Está en la página 1de 22

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial.

Ctedra Jerusalinsky

2015

Biologa e
Introduccin
a la Biologa
Celular
(Cd:54)
Gua de Actividades y
Ejercitacin Segunda Parte
(1er cuatrimestre de 2015)

Ctedra Jerusalinsky

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

Unidades 11 y 12. Ncleo. Transcripcin y traduccin. Regulacin de la


expresin gentica.
1) Complet el siguiente esquema con los nombres correspondientes:

2) Marc con una letra N, los procesos o eventos celulares que tienen localizacin nuclear, y con
una C, los que se localizan en el citoplasma.
sntesis de ARNm
sntesis de histonas.
replicacin o autoduplicacin del ADN.
transcripcin de un gen para ARNt.
unin de las protenas ribosomales a los ARNr.
sntesis del ARNr.
ensamble de la subunidad mayor con la menor del ribosoma.
traduccin del ARNm.
regulacin de la transcripcin.
maduracin del ARNm.
3) Redact breves prrafos relacionando los siguientes trminos:
a. complejos de poro nuclear histonas energa
b. nucleolo ARN ribosomal subunidades ribosomales
c. cromosomas cromatina protenas estructurales
4) De acuerdo a la actual definicin, un gen es un segmento de ADN a partir del cual se genera
un producto con funcin en la clula. Indic qu productos se pueden obtener a partir de los
distintos genes, y cul es la funcin de cada uno de ellos.
2

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

5) Complet el siguiente cuadro comparativo:


Genoma procarionte

Genoma eucarionte

Caractersticas de las
molculas de ADN
Localizacin del ADN
en la clula
Presencia de secuencias
no codificantes
Presencias de secuencias
repetidas
6) Seal:
a. cinco diferencias y cinco semejanzas entre la transcripcin en procariontes y en eucariontes.
b. tres diferencias entre los ARNm eucariontes y los ARNm procariontes.
7) Confeccion un cuadro comparativo entre transcripcin y traduccin considerando los
siguientes tems:
- tipo de proceso en cuanto a la materia y a la energa
- localizacin celular en eucariontes y procariontes
- sustratos
- productos
- enzima principal
- otras enzimas involucradas
- otras estructuras y/o macromolculas involucradas
- molcula con funcin de molde
- sentido de la lectura
- fuente de energa
- seal de inicio
- seal de finalizacin
8) Respecto al cdigo gentico:
a. Qu es? Qu significa que es universal? Qu significa que es degenerado?
b. Diferenci claramente los conceptos de cdigo gentico e informacin gentica.
c. Indic si las siguientes afirmaciones son verdaderas o falsas, justificando la eleccin:
1. El cdigo gentico contiene la informacin para la sntesis de las protenas.
2. El Proyecto Genoma Humano consiste en descifrar el cdigo gentico de la especie
humana.
3. Dada una secuencia de nucletidos, el cdigo gentico nos permite saber a qu
secuencia de aminocidos corresponde.
4. Dada una secuencia de aminocidos, el cdigo gentico nos permite saber a qu
secuencia de nucletidos corresponde.
9) La siguiente secuencia de nucletidos corresponde a la cadena molde de un fragmento de
ADN. Supon que se trata de un gen que codifica para una protena (para resolver este ejercicio
es necesario que copies la secuencia en tu cuaderno)
1
10
20
30
TAGCCTACGTATCATCTCCCGGGTACAAAATCAC
1. a. Cul es el resultado de la transcripcin?
b. Cul es el resultado de la traduccin?
3

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

2. Si se produce una sustitucin (cambio) del nucletido de la posicin 19 (cuya base nitrogenada
es citosina) por un nucletido de timina,
a. cul ser la consecuencia en la traduccin?
b. la protena obtenida tendr la misma forma y la misma funcin? Por qu?
3. Puede ocurrir que una sustitucin de un nucletido por otro no altere la secuencia de
aminocidos de la protena? Por qu? Explicar con un ejemplo.
4. Dadas las siguientes mutaciones puntuales cul ser la consecuencia en la traduccin para
cada una de ellas?
a. Sustitucin del nucletido de la posicin 15 (timina) por adenina.
b. Sustitucin del nucletido de la posicin 8 (citosina) por guanina.
c. Insercin (agregado) de un nucletido de adenina entre las posiciones 22 y 23.
d. Delecin (prdida) del nucletido de guanina de la posicin 9.
5. Considerando los ejemplos de los puntos 2, 3 y 4, explicar:
a. Cules son las mutaciones llamadas silenciosas? Con qu caracterstica del cdigo
gentico se relacionan dichas mutaciones?
b. Qu tipo de mutaciones producen un corrimiento del marco de lectura ?
10) Dada una clula cualquiera, cul sera la consecuencia si...
a. ... todos los ARNt para la leucina estn alterados, de modo que no reconocen a estos
aminocidos?
b. ...tiene alteradas todas las aminoacil ARNt sintetasas para el aminocido glicina?
c. ...ocurri un error durante la transcripcin de un ARNm de la protena J, que genera un
codn stop prematuro?
d. ...ocurri una mutacin en el gen de la protena J, que genera un codn stop prematuro?
e. ...ocurri una mutacin en el promotor del gen de uno de los ARN ribosomales que impide
su reconocimiento?
11) En las clulas eucariontes, la presencia de una envoltura nuclear que separa espacialmente
los procesos de transcripcin y traduccin, tiene una consecuencia fundamental para este tipo de
clulas De qu consecuencia se trata?
12) Luego de estudiar los mecanismos de regulacin de la expresin gentica en procariontes,
seal cinco similitudes y cinco diferencias entre los operones lac y trp.
13) Mencion cuatro niveles de regulacin de la expresin gentica en eucariontes, y explic
brevemente un ejemplo para cada uno.

Ejercicios de opcin mltiple Unidad 11


1. Las importinas son protenas que:
a. se sintetizan en el ncleo.
b. transportan monmeros al interior del ncleo
c. forman parte de la envoltura nuclear.
d. reconocen la SLN (seal de localizacin nuclear).
2. Seale la opcin correcta:
a. La heterocromatina contiene solamente secuencias altamente repetidas.
b. La eucromatina contiene genes que generalmente se estn transcribiendo.
4

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

c. El ADN del centrmero y los telmeros no est asociado a histonas.


d. Los centrmeros corresponden a segmentos de eucromatina.
3. En el nuclolo se:
a. sintetiza el ARN ribosomal
b. unen las subunidades ribosomales.
c. sintetizan las protenas y los ARN ribosomales
d. encuentran los genes de las histonas
4. Cul de los siguientes eventos ocurren en el ncleo?
a. Sntesis de protenas ribosomales.
b. Traduccin del ARNm
c. Duplicacin del ADN
d. Unin de las subunidades ribosomales.
5. Las siguientes macromolculas y/o estructuras presentan SLN:
a. Los ARN mensajeros, de transferencia y ribosomales.
b. Histonas y subunidades ribosomales.
c. Enzimas de la transcripcin y de la duplicacin del ADN.
d. Factores que intervienen en la traduccin.
6. Las histonas son protenas que:
a. se asocian indistintamente al ARN o al ADN.
b. poseen una seal reconocida por una importina.
c. se sintetizan en los ribosomas de la membrana nuclear
d. se sintetizan en todas las clulas
7. A travs del CPN (complejo de poro nuclear) sern importados al ncleo:
a. ARN mensajeros.
c. ARN de transferencia.
b. Protenas ribosomales
d. factores de traduccin.

Ejercicios de opcin mltiple Unidad 12


1.
a.
b.
c.
d.

Respecto al genoma de una bacteria:


presenta gran cantidad de secuencias repetidas
presenta muchos genes repetidos.
contiene genes que poseen informacin para histonas.
Contiene genes en copia nica.

2. Un gen es:
a. Un segmento de ARN que contiene informacin para la sntesis de una protena.
b. Un segmento de ADN que contiene informacin para la sntesis de algn tipo de ARN.
c. Una secuencia de nucletidos que siempre es traducida.
d. Una secuencia de nucletidos que necesariamente debe ser transcripta.
3. Seale una caracterstica que le permita distinguir la transcripcin en eucariontes, de la que
ocurre en bacterias:
a. requiere una ARNpolimerasa.
b. utiliza ribonucletidos trifostatados.
c. requiere factores basales de transcripcin.
d. es selectiva y asimtrica.
5

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

4. Seale cual es la secuencia de la molcula de ARNm sintetizada a partir de la siguiente


hebra codificante 5 ACCGGGTTAAA 3:
a. 3 UGGCCCAAUUU 5.
c. 5 UGGCCCAAUUU 3.
b. 3 UUUAACCCGGU 5.
d. 5 ACCGGGUUAAA 3.
5. Cul de las siguientes caractersticas se encuentra solamente en un ARNm bacteriano?:
a. la presencia de varios codones que codifican para metionina.
b. la presencia de un nico codn STOP.
c. la orientacin de 5 a 3.
d. la presencia de varios codones de iniciacin.
6. El proceso de splicing:
a. Ocurre sobre ARNm procarionte policistrnico.
b. En eucariontes da como resultado un transcripto primario.
c. Permite la eliminacin de intrones y el empalme de los exones.
d. Consiste en el alargamiento de la cadena de ARNm maduro por agregado de poliA
7. La transcripcin en una bacteria:
a. ocurre al mismo tiempo que la traduccin.
b. requiere de factores de transcripcin especficos.
c. utiliza varias ARNpolimerasas.
d. utiliza siempre la misma hebra como molde
8.
a.
b.
c.
d.

Que el cdigo gentico es degenerado significa que:


existen varios codones de inicio
cada aminocido est codificado por tres codones
los aminocidos pueden estar codificados por ms de un codn
el codn que indica el inicio de la traduccin tambin codifica para un aminocido

9. Respecto a la traduccin:
a. tanto en procariontes como en eucariontes se inicia en el citoplasma.
b. requiere solamente de la energa proveniente del ATP.
c. el ARNm se lee siempre desde el extremo 3 libre hasta el primer codon STOP.
d. se inicia siempre agregando el aminocido metionina en el sitio A (aminoacil).
10. En condiciones experimentales a partir de un nico ARNm bacteriano fue posible sintetizar 3
protenas distintas. Esto es debido a:
a. el splicing alternativo.
b. la presencia de polirribosomas.
c. las mutaciones en el ADN.
d. la presencia de mensajeros policistrnicos.
11. Las clulas musculares y las clulas nerviosas de un mismo individuo son iguales en cuanto a:
a. los genes que se expresan
b. todas las protenas que sintetizan
c. la informacin gnica que poseen.
d. todos los ARN mensajeros que sintetizan
12. Si se desea sintetizar el pptido metionina histidina fenilanalina lisina en el laboratorio,
cul de las siguientes sera la secuencia de ADN molde necesaria para la sntesis?:
6

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

a. 5 TACGTGAAATTTACT3.
b. 3 TACGTGAAATTTACT5.
c. 5ATGCACTTTAAATGA3
d. 3ATGCACTTTAAATGA5.
Considere los siguientes datos:his=CAC, fen=UUU, lis=AAA, stop=UGA, met=AUG.
13. Seale la opcin correcta:
a. el cdigo gentico de una bacteria ser diferente al de una clula epitelial humana.
b. el cdigo gentico de una bacteria ser igual al de una clula epitelial humana.
c. la informacin gentica de una clula epitelial ser diferente a la de una neurona de un
mismo individuo.
d. la informacin gentica de una clula epitelial ser la misma, tanto para un humano como
otro organismo no humano.
14. Tanto en el proceso de transcripcin como en el de traduccin se requiere energa que:
a. proviene de los propios sustratos
b. se utiliza para la unin entre monmeros
c. proviene exclusivamente del ATP y del GTP
d. se utilizara para la formacin de enlaces peptdicos
15. Cul de las siguientes opciones acerca del opern triptofano es correcta:
a. codifica para cinco protenas implicadas en la va de degradacin del triptofano.
b. la protena represora se une a la regin operadora en ausencia de triptofano.
c. la protena represora no se expresa constitutivamente.
d. en presencia de triptofano no se transcribirn los genes del opern.
16. Seale la opcin correcta respecto a los operones:
a. Son un sistema de regulacin gnica presente en todos los tipos celulares.
b. Sus genes estructurales se transcriben como un ARNm policistrnico.
c. La trascripcin de los genes reguladores depende de la presencia de una protena
especfica.
d. Sus genes estructurales codifican para protenas implicadas en diferentes vas metablicas.
17. Cul de las siguientes opciones incluye mecanismos de regulacin exclusivos de
eucariontes?:
a. induccin de la expresin gnica a travs de protenas reguladoras.
b. represin de la expresin gnica a travs de protenas reguladoras.
c. activacin de la ARN polimerasa a travs de protenas activadoras.
d. maduracin del producto de la transcripcin de un gen.
18. Los factores de transcripcin son:
a. secuencias de ribonucletidos con alta afinidad por el ADN
b. secuencias de desoxirribonucletidos con baja afinidad por el ADN
c. protenas con alta afinidad por el ADN
d. esteroides con baja afinidad por el ADN

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

Unidad 8. Sealizacin celular.


1) Con respecto a las seales qumicas:
a. Busc en la bibliografa la definicin de los siguientes trminos: hormona glndula
endcrina rgano blanco neurotransmisor factor de crecimiento.
b. Cul es la diferencia entre una seal qumica parcrina y una endcrina? Indique ejemplos
de cada una.
2) Confeccion un cuadro comparativo entre las seales hidroflicas e hidrofbicas en cuanto a:
- Localizacin de los receptores.
- Tipos de molculas y ejemplos.
- Formas en las actan en las clulas blanco
3) Observ la figura siguiente e describ brevemente qu ocurre en cada paso;
1-..
2-..
3-..
4-..
5-..

4) a. A qu se llama cascada enzimtica?


b. A qu se denomina segundo mensajero? D tres ejemplos de segundos mensajeros.
c. Utilizando el ejemplo de la hormona adrenalina, detall la secuencia de pasos que ocurren
a nivel celular desde que la hormona se une a su receptor, hasta que se desencadena una
respuesta en el interior celular. Pods guiarte por la siguiente imagen. En ella intent
identificar los siguientes elementos: hormona receptor transductor de la seal enzima
adenilato ciclasa segundo mensajero kinasa dependiente de AMPc (PKA).

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

Ejercicios de opcin mltiple Unidad 8


1. Las hormonas esteroideas se unen a:
a. un receptor de membrana
c. un receptor nuclear
b. un receptor citoslico
d. el ADN directamente
2.
a.
b.
c.
d.
3.
a.
b.
c.
d.

Seale la opcin correcta:


los neurotransmisores son liberados en el torrente sanguneo.
Las hormonas son siempre de naturaleza proteica.
Algunos receptores actan como canales para hormonas.
Algunos receptores tienen actividad enzimtica.
Los neurotransmisores:
estn presentes en todas las clulas.
son seales qumicas liberadas por las neuronas.
viajan por el torrente sanguneo.
se unen a receptores citoplasmticos.

4.
a.
b.
c.
d.

Una hormona es una seal:


siempre hidrofbica.
que no atraviesa la membrana plasmtica.
que puede provocar diferentes respuestas en diferentes clulas.
exclusiva de las clulas animales.

5.
a.
b.
c.
d.

El AMPc :
se une a un receptor de membrana
acta fosfoforilando enzimas intracelulares
acta como segundo mensajero amplificando una seal
es producido por una protena G

6.
a.
b.
c.
d.

La amplificacin de la seal es un fenmeno que ocurre ,entre otras cosas por:


La unin de una seal liposoluble a su receptor citoplasmtico
degradacin de los segundos mensajeros
el cierre de canales ligando dependientes
Aumento de la concentracin citoplasmtica de segundos mensajeros.

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

Unidad 13. Ciclo celular. Duplicacin del ADN. Mitosis. Meiosis.


1) Cuestionario sobre ciclo Celular:
a. Cules son las fases del ciclo celular eucariota y cules son los eventos ms importantes en
cada una?
b. Qu factores pueden modular la duracin del ciclo celular eucariota?
c. A qu se llama G0 y qu clulas se encuentran en este estado?
d. Mencion por lo menos tres ejemplos de tipos celulares que se encuentran en activa divisin.
e. Respecto al factor promotor de la fase S (FPS):
- Qu es y qu funcin cumple en el ciclo celular?
- Cul es la funcin de la subunidad cataltica?
- A qu se debe el nombre ciclina de la subunidad regulatoria?
f. Idem e) para FPM.
2) Confeccion un cuadro comparativo entre la duplicacin del ADN en procariontes y
eucariontes considerando los siguientes tems:
Localizacin celular
Enzima principal
Sentido de la sntesis
Sustratos
Fuente de energa
Nmero de sitios de origen de la replicacin en cada molcula de ADN
Terminacin del proceso
3) Indic si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente:
a. Las molculas resultantes de la duplicacin del ADN son idnticas entre s.
b. Los cromosomas homlogos son idnticos en cuanto a la forma, el tamao y la informacin
gentica que contienen.
c. En una clula 2n=6 que se encuentra en G1, el nmero de molculas de ADN presentes en su
ncleo es 12.
d. Si una clula que se encuentra en G1 se coloca en un medio que contiene un inhibidor de la
ADN polimerasa no se podr dividir.
e. Si una clula que se encuentra en G1 se coloca en un medio que contiene un inhibidor de la
ADN polimerasa no podr producir protenas.
f. Las clulas procariontes duplican su ADN en la etapa S
g. Las bacterias duplican su ADN por fisin binaria.
h. De la divisin de una bacteria se obtienen siempre dos bacterias con idntica informacin
gentica.
4) Indic brevemente:
a. Qu es un cariotipo?
b. Cules son las caractersticas del cariotipo humano masculino y femenino?
c. La utilidad de la confeccin de cariotipos de la misma especie.
d. La utilidad de la confeccin de cariotipos de distintas especies.
5) Observ el cariotipo humano que se encuentra en la figura de la izquierda y respond:
a. Cuntos cromosomas observa en total? Por qu se agrupan de a pares?
b. Corresponde a un hombre o a una mujer? Cmo lo sabs?
c. La informacin de todos los cromosomas ser igual o diferente?
d. Comparado con el que se encuentra en el cuadro derecho, qu diferencias encontrs?
e. Qu consecuencias tendrn estas diferencias para el individuo poseedor de este cariotipo?

10

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

6) Complet el siguiente cuadro comparativo:


MITOSIS

MEIOSIS

Clulas en que se produce


Variabilidad gentica
Presencia de cromosomas
homlogos
Apareamiento de los
cromosomas homlogos
Cantidad de ADN en las
clulas hijas respecto a la
original en G1
Numero de divisiones
Tipo de divisin
(ecuacional o reduccional)
Requiere de la duplicacin
previa del ADN?
7) Complet los siguientes esquemas correspondientes a la mitosis y meiosis, sealando:

Nombre de cada fase.

Grado de ploida y nmero de cromosomas para cada fase

Cromosomas homlogos, cromtides hermanas/ recombinantes, y eventos ms


representativos de cada fase.
11

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

ESQUEMA MITOSIS Y MEIOSIS

12

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

8) Cierta especie presenta una ploida 2n=6, y sus clulas presentan en G1 una cantidad de ADN
de 100 unidades arbitrarias. En base a estos datos complet los siguientes cuadros:
Etapa del
ciclo (clula
somtica)

N de
cromosomas

Cantidad
deADN

Nro de
cromtides por
cromosoma

N de
molculas
de ADN

Cantidad
de ADN

Nro de
cromtides por
cromosoma

N de
molculas
de ADN

G1
G2
Metafase
En cada polo
de la telofase

Etapa del ciclo


(clula
germinal)

N de
cromosomas

G1
G2
Metafase I
En cada polo
de la telofase I
Metafase II
En cada polo
de la telofase II
9) Indic si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente:
a. La segunda divisin meitica es reduccional porque da como resultado clulas haploides
b. Durante la interfase pueden ocurrir mutaciones puntuales y cromosmicas.
c. Durante la meiosis se separan primero las cromtidas y luego los cromosomas homlogos.
d. Una clula resultante de la mitosis tiene la mitad de ADN y de cromosomas que la clula madre
en G2.
e. Una clula n=8 puede provenir de una clula n=8 que hizo mitosis o de una clula 2n=16 que
hizo meiosis.
f. La clula huevo o cigota se divide por meiosis.
g. Los espermatocitos II son clulas haploides porque sufrieron primera divisin meitica
h. Un ovocito I en G1 tiene la misma cantidad de ADN que una ovogonia en G1
i. La mitosis permite que todos los individuos pluricelulares se reproduzcan asexualmente.
j. La meiosis ocurre solo en individuos de reproduccin sexual.

13

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

10) Para cada evento de la primera columna elegir la o las fases del ciclo celular en las que
ocurre:
Sntesis de histonas
Sntesis de ADN
Separacin de cromtidas hermanas
Mxima compactacin de la cromatina
Sntesis de ARN ribosomal
Desintegracin de la envoltura nuclear
Separacin de cromtides recombinantes
Formacin del huso acromtico
Descondensacin de los cromosomas
Apareamiento de homlogos
Separacin de cromosomas homlogos

perodo G1
perodo S
perodo G2
profase
metafase
anafase I
telofase
anafase II
profase I
anafase

11) Complet los siguientes cuadros sobre gametognesis en la especie humana:


Edad de la mujer
Hasta los 3 meses
de gestacin
Hasta el
nacimiento
2 aos

Clulas en el ovario

Edad del hombre


Hasta los 3 meses
de gestacin
Hasta el
nacimiento
2 aos

Pubertad

pubertad

30 aos

30 aos

70 aos

70 aos

Clulas en el testculo

Embarazo

12) Dada una especie 2n=4:


a. esquematiz:
una clula epitelial en profase
la cigota en anafase
una clula en profase I
un ovocito I en anafase
un espermatocito II en metafase
un ovocito II en anafase
b. Seal en cada esquema un par de cromosomas homlogos y un par de cromtidas
hermanas o recombinantes (si no fuera posible, explicar por qu).
c. En los casos que sea posible, indic el nombre de las clulas resultantes de la divisin
correspondiente.
13) En las clulas somticas humanas encontramos 46 cromosomas en total. Complet los cuadros
suponiendo que partimos de una cantidad de ADN de 100 unidades arbitrarias en G1.

14

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

Etapa del
ciclo (clula
somtica)

N de
cromosomas

Cantidad
De ADN

Nro de
cromtides por
cromosoma

2015

N de
molculas
de ADN

G1
G2
Metafase
En cada polo
de la telofase

Etapa del ciclo


N de
Cantidad
(clula germinal) cromosomas de ADN

Nro de
cromtides por
cromosoma

N de
molculas
de ADN

Nombre de la clula
germinal (masculina
y femenina)

metafase I
en cada polo de
la telofase I
profase II
metafase II
en cada polo de
la telofase II

Ejercicios de opcin mltiple Unidad 13


1. Indique la opcin correcta referida al ciclo celular:
a. En G1 se sintetizan las protenas histonas.
b. Durante la etapa S no se realiza la transcripcin.
c. La etapa G2 contiene el doble de ADN que G1.
d. En G1 el ADN se encuentra fuertemente asociado a histonas.
2. Si durante la replicacin del ADN de una clula bacteriana se impide, mediante la utilizacin
de un frmaco la polimerizacin, de fragmentos de ARN:
a. seguir replicndose pero no podr realizar la trascripcin
b. no podr replicar su ADN y por lo tanto no se dividir.
c. no podr replicar su ADN pero igual se dividir.
d. continuara replicndose pero lo har ms lentamente.
3. El proceso de replicacin del ADN:
a. es bidireccional en todas las clulas pero solo posee mltiples sitios de origen en eucariontes.
b. es bidireccional slo en eucariontes pero posee mltiples sitios de origen solo en
procariontes.
c. tanto en procariontes como en eucariontes es bidireccional y posee un solo sitio de origen.
d. es bidireccional slo en eucariontes y posee un solo sitio de origen en todos los tipos
celulares.
15

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

4. Los fragmentos de Okasaki son secuencias de:


a. ribonucletidos que permiten a la ADN pol comenzar a polimerizar el ADN.
b. desoxirribonucletidos que se sintetizan en forma discontinua.
c. ribonucletidos sintetizadas por la primasa.
d. desoxirribonucletidos que se sintetizan en sentido 3 a 5.
5. Todo el ADN de una clula esta marcado con timina radiactiva, si se producen dos clulas
hijas por mitosis, la marca aparecera en:
a. todos los cromosomas de las dos clulas hijas.
b. todos los cromosomas de una de las dos clulas hijas.
c. ninguno de los cromosomas de las clulas hijas.
d. algunos cromosomas de las dos clulas hijas.
6. Ciertos frmacos que se utilizan en tratamientos contra el cncer, actan inhibiendo la
polimerizacin de microtbulos durante la divisin mittica. Por lo tanto estos frmacos inhiben:
a. la formacin del huso acromtico
b. la desorganizacin de la membrana nuclear
c. la condensacin de los cromosomas
d. la reorganizacin de la membrana nuclear
7. La primera divisin meitica es:
a. ecuacional porque hay separacin de cromosomas homlogos.
b. reduccional porque hay separacin de cromosomas homlogos.
c. ecuacional porque hay separacin de cromtides recombinantes.
d. reduccional porque hay separacin de cromtides recombinantes.
8. La meiosis se diferencia de la mitosis en que:
a. en la metafase los cromosomas se ubican en la placa ecuatorial
b. se forma huso acromtico
c. hay apareamiento de cromosomas homlogos
d. se produce separacin al azar de cromtides hermanas
9. Cul de las siguientes caractersticas corresponde al proceso de ovognesis en humanos?:
a. se inicia siempre en la pubertad.
b. produce un total de 4 gametas por cada ovocito I.
c. se inicia en la vida intrauterina.
d. produce siempre un vulo por cada ovocito I.
10. Una ameba o un paramecio se reproducen asexualmente por:
a. fisin binaria o divisin simple. b. mitosis.
c. meiosis.
d. mitosis o meiosis.
11. Los ovocitos de una nia que aun no alcanz la pubertad contienen:
a. 46 cromosomas simples.
c. 23 cromosomas duplicados
b. 46 cromosomas duplicados.
d. 23 cromosomas simples
12. El caballo tiene un complemento diploide de 60 cromosomas y el asno de 66. Cuantos
cromosomas esperara encontrar en una mula, producto del cruzamiento de los dos anteriores:
a. 63.
b. 66.
c. 60.
d. 30
13. Si tuviera que comparar clulas del mismo individuo con respecto a su cantidad de ADN, la
de mayor cantidad correspondera a:
16

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

a. un hepatocito detenido en G0.


b. un espermatocito I en G2.

2015

c. un espermatozoide.
d. un espermatocito II en profase.

14. Considerando que la cantidad de ADN medida antes del perodo S es igual a 2C, seale
cual de las siguientes opciones es correcta:
a. en una clula somtica en metafase la cantidad de ADN seria 2C.
b. en una espermtide la cantidad de ADN seria C.
c. en una gameta la cantidad de ADN seria igual a 2C.
d. en cada clula hija luego de la divisin mittica la cantidad de ADN seria igual a 4C.
15. Seale cual de las siguientes opciones es correcta:
a. En una clula que est realizando mitosis no se observan cromosomas homlogos.
b. Todas las clulas somticas se dividen por mitosis.
c. Las clulas haploides se dividen por meiosis.
d. En una clula al comienzo de la meiosis II no se observan cromosomas homlogos.
16. Con respecto a la gametognesis en la especie humana:
a. la ovognesis se inicia en la pubertad.
b. la espermatognesis se inicia en la pubertad.
c. a partir de un nico ovocito I se producen cuatro gametas femeninas.
d. por cada espermatocito II se producen cuatro gametas masculinas.
17. Si en una fotografa de una clula humana en divisin se ven 23 cromosomas con dos
cromtidas c/u y en el plano ecuatorial, la clula se encuentra en:
a. metafase mittica.
c. metafase de meiosis II.
b. metafase de meiosis I.
d. profase de meiosis I.
18. Cul de las siguientes opciones hace referencia a la diferenciacin celular?:
a. en todas las clulas de nuestro cuerpo se encuentra la informacin para la hemoglobina
pero solo se expresa en los glbulos rojos.
b. las clulas del epitelio intestinal y las neuronas de un mismo individuo, tienen el mismo cdigo
gentico.
c. en los organismos eucariontes hay mucha informacin accesoria que no codifica para
nada.
d. en todas las clulas de un organismo pluricelular existe diferente informacin gentica.
19. Una clula del pulmn se diferencia de una clula de la piel de la misma persona en:
a. la informacin contenida en sus cromosomas
b. la expresin diferencial de sus genes
c. el cariotipo asociado a cada una de ellas
d. el nmero y tipo de genes que contienen

17

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

Unidad 13. Gentica.


Primera ley de Mendel, codominancia y herencia ligada al cromosoma X.
Dato: Para resolver los problemas de gentica humana, record que en nuestra especie
consideramos que los colores oscuros de pelo u ojos dominan sobre los colores claros.
1) En los ogros el color de piel verde domina sobre el color de piel azul. Teniendo en cuenta esto
antes de ir a ver (nuevamente) la saga de Shrek, conteste:
a) Puede una pareja de ogros azules tener un ogrito de piel verde?
b) Pueden Shrek y Fiona tener un ogrito de piel azul?
Justificar las respuestas con los cruzamientos correspondientes.
2) En las ratas de laboratorio el carcter cola larga domina sobre el carcter cola corta. Suponga
que Ud. tiene una rata de cola larga Cmo hara para averiguar su genotipo?
3) Una mujer de grupo sanguneo A tiene un hijo de grupo B. Indicar todos los genotipos posibles
de la mam, el beb y el pap.
4) Para cada una de las siguientes parejas, cul es la probabilidad de tener un hijo (varn o
mujer) daltnico?
Pareja N
Mujer
Hombre
1
Portadora
De visin normal
2
Daltnica
De visin normal
3
De visin normal
Daltnico
(no portadora)
5) Cmo debe ser el genotipo de una pareja para que, en el caso de que tengan una hija
mujer, ella sea daltnica?
6) El factor Rh presenta dos alelos: Rh+ domina sobre Rh . Ana tiene sangre factor Rh+ y Juan
tiene sangre factor Rh Cul es la probabilidad de que esta pareja tenga un hijo de factor
Rh+?
7) Dos personas fenotpicamente normales (A_) tienen un hijo albino (aa)
a. Cul es la probabilidad de que su segundo hijo manifieste ese rasgo?
b. Dibujar una clula somtica de uno de los padres, indicando cromosomas homlogos y
alelos (suponer 2n=4)
8) En las langostas, el color de ojos rojo domina sobre el color de ojos blanco. Se cruza una
langosta macho de ojos blancos con una hembra de ojos rojos y se obtienen 309 langostas de
ojos blancos y 298 de ojos rojos.
a. Indicar genotipo y fenotipo de los padres y la descendencia.
b. Dibujar las posibles gametas de la hembra indicando cromosomas homlogos y alelos
(suponer 2n=8)
9) Indicar la respuesta correcta: Dado un individuo heterocigota para un determinado carcter,
solamente se puede garantizar que el 100% de su descendencia tendr fenotipo dominante si
se aparea con un individuo
a) heterocigota
c) homocigota dominante
b) homocigota recesivo
d) homocigota, dominante o recesivo

18

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

10) En la telenovela de la tarde la familia Gonzlez - Iturralde comienza a dudar de que la beb que
les dieron en la maternidad, sea su legitima heredera, piensan que fue cambiada al nacer por la
hija de la familia Corts. Se ordena el examen de los grupos sanguneos de las respectivas hijas y
de los padres, con los siguientes resultados:
Madre
Padre
Hija
Familia Gonzles - Iturralde
AB
O
A
Familia Corts
A
B
O
a. Es cierto que a los Gonzlez - Iturralde son los verdaderos padres de la hija del matrimonio
Cortes. Justifquelo mediante los cruzamientos necesarios.
b. Conociendo tan solo los fenotipos de sus padres y habiendo cursado Biologa, podra la
hija de los Cortes dudar de ser la hija de su padre? Cmo debera ser el genotipo de su
padre para asegurar que la Sra. Corts no ha sido infiel?
11) Un hombre de grupo sanguneo A y una mujer de grupo AB tienen un hijo de grupo B Cul es
la probabilidad de que su prximo hijo sea de grupo A?
12) Indicar la respuesta correcta: Qu grupos sanguneos pueden heredar los hijos de un hombre
de grupo B y una mujer de grupo A, ambos homocigotas?
a) A o B solamente
c) A, B o 0
b) A, B, AB o 0
d) AB solamente

Segunda ley de Mendel.


1) Se realiza el cruzamiento de una planta de semillas amarillas (A) y Lisas (L), de una lnea pura,
con otra de semillas verdes y rugosas. Seale si las siguientes afirmaciones son verdaderas o falsas.
a. Todas las plantas de la F1 sern de semillas amarillas y lisas.
b. Todas las plantas amarillas y lisas formarn solamente un tipo de gametas.
c. Las plantas de la F2 tendrn solo dos fenotipos posibles: semillas amarillas y lisas, o semillas verdes
y rugosas.
d.Entre los individuos de la F2 habr al menos 16 genotipos diferentes posibles.
2) Cuntas gametas diferentes puede formar...
a. ...una persona que presenta un genotipo heterocigota para dos genes (AaBb) (se sabe que
ambos genes se encuentran en diferentes pares de cromosomas homlogos).
b. ...una persona que presenta un genotipo heterocigota para el color de pelo y homocigota
recesivo para el factor Rh?
c. ...una persona que presenta un genotipo homocigota para dos caracteres?
3) En una especie de aves, el pico recto domina sobre el pico curvo, y el color gris de las plumas
domina sobre el marrn. Un ave macho heterocigota para ambos genes se cruza con una
hembra de pico recto y plumas marrones. Algunos de sus pichones tienen pico curvo.
a. De acuerdo a estos datos cul es la probabilidad de que tengan pichones de pico recto y
plumas grises? Justific con el cuadro correspondiente.
b. Suponiendo 2n=4, dibuj: i) una clula somtica del macho en metafase y ii) una clula
sexual de la hembra en anafase I. En ambos dibujos seal un par de cromosomas
homlogos, un par de cromtidas hermanas o recombinantes y los alelos para cada gen.
4) Marcos es de ojos oscuros y padece fenilcetonuria (enfermedad recesiva no ligada al sexo).
Marcela, de ojos claros, es sanita. Pepe, el hijo de ambos, es de ojos claros y fenilcetonrico.
a. Indicar genotipo y fenotipo de los tres integrantes de la familia
b. Cul es la probabilidad de que un hermanito de Pepe sea fenilcetonrico y de ojos claros?
19

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

c. Dibujar una clula de Marcos en metafase, otra en metafase I y otra en metafase II,
indicando cromosomas homlogos, cromtidas hermanas y alelos (suponer 2n=4).
5) Una mujer morocha y de ojos negros y un hombre rubio y de ojos celestes tienen dos hijos: uno
morocho y de ojos celestes y otro rubio y de ojos negros.
a. Indicar los genotipos de los cuatro integrantes de la familia
b. Cul es la probabilidad de que un tercer hijo sea morocho y de ojos negros?
c. Dibujar una clula del hombre en anafase I, indicando cromosomas homlogos, cromtidas
hermanas o recombinantes y alelos (suponer 2n=6).
d. Dibujar una clula de la mujer en anafase II, indicando cromosomas homlogos, cromtidas
hermanas o recombinantes y alelos (suponer 2n=6).
6) Una mujer cuyo fenotipo es B, Rh+ da a luz un beb de fenotipo A, Rh-.
a. Indicar todos los genotipos posibles de la mam y el hijo.
b. Cmo debera ser genotpicamente el pap para asegurar que su esposa le ha sido fiel?
c. Cmo debera ser genotpicamente el pap para asegurar que su esposa lo ha
engaado?
7) En la zona pampeana habita una especie de ratn de campo. Supon que en dicha especie el
pelaje gris domina sobre el negro, y que la cola larga domina sobre la cola corta. Un ratn gris y
de cola corta y una ratona negra y de cola larga, tuvieron una camada de ratoncitos. Entre ellos
haba uno con el mismo fenotipo que el pap y otro con el mismo fenotipo que la mam. En base
a estos datos:
a. Indic (con palabras) el genotipo de los cuatro ratones mencionados. Justific tu respuesta de
la manera ms clara y completa posible.
b. Cul es la probabilidad de que esta pareja de ratones tenga un descendiente heterocigota
para ambas caractersticas? Para justificar tu respuesta realiz el cruzamiento correspondiente.
8) Los lemures de cola anillada son una especie de primates. Se sabe que el color de sus ojos est
codificado en un gen con dos variantes: el color miel domina sobre el color negro. Por otro lado,
los mechones que recubren sus orejas pueden ser largos (dominante) o cortos (recesivo). Una
hembra, homocigota recesiva para ambas caractersticas, tiene, tras sucesivos apareamientos
con un mismo macho, cuatro descendientes todos fenotpicamente diferentes entre s.
a. Indicar los genotipos y fenotipos de los padres y de las cras.
b. Cul es la probabilidad de que nazca otro hijo de ojos color negro y mechones largos?
c. Suponiendo que los lemures tienen en sus clulas somticas 4 cromosomas, y que en G1
contienen 40 unidades arbitrarias de ADN, completar la tabla:
Etapa del ciclo celular

No de
No de cromtides
cromosomas
en la clula

Cantidad
de ADN

G2 (interfase)
Metafase mittica
En cada polo de telofase II

Ejercicios de opcin mltiple Unidad 13. Gentica.


1. Una mujer cuyos padres eran ambos de grupo AB, es de fenotipo B. Se casa con un hombre
de grupo 0, con el que tiene 3 hijas todas fenotpicamente iguales a ella. En base a estos datos
indique la opcin correcta:
a. el genotipo de las hijas ser igual al de la madre.
20

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

b. la madre es homocigota dominante para grupo sanguneo


c. la madre es heterocigota para grupo sanguneo.
d. las hijas son homocigotas para grupo sanguneo.
2. Al cruzar dos moscas verdes se obtuvieron slo 29 moscas negras de un total de 119
descendientes. Cul o cules sern los genotipos de la descendencia?:
a. heterocigotas.
b. homocigotas recesivos.
c. homocigotas dominantes y heterocigotas.
d. homocigotas recesivo, homocigota dominante y heterocigota.
3. Un padre y su hijo varn, ambos daltnicos (enfermedad ligada al sexo), tendrn:
a. cariotipos diferentes y el mismo genotipo referido al daltonismo.
b. Igual fenotipo y genotipo referidos al daltonismo, e igual cariotipo.
c. cariotipos iguales y diferente genotipo referido al daltonismo.
d. cariotipos iguales y diferente fenotipo referido al daltonismo.
4. El dedo ndice corto se manifiesta como un carcter recesivo ligado al sexo. Una mujer con
el dedo ndice corto y un hombre con dedo ndice normal tienen una hija con dedo ndice
normal. Cul es la probabilidad de que el segundo hijo de la pareja tenga el dedo ndice
normal, si resulta varn:
a. .
b. .
c. 1.
d. 0
5. Un mujer de grupo 0 y factor Rh- tiene un hijo A Rh+. Cul de los siguientes fenotipos podra
corresponder al padre del beb?:
a. 0 Rh+.
b. AB Rh-.
c. AB Rh+.
d. 0 Rh6. En el laboratorio se obtuvieron dos lneas puras de rata domstica, la primera tena pelaje
marrn y bigote ralo, mientras que la otra era de pelaje blanco y bigote espeso. Al cruzarlas
entre s, todos sus descendientes eran de marrones y de bigote ralo. Si se realizara el
cruzamiento prueba de una rata de la F1, cul sera la probabilidad de tener un descendiente
marrn y de bigote espeso?:
a. 0.
b. .
c. 2/4.
d. 1/4
7. En una especie de grillos los individuos pueden presentar patas largas (A) o cortas (a), y el
color puede ser verde (B) o marrn (b). Una hembra de patas largas y color verde tuvo, con un
macho de patas cortas y cuerpo marrn, una abundante descendencia. Entre tantos grillitos
haba una hembra de patas cortas y color verde, y un macho de patas largas y de color
marrn. En base a estos datos, indique la opcin correcta:
a. El genotipo materno es homocigota dominante para las dos caractersticas.
b. El genotipo paterno es heterocigota.
c. Todas las gametas de la madre son portadoras de un alelo recesivo para alguna de las dos
caractersticas.
d. Tienen de probabilidad de tener un hijo fenotpicamente igual a cada uno de los padres.

21

Gua de Actividades y Ejercitacin de opcin mltiple. Segundo Parcial. Ctedra Jerusalinsky

2015

Gentica humana (algunos ejemplos)


Alelo dominante

Alelo recesivo

Capacidad de enrollar la lengua

Si

No

Hoyuelos en las mejillas

Presencia

Ausencia

Hoyuelo en la barbilla o barbilla partida

Presencia

Ausencia

Capacidad de doblar el pulgar

Pulgar curvado hacia atrs

Pulgar recto

Pecas

Presencia de pecas

Ausencia

Color de pelo

Marrn

Rubio

Color de ojos

Marrn (verde, pardo)

Celeste

Textura del pelo

Rizado

Lacio

1. Capacidad de enrollar la
lengua

3. Barbilla partida

2. Hoyuelos en las mejillas

5. Presencia de pecas

4. Capacidad de doblar el dedo pulgar

6-7 Color de pelo y ojos 8. Textura del pelo

Escrib tu propio fenotipo y genotipo:


1

Fenotipo
Genotipo /s
posible/s
22