Está en la página 1de 8

INSTITUTOPOLITECNICO NACIONAL

ESCUELA NACIONAL DE CIENCIAS BIOLOGICAS

GENETICA MICROBIANA
PRACTICA 1
AISLAMIENTO Y CARACTERIZACION DEL DNA

EQUIPO 5
FLORES MERCHANT BRENDA ALYN
GARCIA FELIPE IGNACIO GERARDO

SECCION 1

INTRODUCCION

GRUPO 5QM1

Los experimentos de Hershey-Chase probaron que el ADN era el material


gentico pero, no como el ADN conformaba los genes. El DNA deba transferir
informacin de la clula de origen a la clula hija. Deba tambin contener
informacin para replicarse a si mismo, ser qumicamente estable y tener
pocos cambios. Watson y Crick eran investigadores tericos que integraron
todos los datos disponibles en su intento de desarrollar un modelo de la
estructura del DNA. El DNA es una doble hlice, con las bases dirigidas hacia el
centro, perpendiculares al eje de la molcula y las unidades azcar-fosfato a lo
largo de los lados de la hlice. Las hebras que la conforman son
complementarias (deduccin realizada por Watson y Crick a partir de los datos
de Chargaff, A se aparea con T y C con G, el apareamiento se mantiene debido
a la accin de los puentes hidrogeno entre ambas bases). Una purina con doble
anillo siempre se aparea con una pirimidina con un solo anillo en su molcula.
Las purinas son la Adenina (A) y la Guanina (G). En el ADN se encuentra la
desoxirribosa.
Las
Pirimidinas
son
la Citosina (C)
y
la Timina (T).
Las
bases
son complementarias, con A en un lado de la molcula nicamente
encontramos T del otro lado, lo mismo ocurre con G y C. Si conocemos la
secuencia de bases de una de las hebras, conocemos su complementaria. En
cada extremo de una doble hlice lineal de DNA, el extremo 3'-OH de una de
las hebras es adyacente al extremo 5'-P (fosfato) de la otra. En otras
palabras, las dos hebras son antiparalelas, es decir, tienen una orientacin
diferente. En el esqueleto azucar -fosfato de del DNA los grupos fosfato se
conectan al carbono 3 de la molcula de desoxirribosa y al carbono 5 de la
siguiente, uniendo azcares sucesivos. La prima () indica la posicin del
carbono en un azcar. Por convencin, la secuencia de bases de una hebra
sencilla se escribe con el extremo 5'-P a la izquierda.
Debido a la presencia del anillo aromtico delas bases nitrogenadas, la
molcula puede absorber luz de 230 a 280 nm y esto permite identificarla ya
que presenta un espectro de absorcin caracterstico. Cuando se calienta un
ADN de doble hebra (forma nativa) se rompen las fuerzas de unin entre las
dos hebras y acaban por separarse. Por tanto el DNA desnaturalizado es una
sola hebra. En determinadas condiciones, una disolucin de ADN
desnaturalizado puede volver formar DNA nativo. Este proceso recibe el
nombre de renaturalizacin del DNA. Cuando es renaturalizado se forma a
partir de molculas de DNA de distinto origen o entre una molcula de DNA y
otra de RNA la renaturalizacin se conoce como hibridacin.
OBJETIVOS

Aislar DNA cromosmico de alto peso molecular, a partir de un cultivo


bacteriano y/o de un lisado fagico.
Establecer el espectro de absorcin de DNA aislado.
Determinar la concentracin y grado de pureza del DNA obtenido.

Mediante la aplicacin del programa bioinformatico DNAMAN

Determinar la influencia de algunas caractersticas de la secuencia de


DNA sobre su desnaturalizacin.

RESULTADOS
A. Aislamiento del DNA
De acuerdo al procedimiento realizado se obtuvo DNA de la cepa Escherichia
coli DH0B pCR2.1 Topo y Escherichia coli DH10B pCR2.1 TOPO-ape. Se aisl el
DNA.
B. Determinacin de la concentracin de DNA
Escherichia coli DH10B pCR 2.1 TOPO

C=

As 260 nm
4.0
g
C=
=1.77 x 104
x 1 x 10 6=177 g/mL
Aex b
22500 x 1
ml

pureza=

As 260 nm
4.0
pureza=
=2.13
As 280 nm
1.87

Escherichia coli DH10B pCR 2.1 TOPO-ape

C=

As 260 nm
52.66
C=
=2.34 x 103 g /ml x 1 x 106 =2340 g /ml
Aex b
22500 x 1

pureza=

As 260 nm
52.66
pureza=
=2.16
As 280 nm
24.33

C. Determinacin del espectro de absorcin del DNA


Nm

Escherich Escherichia
ia
coli coli DH10B
DH10B
pCR2.1
pCR2.1
TOPO-ape
TOPO
230 1.83
21.15
240 2.36
31.70
250 3.52
47.36
260 4
52.66
270 3.26
40.52
280 1.87
24.33
290 0.74
9.54
300 0.16
1.71
Tabla 1.- Absorbancias del aislamiento de DNA de Escherichia coli DH10B
pCR2.1 TOPO y Escherichia coli DH10B pCR2.1 TOPO-ape

D. Curva de desnaturalizacin del DNA del bacterifago Q


TM= 69.3+0.41 (G+C)
(G+C)= TM-69.3
0.41
(G+C) = 74.1-69.3
0.41
(G+C)= 11.8 POR LO TANTO (G+C) + (A+T)=100 DESPEJANDO (A+T)=
100 (G+C)
(A+T)= 88.2

Espectro de absorcion del DNA del plasmido pCR 2.1 TOPO


4.5
4
3.5
3
Absorbancia

2.5
2
1.5
1
0.5
0
210

220

230

240

250

260

270

280

290

300

310

Figura 1.- espectro de absorcin del DNA del plsmido pCR 2.1 TOPO

Espectro de absorcion del DNA del plasmido pCR 2.1 TOPO- APE
60
50
40
Absorbancia
30
20
10
0
210

220

230

240

250

260

270

280

290

300

310

Figura 2. Espectro de absorcin del DNa del plasmido pCR 2.1 TOPO-ape
E. Curva de desnaturalizacin del DNA
Grafica

Curva de desnaturalizacion del DNA


0.29
0.28
0.27
0.26

As 260 nm

0.25

TM

0.24
0.23
0.22
0.21
0.2
65

70

75

80

85

90

95

Figura 3. Curva de desnaturalizacin del DNA del bacterifago Q

F. Influencia de diferentes parmetros sobre la desnaturalizacin del DNA.


Las determinaciones se efectuaran empleando el programa DNAMAN.
Olig
onu
cle
tido
1

Longit
ud

(G,C)
%

Tm

Secuencia

40

50

40

75

40

62.5

86.
8
94.
2
90

40

57.5

40

57.5

40

57.5

20

50

GCATGCGCATGCATATGCGCATGCATATGCATATG
CGCAT
GCCGACGTGGCTCCGCCCGGATGCAACCCGCGT
CGGCTAG
AATGCCATCGTCAGCCGCCGGGTGCGGCCTCGCT
GATTAT
AAAGGTAGGCCGCTTCGCGACCCGGTCGAGCAA
GTTCATA
GTACGGTTAACCGGCCTACGGCTCCGGGGATGCT
TAACAT
CCGCCTCAAGCTAGGATCCGCCTGACTCTTGATAC
TGCGA
AAGTCCGTACAAGTCCGTAC

30

50

60

50

85.
2
82.
7
83.
5
54.
3
75.
4
84.
3

GCGCGTGTAATGCTCAAGTGCAAGGTCATT
TGCTAAATAGGTGCCTGCAAGTCGTACCCTATTGA
AGCTATAGCTCAGTAGCTCCTGCCG

DISCUCION
ANLISIS DE LA TCNICA
Durante la prctica se efectu el aislamiento de DNA de los plasmidos pCR 2.1.TOPO y pCR 2.1 .- TOPO-APE ; en el primer paso se coloc Tris/EDTA/glucosa , el
tris funciona como regulador de pH el cual favorece la aparicin de DNA , el
EDTA es un quelante que atrapa los iones Mg +2 para evitar las accin de las
DNAasas, la glucosa mantiene la fuerza inica para evitar daos al DNA.
Al adicionar la solucin de NaCl se precipitan las protenas, se favorece la lisis
celular y desnaturaliza el DNA; el SDS al ser un detergente disuelve las
membranas celulares y al romperse la membrana se libera DNA que tiene
protenas asociadas de las cuales se va a separar. En el siguiente paso se
adiciono acetato de potasio el cual va a neutralizar el medio y favorecer la
precipitacin de las protenas y el DNA genmico, el cido actico glacial
tambin favorece las condiciones para la neutralizacin del medio.
Posteriormente se verti una mezcla de fenol: cloroformo para quitar el exceso
de protenas. La adicin posterior del etanol absoluto fue para precipitar el
DNA y as obtenerlo en forma de pastilla despus de centrifugar, en el
siguiente paso se volvi a adicionar etanol pero al 70% esto fue para retirar el
exceso de iones del acetato de potasio; ya despus de dejar que se evaporara
el etanol se adiciono solucin salina la cual sirve para recibir el DNA sin que
este sufra daos.

Como se observa en las grficas logramos obtener el espectro caracterstico


del DNA ya que el pico de mayor absorbancia lo obtuvimos en la longitud de
onda de 260nm a la cual absorben en mayor grado la luz las bases nitrogenas
del DNA, aunque en la cepa recombiante (pCR 2.1 TOPO.- APE) se obtuvieron
absorbancias demasiadas altas a comparacin de la otra esto pudo haberse
debido tal ves que no solo se ley DNA si no tambin RNA o que se haya
cometido algn error en la tcnica de aislamiento ya sea durante el proceso o
desde el inicio de la toma de la cepa. Posteriormente con las lecturas a 260 nm
y 280nm se determin la concentracin y pureza del DNA obtenido, la cual fue

177 g/mL

de

para la cepa no recombinante mientras que

2340 g /ml

para la recombinante y de pureza 2.13 para la no recombinante y 2.16 para la


recombinante lo cual indica que tienen una pureza alta.

En el siguiente experimento construimos una curva de desnaturalizacin con


los datos proporcionados en el ejercicio, se determin el punto medio de la
parte recta de la curva e interpolo en el eje de las abscisas para obtener el
valor de TM del DNA del bacterifago Q el cual fue de 74.16, ya con este e
valor se despejo de la formula y se obtuvo una concentracin de (G+C) de
11.8 y por lo tanto lo restante fue concentracin de (A+T)= 88.2

En la influencia de diferentes parmetros sobre la desnaturalizacin del DNA se


observa que la influencia del contenido de GC es proporcional a la cantidad de
Tm (temperatura media de desnaturalizacin) ya que entre mayor porcentaje
de GC tenga el oligonucletido aumenta el valor de Tm. Con respecto a la
influencia de la variacin de la secuencia de nucletidos se observa que no hay
una diferencia significativa en los valores de Tm, es decir que no afecta la
variacin de la secuencia y por ltimo la influencia de la longitud de la
secuencia del nucletido se observa que el valor de Tm es proporcional a la
longitud del nucletido ya que entre mayor sea su longitud mayor es el valor
de Tm.
CONCLUSIONES

Se aisl el DNA de los plsmidos pCR 2.1.- TOPO recombinante y no


recombinante
Se obtuvo el espectro absorcin de plsmidos pCR 2.1.- TOPO
recombinante y no recombinante
La concentracin obtenida fue de

2340 g /ml

para pCR 2.1 TOPO-APE

177 g/mL

para pCR 2.1 TOPO y

La pureza obtenida fue de 2.13 para pCR 2.1 TOPO y de 2.16 para pCR
2.1 TOPO-APE
La pureza obtenida fue alta.
La concentracin de GC es directamente proporcional a su TM es decir a
mayor concentracin de GC mayor ser su TM.
La variacin de la secuencia de nucletidos no afecta significativamente
la TM.
La longitud de la secuencia es directamente proporcional a su valor de
TM es decir a mayor longitud mayor TM.

Bibliografa
http://www.biologia.edu.ar/adn/adnestructura.htm
http://www.ibt.unam.mx/sintesis/cuantificacion.html
https://books.google.com.mx/books?
id=FXDiqLK6GmAC&pg=PA835&lpg=PA835&dq=dna+espectro&source=bl&ots
=UrHryiX0PI&sig=ecFoffA9DSrLjckIlnLhNqipe0c&hl=es&sa=X&ei=CaM_VZO6J4
qesAXl74HYBA&ved=0CB0Q6AEwADgK#v=onepage&q=dna
%20espectro&f=false

También podría gustarte