Está en la página 1de 100

Editorial

Julio Ruelas

pliego16_finales.indd 1

15/09/2014 16:58:58

Instrucciones: Une con una lnea los elementos del ndice a

a*
Literatura Hispanoamericana
Oda a la vida retirada (c. 1557). Fray Luis de Len

Una dama se vio en una calavera de cristal. Luis de Sandoval Zapata (1620-1671)
Infortunios de Alonso Ramrez (1690). Carlos de Sigenza y Gngora
Hombres necios (c. 1680). Sor Juana Ins de la Cruz
Primero sueo (1692). Sor Juana Ins de la Cruz
Abrojos (1877). Rubn Daro

Declaracin de odio (1944). Efran Huerta


Piedra de sol (1957-1960). Octavio Paz
Epigramas (1972). Ernesto Cardenal

Ao Nuevo (1979). Ins Arredondo

Entrevista a Leopoldo Mara Panero (1999). Fernando Snchez Drag


Poemas (2001). Leopoldo Mara Panero
Can (2010). Javier Mrquez

Verde Shanghai (2011). Cristina Rivera Garza


Helada (2013). Daniel Espartaco
Literatura Universal
Tito Andrnico (1593). William Shakespeare
Macbeth (c. 1606). William Shakespeare

La carretilla roja (1920). William Carlos Williams

Esto es slo para decirte (1934). William Carlos Williams

La tierra balda (1922). T. S. Eliot

*pliego16 no incluye estos textos. Se leen por separado.

pliego16_finales.indd 2

15/09/2014 16:58:59

con los del ndice b segn la reescritura.

b
Vampirizar
vampyr. javier mrquez

El asesinato de la mujer piedra. Jorge Luis Herrera


Cangreja. rika Tllez

El aroma de la luz. Herson Barona

Eplogo a la masacre. Marina Azahua

4
14
17
18
20

Destejer
Jalar los hilos: tejido y (re) escritura. Mariana Oliver
Nouvel An. Hayde Salmones

Riada. Bernardo Barrientos Domnguez


Declaracin de odio 2.0. Arturo Loera
Oda a la vida retirada. Ren Rueda

29
33
34
40
42

Dos epigramas a la manera de Ernesto Cardenal. Samuel Espinosa


Mmox

47

William Carlos Williams en Reno. Santiago Ruiz Velasco

48

Reescrituras crticas. Patricia Arredondo

Flores de Baria Poesa. Jorge Gutirrez Reyna


Poemas. Dulce Alcntara

61
65
68

Adaptar
Qu es la reescritura? Ana Laura Magis Weinberg

70

De nios perdidos y llaves sangrantes: reescrituras del cuento de

75

Entreacto. Salvador Calva Carrasco

79

hadas en el siglo xx. Lola Horner


Sibila. Demian Marn

Flebas. Rodrigo Crigo

Andrnico (fragmento). Mnica Perea


3:23-4:39. David Alejandro Martnez

pliego16_finales.indd 3

80
86
87
93

15/09/2014 16:58:59

vampyr
javier mrquez

i)

en el thtre des vampires,


los espectadores humanos
observan vampiros
que actan ser seres humanos
que actan ser vampiros
dentro de pesadillas
de seres humanos
que anhelan ser vampiros.
ii)

durante la dcada de los 90, dave gahan, vocalista de depeche


mode, se obsesion con la idea del vampirismo. comenz a
utilizar ropa negra y anillos puntiagudos. se dej crecer el
cabello y uas. para la gira playing the angel por sudamrica,
los roadies le construyeron un atad como parte de una broma,
pero gahan comenz a dormir siestas dentro del fretro antes
de cada concierto. lleg a creer que era un vampiro al punto
en que mordi en el cuello a varias personas. sus amigos lo
internaron en un psiquitrico. soy el vampiro lestat. soy inmortal. ms o menos. la luz del sol o el calor prolongado de un
fuego intenso podran acabar conmigo. tambin podran no
hacerlo. mido un metro ochenta, una estatura que resultaba
bastante impresionante hacia 1780, cuando yo era un joven
actor mortal de lo que despus convertimos en el thtre des
vampires. tengo el cabello rubio y tupido, largo hasta casi

pliego16_finales.indd 4

15/09/2014 16:58:59

los hombros y bastante rizado. parece blanco bajo una luz


fluorescente. mis ojos son grises pero absorben con facilidad
los tonos azules o violceos de la piel que los rodea. tambin
tengo una nariz fina y bastante corta, y una boca bien formada,
aunque resulta demasiado grande para el resto del rostro. una
boca que puede parecer muy mezquina, o extremadamente
generosa, pero siempre sensual. mis emociones y estados de
nimo se reflejan siempre en mi expresin. mi rostro est
continuamente animado.

mi condicin de vampiro se pone de relieve en la piel, tan


extremadamente blanca que refleja la luz: ello me obliga a
maquillarme para aparecer ante cualquier tipo de cmara.
cuando estoy sediento de sangre, mi aspecto produce verdadero horror: la piel contrada, las venas como sogas sobre los
contornos de mis huesos... pero ya no permito que tal cosa
suceda; el nico indicio firme de que no soy humano son las
uas de mis dedos. a todos los vampiros nos sucede lo mismo:
nuestras uas parecen de cristal. y hay gente que se fija slo en
eso aunque no advierta nada ms.
ahora soy lo que en norteamrica llaman un rockstar. he vendido cuatro millones de copias de mi primer lbum y voy camino
a san francisco para dar el primer concierto de una gira
nacional que me llevar de costa a costa con mi grupo. mtv
lleva dos semanas pasando mis videoclips da y noche. tambin
los pasan en el top of the pops ingls y en el resto del viejo
continente, as como en algunas partes de asia. las cintas que
recogen la serie completa de videoclips se estn vendiendo por
todo el mundo.
iii)

vampirizar:
perforar arterias con los colmillos
para beber la sangre del otro.
privar a alguien de sus rasgos caractersticos
para lograr su dependencia total.
extraer la energa vital de alguien
para fortalecerse.

pliego16_finales.indd 5

15/09/2014 16:58:59

devorar libros y llenarse el torrente textual de palabras de otros


para resemantizarlas en un nuevo ser escritural.
el vampiro pertenece a la noche
porque ella es la oscuridad de la tinta,
la sintaxis de la palabra en el firmamento
que apenas deja espacios en blanco.
por eso el vampiro slo puede habitar en el negro plano
[de la ficcin.
ante la pgina soleada de la realidad
se inmola:
cenizas de leyendas.
iv)

los vampiros se alimentan primordialmente de la sangre de sus


vctimas, aunque hay descripciones donde tambin sonantropfagos, como los vrycolacas de grecia, seres que regresaban de
la muerte para cobrar venganza y devorar a sus enemigos.en
algunas culturas se consideraba que la sangre no era la base de
su sustento, sino el fluido vital humano: la energa psquica.
esto ha dado pie a la nocin del vampiro energtico: una
persona comn que, intencionalmente o no, absorbe la energa
vital de otra persona para fortalecerse.
v)

en el thtre des vampires


se recrean las parbolas y fbulas
que dan cuenta de los misterios de la pgina oscura
de la gramtica escarlata.
slo con cuatro caracteres
(t) timina
(a) adenina
(c) citosina
(g) guanina
cuatro letras con infinidad de combinaciones,
las nicas cuatro letras que no representan

pliego16_finales.indd 6

15/09/2014 16:58:59

sino que producen el mundo desde sus inicios


una y otra vez
infinitamente.

todo acto del habla


es eco de la palabra primera.
toda escritura
es la iteracin de la gramtica primera.
todo ser humano
es la reescritura gentica
del ser primero.
vi)

las personalidades ms comunes de los vampiros energticos son:


el pobre-de-m o vctima: pesimistas. piensan que no tienen
suficiente energa para enfrentarse al mundo y todo el
da se quejan de sus desgracias. atraen la atencin con
expresiones faciales preocupadas, suspiros, temblores,
llantos, miradas perdidas, respuestas lentas y relatos
reiterados de dramas y crisis punzantes. seducen por
su vulnerabilidad y necesidad de ayuda. no les interesan
verdaderamente las soluciones a sus problemas porque entonces perderan su fuente de vitalidad. obtienen la
energa de la compasin que generan y de los intentos por
ayudarles.
el intimidador: logran la atencin a travs de gritos, fuerza f sica, amenazas y exabruptos. mantienen a los dems
a raya, quienes temen desatar su ira. reciben la energa a
travs del miedo que provocan en los otros.
el interrogador: socavan el nimo y la voluntad cuestionando cualquier actividad y motivacin. crticos hostiles,
buscan hacer sentir mal a los dems. todo lo que se
les conf e lo utilizarn como arma en algn momento.
seducen por su ingenio, lgica infalible e intelecto. obtienen la energa a partir de los esfuerzos que los dems hacen
para probar su vala y para responderles.

pliego16_finales.indd 7

15/09/2014 16:58:59

el culpador: buscan culpables por las situaciones que ellos


mismos generan. suelen ser verbalmente agresivos y abusivos. atacan a sus seres queridos. no es el mundo contra
ellos, sino t en su contra. obtienen su energa a travs de
los esfuerzos de los dems por defenderse de sus ataques.
el conversador imparable: slo estn conectados consigo
mismos, son incapaces de escuchar a los dems y usan a
sus seres queridos como espectadores de sus eternos monlogos. obtienen la energa de la pasividad del otro.
el siempre-me-va-peor: son aqullos que interrumpen cualquier relato para afirmar que a ellos les han sucedido las
peores cosas. obtienen la energa de la lucha de egos que
generan por ver a quin le ha ido peor en la vida.
vii)

cuando el vampiro bebe la sangre de su vctima,


es capaz de ver la vida entera del moribundo.
no slo engulle la sangre
sino tambin sus experiencias.
despus deja caer el cadver como basura.
el ser humano
como ficcin para el vampiro.
leer es vampirizar.
extraer conocimiento y experiencias vitales de los libros.
ante la lectura
ningn libro es original;
est constituido por todos los anteriores.
viii)

no me cost adaptarme a esta nueva era porque algo completamente mgico haba sucedido con las pocas. lo viejo ya
no era sustituido rutinariamente por lo nuevo. al contrario,
el ingls que oa a mi alrededor era el mismo que conoca del
siglo xix. incluso la antigua jerga segua funcionando. al propio
tiempo, otras frases novedosas y fascinantes como te han lavado el cerebro o es muy freudiano estaban en labios de todos.

pliego16_finales.indd 8

15/09/2014 16:59:00

en el mundo artstico y del espectculo, todos los siglos anteriores estaban siendo reciclados. los msicos interpretaban
por igual a mozart que una cancin de jazz o de rock. la gente
iba a ver shakespeare una noche y una pelcula francesa al da
siguiente.

uno poda comprar cintas de madrigales medievales en una


enorme tienda iluminada con fluorescentes y escucharlas en
el estreo del coche mientras corra por la autopista a ciento
cincuenta por hora. en las libreras, la poesa del renacimiento estaba a la venta junto a las novelas de dickens o
de ernest hemingway. los manuales de educacin sexual
coexistan en la misma estantera con el libro egipcio de los
muertos, johann wolfang von goethe john william polidori
lord byron cyprien brard aleksi konstantnovich tolsti
james malcolm rymer thomas preskett joseph sheridan le
fanu bram stoker richard matheson anne rice brian lumley
l.j. smith john ajvide lindqvist stephanie meyer claudia grey
chuck hogan guillermo del toro.
ix)

en el thtre des vampires,


hablar de todos los vampiros reales
es hablar de dave gahan
el strigon.
hablar de todos los vampiros reales
es hablar de dave gahan
el empalador.
hablar de todos los vampiros reales
es hablar de dave gahan
la condesa sangrienta.
hablar de todos los vampiros reales
es hablar de dave gahan
el torturador de nios.
hablar de todos los vampiros reales
es hablar de dave gahan
el canadiense.

pliego16_finales.indd 9

15/09/2014 16:59:00

10

hablar de todos los vampiros reales


es hablar de dave gahan
porque dave gahan
est constituido por todos los vampiros anteriores.
x)

lestat bebe directamente de la yugular de cristo


bebe de la sintaxis gentica primera
y presencia el origen de la palabra.
lestat queda inmerso en el abismo de silencio y distancia.
soy el vampiro dave gahan. soy inmortal. ms o menos. la industria musical o la crtica histrica desfavorable podran acabar
conmigo. tambin podran no hacerlo. mido un metro ochenta,
una estatura que resulta benfica cuando ests en un escenario. mis emociones y estados de nimo se reflejan siempre en mi
expresin. mi rostro est continuamente desanimado y mi estilo de baile es increble. cuando estoy en el estudio grabando una
nueva cancin slo puedo pensar en los ocanos de personas que
estarn en los conciertos de las giras. ocanos de sangre hirviente, de gargantas afiladas que morder con mis gritos y que
me desollarn con su eco. seremos un mismo ser alimentndonos mutuamente. ellos sern mis letras, yo ser sus anhelos. una
masa parasitaria bajo la sintaxis oscura de la noche.
la cultura:
constante vampirizar la sabidura humana.
ningn ser humano es original.
est constituido por todos los anteriores.
xi)
las personalidades ms comunes de las bandas de rock son:
pobre-de-m o vctima: su gnero representante es el grunge.
guitarras fuertemente distorsionadas y enrgicas, melodas vocalesguturales, pegadizas y repetitivas, bateras
predominantes; letras que reflejan apata y desencanto,
chillan por todo. bandas como nirvana, pearl jam,

pliego16_finales.indd 10

15/09/2014 16:59:00

mudhoney, the melvins, soundgarden, alice in chains, the


smashing pumpkins.

11

intimidador: heavy metal. ritmos agresivos, guitarras elctricas muy amplificadas y distorsionadas, bajos, bateras
con doble pedal. tiene varios subgneros. se le asocian
bandas como led zeppelin, deep purple, black sabbath, iron
maiden, metallica, slayer, anthrax, megadeth.
interrogador: los llamados crooners que, en ingls, tiene connotaciones cercanas al trovador. voz grave acompaada
por una orquesta o una big band. se asocian cantantes
como frank sinatra y bing crosby. en lo underground existen crooners como tom waits, nick cave y morrisey.
culpador: el punk. rock sencillo y algo ruidoso para expresarse
con sus propios medios y conceptos. la filosof a punk puede
resumirse en: hazlo t mismo. en sus canciones expresan
un serio descontento con los sistemas e instituciones que
controlan el mundo. bandas como the clash, sex pistols,
the ramones, misfits, black flag, the damned y the jam.
siempre-me-va-peor: el gtico. voces andrginas o bartonas
a las que se les aade un efecto de eco. las guitarras se
enfocan en crear atmsferas que pueden variar desde etreas, melanclicas y siniestras. un elemento capital es el
bajo, que destaca por aparecer adelante junto con las voces sonando igual o ms predominantemente que las
guitarras. bandas como siouxsieand thebanshees, fields
of the nephilim, the sisters of mercy y the cure. el dark
wave aade letras oscuras e introspectivas junto a un
trasfondo de lamento en el sonido de algunos grupos como
joy division y depeche mode.
xii)

en el thtre des vampires:


un actor es un vampiro
que obtiene su energa a travs del espectador.
un espectador es un vampiro
que obtiene experiencias vitales a travs del actor.

pliego16_finales.indd 11

15/09/2014 16:59:00

12

esta obra ha vampirizado materiales de anne rice, dave


gahan, alejandro tantanian, nick cave, eduardo del estal,
laura muoz, artculos de divulgacin y secuencias de
adn. soy el actor que siempre quiso decir las palabras soy
el vampiro lestat. soy mortal. mi deficiencia actoral y
la mala memoria de ustedes acabarn conmigo. no llevo
maquillaje, mis uas son normales, odio mi estatura. si un
vampiro bebiera de mi sangre, lo nico que vera pasar ante
sus ojos sera una vida gris donde lo ms importante es que
hoy muri mi gata cata... la mat mi sobrina gata. fue tan
triste gata cata, ac gata, ata a gata cata. gata
acata gata cata ataca a gata caga caca gata cata.
ag, gata gata ataca a gata cata... sera una ficcin
olvidable para ver un domingo por la noche. no me gusta el
rock. segn mis compaeros, soy un vampiro energtico, de
los pobre-de-m, una reescritura menor de la raza humana.
estoy diciendo esto para que se compadezcan de m.
xiii)

en el thtre des vampires


el vampiro
que bebe el fluido vital
de un espectador humano
reescribe su sintaxis gentica
hasta extraer todos los rasgos de su vctima
hasta mimetizarse con ella.
lo que fue un ser humano
queda reducido a un cascarn de masa blanca
hundida en la butaquera
y el vampiro es libre
ahora
de tomar el lugar del espectador en la vida real.
la sociedad
es un constante vampirizar seres humanos.
cada ser humano est constituido por todas las aspiraciones
[de su sociedad.

pliego16_finales.indd 12

15/09/2014 16:59:00

un actor muerde la yugular del actor que habla, ste grita como
si se tratara de una mala pelcula de terror. el actor-vctima
cae muerto. el procedimiento se repite con cuantos actores se
tenga.

13

los actores-vctima resucitan y muerden a los actores-vampiro


repitiendo el procedimiento anterior.
la mquina vamprica contina mientras suena slo la msica
de release the bats de nick cave. lestat y dave gahan cantan a
dueto:
CAGGTGCAGCTGTTGCAGTCTTGCAG
AG AG G TG A A A A AG C C C G G G G AG TC T
T G A A G AT C T C C T G TA A G G G T T C T G G
TAC AG C T T TACC AG C TAC TG GATCG G
TG G G TG C G C C AG ATG C C C G G G A A AG
C C T G G A G T G G AT G G G G AT C AT C TAT
C TG GTGAC TC TGATAC C AGATAC AG C
C G T C C T T C C A A G G C C A G G T C A C C AT
TC AG CCGAC AAGTCC ATC AG C ACCG C
TA C C TG C A G TG G A G C A G C C TG A A G G
C TCG GAC ACG G CCGTGTAT TAC TGTG
A A G ATG G C G TG AT TC G C C T T TG TG G
G CC AAG GTACCC TG GTC ACCGTC TCG
G TG G TG AG G C G G T TC AG G C G G AG G T
GCTCTGGCGGTAGTGCACTTCAGGCT
TG GTGAC TC AG GAG CC ATCC AG GTG C
G C TG C TG T TG C A G TC T TG C A G C A G A
GTGAAAAAGCCCGGGGAGTCTCTGAA
ATC TC TA AG G GT TC TG GATAC AG C T T
A C C A G C TA C TG G ATC G G C TG G G TG C
CC AGATG CCCG G GAAAG G CC TG GAGT
GATG G G GATC ATC TATC C TG GTGAC T
TGATAC C AGATAC AG C C C GTC C T TC C
A G G C C A G G TC A C C ATC TC A G C C G A C
AGTCC ATC AG C ACCG CC TACC TG C AG
GGAGCAGCCTGAAGGCCTCGGACACG
CCG GTAT TAC TGTG C AAGATG G CGTG
TTCGCCTTTGTGGGGCC AAG GTACCC
GGTCACCGTCTCGAGTGGTGGAGGCG
TTC AG G CG GAG GTG G CTCTG G CG GTA
TA G T G C A C T T C A G G C T G T G G T G A C T
A G G A G C C ATC C A G G TG C A G C TG T TG

pliego16_finales.indd 13

C
C
A
C
G
C
C
C
C
C
C
G
A
G
G
A
G
G
T
G
G
C
A
A
T
G
A
T
G
G
C
C

15/09/2014 16:59:01

14

El asesinato de la mujer piedra


Jorge Luis Herrera

Para Patricia Herrera Velasco


Dales la vuelta,
cgelas del rabo (chillen, putas),
aztalas,
[] haz que se traguen todas sus palabras.
Octavio Paz

Adolescente rostro perseguido, mirada nia de la madre vieja,


yedra que avanza, envuelve y desarraiga, y llega siempre entre
las ramas que se desvanecen, como la nube por tu pensamiento.
Avanza, retrocede, da un rodeo petrificando el bosque con su
canto oh bosque de pilares encantados!, corriendo entre los
rboles nocturnos.
Caminas como un rbol, como un ro.
Hablando solo como el viento loco.
Alta como el otoo caminaba un caminar de ro que se
curva, un caminar entre las espesuras al mundo con sus mares
y sus montes.
Vuelas como mil pjaros, tu risa...
Que dice sin decir, no dice nada?
Caminas y me hablas como un ro.
Camino por las calles de m mismo. Piso das, instantes caminados.
Y mi sangre camina ms despacio. Invisible camino sobre espejos
que en un abismo brusco se termina. No hay nadie, cae el da, cae el
ao Caigo en el instante, caigo al fondo. Mi sombra despeada se
destroza. Caigo sin fin desde mi nacimiento, caigo en m mismo sin
tocar mi fondo: Caer, volver, soarme y que me sueen!. Busco
sin encontrar, escribo a solas presagios que se escapan de la mano

pliego16_finales.indd 14

15/09/2014 16:59:01

al reino de pronombres enlazados, a pulso levantado letra a letra,


escritura del viento en el desierto que se cubre de signos, el silencio.
Arrancado a la nada de esta noche: el delirio, el relincho, el ruido
obscuro. Ardo sin consumirme, busco el agua. O es al revs: caer
en esos ojos donde beban luz los gorriones?. Voy por las transparencias como un ciego: un paraje de sal, rocas y pjaros; corredores
sin fin de la memoria; horas de luz que pican ya los pjaros; otros
ojos futuros, otra vida; el pan vuelve a saber, el agua es agua.
Dorm sueos de piedra que no suea, bajo un sol sin edad, y t
a mi lado: dormas enroscada entre las sbanas, cuerpo del mundo,
casa de la muerte, los amores feroces, el delirio. Mis pensamientos
slo son sus pjaros, y tus pechos, tu vientre, tus caderas verdad de
dos en slo un cuerpo y alma: adonde yo soy t somos nosotros...
El mundo nace cuando dos se besan; y al cabo de los aos como
piedras es cada amanecer y yo amanezco.

15

Tu falda de cristal, tu falda de agua es transparente por tu transparencia: como mi pensamiento vas desnuda. Mis miradas te cubren como yedra, adolescente rostro innumerable; tus labios, tus
cabellos, tus miradas, y las felicidades inminentes. Vestida del color
de mis deseos (son de piedra, tu boca sabe a polvo).
Al caer en el llano ceniciento, caen sobre la yerba: el cielo baja:
Tindete al pie del rbol, bebe el agua!
Tu cuerpo sabe a pozo sin salida. Y en tus ojos no hay agua,
son de piedra voy por tus ojos como por el agua, agua que con los
prpados cerrados mana toda la noche profecas. Recgeme en tus
ojos, junta el polvo.
Busco el sol de las cinco de la tarde, rostro de llamas, rostro devorado, como el viento cantando en el incendio. Y no hay nada
detrs de sus imgenes, sino un pensar en llamas, al fin humo. Brasa
los labios y tizn la lengua. Emerge de s mismo, sol de soles: roca
solar, cuerpo color de nube: una presencia como un canto sbito.
Se contempla en la nada, el ser sin rostro, ola tras ola hasta cubrirlo
todo. Fluyo entre las presencias resonantes, plenitud de presencias
y de nombres, unnime presencia en oleaje, indecible presencia de
presencias...
El adulterio en lechos de ceniza. Fulgor de la desdicha como
un ave: djame ser tu puta, son palabras que repiten mi imagen

pliego16_finales.indd 15

15/09/2014 16:59:01

16

destrozada. Los dos se desnudaron y besaron. Amar es desnudarse de los nombres: los dos se desnudaron y se amaron, enamorados
de su semejanza.
Toda la noche llueves, todo el da. El mundo se despoja de sus mscaras (invisibles, las mscaras podridas). Muestra tu rostro al fin
para que vea. Tienes todos los rostros y ninguno. Tu boca sabe a
tiempo emponzoado, un racimo ya seco, un hoyo negro... Tus palabras afiladas cavan cementerio de frases y de ancdotas, y al cabo
de los siglos me descubro. Lo que pas no fue pero est siendo: enredadera, planta venenosa; no hay nada en m sino una larga herida
(y mortal que da penas inmortales).
Piso mi sombra en busca de un instante: todo se quema, el universo
es llama; en el lecho de espinas de su insomnio, el olvidado asombro de estar vivos: dnde estuve, quin fui, cmo te llamas. Busco
sin encontrar, busco un instante; no hay nada frente a m, slo un
instante. Cada minuto es nada para siempre. Todos los siglos son
un slo instante... No pasa nada cuando pasa el tiempo?
Mejor el crimen.
Mejor comer el pan envenenado; y a la copa de sangre del verdugo, un gargajo, mejor ser lapidado. Vida y muerte. Y el grito de la
vctima... son llamas que nadie contest: por qu me matan? Y su
grito y el grito del verdugo. Y caste sin fin, quebrada y blanca, de la
muerte vivaz y enmascarada. Un montn de ceniza y una escoba.
Su muerte ya es la estatua de su vida.
No hay redencin, no vuelve atrs el tiempo (un siempre estar ya
nada para siempre). Quiero seguir, ir ms all, y no puedo. Los
muertos estn fijos en su muerte. Piso los pensamientos de mi
sombra. Recojo mis fragmentos uno a uno: a perpetua cadena
condenado, y en el fondo del hoyo los dos ojos, sus horrores vacos
acumulan, desde su soledad, desde su muerte. No hay nadie, no
eres nadie.
He olvidado mi nombre, mis amigos. Miradas enterradas en un
pozo. Tu silencio d paz al pensamiento.

pliego16_finales.indd 16

15/09/2014 16:59:01

Cangreja
rika Tllez

Soy pequea

17

pequeo mi cabello de muchacho

mis manos
[mis ojos

desde apenas unos das.


Tabaco oscuro para mi/su garganta ya sabes ya lo s.
l sabe que tengo un miedo l sabe que quiero derrotarlo.
Hombre envejecido y derrotado el miedo.
(El hombre empieza a hablar de manera desmedida).
Qu no tienes miedo?
Soy pequea Marina Cangreja
contesto sin dobleces.
No avizoras el peligro?

Pienso en la lengua untuosa de un gato sobre mi rostro: el peligro.


Lo veo hombre envejecido tabaco oscuro.
Me introduzco a fuerza dentro de sus ojos para saber hasta dnde
[me sabe. Remos
es para dar risa rerse de miedo.
Y bien?
Es lo de siempre

que nada pasa

que todo nos est pasando.

Soy Marina dando vueltas.


Marina Cangreja donde no hay transcurso.
Donde todava no se acaba esto.

pliego16_finales.indd 17

15/09/2014 16:59:01

18

El aroma de la luz
Herson Barona

Subi las escaleras lentamente, todava sintiendo que su garbo y su


donaire le pertenecan a otro edificio. Imagin que el dueo las haba
mandado traer de otro lado, desmantelando otra construccin piedra
tras piedra, con mucho cuidado, slo para reconstruir la con el mismo
afn en el nuevo espacio. Se podra hacer eso en realidad? Tuvo la
tentacin de dejarse sorprender, pero en el mismo instante visualizaba
escenarios. Dira: qu gusto, con la voz de alguien que paseaba por las
calles de una ciudad que conoca de memoria. Dira: cunto tiempo,
con el tono neutro de una persona lejana. Tambin avizor el silencio.
El pasmo. La frustracin inherente a las palabras que se saborean bajo
la lengua sin posibilidad alguna de llegar al sonido. O dira: cmo
lograste entrar? A la defensiva, fingiendo que todo era real. A medida que
ascenda las escaleras equivocadas, seguramente tradas de otro edificio
ms ufano, menos decadente, se preguntaba si todo esto no era ms que
un invento, el resultado de su imaginacin afiebrada. Su imaginacin
necesitada. Y se pregunt tambin si esto era lo que toda la gente haca
dentro de sus propios olvidos: correr el teln de lo real y agazaparse en
un lugar pequeo, un ngulo apenas, detrs de los escenarios donde todo
ocurra. Sin cesar. Se repiti su nombre una y otra vez. Marina. Trataba
de regresar a su cuerpo. Marina Espinosa. Sinti la lisura de la madera
donde apoyaba su mano mientras suba la escalera en la cmara lenta de
su cansancio. Oli el aroma de flores frescas que sala de algn cuarto.
Inspeccion la luz que se colaba desde dnde? No pudo identificar la
fuente, pero se fij en las isletas luminosas que se formaban en el filo
de los escalones. Su zapato horadando la mancha luminfera. Su zapato
saliendo de ella. Dira: qu sorpresa, con la voz impostada, tratando de
mentir con los ojos. O no dira nada. Como santo Toms, ira hasta ella
para tocarla, para comprobar que no se trataba de un producto de su

pliego16_finales.indd 18

15/09/2014 16:59:01

imaginacin. Mordera la moneda de oro. Usara el microscopio del


tacto. Burlara a su mente. Se burlara de ella. Te descubr. Nia con
manos en la masa. Dira: no te esperaba. Dira: te esperaba. Los escenarios
se multiplicaban conforme suba la escalera. Los teatros enteros. Las
marquesinas. Las palabras brotaban la una de la otra con reminiscencias
de planta, de ser vivo. Hijas de las hijas de las hijas. Todo en femenino.
Dira: cmo ests? Y de inmediato estallara en una carcajada jocosa,
medianamente avergonzada. Si estuviera bien, si alguna de las dos
estuviera bien, no estara aqu, no estaran aqu. Un cuarto del hotel La
Estrella de Choi. Dira: dnde ests? Tratando de identificar su silueta
entre la penumbra del lugar. Hacindose presente y huyendo al mismo
tiempo. Estableciendo la distancia. Determinando que se encontraban
ah, aqu, dentro del verbo estar. Que los muertos entierren a sus muertos.
Qu quera decir esa frase realmente? Y mientras el significado se le
escapaba, eludindola con contorsiones imprevistas pero bien ensayadas,
pens que, de tener a santo Toms frente a ella, le preguntara: y quin te
dijo que la carne es real? Volvi a repetir el nombre propio. Marina. Dira:
aqu estoy. Titubeante. Abierta como la puerta que estaba abriendo.
Derrotada en su apertura. Entregada a su apertura. Qu importaba a
fin de cuentas que no existiera, que nada existiera? Cuntas fracturas
se necesitaban para formar el caparazn de lo real? Dira: quin eres?
Fingiendo ignorancia. Sabiendo de ms. Oy el timbre del telfono. Y
luego la voz del recepcionista, un bostezo, la saliva uniendo diente contra
diente antes de que la palabra bueno lograra romper el todo de la boca
en dos. Nmero equivocado. Silencio. Y luz. Otra vez la luz sobre el filo
de los escalones. Volvi la cabeza hacia el techo. Eso era. S, eso era: un
tragaluz de cristales sucios, adulterados. Deban ser las tres de la tarde.
Tal vez un poco antes. Minutos apenas. Dira: apresaron a Juana Olivares.
No, no dira eso. No tena caso. Si slo los muertos podan enterrar a los
muertos, quera eso decir que no haba posibilidad alguna de conexin
entre los muertos y los vivos? Pero qu falta de fe, pens. Qu falta de
imaginacin. Empata. Sinti su rodilla y el peso sobre su rodilla. La tensin
sobre el taln, los talones. El momento exacto en que flexionaba la pierna
y el cuerpo se impulsaba a s mismo hacia el siguiente escaln. Eso era
caminar hacia arriba. Eso era subir una escalera. Dira: ya llegu, tratando
de recordar el recorrido sin poder lograrlo. Haba, de verdad, subido la
escalera? Cuando abri la puerta no dijo nada. Se qued detenida bajo
el umbral, observando la espalda de alguien que miraba hacia la calle.
Una silueta protegida por el velo de las cortinas radas. Un bulto apenas.

pliego16_finales.indd 19

19

15/09/2014 16:59:01

20

Eplogo a la masacre
Marina Azahua

La creatividad solamente es reordenar las cosas,


como nadie las ha ordenado.
Fidel Monroy
El Mal no es el demonio enemigo, la anttesis de Dios y del Bien,
sino algo extrao y desorientador: lo Semejante. El Mal no es
lo antagnico del Bien sino su Doble indisociable.
Eduardo del Estal

Los fragmentos en itlicas son citas de Javier Mrquez,


entrevistado en marzo de 2014.
Los fragmentos en negritas son citas de Can.
I.
Apologa sobre las cosas extremas, triloga diseada por el
dramaturgo Javier Mrquez y el director Sixto Castro Santilln,
retoma mitos fundamentales de la tradicin humana con el objetivo
de subvertirlos. El mecanismo de las obras parte de la desarticulacin de los elementos de las narraciones para detonar
preguntas que continan asediando la conciencia humana. En
Can, la primera pieza de la triloga, se parte de una de las ms
antiguas historias del mundo judeocristiano: el pasaje bblico
donde el primognito de Adn y Eva asesina a su hermano, Abel
instante mtico donde comenz la caza del hombre.
Can recontextualiza esta historia fundacional al ubicarla en
un presente abstracto pero plagado de referencias al escenario

pliego16_finales.indd 20

15/09/2014 16:59:01

mexicano de principios del siglo xxi. Se trata de la reelaboracin


del mito a partir de su fragmentacin: Tomar un mito que se d por
hecho, y ponerlo en crisis hasta destruirlo. Algo que tomo de Mller
y que me acompaa hasta ahora: la desmitificacin de la cosa. En
el proceso, se plantean escenarios donde a partir del concepto de
primer asesinato se problematiza la asignacin tradicional de la
culpa en el hermano mayor. La obra implica la posibilidad de una
apologa de Can. Can fue el primer asesino / Y qu hizo Abel? /
Entreg la oveja en sacrificio. / La mat! / La sacrific. Se plantea
que Abel en realidad podra considerarse el primer asesino, pues
fue l quien mat por primera vez a un ser vivo, para cumplir con
la ofrenda al Padre quien podra ser o no ser un dios. El que
inici la plaga de muerte fue Abel [] La vida es vida / sin razas
ni jerarquas. Considerar el sacrificio de la oveja como el primer
asesinato, y nada menos que aprobado por Dios, parte de la idea de
naturaleza pensada paisajsticamente donde el hombre es parte del
paisaje, no es el paisaje.
El tema de la asignacin de la culpa y la responsabilidad sugiere
que Dios podra ser considerado el primer asesino. Finalmente fue
l quien, sin explicacin de por medio, neg la ofrenda de Can en
favor de la de su hermano, desatando as un resentimiento primigenio, que no es envidia, / es ira, / es odio, / es asco, / es amor, /
es escozor en el alma, / es hervor en las entraas que posibilita el
asesinato inaugural entre humanos.
Por qu eligi el Padre la ofrenda de Abel? Quin es el verdadero asesino? Quien sostiene la quijada de burro, la pistola, la
balaquijada? El que genera las condiciones necesarias para que
el asesinato exista como posibilidad? Aqul que recibe la ofrenda
para despus negarla? stas son algunas de las preguntas siempre ms preguntas que respuestas que detona la obra, partiendo
de cuestionar el mito hasta el punto de ponernos del lado de Can.
El ejercicio dramatrgico y escnico resulta profundamente poltico, entendido lo poltico como la relacin entre humanos. Por qu
nos relacionamos como nos relacionamos?
Luego de los estudios pertinentes, / se encuentra que la
causa definitiva de muerte / del paciente Abel es: / la necesidad
paradigmtica / de tener una vctima ante un victimario. En el
Mxico contemporneo, problematizar el ritual de la asignacin
de culpas y responsabilidades sobre los actos cometidos resulta

pliego16_finales.indd 21

21

15/09/2014 16:59:01

22

no slo urgente, sino fundamental. La presencia simblica de referencias a la explotacin petrolera y del papel del ejrcito en la guerra
contra el narcotrfico abre la pregunta de si acaso vale la pena, en el
mundo real, que sacrifiquemos lo que sacrificamos, en nombre
de nuestros nuevos dioses si es que existen: el orden, el
progreso, la modernidad; conceptos abstractos que, al igual que el
dios de la Biblia, no son verificables.
El elemento que plaga al texto de manera central cuestiona la
parte del ser humano que acta en nombre de algo que tal vez no
exista. Por pensar en Dios uno termina matando a una oveja o matando a su hermano. Por pensar en Dios uno se lastima, en nombre
de algo que no es concreto, cuya existencia no es verificable. La
cuestin no es slo la existencia o no de Dios, sino preguntarse:
valdra la pena hacerlo por l? Aunque existiera?
Can tiene un lugar particular dentro de la dramaturgia de
Mrquez, pues en sus trabajos posteriores persiste una preocupacin
por reelaborar la mitologa, ahora trasladada al terreno de la mitologa popular de la cultura de masas. Muchos aspectos de la
cultura popular los tomo como mitos contemporneos: mitologa
contempornea. Estos nuevos hroes el Joker de Batman, el actor
Heath Ledger, Michael Jackson, Walt Disney protagonistas de nuevos
mitos, inundan nuevos ejercicios de desarticulacin. La pregunta
que ofrecen es: qu dioses nos hablan ahora, qu dioses toman
el poder ahora? Y cmo se relacionan estos nuevos dioses con
ese dios primigenio de Can, aqul que prefiere la grasa, / el sabor de la carne quemada, / el olor de la muerte por encima
de la cosecha?
ii.
Can, qu has hecho de tu hermano? es la pregunta reiterativa
que plaga la obra. Su doble es la duda encarnada en la evocacin
de los rasgos f sicos de Dios ojos, fosas nasales, corazn, mejillas, paladar evocados rtmicamente, una y otra vez, a la par de la
coda: si es que tiene, / si es que existe. La duda en torno a
la existencia de Dios, en nombre de quien se ofrenda y se asesina,
se acompaa de un ritmo en el lenguaje que asemeja una letana,
casi un conjuro o encantamiento, que se repite para encontrar la
verdad a travs del acto mgico qu es una ofrenda, sino un acto

pliego16_finales.indd 22

15/09/2014 16:59:01

mgico?. Las voces a menudo no se encuentran asignadas a un


personaje. La coralidad satura al texto, y se lleva al extremo cuando
hablan el viento, las rocas, el desierto globalizado. Mucho de
la puesta es hacia lo potico, hacia la introduccin de lo lrico en la
dramaturgia. En Can, el monlogo dirigido a Dios o al vaco
tiene preponderancia sobre el dilogo, un recurso que privilegia el
proceso interno de los personajes por encima de su interaccin.
Sin embargo, al anclarse el conflicto moral en procesos de violencia y explotacin, se logra vincular el combate interno con el problema social, revelando que es imposible escindir a uno del otro.
La idea de dualidad Can - Abel, bien - mal, vctima - perpetrador se presenta desde la primera lnea del texto en la indicacin
que especifica que se trata de una obra para cualquier nmero de
actores siempre y cuando ese nmero sea par. No importa cmo
se interprete este nico lmite, la dualidad del primer humano en
nacer y el primer humano en morir persistir. Posteriormente, el
texto se dedica a trastocar esta dualidad hasta destruirla. Cuestiona
su oposicin introduciendo matices que habitan entre los polos. La
obra insiste en la figura del par y de la dualidad, pero ronda siempre
un tercero involucrado: Dios si es que existe. Dios como
detonante fundamental de la violencia. Dios, relativizado, porque
nunca aparece como tal, como enunciador. Dios como silencio:
personaje que no habla pero sin el cual el drama no existe. Dios que
nos castiga con su silencio, con su no explicarse nunca. Dios
que eligi a uno de sus hijos por encima del otro: constructor
primario de la otredad, de la diferencia, de la dualidad en
pugna. Dios, tan pasivo y silencioso como todos nosotros.
Jams se explicita el paralelo posible entre Dios y la sociedad
contempornea, pero esta equiparacin est presente todo el
tiempo y se incrementa. A la manera de la necropsia inaudible
que le practican unos doctores a Abel sin explicitaciones, sin
enunciacin poco a poco todos nos convertimos en Can y en
Abel, en Dios y en su paralelo inexistente, y terminamos leyendo
en su historia la nuestra. Entre la alfombra de cadveres /
reconozco mi sangre. Como apunta Marco Antonio de la Parra
en un texto introductorio a la primera edicin de la obra (Grupo
Editorial Antropfagos, 2010) la reelaboracin del mito de Can
nos convierte en la estirpe de su linaje. Todo asesinato posterior
/ sera la mera reproduccin de ste, / un clich ms.

pliego16_finales.indd 23

23

15/09/2014 16:59:02

24

pliego16_finales.indd 24

iii.
Can toma lo ya hecho, lo ya establecido, para deconstruirlo.
Apelar a un imaginario colectivo establecido, permite una mayor
apertura a la poesa: si t tomas algo concreto sobre Can y Abel
ya no tienes que contar la historia. La gente sabe lo bsico: Can
mat a Abel; esto permite que se explicite el trastrocamiento
de la historia-origen. Se trata de tomar lo mtico, lo que est en
el imaginario colectivo, para elaborar poesa a partir de eso.
El arquetipo Can y Abel, culpable y vctima es parte del
material con el que se trabaja: las ideas preconcebidas de la sociedad
como materia prima. Es ms fcil generar la sensacin de poesa en
la otra persona si ya tiene un referente que si construyes todo desde
el inicio. En este sentido, el trabajo de Mrquez resulta ms af n
a la desarticulacin de universos que a la construccin de nuevos
mundos. El procedimiento se basa en reventar.
Can busca dialogar con Heiner Mller en aspectos formales,
pero particularmente en el proceder desde elementos sociales y
polticos a travs de la poesa y a partir de la propia experiencia.
La idea del petrleo y de la guerra estaban muy presentes cuando
empec a escribir Can. Siguen estndolo. Hablan todos los
Canes. Cunde un sentimiento de desamparo ante la inmensidad
del mundo, donde uno hace las cosas y quin sabe si sus acciones
tengan sentido o coherencia.
El propsito de la obra es generar en el espectador posturas
crticas ante los fenmenos extremos que vive nuestra sociedad. De ah el enorme listado de referencias al contexto mexicano
de fines del siglo xx y principios del xxi: catequistas, columpios de
llantas, nios compartiendo el lunch en el recreo, dos ofrendas
trasladadas desde el mito a la realidad Can frente a un barril
de petrleo como smbolo de la cosecha, Abel frente a uniformes
sucios del ejrcito: una camada de ovejas por sacrificar, jvenes
de la calle que hacen malabares y limpian parabrisas, obreros,
reporteros y fotgrafos que afilan sus dientes para tener la exclusiva
de El primer asesino de la historia, asaltos, mujeres asesinadas en
Ciudad Jurez, un lanzamiento de granadas en el zcalo de Morelia
mientras se celebra el grito de Independencia, misiles sobre Irak,
un conejo negro de peluche, pupitres con porteras hechas de papel
para jugar futbol con los dedos cuando la maestra se voltea hacia
el pizarrn, una joven promesa para la humanidad, peticiones de

15/09/2014 16:59:02

asilo poltico, el dramaturgo que escribi la obra, el director que la


dirigi, los actores, el pblico, Can arando con un carrito de supermercado, el asesinato de Abel en un pozo petrolero.
Estas referencias auxilian el traslado del mito a la realidad, haciendo patente que en nosotros se encarnan todos los humanos
de la historia. El acto de unos es el acto de todos. La obediencia
como culpa de Abel vive en nosotros, y tambin el resentimiento como culpa de Can. Estos elementos inciden en la escena
para reventar la estructura de ficcin y revelar que todo mito tiene
su correspondencia en la realidad.
En la seccin xvi de la obra sucede un rompimiento de la forma
tipogrfica, con tres frases acomodadas en crculos concntricos,
abarcando toda la pgina:

25

A travs de este texto/imagen, el rasgo incontrovertiblemente


cclico de la violencia se concreta no slo en el contenido del texto,
sino en su forma Can que mata a Abel que mata a Can que
mata a Abel que mata

La figura del crculo, a su vez, emula los ciclos de la naturaleza:


de cultivo para el agricultor Can: Grano por grano / ha sido cuidado desde su sembrado / hasta su madurez, y de trashumancia
para el pastor Abel: Oveja por oveja / ha sido cuidada desde

pliego16_finales.indd 25

15/09/2014 16:59:03

26

su parto / hasta su vejez. Asimismo, los ciclos se vuelven


smbolo paralelo de la circulacin transgeneracional de la culpa:
interrupcin vital encarnada en el vientre que aborta la vida
hijos de Can e hijos de Abel que terminarn clavndose las
garras en el vientre que aborta la vida...

En esta figura se concretan los ciclos de la naturaleza emparejados al ciclo imparable de la violencia, bebiendo del resentimiento
y la venganza, que han resultado histricamente tan dif ciles de
romper frente al olvido, los campos se fertilizan y los animales
se nutren con las vsceras de la batalla mientras la marca de
Can nos brota en la frente

Este recurso tipogrfico es importante, porque en l se encuentra el germen de un aspecto que se desarrollar posteriormente en
la dramaturgia de Mrquez: la importancia fundamental de la forma f sica de la letra escrita.
Una dramaturgia que busca vincularse con la realidad se traduce
tambin en recursos tcnicos que continuamente destruyen la
convencin: Te acuerdas de Abel? / Descripcin del actor que

pliego16_finales.indd 26

15/09/2014 16:59:04

incluye: estatura, tez, cabello, complexin, una curiosidad


f sica y el parecido con una caricatura. Dos catequistas piden
a Can que recite los diez mandamientos. Can no responde. / Si
alguien del pblico contesta se sigue al siguiente mandamiento.
/ Si nadie del pblico contesta nunca faltar un fastidioso Abel
que levanta la mano y dice la respuesta correcta. Estos recursos
tcnicos se utilizan para vincular constantemente la historia que se
despliega en escena con su correspondencia en el momento real en
que sucede la accin dentro de un teatro, en una ciudad en particular.
Hoy Can estren su nueva obra de teatro en ____________. Se
trata de instantes cruciales que conducen al espectador,
a la par de los actores, a salir del pacto de ficcin. Ahrrate la
escena. / S que vas a matarme, lo acabo de leer en la Biblia.
Las referencias al contexto contemporneo, a la par de estos
exabruptos que dependen de las caractersticas especficas del
montaje en curso, revelan un compromiso por lograr que el teatro estanque a la gente en el presente. La intencin es vincular el
mito de origen, anquilosado, con la actualidad. No slo en cuanto
a contexto histrico, poltico, econmico y social, sino incluso al
momento del montaje en s. La invitacin es a llenar esos huecos
de referencialidad, para que sea el lector quien una los puntos que
vinculan el mito de Can con su propia realidad social, econmica
y poltica. A partir del despliegue de procedimientos se busca que
estas obras generen sus propios contenidos. Yo digo que hago arquitecturas semnticas: construimos estructuras vacas, arquitecturas
vacas, para que el lector - espectador vomite sus propios contenidos
en ella. Esto implica una idea del dramaturgo no como transmisor
de informacin, sino como edificador de espacios vacos que tienen el potencial de ser llenados por el consciente e inconsciente de
quien observa.

27

IV.
Pareciera que Can aborda fundamentalmente el tema de la
violencia y su relacin con el poder. Pero detrs de esos dos enormes
conceptos se erige uno, menos ntido, pero quizs ms profundo: un cuestionamiento sobre la voracidad. Todo parte desde
la imagen de la ofrenda, tras la cual Dios siempre querr ms,
de la misma manera en que el humano siempre exige ms, a sus

pliego16_finales.indd 27

15/09/2014 16:59:04

28

pliego16_finales.indd 28

congneres, a la naturaleza. La voracidad de todo poder funciona


as: siempre se nos va a pedir que sacrifiquemos ms, en nombre
de qu? De quin? Del progreso, el avance, la modernizacin? De
conceptos abstractos que resulten tan ficticios, tan construccin
cultural vaca, como la idea misma de Dios? El poder exige a las
personas sacrificar su tiempo, sus impuestos, sus hijos, sus cuerpos,
su dignidad. La voracidad del poder, del gobierno, de la economa:
esos dioses que nos rigen en la secularidad econmica y poltica
donde lo que se sacrifica es lo social y comunitario.
Quedarse callado tambin es una forma de acto. Si Dios es
el espectador de la violencia suscitada o incitada por l
entre Can y Abel, nosotros como lectores - espectadores nos
convertiremos tambin en testigos pasivos de la violencia. Como
tales, recibiremos al final de la obra la misma ofrenda de carne y
hueso que recibiera Dios de Abel a travs del cordero, y de Can
a travs del cadver de Abel: un trozo de carne empaquetada
con una etiqueta que dice: Can y Abel. Este ltimo pedazo
de carne, ofrendado al pblico, trastoca el papel del espectador que hasta ese momento se crea pasivo, un observador
neutro de lo que suceda ante l en escena. La ofrenda final va dirigida al espectador y lo obliga a responsabilizarse de lo que ha visto.
A nosotros nos toca, como a Dios, escuchar las voces de la
culpa que surgen de la tierra de Nod. Si la inaccin es una forma
de acto y a travs del no actuar se acta, habra que pensar de
qu forma actuamos como pblico / lector de esta obra.

15/09/2014 16:59:04

Jalar los hilos: tejido y (re) escritura


Mariana Oliver

29

Si los motivos que conducen a la escritura son tan diversos como


quienes escriben, tal vez la reescritura corre con la misma suerte
y surge de muchos lugares, acaso de la sospecha, de la insatisfaccin, de una mirada que se busca en el pasado, en lo que se supone
anterior; tambin emerge del placer, de una fascinacin que fluye
y desemboca en otro texto. Quiz se reescribe porque hay algo no
dicho, que se oculta, o todo lo contrario, se vuelve a escribir porque
el texto dice demasiado.
Al escribir, una maraa informe se ordena, adquiere su silueta,
su lugar en el mundo. Reescribir es como destejer, jalarle los hilos al
texto y stos, vueltos nudos en los dedos, encuentran otro camino,
enlazados ya con otras voces. Quien ha tejido sabe que al hacerlo el
tiempo adquiere un ritmo distinto aunque el ovillo contenga en
s el principio y el final ineludibles y es posible volver en l, destejer por la noche lo avanzado durante la vigilia y, como Penlope,
estirar los das.
Si el paso de la oralidad a la escritura fue un guio a la posibilidad de permanencia, a hacer de la tinta sobre el papel una extensin confiable de la memoria de ah las Tablas de la Ley, grabadas
en piedra por la mano de Dios, entonces reescribir es rechazar,
resistirse a lo esttico, a lo inmutable. Romper la piedra y adorar un
becerro dorado.
*
Imagino que quienes reescriben experimentan una satisfaccin
agridulce, incompatible con la de los nios, vidos de repeticin, que ven la misma pelcula o piden el mismo cuento cada
noche. Durante una poca, hace ms de veinte aos, mi hermana

pliego16_finales.indd 29

15/09/2014 16:59:04

30

y yo vimos una cinta hasta que se desgast. Paulatinamente, las


manchas de los dlmatas que buscaban a sus cachorros todos
los das se multiplicaron en la pantalla y la cubrieron casi por
completo. Estoy segura de haber visto la pelcula hasta aprenderme
los dilogos de memoria y nunca entend por qu una mujer quera
matar tantos perros slo para tener un abrigo (en esas historias
de iniciacin, las malas siempre son mujeres), ni cmo un msico
enclenque y nervioso poda adoptar ms de cien cachorros mientras
yo ni siquiera tena uno.
Mi simpata por aqullos que reescriben se deriva de un prejuicio, supongo que poseen una de las caractersticas que ms aprecio:
la incredulidad. Incluso he imaginado el proceso que lleva a alguien
a reescribir: primero, la historia pica o bblica narrada como aliciente para inducir al sueo se instala y, como semilla, echa races.
Crece as por dentro y va trazando deseos, bordando expectativas.
Un da, quien reescribir (y que todava no lo sabe), convertido en un
inconforme capaz de llevar su malestar hasta sus ltimas consecuencias, tal vez mirando al horizonte, tal vez al fondo de la taza de
t, susurra para s la frase que da vueltas en su cabeza: seor Dios,
usted se equivoca, las personas no resucitan; seor Homero, no
quiero ser un hroe ni quiero ir a la guerra.
Palimpsestos
Escribir donde ya se ha escrito es una prctica antiqusima. Aunque en el Antiguo Egipto y en Grecia los papiros se reutilizaban
pese a ser un material poco propicio para ello, fue durante la Edad
Media que los palimpsestos se multiplicaron; sin embargo, nada
hay ms lejano a un deseo de reinventar la literatura que estos artefactos medievales que se producan slo por motivos econmicos.
Confeccionar un pergamino era equivalente a desollar un ganado
entero que, mientras ms joven, posea una membrana ms suave y
fcil de coser, por lo que reutilizar folios era una prctica habitual.
Los pergaminos se lavaban y raspaban para permitir la copia de
un segundo texto; incluso stos podan usarse de nuevo. As, tres
copias de pocas, caligraf as y gneros distintos se encontraban en
el mismo cdice.
Palimpsesto significa grabado nuevamente, de ah que cada
uno de ellos sea nico. El tiempo que hay entre cada copia, as como

pliego16_finales.indd 30

15/09/2014 16:59:04

la disposicin de los textos, les confiere individualidad, un carcter


propio: Homero enterrado bajo un tratado mdico, Arqumedes
desdibujado entre salmos y oraciones de convento. Frmulas y
poesa, herejes y santos encerrados entre las mismas tapas durante
siglos. El amor, por ejemplo, convierte al cuerpo en palimpsesto.
Una primera escritura lo estrena hasta su inevitable lavado y
raspado que no logra borrarla del todo. Y andamos as, con la piel
como testimonio.
Durante la segunda mitad del siglo xx, cuando los tericos
literarios se ocupaban de estudiar las relaciones entre textos,
Grard Genette utiliz el trmino palimpsesto para hablar de
las reescrituras literarias, de las voces propias y ajenas que conforman al texto, de cmo los autores se apropian de una obra ya
existente para contar otra historia. La idea de Genette fue esclarecedora: detrs de cada texto, de lo que leemos en la superficie,
hay un sinf n de autores enterrados, basta con soplar un poco.
Los palimpsestos son testigos de la marginacin, de la seleccin
no natural de la literatura. Aquellas copias de las que se poda prescindir eran borradas, enviadas al fondo, convertidas sin reparo en
fantasmas. Como es usual, el tiempo pone al mundo al revs y hoy
se busca en los palimpsestos lo que el pergamino esconde.
Al igual que otros libros, los palimpsestos producen ideas perversas, no slo porque nos revelan un da que los subalternos tambin hablan o que algunos hroes bien podran llamarse asesinos;
su estructura es una provocacin en potencia. Se me ocurre, por
ejemplo, un palimpsesto testimonial, donde la encclica Veritatis
Splendor de Juan Pablo ii quedara enterrada bajo el Manual de la
buena lesbiana de Ana Francis Mor.

31

Letras indelebles
Me llamaba Emma Rosa Arce Becerra. Tena 40 aos.
Encontraron mi cuerpo en la calle Guadalupe, en Puerto Vallarta.
Me mat mi esposo Jos Garca Garca.
Me dispar varias veces en el trax y en la cara.
Mat tambin a un joven de 16 aos de quien tena celos
y despus se mat l.
De vez en cuando, a modo de escritura colectiva, un grupo de
personas nos reunimos a bordar en lugares pblicos. Con hilo

pliego16_finales.indd 31

15/09/2014 16:59:04

32

prpura letra por letra, desovillando, dejando testimonios indelebles de lo terrible sobre el pao blanco. A veces hablamos, otras
veces no es posible. Hay quien se detiene a leer los retazos de tela.
Siempre nos preguntan por qu bordamos, nunca por qu matan
mujeres.
Una bordadora me cont que, una vez, una nia pasaba en bicicleta y entre los pauelos que ondeaban se encontr con la historia
de su madre. Saber que alguien ms la recordaba la reconfort.
(La aguja se encuentra por un instante con mi dedo, instintivamente me lo llevo a la boca para seguir bordando. Cada letra duele).
*
Hay reescrituras fallidas o imposibles. A la mala, una aprende que
ciertas historias deben dejarse como estn, intentar reescribir
la memoria es terreno peligroso, no es como un lbum de fotograf as, un sitio fijo que muestra miradas y gestos petrificados,
sonrisas fijas que no se agotan. Dicen que una mujer se
convirti en estatua de sal slo por mirar atrs usualmente la
memoria se encuentra atrs y no adelante, por dar un ltimo
vistazo a lo que deba dar la espalda.
A travs de nuestras historias o de su rechazo nos inventamos.
Somos lo que contamos sobre nosotras mismas, repeta como
mantra una profesora de la Facultad. Entonces no dej de preguntarme qu era aquello que guardaba en la memoria, cmo
me contaba, cmo me iba tejiendo o quin era en mis historias.
Hay gente que recuerda largos fragmentos de su infancia y dispone
de relatos elocuentes para la sobremesa; de la ma recuerdo poco,
rastrojos apenas: los das de Reyes, el hombre de la bicicleta
arrollado por un auto, la presa frente a mi casa, el uniforme de la
escuela. Supongo que comenc a existir despus.
Y quin, si pudiera, no se reescribira? Yo borrara un ao o
dos y dejara a Stravinsky de fondo musical. Entonces sera otra,
distinta de la que escribe, mutilada, con una laguna inocua de aguas
calmadas, pero liberada de ese ao o dos.

pliego16_finales.indd 32

15/09/2014 16:59:04

Nouvel An
Hayde Salmones

33

Para Huberto Batis


Para Lorena

Estaba ebrio. Al despertar, en una estacin del metro de Pars vi


que daban las 12 : 00 de la noche. Era pattico; no recordaba nada.
Las arcadas volvieron, ms fuertes.
La mir. Estaba buena. Iba sentada frente a m, con las piernas
cruzadas y los muslos muy tensos. Lloraba. Le mir los pechos, con
ganas de estrujrselos. Cogrmela all, duro, sin palabras. Metrsela
en el culo, hasta adentro. La mir a los ojos para que supiera. Dej
de llorar. En la siguiente estacin, baj.

pliego16_finales.indd 33

15/09/2014 16:59:04

34

Riada
Bernardo Barrientos Domnguez

La cara de Penlope se esconde bajo las cobijas; no quiere que los


rayos del sol la despierten. No quiere que nada interrumpa el sueo.
Para muchos, los sueos son lugares para evadir realidades y donde
encontramos las cosas perdidas a lo largo de nuestra vida. Y vaya
que Penlope ha perdido mucho en su breve paso por este mundo:
no pasa un ao en el cual la muerte se lleve a un familiar o a una
amistad. Por tal razn, ella est muy sola: la fama de su maldicin
termin por alejar a los dems. No obstante, mientras pueda parir
sueos, a Penlope no le importa. Yo tambin he sufrido prdidas.
Mi madre muri de tristeza y mis dos hermanos fallecieron en un
terremoto. Mis abuelos enfermaron de cncer letal y mi padre descuid una hernia que lo llev a estirar la pata. Desaparecieron a mis
amigos en el norte; nadie ms ha escuchado hablar de ellos. S, los
dos hemos llorado, pero yo no puedo dormir. No es mi naturaleza;
tampoco me causa angustia no poder hacerlo; soar no es importante. Sin embargo, obedezco las reglas del cielo y me levanto de
la cama al momento en que sale el sol. De repente, el da despunta
y el deber, ese bicho raro que aplasta sueos, empieza a dictar las
diligencias estriles que nos vincularn al estrs y a los dems.
Tengo que ir al trabajo. Ya se me hizo tarde. Tengo que despertar
a Penlope. Tengo que preparar el desayuno. Quiero innovar, pero
slo s cocinar huevos y quesadillas. Tengo que baarme. Tengo
que rasurarme. Tengo que sacar al chamaco de la cama. Tengo que
vestirlo. Tengo que recoger los platos y lavarlos. Tengo que hacer el
caf y explicarle a mi hijo por qu todava no puede beberlo. Tengo
que hacer una lista de los deberes para que Penlope se encargue
de realizarlos. Tengo que sacar la basura. Tengo que revisar que la
tarea est bien hecha. Todo eso, al tiempo que descorro las cortinas

pliego16_finales.indd 34

15/09/2014 16:59:04

y me doy cuenta de que otra vez llegar tarde al trabajo. Mientras,


Penlope an se oculta bajo las frazadas; llamo a la oficina con voz
adormilada y pregunto por el jefe.
No ha llegado me dice una secretaria.
Dgale que voy retrasado. Problema domstico.
No entro en detalles. Cuelgo e identifico la frustracin inicial del
da. Quisiera meterme bajo las cobijas y quedarme tendido hasta
envejecer, pero tengo la certeza de que me har viejo trabajando.
No jetn. Entonces prendo el biler y, en lo que calienta, dispongo
de veinte minutos para exprimir las naranjas, mezclar el huevo con
el jamn y poner la mesa. Elegir el traje que usar. Ponerlo sobre la
cama. Despus escoger la camisa y colocarla debajo de la chaqueta.
Al final, la corbata, la pinche corbata. Durante el periodo de seleccin, recordar ante todo que una camisa estampada siempre va con
corbata lisa de un slo color. Pero las corbatas son un rollo. No les
entiendo por ms sencillo que parezca. Corbata negra combinada
con un traje negro y una camisa blanca. Corbata rosa con una camisa blanca o celeste y un traje gris. No s por qu, pero la corbata
naranja va muy bien con una camisa azul o blanca o beige. Corbata
azul con una camisa del mismo color en tonos ms claros o igualmente con una camisa blanca. Demasiadas corbatas, demasiadas
decisiones intiles. Termino con ello tras una larga pausa agobiante
y me bao mientras mi cabeza no deja de trabajar como una locomotora infernal. Las cuentas, las malditas cuentas. El gas, la luz, el
cable, las tarjetas, el internet, la escuela, la despensa, las medicinas,
el dentista, el plomero, el cumpleaos, el da del nio, el da
de cmprame esto, la semana de cmprame aquello, el mes de
cmprame lo otro, el gasto, el gasto, el gasto. Al terminar, despierto
a Penlope con un dulce beso, que no es dulce ni es beso. No puedo
ver su cara, pues est muy escondida. Entonces me dispongo a
adentrarme en las cobijas para rescatarla y aquello me llevar ms
tiempo del disponible. Despus de varios insultos que pierden el
sentido con su repeticin matutina palabras que suelen decirse
cuando no hay nada ms que decir, Penlope sale de la cama con
una cabellera ingobernable que cubre su enojo. Miro mi reloj pero
no tengo la necesidad de comprobar la hora; estoy seguro de que
es demasiado tarde. Vuelvo a coger el telfono y llamo a la oficina.
No ha llegado me dice un secretario.
Dgale que voy retrasado. Problema intestinal.

pliego16_finales.indd 35

35

15/09/2014 16:59:04

36

pliego16_finales.indd 36

No entro en detalles. Cuelgo y despierto a mi hijo. Al igual


que muchas personas, l atesora los sueos como joyas preciosas,
secretos tan ntimos que nunca se dicen. Se hace el dormido
aunque lo est sacudiendo con la fuerza para despertar a un
borracho. Le retiro el edredn, las sbanas, las almohadas y aun as
no se mueve, mantiene un escorzo demasiado forzado. Entonces
le ruego que se despierte, me pongo de rodillas pero nada funciona.
Finalmente cuando logro sacarlo de la cama, contina el reto de
vestirlo. Quieres esta playera? No? Bueno. Quieres sta otra?
Tampoco? Qu te parece sta? Bueno, cul quieres? La verde?
sa est sucia. No te la puedes volver a poner. Por qu no usas la
morada? Ya lo s, pero en serio est muy sucia y te prometo que la
voy a lavar en la tarde. Nooo, no llores. Por favor escoge otra. No
puedes usar la verde. Qu tal la naranja? Ya, por favor, no llores.
La lavar al regresar del trabajo. Por favor ya no llores, ya no
llores. En ese mismo momento, guardo la absoluta conviccin de
que voy a meter la playera verde a la lavadora y luego la meter
en la secadora de forma inevitable. Entretanto, Penlope sonre
con malicia, los ojos cerrados desde su cuartel de plumas. Regreso
a mi habitacin y vuelvo a llamar al trabajo.
No ha llegado me dice un hombre viejo.
Dgale que voy retrasado. Problema vecinal.
No entro en detalles. Cuelgo y prendo el sartn, echo los huevos.
Caliento el pan en el tostador y sirvo el cereal. Escancio el jugo
de naranja y, para esto, no hay nadie en la cocina. Los dos han
vuelto a quedarse dormidos. Cuando me asomo a las habitaciones,
los encuentro agazapados debajo de sus respectivas mantas. De
pronto, suspiro resignado; una especie de adiccin y suicidio
contemporneo. No puedo evitarlo, quiero aventar los platos a las
paredes como lo hacen en las series americanas, quiero mandar
todo a la chingada y retirarme de la escena en medio de un silencio
de nerviosa incertidumbre. Quiero gritar como chango alterado
por la presencia de una amenaza, pero no puedo. Los cuerpos
dbiles no pueden vivir sin el deber. Tengo muchas cosas que
hacer. Tengo que sentarlos a la mesa, tengo que lavar sus platos,
tengo que mantener a Penlope fuera del cuarto, tengo que sacar
la basura orgnica pues ya hay varias moscas, tengo que sacar la
playera verde de la secadora. Tambin tengo que pasar al banco y
a la gasolinera, tengo que pensar en las vacaciones en Cuernavaca,

15/09/2014 16:59:04

en Navidad y en Reyes, tengo que pensar en el aniversario. Tengo


que pensar, pensar, pensar. Y ellos dormir, dormir, dormir.
Al fin se levantan ojerosos. Desayunamos mientras masticamos para sentirnos vivos. Lo hacemos en silencio como debe de
ser: nuestras fantasas mudas nunca se tocan, slo nos vincula
el sonido de los dientes triturando la comida que dej de ser
comida conforme se fue repitiendo hasta el sinsabor del convencionalismo. Ante todo, tenemos prisa por terminar las misiones
que nos han encomendado el deber y el estrs. No nos prestamos
atencin, ya que cada quien est inmerso en sus pensamientos. Es
cosa de minutos para que retire los platos sucios a medio acabar
y los coloque en el fregadero. Tengo que lavarlos, pues Penlope
no lo har. Les pido de favor a los dos que limpien la mesa; sin
embargo, resulta lo mismo hablarle a un fantasma. Antes de salir,
intento comunicarme a la oficina.
No ha llegado me dice una jovencita.
Dgale que voy retrasado. Problema en la primaria de mi hijo.
No entro en detalles. Saco y cuelgo la playera verde de la secadora
y salgo disparado por la puerta con mi hijo. De camino al trabajo
me acuerdo de que no hice la lista. Falta leche, jitomates, aceite,
mantequilla, frijoles, queso y tortillas al menos. Estara bien comprar
huevos tambin. Aprovecho el embotellamiento, ese fenmeno tan
comn que an sigue irritando a la gente que lo provoca, y marco
a la casa. Penlope no contesta, tampoco funciona su celular. No le
gusta recibir llamadas. De seguro se volvi a dormir, igual que mi
hijo, quien va dormido de ida a la escuela. l tambin ha conocido
las prdidas. Tuvo un hermano por tan slo dos aos, al cual quiso
con toda su alma. Como usualmente pasa en muchos hogares, un
perrito lleg tiempo despus. Hermoso schnauzer que conoci el
mundo slo por dos aos. La tristeza de un nio dista de ser reproducida ejemplarmente por las palabras; por ello basta decir que
sufri de forma amarga. Cuando lo miro dormir pienso en eso. De
la misma manera en la que miro a Penlope. Ellos necesitan de los
sueos para paliar el dolor de su mundo, para librarse de la acuciante
realidad. Quisiera acompaarlos en su dolor, ser su fortaleza,
pero ciertamente escapan de mi ayuda. Tardo una hora y cuarto
en cruzar Coyoacn. Procuro sonrer cuando mi hijo dice adis,
pero no puedo ocultar la angustia de que me van a despedir. No
s por qu vuelvo a mirar el reloj. Es una costumbre masoquista,

pliego16_finales.indd 37

37

15/09/2014 16:59:04

38

pliego16_finales.indd 38

una locura de esperar algo que nunca va a suceder. Ya en el


trfico que abunda en todas partes, no puedo evitar imaginarme
en la pobreza; en cmo voy a mantener a mi familia. Las dificultades
que sobrevendrn a mi despido, los gritos y las pesadillas. Divago
en la forma en la que tendr que confesarles que ya no van a tener
una cama donde soar. Que los sueos tendrn que ser cambiados
por un boleto de ida a la desesperacin. Que no tenemos familiares
ni amigos en quienes confiar, a quin pedirle dinero. Estoy muy
molesto por cosas que todava no suceden, tan enojado que piso
el acelerador sin querer. Entonces golpeo la defensa de un Chevy.
No es tan fuerte el impacto, pero el conductor est que arde. Las
cosas se caldean. Estoy seguro de que l tambin va retrasado.
En un segundo de no tensin, los dos llamamos a la oficina.
No ha llegado me dice un joven.
Dgale que voy retrasado. Problema automovilstico.
No entro en detalles. Cuelgo y el otro conductor cuelga. Nuestro
da al parecer es un infierno. No s por qu no descargamos
nuestra ira en el otro. l se ve feln. Yo tambin rifo. No obstante,
de alguna forma tenemos la idea de que nos van a despedir y no
podemos alargar ms el asunto. Tampoco podemos llegar con
sangre en nuestras camisas. Es inaceptable. Tengo que darle
trescientos pesos por el golpe; lo acordamos y cada quien jala por
su camino. Eventualmente todos tenemos que hacerlo. Antes de
llegar al trabajo, despus de que me lavaron tres veces el parabrisas
chin!, ya no pas a la gas ni al banco, veo que el estacionamiento est lleno; ya llegaron todos. Doy vueltas alrededor de un
sinf n de vehculos estacionados, alineados a la perfeccin,
indispuestos a traspasar las lneas divisorias de espacio. De manera
eventual encuentro un sitio apartado y la violencia que ocupa mi
corazn parece haberse apagado. Me bajo del auto y mis piernas flaquean, un adormecimiento las invade. Apenas puedo
mantenerme en pie; ms de dos horas cuarenta minutos sentado.
No importa. Calculo que ya me estn esperando con el cheque
del despido, listos para soltarme. En ese instante, en el trecho entre
la oficina y el estacionamiento, deseo tener alas y volar hacia el sol.
Desintegrarme sin aspavientos. Slo fundirme a sus potentsimos
rayos que destruyen sueos al amanecer. Sin embargo, puedo pedir
muchas ms cosas, pero al fin y al cabo, s que maana voy a repetir
el mismo ritual tan montono como mesinico, sin importar lo que

15/09/2014 16:59:04

suceda. Cuando se abren las puertas, entro con la sensacin de que


voy a perder aun antes de hacer la apuesta. Camino con los hombros
encogidos, la cara medio escondida en la solapa del saco. Procuro
que nadie se d cuenta de mi presencia: si me van a correr que no
se arme un escndalo o un chismero. Al tiempo que atravieso un
largo corredor, sopeso las posibilidades de buscar trabajo en una
de las empresas competidoras. O vendiendo comida, no s. Tengo
que salir adelante, tengo que proveer, tengo que cumplir, tengo que
portarme bien, tengo que satisfacer sus necesidades, tengo que facilitarles la travesa, tengo que estar all, tengo que estar ac, tengo
que estar all, tengo que estar en todos los lugares, tengo que pagar,
tengo que producir, tengo que generar, tengo que ofrecer, tengo
que, tengo que y tengo que. Para cuando llego con la secretaria,
estoy tan plido que parezco enfermo, mi corazn late a mil por
hora. Ante la situacin, ella me pregunta:
Jefe, est usted bien?
Disculpe, seorita le digo sin escucharla. Lleg ya el
patrn?
Horrorizada, se lleva la mano a la boca.
Seor director!, se encuentra bien?

pliego16_finales.indd 39

39

15/09/2014 16:59:04

40

Declaracin de odio 2.0


Arturo Loera

Se ha trascendido la carne simplemente


y quedan la piel, las vsceras y el tiempo
cabalgando en el alba
ef mero entre dudas y esperanzas inciertas.
Las absurdas cadenas se mantienen, Efran,
pero los gritos brotan ahora de las cloacas:
cocodrilos furiosos, acaso poetas,
cayendo en el drenaje de las negras ciudades
o sobre pequeas slabas esclarecedoras
que sean una flor blanca ms all de los tneles podridos.
Porque qu alta ciudad, mareada y lodosa!
Hay rboles de concreto, y persiste una extraa calma.
Las horas grises, blancas y amarillas
ahora son canas, dientes y hepatitis
y lo que hubiera muerto en las traidoras calles
sigue muriendo sin voz ni acero ni tezontle.
La ciudad es justa en nuestro odio
pues alberga en el reflejo de sus cristales sucios
las mismas figuras que en un tiempo
causaron conmocin y van pasando
a ser parte de lo cotidiano.
Sin embargo persiste cierto odio, ciudad,
que genera la perpetuacin de contrapartes
que no deja de llenarnos los bolsillos
a cada paso que camina nuestra vista.

pliego16_finales.indd 40

15/09/2014 16:59:04

Ciudad negra o colrica o mansa o cruel


o pequea hoguera que no ha de calentar
dos o tres partes de nuestro espritu.
Y al mismo tiempo fuerte en nuestra carne
y nuestras columnas
y nuestro origen orientado hacia el rencor
de odiar a la tierra y amar a la vida.

41

Te declaro mi nico odio

(ya que no puedo hablar por los dems).


A ti, a tus alegres y farsantes noticias,
a tus muchachos malditos
que de malditos slo tienen las uas,
a tus prostitutas fras y a tu acero caliente.
Te declaro mi nico odio a fuerza
de ser engrane en el progreso
de tu talla gigante y sentirte as inmensa
pero cercana.
Y si te odio es para mantener la parcialidad
a la hora y en la hora de nuestro poema
y encontrarlo entre tus meses cada vez ms chicos,
entre la publicidad y la msica de un alma desarticulada.
Y as tambin he visto a los hombres:
rosas o geranios, claveles o palomas,
hombres y cocodrilos que esperan caer
en el drenaje de la negras ciudades, como t
y no ser una casa apacible donde vivir cobardes
y no una puerta falsa para huir de rodillas.

pliego16_finales.indd 41

15/09/2014 16:59:04

42

Oda a la vida retirada


Ren Rueda

Mi vida habra seguido su cauce natural si el consejo eclesistico no se hubiera enterado de que en vila burl al regimiento
completo de monjas carmelitas. Una mozuela de caderas anchetas
no soport el silencio y cont lo que vio y vivi. Asumirse como
vctima ma la salv de los fuetes, el destierro o la muerte.
Yo, como obrador de sus congojas, fui con el vano dedo sealado.
El obispo Gonzlez, de Teruel, ley mi sentencia.
Me arrancaron los hbitos y me otorgaron el destierro. Llor
porque la vida monacal, a la que me consagrara desde los trece
aos, slo haba abonado mis desdichas. De nada sirvieron mis
ttulos de traductor de los Proverbios o del Libro de Job; tampoco
mi trabajo en la ctedra de santo Toms. Mi Orden pregon que yo
era la encarnacin de Satans. Entonces abandon mi cruz y,
puesta la fe en mi cuerpo, march hacia los pueblos de Flandes
y Bretagne, con el fin de mudar mi destino.
En Arkngelsk ahogu cuarenta hombres y puse fin a las contiendas del ahogo; en Marken me cas ocho veces y jams conocieron mi verdadero nombre. A pie, deshice los meses de siete aos.
Dichosas experiencias ocupan mi memoria: conozco bien el sabor
de las tardes en Quiberon, donde aprend a comer pescado crudo.
Pero la suerte me tir de su lecho y al cabo de once aos volv, en
calidad de mendicante, a la terrible patria. Me hice bandido de capa
y estocada, luego matn a sueldo. Por una coincidencia, durante
una encomienda en Teruel, mat al ms frreo enemigo del obispo
Gonzlez, mi antiguo juez, y ste, despus de meditar sobre el
provecho que supona tenerme cerca, me hizo su guardia personal.
Durante dos aos segu su carruaje sobre un caballo negro de buena
estampa. Era feliz con mi sombrero de ala pronunciada, mi espada

pliego16_finales.indd 42

15/09/2014 16:59:05

y mi casaca roja de la cual sobresalan las mangas de una limpia


camisa con cuello a la valona.
En los das de descanso escriba poesas por las maanas, y
dedicaba las tardes a pasear por las calles bien empedradas, donde
me deleitaba con el andar de las mujeres jvenes. Pensaba en que
Teruel y sus comarcas eran buenos lugares para transcurrir una vida
sin grandes aspavientos: desde que el obispo me tena consigo nadie
lo perturbaba. Mi existencia por fin haba alcanzado cierto equilibrio.
Un da de noviembre, el equilibrio se rompi. Al promediar la
tarde, por vez primera mir a la nia triste. Se trataba de una mozuela espigada con un canasto de pan colgando de sus puos; se me
antoj tan sola y tan sublime que pens en protegerla. Caminaba
tras una mujer de rostro inflexible y entrada en aos. Desde ese
momento, la serenidad me abandon. Buscaba cualquier pretexto
para separarme del obispo y rondar los caminos de la nia. Mis
persecuciones fueron cada vez ms notorias. Recuerdo que permanec frente a la puerta de mi amada cuatro noches seguidas, hasta
que el desvelo enmarc mis ojos; y que llor a solas, porque me
senta indigno de amar a tal belleza. Recuerdo que una tarde
encontr en la taberna a ciertos conocidos y que les habl, entre sollozos, de mi amor por la nia triste.
Un hombre viejo, cuyos ojos apenas se notaban entre sus
muchas arrugas, conmovido por mis quejas, se acerc hasta mi
mesa y me llev aparte. Dijo que me aconsejara, porque haba
escuchado de mi fama y no le complaca que un hombre valeroso
se ahogara en un pequeo estanque. Hablaba con gran autoridad y,
a pesar de sus aos, su voz era brillante y grave. Le di gracias y, al
momento, comenz a hablarme en liras:
Qu vida ms afable, la del que huye del mundanal ruido, y sigue la escondida senda, por donde han ido los pocos sabios que en
el mundo han sido! Y quin sabio llamarse?, sino aqul que ha corrido mil caminos, sin dolores ahorrarse y no escuchar ms trinos,
que el combate de alfanjes asesinos. El valor de los leones, la ms
ilustre gracia de esta vida, por las Dominaciones de cuidado cedida, es poderosa luz que en vos anida. Bien vale que por sta, procures un descanso prolongado, en el mar o en la cresta de la sierra
que, presta, a recibirte va como a un regalo. Irte de aqu, valiente, y
en la marcha llevar a tu adorada, mantenerla caliente, con ternura
bullente, hasta que brote amor de su mirada!

pliego16_finales.indd 43

43

15/09/2014 16:59:05

44

pliego16_finales.indd 44

Las palabras del viejo, al que di por poeta, inflamaron mi pecho


de esperanza. Al llegar a mi casa comenc a preparar la que crea
mi ltima aventura. A la siguiente jornada sub las escarpaciones
de la sierra hasta que encontr un lugar oculto y confortable donde
inici la construccin de una cabaa. Me alegr la cercana del Tajo.
Cuando conclu la cabaa me dispuse a robar a la nia. En esos
das me convert en un animal silencioso: si antes me mostraba en
todo el esplendor que la ropa de guardia y mi caballo me otorgaban,
ahora me dedicaba a espiar a la nia desde las esquinas, o desde los
comercios de telas que abundaban por aquellos rumbos. Comenc
a codiciar su cuerpo ms que su alma. Una noche de luna menguante en que las pulgas del ansia carcoman mi espritu, improvis
unos versos a fin de serenarme: Qu presta a mi contento si soy
del vano dedo sealado; si, en busca deste viento, ando desalentado
con ansias vivas, con mortal cuidado? Oh monte, oh fuente, oh
ro! Oh secreto seguro deleitoso!, ya roto el enato, a vuestro almo
rugoso huir de aqueste mar tempestuoso.
Un tres de marzo realic aquello que tanto haba soado. Era
casi la hora nona cuando, a caballo, persegu a mi nia hasta la
iglesia. En el prtico le di alcance, con una mano apagu su grito.
La empotr con facilidad. La mujer que la acompaaba intent
detenerme. Le di un puntapi en la boca. Luego chifl. El caballo
emprendi el galope entre las miradas injuriosas de los pocos
testigos. Yo profera maldiciones y los tildaba de cobardes. Al dejar
atrs la ltima casa de Teruel, hund mi nariz en el cuello de mi
amada y exclam, victorioso: Un no rompido sueo, un da puro,
alegre, libre quiero; no quiero ver el ceo vanamente severo
de a quien la sangre ensalza o el dinero! Despirteme esta ave,
con su lozano cuerpo encendido, no el cuidado grave de que siempre es seguido el que al ajeno arbitrio est atenido.
Luenga fue nuestra cabalgata. Los espritus del bosque ya
chirriaban cuando se levant ante nosotros la cabaa: posea un
jardn gigantesco abundante en flores. A su diestra, el caudaloso
Tajo serpenteaba.
Esa primera noche desnud a la nia, pero no desfalqu ninguna
de sus glorias. Me limit a proferir un sermn sobre nuestra unin
en medio de una tierra enjuiciadora, le dije que ramos las mitades
separadas de un solo cuerpo; que mis ojos la haban buscado
tantas veces, en tantos lugares, como quien busca un lugar dnde

15/09/2014 16:59:05

transcurrir la existencia; que era como si, al hallarla, me hubiera


topado con la verdadera vida; que vivir con ella era como vivir
conmigo. Mientras le deca esto ella lanzaba profundos gimoteos
y, al ms leve contacto de mis manos, encoga sus suaves muslos.
Por hoy has de quedarte as, quiero mirar cmo te labra el fro le
dije finalmente.
Apenas despunt el sol, la puse en mi lecho y, como si abriera
de par en par las puertas del monasterio, abr sus blancas piernas.
Goc sin paz del bien, luego del duelo, a solas, sin testigos, libre
por fin de celo, de odio, de condena, de recelo. Cuando ella dej de
oponerse a mis abrazos y dej caer su cabeza en mi pecho, sent en
la piel su tenue llanto y me promet que sera el ltimo de su vida.
Pero una infausta sed hizo que, despus de una semana de goce,
la amordazara y la metiera en una jaula de troncos que colgu de
un rbol, pues haba decidido bajar a las comarcas de Teruel para
busca otras glorias semejantes a ella, glorias que perdan su esencia
en poqusimos das.
En los alrededores me apodaron el monstruo y durante un tiempo no se atrevieron a recorrer mis territorios, slo daban gracias
al cielo cuando los restos de sus muchachitas corran ro abajo,
llagados y flacos, mientras mi espacio de rboles reverdeca con
las presencias nuevas y yo recitaba graciosas poesas como sta:
Del monte en la ladera, por mi mano plantado tengo un huerto, do
siempre es primavera, de bella flor cubierto, ya muestra en esperanza el fruto cierto. Mis nias codiciadas, en cuatro das de ayunas
reverdecen, suben tristes y agriadas pero al bajarlas crecen en candor y, en silencio, obedecen. Sola tenderme bajo las jaulas: madur
a la sombra de los temblores y de las llorosas peticiones que convert en tenues lricas, puesto el atento odo al son dulce, acordado,
del plectro sabiamente meneado.
Cuando los poblados se vaciaron de mozuelas, treinta hombres
en la flor de sus das decidieron acabar conmigo. Sobre caballos
fuertes abrieron los caminos de la sierra. Se encomendaban al Dios
de la victoria; a cada rato soltaban los pomos de sus espadas para
besar sus cruces; no les importaba morir pues crean que yo mereca ese destino. Pero ellos no saban que en Arkngelsk haba dado
muerte a cuarenta hombres bravos en una sola lucha.
Si tuviera un poco ms de tiempo consignara, minuciosamente,
la manera en que romp sus crneos; describira mis trampas y

pliego16_finales.indd 45

45

15/09/2014 16:59:05

46

pliego16_finales.indd 46

hablara del sonido de mi gurka al hundirse en su carnes, al tajar sus


narices y orejas. Pero el rey se ha dado cuenta de que soy un gran
tigre y ha enviado a ms de doscientos hombres por mi cabeza.
Ya escucho el crujir de sus botas contra las castaas de este otoo;
ya puedo oler su miedo. Me voy de aqu. ltimamente he soado
con pieles del color de la nieve y blondas cabelleras.
Si la vida me alcanza, probar suerte en diversos pases. Adis
cabaa ma, dejo esta relacin de hechos para darle a la gente algo
con qu entretenerse. La finalizo con estos versos que dan razones
fieles a mi comportamiento: Como dice Aristteles, cosa es verdadera: el mundo por dos cosas trabaja: la primera, por tener
mantenencia; la otra cosa era por tener juntamiento con hembra
placentera.

15/09/2014 16:59:05

Dos epigramas a la manera de Ernesto Cardenal


Samuel Espinosa Mmox

47

A m tambin Anel me gustara escribirte


un epigrama de amor como el de Ernesto a Myriam
Pero de aquellos das

Anel
en los que t me parecas tan bella
tan bella que ni Myriam me lo hubiera parecido
a duras penas

y me acuerdo

***

para una como vosotras

Y t que algn da leas estos versos


emocionada ms por mirar tu nombre en el poema
que por el poema mismo
recuerda cada tarde que pasamos juntos
y hasta presmelo
tuviste tu poeta
Pero tambin recuerda
tus ltimas palabras antes de partir
como si hubieran sido mas

pliego16_finales.indd 47

15/09/2014 16:59:05

48

William Carlos Williams en Reno


Santiago Ruiz Velasco

William Carlos Williams levanta la cabeza y se cala la visera. En la


loma, un japonesito subrepticio que ha mantenido al equipo a raya
durante tres entradas. Piensa en su madre, en Panam, en su padre,
un marine que desapareci en el 99, y en el Herrera, con el que
fue campen la temporada pasada. Haba llegado a Reno en junio
gracias a su bateo de .357, a probarse con el equipo local, los Ases,
pero ac era distinto. La altura, el idioma, la dieta, el fro endemoniado y esa llovizna constante que conforme avanza el ao se va
convirtiendo en nieve. Y la gente. Hoy amaneci solo, y slo
encontr una nota: me com las ciruelas del refri. Estaban deliciosas, tan dulces y heladas. Perdona. Estara ella entre el pblico?
Sepa Dios. El parque es tan grande, inimaginable para ligas menores. Los jonrones son mucho ms escasos y hay que colocar
mejor los golpes. Atrs, entre los jardineros.
No todo es malo, claro, y por algo emigr, pero si planea quedarse o ir a los Diamantes de Arizona, el equipo matriz, tiene
que empezar a batear ms. El juego defensivo no basta, no lo
trajeron por ser tercera base.
Un out, hombre en segunda, y el toletero que le sigue es malo de
veras. Son los altos de la sptima y empieza, otra vez, la llovizna.
William Carlos se planta. Abanica. Mira al pitcher. Vuelve a fallar.
Recuerda la broma del dominicano sobre que no se le pueden leer
los ojos al huevn. Se estira, hace un par de swings fuera de la caja
y vuelve. Le mira las manos entonces, ve la pelota salir, los dedos
imprimindole efecto. Sabe dnde poner el palo, y toda la tensin
acumulada en su cuerpo se dedica a ponerlo justo all. Se astilla el
bate y la pelota sale hacia las gradas. De foul.
La atrapa un nio emocionado y, tras el instante, la mirada de
William Carlos sigue hacia el gallinero donde est el resto del equipo. Muy primer mundo, pero los bates de repuesto estn en una
carretilla vieja, roja, lustrosa de agua. Mientras se acerca, sin prisa,
se da cuenta
de
todo
lo que depende
de ella.

pliego16_finales.indd 48

15/09/2014 16:59:05

pliego16_finales.indd 49

15/09/2014 16:59:07

pliego16_finales.indd 50

15/09/2014 16:59:09

pliego16_finales.indd 51

15/09/2014 16:59:12

pliego16_finales.indd 52

15/09/2014 16:59:18

pliego16_finales.indd 53

15/09/2014 16:59:19

pliego16_finales.indd 54

15/09/2014 16:59:23

pliego16_finales.indd 55

15/09/2014 16:59:25

pliego16_finales.indd 56

15/09/2014 16:59:26

pliego16_finales.indd 57

15/09/2014 16:59:33

pliego16_finales.indd 58

15/09/2014 16:59:40

pliego16_finales.indd 59

15/09/2014 16:59:41

pliego16_finales.indd 60

15/09/2014 16:59:42

Reescrituras crticas
Patricia Arredondo

61

Las ideas del artista son el alimento del crtico; sta es la tesis del grabado de
Julio Ruelas (1870-1907) que aparece reproducido en nuestra editorial y en el
cual el pintor decimonnico se retrata siendo atacado por un bicho malvolo.
Las caractersticas f sicas de la alimaa simbolizan el carcter de su naturaleza pedestre, de ah que se asemeje a un horrendo pajarraco con manos en
lugar de alas.
En este nmero, jugamos a ser de alguna forma esos bichos horrorosos que
vampirizan las ideas de otros para sustentar las propias, pues la reescritura
opera tambin como un ejercicio valorativo. El reescritor desarma el texto,
analiza los mecanismos que lo componen estructural y semnticamente, y
emite un juicio a partir del cual reconstruye el entramado a su antojo, o en
funcin de lo perfectible, retomando algunos de sus elementos compositivos
e integrando otros tantos para la conformacin de una nueva idea.
La tarea de reescribir no es ajena a la historia del arte. La reelaboracin de
pinturas u obras plsticas acta en diversas direcciones: como stira, negacin
o reconocimiento El artista que reescribe la imagen lo hace desde su tiempo,
su estilo y su potica. Estos elementos se sirven de la variedad de formas y el
orden de la composicin para dar un giro a la idea del autor original, o crean
partiendo de esa misma estructura y actualizan tcnicamente la obra. Se busca
tambin la referencialidad y el dilogo entre pocas, es decir, se trabaja sobre
un discurso que permite replantear conceptos y miradas con respecto a lo ya
hecho de manera grfica.
Al pensar que la reescritura tambin est presente en lo pictrico, decidimos
convocar a diversos artistas para hacer una reinterpretacin del grabado La
crtica (1907) de Ruelas. Los creadores deban cambiar de sujeto y reelaborar
la imagen del bicho desde la tcnica que les pareciera pertinente, con un estilo
libre, conservando los elementos y su disposicin bicho-autor (pues en sta se
concentra la idea central de la obra). Los protagonistas grficos se pensaron en
relacin a los autores reescritos en los textos de la revista, si bien tuvimos un
par de invitados que se distinguen por su independencia.

pliego16_finales.indd 61

15/09/2014 16:59:42

62

La organizacin de los retratos se basa en el dilogo que establecen entre s.


En la portada tenemos a William Carlos Williams a manera de caricatura, por
Erik Rosales. La separata abre con la versin de Andrs Espino, en la cual Ruelas
es quien manipula al bicho. En tanto, la reinterpretacin de Rodrigo Cifuentes
propone que aun en la muerte las alimaas crticas siguen succionando las
ideas. A sta le sigue la del pintor mexicano Arturo Rivera un autorretrato
apoyado en el de Ruelas, que fue el detonante para lanzar la convocatoria,
pues nos hizo pensar en la posibilidad de una reescritura en lo grfico.
En la versin de Miguel Mar, Shakespeare es atacado por lo que pareciera
ser no la crtica sino la muerte, a lo que el autor reacciona con una mirada
de indiferencia. Diomedes Heras retrata a Cervantes, quien es mordido por
la araa de la locura. David Martnez pinta a sor Juana cabalgando la cabeza
de Octavio Paz. Ytzel Maya, a su vez, en una acuarela, hace que un arcnido
gigantesco atenace y envuelva con su red a la dcima musa.
ngel de la Cruz dibuja a Bram Stoker, quien es atacado tambin por una
araa; al autor de Drcula lo representa Corron con una especie de murcilago
montado en la cabeza. Hayde Salmones dibuja a Ins Arredondo con una
mariposa como prendedor en el cabello (la femineidad es lo que la hostiga o
son sus mariposas nocturnas?). Por su parte, Capitan Monsta la pinta con un
par de pjaros tomando el t y discutiendo en su cabeza; stos no la agreden
pero la usan como base o instrumento. Dispusimos tambin la reescritura de
Manuel Reyes, quien intervino una fotograf a de Anne Rice en la cual el bicho,
un libro, ha cado sobre la mesa.
As, en algunos casos el atacante es autorreferencial; en otros, la crtica deja
de serlo para convertirse en una metfora de los temas que obsesionaban a
cada uno de los escritores retratados.
La separata a color cierra con el linograbado
de la artista Gabriela Martnez, cuyo abductor
es un ave que se alimenta de su creatividad. La
tcnica empleada nos incit a colocarlo en un lugar
simblico: al usarlo de ex libris, queremos signar
que esta revista pertenece a la reescritura.
Tenemos la seguridad de que el abanico de
imgenes que presentamos crear una reflexin
en torno al tema que da unidad a este nmero:
qu es una reescritura y cmo opera en distintos
lenguajes, segn los recursos de los que se puede
echar mano. Confiamos tambin en que tanto quien
lea esto como quien d un vistazo a las imgenes,
se convertir, sin duda, en una de esas bestias
monstruosas que emiten juicios con respecto a lo
que testifican. Bajo esa premisa, cul ser la forma
del bicho que corone la cabeza de esta revista?

pliego16_finales.indd 62

15/09/2014 16:59:43

Colaboradores grficos

63

Rodrigo Cifuentes (Jalisco, 1980)


Realiz estudios en La Esmeralda. Pintor
tenebrista contemporneo; su trabajo, cargado de
un cido humor negro, analiza la dicotoma del
mito latinoamericano y el sueo americano.
Corron (DF, 1989)
Tigre / palabrista / ilustradora / msico. Habita en:
flickr.com/photos/corronie corronie.tumblr.com
facebook.com/corronie twitter.com/@corronie
instagram.com/corronie
ngel de la Cruz
Estudi Diseo de la Comunicacin Grfica
en la UAM-A. Trabaj en el rea de Imagen de
Canal Once y en diseo editorial. Es diseador y
animador freelance. www.behance.net/anhell
Andrs Espino (a. k. a. Ende)
Estudi diseo grfico en la UAM-X. Ha hecho
talleres y diplomados en ilustracin y paredes del
bao. Tatuador de tiempo completo en Garage Ink.
http://ende-ensutinta.blogspot.mx
Diomedes Heras (a. k. a. David Heras)
Animador, ilustrador y diseador licenciado de
la ENAP. Colabora con Cocolab y el colectivo de
animacin Paper Bandits.
http://diomedes-heras.tumblr.com/
Miguel Mar
Diseador grfico por la UAT Tampico. Ha publicado
comics independientes y cuentos en antologas
del ITCA. Actualmente se desempea como
maestro de iniciacin artstica y como tallerista.
David Martnez (Chihuahua, 1987)
Estudi literatura. Pinta desde que encontr una
paleta en 2008; en 2010, expuso en el Museo Casa
de Jurez. Becario de investigacin de la f,l,m.

pliego16_finales.indd 63

15/09/2014 17:00:06

64

Gabriela Martnez (Los ngeles, California)


De ascendencia peruana y mexicana, su trabajo
utiliza smbolos visuales de este doble linaje para
explorar las escenas cotidianas y las mitologas
familiares que conforman su historia.
http://gabrielamartinez.wordpress.com/
Ytzel Maya (DF, 1993)
Estudia Letras Hispnicas en la UNAM y
Comunicacin en la BUAP. Curs el diplomado
en Creacin Literaria del INBA. Se dedica a la
ilustracin y a la direccin escnica teatral.
Manuel Reyes
Estudi Ilustracin Editorial en la AMAS. Trabaj
en Nickelodeon, Cartoon Network y Play Station.
Public en InKult Magazine, Errr Magazine y
La devoradora. Cofundador de Calaca Studio.
Arturo Rivera (DF, 1945)
Estudi pintura en la Academia de San Carlos y
serigraf a en The City Lil Art School de Londres.
Ha expuesto en el MoMA D.F., Bellas Artes, el
MARCO y en el extranjero. www.arturorivera.net/
Erik Rosales
Diseador grfico egresado de la ENAP-UNAM
Xochimilco.
dospallevar.blogspot.mx
www.behance.net/erikrosales
Julio Ruelas (Zacatecas, 1870-Pars, 1907)
Pintor y grabador. Estudi en la Academia de San
Carlos y en la Universidad de Karlsruhe, Alemania.
De Pars trajo la tcnica de grabado por aguafuerte.
Fue el principal ilustrador de la Revista Moderna.
Hayde Salmones (DF, 1989)
Estudi literatura y fue rescatista de autores decimonnicos en la UNAM, pero hoy tiene una pug
y se desempea como ngel del hogar. A veces, dibuja. Es becaria de la f,l,m. en el rea de narrativa.
Alan Vzquez (a. k. a. Capitan Monsta).
Es diseador industrial pero se titular como diseador grfico prximamente. Animador 2D de clset. Su peor miedo es que se le caigan los dientes.
http://paper-bandits.tumblr.com/

pliego16_finales.indd 64

15/09/2014 17:00:25

Flores de Baria Poesa


Jorge Gutirrez Reyna

65

Don Carlos de Sigenza y Gngora


Cosmgrafo y catedrtico y capelln (ttulos son estos
que suenan mucho y valen muy poco)
Infortunios de Alonso Ramrez

A travs de los redondos vidrios


de mis lentes observ la travesa
del isberg que dejaba un rastro
de espuma sobre las altas aguas de la noche;
trac en un mapa las finas venas
azules de los ros que se desangran
en el lago de Texcoco; y desenterr
el vuelo petrificado de la serpiente
en los muros rojizos de Teotihuacn.
Yo hubiera querido
legar a las bibliotecas del tiempo
un verso perdurable como aquella calzada
que custodian ruinas de pirmides
y frondas de nopal, como el latido
del corazn de agua que enciende
los frutos en el pecho verde de la tierra,
como el hielo en los acantilados
de los cometas navegantes.
Quiz no son estrellas las slabas del verso.
Deb quitarme los lentes para ver
estas tunas ms de cerca,
constelacin de soles diminutos,
sobre el plido mantel de las maanas.

pliego16_finales.indd 65

15/09/2014 17:00:25

66

La dama que se vio en una calavera de cristal


En calavera de cristal se va,
en el espejo docto escarmentaba,
la que, cuando belleza se miraba,
luz mortal de belleza se atenda.
Don Luis de Sandoval Zapata (ca. 1620 - 1671)

Mientras paseaba en el jardn aquella noche


te escabulliste hasta la biblioteca.
Buscabas un objeto que te haba
prohibido especialmente que tocaras.
Desenterraste del fondo del bal de taracea
el bulto envuelto en un pao rojizo;
lo colocaste sobre la mesa y lo fuiste
desenvolviendo con dedos temblorosos,
como si deshojaras las flores del granado.
A la luz tartamuda del candil habrs visto
esplender la calavera de cristal, tesoro azteca
conquistado por la espada de mis mayores.
Alzaste con ambas manos ese espejo:
habr colmado la miel de tus pupilas
el par de cuencas transparentes hasta el borde;
la sangre de tus mejillas habr fluido
por las traslcidas venas de los pmulos;
debieron cerrarse tus labios por encima
del labrado minucioso de los dientes sobre el cuarzo.
Extraado de tu silencio,
haba emprendido ya tu busca por la casa.
Abr de golpe la puerta de la biblioteca,
soltaste un gritillo de espanto y dejaste caer
al suelo la preciosa reliquia:
calavera en esquirlas reventada.
Tiempo despus el bronco Bragadoro
te parti la frente de una coz.
Te hall de espaldas sobre la hierba hmeda

pliego16_finales.indd 66

15/09/2014 17:00:25

coronada con la guirnalda de tus propios sesos.


Teresa, t lo supiste bien esa maana helada:
somos calaveras de vidrio entre las manos
de una muchacha asustadiza.

67

Sor Juana Ins de la Cruz


la vista perspicaz, libre de antojos...
libre tendi por todo lo crado.
Primero sueo

En un sueo contempl la vastedad del universo.


Vi la oreja vigilante de un venado
dormido en la cumbre de nieve del volcn,
el hasta entonces ignorado rostro
de mi padre, un chacal de piedra
en los relieves interiores del sarcfago;
vi tus ojos verdes, Mara Luisa, y una carta
tuya entre las pginas de un tratado
de mitologa en mi biblioteca,
la misteriosa arquitectura de la rosa;
vi catedrales de vidrio en la Antrtida
y rebaos de unicornios marinos que se abran
camino entre los blancos tmpanos del agua;
vi a un hombre leer en la banca de un parque
un soneto de mis noches de vigilia;
en Nepantla vi tambin la tumba
con el nombre de mi madre, a m misma
dormida entre los muros del convento y en mi pecho
la insomne y delicada relojera del corazn.
So una noche con la vastedad del universo.
Mis pies nunca pisaron
la arena humedecida por el mar.

pliego16_finales.indd 67

15/09/2014 17:00:25

68

Poemas
Dulce Alcntara

Abrojos ii
Pero por qu derramas
tantas lgrimas?... Ah!
S, todo lo comprendo
No, no me digas ms.
Rubn Daro

Qu comprendes? No mientas.
Todo concluido est.
Pero yo muero por verte,
y por fin hablar
del amor que siempre siempre prometiste
y de las nupcias que no llegaron jams.
Por qu huiste cobarde
despus de mis vestidos,
y mis flores arrancar?
Ahora en el estero
tu imagen no soportas mirar.
Mi nombre es Crdula
y el tuyo es Charlatn.
ngel locuaz,
cierra tus alas
y al precipicio no me arrojes,
que mis plantas
el suelo quieren pisar.
Pero qu pretendes
con ese poema lograr?
Ah!... S, todo lo comprendo
Por favor, no vuelvas ms.

pliego16_finales.indd 68

15/09/2014 17:00:25

Hombres vanos y vanidosos

69

Pues para qu os espantis


de la culpa que tenis?
Queredlas cual las hacis
o hacedlas cual las buscis.
Sor Juana Ins de la Cruz

Que le faltan centavos


y por eso es inestable.
Vanidad!
Que rebosa en monedas
y por eso es petulante.
Vanidad de vanidades!
La fmina es codiciosa, dicen,
mas tienen muchas mujeres.
Todo es vanidad!
Que no le gusta el compromiso
y es por eso su desdn.
Vanidad!
Que quiere desposarse maana
y por eso busca doncella.
Vanidad de vanidades!
La fmina todo quiere, dicen,
pero una mujer es quien todo se los da.
Que no hay encanto en la cama
y por eso la repelen.
Vanidad!
Que su cuerpo es la lujuria
y la tratan peor que furcia.
Vanidad de vanidades!
La fmina a mis deseos no obedece, dicen,
pero para ellos es nimio el placer de la mujer.
Hombres vanos y vanidosos
cundo entendern?

pliego16_finales.indd 69

15/09/2014 17:00:26

70

1. Linda Hutcheon. A
Theory of Adaptation.
Nueva York,
Routledge, 2006.

2. Jos Luis Snchez


Noriega. De la
literatura al cine.
Teora y anlisis
de la adaptacin.
Barcelona, Ediciones
Paids Ibrica, 2000.

pliego16_finales.indd 70

Qu es la reescritura?
Ana Laura Magis Weinberg

Reescribir es un trmino muy amplio, tanto que parece dif cil de


abordar. Para hablar de la reescritura me basar, principalmente,
en textos tericos de adaptacin, sobre todo A Theory of Adaptation
escrito por una de mis crticas/tericas favoritas, Linda Hutcheon. 1
Antes de empezar, tambin, quiz deba esclarecer que como buena
posmodernista, posbakhtiniana, postodo, entiendo texto ms all
de lo que hay en una hoja y uso el trmino para hablar de pelculas y
otras cosas que se pueden interpretar como si fueran palabras
escritas.
La reescritura es una manifestacin concreta de la gran nebulosa
que es la adaptacin. Es dif cil encontrar una definicin de qu es
adaptar e incluso, cuando la hay, sta es demasiado general. Por
ejemplo, Jos Luis Snchez Noriega se refiere a adaptacin como
el proceso por el que un relato, la narracin de una historia,
expresada en forma de texto literario, deviene, mediante sucesivas
transformaciones [] en un relato muy similar expresado en forma
de texto f lmico. 2 Snchez Noriega habla especficamente de la
adaptacin al cine de un texto literario, pero es dif cil encontrar
definiciones que no sean de procesos concretos. Linda Hutcheon,
que habla de la adaptacin como proceso sin importar qu se adapta
a qu medio, se rehsa a darnos una definicin. En cambio, aborda el
problema a partir de ideas: la adaptacin es una re-mediacin (es
decir, cambiar de medio), y tambin es una transcodificacin donde
se pasa de una serie de convenciones a otras; estas consideraciones
parecen apuntar ms a pasar una novela a una pelcula y esta pelcula a un videojuego, pero bien podran referirse al remake de una
pelcula de los setenta que se rehace tomando en cuenta las nuevas
convenciones (qu esperamos de las pelculas, cmo hay que hacer

15/09/2014 17:00:26

los efectos especiales, etc.). Es decir, eso de cambiar de medio o de


codificacin no implica necesariamente cambiar la forma f sica
o textual. Hutcheon, sin embargo, es bastante clara para hablar de
lo que no es una adaptacin. No es copiar al pie de la letra, sino
apropiarse del material que se copia: el xito de una adaptacin
no depende de la fidelidad al texto de partida. 3
Una adaptacin, para Hutcheon, tiene que ser un texto autnomo
por s solo (y es aqu, y no en su fidelidad, donde radica el xito),
y se compone de dos partes: repeticin y cambio. La repeticin nos da
seguridad y en realidad nos encanta que nos cuenten la misma
historia una y otra vez, mientras el cambio hace que valga la pena
que se cuente de nuevo. Qu y cunto se cambia depende de las
posibilidades tecnolgicas de la poca, las capacidades imaginativas y econmicas del adaptador, y el entusiasmo del pblico por el
texto de origen. Hutcheon seala la diferencia entre una adaptacin y
fenmenos como fan fiction, historias donde los lectores se dedican
a imaginar nuevas aventuras para sus personajes queridos. Dice al
respecto que hay una diferencia entre no querer que termine la
historia y querer contar lo mismo una y otra vez pero de distintas
maneras. Al final del libro termina plantendonos una especie de
grfica, que hizo ecos con un texto sobre traduccin que le hace
algunos aos y que traa un dibujo de un abanico. En los dos casos
se explora la idea de que hay textos ms cercanos al original y textos ms alejados, y que se van moviendo en una especie de continuo.
La reescritura est situada a la mitad de este continuo, entre el
extremo que sera copiar palabra por palabra y lo que Hutcheon
llama spin-offs (historias completamente nuevas elaboradas a partir
de un personaje que apenas tocan lo que sucede en el texto original).
Al plantearla justo en medio de este continuum nos indica que la
reescritura conserva bastante del texto de origen pero tambin
tiene muchos cambios hechos por el adaptador (digamos, si
furamos cientficos y esto fuera ciencia, que habra un 50% de
material que se conserva y 50% que se cambia). Si pensamos en
trminos legales, una traduccin necesita pagar derechos de autor
porque es su obra, al igual que lo hace una puesta en escena teatral,
o una pelcula hecha a partir de un libro. Estas adaptaciones estn
ms cercanas al original, mientras que otras (llamadas a veces
derivadas) estn tan lejos que hay que encontrar las referencias
escondidas (como Hamlet en El rey len o Robinson Crusoe en La

pliego16_finales.indd 71

71

3. Como indica
Robert Stam en
Literature and Film
(A Guide to the
Theory and Practice
of Film Adaptation),
eso de hablar de
infidelidad de
un texto nos hace
parecer mojigatos, y
cuando decimos que
traiciona al original
le estamos dando
connotaciones ticas.

15/09/2014 17:00:26

72

vida de Pi). Una reescritura infringe los derechos de autor (pues


hay que conservar la propiedad intelectual, no?), pero si no
hubiera un cartel diciendo basada en pocos se daran cuenta
de su origen. Las reescrituras cambian el final, nos cuentan la
infancia de algunos personajes, pasan una obra a otra poca
o lugar, pero permiten que la trama se desarrolle igual o casi
igual. Creo, sin embargo, que para poder llamarse reescritura
el nuevo texto tiene que cambiar el original de alguna manera.
Por qu reescribimos?
En 1967 Roland Barthes mat al autor, y desde entonces la crtica
literaria se ha separado mucho del creador del texto. Antes era
vlido preguntarse cmo influy la biograf a de un escritor en una
obra, o qu quiso decir; ahora los textos se suponen objetos
completamente separados de sus creadores, y las pistas para
decodificarlos estn en el mismo texto o en otros. Hutcheon, sin
embargo, propone que la adaptacin le quita el peso al texto en s
(ya que existe aparte del adaptador) y regresa la atencin al creador,
pues vuelve a ser vlido preguntar por qu lo hizo? y por qu
lo hizo as? cuando sabemos que existen otras maneras de hacerlo.
Hutcheon plantea la pregunta de por qu nos gusta adaptar
pero no la contesta del todo. Y es aqu donde intervengo. Hutcheon
insiste siempre en nuestro amor por la repeticin y la innovacin
y esto, invariablemente, me hace pensar en el juego. Jugar es una
actividad que no es exclusiva de los seres humanos (los chimpancs
tienen muecas de palitos y los leones bebs se pelean de broma), y
que cada vez se estudia ms como fenmeno de la mente; algunos
juegos sirven como preparacin para actividades futuras, para
forjar lazos dentro de una sociedad, pero sobre todo por el simple
hecho de que son divertidos. Ms all de la funcin del juego, se
ha demostrado que jugar sirve para formar y reforzar conexiones
neurolgicas (es decir, para aprender). No somos el nico animal
que juega, pero s el que juega ms. Jugar nos permite explorar
el mundo y plantear posibilidades. Al ver a un nio aprender
notaremos que primero repite la actividad un par de veces de la
misma manera que se la mostramos, y cuando se da cuenta de que
tiene un dominio suficiente empieza a proponer variaciones de
la actividad. Cuando aprendemos un idioma nos ensean frases
hechas que repetiremos un par de veces, y al ver que el maestro nos

pliego16_finales.indd 72

15/09/2014 17:00:26

sonre intentamos cambiar algo de la estructura o las palabras para


probar si entendimos bien.
Cuando llegaba el momento de entregar el trabajo final siempre agradeca a los profesores que nos dejaban temas establecidos
en lugar de decirnos escriban sobre cualquier cosa vista en clase.
Tambin me pas lo mismo cuando, intentando escribir poesa, escoga hacer sonetos en lugar de verso libre. Creo que es ms fcil ser
creativo cuando se tiene un marco limitado, pues la libertad absoluta
requiere mucha disciplina para domarla. Las formas rgidas preestablecidas tambin permiten jugar con ellas y pueden convertirse
en un juego del ingenio, y sa es otra razn detrs de la reescritura.
Creo firmemente que la reescritura es un ejercicio de amor.
Cuando amamos algo, nos queremos vestir lo ms posible de ello,
queremos que sea tan parte de nosotros, habitarlo. La reescritura
parte de este amor: primero repetimos el texto algunas veces,
releemos y volvemos a ver la pelcula. Llega un momento en que la
copia nos cansa, y de la misma manera que como aprendemos
a amarrarnos las agujetas, cuando sentimos que ya dominamos el
texto nos empieza a dar ganas de querer alterarlo de alguna manera.
Tambin tiene mucho de la eterna curiosidad humana: queremos
explorar el texto y el universo que nos propone, descubrir sus
fronteras y pasearnos por sus lmites. La reescritura no es un
ejercicio sino un juego: queremos simular nuevos escenarios en eso
que tanto nos gust.
La reescritura no siempre es inocente: puede partir del amor
por un texto pero no siempre da un resultado amoroso. Pienso en
Wide Sargasso Sea, una novela de Jean Rhys donde toma a un personaje de Jane Eyre y lo reconstruye. En la novela clsica inglesa Jane
trabaja en la casa de Rochester, que parece estar habitada por un
fantasma. Cuando ella y Rochester se van a casar llega un testigo a
detener la boda, pues Rochester est casado con una mujer loca que
tiene encerrada en el piso de arriba, y quien est obsesionada con el
fuego. Menciona, tambin, que es una criolla del Caribe. Jean Rhys,
nacida en la isla Dominica, escribi una novela contestataria donde
se narra la infancia de esta mujer, que llama Antoinette Cosway, y
nos deja ver el maltrato a la que la someti Rochester, la manera en
que le quit su fortuna y la orill a la locura, culminando en un viaje
en barco que ella misma no reconoce. As, Rhys transforma la novela original, pues seala el discurso racista y machista implcito en el

pliego16_finales.indd 73

73

15/09/2014 17:00:26

74

4. Keith Cohen con


respecto al director
Sergei Eisenstein
en Eisensteins
Subversive
Adaptation, Peary
and Shatskin, 1997.

pliego16_finales.indd 74

texto. Charlotte Bront hace que Cosway sea responsable de todo el


mal de Rochester, y Rhys regresa la culpa a Rochester al mostrar
el verdadero proceso detrs de la locura de su mujer (que en el
texto original se explica diciendo que ella es del Caribe y por lo
tanto est loca, y adems atrap tramposamente a Rochester al
casarse con l).
La reescritura permite jugar dentro de los lmites propuestos por
un texto, pero tambin nos da la oportunidad de cambiar el texto de
origen. Hutcheon dice que para que una adaptacin sea buena
no basta con sealar los momentos en los que se aleja o se acerca del
original: el problema no est en la fidelidad. Para ella una buena
adaptacin tiene que ser una obra autnoma, capaz de existir por s
misma sin el conocimiento previo de la obra adaptada. Ella misma
cita a un crtico que afirma que las adaptaciones deben subvertir
al original, 4 y aunque no estoy de acuerdo totalmente con tal
declaracin (y Hutcheon tampoco), creo que tiene algo de cierto.
La reescritura est justo en el lugar adecuado, al separarse lo suficiente pero no demasiado del original, para ser el tipo de texto que
puede cambiar la obra de partida. Creo que una buena reescritura,
adems de poder existir libremente por el mundo, tiene que hacernos ver lo reescrito con una nueva mirada, nos tiene que aportar
algo que el primero sugiere pero no explora. Pienso, por ejemplo, en
cmo la nueva serie de la BBC, Sherlock, me ha hecho ver lo estrecha
que es la amistad entre Watson y Holmes, sugerida en los cuentos
pero no encarnada como lo hacen Martin Freeman y Benedict
Cumberbatch. No concuerdo con eso de subvertir al original porque no siempre es necesario, como en el caso del detective ingls.
A veces basta con alumbrar las esquinas oscuras para que la prxima vez que nos metamos en el cuarto desordenado, el texto de
partida, nos acordemos de mirar hacia arriba y fijarnos en el estucado que nunca se nos ocurri que poda estar ah.
sta es una pregunta que se aborda mucho con respecto a las
adaptaciones literarias al cine, ya que traen varios problemas: el
principal, las hordas de fanticos que leyeron los libros y nunca
quedarn satisfechos porque ellos imaginaron las cosas de otra
manera. Por otro lado, las adaptaciones tienen la gran ventaja de
que, precisamente por los libros, es ms probable que les vaya bien
comercialmente. Las reescrituras, creo, actan menos en funcin
del pblico y ms alrededor.

15/09/2014 17:00:26

De nios perdidos y llaves sangrantes:


reescrituras del cuento de hadas en el siglo xx

75

Lola Horner

Reescribir es ante todo releer. No cabe adivinar el significado de las


palabras sin antes relacionarlas con lecturas previas. El texto funciona como un doble espejo: observamos en l las obras que lemos
antes, los lectores que fuimos y tambin aqullos que somos conforme nuestros ojos se deslizan sobre las pginas.
La relectura modificar nuestras concepciones de significado
anterior al tiempo que cubre, con un plumaje hbrido y distinto, al
texto que leemos en el momento.
Los cuentos de hadas son un gnero tan antiguo como la humanidad. Si en un inicio se escurrieron de boca en boca, entre las
lenguas y los ojos de hombres y mujeres que transmitan sus relatos
alrededor del fuego, los escritores ms populares (pensemos por
ejemplo en Perrault o los hermanos Grimm) ya eran reescritores.
Tomaban las palabras del aire y las transformaban, gracias a un
proceso alqumico que llevaba su firma, en tinta sobre papel inmaculado.
El material del cuento de hadas es inflamable. En sus smbolos se
han recreado psiclogos, antroplogos y eruditos. Su complejidad
y la atraccin que por ellos sentimos no se ha visto mitigada por la
historia. Cada una de las sucesivas reescrituras dot a los cuentos
de un contexto cultural y sociopoltico que se insinuaba, casi a
contraluz, en las modificaciones que los autores introducan entre
los personajes y la trama. No slo Perrault pensaba que sus cuentos
deban ser edificantes y diseminar el concepto de la civilit francesa
a lo largo y ancho del continente europeo: los mismos hermanos
Grimm vean en el cuento de hadas una oportunidad para construir
la identidad distintiva del pueblo alemn.

pliego16_finales.indd 75

15/09/2014 17:00:26

76

pliego16_finales.indd 76

Quien tiene el poder decide cules cuentos trascienden y


cules languidecen, despojos que naufragan al lado del camino.
Quines conocen hoy da los cuentos de hadas expresionistas, que
el rgimen nazi se encarg de prohibir y desaparecer? Quines
a las escritoras de la corte francesa, contemporneas de Perrault,
mismas que sufrieron crcel y exilio por el carcter transgresor de
sus relatos? Dentro de la historia del cuento de hadas se encuentra
escrita con sangre aquella otra historia, la de los discursos nicos,
que amenaza cada tanto con imponerse a la libertad creativa en
aras de los ms altos valores sociales o morales.
As, los cuentos transmitidos por mujeres fueron escritos
(reescritos?) por varones. El cuento de hadas viaj a Amrica entre
las sbanas de los inmigrantes irlandeses, dentro de las maletas
de los ministros alemanes, junto a las Biblias de los misioneros
espaoles. Walt Disney supo retocarlo con su varita mgica: lo
convirti en celuloide. Si durante el siglo xix el cuento de hadas
fue arrinconndose cada vez ms del fuego del hogar hacia la
habitacin de los nios, para el xx el contenido familiar, defensor de
valores occidentales y conservadores estaba totalmente afianzado
en forma de pjaros cantarines y ardillas simpticas. Su potencial
subversivo se redujo mientras el didctico se potenciaba. Tan es as
que junto a las pelculas de Disney los cuentos de los Grimm, ya
censurados por los hermanos con miras al pblico infantil, resultan
directamente transgresores.
Qu ocurre hoy que la reescritura del cuento de hadas goza
de verdadera salud? Qu tienen en comn los poemas de Anne
Sexton, la pelcula Jack el matagigantes y los Cuentos de Hades
de Luisa Valenzuela? El siglo xx es el siglo del reciclaje, y el xxi
contina con esta tendencia. Se exploran nuevas maneras de
dialogar con los textos, de transgredirlos, de apropirnoslos. Si ya
es imposible ser original, explotemos el discurso desde dentro.
El cuento de hadas es un discurso plstico; si le creemos a
Umberto Eco, admite toda suerte de modificaciones porque se
construye a partir de una serie de acciones simples que Vladimir
Propp se ocup de catalogar cual entomlogo preocupado. Veamos
como ejemplo tres reescrituras de la Caperucita. Ya son distintas
a las dos ms conocidas, la de Perrault y la de los Grimm, pues
el escritor francs permite que el lobo se meriende a la niita,
mientras que los Grimm, en un alarde de poder autoral, dotaron al

15/09/2014 17:00:26

cuento de un cazador para rescatar a la indefensa. Escojamos tres


autores dismiles: Roald Dahl, Angela Carter y Luisa Valenzuela.
Dahl lo hace en clave infantil, satirizando los valores de la niez.
Su Caperucita es una asesina despiadada, que no slo se fabrica un
abrigo con la piel del lobo, sino que se da el lujo de construirse una
maleta con el cuero del ms pequeo de los tres cochinitos (cabra
preguntarnos qu pensara Cri-Cri del cuento de Dahl).
Carter, por el contrario, explota la vertiente ertica del cuento
original y, en sus cuatro variaciones de la Caperucita, el encuentro
con el lobo, sin dejar de ser violento, incluye otro tipo de matices.
Puede ser que el lobo y la abuela conformen el mismo personaje (a
quien Caperucita tiene que vencer) o que Caperucita deba aprender
a yacer con el lobo para salvar la vida. Puede ser incluso que se
trate de una loba, quien no se halla del todo cmoda en el mundo
humano, limtrofe, marginada por unos y otros.
Valenzuela juega a desaparecer los lmites entre el lobo, la
abuela, Caperucita y el lector. La protagonista puede ser los tres
personajes o ninguno. El bosque es a la vez un desierto y un jardn.
Quiz nunca llegue a casa de la abuela; quiz, si llega, sea peor
para ella.
Los tres autores, en tres pocas diferentes y con propsitos distintos, se valen del cuento original como marco para volcar preocupaciones estticas particulares. Toda reescritura tiene un dejo de
irona, y las reescrituras del siglo xx se caracterizan por faltarle el
respeto a los textos, buscarles las costuras. La pluma del escritor
juega a hacerle cosquillas a los personajes empolvados hasta
volverlos temibles o ridculos. Todas las reescrituras beben de
textos ms antiguos. Ya se trate de las rimas para nios perversos
de Dahl, las pelculas de Shrek o la serie de televisin Once Upon a
Time, la simbologa del cuento de hadas se halla presente con un
propsito concreto: provocar el asombro del espectador.
Por qu hablar de cuento de hadas y no de mito o leyenda?
Porque lo que hace especial al gnero es el asombro que pretende
provocar. Por ello se le ha llamado tambin, en sucesivos intentos de estudio, cuento maravilloso. No es el asombro el ltimo
bastin a defender en la era de la tablet y las redes sociales? Es l
quien se coloca detrs de las pupilas que se dilatan cada vez que
el nio escucha, embelesado, Haba una vez, y es a l a quien
recordamos cuando permitimos que el nio que guardamos en las

pliego16_finales.indd 77

77

15/09/2014 17:00:26

78

pliego16_finales.indd 78

partes ms recnditas de nosotros mismos, encerrado con llaves


sangrantes, se asome a escuchar otra vez el mismo cuento, quizs
no de la misma forma, dispuesto a sorprenderse.
No tengo duda de que el asombro nos hace ms humanos.
Las reescrituras del cuento de hadas nos entregan una doble
sorpresa: la que sentimos al reconocer el cuento tradicional
(reconocer al nio que fuimos mientras lo escuchbamos) y
la que se produce al descubrir las modificaciones que el autor,
hbil prestidigitador, ha efectuado para nosotros. Sea en forma
pardica o terrorfica, nos regocijamos con goce arcaico como se
regocijaban los hombres de las primeras hogueras, dispuestos a
recoger las migajas de sentido ocultas entre el bosque y el palacio.

15/09/2014 17:00:26

Entreacto
Salvador Calva Carrasco

79

Soy Macbeth, rey de Escocia, y me arrepiento. En mi juventud, seducido por la tragedia, admir a los personajes de Shakespeare. Lear
y Julio Csar fueron mi inspiracin y mi sueo; pero ninguno como
Macbeth. Ensay con horror y dedicacin sus lneas. Pronto los espejos disimularon mi rostro. As, nuestro ascenso a los escenarios
fue inevitable. Los aplausos, las crticas y las dilatadas temporadas
desairaron a la ficcin. El teatro era un arte sin muros. Prodigu
tiempo y memoria a un personaje ms hecho de tinta que de polvo.
Era tal su requisa, que pronto la vida me pareci una impostura.
Entre galas y esplendores tuve que reducir las jornadas de trabajo
para recuperar a toda costa mi personalidad. En un par de semanas
sus facciones se disolvan, sus ojos negros se tornaban caf claro
y la sonrisa volva a mi boca. Buscaba campos abiertos y atardeceres con sol. Cualquier sitio era mejor que el teatro. Entonces
soaba con recuerdos propios y una obra que actuar.
Pero la materia de la que estamos hechos: el tiempo, y nuestros
dioses: los astros, nos orillan a la finitud y a la desdicha. Ayer el director anunci una temporada ms. Mi corazn estuvo a punto de
florecer. Cre que el terreno recuperado se perda en una sola jugada.
Dentro de m, o quiz yo mismo, me complaca de la victoria.
Del pasado y del presente es posible escapar, no as del futuro.
Tengo la esperanza de vivir sin el recuerdo de Macbeth. La realidad
o el teatro, lo ignoro, me orilla a tramar una jugada no prevista.
La esperanza est en la carne de Duncan. Si el rey cae, nunca ms
tendr que matarlo; su sangre no enturbiar cada noche mi alma.
Truenos y relmpagos
(Se abre el teln)

pliego16_finales.indd 79

15/09/2014 17:00:26

80

Sibila
Demian Marn

I will show you fear in a handful of dust.


T. S. Eliot

En esta jaula nos vamos consumiendo. Nuestra piel cuelga de los


barrotes. Somos seres inmundos con poderes que no pedimos.
Nuestra garganta envejece hasta enmudecer. El cuerpo se cae a pedazos. Despus de tantos siglos, nuestro canto se pierde en el silencio.
Pero los hombres siguen llegando, siguen pidiendo un designio.
Cuando la edad apaga nuestro canto, escribimos los acertijos en
hojas de roble.
*
En una caverna fra y solitaria, hombres de diversas latitudes
visitan una jaula que cuelga del techo. En la penumbra de la jaula
yace una anciana moribunda. Ella les anuncia el destino en forma
de acertijo. Su futuro se encuentra all, encerrado en una maraa de palabras, en un puo de sonidos que cobran forma slo
cuando se cumplen los augurios. Los hombres salen con azoro,
con un secreto agradecimiento y con la profunda impotencia que
otorga la incomprensin.
*
Yo, Apolo, he visto en los ojos de esa mujer la misericordia y el
amor. Yo, dios benvolo, le ofrec el gran poder de la profeca. La
nombr Sibila, porque de esta manera todos sabrn de ella, del
poder que le he regalado, por el bien de los hombres. Yo, dios de la
luz, me he maravillado con sus embrujos.

pliego16_finales.indd 80

15/09/2014 17:00:26

Deseas algo? pregunt. Algo que pueda ofrecerte a


cambio de tus encantos?
Yo, Apolo, hijo de Zeus, estaba dispuesto a ofrecer cualquier
cosa con tal de poseerla.
Pide lo que sea le dije, cualquier cosa te ser concedida.
Cualquier cosa? pregunt Sibila.
Cualquier cosa dije ardiendo de pasin.
Ella tom un puado de arena.

81

*
Nacimos en lugares remotos que hemos olvidado. Nuestro
recuerdo no va ms all de este sitio, no se atreve a navegar aguas
subterrneas. Somos despojos de nosotras mismas, elevadas como
deidades que asquean. Somos muchas y a la vez somos una: la
sibila, la anciana de mil aos que conoce el destino de los hombres.
*
Las supersticiones no hacen dao, a menos que se vuelvan realidad.
Nosotros no creamos en esas supercheras que se hablaban acerca
de las sibilas. No cremos que alguien del pueblo podra convertirse en una de ellas.
Mi madre anunci la muerte de mi padre. Era de esperarse.
Ambos eran viejos ya. La muerte rondaba desde haca tiempo.
La tragedia, la funesta sorpresa, fue escuchar la prediccin de las
circunstancias.
Con un dulce canto, desconocido para nosotros, mi madre
anunci:
los cascos destrozan el crneo
el tiempo se desboca
una llama se apaga
Comprend sus extraas palabras al da siguiente. Mi padre iba
caminando de regreso a casa. Un patricio perdi el control
de su caballo. Pas encima de mi padre. Una muerte inmediata.
*
Los restos de la ltima sibila se vuelven la carroa de la que toma
su lugar. Pronto la nueva termina por devorar el cadver de la vieja.
El hambre aparece.

pliego16_finales.indd 81

15/09/2014 17:00:26

82

Durante un ao, quiz dos, la nueva grita, desfallece, su cuerpo


se reduce a un esqueleto envuelto en pellejo. Algunas sibilas han
llegado a arrancarse los dedos, las manos. Su propia carne es sucednea del hambre que, irremediablemente, vuelve a aparecer.
Un ao, quiz dos. La sibila clama por comida. Los escasos
visitantes le arrojan frutos, semillas. La sibila alcanza a tomar algunos, se los lleva a la boca con sonoras carcajadas. El hambre
desaparece. Y al da siguiente, regresa, como si nunca la hubiera
abandonado.
As pasa un ao, quiz dos. El hambre, omnipresente durante
todo ese tiempo, de repente se va. Y no vuelve ms.
*
Habitamos un lugar que con los aos se vuelve gigante. Cantamos
los designios hasta no poder ms. Nuestros cantos regresan con
el eco de la jaula y de los aos. Ecos repetidos, siempre repetidos.
Palabras que carecen de significado. El destino es un ciclo irritante:
las mismas palabras, los mismos cantos. Slo el nuestro es diferente.
*
Pide cualquier cosa.
Cualquier cosa?
Lo que desees.
Quiero vivir tantos aos como granos de arena tenga en la mano.
*
Mi madre dej de ser mi madre ese da. Le pregunt si haba sido
un demonio el que hablaba a travs de ella o, peor, si el demonio se
haba hospedado en su cuerpo de forma definitiva. Mi madre, que
no era mi madre, no dijo nada.
Al pueblo lleg la noticia de que all en la montaa, en la caverna donde habitaba la bruja que llamaban sibila, sta dej de escribir.
Los supersticiosos decan que cuando una bruja mora, otra
apareca en algn lugar cercano. Decan que el lugar donde la nueva bruja surga se volva maldito, y que grandes tragedias ocurran
all. Decan que eso pasaba cada mil aos.
La bruja que fuera mi madre, antes de ir por su cuenta a su
encierro en la caverna, anunci con un canto:

pliego16_finales.indd 82

15/09/2014 17:00:26

el estupor galopa a su encuentro


su fuete es el fuego
su brida la desolacin

83

*
Aqu aprendimos del odo, comprendimos el verdadero fin de
palabras que se encierran como erizos. Aqu sedujimos al paseante
con ecos, con frases que pronto se convertan en realidades, en la
propia realidad de quien pregunta. Aqu recogimos los restos
de una vieja civilizacin y dijimos con orgullo: aqu aprendemos del odo y comprendemos, poco a poco, el verdadero fin de
palabras que se encierran.
*
Hay un roble a la entrada de la caverna. La sibila, cuando ha
perdido la voz, demanda hojas de este rbol. En las hojas escribe
varios versos y los libera al viento. Las hojas que caigan ms cerca
del visitante son las que marcan su destino.
En invierno, el roble se queda sin hojas. Los visitantes dejan
de venir, por falta de hojas, por causa del fro. Los pocos torpes
que suben la montaa han visto gruesos tmpanos de hielo colgar
de la jaula donde se encuentra suspendida la sibila. No comprenden cmo pueda sobrevivir a los inviernos ms crudos en esa,
de por s, fra y hmeda caverna.
Durante el otoo, cuando el viento mece las ramas del roble y el
suelo se cubre de hojas, no hay da que no se aparezca algn hombre
deseoso de conocer su futuro.
*
Nunca haba sentido tanta repugnancia. Nunca me haba sentido
tan ultrajada por las palabras de Apolo.
Ves esta arena? le dije. Si yo vivo tantos aos como granos de arena tengo en la mano, mi virginidad ser tuya.
Apolo extendi su brazo. Deposit la arena en su mano.
As ser dijo.
Tu deseo se ha cumplido. Ahora ven a m, hermosa Sibila.
De slo pensarlo me daban ganas de vomitar. Apolo, lascivo, se
acerc a m.
Ven aqu, Sibila, ven a darme lo que ya es mo.

pliego16_finales.indd 83

15/09/2014 17:00:26

84

*
Hay veces que miramos nuestro destino, como si furamos
cualquiera de los que vienen a vernos. Nos preguntamos a nosotras
mismas (con sonrisa cmplice) por lo que va a pasar, por nuestro
inevitable futuro. La eterna visin de lo mismo, de la misma
existencia en esta jaula, del proceso de envilecimiento de nuestro
cuerpo, la imagen perenne de la tortura que significa la vida, nos
hace olvidar, por siglos, la sonrisa cmplice de este ruin juego.
*
Era mi madre, pero no tena opcin. Debamos expulsarla del
pueblo. Tapi la casa, pas los das siguientes con los vecinos. La
que antes fuera mi madre recorri las calles, cant a gritos terribles
profecas, solt siniestras carcajadas. Nadie sali en todo ese
tiempo. Nadie hizo nada por ella.
Mi madre grit, blasfem, dio puntapis en las casas hasta que
se cans. Despus se fue. Todos sabamos a dnde se haba ido. La
vida sin ella volvi a la normalidad. Regres a mi casa, trat de
retomar mis actividades. La gente del pueblo apoy mi duelo. Todos
sentamos el vaco que mi madre haba dejado en la comunidad.
Sabamos que, con el tiempo, todo se olvidara.
Pero nada se olvid. A las pocas semanas, un terrible incendio
acab con el pueblo.
*
Los nios, por juego o por maldad, suben la montaa, se internan
en la caverna, se esconden y ren. La sibila cuelga en una jaula. No
tiene ms hogar que ese medio metro cuadrado que la delimita. Los
nios la miran, cuchichean, se burlan de ella. Su vida es demasiado
nueva. No tienen inters por el destino. La sibila musita, pero su
voz se apaga. La alegra de los nios opaca la vieja voz de la sibila.
Pero, en pequeos lapsos de silencio, alcanza a orse el murmullo.
Quiero morir. Quiero morir. Quiero morir...
*
La agona. Los hombres nos visitan. Vienen en busca de su futuro,
en busca de nuestras palabras que se hacen realidad. Nosotras,
desde el encierro, dictamos el destino de los hombres con pala-

pliego16_finales.indd 84

15/09/2014 17:00:26

bras de fuego. Palabras incomprensibles. Palabras peligrosas. La


agona. Los hombres vienen en nuestra bsqueda, siempre agnicos, siempre inquietos. La agona de no saber si alcanzarn a
comprender nuestras palabras.

85

*
Yo, Apolo, hijo de dioses, cumpl mi promesa. Novecientos noventa
y nueve granos de arena en la hermosa y perfecta palma de su
mano. Novecientos noventa y nueve aos por delante. Novecientos
noventa y nueve aos para amarnos.
Yo, Apolo, dios de la profeca, enceguecido por la lujuria, he
sido engaado por Sibila.
He cumplido mi promesa le dije. Ahora t cumple la tuya.
No dijo Sibila. No dijo, y huy.
Por eso, padre mo, yo, Apolo, tu humilde hijo y servidor, te pido
justicia, te pido que intercedas por m, por este ultraje cometido.
Sibila pidi larga vida dijo Zeus, nunca pidi juventud. Su
deseo ser cumplido.
*
No comemos, no bebemos, no dormimos. La muerte puebla nuestros pensamientos. Es lo nico que pensamos. Morir es ahora
nuestra ms grande ilusin. En nuestra mano todava hay polvo.
El polvo que aleja a la muerte e invita a la decrepitud. Nuestra mano
est manchada con polvo, con motas de polvo. Por alguna razn,
que ya hemos olvidado, ese polvo es nuestra desgracia.
*
He ido a la caverna de la sibila. He preguntado por el futuro del ser
humano. La sibila contest:
un dios vendr para morir
y ser ms grande
que los inmortales
Despus exhal su ltimo suspiro. O eso pareci, porque el
mundo, por un instante, qued en silencio.

pliego16_finales.indd 85

15/09/2014 17:00:26

86

Flebas
Rodrigo Crigo

para evitar complicaciones


te sacaron los ojos con un hacha
mientras decan Tan alto y hermoso
pero t
acostumbrado a morder sal
no te quejabas
ni siquiera cuando clavaron perlas
en tus rbitas como tiburones
murmurando Alto y hermoso Eres alto y hermoso
como un consuelo
una lamentacin
dedicada a ellos mismos
porque no eras su semejante
no eras la roca ni la espuma
ni el milagro de sus gargantas
Alto y hermoso
Tan alto y hermoso

pliego16_finales.indd 86

15/09/2014 17:00:26

Andrnico (fragmento)
Mnica Perea

87

Andrnico se estren el 15 de septiembre de 2014, en el teatro El Milagro.


Direccin: Sixto Castro Santilln.
Diseos: Natalia Sedano.
Reparto: David del guila, Isa Flores, Jess Ivn Garca Montes, Gonzalo Guzmn, Sergio
Jaramillo, Cut Lpez, Oscar Serrano Cotn.
Asistente de Direccin: Ulises Galvn.

ii. Qu hay para perder?


Qu es lo que engrandece a un hombre, Andrnico?
Son acaso los muertos que lleva en su espalda?
O son las batallas que gana sin que le importe otra cosa que vencer?
Sabes, siquiera, cunto dolor cabe en el vientre de una madre?
Ningn hombre ser capaz de sentir algo semejante.
Por eso pueden acabarse entre ustedes,
porque no saben del sufrimiento que implica engendrar una vida.
Cunto dolor cabe en una guerra?
Cuntas vidas ms van a perderse por el enemigo?
A veces, el enemigo est lejos, en otras tierras.
A veces, el enemigo est en tu propia casa,
en tu propia cama y duerme bajo tus sbanas.
Qu es lo que hace grande a un hombre?
Cuntos ms van a seguir jugando a la guerra?
Y mientras ustedes juegan a matarse,
a qu jugamos nosotras?
Andrnico, t que has perdido hijos en la batalla,
no me arrebates a ste de las manos.
Ten respeto por quien lo llev nueve meses en el vientre.
Ten respeto por esta mujer
a quien slo le quedan sus hijos.
v. Voz muda
Quisiera

pliego16_finales.indd 87

Me gustara decirles que fueron los hijos de Tamora.


Ella, que tambin es mujer, no tuvo compasin de m.

15/09/2014 17:00:26

88

Esa arpa me entreg a sus hijos como premio por acabar


[con mi esposo.
El mismo que desafi a su propio hermano por tenerme a su lado.
Tan slo por eso.
Quisiera gritar la verdad,
que el bosque entero compadezca a los nuestros,
que sea el desierto el que nos haga justicia,
que la sierra devore a ese par de hermanos doblemente malditos,
que las bestias de la selva devoren sus entraas.
Acabaron con mi esposo,
cortaron mi lengua y saciaron su sed de mi cuerpo
al mismo tiempo que me ahogaba
entre los gritos mudos de mi propia sangre
que me escurra de la boca, baando mis pechos.
Pechos separados por sangrienta humillacin.
Primero Demetrio,
luego Quirn,
y los dos al mismo tiempo.
Moribundos perros hambrientos de carne.
Bestias que a plena luz del da
traicionan a quienes les han perdonado la vida.
Al tratar de defenderme, cortaron mis manos, padre.
Esas manos con las que aliviaba tus heridas cuando volvas
[de la guerra.
Las manos con que preparaba la comida que te ofreca
[cuando estabas en casa.
Las manos que jams conocieron cuerpo de hombre.
Las que nunca cometieron pecado alguno,
las que tampoco pudieron amar a Bassiano.
Mis manos, padre, mis manos!
Con las que desollara a esos hermanos malditos.
Sabe Dios si al menos l me escucha.
Frente a ti, Andrnico, no puedo sino callar y, a tu lado,
llorar en silencio la desgracia que cay sobre los nuestros.
vi. Una mano por dos cabezas
Tito Andrnico envi su mano al emperador.
Esa mano que tena cientos de vidas terminadas.

pliego16_finales.indd 88

15/09/2014 17:00:26

La mano de diez aos de victorias.


La mano que acarici a Lavinia cuando nia.
La mano que siempre aliment a su familia.
La mano que trajo honores a los suyos.
La mano de innumerables enemigos muertos.
La mano que rechaz el poder.
La misma mano que prefiri a Saturnino.
Esa mano fue devuelta.

89

Marcio
Quinto
Una mano por dos cabezas.
Las de sus hijos degollados.

vii. Bastardo

Negro y bastardo.
El poder que lleva a los hombres a la ruina.
Negro y bastardo.
El hijo que desobedece a su padre.
Negro y bastardo.
El fruto de un amor prohibido.
Negro y bastardo.
El naciente primognito de la ciudad.
Negro y bastardo.
El hijo engendrado por Tamora y Aarn.
Negro y bastardo.
El da en que Tito lo perdi todo.

viii. La venganza toca a tu puerta


Ladran los perros.

No muerden.
Todava.

La Venganza toca tu puerta.


Desesperacin.
Adelante!
Jams llega sola.

pliego16_finales.indd 89

15/09/2014 17:00:27

Crimen y Violacin.

90

Embriagarse de placer con esa reina.


Regodearse en sus hijos.
Recibirlos como reyes.
Honores merecen.
La reina Venganza se va.
Deja a sus hijos,
Crimen y Violacin.
Ladran como perros.
ix. La cena est servida

Tito el loco, lo llaman.

No saben que est ms cuerdo que nunca.


Crimen y violacin.

Viste de chef.
Prepara la cena.
Crimen
Y
Violacin

Con la mano que le queda, amasa los ingredientes.


Un banquete.
Un festn.
Qu se celebra?
Venganza es la seora de la fiesta.
Ladran los perros.
La cena est servida.
Todos los comensales a la mesa.
Andrnico mismo prepar todo con su nica mano.
Rabiosos y hambrientos.
Los perros muerden la carne,
la trituran en su boca, la devoran
hasta hacerla llegar a sus estmagos.
Una reconciliacin?

pliego16_finales.indd 90

15/09/2014 17:00:27

Crimen
Y
Violacin

91

Crimen y violacin son el plato fuerte.


Qu nos prepar Tito para el postre?
Venganza que se come al calor de la sangre
tan hirviente que quema la lengua.
Lengua que Lavinia no posee.
Tampoco tiene manos.
Despojada de su inocencia.
Es arrancada de lo nico que le queda.
Gran emperador, segn la leyenda,
Virginio hizo bien
en matar a su hija con su propia mano
por haber sido violada y deshonrada?
Hizo bien, Andrnico.
Ella no deba sobrevivir a la propia vergenza.
Ni a la de su padre.
Tampoco deba propiciarle ms dolor a su padre.
Satisfecho?

Razones poderosas.

Muere Lavinia!
Mueran contigo tu vergenza
y el dolor de tu padre!
No se dignan a comer vuestras altezas?
Por qu?
Por qu mataste a tu hija, Andrnico?
No ha sido l,
fueron Quirn y Demetrio.
Perros de la noche.
De eso es la carne que devoraron.
Pestilente y repugnante carne de perro.
Alcanza a tu hijos, Tamora.

pliego16_finales.indd 91

15/09/2014 17:00:27

Venganza.

92

La cabeza de Tamora rueda por el piso.


Antes de que Tito pueda patearla
la suya le hace compaa segundos despus.
Las cabezas quedan en el piso mirndose frente a frente.
x. Recapitulacin
Tito gan en la guerra.
La guerra acab con Tito.
Cuntos hijos perdi Tito Andrnico en la guerra?
Veintids.
Cuntos hijos perdi Tito Andrnico en la paz?
Dos de ellos por su propia mano.

Cuatro.

Qu extremidades se perdieron en esta obra?


Mano de Lavinia.
Mano de Tito Andrnico.
Lengua de Lavinia.
Tito gan en la guerra.

Qu se gan en la guerra?

Sangre de tu sangre derramada por tu pueblo.



La guerra acab con Tito.

Qu se gan en la paz?

Sangre de tu sangre derramada por los tuyos.


Cundo ganaremos la paz?
Sangre de tu sangre como moneda corriente.
Derramada sin piedad.
Tito gan en la guerra.
La guerra acab con Tito.

pliego16_finales.indd 92

15/09/2014 17:00:27

3:23 - 4 :391
David Alejandro Martnez

Min.
3:23

Leopoldo,2 cmo va ese hgado? 3

Min.
3:25

Pues muy mal y no estoy precisamente paranoico.a

El entrevistador toma un libro de la mesa,


abre la solapa y lee. Panero lleva un cigarro
a la boca y con su antena llameando
inspecciona la atmsfera. Se rasca, sorbe
un vaso en el que queda atrapado el insecto.

93

a. Huyendo de la muerte
encontr el ciervo de la
locura
irreal para perseguirlo con
mi desdicha
con mi desdicha concreta,
presente
en donde lavan sus pies los
dioses.

1. Entrevista de Fernando Snchez Drag para el programa Negro sobre Blanco


emitida el 26 de septiembre de 1999 con Leopoldo Mara Panero Blanc. Ver en:
http://www.youtube.com/watch?v=amKAfNVpIh8
2. Leopoldo Ma. Panero es un poeta.
Los poetas, como los perros, deben morder la piel / llevarse un buen trozo de
carne entre los dientes / si quieren sonrer y estar tranquilos. Calmar las encas.
Soar / con que alguien les d una palmada detrs de las orejas. / A Leopoldo
Mara Panero le gustan los hombres gordos / que se juntan alrededor de un asador
para hablar de deportes / los domingos; le gustan las mujeres que acarrean las
cervezas para esas reuniones. / Sus hijos: muchachos en trajes de Zara que aspiran
a ser abogados y doctores / con suteres de lana. Le gustan los domingos porque
su dueo / hace carne asada y a l le toca algo ms que los huesitos. / Hijo de perra,
poeta, que nos comera a todos sin dudarlo porque a Leopoldo / Mara Panero /
siempre le apetece / llevarse un trozo bueno de carne entre los dientes.
3. Prometeo yace desnudo, un guila cae del cielo contra el hombre, su carne
palpitante, el hgado. Propiedades curativas: cero. Al menos que sea de bacalao.
Castigo ejemplar para ayudarte a crecer. No se puede hacer mucho cuando eres
nio: cierro los ojos, me guardo; debajo de la cama tu cuerpo negro. He crecido
con las culpas de mis padres y por eso mi aliento agrio.
Tambin existe otra explicacin: guila contra el hombre, ttulo. Autor, Leopoldo.

pliego16_finales.indd 93

15/09/2014 17:00:27

94

Min.
3:30

Cuntas Coca-colas4 bebes al da?

Min.
3:33

No, no les digas Coca-colas que


tienen alcohol. El ttulo de este libro
mo de cuentos de terror de las ediciones de Roger, viene de un verso que
hice, que dice cuando el veneno b entra
en sangre mi cerebro es una rosa.

Unge sus labios. Fernando Snchez


Drag mueve sus noventa y tantos kilos
de un lado a otro de la silla. Da nombres,
entrevistas y homenajes. Comienza una
pregunta que capta la atencin de Panero
a la mitad.
Min.
4:26

b. Nada hay ya turbio


nada hay ya
parecido a la vida
ni un muslo de mujer, ya ni
una duda
nada hay ya
sino el poema como un
pus, como una ortiga
cercenando mi mano.

Ese ser a ratos no tiene que ver


con la locura? 5 Cundo eres ms t?

4. Primer principio del apocalipsis. No hay nada de malo en soltar los perros y
salir corriendo tras de ellos. Esto es la carrera absurda de la vida como quien se
apresura para entrar antes al vagn y salir despus; como quien quiere ser amigo
de todos y no sabe que desaparecen al doblar la esquina; quien lleva los pantalones
puestos, la camisa remangada y cree (confundido por el entusiasmo) que conoce
todos los nombres de las calles; quien, llegado el momento, no se dar cuenta
de que lo primero que dejar de escuchar ser el sonido de los refrigeradores y
entonces tanta carne y tanta Coca-cola sern la miel negra de un panal echndose
a perder en la boca.
5. Drama en un solo acto. / Acto nico. // Escena 1 El quicio de la puerta para
perderse. La luz de un anuncio de nen: El Corazn Sagrado de Jess. Restaurante
de comida china. Quisiera ser pelirroja. Suerte de enano el da que cobra su
quincena. Mancha de Can en una servilleta. Lleva rollitos primavera su combo? Sanatorio / sanitario. Hotel por horas: televisin con cable, bao, cama
limpia. Dos, por favor, para llevar. Al final, en el recuerdo, nos reuniremos
en la misma ausencia. Sube las escaleras queriendo encontrar algo lustroso al
final del pasillo. Un filme porno detrs de la puerta. Ruido blanco. Aire blanco.
Sueltan un suspiro y descansa. Ponen en reversa la cinta. // Escena 2 Sala de
espera bien preparada. Cuatro mquinas de refrescos. Bajo ciertas circunstancias
lo ltimo son las protenas y los asientos cmodos. Los gorros de las enfermeras son
como barcos que estn a punto de hundirse en un mar en calma. Qu hacemos
aqu?, qu estamos mirando? Un espectador de la tercera fila se levanta tapando
con su culo el zumbido de las balastras, entonces la iluminacin es ms dbil. Se
llevan al paciente. // Escena 3 Tres actrices: una de ellas visiblemente ms joven.
Las otras dos podran ser la misma, pero la del cabello rojo est mojada. Una

pliego16_finales.indd 94

15/09/2014 17:00:27

Min.
4:29

No creo en la locura. Al menos no creo en la locura como


una deficiencia orgnica, es
decir, como enfermedad. Creo
que es un proceso, son problemas
humanos que luego se transforman
en psiquitricos. c En la calle nos
vuelven locos y en el manicomio nos
rematan el trabajo.

95

c. Mi pensamiento est
contra m
y las guilas desgarran mi
pensamiento
que cae de mi boca
como los hombres
reptan a lo largo del verso.

S, era Sherlom Homes. No, era Cherlo Hom la otra. Ja, ja, ja, ja, ja! la
ms joven. No! una. La ms joven Bobita! S, era el detective sper
famoso la otra. Ingls! la una. La otra Hablan en francs. La ms joven
T lo hiciste! La una No, t lo hiciste! T lo hiciste! S! Entra el hombre en
cuestin. El juego: quin gana y quin pierde se repite una vez y otra. // Escena 4 El
colchn recubre la habitacin. Alguien duerme. Pasan las horas. Se acomoda a uno
y otro lado: boca arriba, feto, sobre su brazo derecho, a sus anchas. Se oyen gritos
que no lo llaman, sigue dormido. Pasan dos, cinco das y l duerme. El pelo le crece,
la barba tambin. Un grito: su nombre. Despierta impetuosamente, se levanta y
acomoda una silla frente a la rendija de donde sale la mano de un dios enano.
Permanece inmvil. Gritos. Horas, das y sigue sentado de la misma manera en que
abord la silla por primera vez. No despega siquiera los labios. El pelo contina
creciendo y la barba le sirve de bufanda en tiempo de invierno. Un viento fro se
cuela como lengeta afilada. Si no tiene cuidado le cortar otro dedo. Se pone
rgido; de pronto otra pastilla naranja con su nombre. Reacciona y se acomoda
en el colchn, donde permanece como muerto, como lo ha venido haciendo. //
Escena 5 Televisin empotrada; el cable se atraviesa en la pared como el recorrido
de un insecto. Entre los cuatro m2 una cama limpia y dos cuerpos respirando con
dificultad. Primer principio agonal: no se puede ocupar el mismo espacio al mismo
tiempo. Se llevan las manos el uno al otro como lo haran el padre y el hijo en un
incendio queriendo calmar las llagas. Silencio prolongado. La ausencia se extiende.
La pared es blanca como la boca de los nios que guardan el vaco para escuchar
por el quicio de la puerta mientras juegan. En la pantalla, ceniza. // Escena 6 La
cordura es slo la ilacin de eventos aislados, quizs, que en un contexto familiar,
inmediato, nos parece la natural respuesta a ste o aqul acontecimiento.

pliego16_finales.indd 95

15/09/2014 17:00:27

Colaboradores
Dulce Alcntara (DF, 1988) Particip en el 9
Festival Latinoamericano de Poesa Ser al fin una
palabra! (2013). Ha publicado en Katharsis xxi,
Infame, mis C lnea y las Memorias del Festival.
Marina Azahua Ensayista, historiadora y
traductora. Su libro ms reciente es Retrato
involuntario. El acto fotogrfico como forma de
violencia (Tusquets, 2014).
Herson Barona (DF, 1986) Fue una joven promesa
rota, porque ya ni siquiera es joven y ha dejado de
prometer, aunque sigue estando roto. Actualmente
es jefe de redaccin de la revista Tierra Adentro.
Bernardo Barrientos (DF, 1987) Criado por una
mujer que considera el confinamiento solitario
como una forma de vida completamente natural,
no le busca ruido al chicharrn. Ama la lucha libre
mexicana, el barrio y la literatura.
Salvador Calva Carrasco (Guerrero, 1985) Poeta
diletante, narrador por insistencia. Actualmente
espera la publicacin de su primer libro de cuentos:
Personajes.
Rodrigo Crigo (DF, 1992) Poeta y traductor.
Ganador del concurso 39 de Punto de Partida en
traduccin literaria. Dos veces becario de poesa en
el Curso de creacin literaria de la f,l,m. (Xalapa).
Su poesa se incluy en Telescopio: Antologa de
escritores nacidos en los noventa.
Samuel Espinosa Mmox (Puebla, 1985) Ha
sido beneficiario del Programa Jvenes Creadores
del FONCA y del PECDA en el rea de poesa.
Actualmente es becario de la f,l,m. en el rea de
poesa.
Jorge Gutirrez Reyna (Monterrey, 1988)
Licenciado en Lengua y Literatura Hispnicas por
la UNAM. Ha publicado su trabajo en la antologa
Familiaridades / Extraamientos. Muestra de literatura joven de Mxico y en las revistas Fundacin
y Este Pas.
Jorge Luis Herrera Licenciado en Historia del Arte
y maestro en Letras Mexicanas. Ha colaborado con
textos y fotograf a en mltiples libros, suplementos
culturales y revistas. Ha publicado Voces en
espiral. Entrevistas con escritores mexicanos
contemporneos y Cuando ests en el cielo.
Lola Horner Narradora y ensayista. Ha publicado
textos en diversos medios electrnicos e impresos.
Su novela Pcimas contra el divorcio result
seleccionada en la primera convocatoria Edeb
para publicacin infantil y juvenil.

pliego16_finales.indd 96

Arturo Loera (Chihuahua, 1987) Autor de los


libros El poema vaco (ICM/CONACULTA, 2013)
y Cmara de Gesell (Premio de Poesa Editorial
Praxis, 2013).
Ana Laura Magis Weinberg Lectora, traductora,
y escritora. Estudi Letras Inglesas en la UNAM y
fue becaria en el rea de narrativa de la f,l,m. Sus
obras se han publicado tanto en papel como en
lnea (http://lauramagis.wordpress.com).
Demian Marn (Toluca, 1979) Ha perdido gran
parte de su vida viendo pelculas y jugando cualquier
cantidad de juegos con reglas preestablecidas.
Escribe morbo y para tener groupies por todo el
mundo.
Javier Mrquez (DF, 1987) Teatrista y docente. The
Jker Jack. La ltima carcajada de Heath Ledger
(Premio Nacional de Dramaturgia Joven G.M.C.,
2012). Can (Premio a Mejor Obra. Festival Nacional
e Internacional de Teatro Universitario, 2011).
David Alejandro Martnez (1987) Estudi
literatura en Chihuahua, de donde es originario.
Escribe crtica literaria, ensayo y poesa. Becario
de investigacin de la f,l,m.
Mariana Oliver (DF) Estudi la maestra en
Literatura Comparada en la UNAM; es editora de
la seccin literaria de la revista Cuadrivio y becaria
de la f,l,m.
Mnica Perea (Estado de Mxico, 1986)
Dramaturga, productora, docente y directora
de Teatro en bici. Curs la carrera de Literatura
Dramtica y Teatro en la UNAM. Beneficiaria
FOCAEM de dramaturgia en 2010 con la obra
Tlloc y Chaak. De cmo el mundo se qued sin
agua.
Ren Rueda (Chilpancingo, 1984) Estudi Letras
Hispnicas en la UAM-I. Becario de la f,l,m. en el
rea de narrativa.
Santiago Ruiz Velasco (DF, 1983) Estudi
Matemticas y Letras Hispnicas en la UNAM. Se
ha fogueado, a falta de becas, en talleres literarios
de prestigio y el hondo bajofondo donde el barro
se subleva. Ha colaborado en varias revistas
nacionales, un libro colectivo y antologas. Se le
encuentra en @s_ruizvelasco, si se le busca.
Hayde Salmones (DF, 1989) Alguna vez estudi
literatura y fue rescatista de autores decimonnicos
en la UNAM, pero hoy tiene una pug y se
desempea como ngel del hogar. Es becaria de la
f,l,m. en el rea de narrativa.
rika Tllez (DF, 1988) Poeta y narradora.

15/09/2014 17:00:27

Intereses relacionados