 - v 02
;
2 g
2

41,672 m2 - 102 m2
s
s = 83,49m
h0 =
m
2 9,8 2
s

252

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

EXAMEN N. 3
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN B Y C: FSICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente los enunciados antes de contestar a las cuestiones y de


resolver los problemas.
La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.
Podrn utilizarse calculadoras no programables. No se podr utilizar ningn
otro instrumento electrnico.
Es muy importante que expreses los resultados de los problemas en las
unidades correspondientes.

1. Marca con X en la casilla correspondiente si consideras cada una de las


siguientes frases verdadera (V) o falsa (F). (2,5 puntos)
V

Cuando se aplica el Mtodo Cientfico, la elaboracin de una teora es


anterior a la formulacin de hiptesis.
Si la densidad de una sustancia es 10 g/cm3, es lo mismo decir que
equivale a 1 g/mL.
El coeficiente de rozamiento depende de la naturaleza de las superficies
en contacto.
Movimiento absoluto es aquel en el que el punto de referencia se supone fijo respecto del punto que se mueve.
La unidad de temperatura en el Sistema Internacional de Unidades es el C.

2. Un automvil toma una curva disminuyendo su rapidez durante 15 s.


Marca con X en la casilla correspondiente si consideras cada una de las
siguientes frases verdadera (V) o falsa (F), y escribe la frase correcta en
las que consideres falsas: (2,5 puntos)
a) El coche solamente tiene aceleracin tangencial.
b) El coche solamente tiene aceleracin normal.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

253

PRUEBAS DE ACCESO A CFGS

C) La trayectoria del mvil no es una lnea curva.


D) El coche tiene aceleracin tangencial y normal.
E) El mdulo de la velocidad no se mantiene constante.

RESPUESTA CORRECTA

a
b
c
d
e

3. Desde un balcn situado a 15 m se lanza verticalmente hacia arriba una


pelota de 50 g con una velocidad de 10 m/s.
a) Calcula su energa mecnica cuando alcanza la mxima altura. (1,25 puntos)
b) Calcula la velocidad con que llega al suelo. (1,25 puntos)
Realiza los clculos correspondientes y escribe el resultado obtenido.
Resultado:

a)

b)

4. Un ascensor de 320 kg transporta a una persona de 70 kg. Si la tensin


que soporta el cable del ascensor es de 3000 N, calcula la aceleracin
con la que se mueve. (2,5 puntos)
Realiza los clculos correspondientes y escribe el resultado obtenido.
Dato: g = 10 m/s2.
Resultado:

254

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. Marca con X en la casilla correspondiente si consideras cada una de las
siguientes frases verdadera (V) o falsa (F): (2,5 puntos)
V

Cuando se aplica el Mtodo Cientfico, la elaboracin de una teora es


anterior a la formulacin de hiptesis.
Si la densidad de una sustancia es 10 g/cm3, es lo mismo decir que
equivale a 1 g/mL.
El coeficiente de rozamiento depende de la naturaleza de las superficies
en contacto.
Movimiento absoluto es aquel en el que el punto de referencia se supone fijo respecto del punto que se mueve.
La unidad de temperatura en el Sistema Internacional de Unidades es el C.

Solucin

Cuando se aplica el Mtodo Cientfico, la elaboracin de una teora es


anterior a la formulacin de hiptesis.

Si la densidad de una sustancia es 10 g/cm3, es lo mismo decir que


equivale a 1 g/mL.

El coeficiente de rozamiento depende de la naturaleza de las superficies


en contacto.

Movimiento absoluto es aquel en el que el punto de referencia se supone fijo respecto del punto que se mueve.

La unidad de temperatura en el Sistema Internacional de Unidades es el C.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

255

PRUEBAS DE ACCESO A CFGS

Explicacin
1. Cuando se aplica el Mtodo Cientfico, la elaboracin de una teora es posterior a la formulacin de hiptesis.
2. La densidad de una sustancia de 10 g/cm3 en g/mL ser:
d = 10

g
g
g
10 3 cm3 1 dm3 1 l
= 10
3 = 10
3
3
l
ml
ml
1
1000
cm
cm
1 dm

3. El valor del coeficiente de rozamiento es caracterstico de cada par de materiales en contacto; no es una propiedad intrnseca de un material. Depende
adems de muchos factores como la temperatura, el acabado de las superficies, la velocidad relativa entre las superficies, etc.
La fuerza de rozamiento entre dos cuerpos no depende del tamao de la superficie de contacto entre los dos cuerpos, pero s de cul sea la naturaleza
de esa superficie de contacto, es decir, de qu materiales la formen y si es
ms o menos rugosa.
4. El movimiento depende del sistema de referencia que se tome, es decir,
ser absoluto cuando el punto de referencia es fijo, y ser relativo cuando
dicho punto est en movimiento.
Por ejemplo: Un individuo se mueve con una velocidad de 5 Km/h (tomando
el tren como sistema de referencia) en un tren que se mueve a 100 km/h
(tomando la va frrea como sistema de referencia). En este caso, el movimiento absoluto del individuo con respecto al tren es de 5 km/h, pero el
movimiento de ese mismo individuo con respecto a la va frrea, ser de
105 km/h, si se mueve en la misma direccin que el tren. Es decir, se puede
tomar el movimiento como absoluto o relativo dependiendo de los sistemas
de referencia que se usen.
5. La unidad de temperatura en el Sistema Internacional de Unidades es el
kelvin, K.

Pregunta
2. Un automvil toma una curva disminuyendo su rapidez durante 15 s.
Marca con X en la casilla correspondiente si consideras cada una de las
256

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

siguientes frases verdadera (V) o falsa (F), y escribe la frase correcta en


las que consideres falsas: (2,5 puntos)
a) El coche solamente tiene aceleracin tangencial.
b) El coche solamente tiene aceleracin normal.
c) La trayectoria del mvil no es una lnea curva.
d) El coche tiene aceleracin tangencial y normal.
e) El mdulo de la velocidad no se mantiene constante.

RESPUESTA CORRECTA

a
b
c
d
e

Solucin
V

RESPUESTA CORRECTA

El coche tiene aceleracin tangencial y aceleracin normal.

El coche tiene aceleracin tangencial y aceleracin normal.

Es un movimiento circular uniformemente acelerado. Por tanto, la


trayectoria del mvil es una lnea curva.

Se ha mencionado anteriormente.

Al ser un movimiento circular uniformemente acelerado, el mdulo


de la velocidad no se mantiene constante.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

257

PRUEBAS DE ACCESO A CFGS

Pregunta
3. Desde un balcn situado a 15 m se lanza verticalmente hacia arriba una
pelota de 50 g con una velocidad de 10 m/s.
a) Calcula su energa mecnica cuando alcanza la mxima altura.
(1,25 puntos)
b) Calcula la velocidad con que llega al suelo. (1,25 puntos)
Realiza los clculos correspondientes y escribe el resultado obtenido.

Solucin
DATOS:
m = 50g
v 0 = 10 m
s
h0 = 15m

Figura 3. Planteamiento del problema

258

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

a) Calcula su energa mecnica cuando alcanza la mxima altura.


(1,25 puntos)
Aplicando el principio de conservacin de la energa entre los puntos 1 y 0, se tiene:
E m1 =Em 0 ;
E m1 =Ec 0 +E p 0 ;
E m1 = 1 m v 02+m g h0 ;
2
2
1 kg
1 kg
E m1 =1 50 g
9,81 m2 15m;
102 m2 +50 g
2
1000 g
1000 g
s
s
E m1=9,86J

b) Calcula la velocidad con que llega al suelo. (1,25 puntos)


Del mismo modo, haciendo balance de energas entre los puntos 1 y 2, se tiene:
E m1 =Em2 ;
E m1 =Ec 2+E p 2 ;
E m1 =1 m v 22+m g h2 ;
2
Como la altura de la pelota en el punto 2 es nula, su energa potencial es nula
tambin.
E m1 = 1 m v 22 + 0;
2
2 E m1
v 22 =
;
m
2 Em1
v 2 =
=
m

2 9,86 J
=19,86 m
s
1 kg
50 g
1000 g

Como la solucin negativa no tiene sentido, la solucin definitiva ser:


v 2 = 19,86 m
s

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

259

PRUEBAS DE ACCESO A CFGS

Pregunta
4. Un ascensor de 320 kg transporta a una persona de 70 kg. Si la tensin
que soporta el cable del ascensor es de 3000 N, calcula la aceleracin
con la que se mueve. (2,5 puntos)
Realiza los clculos correspondientes y escribe el resultado obtenido.
Dato: g = 10 m/s2.

Solucin
Aplicando el diagrama de fuerzas al sistema, se tiene:

Figura 4. Diagrama de fuerzas del sistema

Si se supone que el ascensor se mueve hacia arriba, se tiene la siguiente ecuacin aplicando la segunda ley de Newton:
mt a = T - Pp - Pa ;
Donde:
mt es la masa total, suma de la masa de la persona y del ascensor.
T es la tensin del cable.
Pp es el peso de la persona.
Pa es el peso del ascensor.
260

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Despejando la aceleracin de la frmula, se tiene:

a=

T-Pp -Pa 3000 N - 70 10 N-320 10N


=
=-2,31 m2
mT
(70 + 320)kg
s

Es decir, el signo significa que el ascensor va frenndose si el sentido es hacia


arriba. Si se toma el movimiento en sentido contrario, indicara que el ascensor va
acelerndose. Luego, en ese caso, el valor de la aceleracin es:
a = 2,31 m2
s

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

261

EXAMEN N. 4
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN B: TECNOLOGA INDUSTRIAL
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente los enunciados antes de contestar a las cuestiones y de


resolver los problemas.
La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.
Podrn utilizarse calculadoras no programables. No se podr utilizar ningn
otro instrumento electrnico.
Es muy importante que expreses los resultados de los problemas en las
unidades correspondientes.

1. Marca con X en la casilla correspondiente si consideras cada una de las


siguientes frases verdadera (V) o falsa (F), y escribe la frase correcta en
las que consideres falsas: (2,5 puntos)
a) El valor de la posicin depende del punto que se haya escogido como
referencia.
b) La distancia recorrida por un mvil depende del punto escogido como
referencia.
c) La trayectoria del mvil es una lnea.
d) La distancia recorrida no coincide con el valor absoluto de la diferencia entre la posicin final y la posicin inicial si el movimiento es de ida y vuelta.
e) La velocidad cuando un cuerpo sube tiene el mismo signo que cuando desciende.
V

RESPUESTA CORRECTA

a
b
c
d
e
262

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

2. Marca con X en la casilla correspondiente si consideras cada una de las


siguientes frases verdadera (V) o falsa (F): (2,5 puntos)

Fuerza, longitud y trabajo son magnitudes vectoriales.


La unidad de cantidad de movimiento es kg m/s2
Cantidad de movimiento, velocidad y aceleracin tangencial son magnitudes vectoriales.
Temperatura, masa y volumen son magnitudes escalares.
La velocidad es una magnitud fundamental en el Sistema Internacional
de unidades.

3. Un coche circula por una calle a 50 km/h. De repente, un nio atraviesa


la calle tras una pelota. El conductor logra detener el coche sin llegar a
atropellar al nio. Sabiendo que el conductor tarda 0,8 s en reaccionar y
pisar el freno, y que, una vez que pisa el freno, la aceleracin de frenado
es de 20 m/s2, qu distancia recorre el coche desde que el conductor
observa al nio hasta que termina por pararse? Realiza los clculos correspondientes y escribe el resultado obtenido. (2,5 puntos)
Resultado:

4. Calcula el trabajo mecnico realizado en cada uno de los movimientos


siguientes:
a) Una gra levanta desde el suelo un paquete de ladrillos de 100 kg a
una altura de 20 m. (1,25 puntos)
b) Una vez elevada la carga anterior a los 20 m de altura la desplaza
horizontalmente 10 m. (1,25 puntos)
Realiza los clculos correspondientes y escribe los resultados obtenidos.
Resultado:

a)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

b)

263

SOLUCIONES

Pregunta
1. Marca con X en la casilla correspondiente si consideras cada una de las
siguientes frases verdadera (V) o falsa (F), y escribe la frase correcta en
las que consideres falsas: (2,5 puntos)
a) El valor de la posicin depende del punto que se haya escogido como
referencia.
b) La distancia recorrida por un mvil depende del punto escogido como
referencia.
c) La trayectoria del mvil es una lnea.
d) La distancia recorrida no coincide con el valor absoluto de la diferencia entre la posicin final y la posicin inicial si el movimiento es de ida y vuelta.
e) La velocidad cuando un cuerpo sube tiene el mismo signo que cuando desciende.
V

RESPUESTA CORRECTA

a
b
c
d
e

Solucin
V

RESPUESTA CORRECTA
Para determinar la posicin de un cuerpo en el espacio es necesario
referir dicha posicin en relacin con otro cuerpo, denominado cuerpo
de referencia. Su eleccin es arbitraria, puede ser un rbol, una casa,
el Sol Esto implica que la posicin de un cuerpo es una magnitud
relativa, dependiente del objeto tomado como cuerpo de referencia.

.../...

264

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

.../...
b

La distancia entre dos cuerpos no depende del sistema de referencia. Es decir, sin importar dnde se haya elegido el punto de referencia, la distancia es una magnitud invariante.
En cinemtica, la trayectoria es el lugar geomtrico de las posiciones sucesivas por las que pasa un cuerpo en su movimiento. La
trayectoria depende del sistema de referencia en el que se describa el movimiento; es decir, el punto de vista del observador.
En la mecnica clsica la trayectoria de un cuerpo puntual siempre
es una lnea continua. Por el contrario, en la mecnica cuntica
hay situaciones en las que no es as. Por ejemplo, posicin de un
electrn orbital de un tomo es probabilstica, por lo que la trayectoria corresponde ms bien a un volumen.
Si el punto inicial y final coinciden, es decir, es un movimiento de
ida y vuelta, la distancia recorrida no coincide con el valor absoluto
de la diferencia entre la posicin final y la inicial, que es nula.
No tiene sentido esta afirmacin. Si se toma positivo el ascenso,
entonces, la velocidad cuando un cuerpo sube es positiva, y tiene
sentido contrario cuando baja, que es negativo. Si se toma positivo
el descenso, el caso es totalmente contrario, el ascenso es negativo y la subida es negativa entonces.
Luego, la velocidad cuando un cuerpo sube tiene sentido contrario
que cuando desciende.

Pregunta
2. Marca con X en la casilla correspondiente si consideras cada una de las
siguientes frases verdadera (V) o falsa (F): (2,5 puntos)

Fuerza, longitud y trabajo son magnitudes vectoriales.


La unidad de cantidad de movimiento es kg m/s2
Cantidad de movimiento, velocidad y aceleracin tangencial son magnitudes vectoriales.
Temperatura, masa y volumen son magnitudes escalares.
La velocidad es una magnitud fundamental en el Sistema Internacional
de unidades.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

265

PRUEBAS DE ACCESO A CFGS

Solucin
V

Fuerza, longitud y trabajo son magnitudes vectoriales.

La unidad de cantidad de movimiento es kg m/s2

Cantidad de movimiento, velocidad y aceleracin tangencial son magnitudes vectoriales.

Temperatura, masa y volumen son magnitudes escalares.

La velocidad es una magnitud fundamental en el Sistema Internacional


de unidades.

Explicacin
1. La fuerza y el trabajo son magnitudes vectoriales. Pero la longitud es una
magnitud escalar. Sin embargo, la distancia o desplazamiento son magnitudes vectoriales.
2. La unidad de cantidad de movimiento es: kg m
s
3. La cantidad de movimiento, la velocidad y la aceleracin tangencial son
magnitudes vectoriales.
4. La temperatura, la masa y el volumen son magnitudes escalares.
5. La velocidad es una magnitud derivada en el Sistema Internacional de unidades.
En la siguiente figura se muestran las magnitudes fundamentales o bsicas.

Figura 5. Unidades bsicas en el Sistema Internacional

266

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Pregunta
3. Un coche circula por una calle a 50 km/h. De repente, un nio atraviesa
la calle tras una pelota. El conductor logra detener el coche sin llegar a
atropellar al nio. Sabiendo que el conductor tarda 0,8 s en reaccionar y
pisar el freno, y que, una vez que pisa el freno, la aceleracin de frenado
es de 20 m/s2, qu distancia recorre el coche desde que el conductor
observa al nio hasta que termina por pararse? Realiza los clculos correspondientes y escribe el resultado obtenido. (2,5 puntos)

Solucin
DATOS:
v 0 = 50 km 1000 m 1 h = 13,89 m ;
h
1km 3600 s
s
t = 0,8 s
a = -20 m2 ;
s
Se va a solucionar el problema atendiendo a las siguientes hiptesis:
1. Se trata de un movimiento uniforme en los primeros 0,8 segundos que tarda
el conductor en reaccionar.
2. Se trata de un movimiento uniformemente desacelerado desde que el conductor pisa el freno.
Analizando el movimiento uniforme, se tiene:
x = x0 + v t
Se supone que el desplazamiento inicial es nulo desde que el conductor observa al nio, es decir, x0= 0. Por tanto:
x = 0 + v t = 13,89 m 0,8 s = 11,11m
s
Analizando el movimiento uniformemente desacelerado, se tiene:
v (t ) = a t + v 0
x = 1 a t 2 + v 0 t + x0
2
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

267

PRUEBAS DE ACCESO A CFGS

Para calcular el tiempo que tarda en la frenada, en la primera frmula se hace


la velocidad final nula y se despeja el tiempo, es decir:
v(t ) = a t + v 0 ;
m
v(t ) - v 0 0 - 13,89 s
t=
=
= 0,69 s
a
-20 m2
s
Calculando el desplazamiento en la segunda frmula, se debe introducir como
dato que el desplazamiento inicial es x0 = 11,11 m, es decir, que cuando el conductor reacciona han pasado 11,11 metros, y el tiempo transcurrido hasta que se
para el coche es 0,69 segundos. Por tanto, se tiene:
x = 1 a t 2 + v 0 t + x0 =
2
= 1 -20 m2 0,692 s2 +13,89 m 0,69 s +11,11m = 15,93m
s
2
s

Pregunta
4. Calcula el trabajo mecnico realizado en cada uno de los movimientos
siguientes:
a) Una gra levanta desde el suelo un paquete de ladrillos de 100 kg a
una altura de 20 m. (1,25 puntos)
b) Una vez elevada la carga anterior a los 20 m de altura la desplaza
horizontalmente 10 m. (1,25 puntos)
Realiza los clculos correspondientes y escribe los resultados obtenidos.

Solucin
a) Una gra levanta desde el suelo un paquete de ladrillos de 100 kg a una
altura de 20 m. (1,25 puntos)
En el suelo (punto 0), la carga no tiene ni velocidad ni altura. Luego, no tiene
ni energa cintica ni energa potencial.
268

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

A los 20 metros de altura (punto 1), no hay movimiento y la carga no tiene


energa cintica, sino energa potencial. Luego, la energa mecnica ser:
E m1 = E c1 + E p1 = 0 + E p1 ;
E m1 = m g h = 100kg 9,81 m2 20m = 19620 J
s

b) Una vez elevada la carga anterior a los 20 m de altura la desplaza horizontalmente 10 m. (1,25 puntos)
Si se desplaza la carga horizontalmente (punto 2), y no verticalmente, tiene
la misma energa potencial y la energa cintica sigue siendo nula (ya que est la
carga en reposo). Luego:
Em2 = Ec 2 + E p 2 = 0 + E p 2 ;
E m2 = m g h = 100kg 9,81 m2 20m = 19620 J
s

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

269

EXAMEN N. 5
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN B: TECNOLOGA INDUSTRIAL
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente los enunciados antes de contestar a las cuestiones y de


resolver los problemas.
La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.
Podrn utilizarse calculadoras no programables. No se podr utilizar ningn
otro instrumento electrnico.
Es muy importante que expreses los resultados de los problemas en las
unidades correspondientes.

1. Una familia se desplaza en su automvil a pasar el fin de semana. En la


grfica siguiente se representa cmo vara la posicin del automvil a lo
largo del recorrido en funcin del tiempo. Indica, marcando con X en la
casilla correspondiente, si las siguientes afirmaciones son verdaderas
(V) o falsas (F), y escribe la frase correcta en las que consideres falsas.
(2,5 puntos)

270

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

RESPUESTA CORRECTA

En el tramo B lleva un movimiento uniforme


En el tramo C su aceleracin es constante
En el tramo A su velocidad es constante
En el tramo B su velocidad es constante
En el tramo A su aceleracin es constante

2. De las siguientes frases, marca con X en la casilla correspondiente si


consideras cada una de ellas verdadera (V) o falsa (F), y escribe la frase
correcta en las que consideres falsas: (2,5 puntos)
a) El sonido es una onda transversal.
b) El movimiento ondulatorio consiste en la transmisin de una perturbacin sin transporte neto de materia.
c) Una onda electromagntica necesita un medio material para propagarse.
d) La velocidad de propagacin de cualquier onda electromagntica es
la misma que la de la luz.
e) La frecuencia y la longitud de onda son magnitudes directamente
proporcionales.
V

RESPUESTA CORRECTA

a
b
c
d
e

3. En clase de Fsica y Qumica el profesor lleva a sus alumnos al patio y


les pide que formen parejas. En cada pareja, un alumno se encarga de
lanzar una pelota de tenis verticalmente hacia arriba mientras que su
compaero cronometra el tiempo que tarda la pelota desde que se lanza
hasta que, al caer, pasa a la misma altura del punto de lanzamiento. Una
de las parejas obtiene que la pelota tarda 8 s. Con qu velocidad se
lanz la pelota? Realiza los clculos correspondientes y escribe el resultado obtenido. Dato: g = 9,8 m/s2 (2,5 puntos)
Resultado:
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

271

PRUEBAS DE ACCESO A CFGS

4. Se est celebrando el campeonato internacional de patinaje artstico


sobre hielo. Una pareja de patinadores, uno de ellos de 80 kg, van juntos
patinando a 10 m/s. En un momento determinado, el patinador de 80 kg
se queda completamente parado mientras impulsa al otro, en la misma
direccin y sentido que llevaban, a una velocidad de 24 m/s. Cul ser
la masa del segundo patinador? Realiza los clculos correspondientes y
escribe el resultado obtenido. (2,5 puntos)
Resultado:

272

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. Una familia se desplaza en su automvil a pasar el fin de semana. En la grfica siguiente se representa cmo vara la posicin del automvil a lo largo
del recorrido en funcin del tiempo. Indica, marcando con X en la casilla
correspondiente, si las siguientes afirmaciones son verdaderas (V) o falsas
(F), y escribe la frase correcta en las que consideres falsas. (2,5 puntos)
V

RESPUESTA CORRECTA

RESPUESTA CORRECTA

En el tramo B no hay movimiento ya que no hay


variacin del espacio S
con respecto al tiempo. Es
una parada del automvil.

En el tramo C su velocidad
es constante. La aceleracin es nula. Es un movimiento uniforme.

En el tramo A su aceleracin es constante. Su velocidad vara linealmente


respecto al tiempo. Es un
movimiento uniformemente acelerado.

En el tramo B lleva un movimiento uniforme


En el tramo C su aceleracin es constante
En el tramo A su velocidad es constante
En el tramo B su velocidad es constante
En el tramo A su aceleracin es constante

Solucin

En el tramo B lleva un movimiento uniforme

En el tramo C su aceleracin es constante

En el tramo A su velocidad es constante

.../...
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

273

PRUEBAS DE ACCESO A CFGS

.../...

En el tramo B su velocidad es constante

En el tramo A su aceleracin es constante

En el tramo B no hay movimiento ya que no hay


variacin del espacio S
con respecto al tiempo. Es
una parada del automvil.

Pregunta
2. De las siguientes frases, marca con X en la casilla correspondiente si
consideras cada una de ellas verdadera (V) o falsa (F), y escribe la frase
correcta en las que consideres falsas: (2,5 puntos)
a) El sonido es una onda transversal.
b) El movimiento ondulatorio consiste en la transmisin de una perturbacin sin transporte neto de materia.
c) Una onda electromagntica necesita un medio material para propagarse.
d) La velocidad de propagacin de cualquier onda electromagntica es
la misma que la de la luz.
e) La frecuencia y la longitud de onda son magnitudes directamente
proporcionales.

RESPUESTA CORRECTA

a
b
c
d
e

274

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Solucin
V
a
b

RESPUESTA CORRECTA

El sonido es una onda longitudinal.

Las ondas electromagnticas pueden propagarse en ausencia de


medio material, es decir, en el vaco.

c
d

La velocidad de propagacin de cualquier onda electromagntica


en el vaco es la misma que la de la luz.

La frecuencia y la longitud de onda son magnitudes inversamente


e

proporcionales, es decir, O = v . Cuando aumenta la frecuencia f,

se hace ms pequea la longitud de onda O.

Pregunta
3. En clase de Fsica y Qumica el profesor lleva a sus alumnos al patio y les
pide que formen parejas. En cada pareja, un alumno se encarga de lanzar
una pelota de tenis verticalmente hacia arriba mientras que su compaero
cronometra el tiempo que tarda la pelota desde que se lanza hasta que, al
caer, pasa a la misma altura del punto de lanzamiento. Una de las parejas
obtiene que la pelota tarda 8 s. Con qu velocidad se lanz la pelota?
Realiza los clculos correspondientes y escribe el resultado obtenido.
Dato: g = 9,8 m/s2 (2,5 puntos)

Solucin
Las ecuaciones del movimiento del lanzamiento vertical son:
v f =v 0 +g t;
2
y=v 0 t+g t ;
2
2
2
v f -v 0 =2 g h;

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

275

PRUEBAS DE ACCESO A CFGS

Se recuerda que, en lanzamiento vertical, cuando un objeto es lanzado hacia


arriba y luego cae, cuando vuelve a pasar por el punto de partida, posee la misma
velocidad que en el momento del lanzamiento pero con sentido contrario (vf= v0).
Tambin se puede asegurar que el tiempo requerido para alcanzar la altura
mxima es la mitad que el tiempo total transcurrido, es decir, 4 segundos.
Sabiendo que el signo de la gravedad en movimiento vertical hacia arriba es negativo y que la velocidad en el punto ms alto es nula, de la primera ecuacin se tiene:
v f =v 0 +g t
0=v 0 +g t
v 0 =-g t

v 0 =- -9,8 m2 4 s = 39,2 m
s
s
Para calcular la altura mxima que ha alcanzado la pelota de tenis, segn la
tercera frmula, se tiene:
v f2 - v 02 = 2 g h;
0 - v 02 = 2 g h;
2

-39,22 m2
-v
s = 78,4 m
h=
=
2 g
2 -9,8 m2
s
2
0

Para comprobar ambos resultados, se introducen en la segunda frmula.


2
y=v 0 t+g t
2
2
78,4 m=39,2 m 4 s+ -9,8 m2 16 s
s
2
s

Pregunta
4. Se est celebrando el campeonato internacional de patinaje artstico
sobre hielo. Una pareja de patinadores, uno de ellos de 80 kg, van juntos
patinando a 10 m/s. En un momento determinado, el patinador de 80 kg
se queda completamente parado mientras impulsa al otro, en la misma
276

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

direccin y sentido que llevaban, a una velocidad de 24 m/s. Cul ser


la masa del segundo patinador? Realiza los clculos correspondientes y
escribe el resultado obtenido. (2,5 puntos)

Solucin
Datos:
m1 = 80 g
m2 = desconocida
v12 = 10 m/s
v1 = 0 m/s
v2 = 24 m/s
Segn el principio de conservacin de la cantidad de movimiento:
ur ur
p=p';
uuur
uur
uur
v12 (m1 +m2 )=m1 v1 '+m2 v 2';
Siendo:
ur
p ; Cantidad de movimiento antes del impulso.
ur
p' ; Cantidad de movimiento despus del impulso.
Si se supone que todo el movimiento se produce en una sola direccin (aunque
sea en sentidos contrarios), se simplifica la resolucin debido a que nicamente
se consideran las componentes escalares de los vectores en el eje considerado.
v12 (m1 +m2 )=m1 v1 '+m2 v 2';
v12 (m1 +m2 )=0+m2 v 2';
v12 m1 +v12 m2=m2 v 2';
v12 m1 =m2 (v 2'-v12 );
m
v12 m1 10 s 80kg
m2=
=
=57,14 kg
v 2'-v12
24 m - 10 m
s
s

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

277

EXAMEN N. 6
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN B Y C: FSICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1. Responde a las siguientes cuestiones.


a) Describe qu es una hiptesis cientfica. (0,75 puntos)
................................................................................................................
................................................................................................................
................................................................................................................
........................................................................................................

b) Indica la diferencia entre una magnitud escalar de otra vectorial.


(0,75 puntos)
................................................................................................................
................................................................................................................
................................................................................................................
........................................................................................................

c) Expresa las siguientes cantidades en unidades del Sistema Internacional. (1 punto)

278

200 kWh (Kilowatios hora):..............................................................

8 N/cm2 (Newton entre centmetro cuadrado):......................................

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

2. Un coche de carreras corre en un circuito de 6,2 kilmetros, dando en


total 53 vueltas durante la carrera.
a) Calcula el desplazamiento realizado por el coche en esa carrera
as como el espacio recorrido en ella. Qu direccin tiene la aceleracin del coche cuando toma una curva a velocidad constante?
(1 punto)
Solucin:
b) Determina el tiempo que tarda en llegar a la primera curva que est
a 350 metros de la salida si acelera a 7 m/s2 partiendo del reposo.
Halla la velocidad con la que llega a esa primera curva. (1 punto)
Solucin:
c) Calcula la aceleracin centrpeta que tiene ese coche cuando toma una
curva de 50 metros de radio a una velocidad de 30 m/s. (0,5 puntos)
Solucin:

3. Dejamos caer una pelota desde una altura de 2 metros y, tras botar en
el suelo, sube hasta una altura de 1,8 metros.
a) Analiza las transformaciones de energa que se han producido en el
proceso de cada y subida as como el balance de energa en el trayecto total. (1 punto)
..........................................................................................................
..........................................................................................................
..........................................................................................................
..........................................................................................................
..........................................................................................................
..........................................................................................................
..........................................................................................................

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

279

PRUEBAS DE ACCESO A CFGS

b) Si en la superficie terrestre ha cado con aceleracin de la gravedad (9,8


m/s2), con qu aceleracin caera ese cuerpo en un planeta de masa
mitad que la terrestre y radio mitad que el terrestre? (0,75 puntos)
Solucin:
c) Si debido al rozamiento con el aire cae con aceleracin de 7 m/s2,
cul es la fuerza de rozamiento si la pelota tiene una masa de 150
gramos? (0,75 puntos)
Solucin:

4. Una onda se propaga a lo largo de una cuerda tensa.


a) Dibuja de manera aproximada la forma de la onda en un instante
determinado y seala en esa grfica su longitud de onda. (1 punto)

b) En qu consiste la reflexin y la refraccin de las ondas? (1 punto)

c) Si la onda tiene una longitud de onda de 1,5 metros y tarda en producirse una oscilacin completa 2 segundos, a qu velocidad se
propaga? (0,5 puntos)
Solucin:

280

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. Responde a las siguientes cuestiones.
a) Describe qu es una hiptesis cientfica. (0,75 puntos)
b) Indica la diferencia entre una magnitud escalar de otra vectorial.
(0,75 puntos)
c) Expresa las siguientes cantidades en unidades del Sistema Internacional. (1 punto)

200 kWh (Kilowatios hora):


8 N/cm2 (Newton entre centmetro cuadrado):

Solucin y explicacin
a) Describe qu es una hiptesis cientfica. (0,75 puntos)
El mtodo cientfico tiene como objetivo adquirir unos conocimientos que expliquen el mundo material visible, dando una explicacin material de su estructura y
una explicacin o formalizacin de su funcionamiento y dinamismo.
La hiptesis cientfica es la aplicacin del mtodo cientfico a un problema que
se desea estudiar. Estas hiptesis explican los problemas segn la ciencia y parten
de hiptesis explicativas.
b) Indica la diferencia entre una magnitud escalar de otra vectorial. (0,75
puntos)
Magnitud escalar
Es una magnitud que slo se describe con la cantidad mediante un nmero y
una unidad. Ejemplo de magnitudes escalares son: la temperatura, la energa, etc.
Estas magnitudes se diferencian de las cantidades vectoriales porque estas ltimas, adems de la cantidad, requieren que se d la direccin y el sentido.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

281

PRUEBAS DE ACCESO A CFGS

Magnitud vectorial
Es una magnitud que se describe con tres caractersticas: cantidad, direccin
y sentido. En algunos textos, a la cantidad tambin se le llama magnitud o intensidad. Ejemplo de magnitudes vectoriales son: la velocidad, la fuerza, la aceleracin,
etc. Su representacin se realiza mediante una flecha que muestra las tres caractersticas.

c) Expresa las siguientes cantidades en unidades del Sistema Internacional. (1 punto)

200 kWh (Kilowatios hora):


8 N/cm2 (Newton entre centmetro cuadrado):

Energa
La energa tiene sus unidades en Julios (J) en el Sistema Internacional.
E =200Kwh =200Kwh

10 3 wh 3600 s

=7,2 108 w s =7,2 108 J


1 kwh
1h

Presin
La presin tiene sus unidades en Pascales (Pa) en el Sistema Internacional.
104 cm2
p =8 N 2 =8 N 2
=8 N2 =8 Pa
cm
cm
1 m2
m

Pregunta
2. Un coche de carreras corre en un circuito de 6,2 kilmetros, dando en
total 53 vueltas durante la carrera.
a) Calcula el desplazamiento realizado por el coche en esa carrera as
como el espacio recorrido en ella. Qu direccin tiene la aceleracin del coche cuando toma una curva a velocidad constante?
(1 punto)

282

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

b) Determina el tiempo que tarda en llegar a la primera curva que est


a 350 metros de la salida si acelera a 7 m/s2 partiendo del reposo.
Halla la velocidad con la que llega a esa primera curva. (1 punto)
C) Calcula la aceleracin centrpeta que tiene ese coche cuando toma una
curva de 50 metros de radio a una velocidad de 30 m/s. (0,5 puntos)

Solucin
Datos:
S = 6,2 km
53 vueltas
a) Calcula el desplazamiento realizado por el coche en esa carrera as como
el espacio recorrido en ella. Qu direccin tiene la aceleracin del coche
cuando toma una curva a velocidad constante? (1 punto)
Se entiende en el enunciado que el desplazamiento realizado por el coche y el
espacio recorrido es la misma magnitud.
3

ST = S n vueltas =6,2 km 53 =328,6 km =328,6 km 10 m =3,29 105 m


1 km
En cuanto a la direccin de la aceleracin del coche cuando toma una curva
a velocidad constante, en este caso, se trata de un movimiento circular uniforme,
donde la aceleracin tangencial es nula; sin embargo, la aceleracin normal, que
es la que mide los cambios en la direccin de la velocidad, es constante, y toma
el valor:
2

a =v
r

Donde:
v = es la velocidad constante del coche.
r = es el radio de curvatura.
Siendo su direccin radial, es decir, perpendicular a la trayectoria, y su sentido
est dirigido hacia la parte cncava de la curva, es decir, hacia el centro. A esta
aceleracin se le llama aceleracin centrpeta.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

283

PRUEBAS DE ACCESO A CFGS

Figura 6. Dibujo de la fuerza centrpeta

Donde:
Fc = Fuerza centrpeta
a = aceleracin centrpeta
v = velocidad
m = masa del coche
b) Determina el tiempo que tarda en llegar a la primera curva que est a
350 metros de la salida si acelera a 7 m/s2 partiendo del reposo. Halla la
velocidad con la que llega a esa primera curva. (1 punto)
En este apartado se trabajar de forma escalar porque todas las magnitudes
tienen la misma direccin.
Datos:
t se desconoce
r-r0 = 350 m
a = 7 m/s2
v0 = 0 m/s
v se desconoce
t0 = 0
284

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Por tanto:

r r0
r r0
r r0
t=
t=

v 0 (t t0 ) 1 a (t t0 ) ;
2
2
0 (t 0) 1 a (t 0) ;
2
01 a t 2 ;
2
2

2 (r r0 )
;
a
2 350 m
= 100 s2 =10 s
m
7 2
s

Para hallar la velocidad, se tiene:


r r
ur v  v 0
a=
;
tt 0
r r ur
v v 0 a (t  t 0 );

Como todas las magnitudes vectoriales estn aplicadas en la misma direccin,


se trabaja de forma escalar:
v

v 0 a (t t0 );

07 m2 (100)s 70 m
s
s

c) Calcula la aceleracin centrpeta que tiene ese coche cuando toma una
curva de 50 metros de radio a una velocidad de 30 m/s. (0,5 puntos)
Como se ha tratado en el apartado A, r = 5 y v = 30 m/s. Por tanto:
2

302 m2
s =18 m
a= v =
50 m
r
s2
2

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

285

PRUEBAS DE ACCESO A CFGS

Pregunta
3. Dejamos caer una pelota desde una altura de 2 metros y, tras botar en
el suelo, sube hasta una altura de 1,8 metros.

a) Analiza las transformaciones de energa que se han producido en el


proceso de cada y subida as como el balance de energa en el trayecto total. (1 punto)

b) Si en la superficie terrestre ha cado con aceleracin de la gravedad (9,8


m/s2), con qu aceleracin caera ese cuerpo en un planeta de masa
mitad que la terrestre y radio mitad que el terrestre? (0,75 puntos)

c) Si debido al rozamiento con el aire cae con aceleracin de 7 m/s2,


cul es la fuerza de rozamiento si la pelota tiene una masa de 150
gramos? (0,75 puntos)

Solucin
a) Analiza las transformaciones de energa que se han producido en el proceso de cada y subida as como el balance de energa en el trayecto
total. (1 punto)
La velocidad de la pelota antes del choque con el suelo se calcula aplicando el
principio de conservacin de la energa.
mgh0 = 1 mv12
2
v1 = 2 gh0

286

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

La velocidad de la pelota despus del choque es (en mdulo) u1 =e v1 . La


pelota asciende con una velocidad inicial u1, y alcanza una altura mxima h1, que
se calcula aplicando el principio de conservacin de la energa. A e se le conoce
como coeficiente de restitucin.
1 mu2 =mgh
1
2 1
2
h1 =e h0
Despus del choque n, la altura mxima que alcanza la pelota es:
h1 =e2 n h0
La prdida de energa que experimenta la pelota en el primer choque es:
'E1

1 mv 2  1 mu2
2 1 2 1

(e2 1) mgh

El tiempo que tarda la pelota en llegar al suelo cuando se deja caer desde una
altura h0, partiendo del reposo, es:
h0 = 1 gt02
2
2h0
t0 =
g
b) Si en la superficie terrestre ha cado con aceleracin de la gravedad (9,8 m/
s2), con qu aceleracin caera ese cuerpo en un planeta de masa mitad
que la terrestre y radio mitad que el terrestre? (0,75 puntos)
Partiendo de la ley de la gravitacin universal, se tiene, de forma escalar:
F =G

Mm
d2

Considerando la pelota sobre la superficie de la tierra (en el suelo), de masa


m, la fuerza de atraccin gravitatoria ejercida sobre esta sera la llamada fuerza de
peso, que se sabe que es igual a su masa multiplicada por la aceleracin local:
F =m g

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

287

PRUEBAS DE ACCESO A CFGS

Igualando ambas frmulas, se tiene:


m g =G

Mm
d2

La masa M en este caso es la masa del cuerpo que interacta con el objeto,
o sea, la masa de la Tierra. La distancia de la frmula, d, es el propio radio de la
Tierra, R. Por tanto, se puede expresar g como:
g =G M2
R
Si se tiene un planeta de masa mitad que la terrestre, M1 = M , y radio mitad
2
R
que el terrestre, R1 = 2 , se tiene:
M
M1
g1 = G 2 = G 2 2 = G
R1
R
2
g1 =2 g

()

M
2 =G M 2 = g 2
R2
R2
4

Es decir, caera con una aceleracin doble a la aceleracin de la gravedad terrestre, o sea, g1 = 19,6 m/s2.
c) Si debido al rozamiento con el aire cae con aceleracin de 7 m/s2, cul
es la fuerza de rozamiento si la pelota tiene una masa de 150 gramos?
(0,75 puntos)
La pelota est sometida a la accin de su peso y de una fuerza de rozamiento
proporcional al cuadrado de la velocidad, es decir, Fr= Kv2. En este caso nicamente se solicita la fuerza de rozamiento Fr.

Figura 7. Diagrama de fuerzas en la cada de la pelota


288

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Por tanto,
ma = mg  Fr ;
m( g  a);

Fr

mg  ma

Fr

150 g 9,8 m2  7 m2
s
s

150 g

1 kg
9,8 m2 7 m2
1000 g
s
s

0,42N

Pregunta
4. Una onda se propaga a lo largo de una cuerda tensa.
a) Dibuja de manera aproximada la forma de la onda en un instante
determinado y seala en esa grfica su longitud de onda. (1 punto)
b) En qu consiste la reflexin y la refraccin de las ondas? (1 punto)
c) Si la onda tiene una longitud de onda de 1,5 metros y tarda en producirse una oscilacin completa 2 segundos, a qu velocidad se
propaga? (0,5 puntos)

Solucin
a) Dibuja de manera aproximada la forma de la onda en un instante determinado y seala en esa grfica su longitud de onda. (1 punto)

Figura 8. Dibujo de una onda

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

289

PRUEBAS DE ACCESO A CFGS

La longitud de onda O, ser:

O = AC =2 AB

b) En qu consiste la reflexin y la refraccin de las ondas? (1 punto)


Reflexin
La reflexin de una onda es el rebote que experimenta cuando llega a un obstculo grande, como una pared. Aunque el obstculo absorba parte de la energa
recibida (incluso vibrando si entra en resonancia) se produce tambin reflexin
en la que se transmite de vuelta parte de la energa a las partculas del medio
incidente.

Figura 9. Reflexin

En la figura se representa un frente de ondas plano llegando a una superficie


horizontal con un cierto ngulo i de incidencia (se mide con respecto a la direccin
normal, N). De acuerdo con el principio de Huygens, cuando el frente de ondas
empieza a tocar la superficie, el punto A se convierte en un nuevo foco que emite ondas secundarias y, segn transcurre el tiempo y el frente AB va incidiendo,
repiten este comportamiento todos los puntos de la superficie comprendidos entre
A y C.
El frente de ondas reflejado, DC, es el envolvente de las ondas secundarias que
se han ido emitiendo durante un tiempo igual al periodo desde el tramo AC de la
pared.
Se aprecia bastante bien la igualdad entre el ngulo de incidencia y el ngulo
de reflexin, r.
Aplicando leyes de geometra elemental al proceso, se llega a la conclusin de
que el ngulo de incidencia i es igual al ngulo de reflexin r (ley de la reflexin).

290

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Refraccin
La refraccin de una onda consiste en el cambio de direccin que experimenta cuando pasa de un medio a otro distinto. Este cambio de direccin se produce como consecuencia de la diferente velocidad de propagacin que tiene la onda en ambos medios.

Figura 10. Refraccin

En la figura se representa la refraccin de una onda plana desde un medio 1 a


otro medio 2, suponiendo que la velocidad de propagacin es menor en el segundo
medio que en el primero. A medida que el frente de ondas AB va incidiendo en la
superficie de separacin, los puntos AC de esa superficie se convierten en focos
secundarios y transmiten la vibracin hacia el segundo medio.
Debido a que la velocidad en el segundo medio es menor, la envolvente de las
ondas secundarias transmitidas conforma un frente de ondas EC, en el que el punto E est ms prximo a la superficie de separacin que el B. En consecuencia, al
pasar al segundo medio, los rayos se desvan acercndose a la direccin normal N.
Mediante un razonamiento similar se comprueba que la desviacin de la direccin de propagacin tiene lugar en sentido contrario cuando la onda viaja de un
medio donde su velocidad de propagacin es menor a otro en el que es mayor.
Para describir formalmente la refraccin de ondas luminosas (no mecnicas) se
define el ndice de refraccin de un medio, n, indicando el nmero de veces que
la velocidad de la luz es mayor en el vaco que en ese medio. Es decir, el ndice de
refraccin es igual a 1 en el vaco (donde la luz tiene su mxima velocidad, 300000
km/s) y mayor que la unidad en cualquier otro medio.
Normalmente la reflexin y la refraccin se producen de forma simultnea.
Cuando incide una onda sobre la superficie de separacin entre dos medios, los
puntos de esa superficie actan como focos secundarios, que transmite la vibracin en todas las direcciones y forman frentes de onda reflejados y refractados.
La energa y la intensidad de la onda incidente se reparte entre ambos procesos
(reflexin y refraccin) en una determinada proporcin.
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

291

PRUEBAS DE ACCESO A CFGS

c) Si la onda tiene una longitud de onda de 1,5 metros y tarda en producirse una oscilacin completa 2 segundos, a qu velocidad se propaga?
(0,5 puntos)
O= 1,5m;
t= 2s;
En fsica, el periodo de una oscilacin u onda (T) es el tiempo transcurrido entre
dos puntos equivalentes de la oscilacin o ciclo. Luego, T = 2s.
La velocidad de propagacin de la onda es:
1,5 m
=0,75 m =0,75 ms1
v =O =
T
2s
s

292

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

EXAMEN N. 7
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN B Y C: FSICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

Revisa cuidadosamente la prueba antes de entregarla.

1. Responde a las siguientes cuestiones.


a) Describe brevemente el mtodo cientfico. (0,5 puntos)
..........................................................................................................
..........................................................................................................
..........................................................................................................
..........................................................................................................

b) Completa el siguiente cuadro. (1,5 puntos)


Magnitud

Fundamental o
derivada en el SI

Escalar o vectorial

Unidad en el SI

Masa
Fuerza
Energa
Tiempo
Volumen

c) Expresa las siguientes cantidades en unidades del Sistema Internacional. (0,5 puntos)
5 kilowatios: .................................
25 C: .....................................
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

293

PRUEBAS DE ACCESO A CFGS

2. Un viajero pasea por el interior de un vagn en el mismo sentido que el


tren, que circula a 72 km/h. El viajero tarda 10 segundos en recorrer los
30 metros del vagn. Responde a las siguientes cuestiones:
a) Calcula la velocidad que lleva el pasajero respecto al tren y respecto
a la va. (1 punto)
Solucin:
b) Si el tren frena y tarda en parar 20 segundos. Determina la aceleracin y la distancia que recorre el tren en esa frenada. (1 punto)
Solucin:
c) Representa grficamente de forma aproximada la velocidad frente al
tiempo para el movimiento de frenada del tren. (0,5 puntos)

3. Responde a las siguientes cuestiones:


a) Enuncia el principio de conservacin del momento lineal y el principio de conservacin de la energa. (0,5 puntos)
b) Una bola de billar de 100 gramos de masa que se mueve a 5 m/s
choca con otra que est en reposo. Despus del choque la primera
avanza a 1 m/s en la misma direccin y sentido con la que iba inicialmente. Con qu velocidad se mover la segunda si ambas tienen la
misma masa? (1 punto)
Solucin:
c) Si la segunda bola tras el choque frena con aceleracin de 2 m/s2,
calcula la fuerza de rozamiento que la ha frenado y analiza las transformaciones de energa que se han llevado a cabo en el proceso de
frenado. (1 punto)
Solucin:
294

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

4. Una onda se propaga a lo largo de una cuerda tensa.


a) Enuncia el Principio de Huygens. (1 punto)
b) Si la imagen en un instante dado de una onda transversal es la que
se observa en la figura, si la distancia AB es 0,5 metros y la distancia
NM 0,8 metros, determina la longitud de onda de ese movimiento
ondulatorio y su amplitud. (1 punto)

Solucin:
c) Si la onda anterior se propaga a una velocidad de 6 m/s, cul ser
el periodo y la frecuencia de esa onda? (0,5 puntos)
Solucin:

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

295

SOLUCIONES

Pregunta
1. Responde a las siguientes cuestiones
a) Describe brevemente el mtodo cientfico. (0,5 puntos)
..........................................................................................................
..........................................................................................................
..........................................................................................................
..........................................................................................................
b) Completa el siguiente cuadro. (1,5 puntos)
Magnitud

Fundamental o
derivada en el SI

Escalar o vectorial

Unidad en el SI

Masa
Fuerza
Energa
Tiempo
Volumen

c) Expresa las siguientes cantidades en unidades del Sistema Internacional. (0,5 puntos)
5 kilowatios: .................................
25 C: .........................................

Solucin
a) Describe brevemente el mtodo cientfico. (0,5 puntos)
Es un proceso destinado a explicar fenmenos, establecer relaciones entre los
hechos y enunciar leyes que expliquen los fenmenos fsicos del mundo y permi296

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

tan obtener, con estos conocimientos, aplicaciones tiles al hombre. Los cientficos emplean el mtodo cientfico como una forma planificada de trabajar. Sus
logros son acumulativos y han llevado a la Humanidad al momento cultural actual.
Aunque no se puede decir que hay un solo mtodo cientfico o modelo clsico,
algunos factores son comunes a todos: una idea brillante del hombre, el trabajo
complementario de los cientficos y de las ciencias, la verificabilidad, la utilizacin
de herramientas matemticas, etc.

b) Completa el siguiente cuadro. (1,5 puntos)

Fundamental o
derivada en el SI

Escalar o vectorial

Unidad en el SI

Masa

kg

Fuerza

Energa

Tiempo

Volumen

m3

Magnitud

Explicacin

En el siguiente cuadro se reflejan las magnitudes fundamentales en el Sistema Internacional. En l figura la masa y el tiempo. Por tanto, el resto de
magnitudes son derivadas en el Sistema Internacional.

Figura 11. Unidades bsicas en el Sistema Internacional

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

297

PRUEBAS DE ACCESO A CFGS

Una magnitud escalar es una magnitud que slo se describe con la cantidad
mediante un nmero y una unidad. Por ejemplo, la temperatura, la energa,
la masa, el tiempo, el volumen, etc. Estas magnitudes se diferencian de
las cantidades vectoriales porque estas ltimas, adems de la cantidad,
requieren que se d la direccin y el sentido.
La magnitud vectorial es una magnitud que se describe con tres caractersticas: cantidad, direccin y sentido. En algunos textos, a la cantidad tambin
se le llama magnitud o intensidad. Por ejemplo, la velocidad, la fuerza,
la aceleracin, etc. Su representacin se realiza mediante una flecha que
muestra las tres caractersticas.

Las unidades de las magnitudes fundamentales del Sistema Internacional


se muestran en la tabla anterior. En cuanto a las magnitudes derivadas del
SI, la fuerza se expresa en Newtons (N), la energa en Julios (J) y el volumen
en metros cbicos (m3).

c) Expresa las siguientes cantidades en unidades del Sistema Internacional. (0,5 puntos)

5 kilowatios
3

5kw = 5kw 10 w = 5 10 3 w = 5000 w


1 kw

25 C
25 C = (25+ 273)K = 298 K

Pregunta
2. Un viajero pasea por el interior de un vagn en el mismo sentido que el
tren, que circula a 72 km/h. El viajero tarda 10 segundos en recorrer los
30 metros del vagn. Responde a las siguientes cuestiones:
a) Calcula la velocidad que lleva el pasajero respecto al tren y respecto
a la va. (1 punto)

298

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

b) Si el tren frena y tarda en parar 20 segundos. Determina la aceleracin y la distancia que recorre el tren en esa frenada. (1 punto)
c) Representa grficamente de forma aproximada la velocidad frente al
tiempo para el movimiento de frenada del tren. (0,5 puntos)

Solucin y explicacin
a) Calcula la velocidad que lleva el pasajero respecto al tren y respecto a
la va. (1 punto)
Como todas las velocidades que se solicitan tienen la misma direccin y sentido
que la del tren, se hace el clculo con sus mdulos y no vectorialmente, ya que
coinciden en la misma direccin y sentido los resultados.
La velocidad que lleva el pasajero respecto al tren, expresada en unidades del
Sistema Internacional, es:
V1 = S = 30 m = 3 m
t
10 s
s
La velocidad que lleva el pasajero respecto a la va, expresada en unidades del
Sistema Internacional, es:
3
V2 = Vtren + V1 = 72 km + 3 m = 72 km 10 m 1 h + 3 m = 20 m + 3 m = 23 m
h
s
h 1 km 3600 s
s
s
s
s

b) Si el tren frena y tarda en parar 20 segundos. Determina la aceleracin


y la distancia que recorre el tren en esa frenada. (1 punto)
La aceleracin media es la relacin que existe entre la variacin de velocidad que
se produce en el movimiento y el intervalo de tiempo en que se produce dicho cambio.
r uur
uur v - v 0
am =
t - t0
Como se pretende que frene el tren en ese tiempo:
r
v =0
t - t0 = 20 s
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

299

PRUEBAS DE ACCESO A CFGS

Por tanto:
0 - 20 m
s = -1 m
am =
20 s
s2
En la direccin y sentido que va el tren.
Suponiendo que es un movimiento rectilneo uniformemente acelerado, la distancia ser:
r - r0 = v 0 (t - t0 )+ 1 a(t - t0 ) ;
2
2
r - r0 = 20 m (20 s) + 1 -1 m2 (20 s) = 400m - 200m = 200m
s
2 s
2

( )

c) Representa grficamente de forma aproximada la velocidad frente al


tiempo para el movimiento de frenada del tren. (0,5 puntos)
Se supone que la frenada es un movimiento rectilneo uniformemente acelerado. Por tanto:

Figura 12. Grfica de la velocidad frente al tiempo

300

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Pregunta
3. Responde a las siguientes cuestiones:
a) Enuncia el principio de conservacin del momento lineal y el principio de conservacin de la energa. (0,5 puntos)
b) Una bola de billar de 100 gramos de masa que se mueve a 5 m/s
choca con otra que est en reposo. Despus del choque la primera
avanza a 1 m/s en la misma direccin y sentido con la que iba inicialmente. Con qu velocidad se mover la segunda si ambas tienen la
misma masa? (1 punto)
c) Si la segunda bola tras el choque frena con aceleracin de 2 m/s2,
calcula la fuerza de rozamiento que la ha frenado y analiza las transformaciones de energa que se han llevado a cabo en el proceso de
frenado. (1 punto)

Solucin y explicacin
a) Enuncia el principio de conservacin del momento lineal y el principio de
conservacin de la energa. (0,5 puntos)
Principio de conservacin del momento lineal
Considrense dos partculas que pueden interactuar entre s pero que estn
aisladas de los alrededores. Las partculas se mueven bajo su interaccin mutua
pero no hay fuerzas exteriores al sistema.
La partcula 1 se mueve bajo la accin de la fuerza F12 que ejerce la partcula
2. La partcula 2 se mueve bajo la accin de la fuerza F21 que ejerce la partcula
1. La tercera ley de Newton o Principio de accin y reaccin establece que ambas
fuerzas tendrn que ser iguales y de signo contrario, es decir:
F12 + F21= 0

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

301

PRUEBAS DE ACCESO A CFGS

Figura 13. Interaccin entre partculas

Aplicando la segunda ley de Newton a cada una de las partculas:


dp1 dp2 d( p1 + p2 )
+
=
= 0;
dt
dt
dt
El principio de conservacin del momento lineal afirma que el momento lineal
total del sistema de partculas permanece constante, si el sistema es aislado, es
decir, si no actan fuerzas exteriores sobre las partculas del sistema. El principio de
conservacin del momento lineal es independiente de la naturaleza de las fuerzas
de interaccin entre las partculas del sistema aislado, es decir:
m1 v01 + m2 v02= m1 v1 + m2 v2 ;
Donde v01 y v02 son las velocidades iniciales de las partculas 1 y 2, y v1 y v2 las
velocidades finales de dichas partculas.
Principio de conservacin de la energa
El principio de conservacin de la energa indica que la energa no se crea ni se
destruye; slo se transforma de unas formas en otras. En estas transformaciones,
la energa total permanece constante; es decir, la energa total es la misma antes
y despus de cada transformacin.
En el caso de la energa mecnica se puede concluir que, en ausencia de rozamientos y sin intervencin de ningn trabajo externo, la suma de las energas cintica y potencial permanece constante. Este fenmeno se conoce con el nombre de
Principio de conservacin de la energa mecnica.
302

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

b) Una bola de billar de 100 gramos de masa que se mueve a 5 m/s choca
con otra que est en reposo. Despus del choque la primera avanza a 1
m/s en la misma direccin y sentido con la que iba inicialmente. Con qu
velocidad se mover la segunda si ambas tienen la misma masa? (1 punto)
Datos:
m1 = 100 g
v1 = 5 m/s
m2 = 100 g
v2 = 0
v1 = 1 m/s
v2 desconocido
Segn el principio de conservacin de la cantidad de movimiento:
ur ur
p = p';
uur
uur
uur
uur
m1 v1 + m2 v 2 = m1 v1 ' + m2 v 2';
Siendo:
ur
p ; Cantidad de movimiento antes del choque.
uur
pc ; Cantidad de movimiento despus del choque.

Si se supone que todo el movimiento se produce en una sola direccin (aunque sea en sentidos contrarios), se simplifica la resolucin debido a que nicamente se consideran las componentes escalares de los vectores en el eje
considerado.
m1 v1 + m2 v 2 = m1 v'1 + m2 v'2
v1 + v 2 = v'1 + v'2
5 m + 0 = 1 m + v'2
s
s
v'2 = 4 m
s

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

303

PRUEBAS DE ACCESO A CFGS

c) Si la segunda bola tras el choque frena con aceleracin de 2 m/s2, calcula la fuerza de rozamiento que la ha frenado y analiza las transformaciones de energa que se han llevado a cabo en el proceso de frenado.
(1 punto)
La segunda bola frena con aceleracin de 2 m/s2, por tanto, se trata de un
movimiento rectilneo uniformemente acelerado con a = -2 m/s2 (signo negativo
debido a la frenada).
En este sistema tan slo acta la fuerza de rozamiento. Por tanto:
ur
r
F =m a
Como el movimiento se produce en una sola direccin, se consideran las componentes escalares.
1 kg
F = m a = 100 g 2 m2 = 100 g
2 m2 = 0,2N
1000
g
s
s
Las transformaciones de energa que se han llevado a cabo en el proceso de
frenado se basan en que la energa cintica de la bola de billar se va transformando
en energa de rozamiento.

Pregunta
4. Una onda se propaga a lo largo de una cuerda tensa.
a) Enuncia el Principio de Huygens. (1 punto)
b) Si la imagen en un instante dado de una onda transversal es la que
se observa en la figura, si la distancia AB es 0,5 metros y la distancia
NM 0,8 metros, determina la longitud de onda de ese movimiento
ondulatorio y su amplitud. (1 punto)
c) Si la onda anterior se propaga a una velocidad de 6 m/s, cul ser
el periodo y la frecuencia de esa onda? (0,5 puntos)

304

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Solucin y explicacin
a) Enuncia el Principio de Huygens. (1 punto)
Alrededor de 1860, el fsico dans Huygens propuso un mecanismo que estableca cmo se propaga una onda mecnica por un medio material.
Un frente de onda es una superficie que pasa por todos los puntos del medio
alcanzados por el movimiento ondulatorio en el mismo instante. La perturbacin
en todos esos puntos tiene la misma fase. Se puede trazar una serie de lneas
perpendiculares a los sucesivos frentes de onda. Estas lneas se denominan rayos
y corresponden a las lneas de propagacin de la onda. La relacin entre rayos y
frente de ondas es similar a la de lneas de fuerza y superficies equipotenciales. El
tiempo que separa puntos correspondientes de dos superficies de onda es el mismo para todos los pares de puntos correspondientes (teorema de Malus).
Pues bien, el mtodo de Huygens permite obtener el frente de onda, S1, que se
SURGXFHHQXQLQVWDQWHWWDSDUWLUGHOIUHQWHGHRQGD60, que se ha producido
en un instante anterior, t.
Huygens visualiz un mtodo para pasar de un frente de onda a otro. Cuando el
movimiento ondulatorio alcanza los puntos que componen un frente de onda, cada
partcula del frente se convierte en una fuente secundaria de ondas, que emite ondas secundarias (indicadas por semicircunferencias) que alcanzan la prxima capa de
partculas del medio. Entonces estas partculas se ponen en movimiento, formando el
subsiguiente frente de onda con la envolvente de estas semicircunferencias. El proceso
se repite, resultando la propagacin de la onda a travs del medio. Esta representacin
de la propagacin es muy razonable cuando la onda resulta de las vibraciones mecnicas de las partculas del medio, es decir, una onda elstica, pero no tendra significado
fsico en las ondas electromagnticas donde no hay partculas que vibren.

b) Si la imagen en un instante dado de una onda transversal es la que se


observa en la figura, si la distancia AB es 0,5 metros y la distancia NM
0,8 metros, determina la longitud de onda de ese movimiento ondulatorio y su amplitud. (1 punto)

Datos:
AB = 0,5m;
NM = 0,8 m;

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

305

PRUEBAS DE ACCESO A CFGS

La longitud de onda O, ser:

O = AC = 2 AB = 2 0,5m = 1m
La amplitud A, ser:
A = AM = NM =
2

0,8 m
= 0,4 m
2

c) Si la onda anterior se propaga a una velocidad de 6 m/s, cul ser el


periodo y la frecuencia de esa onda? (0,5 puntos)
El periodo se define como:
T = 1 = 1 = 1 m-1
O 1m
Y la frecuencia se define como:

f=v =

306

6m
s = 6 1 = 6 s-1 = 6Hz
s
1m

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

EXAMEN N. 8
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN B Y C: FSICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

Revisa cuidadosamente la prueba antes de entregarla.

1. Responde a las siguientes preguntas:


a) Completa la tabla siguiente. (1,5 puntos)

Unidad en el SI
Magnitud
nombre

smbolo

Escalar o
vectorial?

fundamental
o derivada?

Fuerza
kg/m3

Derivada

Aceleracin
watio

b) Expresa las siguientes medidas en las unidades correspondientes


del Sistema Internacional. (1 punto)

35 C:
742 nm:
75 km/h:
108 kWh:

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

307

PRUEBAS DE ACCESO A CFGS

2. El arquero de la imagen ha conseguido lanzar con su arco un mensaje


desde el acantilado hasta el barco. La flecha que lleva el mensaje ha
salido del arco con una velocidad horizontal de 87 m/s:

a) Despreciando los efectos del rozamiento con el aire, cunto tiempo


estar la flecha volando hasta llegar al barco? (1 punto)
Solucin:
b) A qu distancia, aproximadamente, se encuentra el barco del acantilado? (1 punto)
Solucin:

3. El coche de la figura avanza a cierta velocidad hacia el punto A. Al llegar


a l, se rompe el motor y los frenos y empieza a subir por la cuesta. Suponiendo que no hay rozamiento de ningn tipo.

308

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

a) Con qu rapidez deber llegar al punto A para conseguir alcanzar la


casa? (1 punto)
Solucin:
b) Suponiendo ahora que s hay rozamiento con el aire, dibuja las fuerzas que estn actuando sobre el coche cuando ste se encuentra
a mitad de la cuesta, e indica qu cuerpo ejerce cada una de ellas.
(1 punto)

4. Responde a las siguientes cuestiones.


a) Cul es la longitud de onda de una onda electromagntica de 1305
MHz? (1 punto)
Solucin:
b) Al representar la posicin que ocupan en un determinado instante
los puntos de un medio por el que se propaga una onda, se obtiene
la grfica de la figura (la distancia entre dos marcas consecutivas
del eje X es de 0,4 cm).

Cul es, aproximadamente, la longitud de onda del movimiento


ondulatorio representado? Selala en la grfica. (1 punto)

Cul es la amplitud del mismo? Selala en la grfica. (1 punto)

c) Qu diferencia a las ondas longitudinales de las ondas transversales?


(0,5 puntos)

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

309

SOLUCIONES

Pregunta
1. Responde a las siguientes preguntas:
a) Completa la tabla siguiente. (1,5 puntos)
Unidad en el SI
nombre
smbolo

Magnitud

Escalar o
vectorial?

fundamental
o derivada?

Fuerza
kg/m3

Derivada

Aceleracin
watio

b) Expresa las siguientes medidas en las unidades correspondientes


del Sistema Internacional. (1 punto)

35 C:
742 nm:
75 km/h:
108 kWh:

Solucin
a) Completa la tabla siguiente. (1,5 puntos)

Magnitud
Fuerza
Densidad
Aceleracin
Potencia
310

Unidad en el SI
nombre
smbolo
Newton
N
Kilogramo por
kg/m3
metro cbico
Metro por
segundo al
m/s2
cuadrado
watio

Escalar o
vectorial?

fundamental
o derivada?

Vectorial

Derivada

Escalar

Derivada

Vectorial

Derivada

Escalar

Derivada

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Explicacin

En el siguiente cuadro se reflejan las magnitudes fundamentales en el Sistema Internacional. Por tanto, todas las magnitudes son derivadas en el
Sistema Internacional.

Figura 14. Unidades bsicas en el Sistema Internacional

Una magnitud escalar es una magnitud que slo se describe con la cantidad
mediante un nmero y una unidad. Por ejemplo, la temperatura, la energa,
la masa, el tiempo, el volumen, etc. Estas magnitudes se diferencian de
las cantidades vectoriales porque estas ltimas, adems de la cantidad,
requieren que se d la direccin y el sentido.
La magnitud vectorial es una magnitud que se describe con tres caractersticas: cantidad, direccin y sentido. En algunos textos, a la cantidad tambin
se le llama magnitud o intensidad. Por ejemplo, la velocidad, la fuerza,
la aceleracin, etc. Su representacin se realiza mediante una flecha que
muestra las tres caractersticas.

Las unidades de las magnitudes fundamentales del Sistema Internacional


se muestran en la tabla anterior. En cuanto a las magnitudes derivadas del
SI, la fuerza se expresa en Newtons (N), la potencia en watios (W), la densidad en kg/m3 y la aceleracin en m/s2.

b) Expresa las siguientes medidas en las unidades correspondientes del


Sistema Internacional. (1 punto)
35 C:
742 nm:
75 km/h:
108 kWh:
35 C:
35 C = 35 C + 273 = 308 K
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

311

PRUEBAS DE ACCESO A CFGS

742 nm:
742nm = 742nm

1 m = 742 10-9 m = 7,42 10-7 m


109 nm

75 km/h:
75 km = 75 km 1000m 1 h = 20,83 m
h
h
1 km 3600 s
s

108 kWh:
108 kW h = 108 kW h 1000 w 3600 s 1 J = 3,89 108 J
1 kW
1h
1w s

Pregunta
2. El arquero de la imagen ha conseguido lanzar con su arco un mensaje
desde el acantilado hasta el barco. La flecha que lleva el mensaje ha
salido del arco con una velocidad horizontal de 87 m/s:
a) Despreciando los efectos del rozamiento con el aire, cunto tiempo
estar la flecha volando hasta llegar al barco? (1 punto)
b) A qu distancia, aproximadamente, se encuentra el barco del acantilado? (1 punto)

Solucin
a) Despreciando los efectos del rozamiento con el aire, cunto tiempo
estar la flecha volando hasta llegar al barco? (1 punto)
Es un lanzamiento horizontal. Las ecuaciones de movimiento son:
2

x = v 0 t; y = y 0 - g t
2
v x = v 0 = cte; v y = - g t

312

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

La ecuacin de la parbola es:


y = y0 -

g
2
2 x
2 v0

Para obtener el tiempo que tardar hasta llegar al barco, se hace y = 0 en


las ecuaciones de movimiento.
2

y = 0; y = y 0 - g t = 0
2
2
gt
; 2h = g t 2 ;
h=
2
t 2 = 2h ; t = 2h = 2 80 m = 16,31 s2 =4,04 s
g
g
9,81 m2
s
La solucin negativa no tiene sentido. Luego, el tiempo que tarda ser 4,04 s.
b) A qu distancia, aproximadamente, se encuentra el barco del acantilado? (1 punto)
Para obtener la distancia que se encuentra el barco del acantilado, se hace
y=0 en la ecuacin de la parbola.
y = 0; y = y 0 -

g
x 2 = 0;
2 v 02
2

0 = y0 -

2 y0 v0
g
g
2
2
2
;
2 x ; y0 =
2 x ; x =
g
2 v0
2 v0
2

2 80 m 872 m2
2 y 0 v 02
s =351,35m
x =
=
g
m
9,81 2
s
La solucin negativa no tiene sentido. Luego, la distancia ser 351,35 m.
Tambin se podra haber usado la ecuacin de movimiento, es decir:
x = v 0 t = 87 m 4,04 s = 351,48 m
s

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

313

PRUEBAS DE ACCESO A CFGS

Pregunta
3. El coche de la figura avanza a cierta velocidad hacia el punto A. Al llegar
a l, se rompe el motor y los frenos y empieza a subir por la cuesta. Suponiendo que no hay rozamiento de ningn tipo.
a) Con qu rapidez deber llegar al punto A para conseguir alcanzar la
casa? (1 punto)
b) Suponiendo ahora que s hay rozamiento con el aire, dibuja las fuerzas
que estn actuando sobre el coche cuando ste se encuentra a mitad
de la cuesta, e indica qu cuerpo ejerce cada una de ellas. (1 punto)

Solucin
a) Con qu rapidez deber llegar al punto A para conseguir alcanzar la
casa? (1 punto)
Se supone que la casa es el punto B. Haciendo balance de energa mecnica en los puntos A y B, se tiene:
EmA = EmB ;
Ec A + Ep A = EcB + EpB ;
Ep A = EcB = 0; Ec A = EpB
1 mv 2 = mgh ; v 2 = 2 g h ;
B
A
B
2 A
2
v A = 2 g hB = 2 9,81 m2 32m = 627,84 m2 =25,06 m
s
s
s

La solucin negativa no tiene sentido. Luego, la velocidad necesaria para


alcanzar la casa debe ser, al menos, de 25,06 m/s.
b) Suponiendo ahora que s hay rozamiento con el aire, dibuja las fuerzas que estn actuando sobre el coche cuando ste se encuentra
a mitad de la cuesta, e indica qu cuerpo ejerce cada una de ellas.
(1 punto)
314

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Se entiende desde el enunciado que piden el diagrama de fuerzas aplicadas


al coche. Es decir:

Figura 15. Diagrama de fuerzas del coche en la cuesta

ur
ur
ur
P ; Fuerza del peso: P = m g

ur
N ; Fuerza normal o fuerza de rozamiento de la superficie de apoyo con el coche.
ur
F ; Fuerza de rozamiento con el aire, contraria al sentido del movimiento del coche.

Pregunta
4. Responde a las siguientes cuestiones.
a) Cul es la longitud de onda de una onda electromagntica de 1305
MHz? (1 punto)
b) Al representar la posicin que ocupan en un determinado instante los
puntos de un medio por el que se propaga una onda, se obtiene la
grfica de la figura. (La distancia entre dos marcas consecutivas del
eje X es de 0,4 cm)
Cul es, aproximadamente, la longitud de onda del movimiento ondulatorio representado? Selala en la grfica. (1 punto)
Cul es la amplitud del mismo? Selala en la grfica. (1 punto)
c) Qu diferencia a las ondas longitudinales de las ondas transversales? (0,5 puntos)
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

315

PRUEBAS DE ACCESO A CFGS

Solucin
a) Cul es la longitud de onda de una onda electromagntica de 1305
MHz? (1 punto)
El espectro electromagntico puede ser expresado con la siguiente ecuacin:

O = c;
f

Donde c es la velocidad de la luz (300.000.000 m/s), O es la longitud de onda


y f es la frecuencia. As, se tiene:

O=c=
f

300000000 m
s =
1305MHz

300000000 m
s = 0,23m
6
10
Hz
1305MHz
1 MHz

b) Al representar la posicin que ocupan en un determinado instante los puntos de


un medio por el que se propaga una onda, se obtiene la grfica de la figura. (La
distancia entre dos marcas consecutivas del eje X es de 0,4 cm)

Cul es, aproximadamente, la longitud de onda del movimiento ondulatorio representado? Selala en la grfica. (1 punto)
La longitud de onda O ser: O = 14 cm

Cul es la amplitud del mismo? Selala en la grfica. (1 punto)


La amplitud A ser: A = 0,7 cm
Se sealan ambos en la grfica:

Figura 16. Representacin de la amplitud y la longitud de onda


316

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

c) Qu diferencia a las ondas longitudinales de las ondas transversales?


(0,5 puntos)

Ondas transversales
Cuando el movimiento del medio es perpendicular a la direccin en que se
propaga la onda, se dice que se trata de una onda transversal. Como ejemplo, se puede decir que este tipo de ondas se produce cuando se agita una
cuerda agitando el extremo libre hacia arriba y hacia abajo. En este caso,
el movimiento de la cuerda es perpendicular a la direccin del movimiento
de la onda. Las ondas que se producen en las cuerdas tensas de los instrumentos musicales y en las superficies de los lquidos son transversales
tambin. Tambin las ondas electromagnticas que constituyen las ondas
de radio y la luz son transversales.

Ondas longitudinales
En ciertos casos, las partculas del medio se mueven de un lado a otro en la
misma direccin en la que se propaga la onda. Las partculas se mueven a lo
largo de la direccin de la onda en vez de hacerlo en sentido perpendicular.
Una onda de este tipo es una onda longitudinal. Como ejemplo, se puede
decir, que las ondas sonoras son ondas longitudinales.

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

317

EXAMEN N. 9
PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR
OPCIN B Y C: FSICA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

Revisa cuidadosamente la prueba antes de entregarla.

1. Responde a las siguientes preguntas: (2,5 puntos)


a) Completa la tabla siguiente. (1,5 puntos)

Unidad en el SI
Magnitud
Nombre

Smbolo

Escalar o
vectorial?

Fundamental
o derivada?

Tiempo
Pa

Derivada

Velocidad
Kilogramo

b) Expresa las siguientes medidas en las unidades correspondientes del


Sistema Internacional. (1 punto)
 &
 P
 NPK
 N:K
318

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

2. Un coche se mueve en lnea recta y con velocidad uniforme durante 20 s.


En ese instante frena uniformemente hasta que se detiene 5 segundos
despus. En la imagen se muestra la grfica v-t del movimiento del coche. Responde a las preguntas que se plantean. (2,5 puntos)

a) Con qu aceleracin ha frenado el coche? (1 punto)


Solucin:

b) Cul es la distancia total que ha recorrido el vehculo? (1 punto)


Solucin:

c) Cul ha sido la velocidad media del coche durante el recorrido?


(0,5 puntos)
Solucin:

3. Responde a las siguientes cuestiones. (2,5 puntos)


a) Un coche de 865 kg de masa que se mueve sobre una carretera horizontal, est tomando una curva de 42 m de radio de curvatura, con
una rapidez constante de 64,8 km/h. Calcula de forma razonada cul
es la aceleracin que posee el coche. (1 punto)
Solucin:

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

319

PRUEBAS DE ACCESO A CFGS

b) En la situacin anterior, el coeficiente de rozamiento entre las ruedas


del coche y el asfalto de la carretera es de 0,83. Cul ser la rapidez mxima con la que el coche podra tomar la curva sin derrapar?
(1,5 puntos)
Solucin:

4. Responde a las siguientes cuestiones. (2,5 puntos)


a) Explica, empleando el principio de Huygens, en qu consiste la refraccin de las ondas. (1 punto)
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
...............................................................................................................
b) En el aire, a 20 C, el sonido viaja a una velocidad de 344,2 m/s. Cul
ser la longitud de onda de un sonido cuya frecuencia sea de 440 s-1?
(0,5 puntos)
Solucin:

c) Una onda transversal que se propaga por una cuerda tiene una amplitud de 35 cm y una longitud de onda de 0,5 m. Representa grficamente la onda y seala en la grfica que construyas cul es la
amplitud del movimiento y la longitud de onda del mismo. (1 punto)

320

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

SOLUCIONES

Pregunta
1. Responde a las siguientes preguntas: (2,5 puntos)
a) Completa la tabla siguiente. (1,5 puntos)
Unidad en el SI
Magnitud
Nombre

Smbolo

Escalar o
vectorial?

Fundamental
o derivada?

Tiempo
Pa

Derivada

Velocidad
Kilogramo

b) Expresa las siguientes medidas en las unidades correspondientes del


Sistema Internacional. (1 punto)
 &
 P
 NPK
 N:K

Solucin
a) Completa la tabla siguiente. (1,5 puntos)
Unidad en el SI
Nombre

Smbolo

Escalar o
vectorial?

Tiempo

Segundo

Escalar

Fundamental

Presin

Pascal

Pa

Escalar

Derivada

Velocidad

Metros por
segundo

m/s

Vectorial

Derivada

Masa

Kilogramo

kg

Escalar

Fundamental

Magnitud

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

Fundamental
o derivada?

321

PRUEBAS DE ACCESO A CFGS

Explicacin

En el siguiente cuadro se reflejan las magnitudes fundamentales en el Sistema


Internacional. Por tanto, el tiempo y la masa son fundamentales, y la presin y
la velocidad son derivadas de las fundamentales en el Sistema Internacional.

Figura 17. Unidades bsicas o fundamentales en el Sistema Internacional

Una magnitud escalar es una magnitud que solo se describe con la cantidad
mediante un nmero y una unidad. Por ejemplo, la temperatura, la energa,
la masa, el tiempo, el volumen, la presin, etc. Estas magnitudes se diferencian de las cantidades vectoriales porque estas ltimas, adems de la
cantidad, requieren que se d la direccin y el sentido.
La magnitud vectorial es una magnitud que se describe con tres caractersticas: cantidad, direccin y sentido. En algunos textos, a la cantidad tambin
se le llama magnitud o intensidad. Por ejemplo, la velocidad, la fuerza,
la aceleracin, etc. Su representacin se realiza mediante una flecha que
muestra las tres caractersticas.
Las unidades de las magnitudes fundamentales del Sistema Internacional
se muestran en la tabla anterior. En cuanto a las magnitudes derivadas del
SI, la presin se expresa en Newton partido entre m2, es decir, pascales
(Pa), y la velocidad en m/s.

b) Expresa las siguientes medidas en las unidades correspondientes del


Sistema Internacional. (1 punto)





322

&
P
NPK
N:K

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

Solucin y explicacin
 &
18 C = 18 C + 273 = 291 k
 P
263 P m = 263 P m

1m
106 P m

263 106 m

2,63 104 m

 NPK
124

km
km 1000m
1h
= 124

h
h
1 km 3600s

34,44

m
s

 N:K
415kW h = 415kW h

1000 W 3600 s 1J

1 kW
1h
1w s

1,49 109 J

Pregunta
2. Un coche se mueve en lnea recta y con velocidad uniforme durante 20 s.
En ese instante frena uniformemente hasta que se detiene 5 segundos
despus. En la imagen se muestra la grfica v-t del movimiento del coche.
Responde a las preguntas que se plantean. (2,5 puntos)
a) Con qu aceleracin ha frenado el coche? (1 punto)
b) Cul es la distancia total que ha recorrido el vehculo? (1 punto)
c) Cul ha sido la velocidad media del coche durante el recorrido?
(0,5 puntos)
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

323

PRUEBAS DE ACCESO A CFGS

Solucin y explicacin
a) Con qu aceleracin ha frenado el coche? (1 punto)
La frenada es un movimiento rectilneo uniformemente acelerado. Por tanto, la
aceleracin media es la relacin que existe entre la variacin de velocidad que se
produce en el movimiento y el intervalo de tiempo en que se produce dicho cambio.
r uur
uur v  v 0
am =
t  t0
Como se pretende que frene el coche en ese tiempo de 5 segundos:
r
v =0
t  t0

5s

Por tanto:
09
am

m
s

5s

1,8

m
s2

En la direccin y sentido que va el coche.


b) Cul es la distancia total que ha recorrido el vehculo? (1 punto)
Suponiendo que es un movimiento rectilneo uniformemente desacelerado, la
distancia total ser la distancia recorrida por el coche a velocidad constante ms la
distancia recorrida en la frenada. La distancia a velocidad constante ser r0, es decir:
r0

v0 t0

m
20s
s

180 m

Por tanto:
r  r0
r

324

1
2
v 0 (t  t 0 )  a ( t  t 0 ) ;r
2

180 m  9

1
2
r0  v 0 (t  t 0 )  a ( t  t 0 )
2

m
1
m
( 5s)  1,8 2 ( 5s)2
s
2
s

180 m  45 m  22,5 m

202,5 m

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

c) Cul ha sido la velocidad media del coche durante el recorrido? (0,5 puntos)
La velocidad media en el movimiento rectilneo uniformemente desacelerado ser:
v  v0
v

t  t0
; v
2

v 0  a

t  t0
;
2

m
m 5 s
m
m
1,8 2
 4,5
9
s
s
s
s 2

4,5

m
s

Pero en el enunciado solicitan la velocidad media del vehculo durante todo el


recorrido, no tan solo en la frenada. Por tanto, se halla:
vm =

s total 202,5 m
m
=
= 8,1
t total
s
25 s

Pregunta
3. Responde a las siguientes cuestiones. (2,5 puntos)
a) Un coche de 865 kg de masa que se mueve sobre una carretera horizontal, est tomando una curva de 42 m de radio de curvatura, con
una rapidez constante de 64,8 km/h. Calcula de forma razonada cul
es la aceleracin que posee el coche. (1 punto)
b) En la situacin anterior, el coeficiente de rozamiento entre las ruedas
del coche y el asfalto de la carretera es de 0,83. Cul ser la rapidez mxima con la que el coche podra tomar la curva sin derrapar?
(1,5 puntos)

Solucin y explicacin
a) Un coche de 865 kg de masa que se mueve sobre una carretera horizontal est tomando una curva de 42 m de radio de curvatura, con una
rapidez constante de 64,8 km/h. Calcula de forma razonada cul es la
aceleracin que posee el coche. (1 punto)
Cuando un mvil toma una curva a velocidad constante se trata de un movimiento circular uniforme, donde la aceleracin tangencial es nula; sin embargo, la
EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

325

PRUEBAS DE ACCESO A CFGS

aceleracin normal, que es la que mide los cambios en la direccin de la velocidad,


es constante, y toma el valor:
a=

v2
r

Donde:
v = es la velocidad constante del coche.
r = es el radio de curvatura.
Siendo su direccin radial, es decir, perpendicular a la trayectoria, y su sentido
est dirigido hacia la parte cncava de la curva, es decir, hacia el centro. A esta
aceleracin se le llama aceleracin centrpeta.

Figura 18. Dibujo de la fuerza centrpeta

Donde:
Fc = Fuerza centrpeta
a = aceleracin centrpeta
v = velocidad
m = masa del coche
En el caso del problema, la aceleracin centrpeta ser:
2
2
km 1000 m
1h

km
64,8

64,8

h
1 km 3600 s
v2
m
h
a= =
=
= 7,71 2
r
42m
42m
s

326

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

b) En la situacin anterior, el coeficiente de rozamiento entre las ruedas del


coche y el asfalto de la carretera es de 0,83. Cul ser la rapidez mxima con la que el coche podra tomar la curva sin derrapar? (1,5 puntos)
En la siguiente figura se puede apreciar el diagrama de fuerzas de un mvil en
una curva con rozamiento. Se puede ver que en el eje vertical se encuentran las
reacciones que ejercen las ruedas sobre el suelo (hacia arriba) y el peso del vehculo (hacia abajo).

Figura 19. Diagrama de fuerzas de una mvil en una curva

Tambin se puede observar en el eje horizontal la fuerza centrfuga (inversa a la


centrpeta) que tiende a que se salga el vehculo de la calzada (hacia la derecha)
y las fuerzas de rozamiento de las ruedas sobre la calzada que tienden a que el
vehculo permanezca en la calzada (hacia la izquierda).
Por tanto, la fuerza centrpeta (inversa a la centrfuga) en valor absoluto es:
Fc

v2
;
r

Y la fuerza de rozamiento es:


Fr

P m g;

Igualando ambas frmulas y despejando la velocidad se obtendr la velocidad


mxima a la que puede circular dicho mvil sin salirse de la curva. Es decir:
m
v

v2
r

P m g;
r P g

42m 0,83 9,81

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

m
ss

18,49

m
s

327

PRUEBAS DE ACCESO A CFGS

Pregunta
4. Responde a las siguientes cuestiones. (2,5 puntos)
a) Explica, empleando el principio de Huygens, en qu consiste la refraccin de las ondas. (1 punto)
b) En el aire, a 20 C, el sonido viaja a una velocidad de 344,2 m/s. Cul
ser la longitud de onda de un sonido cuya frecuencia sea de 440 s-1?
(0,5 puntos)
c) Una onda transversal que se propaga por una cuerda tiene una amplitud de 35 cm y una longitud de onda de 0,5 m. Representa grficamente la onda y seala en la grfica que construyas cul es la
amplitud del movimiento y la longitud de onda del mismo. (1 punto)

Solucin y explicacin
a) Explica, empleando el principio de Huygens, en qu consiste la refraccin de las ondas. (1 punto)
La refraccin de una onda consiste en el cambio de direccin que experimenta cuando pasa de un medio a otro distinto. Este cambio de direccin se produce como consecuencia de la diferente velocidad de propagacin que tiene la onda en ambos medios.

Figura 20. Refraccin

328

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

PARTE ESPECFICA OPCIN C: FSICA

En la figura se representa la refraccin de una onda plana desde un medio 1 a


otro medio 2, suponiendo que la velocidad de propagacin es menor en el segundo
medio que en el primero. A medida que el frente de ondas AB va incidiendo en la
superficie de separacin, los puntos AC de esa superficie se convierten en focos
secundarios y transmiten la vibracin hacia el segundo medio.
Debido a que la velocidad en el segundo medio es menor, la envolvente de las
ondas secundarias transmitidas conforma un frente de ondas EC, en el que el punto E est ms prximo a la superficie de separacin que el B. En consecuencia, al
pasar al segundo medio, los rayos se desvan acercndose a la direccin normal N.
Mediante un razonamiento similar se comprueba que la desviacin de la direccin de propagacin tiene lugar en sentido contrario cuando la onda viaja de un
medio donde su velocidad de propagacin es menor a otro en el que es mayor.
Para describir formalmente la refraccin de ondas luminosas (no mecnicas) se
define el ndice de refraccin de un medio, n, indicando el nmero de veces que
la velocidad de la luz es mayor en el vaco que en ese medio. Es decir, el ndice de
refraccin es igual a 1 en el vaco (donde la luz tiene su mxima velocidad, 300000
km/s) y mayor que la unidad en cualquier otro medio.
Normalmente la reflexin y la refraccin se producen de forma simultnea.
Cuando incide una onda sobre la superficie de separacin entre dos medios, los
puntos de esa superficie actan como focos secundarios, que transmite la vibracin en todas las direcciones y forman frentes de onda reflejados y refractados.
La energa y la intensidad de la onda incidente se reparte entre ambos procesos
(reflexin y refraccin) en una determinada proporcin.
B) En el aire, a 20 C, el sonido viaja a una velocidad de 344,2 m/s. Cul
ser la longitud de onda de un sonido cuya frecuencia sea de 440 s-1?
(0,5 puntos)
La relacin entre la frecuencia, la velocidad y la longitud de onda es:
f=

Por tanto, no depende de la temperatura, as pues, la longitud de onda ser:


m
v 344,2 s
O= =
= 0,78 m
f
440s1

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C

329

PRUEBAS DE ACCESO A CFGS

c) Una onda transversal que se propaga por una cuerda tiene una amplitud
de 35 cm y una longitud de onda de 0,5 m. Representa grficamente la
onda y seala en la grfica que construyas cul es la amplitud del movimiento y la longitud de onda del mismo. (1 punto)
Segn la onda dibujada en la siguiente figura.

Figura 21. Dibujo de una onda

La longitud de onda y la amplitud son las que se sealan en la siguiente figura


(a otra escala distinta a la que solicitan en el problema).

Figura 22. Representacin de la amplitud y la longitud de onda

Por tanto, habr que hacer el dibujo sealando que la longitud de onda O ser

330

AC

2 AB

50 cm y la amplitud ser A = AM =

MN
= 35 cm .
2

EXMENES RESUELTOS DE PRUEBAS DE ACCESO A CFGS. PARTE C