Está en la página 1de 68

Decisiones

Deteccin

Diagnstico

Investigacin
Terapia

TECNICAS DE ESTUDIO MOLECULAR

PCR

Que es genotipificacion?
Genoma: es la totalidad de la informacin gentica que posee un
organismo en particular y que codifica para l.. En humanos, el genoma
consiste de 23 pares de cromosomas

Alelo: Diferentes formas o variantes de una gen


Genotipo: Conjunto particular de alelos para todos los genes portados por

un individuo

Genotipificacin

Determinacin del genotipo de una persona

PCR
REACCION EN CADENA DE LA POLIMERASA
Amplificacin enzimtica de un fragmento de DNA
(simulando una replicacin natural del DNA in vitro)

Eventos en la Replicacin del DNA:

Apertura de las cadenas (origen de replicacin)

Colocacin de los iniciadores (primers de RNA)

( La cadena lder utilizar un solo iniciador mientras que las


cadenas rezagadas utilizarn varios iniciadores de RNA.)

Sntesis de cadenas de DNA (partiendo de los iniciadores)

Eliminacin de los iniciadores de RNA.

Unin de los fragmentos de DNA (por la enzima DNA

ligasa)

Reaccin en cadena de la polimerasa


(PCR)

Componentes
Desoxinucleotidos (dNTPs) dATP, dTTP, dGTP,
dCTP
Enzima Taq (Thermus aquaticus)
Iniciadores (Primers) Complementarios a la cadena
de ADN
ADN molde Concentracion de 20ng

PCR: Ciclador trmico

Desoxinucleotidos (dNTPs)

Bases Nitrogenadas del ADN


Union por puentes de hidrogeno
Adenina-Timina
Guanina-Citocina

ADN polimerasa

Estable a altas
temperaturas
Thermus
aquaticus

Thermococcus
litoralis

Enzima de 95kd.
Actividad
Exonucleasa: 53

Actuar altas temperaturas

PRIMERS
(Iniciadores, Cebadores)
Dos oligonucletidos que
son complementarios a
cada una de las dos hebras
del ADN.

nicos: Asegura alta especificidad:

5
3

5
3

3
CARACTERSTICAS
IMPORTANTES

nicos
Tamao
Dimeros de primers

5
La secuencia del extremo 3 es critica para el
funcionamiento

Tamao
Efectos en:
Carcter de nico

Mas tamao (15pb)


Temperaturas de anillaje (Tm)
La temperatura a la cual la mitad de las hebras de ADN son
doble cadena (dc) y la mitad cadena sencilla (cs)

Par deprimers
especficos

ADN templado
Buffer p/ ADN Pol.

MgCl2

dCTP
dATP

dTTP
dGTP

dH2O
estril

PCR
Mezcla de Reaccin

Desoxinucletidos

Etapas de la PCR
1. Desnaturalizacin: Apertura de la doble cadena
2. Alineamiento: Anillaje de primers
3. Extensin: Generacin de la nueva cadena

Temperatura

30 ciclos
100

Desnaturacin

Desnaturacin

94 oC

Extension
72 oC

50

50-60oC
Anillaje

Tiempo

94 oC

Temperatura

100

Melting
94 oC

PCR

50

Tiempo

DNA de
cadena doble

Temperatura

100

PCR
94 oC

50

Tiempo
3

DNA de
cadena simple

Calor

Temperatura

100

PCR
94 oC

50

Melting
94 oC
Extension
Annealing
72 oC
Primers
50 oC

Tiempo
3

5
5

Hibridacin
de primers

5
5

Temperatura

PCR
100

94 oC

50

Melting
94 oC
Extension
Annealing
oC
72
Primers
50 oC

Tiempo
3

Calor
5

Calor
5
5

30 ciclos

Temperatura

PCR
100

94 oC

50

Melting
94 oC
Extension
Annealing
72 oC
Primers
50 oC

Tiempo
3

5
5

30ciclos

Temperatura

PCR
100

50

94 oC

30ciclos

Annealing Extension
72 oC
Primers
50 oC

0
3

Tiempo
5

5
5

Calor
5

Calor
5

94 oC

Temperatura

100

50

PCR
94 oC

30ciclos

Annealing Extension
72 oC
Primers
50 oC

0
3

5
5

Tiempo
5

94 oC

Temperatura

PCR
100

94 oC

50

30ciclos

Annealing Extension
72 oC
Primers
50 oC

0
3

5
5

Tiempo
5

Fragmentos de
tamao definido

94 oC

El numero de copias del DNA delimitado por los primers


se duplica en cada ciclo de PCR.
Numero de copias
1
2
4

0
1
# ciclos

16

32

64

PCR animation

PCR

El numero de copias del DNA delimitado por


los primers se duplica en cada ciclo de PCR.
Numero de copias
1

16

32

64

Numero de ciclos

Electroforesis
Revelado
Separacin de molculas en un campo elctrico
Electrodo (+)

Cmara de electroforesis
Camas para preparacin del gel
de agarosa
Fuente de poder

Electrodo (-)

Agarosa y su preparacin
Gel acta como filtro molecular, controlando la migracin en
funcin del peso molecular

Agarosa

Mezclar agarosa con una solucin


tampn como el TAE (tris-ac.
Acetico-EDTA)

Calentar

Tincin con Bromuro de etidio


Agente intercalante Bromuro
de Etidio
Molcula fluorescente que se
intercala entre la s bases de la
molcula de DNA
Absorcin a 330 nm
(UV)emisin en luz visible

Factores que afectan la velocidad de migracin


1. TAMAO DEL FRAGMENTO
la velocidad de migracin del fragmento es
inversamente proporcional al log del n de
pares de bases

2. CONFORMACION DE LA
MOLECULA
ADN circular

ADN Lineal

3. VOLTAJE APLICADO
La velocidad de migracin es
proporcional al voltaje aplicado

4. CONCENTRACIN
AGAROSA
Inversamente proporcional a
velocidad de corrido
2% 1.5%

1% 0.5%

Interpretacin de electroforesis
Marcador de peso molecular
1.Permite identificar tamao de fragmentos

25pb

50pb

100pb

Ejemplos de corridos de electroforesis


Con marcador de 100pb
Con marcador de 50pb
M

300pb 400pb
250pb

150pb
100pb
400pb
350pb 300pb
250pb

Bandas Inespecficas

Corrido de electroforesis con bandas


inespecficas

Bandas definidas con diferentes


pesos moleculares

Interpretacin de electroforesis
Calidad del ADN
BUENA CALIDAD DE ADN
1

CP: Control Positivo


CN: Control Negativo
1-6: Pacientes

CP CN

DIFERENTES CALIDADES DE ADN


1

CP

CN

CP: Control Positivo


CN: Control Negativo

Pozo 2 No ADN
Pozos 3 y 4 Bajas concentraciones

Tcnicas derivadas/ basadas en PCR


PCR Nested

:Amplificacin de una secuencia dentro


de otro previamente amplificada

PCR Multiplex

:Varios targets diferentes en forma


simultnea

PCR-RFLP

:Polimorfismo gentico

RT-PCR

: Deteccin de mRNA

Real Time PCR

:Cuantificacin de copias iniciales en


tiempo real

PCR Nested (anidada)


Dos rondas de amplificacin con diferentes pares de primers

1 Reaccin
Primers externos
para amplificacin
de una secuencia
extensa
2 Reaccin
Primers internos
para amplificacin
de una regin
especifica

SEGUNDA PCR

Genera mayor ESPECIFICIDAD

PCR Multiplex
Amplificacin de varias
secuencias de forma
simultanea
Diferentes set de primers
Ojo Tamao del
amplicon

APLICACIONES

Ensayos de deleciones
Amplifica exones
Ensayos forenses
Biomarcadores polimrficos
Ensayos microbiolgicos
Cepas y especies

RFLPs
Restriction fragment length polymorphism
Estudios de polimorfismos:
variacin en la secuencia de
ADN

METODOLOGIA
1. Extraccin de ADN
2. PCR se obtiene la
secuencia target

3. Digestin con enzimas de


restriccin mecanismo de
defensa de bacterias
4. Electroforesis en gel

Cambios en el sitio de restriccin

Person A
5' GGCC

GGCC

GGCC

GGCC

3'

GGCC

GGTC

GGCC

3'

Person B

5' GGCC

Cambios en el sitio de restriccin

Hae III corta:


5' GGCC
CC

5 GGCC 3

GGCC

GGCC
GG
CC

CC

3'

GG
CC

5' GGCC

GGCC

GGCC

GGTC

GG

GGCC

GG
CC

GG

3'

ADN NORMAL
A

ADN

ADN

NORMAL

SILVESTRE

B+C

C
C

ADN MUTADO
B

A
A

B+C

PCR en tiempo real (RT-PCR)


La tcnica RT-PCR combina la amplificacin del DNA con la deteccin de
los productos en un solo tubo.
Tiempo Real: Deteccin de productos de PCR en la medida que se van
generando
Monitoreando la amplificacin de una secuencia especifica en tiempo
real utilizando tecnologas fluorescentes
UTILIDADES
- Genotipificacin
- Cuantificacin de carga viral
- Cuantificacin del numero de copias
de un gen
- Expresin gnica (RNA)
Retrotranscripcin

Componentes RT-PCR
Target
DNA Polimerasa

Primer

Nucletidos
Solucin Buffer
Sonda
Termociclador

Segmento de ADN que se ha seleccionado para


amplificar. Es el molde (Muestra).
Enzima capaz de copiar el ADN usado como molde
una hebra simple de ADN (produce una hebra
complementaria).
Segmentos cortos de ADN de cadena simple
especfico para un segmento de DNA. Los primers
son usados como punto inicial de la actividad de la
DNA polimerasa.
Pequeas unidades de ADN; letras del alfabeto
biolgico (A, T, C, G).
Solucin que rene las condiciones necesarias para
que la reaccin de amplificacin se de.
Segmento corto de ADN complementario al target
(marcadores fluorescentes)
Equipo que produce ciclos trmicos (Capacidad de
detectar sondas)

PCR Convencional Vs. PCR en Tiempo Real

PCR
tradicional
Preparacin de la
Muestra

Amplificacin

Deteccin

PCR en
Tiempo Real

Preparacin de la
Muestra

Amplificacin y Deteccin

Sistemas de Deteccin
Uso de molculas fluorescentes
No-Especfico
SYBR Green I
Molecular fluorescente que se unen
a ADN
Emisin a 520nm

DESVENTAJAS
Inespecfico

Curva de Melting

PRODUCTOS ESPECIFICOS

Curva de melting

PRODUCTOS ESPECFICOS TIENE UN MAYOR TM

Sistema de Deteccin Especfico


TaqMan
Uso de secuencia especifica
de oligonucleotidos

- Reportero 5: Emite
fluorescencia
- Quencher 3: Bloquea emisin
de fluorescencia

Actividad 5 nucleasa

Separacin reportero-quencher

Sistema de Deteccin Especfico


Molecular Beacon Probes

Secuencia de la
sonda

Stem

Quencher
Fluoroforo

Molecular Beacon Probes

Sistema de Deteccin Especfico


Scorpions probe
1. Hibridacin del primer a una
secuencia target
Loop

Stem

Bloqueador
Quencher
Primer

Fluoroforo

2. Extensin de la
polimerasa formando un
producto de PCR

4. Fase de anillaje Cambio conformacional


del loop

5. Hibridacin

Cintica de
la PCR
Exponencial: Duplicacin
exacta del producto se

acumula en cada ciclo.


Lineal: Componentes

consumidos, productos
empiezan a degradarse.

Plateau: Reaccin se
consume y no se generan

ms productos.

Fluorescencia

Plateau

Fase
logartmica

UMBRAL

CT (CP)

Nmero de ciclos

Umbral: Fluorescencia basal de las muestras debido al SYBR


Green y Sondas de Hibridacin (determinado automticamente
por el instrumento).
CT (CP): Nmero de ciclo en donde la fluorescencia supera el
umbral.

El CT depende de la concentracin inicial de ADN!

A > CT < [ ADN inicial ]


A < CT > [ ADN inicial ]
1

1.
2.
3.
4.
5.

10 ng = CT 18
1 ng = CT 21
100 pg = CT 25
10 pg = CT 28
Blanco

2
3
4
5

RT-PCR (Retro-transcripcin)
Deteccin de la expresin de un gen por presencia de mRNA

mRNA
Enzima mRNAcDNA : Retro-transcriptasa
Primers: - Hexameros al azar
- Oligo dT

cDNA

PCR

Enzima Taq polimerasa

Mtodos moleculares PCR


Ventajas

Mtodo Gold standard


Se independizan del transporte.
Alta sensibilidad y especificidad
Se pueden utilizar sondas
Se puede utilizar en muestras no invasivas

Desventajas:
Se necesita cierta informacin de la secuencia en
estudio para poder disear los primers.
Limitaciones del tamao del fragmento a amplificar
Errores de la replicacin.
Contaminacin (se reduce considerablemente tomando
las
precauciones
necesarias
y
en
manos
experimentadas).

SECUENCIACIN

Mezcla de reaccin

Secuenciacin de Sanger
Reaccin de PCR
Uso de:
Dideoxinucleotidos
Deoxinucleotidos dNTPs

La Reaccin con ddATP


3AATAGCATGGTACTGATCTTACGCTAT5
5TTATCGTA
5TTATCGTACCATGACTAGAATGCGA
5TTATCGTACCATGACTAGA
5TTATCGTACCATGACTA
5TTATCGTACCATGA
5TTATCGTACCA
5TTATCGTA
5TTATCGTACCA
5TTATCGTACCATGA
5TTATCGTACCATGACTA
5TTATCGTACCATGACTAGA
5TTATCGTACCATGACTAGAATGCGA

8pb
11pb
14pb
17pb
19pb
25pb

Separacin de Fragmentos
ddCTP

ddGTP

ddTTP

Lectura 5 a 3 desde la basa al tope

ddATP

INTERPRETACION
DEL GEL
AGTACTTATGCAGGTC
ACGTGCA

Secuenciacin automatizada
Dye terminator
Marca fluorescente en cada uno de los diferentes
nucletidos: A, T, G y C.
Emisin de luz a una longitud de onda especifica
Laser de iones de argn

Electroforesis
Capilar

Lecturas automatizadas de las


secuencias de ADN

Cromatograma o electrofenograma
- Se representa la base segn color diferente
- Intensidad de la seal luminosa (altura del pico)

Secuenciacin de Sanger

Conclusiones
Aunque en biologa molecular existen muchas
tcnicas para deteccin de cambios tanto a nivel

del ADN como a nivel cromosmico, el secreto esta


en seleccionar la mas adecuada dependiendo de
los requerimientos y la disponibilidad