Está en la página 1de 12

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

BIOLOGA
GRADO

EN

QUMICA

2014-15

PRACTICA 2
INGENIERA GENTICA. LABORATORIO VIRTUAL: IDENTIFICACIN DE
TRANSGNICOS

FECHA DE ENTREGA: HASTA EL 20 DE ENERO DE 2015 (NO SE ADMITE LA


ENTREGA POSTERIOR). TAMPOCO EN SEPTIEMBRE
Pase sus respuestas al documento denominado Hoja de
respuestas PR2 que encontrar en el icono Documentos, carpeta
de Prcticas. La Hoja de respuestas PR2 debe enviarse a travs
del curso virtual utilizando la herramienta Entrega de trabajos

Estrella Corts y Mara Jess Rueda

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

En esta prctica se proponen una serie de actividades correspondientes a los temas estudiados en
la segunda parte del temario relacionados con el DNA e ingeniera gentica. Usted debe visualizar el
Laboratorio virtual de ingeniera gentica.

Disponible de forma gratuita en la pgina del grupo


de Biologa de la UNED:
http://dfmf.uned.es/biologia/
Dentro de esta pgina pinche en la imagen
INGENIRIA GENTICA LABORATORIO VIRTUAL.
Se abre un cuadro que solicita
contrasea, donde se debe escribir:

nombre

Nombre de usuario: alumno


Contrasea: alumno
(Debe escribir la palabra alumno, no su nombre)
El CD se puede adquirir en las libreras de la UNED:
Ingeniera Gentica. Laboratorio virtual de
identificacin de transgnicos. M. Lpez Garca,
J. G. Morcillo, E. Corts, G. Morcillo. Editorial
UNED. ISBN: 978-84-362-5644-4.

Ingeniera Gentica. Laboratorio virtual de identificacin de transgnicos es una aplicacin que


contiene informacin sobre las herramientas y tcnicas ms comunes en Ingeniera Gentica. Navegue por
las distintas pginas, observe las animaciones y aprenda los conceptos bsicos que le sern tiles para
complementar los contenidos del Tema 11 y 12 del programa de Biologa.
En el Laboratorio virtual llevar a cabo el anlisis de un alimento y determinar si es o no
transgnico, siga las instrucciones atentamente.
A continuacin debe contestar a las cuestiones que se plantean en este cuadernillo.

Como ha estudiado, las enzimas de restriccin son una herramienta habitual en los laboratorios que se dedican a la
investigacin en biologa molecular as como en el diagnstico de numerosas patologas. A menudo, se combinan con
otras herramientas, como los plsmidos, dando lugar a potentes mtodos que, hoy en da, hacen que sean
imprescindibles para el anlisis del DNA. Gracias a estas enzimas, podemos conocer la localizacin y orientacin de un
fragmento dado dentro del genoma y realizar posteriormente la clonacin del mismo en plsmidos, que se emplean para
secuenciar el DNA, realizar estudios funcionales de ese DNA y expresar la protena que codifica.

Al final de este documento tiene un cuadro que recoge las secuencias diana de
las enzimas de restriccin que necesitar para responder a estas cuestiones.

Estrella Corts y Mara Jess Rueda

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

Ejemplo resuelto. Un DNA, del cual se muestra la secuencia de una de sus hebras, se digiere con la
enzima de restriccin BamHI.
5 CGCCAGGTTATGGATCCCATA 3
Deduzca los fragmentos producidos (escriba en las casillas la secuencia de cada una de las hebras de DNA
producido, mostrando la complementariedad de las bases).
Fragmento 1
1 Hebra
2 Hebra

5
3

3
5

Fragmento 2
1 Hebra
2 Hebra

5
3

3
5

Respuesta: Primero escribimos la secuencia del DNA de doble hlice:


5 CGCCAGGTTATGGATCCCATA 3
3 GCGGTCCAATACCTAGGGTAT 5
Localizamos la secuencia que reconoce BamHI consultando el documento que se encuentra al final de este
cuestionario. (Sealamos en amarillo la diana y las flechas indican los puntos de corte).
5 CGCCAGGTTATGGATCCCATA 3
3 GCGGTCCAATACCTAGGGTAT 5
Escribimos en el cuadro cada uno de los fragmentos teniendo cuidado de mantener la complementariedad
de las bases de las dos hebras del DNA.
Fragmento 1
1 Hebra 5
2 Hebra 3

CGCCAGGTTATG
GCGGTCCAATACCTAG

Fragmento 2
1 Hebra 5
2 Hebra 3

GATCCCATA
GGTAT

3
5

3
5

BamHI crea extremos cohesivos no romos por lo que hay que tener cuidado al escribir los nucletidos de
cada una de las hebras para que las bases guarden su complementariedad. (use el tipo de letra Courier
New)
Responda ahora a las cuestiones propuestas.

Cuestin 1. A una muestra de DNA, cuya secuencia de una de sus hebras es:
Estrella Corts y Mara Jess Rueda

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

5 ATGCCTTCTGCAGCGCGCAGCTGTCTTCGA3
se aaden las enzimas de restriccin PstI y PvuII. Indique cules sern los fragmentos resultantes de la
digestin completa (escriba las secuencias en las casillas procurando que las bases complementarias
queden enfrentadas como en el ejemplo resuelto).
Fragmento 1
1 Hebra
2 Hebra

5
3

3
5

Fragmento 2
1 Hebra
2 Hebra

5
3

3
5

Fragmento 3
1 Hebra
2 Hebra

5
3

3
5

Cuestin 2. Indique qu productos se generarn al actuar sobre este fragmento de DNA bicatenario las
siguientes enzimas de restriccin: EcoRI; HaeIII; BamH1.
(5') AAGAATTGCGGAATTCGAGCTTAAGGGCCGCGCCGAAGCTTTAAA (3')
(3') TTCTTAACGCCTTAAGCTCGAATTCCCGGCGCGGCTTCGAAATTT (5')

Eco RI

HaeIII

Bam H1

Con las
tres

Fragmento 1

Fragmento 2

5...........

5...........

3...........
Fragmento 1

3...........
Fragmento 2

5...........

5...........

3...........
Fragmento 1

3...........
Fragmento 2

5...........

5...........

3...........
Fragmento 1
5...........

3...........
Fragmento 2
5...........

3...........
Fragmento 3
5...........

3...........
Fragmento 4
5...........

3...........

3...........

Cuestin 3.

Las enzimas de restriccin reconocen secuencias palindrmicas. Explique qu son las

secuencias palindrmicas. El siguiente DNA tiene un solo sitio de restriccin. Indique su localizacin ms
probable. Razone su respuesta.
(5') -GGTATGCTAGCATG- (3')
Estrella Corts y Mara Jess Rueda

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

(3') -CCATACGATCGTAC- (5')

Cuestin 4. Aunque las enzimas de restriccin se emplean en tcnicas de biologa molecular, tienen su
origen en las bacterias. Explique cul es la funcin original de este tipo de enzimas en la clula bacteriana.

Cuestin 5. Seale si las afirmaciones son correctas justificando su respuesta.


a. El DNA durante la electroforesis migra hacia el electrodo positivo.

b. Los fragmentos de restriccin de un DNA dado migran en funcin de su tamao, migrando los de mayor
tamao de forma ms rpida quedando ms lejos de los pocillos en un gel de agarosa.

Cuestin 6. Determinacin del tamao de los fragmentos de restriccin de un DNA circular.


Puede visitar la siguiente pgina web para aprender ms sobre cmo interpretar geles de DNA cortados con enzimas
de restriccin http://www.biorom.uma.es/contenido/biomodel/an/plasmido/inicio.htm y ms concretamente la pgina:
http://www.biorom.uma.es/contenido/biomodel/an/plasmido/3/index.htm

En la figura 1 se muestra un plsmido (DNA circular de origen procaritico) con un tamao de 20000
pares de bases (20kb). Contiene varios sitios de restriccin, que corresponden a dos enzimas BamHI y
EcoRI. La presencia de 4 sitios de corte y slo 2 enzimas indica que una o las dos enzimas pueden tener
ms de un sitio de corte.
Figura 1
Estrella Corts y Mara Jess Rueda

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

Analice el mapa del plsmido pX representado y deduzca el tamao de los fragmentos esperados si este
plsmido fuese digerido con la endonucleasa Bam HI, con EcoRI o con ambas enzimas a la vez.
Digestin con la endonucleasa
BamHI
EcoRI
BamHI/EcoRI

Tamaos de los fragmentos esperados

Cuestin 7. Interpretacin de geles de DNA digeridos con enzimas de restriccin.


En la figura 2 se muestra el resultado de una electroforesis en un gel de agarosa de los productos de las
digestiones del plsmido anterior con las enzimas de restriccin. En la electroforesis se separan los
fragmentos de DNA generados, como consecuencia del corte con las enzimas, en funcin de su tamao. El
tamao, como se ha comentado antes, se expresa en pares de bases. El gel tiene cuatro carriles que
corresponden a:
I- Marcador. Consiste en una serie de fragmentos de DNA con un tamao conocido que se emplean como
referencia para conocer el tamao de los fragmentos obtenidos en la digestin con las enzimas de
restriccin.
II, III y IV. Corresponden a los fragmentos de DNA obtenidos al digerir el plsmido con una enzima o con las
dos enzimas.
Analice los resultados del gel y deduzca con qu enzimas ha sido digerido el DNA cargado en los carriles II,
III y IV.
Figura 2

Estrella Corts y Mara Jess Rueda

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

Carriles
Carril II
Carril III
Carril IV

Enzimas utilizadas:

Cuestin 8. Los resultados de las digestiones de un plsmido con distintas enzimas de restriccin se
representan en el gel de agarosa de la figura 3. Cul de los mapas de restriccin correspondera al
plsmido analizado?

Figura 3

Seale con una X el plsmido correcto:


a. Plsmido 1
Estrella Corts y Mara Jess Rueda

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

b. Plsmido 2
c. Plsmido 3
d. Ninguno de los tres
Cuestin 9. Determinacin del tamao de un plsmido.
Una preparacin de plsmidos bacterianos ntegros, se trata con la enzima EcoRI y cuando el DNA digerido
se separa mediante electroforesis en gel de agarosa se observan bandas de 150, 800 y 2000 pares de
bases (bp). Si esta misma preparacin se trata con HindIII se observan bandas de 1700, 1000 y 250 bp.
Cuando se trata con ambas enzimas simultneamente se observan bandas de 1600, 600, 400, 200, 100 y
50 bp.
Cul es el tamao del plsmido analizado? Marque con una X la respuesta correcta:
a.
b.
c.
d.

2950 pb
2000 pb
1475 pb
No se puede determinar con estos datos

Cuestin 10. Con los datos de la pregunta anterior se intenta conocer el mapa del plsmido. Cul de los
mapas de restriccin siguientes correspondera al plsmido descrito?

Marque con una X la respuesta correcta:


a. el mapa A exclusivamente
b. el mapa B exclusivamente
c. ambos mapas son correctos
d. no hay informacin para saber si A o B es el correcto, pero ambos pueden ser

Cuestin 11. Clonacin de fragmentos de DNA.


Seale con una X la respuesta correcta. El DNA humano y un plsmido especfico tienen ambos,
secuencias diana para que puedan ser cortados por enzimas de restriccin Hind III y EcoRI. Para generar
DNA recombinante es necesario:

Estrella Corts y Mara Jess Rueda

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

a. Cortar el plsmido con EcoRI y el DNA humano con HindIII


b. Usar EcoRI para cortar tanto el plsmido como el DNA humano
c. Usar HindIII para cortar tanto el plsmido como el DNA humano
d. b o c son correctas
Cuestin 12. Amplificacin de fragmentos por PCR.
Se tiene un fragmento de DNA cuya secuencia es:
5'AATTATTGCGGGGCATATTATATTAATTATTCCGGCGGGTTTA3'
|||||||||||||||||||||||||||||||||||||||||||
3'TTAATAACGCCCCGTATAATATAATTAATAAGGCCGCCCAAAT5'
y se amplifica mediante PCR empleando como iniciadores o primers los fragmentos siguientes:
3GCCGCCCA 5
5TGCGGGGC 3
Seale con una X la secuencia de DNA amplificado:
a. Idntica a la que se da en el problema
b. 5'TGCGGGGCATATTATATTAATTATTCCGGCGGGT3'
||||||||||||||||||||||||||||||||||
3'ACGCCCCGTATAATATAATTAATAAGGCCGCCCA5'
c. TATTATATTAATTATTC
|||||||||||||||||
ATAATATAATTAATAAG
d. es una cadena sencilla de secuencia
3'ACGCCCCGTATAATATAATTAATAAGGCCGCCCA5'

Cuestin 13. Indique con una X la relacin correcta entre los siguientes trminos:
A. PCR
B. Tcnica de didesoxirribonucletidos trifosfato
C. Transferencia Southern
D. Clonacin
a.
b.
c.
d.

1. Obtencin de clulas idnticas


2. Generacin de DNA en cantidad
3. Anlisis de DNA
4. Secuenciacin de DNA

A1-B2-B3-D4
A2-B4-C3-D1
A3-B1-C4-D1
A4-B2-C1-D3

Cuestin 14. Secuenciacin de DNA.


El esquema que se representa corresponde a un gel de secuenciacin por el mtodo del didesoxi. Cul es
la secuencia del DNA objeto de estudio?
(Recuerde que en el mtodo de secuenciacin de Sanger se sintetiza la hebra complementaria a la que se
usa como molde en la secuenciacin, se pide por tanto que averige cul es la molde).

Estrella Corts y Mara Jess Rueda

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

Seale con una X la respuesta correcta:


a. 3TACCTGGTCAAC5
b. 5 TACCTGGTCAAC3
c. 3 GTTGACCAGGTA3
d. 5 GTTGACCAGGTA3

Cuestin 15. La tcnica de Southern blot implica:


a. La deteccin de fragmentos de RNA sobre una membrana usando anticuerpos especficos.
b. La deteccin de protenas sobre una membrana usando una sonda de DNA.
c. La deteccin de fragmentos de DNA sobre una membrana usando una sonda de DNA.
d. La deteccin de protenas sobre una membrana usando anticuerpos especficos.

Una vez realizada la prctica del Laboratorio virtual de identificacin de


transgnicos seale con una X la respuesta correcta a cada una de las siguientes
preguntas:
Cuestin 16. La solucin de extraccin del DNA de una muestra contiene proteinasa K cuya funcin es:
a.
b.
c.
d.

hidrolizar las protenas


disolver los lpidos de las membranas celulares
romper el RNA
solubilizar los hidratos de carbono

Cuestin 17. En el protocolo de extraccin de DNA de una muestra, el isopropanol se utiliza


especficamente para:
a.
b.
c.
d.

resuspender el DNA puro


precipitar el DNA aislado
precipitar protenas
disolver los lpidos

Cuestin 18. Cules de los siguientes compuestos ha empleado para amplificar un fragmento de DNA
mediante la tcnica de PCR? :
a.
b.
c.
d.

enzimas de restriccin, ligasa, Taq polimerasa


ligasa, ARN polimerasa, nucletidos
nucletidos, primers, Taq polimerasa
primers, nuleasas, ARN polimerasa

Cuestin 19. Seale la correspondencia correcta entre las fases de la PCR empleada en el experimento y
las temperaturas del termociclador utilizado:
Estrella Corts y Mara Jess Rueda

10

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

I. 95 C 30
II. 72 C 45
III. 55 C 30
a.
b.
c.
d.

A. Desnaturalizacin del DNA


B. Hibridacin con los cebadores
C. Extensin

I-A, II-B, III-C


I-B, II-C, III-A
I-C, II-A, III-B
I-A, II-C, III-B

Cuestin 20. Tena la muestra del alimento analizado maz transgnico?

a. no porque slo amplifica un fragmento correspondiente al gen de la azaina como en el control


positivo.
b. s porque amplifica dos fragmentos uno del gen de la azaina y otro del promotor PS35.
c. s porque amplifica dos fragmentos que corresponden a un gen desconocido.
d. no porque amplifica el gen de la azaina que est presente en el control negativo y no en el control
positivo.

Una vez haya respondido a las preguntas de este cuestionario pase sus respuestas
al documento denominado Hoja de respuestas PR2 que encontrar en el
icono Documentos. Una vez rellenada la hoja de respuestas guarde el archivo con
el siguiente nombre: Su primer apellido-Su nombre-PR2.
(Ejemplo: Cortes-Estrella-PR2)
Enve el documento a travs de la plataforma aLF en Entrega de Trabajos.

Estrella Corts y Mara Jess Rueda

11

PRCTICA 2

GRADO EN QUMICAS
BIOLOGIA

ENZIMAS DE RESTRICCIN

Estrella Corts y Mara Jess Rueda

12