Está en la página 1de 7

11/7/2015

RevistaCubanadeInvestigacionesBiomdicasTelmerosytelomerasas

RevistaCubanadeInvestigacionesBiomdicas
versinOnlineISSN15613011

MiSciELO
Serviciospersonalizados

RevCubanaInvestBiomdv.18n.2CiudaddelaHabanamay.ago.1999

TrabajosdeActualizacin

ServiciosPersonalizados
Articulo

InstitutodeCienciasBsicasyPreclnicas"VictoriadeGirn"

Telmerosytelomerasas
Dr.RolandoA.HernndezFernndez

RESUMEN

ArticuloenPDF
ArticuloenXML
Referenciasdelartculo
Comocitaresteartculo

Lostelmerossonestructurascromatnicasespecializadasquese
Enviararticuloporemail
encuentranlocalizadasenlosextremosdeloscromosomaseucariontes.
TantoelADNcomolasprotenasquelosconstituyenpresentan
Indicadores
caractersticassingularesquelosdiferenciandelrestodelos
cromosomas.Parecenestarimplicadosennumerosasfuncionescelulares,
Linksrelacionados
especialmentelasrelacionadasconelcontroldeladuracindelavidade
Bookmark
diferentesestirpescelulares.Estasestructurassereplicanduranteelciclo
|
celulargraciasalaaccindeenzimasdenominadastelomerasasque
estnformadasporprotenasyARNypresentanunmecanismopeculiar.
Recientementesehaestudiadoelcomportamientodelastelomerasasen
lasclulascancerosasysusposiblesaplicacionesdiagnsticasyteraputicas.Enestetrabajosepresentaun
resumendelosprincipaleshallazgosmsrecientessobrelaestructurayfuncionesdelostelmerosyla
accindelastelomerasas.
DescriptoresDeCS:TELOMERASA/fisiologaTELOMERO/fisiologaCICLOCELULAR.
Lostelmerosconstituyenestructurasespecializadasqueformanlosextremosdeloscromosomaseucariontes
queparticipanenfuncionescelularestanimportantescomolamitosis,laestabilidadcromosmicayeltiempo
devidadelasestirpescelulares.Recientementesehademostradosurelacinconalgunasenfermedades,
especialmenteconelcncer.Durantelasltimas2dcadasmuchosehaavanzadoenelconocimientodesu
estructuraydinmica.Enestetrabajoseresumenloshallazgosrecientesmsimportantes.

Estructuradelostelmeros
LostelmerosfueronidentificadosporH.J.Mullerduranteladcadadelosaos30.Desdeentonces,seha
profundizadoextraordinariamenteenelconocimientodeestasestructuras,graciasalaintroduccindela
modernatecnologadelaGenticaMolecular.Unresumendelosprincipalestrabajosrealizadosenlos
primerosaosdeaplicacindeestastcnicasfuepublicadoen1984porBlackburnySzostack.1
Losestudiossehanrealizadoprincipalmenteenciliados,cuyosmacroncleospuedencontenerde40000a1
000000detelmerossegnlaespecie,porloqueconstituyenunaexcelentefuentedecomponentes
telomricosydelasenzimasqueparticipanensureplicacin.Posteriormente,sehacomprobadoquelos
aspectosdescritosenciliadosestnpresentesenotrosorganismos.EnlosciliadosyenS.cerevisiaelos
telmerosseencuentranenunaformadeestructuracromatnicaparticularnonucleosmicaquehasido
denominadatelosoma.Losnucleosomasadyacentespresentanhistonashipoacetiladascaractersticasdela
cromatinaquenosetranscribeactivamente.Enmamferos,dondesonmuchomslargos,sepresentan
formadospornucleosomasperohacialazonamsextremaaparecencomotelosomas.Estoevidenciaqueal
menosenpartehayconservacinestructuraldelostelmeros.Tambinmuestrandiferenciasinterespeciesalgo
sorprendentes.

Eladntelomrico
http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S086403001999000200009

1/7

11/7/2015

RevistaCubanadeInvestigacionesBiomdicasTelmerosytelomerasas

Encasitodosloseucariontesestudiados,elADNtelomrico(ADNt)consisteenrepeticionesentandende
pequeassecuenciasnucleotdicasconunadistribucinasimtricadelosparesG:C,pueslasGseacumulan
enunadelashebras(hebraG)yseencuentranagrupadas.LahebraGestorientadade5'a3'haciael
extremodeltelmeroyformaelextremo3'delADNcromosmico.Enlazonamsextremanoestapareada
formandounsegmentofinalmonofibrilarconunalongitudquevarasegnlaespecie.Lasprincipales
caractersticasestructuralesdelostelmerosseresumenenlafigura1.Lalongituddeltelmeroesvariable.
EnOxytrichayEuplotesesapenasde38pbmientrasenratonesalcanza150kb.Cadaorganismoposeeuna
longitudmediacaracterstica.LacantidaddeADNtporcromosomatambinflucta.Enalgunosorganismosla
longitudpromediodelostelmerosrespondeacambiosgenticosonutricionales.

Fig.1.Representacinesquemticadelaestructuradelostelmeros.(A)ElADNtelomricoconstade
pequeassecuenciasrepetidasricasenbasesdeguaninaconunextremomonofibrilar.(B)Elextremo
monofibrilarpuedeformarestructurasdetiposecundarioporapareamientodelasbasesdeguanina.(C)Estas
repeticionessirvenparalauninaprotenastantoenladoblehebracomoenlazonamonofibrilar.
LassecuenciasdeADNtmejorcaracterizadassemuestranenlatabla1confeccionadaapartirdelaexcelente
revisindeV.A.Zakian.2Lamayoradelassecuenciassoncortasyprecisas,comoenTetrahymenaqueesde
6pb(TTGGGG).Sinembargo,enS.cerevisiaeesheterognea,ymuylargaenK.lactisdondepresenta25pb.
Especiesmuydistantespuedenpresentarlamismasecuencia,comolosvertebrados,yespeciesmuycercanas
comoTetrahymenayOxytrichaserdiferentesaunquemuyrelacionadas.

Tabla1.SecuenciasdeADNtelomricomejorcaracterizadas
Organismo
Tetrahymena
Oxytricha

Secuencia
TTGGGG
TTTTGGGG

Giardia

TAGGG

Physarum

TTAGGG

Kluyveromyces

TCGGATTTGATTAGGTATGTGGTGT

Neurospora

TTAGGG

Caenorphabditis

TTAGGG

Vertebrados

TTAGGG

Mientrasmssecuenciastelomricasseconocen,msdifcilresultaencontrarunasecuenciaconsenso.La
existenciademltiplessecuenciastelomricassugierequelasfuncionesdelostelmerosnorequierendeuna
secuencianica.Elhallazgodesecuenciastelomricasensitiosinternosdeloscromosomasdemuestraque
ellasporsmismasnohacenlostelmeros.Invitro,lashebrasGpuedenaparearsedeformasdiversas.Una
deellasesladehlicestetrafibrilaresocuartetosG,quesemantienenpormltiplesparesG:G.Siestas
estructurassonimportantesparalafuncindelostelmerosseexplicaraelagrupamientodelasGquese
observaenlassecuencias.
Dosexcepcionesnotablesaparecenentrelostelmeros.EnParascarisnoseobservaladistribucinasimtrica
delasG,stasnisiquieraestnagrupadaspuessusecuenciaesTTGCA.EnDrosophilapresentanunaestructura
http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S086403001999000200009

2/7

11/7/2015

RevistaCubanadeInvestigacionesBiomdicasTelmerosytelomerasas

totalmentediferenterepresentadaporrepeticionesdeelementosdetransposicin.

Lasprotenastelomricas
Lasprotenastelomricas(PT)puedenpresentarseasociadasalextremomonofibrilaroalazonaadyacentede
doblehebra.EntrelasprimerassehaidentificadounaprotenadeOxytrichaquenoestrelacionada
estructuralmenteconningunaotraprotena.Invitro,estaprotenafacilitalaformacindecuartetosG,locual
sugierelaexistenciadeestasestructurasinvivo.Noselehadetectadouninazonasinternasdel
cromosoma.
UnaprotenadeuninalahebraGmonofibrilarenlevaduraseselproductodelgenEST1.LaunindeEST1pes
especficaparalasrepeticiones(TG1!3)ndeunasolahebrayrequieredeunextremo3'libre.3
LaprincipalPTdeuninalazonadedoblehebraenS.cerevisiaeeselproductodelgenRAP1.Suuninalas
repeticiones(TG1!3)ndehebrasimpleserealizaconmenosafinidadquealasdedoblehebra.Seha
demostradoqueRAP1pcontiene2motivosestructuralesdeuninalADNquesonhomlogosalosdeloncogen
myb.
ApartirdeclulasHeLasepurificunaprotenade60kDaqueseunealostelmeroshumanosysele
denominhTRF.Laprotenatiene439aminocidosparaunamasamolecularde50341daltonysuexpresinin
vitrodalugaraunaprotenadetamaosimilaralaidentificadaenlosextractosnuclearesdeclulasHeLa.4
Alrededordelaposicin350hTRFcontiene2secuenciasdelocalizacinnuclear,lazonaNterminalesricaen
asprticoyglutmicoyenlazonaCterminalpresentafuertehomologaconlaregindeuninalADNdel
oncogenmyb.Verlareferencia5paraunacomparacinconotrosTRFdemamferos.ApartirdelhTRFsepudo
localizarunaprotenatelomricaconmotivosdeloncogenmybenSchizosaccharomycespombe.6
Esdeesperarqueenlosprximosaossepuedanidentificarotrasprotenasimplicadasenlaestructuray
funcindelostelmeros.

Lastelomerasas
Eldescubrimientodelastelomerasasresolvienprincipioelproblemadelareplicacindelosestremosde
molculaslinealesdeADN.LaactividaddetelomerasafuedetectadaporprimeravezenTetrahymenay
despusenotroseucariontes.Enlareferencia7apareceunarevisindelosprincipalestrabajossobreesta
enzima.Laenzimaesunaribonucleoprotenayparasuactividadsonesencialestantoelcomponente
protenicocomoelARN.
EnTetrahymenaelARNtelomersico(ARNtl)tieneunalongitudde159nucletidos(nt)ycontiene9
repeticionesdelmolde5'CAACCCCAA3'.EstacaractersticaqueseobservatambinentodoslosotrosARNtl
identificados,permiteelapareamientodeltelmeroencrecimientoconelARNtlyqueanquedeunaregin
quepuedaservirdemolde.
Lastelomerasasdifierendetodaslaspolimerasasenqueutilizanunmoldeinternoenvezdeunoexterno,lo
cualimponelimitacionesestricasespecficasparalaelongacindeliniciadorylacatlisis.Latelomerasa
alargaelADNiniciadorporlaadicinunoaunodelosdesoxinuclesidostrifosfatadosyasgeneralas
repeticionesentandendelostelmeros.LadeTetrehymenapuedealargarADNiniciadoresOxytricha,
humanos,plantasylevaduras.EstosugierequelaenzimatieneafinidadgeneralporlassecuenciasricasenG
msqueporunmotivoespecficocomosucedeconotrasprotenasdeuninalADN.Peroentodosloscasos,la
secuenciaaadidasecorrespondeconelmoldedeARNdelaenzima.
Actualmente,seproponelaexistenciade2sitiosenzimticosindependientesdeinteraccinconelADN
iniciador.UnocontieneelmoldedeARNyalneaelextremo3'deliniciadorparasuelongacinenelcentro
cataltico.ElotroseunealADNiniciadorhaciaellado5'delmoldeyproporcionaunavadesalidaparalahebra
encrecimiento.EstemodeloexplicalaadicindevariasrepeticionessinquelaenzimasedisociedelADN
iniciador.EstesitiocatalticonicodebemoverseenrelacinconelARNmolde.ExperimentosenEuplotes
apoyanestemodelodelos2sitios.8Laenzimaposeetambinactividadendonucleolticaquepudieraestar
relacionadaconunafuncindecorreccin(fig.2).

http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S086403001999000200009

3/7

11/7/2015

RevistaCubanadeInvestigacionesBiomdicasTelmerosytelomerasas

Fig.2.Mecanismodeaccindelatelomerasa.(1)LaenzimacontieneelARNtelomersicoconunsector
complementarioalasecuenciadelostelmeros.(2)LaunindelADNtelomricoconelARNtelomersicose
produceporapareamientodebasescomplementarias.(3)Laenzimaalargaeltelmerousandocomomoldeel
ARN.(4)Alcompletarunalargamientolaenzimasedesplazaycomienzaunnuevociclodealargamientoyas
sucesivamente.

Elarntelomersico
ElARNtlhasidoaisladodenumerosasespecies.Lalongituddestevaradesde160a190ntenlosciliados
hasta1300enlevadurasycadaunodeelloscontieneunasecuenciamoldeapropiadaparalasntesisdelas
repeticionestelomricas.LosARNtlpresentanpocahomologadesecuencia,sinembargo,almenosen
ciliados,laestructurasecundariaestmuyconservada.EnTetrahymenasolamente159ntsonsuficientes
paraunfuncionamientoadecuado.Seignoraporquenotrasespeciesesmuchomslargo.Algunas
caractersticasdeestosARNserecogenenlatabla2.
Tabla2.CaractersticasdealgunosARNtelomersicos
Organismo

Molde

Longitud(nts)

CAACCCCAA

159

Euplotes

CAAAACCCCAAAACC

190

Oxytricha

CAAAACCCCAAAACC

190

Humanos

CUAACCCUAAC

450

CCUAACCCU

450

CACCACACCCACACAC

~1300

UCAAAUCCGUACACCAAUACCUAAUCAAA

~1300

Tetrahymena

Ratn
S.cerevisiae
K.lactis

LosestudiosconmutantesdeARNtlenTetrahymenahanmostradoquecambiosenalgunosdelos6ntdel
extremo5'(CAACCCCAA)producensecuenciasrepetidasalteradas,sinembargolos3ltimosnosonutilizados
comomoldeymsbienparecenparticiparenalineareliniciador.Enelmutante(AAACCCCAA)seproduceuna
disociacinprematuradelaenzimaantesdearribaralnucletidocambiado,talvezporefectosestricosdelos
nucletidosalteradosenelmoldeoporqueelARNdesempeealgnpapelenlacatlisisuotrafuncin.9

Protenastelomersicas
LatelomerasadeTetrahymenaconstade2polipptidos,p80yp95,elmenorseunealARNtlyelmayoral
ADNiniciador.LaenzimacontieneunacopiadecadaunadelasprotenasyunadelARNtlparaunamasa
molecularaparentede250kDa.Lassecuenciasdep80yp95noguardanunaextensahomologaconotras
protenas,loqueindicaquesetratadeprotenasnuevas.Noobstante,sehaencontradounahomologa
limitadaentrep95ylasARNpolimerasasdependientesdeARN(transcriptasasinversas,T1)ascomocon
motivosestructuralesdealgunasADNpolimerasas.EstemotivodeT1tambinseencuentraenlap123deE.
aediculatusyenelproductodelgenEST2deS.cerevisiaecuyadelecinproducedefectostelomricos.Los
cambiosdeunaminocidoporotroenelmotivodeT1deEST2pproduceacortamientodelostelmerosy
senescenciaenlevaduras,loqueindicasuimportanciaparaelalargamientodelostelmerosinvivo.10
http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S086403001999000200009

4/7

11/7/2015

RevistaCubanadeInvestigacionesBiomdicasTelmerosytelomerasas

Tambinsehanidentificadoenmamferos2protenasconhomologasecuencialconp80.Unadeellas
designadaTP1interactaconelADNt.11LaotraobtenidaderatassehadenominadoTLP1ysuADNccodifica
unaprotenade2629aminocidosparaunamasamoleculardeducidade240kDa(p240).12Estap240es
modificadainvivoyconvertidaenp230,talvezcomounmecanismopostraduccionalderegulacindela
actividaddelatelomerasa.

Genticadelatelomerasa
AlintroducircambiosenlasecuenciamoldedelARNtlenTetrahymenalasclulassehacenmuygrandescon
problemasenladivisinnuclearypierdenviabilidaddespusdevariasgeneraciones.Existeunaalteracinen
losmecanismosqueregulanlalongituddelostelmeros,talvezporqueseinhibelaunindelasPTal
cambiarlasecuencia.EnS.cerevisiaeladelecindeEST1produceunacortamientoprogresivodelos
telmerosyalcabodeunas50generacioneslasclulassehacenmuygrandesymuchasdeellasmueren.La
delecindelgenTLC1,quecodificaelARNtlydeEST2,EST3yEST4producefenotipossimilaresquenose
agravanenlosdoblesmutantes,loquesugierequeestosgenesestnenepistasis.13

Replicacindelostelmeros
Enlaestructuradelostelmerospredominalazonaderepeticionesenladoblehebraysolamenteelextremo
terminalpresentalaestructuramonofibrilar.Aunquelatelomerasaesnecesariaparamantenerlalongitudde
lostelmeros,estaenzimasloalargalahebraG.LareplicacindelahebraCdebehacerseporelsistema
convencionaldelaspolimerasas.EnlevadurasmutantesparalapolimerasaaylaprotenareplicativaC(RFC)
tienenalteracionesenlasntesisdelostelmeros.Tantoenlevaduras,enhumanos,comoenotros
organismoslostelmerossereplicanalfinaldelafaseS.14
LareplicacindelostelmerosesslonecesariaparacompensarlapequeaylentaprdidadeADNque
resultadelareplicacinincompleta,porlotantodebeserconsideradacomounafuncindereparacin.Eneste
proceso,elADNtelomriconotieneexactamentelafuncindemolde.InvitrolatelomerasadeTetrahymena
puedeaadirhasta500ntantesdesepararsedelADN.LasntesisdelahebraCporelsistemaconvencionalde
laspolimerasasgeneraraunalargamolculabifibrilarconunextremomonofibrilarde8a12nucletidos,que
esunbuensustratoparalatelomerasa.
Elestadodinmicodelostelmerosdependedevariosfactores,entreellos,laprocesividaddelastelomerasas,
lafrecuenciadesuaccinsobrecadatelmeroparticularylavelocidaddedegradacindelADNt.15LasPT
comoelhTRF1tambinpuedenregularsulongitud.16
Sehavistoqueenlevaduras,unmutante(TEL1)deficienteenlaregulacindelostelmeroseshomlogode2
genesimplicadosenlaregulacindelciclocelular:elMEC1enlevadurasyeldelaataxiatelangiectsica(ATM)
enhumanos,locualapuntaaunvnculoentrelareplicacindelostelmerosyelciclocelular.

Funcionesdelostelmeros
Lostelmerosrepresentanestructurasesencialesparalasclulas,puesevitanlafusincromosmica,
desempeanunimportantepapelenmantenerlaestabilidadcromosmica17yparticipantantoenlameiosis
comoenlamitosis.18
Sinembargo,sufuncinmsnotoriaesladeservircomounrelojmitticoquemideyregulaelnmerodelas
divisionescelulares.19Lostelmerosseacortanconcadadivisincelularyelnmerodedivisionesquela
clulapuedeexperimentarsecorrelacionaconlalongituddelostelmeros.20Esteacortamientopudiera
eliminargenesindispensablesparalavidaosilenciargenescercanosporelefectodeposicindeltelmero.
Unalongitudcrticapudieraserlasealparalaentradaenlasenescenciacelular.Sinembargo,valetener
presentequenoestrelacionadaconlaedaddelorganismo.
Laactividaddelatelomerasavaraendiferentesetapasdelavida.Sehadetectadoenovariosytestculosen
fetos,recinnacidosyadultos,peronoenvulosniespermatozoidesmaduros.Elblastocistoylamayorade
lostejidossomticosde16a20semanasdedesarrolloexhibenunaltoniveldetelomerasaquedesaparece
despusdelnacimiento.21Tambinesaltaentejidosadultosconunaintensaproliferacincelularcomoenlas
clulasendoteliales22yelendometrio.23Enotrasclulaspuedeserinducidaendeterminadasetapasdelavida
comoocurreconlaactivacindeloslinfocitosT24ylosB.25
Estafuncindelostelmeroslosrelacionadeinmediatoconlatransformacincancerosa.Enunodelos
primerostrabajossobreeltemaseencontrqueenclulascultivadasde18diferentestejidoshumanos98de
cada100inmortalesyningunade22mortalesmostrabanactividaddetelomerasa.Asimismo90de101biopsias
de12tiposdetumoresyningunade50detejidossomticosnormalesposeanactividaddelaenzima.26
Estudiosposterioreshanconfirmadounaactividadincrementadadetelomerasaencncerdemama,27
http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S086403001999000200009

5/7

11/7/2015

RevistaCubanadeInvestigacionesBiomdicasTelmerosytelomerasas

prstata,28astrocitomas29yotros.Estoshallazgospudierantenerimportantesimplicacionesclnicas.La
determinacindelaactividaddetelomerasapudieraserutilizadaparaeldiagnsticoprecozdelcnceren
pruebasnoinvasivas30ylosinhibidoresdelaenzimapudieranserusadoscomoagentesantitumoralesconun
altogradodeselectividadparalasclulastransformadas.

Perspectivas
Eldescubrimientodelasingularestructuranucleoprotenicadelostelmerosysuconservacinfilogentica
estructuralyfuncionaldemuestranelcarcteresencialdeesasestructurasparalavidadelaclula.La
existenciadelastelomerasassolucionaelviejoproblemasobrelareplicacindelosextremosdemolculas
linealesdeADN.Sinembargo,estoshallazgosplanteannuevosproblemas.Entreellosestdeterminarla
funcindelARNtlenlazonaquenofuncionacomomoldeysuposibleparticipacinenlacatlisisenzimtica.
Losfactoresqueregulanlaactividaddelaenzimaporunaparteylalongituddelostelmerosporotra.
Dilucidarlosmecanismosmolecularesquevinculanlostelmerosconlaregulacindelaproliferacincelular.
Tambinserinteresanteytrascendentallaposibleaplicacindeestosconocimientosparaeldiagnsticoy
tratamientodeenfermedadesproliferativas,especialmenteelcncer.Paradarrespuestaaestosyotros
problemasdebenencaminarselasfuturasinvestigaciones.

SUMMARY
Telomeresarespecializedchromatinstructureslocatedintheextremesofeukaryoticchromosomes.Boththeir
DNAandproteinspresentsingularcharacteristicsthatdifferentiatethemfromtherestofchromosomes.They
seemtobeinvolvedinamemberofcellfunctions,especiallythoserelatedtothecontroloflifespanof
differentcellspecies.Thesestructuresreplicateinthecellcyclethankstotheactivityoftelomerases.which
areenzimescomposedbyproteinsandRNAwithapeculiarmechanism.Recentresearchworkshavestudied
thebehaviouroftelomerasesincancercellsandtheirpossiblediagnosticandtherapeuticaluses.Thispaper
showsasummaryofthemainandmostrecentfindingsonthestructureandfunctionsoftelomeresandthe
actionbytelomerases.
Subjectheadings:TELOMERASE/physiologyTELOMERE/physiologyCELLCYCLE.

REFERENCIASBIBLIOGRFICAS
1. BlackburnEH,SzostakJW.Molecularstructureofcentromeresandtelomeres.AnnRevBiochem
198453:16394.
2. ZakianVA.Telomeresbeginningtounderstandtheend.Science1995270:16017.
3. ViriaPearimanV,MorrisDK,LundbladV.Est1hasthepropertiesofasinglestrandedtelomereend
bindingprotein.GenesDev199610:3094104.
4. ChongL,StenselBvan,BroccoliD,ErdjumentBromageH,HanishJ,TempstP,etal.Ahuman
telomericprotein.Science1995270:16637.
5. SmithS,LangeTde.TRF1,amammaliantelomericprotein.TrendsGenet199713:216.
6. CooperJP,NimmoER,AlishireRC,CechTR.Regulationoftelomericlenghtandfunctionbyamyb
domainproteininfissionyeastNature1997385:7447.
7. CollinsK.Structureandfunctionoftelomerase.CurrOpinCellBiol19968:37480.
8. HammondPW,LiveTN,CechTR.TheanchorsiteoftelomerasefromEuplotesaediculatusrevealedby
photocrosslinlingtosingleanddoublestrandedDNAprimers.MolCellBiol199717:296308.
9. BattachayA,BlackburnEH.AfunctionaltelomeraseRNAswapinvivorevealstheimportanceof
nontemplateRNAdomains.ProcNatlAcadSciUSA199794:28237.
10. LingnerJ,HughesTR,ShevchenkoA,MannM,LundbladV,CecchTR.Reversetranscriptasemotifsin
thecatalyticsubunitoftelomerase.Science1997276:5617.
11. HarringtonL,McPhailT,MarV,ZhouW,OultonR,BassMB,etal.Amammaliantelomeraseassociated
protein.Science1997275:9737.
12. NakayamaJ,SaitoM,NakamuraH,MatsuuraA,IshikawaF.TLP1:ageneencodingaproteincomponent
ofmammaliantelomeraseisanovelmemberofWDrepeatsfamily.Cell199788:87584.
13. LendvaTS,MorrisDK,SahJ,BalasubramanianB,LundbladV.SenescencemutantsofSaccharomyces
cerevisiaewithadefectintelomerereplicationidentifythreeadditionalESTgenes.Genetics
1996144:1399412.
14. ShimadaY,NakanoM,KandaN,MurakamiMurofushiK,KimJK,IdeT,etal.Cycledependentactivation
oftelomeraseinnaturallysynchronizedcultureofatrueslimemold,Physarumpolycephalum.Biochem
BiophysResCommun1997232:49216.
15. GreiderC.Telomerelengthregulation.AnnRevBiochem199665:3375.
16. SteenselBvan,LangeTde.Controloftelomerelengthbythehumantelomericprotein.Nature1997
385:7403.
17. PommierJP,LebeauJ,DucrayC,SabatierL.Chromosomalinstabilityandalterationoftelomererepeat
sequence.Biochimie199577:81725.
http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S086403001999000200009

6/7

11/7/2015

RevistaCubanadeInvestigacionesBiomdicasTelmerosytelomerasas

18. KirkKE,HarmonBP,ReichardtIK,SedatJW,BlackburnEH.Blockinznaphasechromosomeseparation
causedbytelomerasetemplatemutation.Science1997275:147881.
19. ChiuCP,HarleyCB.Replicativesenescenceandcellinmortality:theroleoftelomeresandtelomerase.
ProcSocExpBiolMed1997214:99106.
20. CounterCM.Therolesoftelomeresandtelomeraseincelllifespan.MutatRes1996366:4563.
21. WrightWE,PiatyszeckMA,RaineyWE,ByrdW,ShayJW.Telomeraseactivityinhumangermlineand
embryonictissuesandcells.DevGenet199618:1739.
22. HsiaoR,SharmaHW,RamakrishnanS,KeithE,NarayananR.Telomeraseactivityinnormalhuman
endothelialcells.AnticancerRes199717:82732.
23. SaitoT,ScheneiderA,MartelN,MizumotoH,BulgayMoeschelM,KudoR,etal.Proliferationassociated
regulationoftelomeraseactivityinhumanendometriumanditspotencialimplicationinearlycancer
diagnosis.BiochemBiophysResCommun1997321:6104.
24. WengN,LevineBL,JuneCH,HodesRJ.RegulationoftelomeraseRNAtemplateexpressioninhumanT
lumphocyutedevelopmentandactivation.Jimmunol1997158:321520.
25. IgarashiH,SakagushiN.TelomeraseactivityisinducedinhumanperipheralBlumphocytesbythe
stimulationtoantigenreceptor.Blood199789:1299307.
26. KingNW,PiatyszeckMA,ProwseKR,HarleyCB,WestMD,HoPLCetal.Specificassoiationofhuman
telomeraseactivitywithinmortalcellsandcancer.Science1994266:29115.
27. NawazS,HashizumiTL,MarkkhanNE,ShroyerAL,ShroyerKR.Telomeraseexpressioninhumanbreast
cancerwithandwithoutlumphnodemetastases.AmJClinPathol1997107:5427.
28. LinY,UemuraH,FujinamiK,HosakaM,HaradaM,KubotaY.Telomeraseactivityinprimaryprostate
cancer.JUrol1997157:11615.
29. SallinenP,MiettinenH,SallinenSL,HaapasaloH,HelinH,KononenJ.Increasedexpressionof
telomeraseRNAcomponentisassociatedwithincreasedcellproliferationinhumanastrocytomas.AmJ
Pathol1997150:115964.
30. ShayJW,GazdarAF.Telomeraseintheearlydetectionofcancer.JClinPathol199750:1069.
Recibido:29deseptiembrede1998.Aprobado:19dejuliode1999.
Dr.RolandoA.HernndezFernndez.InstitutodeCienciasBsicasyPreclnicas"VictoriadeGirn",Calle146y
Ave.31,Playa,CiudaddeLaHabana,Cuba.

20151999,EditorialCienciasMdicas
Calle23#654entreDyE,Vedado
CiudaddeLaHabana,CP10400
Cuba
ecimed@infomed.sld.cu

http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S086403001999000200009

7/7