Editorial

Julio Ruelas

pliego16_finales.indd 1

15/09/2014 16:58:58

Instrucciones: Une con una línea los elementos del índice a

a*
Literatura Hispanoamericana
“Oda a la vida retirada” (c. 1557). Fray Luis de León

“Una dama se vio en una calavera de cristal”. Luis de Sandoval Zapata (1620-1671)
Infortunios de Alonso Ramírez (1690). Carlos de Sigüenza y Góngora
“Hombres necios” (c. 1680). Sor Juana Inés de la Cruz
Primero sueño (1692). Sor Juana Inés de la Cruz
“Abrojos” (1877). Rubén Darío

“Declaración de odio” (1944). Efraín Huerta
Piedra de sol (1957-1960). Octavio Paz
Epigramas (1972). Ernesto Cardenal

“Año Nuevo” (1979). Inés Arredondo

Entrevista a Leopoldo María Panero (1999). Fernando Sánchez Dragó
Poemas (2001). Leopoldo María Panero
Caín (2010). Javier Márquez

Verde Shanghai (2011). Cristina Rivera Garza
“Helada” (2013). Daniel Espartaco
Literatura Universal
Tito Andrónico (1593). William Shakespeare
Macbeth (c. 1606). William Shakespeare

“La carretilla roja” (1920). William Carlos Williams

“Esto es sólo para decirte” (1934). William Carlos Williams

La tierra baldía (1922). T. S. Eliot

*pliego16 no incluye estos textos. Se leen por separado.

pliego16_finales.indd 2

15/09/2014 16:58:59

con los del índice b según la reescritura.

b
Vampirizar
vampyr. javier márquez

El asesinato de la mujer piedra. Jorge Luis Herrera
Cangreja. Érika Téllez

El aroma de la luz. Herson Barona

Epílogo a la masacre. Marina Azahua

4
14
17
18
20

Destejer
Jalar los hilos: tejido y (re) escritura. Mariana Oliver
Nouvel An. Haydeé Salmones

Riada. Bernardo Barrientos Domínguez
Declaración de odio 2.0. Arturo Loera
Oda a la vida retirada. René Rueda

29
33
34
40
42

Dos epigramas a la manera de Ernesto Cardenal. Samuel Espinosa
Mómox

47

William Carlos Williams en Reno. Santiago Ruiz Velasco

48

Reescrituras críticas. Patricia Arredondo

Flores de Baria Poesía. Jorge Gutiérrez Reyna
Poemas. Dulce Alcántara

61
65
68

Adaptar
¿Qué es la reescritura? Ana Laura Magis Weinberg

70

De niños perdidos y llaves sangrantes: reescrituras del cuento de

75

Entreacto. Salvador Calva Carrasco

79

hadas en el siglo xx. Lola Horner
Sibila. Demian Marín

Flebas. Rodrigo Círigo

Andrónico (fragmento). Mónica Perea
3:23-4:39. David Alejandro Martínez

pliego16_finales.indd 3

80
86
87
93

15/09/2014 16:58:59

4

vampyr
javier márquez

i)

en el théâtre des vampires,
los espectadores humanos
observan vampiros
que actúan ser seres humanos
que actúan ser vampiros
dentro de pesadillas
de seres humanos
que anhelan ser vampiros.
ii)

durante la década de los 90, dave gahan, vocalista de depeche
mode, se obsesionó con la idea del vampirismo. comenzó a
utilizar ropa negra y anillos puntiagudos. se dejó crecer el
cabello y uñas. para la gira playing the angel por sudamérica,
los roadies le construyeron un ataúd como parte de una broma,
pero gahan comenzó a dormir siestas dentro del féretro antes
de cada concierto. llegó a creer que era un vampiro al punto
en que mordió en el cuello a varias personas. sus amigos lo
internaron en un psiquiátrico. soy el vampiro lestat. soy inmortal. más o menos. la luz del sol o el calor prolongado de un
fuego intenso podrían acabar conmigo. también podrían no
hacerlo. mido un metro ochenta, una estatura que resultaba
bastante impresionante hacia 1780, cuando yo era un joven
actor mortal de lo que después convertimos en el théâtre des
vampires. tengo el cabello rubio y tupido, largo hasta casi

pliego16_finales.indd 4

15/09/2014 16:58:59

los hombros y bastante rizado. parece blanco bajo una luz
fluorescente. mis ojos son grises pero absorben con facilidad
los tonos azules o violáceos de la piel que los rodea. también
tengo una nariz fina y bastante corta, y una boca bien formada,
aunque resulta demasiado grande para el resto del rostro. una
boca que puede parecer muy mezquina, o extremadamente
generosa, pero siempre sensual. mis emociones y estados de
ánimo se reflejan siempre en mi expresión. mi rostro está
continuamente animado.

5

mi condición de vampiro se pone de relieve en la piel, tan
extremadamente blanca que refleja la luz: ello me obliga a
maquillarme para aparecer ante cualquier tipo de cámara.
cuando estoy sediento de sangre, mi aspecto produce verdadero horror: la piel contraída, las venas como sogas sobre los
contornos de mis huesos... pero ya no permito que tal cosa
suceda; el único indicio firme de que no soy humano son las
uñas de mis dedos. a todos los vampiros nos sucede lo mismo:
nuestras uñas parecen de cristal. y hay gente que se fija sólo en
eso aunque no advierta nada más.
ahora soy lo que en norteamérica llaman un rockstar. he vendido cuatro millones de copias de mi primer álbum y voy camino
a san francisco para dar el primer concierto de una gira
nacional que me llevará de costa a costa con mi grupo. mtv
lleva dos semanas pasando mis videoclips día y noche. también
los pasan en el “top of the pops” inglés y en el resto del viejo
continente, así como en algunas partes de asia. las cintas que
recogen la serie completa de videoclips se están vendiendo por
todo el mundo.
iii)

vampirizar:
perforar arterias con los colmillos
para beber la sangre del otro.
privar a alguien de sus rasgos característicos
para lograr su dependencia total.
extraer la energía vital de alguien
para fortalecerse.

pliego16_finales.indd 5

15/09/2014 16:58:59

6

devorar libros y llenarse el torrente textual de palabras de otros
para resemantizarlas en un nuevo ser escritural.
el vampiro pertenece a la noche
porque ella es la oscuridad de la tinta,
la sintaxis de la palabra en el firmamento
que apenas deja espacios en blanco.
por eso el vampiro sólo puede habitar en el negro plano
[de la ficción.
ante la página soleada de la realidad
se inmola:
cenizas de leyendas.
iv)

los vampiros se alimentan primordialmente de la sangre de sus
víctimas, aunque hay descripciones donde también son antropófagos, como los vrycolacas de grecia, seres que regresaban de
la muerte para cobrar venganza y devorar a sus enemigos. en
algunas culturas se consideraba que la sangre no era la base de
su sustento, sino el “fluido vital” humano: la energía psíquica.
esto ha dado pie a la noción del vampiro energético: una
persona común que, intencionalmente o no, absorbe la energía
vital de otra persona para fortalecerse.
v)

en el théâtre des vampires
se recrean las parábolas y fábulas
que dan cuenta de los misterios de la página oscura
de la gramática escarlata.
sólo con cuatro caracteres
(t) timina
(a) adenina
(c) citosina
(g) guanina
cuatro letras con infinidad de combinaciones,
las únicas cuatro letras que no representan

pliego16_finales.indd 6

15/09/2014 16:58:59

sino que producen el mundo desde sus inicios
una y otra vez
infinitamente.

7

todo acto del habla
es eco de la palabra primera.
toda escritura
es la iteración de la gramática primera.
todo ser humano
es la reescritura genética
del ser primero.
vi)

las personalidades más comunes de los vampiros energéticos son:
el pobre-de-mí o víctima: pesimistas. piensan que no tienen
suficiente energía para enfrentarse al mundo y todo el
día se quejan de sus desgracias. atraen la atención con
expresiones faciales preocupadas, suspiros, temblores,
llantos, miradas perdidas, respuestas lentas y relatos
reiterados de dramas y crisis punzantes. seducen por
su vulnerabilidad y necesidad de ayuda. no les interesan
verdaderamente las soluciones a sus problemas porque entonces perderían su fuente de vitalidad. obtienen la
energía de la compasión que generan y de los intentos por
ayudarles.
el intimidador: logran la atención a través de gritos, fuerza f ísica, amenazas y exabruptos. mantienen a los demás
a raya, quienes temen desatar su ira. reciben la energía a
través del miedo que provocan en los otros.
el interrogador: socavan el ánimo y la voluntad cuestionando cualquier actividad y motivación. críticos hostiles,
buscan hacer sentir mal a los demás. todo lo que se
les conf íe lo utilizarán como arma en algún momento.
seducen por su ingenio, lógica infalible e intelecto. obtienen la energía a partir de los esfuerzos que los demás hacen
para probar su valía y para responderles.

pliego16_finales.indd 7

15/09/2014 16:58:59

8

el culpador: buscan culpables por las situaciones que ellos
mismos generan. suelen ser verbalmente agresivos y abusivos. atacan a sus seres queridos. no es el mundo contra
ellos, sino tú en su contra. obtienen su energía a través de
los esfuerzos de los demás por defenderse de sus ataques.
el conversador imparable: sólo están conectados consigo
mismos, son incapaces de escuchar a los demás y usan a
sus seres queridos como espectadores de sus eternos monólogos. obtienen la energía de la pasividad del otro.
el siempre-me-va-peor: son aquéllos que interrumpen cualquier relato para afirmar que a ellos les han sucedido las
peores cosas. obtienen la energía de la lucha de egos que
generan por ver a quién le ha ido peor en la vida.
vii)

cuando el vampiro bebe la sangre de su víctima,
es capaz de ver la vida entera del moribundo.
no sólo engulle la sangre
sino también sus experiencias.
después deja caer el cadáver como basura.
el ser humano
como ficción para el vampiro.
leer es vampirizar.
extraer conocimiento y experiencias vitales de los libros.
ante la lectura
ningún libro es original;
está constituido por todos los anteriores.
viii)

no me costó adaptarme a esta nueva era porque algo completamente mágico había sucedido con las épocas. lo viejo ya
no era sustituido rutinariamente por lo nuevo. al contrario,
el inglés que oía a mi alrededor era el mismo que conocía del
siglo xix. incluso la antigua jerga seguía funcionando. al propio
tiempo, otras frases novedosas y fascinantes como “te han lavado el cerebro” o “es muy freudiano” estaban en labios de todos.

pliego16_finales.indd 8

15/09/2014 16:59:00

en el mundo artístico y del espectáculo, todos los siglos anteriores estaban siendo “reciclados”. los músicos interpretaban
por igual a mozart que una canción de jazz o de rock. la gente
iba a ver shakespeare una noche y una película francesa al día
siguiente.

9

uno podía comprar cintas de madrigales medievales en una
enorme tienda iluminada con fluorescentes y escucharlas en
el estéreo del coche mientras corría por la autopista a ciento
cincuenta por hora. en las librerías, la poesía del renacimiento estaba a la venta junto a las novelas de dickens o
de ernest hemingway. los manuales de educación sexual
coexistían en la misma estantería con el libro egipcio de los
muertos, johann wolfang von goethe john william polidori
lord byron cyprien bérard alekséi konstantínovich tolstói
james malcolm rymer thomas preskett joseph sheridan le
fanu bram stoker richard matheson anne rice brian lumley
l.j. smith john ajvide lindqvist stephanie meyer claudia grey
chuck hogan guillermo del toro.
ix)

en el théâtre des vampires,
hablar de todos los vampiros reales
es hablar de dave gahan
el strigon.
hablar de todos los vampiros reales
es hablar de dave gahan
el empalador.
hablar de todos los vampiros reales
es hablar de dave gahan
la condesa sangrienta.
hablar de todos los vampiros reales
es hablar de dave gahan
el torturador de niños.
hablar de todos los vampiros reales
es hablar de dave gahan
el canadiense.

pliego16_finales.indd 9

15/09/2014 16:59:00

10

hablar de todos los vampiros reales
es hablar de dave gahan
porque dave gahan
está constituido por todos los vampiros anteriores.
x)

lestat bebe directamente de la yugular de cristo
bebe de la sintaxis genética primera
y presencia el origen de la palabra.
lestat queda inmerso en el abismo de silencio y distancia.
soy el vampiro dave gahan. soy inmortal. más o menos. la industria musical o la crítica histórica desfavorable podrían acabar
conmigo. también podrían no hacerlo. mido un metro ochenta,
una estatura que resulta benéfica cuando estás en un escenario. mis emociones y estados de ánimo se reflejan siempre en mi
expresión. mi rostro está continuamente desanimado y mi estilo de baile es increíble. cuando estoy en el estudio grabando una
nueva canción sólo puedo pensar en los océanos de personas que
estarán en los conciertos de las giras. océanos de sangre hirviente, de gargantas afiladas que morderé con mis gritos y que
me desollarán con su eco. seremos un mismo ser alimentándonos mutuamente. ellos serán mis letras, yo seré sus anhelos. una
masa parasitaria bajo la sintaxis oscura de la noche.
la cultura:
constante vampirizar la sabiduría humana.
ningún ser humano es original.
está constituido por todos los anteriores.
xi)
las personalidades más comunes de las bandas de rock son:
pobre-de-mí o víctima: su género representante es el grunge.
guitarras fuertemente distorsionadas y enérgicas, melodías vocales guturales, pegadizas y repetitivas, baterías
predominantes; letras que reflejan apatía y desencanto,
chillan por todo. bandas como nirvana, pearl jam,

pliego16_finales.indd 10

15/09/2014 16:59:00

mudhoney, the melvins, soundgarden, alice in chains, the
smashing pumpkins.

11

intimidador: heavy metal. ritmos agresivos, guitarras eléctricas muy amplificadas y distorsionadas, bajos, baterías
con doble pedal. tiene varios subgéneros. se le asocian
bandas como led zeppelin, deep purple, black sabbath, iron
maiden, metallica, slayer, anthrax, megadeth.
interrogador: los llamados crooners que, en inglés, tiene connotaciones cercanas al trovador. voz grave acompañada
por una  orquesta  o una  big band. se asocian cantantes
como frank sinatra y bing crosby. en lo underground existen crooners como tom waits, nick cave y morrisey.
culpador: el punk. rock sencillo y algo ruidoso para expresarse
con sus propios medios y conceptos. la filosof ía punk puede
resumirse en: “hazlo tú mismo”. en sus canciones expresan
un serio descontento con los sistemas e instituciones que
controlan el mundo. bandas como the clash, sex pistols,
the ramones, misfits, black flag, the damned y the jam.
siempre-me-va-peor: el gótico. voces andróginas o barítonas
a las que se les añade un efecto de eco. las guitarras se
enfocan en crear atmósferas que pueden variar desde etéreas, melancólicas y siniestras. un elemento capital es el
bajo, que destaca por aparecer adelante junto con las voces sonando igual o más predominantemente que las
guitarras. bandas como siouxsie and the banshees, fields
of the nephilim, the  sisters of mercy y the cure. el dark
wave añade letras oscuras e introspectivas junto a un
trasfondo de lamento en el sonido de algunos grupos como
joy division y depeche mode.
xii)

en el théâtre des vampires:
un actor es un vampiro
que obtiene su energía a través del espectador.
un espectador es un vampiro
que obtiene experiencias vitales a través del actor.

pliego16_finales.indd 11

15/09/2014 16:59:00

12

esta obra ha vampirizado materiales de anne rice, dave
gahan, alejandro tantanian, nick cave, eduardo del estal,
laura muñoz, artículos de divulgación y secuencias de
adn. soy el actor que siempre quiso decir las palabras “soy
el vampiro lestat…”. soy mortal. mi deficiencia actoral y
la mala memoria de ustedes acabarán conmigo. no llevo
maquillaje, mis uñas son normales, odio mi estatura. si un
vampiro bebiera de mi sangre, lo único que vería pasar ante
sus ojos sería una vida gris donde lo más importante es que
hoy murió mi gata cata... la mató mi sobrina ágata. fue tan
triste… gata cata, acá… ágata, ata a gata cata. ágata
acata… gata cata ataca a ágata… caga caca gata cata.
ag, gata… ágata ataca a gata cata... sería una ficción
olvidable para ver un domingo por la noche. no me gusta el
rock. según mis compañeros, soy un vampiro energético, de
los pobre-de-mí, una reescritura menor de la raza humana.
estoy diciendo esto para que se compadezcan de mí.
xiii)

en el théâtre des vampires
el vampiro
que bebe el fluido vital
de un espectador humano
reescribe su sintaxis genética
hasta extraer todos los rasgos de su víctima
hasta mimetizarse con ella.
lo que fue un ser humano
queda reducido a un cascarón de masa blanca
hundida en la butaquería
y el vampiro es libre
ahora
de tomar el lugar del espectador en la vida real.
la sociedad
es un constante vampirizar seres humanos.
cada ser humano está constituido por todas las aspiraciones
[de su sociedad.

pliego16_finales.indd 12

15/09/2014 16:59:00

un actor muerde la yugular del actor que habla, éste grita como
si se tratara de una mala película de terror. el actor-víctima
cae muerto. el procedimiento se repite con cuantos actores se
tenga.

13

los actores-víctima resucitan y muerden a los actores-vampiro
repitiendo el procedimiento anterior.
la máquina vampírica continúa mientras suena sólo la música
de release the bats de nick cave. lestat y dave gahan cantan a
dueto:
CAGGTGCAGCTGTTGCAGTCTTGCAG
AG AG G TG A A A A AG C C C G G G G AG TC T
T G A A G AT C T C C T G TA A G G G T T C T G G
TAC AG C T T TACC AG C TAC TG GATCG G
TG G G TG C G C C AG ATG C C C G G G A A AG
C C T G G A G T G G AT G G G G AT C AT C TAT
C TG GTGAC TC TGATAC C AGATAC AG C
C G T C C T T C C A A G G C C A G G T C A C C AT
TC AG CCGAC AAGTCC ATC AG C ACCG C
TA C C TG C A G TG G A G C A G C C TG A A G G
C TCG GAC ACG G CCGTGTAT TAC TGTG
A A G ATG G C G TG AT TC G C C T T TG TG G
G CC AAG GTACCC TG GTC ACCGTC TCG
G TG G TG AG G C G G T TC AG G C G G AG G T
GCTCTGGCGGTAGTGCACTTCAGGCT
TG GTGAC TC AG GAG CC ATCC AG GTG C
G C TG C TG T TG C A G TC T TG C A G C A G A
GTGAAAAAGCCCGGGGAGTCTCTGAA
ATC TC TA AG G GT TC TG GATAC AG C T T
A C C A G C TA C TG G ATC G G C TG G G TG C
CC AGATG CCCG G GAAAG G CC TG GAGT
GATG G G GATC ATC TATC C TG GTGAC T
TGATAC C AGATAC AG C C C GTC C T TC C
A G G C C A G G TC A C C ATC TC A G C C G A C
AGTCC ATC AG C ACCG CC TACC TG C AG
GGAGCAGCCTGAAGGCCTCGGACACG
CCG GTAT TAC TGTG C AAGATG G CGTG
TTCGCCTTTGTGGGGCC AAG GTACCC
GGTCACCGTCTCGAGTGGTGGAGGCG
TTC AG G CG GAG GTG G CTCTG G CG GTA
TA G T G C A C T T C A G G C T G T G G T G A C T
A G G A G C C ATC C A G G TG C A G C TG T TG

pliego16_finales.indd 13

C
C
A
C
G
C
C
C
C
C
C
G
A
G
G
A
G
G
T
G
G
C
A
A
T
G
A
T
G
G
C
C

15/09/2014 16:59:01

14

El asesinato de la mujer piedra
Jorge Luis Herrera

Para Patricia Herrera Velasco
Dales la vuelta,
cógelas del rabo (chillen, putas),
azótalas,
[…] haz que se traguen todas sus palabras.
Octavio Paz

Adolescente rostro perseguido, mirada niña de la madre vieja,
yedra que avanza, envuelve y desarraiga, y llega siempre entre
las ramas que se desvanecen, como la nube por tu pensamiento.
Avanza, retrocede, da un rodeo… petrificando el bosque con su
canto —¡oh bosque de pilares encantados!—, corriendo entre los
árboles nocturnos.
—Caminas como un árbol, como un río.
—Hablando solo como el viento loco.
Alta como el otoño caminaba —un caminar de río que se
curva, un caminar entre las espesuras— al mundo con sus mares
y sus montes.
—Vuelas como mil pájaros, tu risa...
—Que dice sin decir, ¿no dice nada?
—Caminas y me hablas como un río.
Camino por las calles de mí mismo. Piso días, instantes caminados.
Y mi sangre camina más despacio. Invisible camino sobre espejos
que en un abismo brusco se termina. No hay nadie, cae el día, cae el
año… Caigo en el instante, caigo al fondo. Mi sombra despeñada se
destroza. Caigo sin fin desde mi nacimiento, caigo en mí mismo sin
tocar mi fondo: “¡Caer, volver, soñarme y que me sueñen!”. Busco
sin encontrar, escribo a solas presagios que se escapan de la mano

pliego16_finales.indd 14

15/09/2014 16:59:01

al reino de pronombres enlazados, a pulso levantado letra a letra,
escritura del viento en el desierto que se cubre de signos, el silencio.
Arrancado a la nada de esta noche: el delirio, el relincho, el ruido
obscuro. Ardo sin consumirme, busco el agua. “¿O es al revés: caer
en esos ojos donde bebían luz los gorriones?”. Voy por las transparencias como un ciego: un paraje de sal, rocas y pájaros; corredores
sin fin de la memoria; horas de luz que pican ya los pájaros; otros
ojos futuros, otra vida; el pan vuelve a saber, el agua es agua.
Dormí sueños de piedra que no sueña, bajo un sol sin edad, y tú
a mi lado: dormías enroscada entre las sábanas, cuerpo del mundo,
casa de la muerte, los amores feroces, el delirio. Mis pensamientos
sólo son sus pájaros, y tus pechos, tu vientre, tus caderas verdad de
dos en sólo un cuerpo y alma: adonde yo soy tú somos nosotros...
El mundo nace cuando dos se besan; y al cabo de los años como
piedras… es cada amanecer y yo amanezco.

15

Tu falda de cristal, tu falda de agua… es transparente por tu transparencia: como mi pensamiento vas desnuda. Mis miradas te cubren como yedra, adolescente rostro innumerable; tus labios, tus
cabellos, tus miradas, y las felicidades inminentes. Vestida del color
de mis deseos (son de piedra, tu boca sabe a polvo).
Al caer en el llano ceniciento, caen sobre la yerba: el cielo baja:
—¡Tiéndete al pie del árbol, bebe el agua!
—Tu cuerpo sabe a pozo sin salida. Y en tus ojos no hay agua,
son de piedra… voy por tus ojos como por el agua, agua que con los
párpados cerrados mana toda la noche profecías. Recógeme en tus
ojos, junta el polvo.
Busco el sol de las cinco de la tarde, rostro de llamas, rostro devorado, como el viento cantando en el incendio. Y no hay nada
detrás de sus imágenes, sino un pensar en llamas, al fin humo. Brasa
los labios y tizón la lengua. Emerge de sí mismo, sol de soles: roca
solar, cuerpo color de nube: una presencia como un canto súbito.
Se contempla en la nada, el ser sin rostro, ola tras ola hasta cubrirlo
todo. Fluyo entre las presencias resonantes, plenitud de presencias
y de nombres, unánime presencia en oleaje, indecible presencia de
presencias...
El adulterio en lechos de ceniza. Fulgor de la desdicha como
un ave: “déjame ser tu puta”, son palabras que repiten mi imagen

pliego16_finales.indd 15

15/09/2014 16:59:01

16

destrozada. Los dos se desnudaron y besaron. Amar es desnudarse de los nombres: los dos se desnudaron y se amaron, enamorados
de su semejanza.
Toda la noche llueves, todo el día. El mundo se despoja de sus máscaras (invisibles, las máscaras podridas). Muestra tu rostro al fin
para que vea. Tienes todos los rostros y ninguno. Tu boca sabe a
tiempo emponzoñado, un racimo ya seco, un hoyo negro... Tus palabras afiladas cavan cementerio de frases y de anécdotas, y al cabo
de los siglos me descubro. Lo que pasó no fue pero está siendo: enredadera, planta venenosa; no hay nada en mí sino una larga herida
(y mortal que da penas inmortales).
Piso mi sombra en busca de un instante: todo se quema, el universo
es llama; en el lecho de espinas de su insomnio, el olvidado asombro de estar vivos: “dónde estuve, quién fui, cómo te llamas”. Busco
sin encontrar, busco un instante; no hay nada frente a mí, sólo un
instante. Cada minuto es nada para siempre. Todos los siglos son
un sólo instante... ¿No pasa nada cuando pasa el tiempo?
Mejor el crimen.
Mejor comer el pan envenenado; y a la copa de sangre del verdugo, un gargajo, mejor ser lapidado. Vida y muerte. Y el grito de la
víctima... son llamas que nadie contestó: ¿por qué me matan? Y su
grito y el grito del verdugo. Y caíste sin fin, quebrada y blanca, de la
muerte vivaz y enmascarada. Un montón de ceniza y una escoba.
Su muerte ya es la estatua de su vida.
No hay redención, no vuelve atrás el tiempo (un siempre estar ya
nada para siempre). Quiero seguir, ir más allá, y no puedo. Los
muertos están fijos en su muerte. Piso los pensamientos de mi
sombra. Recojo mis fragmentos uno a uno: a perpetua cadena
condenado, y en el fondo del hoyo los dos ojos, sus horrores vacíos
acumulan, desde su soledad, desde su muerte. No hay nadie, no
eres nadie.
He olvidado mi nombre, mis amigos. Miradas enterradas en un
pozo. Tu silencio dé paz al pensamiento.

pliego16_finales.indd 16

15/09/2014 16:59:01

Cangreja
Érika Téllez

Soy pequeña

17

pequeño mi cabello de muchacho

mis manos
[mis ojos

desde apenas unos días.
Tabaco oscuro para mi/su garganta ya sabes ya lo sé.
Él sabe que tengo un miedo él sabe que quiero derrotarlo.
Hombre envejecido y derrotado el miedo.
(El hombre empieza a hablar de manera desmedida).
¿Qué no tienes miedo?
Soy pequeña Marina Cangreja
contesto sin dobleces.
¿No avizoras el peligro?

Pienso en la lengua untuosa de un gato sobre mi rostro: el peligro.
Lo veo hombre envejecido tabaco oscuro.
Me introduzco a fuerza dentro de sus ojos para saber hasta dónde
[me sabe. Reímos
es para dar risa reírse de miedo.
¿Y bien?
Es lo de siempre

que nada pasa

que todo nos está pasando.

Soy Marina dando vueltas.
Marina Cangreja donde no hay transcurso.
Donde todavía no se acaba esto.

pliego16_finales.indd 17

15/09/2014 16:59:01

18

El aroma de la luz
Herson Barona

Subió las escaleras lentamente, todavía sintiendo que su garbo y su
donaire le pertenecían a otro edificio. Imaginó que el dueño las había
mandado traer de otro lado, desmantelando otra construcción piedra
tras piedra, con mucho cuidado, sólo para reconstruir la con el mismo
afán en el nuevo espacio. ¿Se podría hacer eso en realidad? Tuvo la
tentación de dejarse sorprender, pero en el mismo instante visualizaba
escenarios. Diría: qué gusto, con la voz de alguien que paseaba por las
calles de una ciudad que conocía de memoria. Diría: cuánto tiempo,
con el tono neutro de una persona lejana. También avizoró el silencio.
El pasmo. La frustración inherente a las palabras que se saborean bajo
la lengua sin posibilidad alguna de llegar al sonido. O diría: ¿cómo
lograste entrar? A la defensiva, fingiendo que todo era real. A medida que
ascendía las escaleras equivocadas, seguramente traídas de otro edificio
más ufano, menos decadente, se preguntaba si todo esto no era más que
un invento, el resultado de su imaginación afiebrada. Su imaginación
necesitada. Y se preguntó también si esto era lo que toda la gente hacía
dentro de sus propios olvidos: correr el telón de lo real y agazaparse en
un lugar pequeño, un ángulo apenas, detrás de los escenarios donde todo
ocurría. Sin cesar. Se repitió su nombre una y otra vez. Marina. Trataba
de regresar a su cuerpo. Marina Espinosa. Sintió la lisura de la madera
donde apoyaba su mano mientras subía la escalera en la cámara lenta de
su cansancio. Olió el aroma de flores frescas que salía de algún cuarto.
Inspeccionó la luz que se colaba desde ¿dónde? No pudo identificar la
fuente, pero se fijó en las isletas luminosas que se formaban en el filo
de los escalones. Su zapato horadando la mancha luminífera. Su zapato
saliendo de ella. Diría: qué sorpresa, con la voz impostada, tratando de
mentir con los ojos. O no diría nada. Como santo Tomás, iría hasta ella
para tocarla, para comprobar que no se trataba de un producto de su

pliego16_finales.indd 18

15/09/2014 16:59:01

imaginación. Mordería la moneda de oro. Usaría el microscopio del
tacto. Burlaría a su mente. Se burlaría de ella. Te descubrí. Niña con
manos en la masa. Diría: no te esperaba. Diría: te esperaba. Los escenarios
se multiplicaban conforme subía la escalera. Los teatros enteros. Las
marquesinas. Las palabras brotaban la una de la otra con reminiscencias
de planta, de ser vivo. Hijas de las hijas de las hijas. Todo en femenino.
Diría: ¿cómo estás? Y de inmediato estallaría en una carcajada jocosa,
medianamente avergonzada. Si estuviera bien, si alguna de las dos
estuviera bien, no estaría aquí, no estarían aquí. Un cuarto del hotel La
Estrella de Choi. Diría: ¿dónde estás? Tratando de identificar su silueta
entre la penumbra del lugar. Haciéndose presente y huyendo al mismo
tiempo. Estableciendo la distancia. Determinando que se encontraban
ahí, aquí, dentro del verbo estar. Que los muertos entierren a sus muertos.
¿Qué quería decir esa frase realmente? Y mientras el significado se le
escapaba, eludiéndola con contorsiones imprevistas pero bien ensayadas,
pensó que, de tener a santo Tomás frente a ella, le preguntaría: ¿y quién te
dijo que la carne es real? Volvió a repetir el nombre propio. Marina. Diría:
aquí estoy. Titubeante. Abierta como la puerta que estaba abriendo.
Derrotada en su apertura. Entregada a su apertura. ¿Qué importaba a
fin de cuentas que no existiera, que nada existiera? ¿Cuántas fracturas
se necesitaban para formar el capa­razón de lo real? Diría: ¿quién eres?
Fingiendo ignorancia. Sabiendo de más. Oyó el timbre del teléfono. Y
luego la voz del recepcionista, un bostezo, la saliva uniendo diente contra
diente antes de que la palabra “bueno” lograra romper el todo de la boca
en dos. Número equivocado. Silencio. Y luz. Otra vez la luz sobre el filo
de los escalones. Volvió la cabeza hacia el techo. Eso era. Sí, eso era: un
tragaluz de cristales sucios, adulterados. Debían ser las tres de la tarde.
Tal vez un poco antes. Minutos apenas. Diría: apresaron a Juana Olivares.
No, no diría eso. No tenía caso. Si sólo los muertos podían enterrar a los
muertos, ¿quería eso decir que no había posibilidad alguna de conexión
entre los muertos y los vivos? Pero qué falta de fe, pensó. Qué falta de
imaginación. Empatía. Sintió su rodilla y el peso sobre su rodilla. La tensión
sobre el talón, los talones. El momento exacto en que flexionaba la pierna
y el cuerpo se impulsaba a sí mismo hacia el siguiente escalón. Eso era
caminar hacia arriba. Eso era subir una escalera. Diría: ya llegué, tratando
de recordar el recorrido sin poder lograrlo. ¿Había, de verdad, subido la
escalera? Cuando abrió la puerta no dijo nada. Se quedó detenida bajo
el umbral, observando la espalda de alguien que miraba hacia la calle.
Una silueta protegida por el velo de las cortinas raídas. Un bulto apenas.

pliego16_finales.indd 19

19

15/09/2014 16:59:01

20

Epílogo a la masacre
Marina Azahua

La creatividad solamente es reordenar las cosas,
como nadie las ha ordenado.
Fidel Monroy
El Mal no es el demonio enemigo, la antítesis de Dios y del Bien,
sino algo extraño y desorientador: lo Semejante. El Mal no es
lo antagónico del Bien sino su Doble indisociable.
Eduardo del Estal

Los fragmentos en itálicas son citas de Javier Márquez,
entrevistado en marzo de 2014.
Los fragmentos en negritas son citas de Caín.
I.
Apología sobre las cosas extremas, trilogía diseñada por el
dramaturgo Javier Márquez y el director Sixto Castro Santillán,
retoma mitos fundamentales de la tradición humana con el objetivo
de subvertirlos. El mecanismo de las obras parte de la desarticulación de los elementos de las narraciones para detonar
preguntas que continúan asediando la conciencia humana. En
Caín, la primera pieza de la trilogía, se parte de una de las más
antiguas historias del mundo judeocristiano: el pasaje bíblico
donde el primogénito de Adán y Eva asesina a su hermano, Abel
—instante mítico donde comenzó la caza del hombre.
Caín recontextualiza esta historia fundacional al ubicarla en
un presente abstracto pero plagado de referencias al escenario

pliego16_finales.indd 20

15/09/2014 16:59:01

mexicano de principios del siglo xxi. Se trata de la reelaboración
del mito a partir de su fragmentación: Tomar un mito que se dé por
hecho, y ponerlo en crisis hasta destruirlo. Algo que tomo de Müller
y que me acompaña hasta ahora: la “desmitificación de la cosa”. En
el proceso, se plantean escenarios donde a partir del concepto de
“primer asesinato” se problematiza la asignación tradicional de la
culpa en el hermano mayor. La obra implica la posibilidad de una
apología de Caín. Caín fue el primer asesino / ¿Y qué hizo Abel? /
Entregó la oveja en sacrificio. / ¡La mató! / La sacrificó. Se plantea
que Abel en realidad podría considerarse el primer asesino, pues
fue él quien mató por primera vez a un ser vivo, para cumplir con
la ofrenda al Padre —quien podría ser o no ser un dios—. El que
inició la plaga de muerte fue Abel […] La vida es vida / sin razas
ni jerarquías. Considerar el sacrificio de la oveja como el primer
asesinato, y nada menos que aprobado por Dios, parte de la idea de
naturaleza pensada paisajísticamente donde el hombre es parte del
paisaje, no es el paisaje.
El tema de la asignación de la culpa y la responsabilidad sugiere
que Dios podría ser considerado el primer asesino. Finalmente fue
él quien, sin explicación de por medio, negó la ofrenda de Caín en
favor de la de su hermano, desatando así un resentimiento primigenio, que no es envidia, / es ira, / es odio, / es asco, / es amor, /
es escozor en el alma, / es hervor en las entrañas que posibilita el
asesinato inaugural entre humanos.
¿Por qué eligió el Padre la ofrenda de Abel? ¿Quién es el verdadero asesino? ¿Quien sostiene la quijada de burro, la pistola, la
balaquijada? ¿El que genera las condiciones necesarias para que
el asesinato exista como posibilidad? ¿Aquél que recibe la ofrenda
para después negarla? Éstas son algunas de las preguntas —siempre más preguntas que respuestas— que detona la obra, partiendo
de cuestionar el mito hasta el punto de ponernos del lado de Caín.
El ejercicio dramatúrgico y escénico resulta profundamente político, entendido lo político como la relación entre humanos. ¿Por qué
nos relacionamos como nos relacionamos?
Luego de los estudios pertinentes, / se encuentra que la
causa definitiva de muerte / del paciente Abel es: / la necesidad
paradigmática / de tener una víctima ante un victimario. En el
México contemporáneo, problematizar el ritual de la asignación
de culpas y responsabilidades sobre los actos cometidos resulta

pliego16_finales.indd 21

21

15/09/2014 16:59:01

22

no sólo urgente, sino fundamental. La presencia simbólica de referencias a la explotación petrolera y del papel del ejército en la guerra
contra el narcotráfico abre la pregunta de si acaso vale la pena, en el
mundo real, que sacrifiquemos lo que sacrificamos, en nombre
de nuestros nuevos dioses —si es que existen—: el orden, el
progreso, la modernidad; conceptos abstractos que, al igual que el
dios de la Biblia, no son verificables.
El elemento que plaga al texto de manera central cuestiona la
parte del ser humano que actúa en nombre de algo que tal vez no
exista. Por pensar en Dios uno termina matando a una oveja o matando a su hermano. Por pensar en Dios uno se lastima, en nombre
de algo que no es concreto, cuya existencia no es verificable. La
cuestión no es sólo la existencia o no de Dios, sino preguntarse:
¿valdría la pena hacerlo por Él? ¿Aunque existiera?
Caín tiene un lugar particular dentro de la dramaturgia de
Márquez, pues en sus trabajos posteriores persiste una preocupación
por reelaborar la mitología, ahora trasladada al terreno de la mitología popular de la cultura de masas. Muchos aspectos de la
cultura popular los tomo como mitos contemporáneos: mitología
contemporánea. Estos nuevos héroes —el Joker de Batman, el actor
Heath Ledger, Michael Jackson, Walt Disney— protagonistas de nuevos
mitos, inundan nuevos ejercicios de desarticulación. La pregunta
que ofrecen es: ¿qué dioses nos hablan ahora, qué dioses toman
el poder ahora? ¿Y cómo se relacionan estos nuevos dioses con
ese dios primigenio de Caín, aquél que prefiere la grasa, / el sabor de la carne quemada, / el olor de la muerte por encima
de la cosecha?
ii.
Caín, ¿qué has hecho de tu hermano? es la pregunta reiterativa
que plaga la obra. Su doble es la duda encarnada en la evocación
de los rasgos f ísicos de Dios —ojos, fosas nasales, corazón, mejillas, paladar— evocados rítmicamente, una y otra vez, a la par de la
coda: —si es que tiene, / si es que existe—. La duda en torno a
la existencia de Dios, en nombre de quien se ofrenda y se asesina,
se acompaña de un ritmo en el lenguaje que asemeja una letanía,
casi un conjuro o encantamiento, que se repite para encontrar la
verdad a través del acto mágico —¿qué es una ofrenda, sino un acto

pliego16_finales.indd 22

15/09/2014 16:59:01

mágico?—. Las voces a menudo no se encuentran asignadas a un
personaje. La coralidad satura al texto, y se lleva al extremo cuando
hablan el viento, las rocas, el desierto globalizado. Mucho de
la puesta es hacia lo poético, hacia la introducción de lo lírico en la
dramaturgia. En Caín, el monólogo —dirigido a Dios o al vacío—
tiene preponderancia sobre el diálogo, un recurso que privilegia el
proceso interno de los personajes por encima de su interacción.
Sin embargo, al anclarse el conflicto moral en procesos de violencia y explotación, se logra vincular el combate interno con el problema social, revelando que es imposible escindir a uno del otro.
La idea de dualidad —Caín - Abel, bien - mal, víctima - perpetrador— se presenta desde la primera línea del texto en la indicación
que especifica que se trata de una obra para cualquier número de
actores siempre y cuando ese número sea par. No importa cómo
se interprete este único límite, la dualidad del primer humano en
nacer y el primer humano en morir persistirá. Posteriormente, el
texto se dedica a trastocar esta dualidad hasta destruirla. Cuestiona
su oposición introduciendo matices que habitan entre los polos. La
obra insiste en la figura del par y de la dualidad, pero ronda siempre
un tercero involucrado: Dios —si es que existe—. Dios como
detonante fundamental de la violencia. Dios, relativizado, porque
nunca aparece como tal, como enunciador. Dios como silencio:
personaje que no habla pero sin el cual el drama no existe. Dios que
nos castiga con su silencio, con su no explicarse nunca. Dios
que eligió a uno de sus hijos por encima del otro: constructor
primario de la otredad, de la diferencia, de la dualidad en
pugna. Dios, tan pasivo y silencioso como todos nosotros.
Jamás se explicita el paralelo posible entre Dios y la sociedad
contemporánea, pero esta equiparación está presente todo el
tiempo y se incrementa. A la manera de la necropsia inaudible
que le practican unos doctores a Abel —sin explicitaciones, sin
enunciación— poco a poco todos nos convertimos en Caín y en
Abel, en Dios y en su paralelo inexistente, y terminamos leyendo
en su historia la nuestra. Entre la alfombra de cadáveres /
reconozco mi sangre. Como apunta Marco Antonio de la Parra
—en un texto introductorio a la primera edición de la obra (Grupo
Editorial Antropófagos, 2010)— la reelaboración del mito de Caín
“nos convierte en la estirpe de su linaje”. Todo asesinato posterior
/ sería la mera reproducción de éste, / un cliché más.

pliego16_finales.indd 23

23

15/09/2014 16:59:02

24

pliego16_finales.indd 24

iii.
Caín toma lo ya hecho, lo ya establecido, para deconstruirlo.
Apelar a un imaginario colectivo establecido, permite una mayor
apertura a la poesía: si tú tomas algo concreto sobre Caín y Abel
ya no tienes que contar la historia. La gente sabe lo básico: Caín
mató a Abel; esto permite que se explicite el trastrocamiento
de la historia-origen. Se trata de tomar lo mítico, lo que está en
el imaginario colectivo, para elaborar poesía a partir de eso.
El arquetipo —Caín y Abel, culpable y víctima— es parte del
material con el que se trabaja: las ideas preconcebidas de la sociedad
como materia prima. Es más fácil generar la sensación de poesía en
la otra persona si ya tiene un referente que si construyes todo desde
el inicio. En este sentido, el trabajo de Márquez resulta más af ín
a la desarticulación de universos que a la construcción de nuevos
mundos. El procedimiento se basa en reventar.
Caín busca dialogar con Heiner Müller en aspectos formales,
pero particularmente en el proceder desde elementos sociales y
políticos a través de la poesía y a partir de la propia experiencia.
La idea del petróleo y de la guerra estaban muy presentes cuando
empecé a escribir Caín. Siguen estándolo. Hablan todos los
Caínes. Cunde un sentimiento de desamparo ante la inmensidad
del mundo, donde uno hace las cosas y quién sabe si sus acciones
tengan sentido o coherencia.
El propósito de la obra es generar en el espectador posturas
críticas ante los fenómenos extremos que vive nuestra sociedad. De ahí el enorme listado de referencias al contexto mexicano
de fines del siglo xx y principios del xxi: catequistas, columpios de
llantas, niños compartiendo el lunch en el recreo, dos ofrendas
trasladadas desde el mito a la realidad —Caín frente a un barril
de petróleo como símbolo de la cosecha, Abel frente a uniformes
sucios del ejército: una camada de ovejas por sacrificar—, jóvenes
de la calle que hacen malabares y limpian parabrisas, obreros,
reporteros y fotógrafos que afilan sus dientes para tener la exclusiva
de El primer asesino de la historia, asaltos, mujeres asesinadas en
Ciudad Juárez, un lanzamiento de granadas en el zócalo de Morelia
mientras se celebra el grito de Independencia, misiles sobre Irak,
un conejo negro de peluche, pupitres con porterías hechas de papel
para jugar futbol con los dedos cuando la maestra se voltea hacia
el pizarrón, una joven promesa para la humanidad, peticiones de

15/09/2014 16:59:02

asilo político, el dramaturgo que escribió la obra, el director que la
dirigió, los actores, el público, Caín arando con un carrito de supermercado, el asesinato de Abel en un pozo petrolero.
Estas referencias auxilian el traslado del mito a la realidad, haciendo patente que en nosotros se encarnan todos los humanos
de la historia. El acto de unos es el acto de todos. La obediencia
como culpa de Abel vive en nosotros, y también el resentimiento como culpa de Caín. Estos elementos inciden en la escena
para reventar la estructura de ficción y revelar que todo mito tiene
su correspondencia en la realidad.
En la sección xvi de la obra sucede un rompimiento de la forma
tipográfica, con tres frases acomodadas en círculos concéntricos,
abarcando toda la página:

25

A través de este texto/imagen, el rasgo incontrovertiblemente
cíclico de la violencia se concreta no sólo en el contenido del texto,
sino en su forma …Caín que mata a Abel que mata a Caín que
mata a Abel que mata…

La figura del círculo, a su vez, emula los ciclos de la naturaleza:
de cultivo para el agricultor Caín: Grano por grano / ha sido cuidado desde su sembrado / hasta su madurez, y de trashumancia
para el pastor Abel: Oveja por oveja / ha sido cuidada desde

pliego16_finales.indd 25

15/09/2014 16:59:03

26

su parto / hasta su vejez. Asimismo, los ciclos se vuelven
símbolo paralelo de la circulación transgeneracional de la culpa:
interrupción vital encarnada en …el vientre que aborta la vida
hijos de Caín e hijos de Abel que terminarán clavándose las
garras en el vientre que aborta la vida...

En esta figura se concretan los ciclos de la naturaleza emparejados al ciclo imparable de la violencia, bebiendo del resentimiento
y la venganza, que han resultado históricamente tan dif íciles de
romper …frente al olvido, los campos se fertilizan y los animales
se nutren con las vísceras de la batalla mientras la marca de
Caín nos brota en la frente…

Este recurso tipográfico es importante, porque en él se encuentra el germen de un aspecto que se desarrollará posteriormente en
la dramaturgia de Márquez: la importancia fundamental de la forma f ísica de la letra escrita.
Una dramaturgia que busca vincularse con la realidad se traduce
también en recursos técnicos que continuamente destruyen la
convención: ¿Te acuerdas de Abel? / Descripción del actor que

pliego16_finales.indd 26

15/09/2014 16:59:04

incluye: estatura, tez, cabello, complexión, una curiosidad
f ísica y el parecido con una caricatura. Dos catequistas piden
a Caín que recite los diez mandamientos. Caín no responde. / Si
alguien del público contesta se sigue al siguiente mandamiento.
/ Si nadie del público contesta nunca faltará un fastidioso Abel
que levanta la mano y dice la respuesta correcta. Estos recursos
técnicos se utilizan para vincular constantemente la historia que se
despliega en escena con su correspondencia en el momento real en
que sucede la acción dentro de un teatro, en una ciudad en particular.
Hoy Caín estrenó su nueva obra de teatro en ____________. Se
trata de instantes cruciales que conducen al espectador,
a la par de los actores, a salir del pacto de ficción. Ahórrate la
escena. / Sé que vas a matarme, lo acabo de leer en la Biblia.
Las referencias al contexto contemporáneo, a la par de estos
exabruptos que dependen de las características específicas del
montaje en curso, revelan un compromiso por lograr que el teatro estanque a la gente en el presente. La intención es vincular el
mito de origen, anquilosado, con la actualidad. No sólo en cuanto
a contexto histórico, político, económico y social, sino incluso al
momento del montaje en sí. La invitación es a llenar esos huecos
de referencialidad, para que sea el lector quien una los puntos que
vinculan el mito de Caín con su propia realidad social, económica
y política. A partir del despliegue de procedimientos se busca que
estas obras generen sus propios contenidos. Yo digo que hago arquitecturas semánticas: construimos estructuras vacías, arquitecturas
vacías, para que el lector - espectador vomite sus propios contenidos
en ella. Esto implica una idea del dramaturgo no como transmisor
de información, sino como edificador de espacios vacíos que tienen el potencial de ser llenados por el consciente e inconsciente de
quien observa.

27

IV.
Pareciera que Caín aborda fundamentalmente el tema de la
violencia y su relación con el poder. Pero detrás de esos dos enormes
conceptos se erige uno, menos nítido, pero quizás más profundo: un cuestionamiento sobre la voracidad. Todo parte desde
la imagen de la ofrenda, tras la cual Dios siempre querrá más,
de la misma manera en que el humano siempre exige más, a sus

pliego16_finales.indd 27

15/09/2014 16:59:04

28

pliego16_finales.indd 28

congéneres, a la naturaleza. La voracidad de todo poder funciona
así: siempre se nos va a pedir que sacrifiquemos más, ¿en nombre
de qué? ¿De quién? ¿Del progreso, el avance, la modernización? ¿De
conceptos abstractos que resulten tan ficticios, tan construcción
cultural vacía, como la idea misma de Dios? El poder exige a las
personas sacrificar su tiempo, sus impuestos, sus hijos, sus cuerpos,
su dignidad. La voracidad del poder, del gobierno, de la economía:
esos dioses que nos rigen en la secularidad económica y política
donde lo que se sacrifica es lo social y comunitario.
Quedarse callado también es una forma de acto. Si Dios es
el espectador de la violencia suscitada —o incitada por él—
entre Caín y Abel, nosotros como lectores - espectadores nos
convertiremos también en testigos pasivos de la violencia. Como
tales, recibiremos al final de la obra la misma ofrenda de carne y
hueso que recibiera Dios de Abel —a través del cordero—, y de Caín
—a través del cadáver de Abel—: un trozo de carne empaquetada
con una etiqueta que dice: Caín y Abel. Este último pedazo
de carne, ofrendado al público, trastoca el papel del espectador que hasta ese momento se creía pasivo, un observador
neutro de lo que sucedía ante él en escena. La ofrenda final va dirigida al espectador y lo obliga a responsabilizarse de lo que ha visto.
A nosotros nos toca, como a Dios, escuchar las voces de la
culpa que surgen de la tierra de Nod. Si la inacción es una forma
de acto y a través del no actuar se actúa, habría que pensar de
qué forma actuamos como público / lector de esta obra.

15/09/2014 16:59:04

Jalar los hilos: tejido y (re) escritura
Mariana Oliver

29

Si los motivos que conducen a la escritura son tan diversos como
quienes escriben, tal vez la reescritura corre con la misma suerte
y surge de muchos lugares, acaso de la sospecha, de la insatisfacción, de una mirada que se busca en el pasado, en lo que se supone
anterior; también emerge del placer, de una fascinación que fluye
y desemboca en otro texto. Quizá se reescribe porque hay algo no
dicho, que se oculta, o todo lo contrario, se vuelve a escribir porque
el texto dice demasiado.
Al escribir, una maraña informe se ordena, adquiere su silueta,
su lugar en el mundo. Reescribir es como destejer, jalarle los hilos al
texto y éstos, vueltos nudos en los dedos, encuentran otro camino,
enlazados ya con otras voces. Quien ha tejido sabe que al hacerlo el
tiempo adquiere un ritmo distinto —aunque el ovillo contenga en
sí el principio y el final ineludibles— y es posible volver en él, destejer por la noche lo avanzado durante la vigilia y, como Penélope,
estirar los días.
Si el paso de la oralidad a la escritura fue un guiño a la posibilidad de permanencia, a hacer de la tinta sobre el papel una extensión confiable de la memoria —de ahí las Tablas de la Ley, grabadas
en piedra por la mano de Dios—, entonces reescribir es rechazar,
resistirse a lo estático, a lo inmutable. Romper la piedra y adorar un
becerro dorado.
*
Imagino que quienes reescriben experimentan una satisfacción
agridulce, incompatible con la de los niños, ávidos de repetición, que ven la misma película o piden el mismo cuento cada
noche. Durante una época, hace más de veinte años, mi hermana

pliego16_finales.indd 29

15/09/2014 16:59:04

30

y yo vimos una cinta hasta que se desgastó. Paulatinamente, las
manchas de los dálmatas que buscaban a sus cachorros todos
los días se multiplicaron en la pantalla y la cubrieron casi por
completo. Estoy segura de haber visto la película hasta aprenderme
los diálogos de memoria y nunca entendí por qué una mujer quería
matar tantos perros sólo para tener un abrigo (en esas historias
de iniciación, las malas siempre son mujeres), ni cómo un músico
enclenque y nervioso podía adoptar más de cien cachorros mientras
yo ni siquiera tenía uno.
Mi simpatía por aquéllos que reescriben se deriva de un prejuicio, supongo que poseen una de las características que más aprecio:
la incredulidad. Incluso he imaginado el proceso que lleva a alguien
a reescribir: primero, la historia épica o bíblica narrada como aliciente para inducir al sueño se instala y, como semilla, echa raíces.
Crece así por dentro y va trazando deseos, bordando expectativas.
Un día, quien reescribirá (y que todavía no lo sabe), convertido en un
inconforme capaz de llevar su malestar hasta sus últimas consecuencias, tal vez mirando al horizonte, tal vez al fondo de la taza de
té, susurra para sí la frase que da vueltas en su cabeza: señor Dios,
usted se equivoca, las personas no resucitan; señor Homero, no
quiero ser un héroe ni quiero ir a la guerra.
Palimpsestos
Escribir donde ya se ha escrito es una práctica antiquísima. Aunque en el Antiguo Egipto y en Grecia los papiros se reutilizaban
pese a ser un material poco propicio para ello, fue durante la Edad
Media que los palimpsestos se multiplicaron; sin embargo, nada
hay más lejano a un deseo de reinventar la literatura que estos artefactos medievales que se producían sólo por motivos económicos.
Confeccionar un pergamino era equivalente a desollar un ganado
entero que, mientras más joven, poseía una membrana más suave y
fácil de coser, por lo que reutilizar folios era una práctica habitual.
Los pergaminos se lavaban y raspaban para permitir la copia de
un segundo texto; incluso éstos podían usarse de nuevo. Así, tres
copias de épocas, caligraf ías y géneros distintos se encontraban en
el mismo códice.
Palimpsesto significa “grabado nuevamente”, de ahí que cada
uno de ellos sea único. El tiempo que hay entre cada copia, así como

pliego16_finales.indd 30

15/09/2014 16:59:04

la disposición de los textos, les confiere individualidad, un carácter
propio: Homero enterrado bajo un tratado médico, Arquímedes
desdibujado entre salmos y oraciones de convento. Fórmulas y
poesía, herejes y santos encerrados entre las mismas tapas durante
siglos. El amor, por ejemplo, convierte al cuerpo en palimpsesto.
Una primera escritura lo estrena hasta su inevitable lavado y
raspado que no logra borrarla del todo. Y andamos así, con la piel
como testimonio.
Durante la segunda mitad del siglo xx, cuando los teóricos
literarios se ocupaban de estudiar las relaciones entre textos,
Gérard Genette utilizó el término “palimpsesto” para hablar de
las reescrituras literarias, de las voces propias y ajenas que conforman al texto, de cómo los autores se apropian de una obra ya
existente para contar otra historia. La idea de Genette fue esclarecedora: detrás de cada texto, de lo que leemos en la superficie,
hay un sinf ín de autores enterrados, basta con soplar un poco.
Los palimpsestos son testigos de la marginación, de la selección
no natural de la literatura. Aquellas copias de las que se podía prescindir eran borradas, enviadas al fondo, convertidas sin reparo en
fantasmas. Como es usual, el tiempo pone al mundo al revés y hoy
se busca en los palimpsestos lo que el pergamino esconde.
Al igual que otros libros, los palimpsestos producen ideas perversas, no sólo porque nos revelan un día que los subalternos también hablan o que algunos héroes bien podrían llamarse asesinos;
su estructura es una provocación en potencia. Se me ocurre, por
ejemplo, un palimpsesto testimonial, donde la encíclica Veritatis
Splendor de Juan Pablo ii quedara enterrada bajo el Manual de la
buena lesbiana de Ana Francis Mor.

31

Letras indelebles
Me llamaba Emma Rosa Arce Becerra. Tenía 40 años.
Encontraron mi cuerpo en la calle Guadalupe, en Puerto Vallarta.
Me mató mi esposo José García García.
Me disparó varias veces en el tórax y en la cara.
Mató también a un joven de 16 años de quien tenía celos
y después se mató él.
De vez en cuando, a modo de escritura colectiva, un grupo de
personas nos reunimos a bordar en lugares públicos. Con hilo

pliego16_finales.indd 31

15/09/2014 16:59:04

32

púrpura letra por letra, desovillando, dejando testimonios indelebles de lo terrible sobre el paño blanco. A veces hablamos, otras
veces no es posible. Hay quien se detiene a leer los retazos de tela.
Siempre nos preguntan por qué bordamos, nunca por qué matan
mujeres.
Una bordadora me contó que, una vez, una niña pasaba en bicicleta y entre los pañuelos que ondeaban se encontró con la historia
de su madre. Saber que alguien más la recordaba la reconfortó.
(La aguja se encuentra por un instante con mi dedo, instintivamente me lo llevo a la boca para seguir bordando. Cada letra duele).
*
Hay reescrituras fallidas o imposibles. A la mala, una aprende que
ciertas historias deben dejarse como están, intentar reescribir
la memoria es terreno peligroso, no es como un álbum de fotograf ías, un sitio fijo que muestra miradas y gestos petrificados,
sonrisas fijas que no se agotan. Dicen que una mujer se
convirtió en estatua de sal sólo por mirar atrás —usualmente la
memoria se encuentra atrás y no adelante—, por dar un último
vistazo a lo que debía dar la espalda.
A través de nuestras historias o de su rechazo nos inventamos.
Somos lo que contamos sobre nosotras mismas, repetía como
mantra una profesora de la Facultad. Entonces no dejé de preguntarme qué era aquello que guardaba en la memoria, cómo
me contaba, cómo me iba tejiendo o quién era en mis historias.
Hay gente que recuerda largos fragmentos de su infancia y dispone
de relatos elocuentes para la sobremesa; de la mía recuerdo poco,
rastrojos apenas: los días de Reyes, el hombre de la bicicleta
arrollado por un auto, la presa frente a mi casa, el uniforme de la
escuela. Supongo que comencé a existir después.
¿Y quién, si pudiera, no se reescribiría? Yo borraría un año o
dos y dejaría a Stravinsky de fondo musical. Entonces sería otra,
distinta de la que escribe, mutilada, con una laguna inocua de aguas
calmadas, pero liberada de ese año o dos.

pliego16_finales.indd 32

15/09/2014 16:59:04

Nouvel An
Haydeé Salmones

33

Para Huberto Batis
Para Lorena

Estaba ebrio. Al despertar, en una estación del metro de París vi
que daban las 12 : 00 de la noche. Era patético; no recordaba nada.
Las arcadas volvieron, más fuertes.
La miré. Estaba buena. Iba sentada frente a mí, con las piernas
cruzadas y los muslos muy tensos. Lloraba. Le miré los pechos, con
ganas de estrujárselos. Cogérmela allí, duro, sin palabras. Metérsela
en el culo, hasta adentro. La miré a los ojos para que supiera. Dejó
de llorar. En la siguiente estación, bajé.

pliego16_finales.indd 33

15/09/2014 16:59:04

34

Riada
Bernardo Barrientos Domínguez

La cara de Penélope se esconde bajo las cobijas; no quiere que los
rayos del sol la despierten. No quiere que nada interrumpa el sueño.
Para muchos, los sueños son lugares para evadir realidades y donde
encontramos las cosas perdidas a lo largo de nuestra vida. Y vaya
que Penélope ha perdido mucho en su breve paso por este mundo:
no pasa un año en el cual la muerte se lleve a un familiar o a una
amistad. Por tal razón, ella está muy sola: la fama de su maldición
terminó por alejar a los demás. No obstante, mientras pueda parir
sueños, a Penélope no le importa. Yo también he sufrido pérdidas.
Mi madre murió de tristeza y mis dos hermanos fallecieron en un
terremoto. Mis abuelos enfermaron de cáncer letal y mi padre descuidó una hernia que lo llevó a estirar la pata. Desaparecieron a mis
amigos en el norte; nadie más ha escuchado hablar de ellos. Sí, los
dos hemos llorado, pero yo no puedo dormir. No es mi naturaleza;
tampoco me causa angustia no poder hacerlo; soñar no es importante. Sin embargo, obedezco las reglas del cielo y me levanto de
la cama al momento en que sale el sol. De repente, el día despunta
y el deber, ese bicho raro que aplasta sueños, empieza a dictar las
diligencias estériles que nos vincularán al estrés y a los demás.
Tengo que ir al trabajo. Ya se me hizo tarde. Tengo que despertar
a Penélope. Tengo que preparar el desayuno. Quiero innovar, pero
sólo sé cocinar huevos y quesadillas. Tengo que bañarme. Tengo
que rasurarme. Tengo que sacar al chamaco de la cama. Tengo que
vestirlo. Tengo que recoger los platos y lavarlos. Tengo que hacer el
café y explicarle a mi hijo por qué todavía no puede beberlo. Tengo
que hacer una lista de los deberes para que Penélope se encargue
de realizarlos. Tengo que sacar la basura. Tengo que revisar que la
tarea esté bien hecha. Todo eso, al tiempo que descorro las cortinas

pliego16_finales.indd 34

15/09/2014 16:59:04

y me doy cuenta de que otra vez llegaré tarde al trabajo. Mientras,
Penélope aún se oculta bajo las frazadas; llamo a la oficina con voz
adormilada y pregunto por el jefe.
—No ha llegado —me dice una secretaria.
—Dígale que voy retrasado. Problema doméstico.
No entro en detalles. Cuelgo e identifico la frustración inicial del
día. Quisiera meterme bajo las cobijas y quedarme tendido hasta
envejecer, pero tengo la certeza de que me haré viejo trabajando.
No jetón. Entonces prendo el bóiler y, en lo que calienta, dispongo
de veinte minutos para exprimir las naranjas, mezclar el huevo con
el jamón y poner la mesa. Elegir el traje que usaré. Ponerlo sobre la
cama. Después escoger la camisa y colocarla debajo de la chaqueta.
Al final, la corbata, la pinche corbata. Durante el periodo de selección, recordar ante todo que una camisa estampada siempre va con
corbata lisa de un sólo color. Pero las corbatas son un rollo. No les
entiendo por más sencillo que parezca. Corbata negra combinada
con un traje negro y una camisa blanca. Corbata rosa con una camisa blanca o celeste y un traje gris. No sé por qué, pero la corbata
naranja va muy bien con una camisa azul o blanca o beige. Corbata
azul con una camisa del mismo color en tonos más claros o igualmente con una camisa blanca. Demasiadas corbatas, demasiadas
decisiones inútiles. Termino con ello tras una larga pausa agobiante
y me baño mientras mi cabeza no deja de trabajar como una locomotora infernal. Las cuentas, las malditas cuentas. El gas, la luz, el
cable, las tarjetas, el internet, la escuela, la despensa, las medicinas,
el dentista, el plomero, el cumpleaños, el día del niño, el día
de cómprame esto, la semana de cómprame aquello, el mes de
cómprame lo otro, el gasto, el gasto, el gasto. Al terminar, despierto
a Penélope con un dulce beso, que no es dulce ni es beso. No puedo
ver su cara, pues está muy escondida. Entonces me dispongo a
adentrarme en las cobijas para rescatarla y aquello me llevará más
tiempo del disponible. Después de varios insultos que pierden el
sentido con su repetición matutina —palabras que suelen decirse
cuando no hay nada más que decir—, Penélope sale de la cama con
una cabellera ingobernable que cubre su enojo. Miro mi reloj pero
no tengo la necesidad de comprobar la hora; estoy seguro de que
es demasiado tarde. Vuelvo a coger el teléfono y llamo a la oficina.
—No ha llegado —me dice un secretario.
—Dígale que voy retrasado. Problema intestinal.

pliego16_finales.indd 35

35

15/09/2014 16:59:04

36

pliego16_finales.indd 36

No entro en detalles. Cuelgo y despierto a mi hijo. Al igual
que muchas personas, él atesora los sueños como joyas preciosas,
secretos tan íntimos que nunca se dicen. Se hace el dormido
aunque lo esté sacudiendo con la fuerza para despertar a un
borracho. Le retiro el edredón, las sábanas, las almohadas y aun así
no se mueve, mantiene un escorzo demasiado forzado. Entonces
le ruego que se despierte, me pongo de rodillas pero nada funciona.
Finalmente cuando logro sacarlo de la cama, continúa el reto de
vestirlo. ¿Quieres esta playera? ¿No? Bueno. ¿Quieres ésta otra?
¿Tampoco? ¿Qué te parece ésta? Bueno, ¿cuál quieres? ¿La verde?
Ésa está sucia. No te la puedes volver a poner. ¿Por qué no usas la
morada? Ya lo sé, pero en serio está muy sucia y te prometo que la
voy a lavar en la tarde. Nooo, no llores. Por favor escoge otra. No
puedes usar la verde. ¿Qué tal la naranja? Ya, por favor, no llores.
La lavaré al regresar del trabajo. Por favor ya no llores, ya no
llores. En ese mismo momento, guardo la absoluta convicción de
que voy a meter la playera verde a la lavadora y luego la meteré
en la secadora de forma inevitable. Entretanto, Penélope sonríe
con malicia, los ojos cerrados desde su cuartel de plumas. Regreso
a mi habitación y vuelvo a llamar al trabajo.
—No ha llegado —me dice un hombre viejo.
—Dígale que voy retrasado. Problema vecinal.
No entro en detalles. Cuelgo y prendo el sartén, echo los huevos.
Caliento el pan en el tostador y sirvo el cereal. Escancio el jugo
de naranja y, para esto, no hay nadie en la cocina. Los dos han
vuelto a quedarse dormidos. Cuando me asomo a las habitaciones,
los encuentro agazapados debajo de sus respectivas mantas. De
pronto, suspiro resignado; una especie de adicción y suicidio
contemporáneo. No puedo evitarlo, quiero aventar los platos a las
paredes como lo hacen en las series americanas, quiero mandar
todo a la chingada y retirarme de la escena en medio de un silencio
de nerviosa incertidumbre. Quiero gritar como chango alterado
por la presencia de una amenaza, pero no puedo. Los cuerpos
débiles no pueden vivir sin el deber. Tengo muchas cosas que
hacer. Tengo que sentarlos a la mesa, tengo que lavar sus platos,
tengo que mantener a Penélope fuera del cuarto, tengo que sacar
la basura orgánica pues ya hay varias moscas, tengo que sacar la
playera verde de la secadora. También tengo que pasar al banco y
a la gasolinera, tengo que pensar en las vacaciones en Cuernavaca,

15/09/2014 16:59:04

en Navidad y en Reyes, tengo que pensar en el aniversario. Tengo
que pensar, pensar, pensar. Y ellos dormir, dormir, dormir.
Al fin se levantan ojerosos. Desayunamos mientras masticamos para sentirnos vivos. Lo hacemos en silencio como debe de
ser: nuestras fantasías mudas nunca se tocan, sólo nos vincula
el sonido de los dientes triturando la comida que dejó de ser
comida conforme se fue repitiendo hasta el sinsabor del convencionalismo. Ante todo, tenemos prisa por terminar las misiones
que nos han encomendado el deber y el estrés. No nos prestamos
atención, ya que cada quien está inmerso en sus pensamientos. Es
cosa de minutos para que retire los platos sucios a medio acabar
y los coloque en el fregadero. Tengo que lavarlos, pues Penélope
no lo hará. Les pido de favor a los dos que limpien la mesa; sin
embargo, resulta lo mismo hablarle a un fantasma. Antes de salir,
intento comunicarme a la oficina.
—No ha llegado —me dice una jovencita.
—Dígale que voy retrasado. Problema en la primaria de mi hijo.
No entro en detalles. Saco y cuelgo la playera verde de la secadora
y salgo disparado por la puerta con mi hijo. De camino al trabajo
me acuerdo de que no hice la lista. Falta leche, jitomates, aceite,
mantequilla, frijoles, queso y tortillas al menos. Estaría bien comprar
huevos también. Aprovecho el embotellamiento, ese fenómeno tan
común que aún sigue irritando a la gente que lo provoca, y marco
a la casa. Penélope no contesta, tampoco funciona su celular. No le
gusta recibir llamadas. De seguro se volvió a dormir, igual que mi
hijo, quien va dormido de ida a la escuela. Él también ha conocido
las pérdidas. Tuvo un hermano por tan sólo dos años, al cual quiso
con toda su alma. Como usualmente pasa en muchos hogares, un
perrito llegó tiempo después. Hermoso schnauzer que conoció el
mundo sólo por dos años. La tristeza de un niño dista de ser reproducida ejemplarmente por las palabras; por ello basta decir que
sufrió de forma amarga. Cuando lo miro dormir pienso en eso. De
la misma manera en la que miro a Penélope. Ellos necesitan de los
sueños para paliar el dolor de su mundo, para librarse de la acuciante
realidad. Quisiera acompañarlos en su dolor, ser su fortaleza,
pero ciertamente escapan de mi ayuda. Tardo una hora y cuarto
en cruzar Coyoacán. Procuro sonreír cuando mi hijo dice adiós,
pero no puedo ocultar la angustia de que me van a despedir. No
sé por qué vuelvo a mirar el reloj. Es una costumbre masoquista,

pliego16_finales.indd 37

37

15/09/2014 16:59:04

38

pliego16_finales.indd 38

una locura de esperar algo que nunca va a suceder. Ya en el
tráfico que abunda en todas partes, no puedo evitar imaginarme
en la pobreza; en cómo voy a mantener a mi familia. Las dificultades
que sobrevendrán a mi despido, los gritos y las pesadillas. Divago
en la forma en la que tendré que confesarles que ya no van a tener
una cama donde soñar. Que los sueños tendrán que ser cambiados
por un boleto de ida a la desesperación. Que no tenemos familiares
ni amigos en quienes confiar, a quién pedirle dinero. Estoy muy
molesto por cosas que todavía no suceden, tan enojado que piso
el acelerador sin querer. Entonces golpeo la defensa de un Chevy.
No es tan fuerte el impacto, pero el conductor está que arde. Las
cosas se caldean. Estoy seguro de que él también va retrasado.
En un segundo de no tensión, los dos llamamos a la oficina.
—No ha llegado —me dice un joven.
—Dígale que voy retrasado. Problema automovilístico.
No entro en detalles. Cuelgo y el otro conductor cuelga. Nuestro
día al parecer es un infierno. No sé por qué no descargamos
nuestra ira en el otro. Él se ve felón. Yo también rifo. No obstante,
de alguna forma tenemos la idea de que nos van a despedir y no
podemos alargar más el asunto. Tampoco podemos llegar con
sangre en nuestras camisas. Es inaceptable. Tengo que darle
trescientos pesos por el golpe; lo acordamos y cada quien jala por
su camino. Eventualmente todos tenemos que hacerlo. Antes de
llegar al trabajo, después de que me lavaron tres veces el parabrisas
—¡chin!, ya no pasé a la gas ni al banco—, veo que el estacionamiento está lleno; ya llegaron todos. Doy vueltas alrededor de un
sinf ín de vehículos estacionados, alineados a la perfección,
indispuestos a traspasar las líneas divisorias de espacio. De manera
eventual encuentro un sitio apartado y la violencia que ocupa mi
corazón parece haberse apagado. Me bajo del auto y mis piernas flaquean, un adormecimiento las invade. Apenas puedo
mantenerme en pie; más de dos horas cuarenta minutos sentado.
No importa. Calculo que ya me están esperando con el cheque
del despido, listos para soltarme. En ese instante, en el trecho entre
la oficina y el estacionamiento, deseo tener alas y volar hacia el sol.
Desintegrarme sin aspavientos. Sólo fundirme a sus potentísimos
rayos que destruyen sueños al amanecer. Sin embargo, puedo pedir
muchas más cosas, pero al fin y al cabo, sé que mañana voy a repetir
el mismo ritual tan monótono como mesiánico, sin importar lo que

15/09/2014 16:59:04

suceda. Cuando se abren las puertas, entro con la sensación de que
voy a perder aun antes de hacer la apuesta. Camino con los hombros
encogidos, la cara medio escondida en la solapa del saco. Procuro
que nadie se dé cuenta de mi presencia: si me van a correr que no
se arme un escándalo o un chismerío. Al tiempo que atravieso un
largo corredor, sopeso las posibilidades de buscar trabajo en una
de las empresas competidoras. O vendiendo comida, no sé. Tengo
que salir adelante, tengo que proveer, tengo que cumplir, tengo que
portarme bien, tengo que satisfacer sus necesidades, tengo que facilitarles la travesía, tengo que estar allí, tengo que estar acá, tengo
que estar allá, tengo que estar en todos los lugares, tengo que pagar,
tengo que producir, tengo que generar, tengo que ofrecer, tengo
que, tengo que y tengo que. Para cuando llego con la secretaria,
estoy tan pálido que parezco enfermo, mi corazón late a mil por
hora. Ante la situación, ella me pregunta:
—Jefe, ¿está usted bien?
—Disculpe, señorita —le digo sin escucharla—. ¿Llegó ya el
patrón?
Horrorizada, se lleva la mano a la boca.
—¡Señor director!, ¿se encuentra bien?

pliego16_finales.indd 39

39

15/09/2014 16:59:04

40

Declaración de odio 2.0
Arturo Loera

Se ha trascendido la carne simplemente
y quedan la piel, las vísceras y el tiempo
cabalgando en el alba
ef ímero entre dudas y esperanzas inciertas.
Las absurdas cadenas se mantienen, Efraín,
pero los gritos brotan ahora de las cloacas:
cocodrilos furiosos, acaso poetas,
cayendo en el drenaje de las negras ciudades
o sobre pequeñas sílabas esclarecedoras
que sean una flor blanca más allá de los túneles podridos.
Porque ¡qué alta ciudad, mareada y lodosa!
Hay árboles de concreto, y persiste una extraña calma.
Las horas grises, blancas y amarillas
ahora son canas, dientes y hepatitis
y lo que hubiera muerto en las traidoras calles
sigue muriendo sin voz ni acero ni tezontle.
La ciudad es justa en nuestro odio
pues alberga en el reflejo de sus cristales sucios
las mismas figuras que en un tiempo
causaron conmoción y van pasando
a ser parte de lo cotidiano.
Sin embargo persiste cierto odio, ciudad,
que genera la perpetuación de contrapartes
que no deja de llenarnos los bolsillos
a cada paso que camina nuestra vista.

pliego16_finales.indd 40

15/09/2014 16:59:04

Ciudad negra o colérica o mansa o cruel
o pequeña hoguera que no ha de calentar
dos o tres partes de nuestro espíritu.
Y al mismo tiempo fuerte en nuestra carne
y nuestras columnas
y nuestro origen orientado hacia el rencor
de odiar a la tierra y amar a la vida.

41

Te declaro mi único odio

(ya que no puedo hablar por los demás).
A ti, a tus alegres y farsantes noticias,
a tus muchachos malditos
que de malditos sólo tienen las uñas,
a tus prostitutas frías y a tu acero caliente.
Te declaro mi único odio a fuerza
de ser engrane en el progreso
de tu talla gigante y sentirte así inmensa
pero cercana.
Y si te odio es para mantener la parcialidad
a la hora y en la hora de nuestro poema
y encontrarlo entre tus meses cada vez más chicos,
entre la publicidad y la música de un alma desarticulada.
Y así también he visto a los hombres:
rosas o geranios, claveles o palomas,
hombres y cocodrilos que esperan caer
en el drenaje de la negras ciudades, como tú
y no ser una casa apacible donde vivir cobardes
y no una puerta falsa para huir de rodillas.

pliego16_finales.indd 41

15/09/2014 16:59:04

42

Oda a la vida retirada
René Rueda

Mi vida habría seguido su cauce natural si el consejo eclesiástico no se hubiera enterado de que en Ávila burlé al regimiento
completo de monjas carmelitas. Una mozuela de caderas anchetas
no soportó el silencio y contó lo que vio y vivió. Asumirse como
víctima mía la salvó de los fuetes, el destierro o la muerte.
Yo, como obrador de sus congojas, fui con el vano dedo señalado.
El obispo González, de Teruel, leyó mi sentencia.
Me arrancaron los hábitos y me otorgaron el destierro. Lloré
porque la vida monacal, a la que me consagrara desde los trece
años, sólo había abonado mis desdichas. De nada sirvieron mis
títulos de traductor de los Proverbios o del Libro de Job; tampoco
mi trabajo en la cátedra de santo Tomás. Mi Orden pregonó que yo
era la encarnación de Satanás. Entonces abandoné mi cruz y,
puesta la fe en mi cuerpo, marché hacia los pueblos de Flandes
y Bretagne, con el fin de mudar mi destino.
En Arkángelsk ahogué cuarenta hombres y puse fin a las “contiendas del ahogo”; en Marken me casé ocho veces y jamás conocieron mi verdadero nombre. A pie, deshice los meses de siete años.
Dichosas experiencias ocupan mi memoria: conozco bien el sabor
de las tardes en Quiberon, donde aprendí a comer pescado crudo.
Pero la suerte me tiró de su lecho y al cabo de once años volví, en
calidad de mendicante, a la terrible patria. Me hice bandido de capa
y estocada, luego matón a sueldo. Por una coincidencia, durante
una encomienda en Teruel, maté al más férreo enemigo del obispo
González, mi antiguo juez, y éste, después de meditar sobre el
provecho que suponía tenerme cerca, me hizo su guardia personal.
Durante dos años seguí su carruaje sobre un caballo negro de buena
estampa. Era feliz con mi sombrero de ala pronunciada, mi espada

pliego16_finales.indd 42

15/09/2014 16:59:05

y mi casaca roja de la cual sobresalían las mangas de una limpia
camisa con cuello a la valona.
En los días de descanso escribía poesías por las mañanas, y
dedicaba las tardes a pasear por las calles bien empedradas, donde
me deleitaba con el andar de las mujeres jóvenes. Pensaba en que
Teruel y sus comarcas eran buenos lugares para transcurrir una vida
sin grandes aspavientos: desde que el obispo me tenía consigo nadie
lo perturbaba. Mi existencia por fin había alcanzado cierto equilibrio.
Un día de noviembre, el equilibrio se rompió. Al promediar la
tarde, por vez primera miré a la niña triste. Se trataba de una mozuela espigada con un canasto de pan colgando de sus puños; se me
antojó tan sola y tan sublime que pensé en protegerla. Caminaba
tras una mujer de rostro inflexible y entrada en años. Desde ese
momento, la serenidad me abandonó. Buscaba cualquier pretexto
para separarme del obispo y rondar los caminos de la niña. Mis
persecuciones fueron cada vez más notorias. Recuerdo que permanecí frente a la puerta de mi amada cuatro noches seguidas, hasta
que el desvelo enmarcó mis ojos; y que lloré a solas, porque me
sentía indigno de amar a tal belleza. Recuerdo que una tarde
encontré en la taberna a ciertos conocidos y que les hablé, entre sollozos, de mi amor por la niña triste.
Un hombre viejo, cuyos ojos apenas se notaban entre sus
muchas arrugas, conmovido por mis quejas, se acercó hasta mi
mesa y me llevó aparte. Dijo que me aconsejaría, porque había
escuchado de mi fama y no le complacía que un hombre valeroso
se ahogara en un pequeño estanque. Hablaba con gran autoridad y,
a pesar de sus años, su voz era brillante y grave. Le di gracias y, al
momento, comenzó a hablarme en liras:
¡Qué vida más afable, la del que huye del mundanal ruido, y sigue la escondida senda, por donde han ido los pocos sabios que en
el mundo han sido! ¿Y quién sabio llamarse?, sino aquél que ha corrido mil caminos, sin dolores ahorrarse y no escuchar más trinos,
que el combate de alfanjes asesinos. El valor de los leones, la más
ilustre gracia de esta vida, por las Dominaciones de cuidado cedida, es poderosa luz que en vos anida. Bien vale que por ésta, procures un descanso prolongado, en el mar o en la cresta de la sierra
que, presta, a recibirte va como a un regalo. ¡Irte de aquí, valiente, y
en la marcha llevar a tu adorada, mantenerla caliente, con ternura
bullente, hasta que brote amor de su mirada!

pliego16_finales.indd 43

43

15/09/2014 16:59:05

44

pliego16_finales.indd 44

Las palabras del viejo, al que di por poeta, inflamaron mi pecho
de esperanza. Al llegar a mi casa comencé a preparar la que creía
mi última aventura. A la siguiente jornada subí las escarpaciones
de la sierra hasta que encontré un lugar oculto y confortable donde
inicié la construcción de una cabaña. Me alegró la cercanía del Tajo.
Cuando concluí la cabaña me dispuse a robar a la niña. En esos
días me convertí en un animal silencioso: si antes me mostraba en
todo el esplendor que la ropa de guardia y mi caballo me otorgaban,
ahora me dedicaba a espiar a la niña desde las esquinas, o desde los
comercios de telas que abundaban por aquellos rumbos. Comencé
a codiciar su cuerpo más que su alma. Una noche de luna menguante en que las pulgas del ansia carcomían mi espíritu, improvisé
unos versos a fin de serenarme: ¿Qué presta a mi contento si soy
del vano dedo señalado; si, en busca deste viento, ando desalentado
con ansias vivas, con mortal cuidado? ¡Oh monte, oh fuente, oh
río! ¡Oh secreto seguro deleitoso!, ya roto el enatío, a vuestro almo
rugoso huiré de aqueste mar tempestuoso.
Un tres de marzo realicé aquello que tanto había soñado. Era
casi la hora nona cuando, a caballo, perseguí a mi niña hasta la
iglesia. En el pórtico le di alcance, con una mano apagué su grito.
La empotré con facilidad. La mujer que la acompañaba intentó
detenerme. Le di un puntapié en la boca. Luego chiflé. El caballo
emprendió el galope entre las miradas injuriosas de los pocos
testigos. Yo profería maldiciones y los tildaba de cobardes. Al dejar
atrás la última casa de Teruel, hundí mi nariz en el cuello de mi
amada y exclamé, victorioso: ¡Un no rompido sueño, un día puro,
alegre, libre quiero; no quiero ver el ceño vanamente severo
de a quien la sangre ensalza o el dinero! Despiérteme esta ave,
con su lozano cuerpo encendido, no el cuidado grave de que siempre es seguido el que al ajeno arbitrio está atenido.
Luenga fue nuestra cabalgata. Los espíritus del bosque ya
chirriaban cuando se levantó ante nosotros la cabaña: poseía un
jardín gigantesco abundante en flores. A su diestra, el caudaloso
Tajo serpenteaba.
Esa primera noche desnudé a la niña, pero no desfalqué ninguna
de sus glorias. Me limité a proferir un sermón sobre nuestra unión
en medio de una tierra enjuiciadora, le dije que éramos las mitades
separadas de un solo cuerpo; que mis ojos la habían buscado
tantas veces, en tantos lugares, como quien busca un lugar dónde

15/09/2014 16:59:05

transcurrir la existencia; que era como si, al hallarla, me hubiera
topado con la verdadera vida; que vivir con ella era como vivir
conmigo. Mientras le decía esto ella lanzaba profundos gimoteos
y, al más leve contacto de mis manos, encogía sus suaves muslos.
“Por hoy has de quedarte así, quiero mirar cómo te labra el frío” le
dije finalmente.
Apenas despuntó el sol, la puse en mi lecho y, como si abriera
de par en par las puertas del monasterio, abrí sus blancas piernas.
Gocé sin paz del bien, luego del duelo, a solas, sin testigos, libre
por fin de celo, de odio, de condena, de recelo. Cuando ella dejó de
oponerse a mis abrazos y dejó caer su cabeza en mi pecho, sentí en
la piel su tenue llanto y me prometí que sería el último de su vida.
Pero una infausta sed hizo que, después de una semana de goce,
la amordazara y la metiera en una jaula de troncos que colgué de
un árbol, pues había decidido bajar a las comarcas de Teruel para
busca otras glorias semejantes a ella, glorias que perdían su esencia
en poquísimos días.
En los alrededores me apodaron el monstruo y durante un tiempo no se atrevieron a recorrer mis territorios, sólo daban gracias
al cielo cuando los restos de sus muchachitas corrían río abajo,
llagados y flacos, mientras mi espacio de árboles reverdecía con
las presencias nuevas y yo recitaba graciosas poesías como ésta:
Del monte en la ladera, por mi mano plantado tengo un huerto, do
siempre es primavera, de bella flor cubierto, ya muestra en esperanza el fruto cierto. Mis niñas codiciadas, en cuatro días de ayunas
reverdecen, suben tristes y agriadas pero al bajarlas crecen en candor y, en silencio, obedecen. Solía tenderme bajo las jaulas: maduré
a la sombra de los temblores y de las llorosas peticiones que convertí en tenues líricas, puesto el atento oído al son dulce, acordado,
del plectro sabiamente meneado.
Cuando los poblados se vaciaron de mozuelas, treinta hombres
en la flor de sus días decidieron acabar conmigo. Sobre caballos
fuertes abrieron los caminos de la sierra. Se encomendaban al Dios
de la victoria; a cada rato soltaban los pomos de sus espadas para
besar sus cruces; no les importaba morir pues creían que yo merecía ese destino. Pero ellos no sabían que en Arkángelsk había dado
muerte a cuarenta hombres bravos en una sola lucha.
Si tuviera un poco más de tiempo consignaría, minuciosamente,
la manera en que rompí sus cráneos; describiría mis trampas y

pliego16_finales.indd 45

45

15/09/2014 16:59:05

46

pliego16_finales.indd 46

hablaría del sonido de mi gurka al hundirse en su carnes, al tajar sus
narices y orejas. Pero el rey se ha dado cuenta de que soy un gran
tigre y ha enviado a más de doscientos hombres por mi cabeza.
Ya escucho el crujir de sus botas contra las castañas de este otoño;
ya puedo oler su miedo. Me voy de aquí. Últimamente he soñado
con pieles del color de la nieve y blondas cabelleras.
Si la vida me alcanza, probaré suerte en diversos países. Adiós
cabaña mía, dejo esta relación de hechos para darle a la gente algo
con qué entretenerse. La finalizo con estos versos que dan razones
fieles a mi comportamiento: Como dice Aristóteles, cosa es verdadera: el mundo por dos cosas trabaja: la primera, por tener
mantenencia; la otra cosa era por tener juntamiento con hembra
placentera.

15/09/2014 16:59:05

Dos epigramas a la manera de Ernesto Cardenal
Samuel Espinosa Mómox

47

A mí también Anel me gustaría escribirte
un epigrama de amor como el de Ernesto a Myriam
Pero de aquellos días

Anel
en los que tú me parecías tan bella
—tan bella que ni Myriam me lo hubiera parecido—
a duras penas

y me acuerdo

***

…para una como vosotras…

Y tú que algún día leas estos versos
emocionada más por mirar tu nombre en el poema
que por el poema mismo
recuerda cada tarde que pasamos juntos
y hasta presúmelo
tuviste tu poeta
Pero también recuerda
tus últimas palabras antes de partir
como si hubieran sido mías

pliego16_finales.indd 47

15/09/2014 16:59:05

48

William Carlos Williams en Reno
Santiago Ruiz Velasco

William Carlos Williams levanta la cabeza y se cala la visera. En la
loma, un japonesito subrepticio que ha mantenido al equipo a raya
durante tres entradas. Piensa en su madre, en Panamá, en su padre,
un marine que desapareció en el 99, y en el Herrera, con el que
fue campeón la temporada pasada. Había llegado a Reno en junio
gracias a su bateo de .357, a probarse con el equipo local, los Ases,
pero acá era distinto. La altura, el idioma, la dieta, el frío endemoniado y esa llovizna constante que conforme avanza el año se va
convirtiendo en nieve. Y la gente. Hoy amaneció solo, y sólo
encontró una nota: me comí las ciruelas del refri. Estaban deliciosas, tan dulces y heladas. Perdona. ¿Estaría ella entre el público?
Sepa Dios. El parque es tan grande, inimaginable para ligas menores. Los jonrones son mucho más escasos y hay que colocar
mejor los golpes. Atrás, entre los jardineros.
No todo es malo, claro, y por algo emigró, pero si planea quedarse o ir a los Diamantes de Arizona, el equipo matriz, tiene
que empezar a batear más. El juego defensivo no basta, no lo
trajeron por ser tercera base.
Un out, hombre en segunda, y el toletero que le sigue es malo de
veras. Son los altos de la séptima y empieza, otra vez, la llovizna.
William Carlos se planta. Abanica. Mira al pitcher. Vuelve a fallar.
Recuerda la broma del dominicano sobre que no se le pueden leer
los ojos al huevón. Se estira, hace un par de swings fuera de la caja
y vuelve. Le mira las manos entonces, ve la pelota salir, los dedos
imprimiéndole efecto. Sabe dónde poner el palo, y toda la tensión
acumulada en su cuerpo se dedica a ponerlo justo allí. Se astilla el
bate y la pelota sale hacia las gradas. De foul.
La atrapa un niño emocionado y, tras el instante, la mirada de
William Carlos sigue hacia el gallinero donde está el resto del equipo. Muy primer mundo, pero los bates de repuesto están en una
carretilla vieja, roja, lustrosa de agua. Mientras se acerca, sin prisa,
se da cuenta
de
todo
lo que depende
de ella.

pliego16_finales.indd 48

15/09/2014 16:59:05

pliego16_finales.indd 49

15/09/2014 16:59:07

pliego16_finales.indd 50

15/09/2014 16:59:09

pliego16_finales.indd 51

15/09/2014 16:59:12

pliego16_finales.indd 52

15/09/2014 16:59:18

pliego16_finales.indd 53

15/09/2014 16:59:19

pliego16_finales.indd 54

15/09/2014 16:59:23

pliego16_finales.indd 55

15/09/2014 16:59:25

pliego16_finales.indd 56

15/09/2014 16:59:26

pliego16_finales.indd 57

15/09/2014 16:59:33

pliego16_finales.indd 58

15/09/2014 16:59:40

pliego16_finales.indd 59

15/09/2014 16:59:41

pliego16_finales.indd 60

15/09/2014 16:59:42

Reescrituras críticas
Patricia Arredondo

61

Las ideas del artista son el alimento del crítico; ésta es la tesis del grabado de
Julio Ruelas (1870-1907) que aparece reproducido en nuestra editorial y en el
cual el pintor decimonónico se retrata siendo atacado por un bicho malévolo.
Las características f ísicas de la alimaña simbolizan el carácter de su “naturaleza” pedestre, de ahí que se asemeje a un horrendo pajarraco con manos en
lugar de alas.
En este número, jugamos a ser de alguna forma esos bichos horrorosos que
“vampirizan” las ideas de otros para sustentar las propias, pues la reescritura
opera también como un ejercicio valorativo. El reescritor desarma el texto,
analiza los mecanismos que lo componen estructural y semánticamente, y
emite un juicio a partir del cual reconstruye el entramado a su antojo, o en
función de “lo perfectible”, retomando algunos de sus elementos compositivos
e integrando otros tantos para la conformación de una nueva idea.
La tarea de reescribir no es ajena a la historia del arte. La reelaboración de
pinturas u obras plásticas actúa en diversas direcciones: como sátira, negación
o reconocimiento… El artista que reescribe la imagen lo hace desde su tiempo,
su estilo y su poética. Estos elementos se sirven de la variedad de formas y el
orden de la composición para dar un giro a la idea del autor original, o crean
partiendo de esa misma estructura y actualizan técnicamente la obra. Se busca
también la referencialidad y el diálogo entre épocas, es decir, se trabaja sobre
un discurso que permite replantear conceptos y miradas con respecto a lo ya
hecho de manera gráfica.
Al pensar que la reescritura también está presente en lo pictórico, decidimos
convocar a diversos artistas para hacer una reinterpretación del grabado La
crítica (1907) de Ruelas. Los creadores debían cambiar de sujeto y reelaborar
la imagen del bicho desde la técnica que les pareciera pertinente, con un estilo
libre, conservando los elementos y su disposición bicho-autor (pues en ésta se
concentra la idea central de la obra). Los protagonistas gráficos se pensaron en
relación a los autores reescritos en los textos de la revista, si bien tuvimos un
par de invitados que se distinguen por su independencia.

pliego16_finales.indd 61

15/09/2014 16:59:42

62

La organización de los retratos se basa en el diálogo que establecen entre sí.
En la portada tenemos a William Carlos Williams a manera de caricatura, por
Erik Rosales. La separata abre con la versión de Andrés Espino, en la cual Ruelas
es quien manipula al bicho. En tanto, la reinterpretación de Rodrigo Cifuentes
propone que aun en la muerte las alimañas críticas siguen succionando las
ideas. A ésta le sigue la del pintor mexicano Arturo Rivera —un autorretrato
apoyado en el de Ruelas—, que fue el detonante para lanzar la convocatoria,
pues nos hizo pensar en la posibilidad de una reescritura en lo gráfico.
En la versión de Miguel Mar, Shakespeare es atacado por lo que pareciera
ser no la crítica sino la muerte, a lo que el autor reacciona con una mirada
de indiferencia. Diomedes Heras retrata a Cervantes, quien es mordido por
la araña de la locura. David Martínez pinta a sor Juana cabalgando la cabeza
de Octavio Paz. Ytzel Maya, a su vez, en una acuarela, hace que un arácnido
gigantesco atenace y envuelva con su red a la décima musa.
Ángel de la Cruz dibuja a Bram Stoker, quien es atacado también por una
araña; al autor de Drácula lo representa Corron con una especie de murciélago
montado en la cabeza. Haydeé Salmones dibuja a Inés Arredondo con una
mariposa como prendedor en el cabello (¿la femineidad es lo que la hostiga o
son sus mariposas nocturnas?). Por su parte, Capitan Monsta la pinta con un
par de pájaros tomando el té y discutiendo en su cabeza; éstos no la agreden
pero la usan como base o instrumento. Dispusimos también la reescritura de
Manuel Reyes, quien intervino una fotograf ía de Anne Rice en la cual el bicho,
un libro, ha caído sobre la mesa.
Así, en algunos casos el atacante es autorreferencial; en otros, la crítica deja
de serlo para convertirse en una metáfora de los temas que obsesionaban a
cada uno de los escritores retratados.
La separata a color cierra con el linograbado
de la artista Gabriela Martínez, cuyo abductor
es un ave que se alimenta de su creatividad. La
técnica empleada nos incitó a colocarlo en un lugar
simbólico: al usarlo de ex libris, queremos signar
que esta revista pertenece a la reescritura.
Tenemos la seguridad de que el abanico de
imágenes que presentamos creará una reflexión
en torno al tema que da unidad a este número:
qué es una reescritura y cómo opera en distintos
lenguajes, según los recursos de los que se puede
echar mano. Confiamos también en que tanto quien
lea esto como quien dé un vistazo a las imágenes,
se convertirá, sin duda, en una de esas bestias
monstruosas que emiten juicios con respecto a lo
que testifican. Bajo esa premisa, ¿cuál será la forma
del bicho que corone la cabeza de esta revista?

pliego16_finales.indd 62

15/09/2014 16:59:43

Colaboradores gráficos

63

Rodrigo Cifuentes (Jalisco, 1980)
Realizó estudios en “La Esmeralda”. Pintor
tenebrista contemporáneo; su trabajo, cargado de
un ácido humor negro, analiza la dicotomía del
mito latinoamericano y el sueño americano.
Corron (DF, 1989)
Tigre / palabrista / ilustradora / músico. Habita en:
flickr.com/photos/corronie corronie.tumblr.com
facebook.com/corronie twitter.com/@corronie
instagram.com/corronie
Ángel de la Cruz
Estudió Diseño de la Comunicación Gráfica
en la UAM-A. Trabajó en el área de Imagen de
Canal Once y en diseño editorial. Es diseñador y
animador freelance. www.behance.net/anhell
Andrés Espino (a. k. a. Ende)
Estudió diseño gráfico en la UAM-X. Ha hecho
talleres y diplomados en ilustración y paredes del
baño. Tatuador de tiempo completo en Garage Ink.
http://ende-ensutinta.blogspot.mx
Diomedes Heras (a. k. a. David Heras)
Animador, ilustrador y diseñador licenciado de
la ENAP. Colabora con Cocolab y el colectivo de
animación Paper Bandits.
http://diomedes-heras.tumblr.com/
Miguel Mar
Diseñador gráfico por la UAT Tampico. Ha publicado
comics independientes y cuentos en antologías
del ITCA. Actualmente se desempeña como
maestro de iniciación artística y como tallerista.
David Martínez (Chihuahua, 1987)
Estudió literatura. Pinta desde que encontró una
paleta en 2008; en 2010, expuso en el Museo Casa
de Juárez. Becario de investigación de la f,l,m.

pliego16_finales.indd 63

15/09/2014 17:00:06

64

Gabriela Martínez (Los Ángeles, California)
De ascendencia peruana y mexicana, su trabajo
utiliza símbolos visuales de este doble linaje para
explorar las escenas cotidianas y las mitologías
familiares que conforman su historia.
http://gabrielamartinez.wordpress.com/
Ytzel Maya (DF, 1993)
Estudia Letras Hispánicas en la UNAM y
Comunicación en la BUAP. Cursó el diplomado
en Creación Literaria del INBA. Se dedica a la
ilustración y a la dirección escénica teatral.
Manuel Reyes
Estudió Ilustración Editorial en la AMAS. Trabajó
en Nickelodeon, Cartoon Network y Play Station.
Publicó en InKult Magazine, Errr Magazine y
La devoradora. Cofundador de Calaca Studio.
Arturo Rivera (DF, 1945)
Estudió pintura en la Academia de San Carlos y
serigraf ía en The City Lil Art School de Londres.
Ha expuesto en el MoMA D.F., Bellas Artes, el
MARCO y en el extranjero. www.arturorivera.net/
Erik Rosales
Diseñador gráfico egresado de la ENAP-UNAM
Xochimilco.
dospallevar.blogspot.mx
www.behance.net/erikrosales
Julio Ruelas (Zacatecas, 1870-París, 1907)
Pintor y grabador. Estudió en la Academia de San
Carlos y en la Universidad de Karlsruhe, Alemania.
De París trajo la técnica de grabado por aguafuerte.
Fue el principal ilustrador de la Revista Moderna.
Haydeé Salmones (DF, 1989)
Estudió literatura y fue rescatista de autores decimonónicos en la UNAM, pero hoy tiene una pug
y se desempeña como ángel del hogar. A veces, dibuja. Es becaria de la f,l,m. en el área de narrativa.
Alan Vázquez (a. k. a. Capitan Monsta).
Es diseñador industrial pero se titulará como diseñador gráfico próximamente. Animador 2D de clóset. Su peor miedo es que se le caigan los dientes.
http://paper-bandits.tumblr.com/

pliego16_finales.indd 64

15/09/2014 17:00:25

Flores de Baria Poesía
Jorge Gutiérrez Reyna

65

Don Carlos de Sigüenza y Góngora
Cosmógrafo y catedrático y capellán (títulos son estos
que suenan mucho y valen muy poco)
Infortunios de Alonso Ramírez

A través de los redondos vidrios
de mis lentes observé la travesía
del áisberg que dejaba un rastro
de espuma sobre las altas aguas de la noche;
tracé en un mapa las finas venas
azules de los ríos que se desangran
en el lago de Texcoco; y desenterré
el vuelo petrificado de la serpiente
en los muros rojizos de Teotihuacán.
Yo hubiera querido
legar a las bibliotecas del tiempo
un verso perdurable como aquella calzada
que custodian ruinas de pirámides
y frondas de nopal, como el latido
del corazón de agua que enciende
los frutos en el pecho verde de la tierra,
como el hielo en los acantilados
de los cometas navegantes.
Quizá no son estrellas las sílabas del verso.
Debí quitarme los lentes para ver
estas tunas más de cerca,
constelación de soles diminutos,
sobre el pálido mantel de las mañanas.

pliego16_finales.indd 65

15/09/2014 17:00:25

66

La dama que se vio en una calavera de cristal
En calavera de cristal se vía,
en el espejo docto escarmentaba,
la que, cuando belleza se miraba,
luz mortal de belleza se atendía.
Don Luis de Sandoval Zapata (ca. 1620 - 1671)

Mientras paseaba en el jardín aquella noche
te escabulliste hasta la biblioteca.
Buscabas un objeto que te había
prohibido especialmente que tocaras.
Desenterraste del fondo del baúl de taracea
el bulto envuelto en un paño rojizo;
lo colocaste sobre la mesa y lo fuiste
desenvolviendo con dedos temblorosos,
como si deshojaras las flores del granado.
A la luz tartamuda del candil habrás visto
esplender la calavera de cristal, tesoro azteca
conquistado por la espada de mis mayores.
Alzaste con ambas manos ese espejo:
habrá colmado la miel de tus pupilas
el par de cuencas transparentes hasta el borde;
la sangre de tus mejillas habrá fluido
por las traslúcidas venas de los pómulos;
debieron cerrarse tus labios por encima
del labrado minucioso de los dientes sobre el cuarzo.
Extrañado de tu silencio,
había emprendido ya tu busca por la casa.
Abrí de golpe la puerta de la biblioteca,
soltaste un gritillo de espanto y dejaste caer
al suelo la preciosa reliquia:
calavera en esquirlas reventada.
Tiempo después el bronco Bragadoro
te partió la frente de una coz.
Te hallé de espaldas sobre la hierba húmeda

pliego16_finales.indd 66

15/09/2014 17:00:25

coronada con la guirnalda de tus propios sesos.
Teresa, tú lo supiste bien esa mañana helada:
somos calaveras de vidrio entre las manos
de una muchacha asustadiza.

67

Sor Juana Inés de la Cruz
la vista perspicaz, libre de antojos...
libre tendió por todo lo crïado.
Primero sueño

En un sueño contemplé la vastedad del universo.
Vi la oreja vigilante de un venado
dormido en la cumbre de nieve del volcán,
el hasta entonces ignorado rostro
de mi padre, un chacal de piedra
en los relieves interiores del sarcófago;
vi tus ojos verdes, María Luisa, y una carta
tuya entre las páginas de un tratado
de mitología en mi biblioteca,
la misteriosa arquitectura de la rosa;
vi catedrales de vidrio en la Antártida
y rebaños de unicornios marinos que se abrían
camino entre los blancos témpanos del agua;
vi a un hombre leer en la banca de un parque
un soneto de mis noches de vigilia;
en Nepantla vi también la tumba
con el nombre de mi madre, a mí misma
dormida entre los muros del convento y en mi pecho
la insomne y delicada relojería del corazón.
Soñé una noche con la vastedad del universo.
Mis pies nunca pisaron
la arena humedecida por el mar.

pliego16_finales.indd 67

15/09/2014 17:00:25

68

Poemas
Dulce Alcántara

Abrojos ii
Pero ¿por qué derramas
tantas lágrimas?... ¡Ah!
Sí, todo lo comprendo…
No, no me digas más.
Rubén Darío

¿Qué comprendes? No mientas.
Todo concluido está.
Pero yo muero por verte,
y por fin hablar
del amor que siempre siempre prometiste
y de las nupcias que no llegaron jamás.
¿Por qué huiste cobarde
después de mis vestidos,
y mis flores arrancar?
Ahora en el estero
tu imagen no soportas mirar.
Mi nombre es Crédula
y el tuyo es Charlatán.
Ángel locuaz,
cierra tus alas
y al precipicio no me arrojes,
que mis plantas
el suelo quieren pisar.
Pero ¿qué pretendes
con ese poema lograr?
¡Ah!... Sí, todo lo comprendo…
Por favor, no vuelvas más.

pliego16_finales.indd 68

15/09/2014 17:00:25

Hombres vanos y vanidosos

69

Pues ¿para qué os espantáis
de la culpa que tenéis?
Queredlas cual las hacéis
o hacedlas cual las buscáis.
Sor Juana Inés de la Cruz

Que le faltan centavos
y por eso es inestable.
¡Vanidad!
Que rebosa en monedas
y por eso es petulante.
¡Vanidad de vanidades!
“La fémina es codiciosa”, dicen,
mas tienen muchas mujeres.
¡Todo es vanidad!
Que no le gusta el compromiso
y es por eso su desdén.
¡Vanidad!
Que quiere desposarse mañana
y por eso busca doncella.
¡Vanidad de vanidades!
“La fémina todo quiere”, dicen,
pero una mujer es quien todo se los da.
Que no hay encanto en la cama
y por eso la repelen.
¡Vanidad!
Que su cuerpo es la lujuria
y la tratan peor que furcia.
¡Vanidad de vanidades!
“La fémina a mis deseos no obedece”, dicen,
pero para ellos es nimio el placer de la mujer.
Hombres vanos y vanidosos
¿cuándo entenderán?

pliego16_finales.indd 69

15/09/2014 17:00:26

70

1. Linda Hutcheon. A
Theory of Adaptation.
Nueva York,
Routledge, 2006.

2. José Luis Sánchez
Noriega. De la
literatura al cine.
Teoría y análisis
de la adaptación.
Barcelona, Ediciones
Paidós Ibérica, 2000.

pliego16_finales.indd 70

¿Qué es la reescritura?
Ana Laura Magis Weinberg

“Reescribir” es un término muy amplio, tanto que parece dif ícil de
abordar. Para hablar de la reescritura me basaré, principalmente,
en textos teóricos de adaptación, sobre todo A Theory of Adaptation
escrito por una de mis críticas/teóricas favoritas, Linda Hutcheon. 1
Antes de empezar, también, quizá deba esclarecer que como buena
posmodernista, posbakhtiniana, postodo, entiendo “texto” más allá
de lo que hay en una hoja y uso el término para hablar de películas y
otras cosas que se pueden interpretar como si fueran palabras
escritas.
La reescritura es una manifestación concreta de la gran nebulosa
que es la adaptación. Es dif ícil encontrar una definición de qué es
adaptar e incluso, cuando la hay, ésta es demasiado general. Por
ejemplo, José Luis Sánchez Noriega se refiere a adaptación como
“el proceso por el que un relato, la narración de una historia,
expresada en forma de texto literario, deviene, mediante sucesivas
transformaciones […] en un relato muy similar expresado en forma
de texto f ílmico”. 2 Sánchez Noriega habla específicamente de la
adaptación al cine de un texto literario, pero es dif ícil encontrar
definiciones que no sean de procesos concretos. Linda Hutcheon,
que habla de la adaptación como proceso sin importar qué se adapta
a qué medio, se rehúsa a darnos una definición. En cambio, aborda el
problema a partir de ideas: la adaptación es una “re-mediación” (es
decir, cambiar de medio), y también es una “transcodificación” donde
se pasa de una serie de convenciones a otras; estas consideraciones
parecen apuntar más a pasar una novela a una película y esta película a un videojuego, pero bien podrían referirse al remake de una
película de los setenta que se rehace tomando en cuenta las nuevas
convenciones (qué esperamos de las películas, cómo hay que hacer

15/09/2014 17:00:26

los efectos especiales, etc.). Es decir, eso de cambiar de medio o de
codificación no implica necesariamente cambiar la forma f ísica
o textual. Hutcheon, sin embargo, es bastante clara para hablar de
lo que no es una adaptación. No es copiar al pie de la letra, sino
apropiarse del material que se copia: el éxito de una adaptación
no depende de la fidelidad al texto de partida. 3
Una adaptación, para Hutcheon, tiene que ser un texto autónomo
por sí solo (y es aquí, y no en su “fidelidad”, donde radica el éxito),
y se compone de dos partes: repetición y cambio. La repetición nos da
seguridad y en realidad nos encanta que nos cuenten la misma
historia una y otra vez, mientras el cambio hace que valga la pena
que se cuente de nuevo. Qué y cuánto se cambia depende de las
posibilidades tecnológicas de la época, las capacidades imaginativas y económicas del adaptador, y el entusiasmo del público por el
texto de origen. Hutcheon señala la diferencia entre una adaptación y
fenómenos como fan fiction, historias donde los lectores se dedican
a imaginar nuevas aventuras para sus personajes queridos. Dice al
respecto que hay una diferencia entre no querer que termine la
historia y querer contar lo mismo una y otra vez pero de distintas
maneras. Al final del libro termina planteándonos una especie de
gráfica, que hizo ecos con un texto sobre traducción que leí hace
algunos años y que traía un dibujo de un abanico. En los dos casos
se explora la idea de que hay textos más cercanos al original y textos más alejados, y que se van moviendo en una especie de continuo.
La reescritura está situada a la mitad de este continuo, entre el
extremo que sería copiar palabra por palabra y lo que Hutcheon
llama spin-offs (historias completamente nuevas elaboradas a partir
de un personaje que apenas tocan lo que sucede en el texto original).
Al plantearla justo en medio de este continuum nos indica que la
reescritura conserva bastante del texto de origen pero también
tiene muchos cambios hechos por el adaptador (digamos, si
fuéramos científicos y esto fuera ciencia, que habría un 50% de
material que se conserva y 50% que se cambia). Si pensamos en
términos legales, una traducción necesita pagar derechos de autor
porque es su obra, al igual que lo hace una puesta en escena teatral,
o una película hecha a partir de un libro. Estas adaptaciones están
más cercanas al original, mientras que otras (llamadas a veces
“derivadas”) están tan lejos que hay que encontrar las referencias
escondidas (como Hamlet en El rey león o Robinson Crusoe en La

pliego16_finales.indd 71

71

3. Como indica
Robert Stam en
Literature and Film
(A Guide to the
Theory and Practice
of Film Adaptation),
eso de hablar de
“infidelidad” de
un texto nos hace
parecer mojigatos, y
cuando decimos que
“traiciona” al original
le estamos dando
connotaciones éticas.

15/09/2014 17:00:26

72

vida de Pi). Una reescritura infringe los derechos de autor (pues
hay que conservar la propiedad intelectual, ¿no?), pero si no
hubiera un cartel diciendo “basada en…” pocos se darían cuenta
de su origen. Las reescrituras cambian el final, nos cuentan la
infancia de algunos personajes, pasan una obra a otra época
o lugar, pero permiten que la trama se desarrolle igual o casi
igual. Creo, sin embargo, que para poder llamarse “reescritura”
el nuevo texto tiene que cambiar el original de alguna manera.
¿Por qué reescribimos?
En 1967 Roland Barthes mató al autor, y desde entonces la crítica
literaria se ha separado mucho del creador del texto. Antes era
válido preguntarse cómo influyó la biograf ía de un escritor en una
obra, o “qué quiso decir”; ahora los textos se suponen objetos
completamente separados de sus creadores, y las pistas para
decodificarlos están en el mismo texto o en otros. Hutcheon, sin
embargo, propone que la adaptación le quita el peso al texto en sí
(ya que existe aparte del adaptador) y regresa la atención al creador,
pues vuelve a ser válido preguntar “¿por qué lo hizo?” y “¿por qué
lo hizo así?” cuando sabemos que existen otras maneras de hacerlo.
Hutcheon plantea la pregunta de por qué nos gusta adaptar
pero no la contesta del todo. Y es aquí donde intervengo. Hutcheon
insiste siempre en nuestro amor por la repetición y la innovación
y esto, invariablemente, me hace pensar en el juego. Jugar es una
actividad que no es exclusiva de los seres humanos (los chimpancés
tienen muñecas de palitos y los leones bebés se pelean de broma), y
que cada vez se estudia más como fenómeno de la mente; algunos
juegos sirven como preparación para actividades futuras, para
forjar lazos dentro de una sociedad, pero sobre todo por el simple
hecho de que son divertidos. Más allá de la función del juego, se
ha demostrado que jugar sirve para formar y reforzar conexiones
neurológicas (es decir, para aprender). No somos el único animal
que juega, pero sí el que juega más. Jugar nos permite explorar
el mundo y plantear posibilidades. Al ver a un niño aprender
notaremos que primero repite la actividad un par de veces de la
misma manera que se la mostramos, y cuando se da cuenta de que
tiene un dominio suficiente empieza a proponer variaciones de
la actividad. Cuando aprendemos un idioma nos enseñan frases
hechas que repetiremos un par de veces, y al ver que el maestro nos

pliego16_finales.indd 72

15/09/2014 17:00:26

sonríe intentamos cambiar algo de la estructura o las palabras para
probar si entendimos bien.
Cuando llegaba el momento de entregar el trabajo final siempre agradecía a los profesores que nos dejaban temas establecidos
en lugar de decirnos “escriban sobre cualquier cosa vista en clase”.
También me pasó lo mismo cuando, intentando escribir poesía, escogía hacer sonetos en lugar de verso libre. Creo que es más fácil ser
creativo cuando se tiene un marco limitado, pues la libertad absoluta
requiere mucha disciplina para domarla. Las formas rígidas preestablecidas también permiten jugar con ellas y pueden convertirse
en un juego del ingenio, y ésa es otra razón detrás de la reescritura.
Creo firmemente que la reescritura es un ejercicio de amor.
Cuando amamos algo, nos queremos vestir lo más posible de ello,
queremos que sea tan parte de nosotros, habitarlo. La reescritura
parte de este amor: primero repetimos el texto algunas veces,
releemos y volvemos a ver la película. Llega un momento en que la
copia nos cansa, y de la misma manera que como aprendemos
a amarrarnos las agujetas, cuando sentimos que ya dominamos el
texto nos empieza a dar ganas de querer alterarlo de alguna manera.
También tiene mucho de la eterna curiosidad humana: queremos
explorar el texto y el universo que nos propone, descubrir sus
fronteras y pasearnos por sus límites. La reescritura no es un
ejercicio sino un juego: queremos simular nuevos escenarios en eso
que tanto nos gustó.
La reescritura no siempre es inocente: puede partir del amor
por un texto pero no siempre da un resultado amoroso. Pienso en
Wide Sargasso Sea, una novela de Jean Rhys donde toma a un personaje de Jane Eyre y lo reconstruye. En la novela clásica inglesa Jane
trabaja en la casa de Rochester, que parece estar habitada por un
fantasma. Cuando ella y Rochester se van a casar llega un testigo a
detener la boda, pues Rochester está casado con una mujer loca que
tiene encerrada en el piso de arriba, y quien está obsesionada con el
fuego. Menciona, también, que es una criolla del Caribe. Jean Rhys,
nacida en la isla Dominica, escribió una novela contestataria donde
se narra la infancia de esta mujer, que llama Antoinette Cosway, y
nos deja ver el maltrato a la que la sometió Rochester, la manera en
que le quitó su fortuna y la orilló a la locura, culminando en un viaje
en barco que ella misma no reconoce. Así, Rhys transforma la novela original, pues señala el discurso racista y machista implícito en el

pliego16_finales.indd 73

73

15/09/2014 17:00:26

74

4. Keith Cohen con
respecto al director
Sergei Eisenstein
en Eisenstein’s
Subversive
Adaptation, Peary
and Shatskin, 1997.

pliego16_finales.indd 74

texto. Charlotte Brontë hace que Cosway sea responsable de todo el
mal de Rochester, y Rhys regresa la culpa a Rochester al mostrar
el “verdadero” proceso detrás de la locura de su mujer (que en el
texto original se explica diciendo que ella es del Caribe y por lo
tanto está loca, y además atrapó tramposamente a Rochester al
casarse con él).
La reescritura permite jugar dentro de los límites propuestos por
un texto, pero también nos da la oportunidad de cambiar el texto de
origen. Hutcheon dice que para que una adaptación sea buena
no basta con señalar los momentos en los que se aleja o se acerca del
original: el problema no está en la fidelidad. Para ella una buena
adaptación tiene que ser una obra autónoma, capaz de existir por sí
misma sin el conocimiento previo de la obra adaptada. Ella misma
cita a un crítico que afirma que las adaptaciones deben subvertir
al original, 4 y aunque no estoy de acuerdo totalmente con tal
declaración (y Hutcheon tampoco), creo que tiene algo de cierto.
La reescritura está justo en el lugar adecuado, al separarse lo suficiente pero no demasiado del original, para ser el tipo de texto que
puede cambiar la obra de partida. Creo que una buena reescritura,
además de poder existir libremente por el mundo, tiene que hacernos ver lo reescrito con una nueva mirada, nos tiene que aportar
algo que el primero sugiere pero no explora. Pienso, por ejemplo, en
cómo la nueva serie de la BBC, Sherlock, me ha hecho ver lo estrecha
que es la amistad entre Watson y Holmes, sugerida en los cuentos
pero no encarnada como lo hacen Martin Freeman y Benedict
Cumberbatch. No concuerdo con eso de “subvertir” al original porque no siempre es necesario, como en el caso del detective inglés.
A veces basta con alumbrar las esquinas oscuras para que la próxima vez que nos metamos en el cuarto desordenado, el texto de
partida, nos acordemos de mirar hacia arriba y fijarnos en el estucado que nunca se nos ocurrió que podía estar ahí.
Ésta es una pregunta que se aborda mucho con respecto a las
adaptaciones literarias al cine, ya que traen varios problemas: el
principal, las hordas de fanáticos que leyeron los libros y nunca
quedarán satisfechos porque ellos imaginaron las cosas de otra
manera. Por otro lado, las adaptaciones tienen la gran ventaja de
que, precisamente por los libros, es más probable que les vaya bien
comercialmente. Las reescrituras, creo, actúan menos en función
del público y más alrededor.

15/09/2014 17:00:26

De niños perdidos y llaves sangrantes:
reescrituras del cuento de hadas en el siglo xx

75

Lola Horner

Reescribir es ante todo releer. No cabe adivinar el significado de las
palabras sin antes relacionarlas con lecturas previas. El texto funciona como un doble espejo: observamos en él las obras que leímos
antes, los lectores que fuimos y también aquéllos que somos conforme nuestros ojos se deslizan sobre las páginas.
La relectura modificará nuestras concepciones de significado
anterior al tiempo que cubre, con un plumaje híbrido y distinto, al
texto que leemos en el momento.
Los cuentos de hadas son un género tan antiguo como la humanidad. Si en un inicio se escurrieron de boca en boca, entre las
lenguas y los ojos de hombres y mujeres que transmitían sus relatos
alrededor del fuego, los escritores más populares (pensemos por
ejemplo en Perrault o los hermanos Grimm) ya eran reescritores.
Tomaban las palabras del aire y las transformaban, gracias a un
proceso alquímico que llevaba su firma, en tinta sobre papel inmaculado.
El material del cuento de hadas es inflamable. En sus símbolos se
han recreado psicólogos, antropólogos y eruditos. Su complejidad
y la atracción que por ellos sentimos no se ha visto mitigada por la
historia. Cada una de las sucesivas reescrituras dotó a los cuentos
de un contexto cultural y sociopolítico que se insinuaba, casi a
contraluz, en las modificaciones que los autores introducían entre
los personajes y la trama. No sólo Perrault pensaba que sus cuentos
debían ser edificantes y diseminar el concepto de la civilité francesa
a lo largo y ancho del continente europeo: los mismos hermanos
Grimm veían en el cuento de hadas una oportunidad para construir
la identidad distintiva del pueblo alemán.

pliego16_finales.indd 75

15/09/2014 17:00:26

76

pliego16_finales.indd 76

Quien tiene el poder decide cuáles cuentos trascienden y
cuáles languidecen, despojos que naufragan al lado del camino.
¿Quiénes conocen hoy día los cuentos de hadas expresionistas, que
el régimen nazi se encargó de prohibir y desaparecer? ¿Quiénes
a las escritoras de la corte francesa, contemporáneas de Perrault,
mismas que sufrieron cárcel y exilio por el carácter transgresor de
sus relatos? Dentro de la historia del cuento de hadas se encuentra
escrita con sangre aquella otra historia, la de los discursos únicos,
que amenaza cada tanto con imponerse a la libertad creativa en
aras de los “más altos” valores sociales o morales.
Así, los cuentos transmitidos por mujeres fueron escritos
(¿reescritos?) por varones. El cuento de hadas viajó a América entre
las sábanas de los inmigrantes irlandeses, dentro de las maletas
de los ministros alemanes, junto a las Biblias de los misioneros
españoles. Walt Disney supo retocarlo con su varita mágica: lo
convirtió en celuloide. Si durante el siglo xix el cuento de hadas
fue arrinconándose cada vez más del fuego del hogar hacia la
habitación de los niños, para el xx el contenido familiar, defensor de
valores occidentales y conservadores estaba totalmente afianzado
en forma de pájaros cantarines y ardillas simpáticas. Su potencial
subversivo se redujo mientras el didáctico se potenciaba. Tan es así
que junto a las películas de Disney los cuentos de los Grimm, ya
censurados por los hermanos con miras al público infantil, resultan
directamente transgresores.
¿Qué ocurre hoy que la reescritura del cuento de hadas goza
de verdadera salud? ¿Qué tienen en común los poemas de Anne
Sexton, la película Jack el matagigantes y los Cuentos de Hades
de Luisa Valenzuela? El siglo xx es el siglo del reciclaje, y el xxi
continúa con esta tendencia. Se exploran nuevas maneras de
dialogar con los textos, de transgredirlos, de apropiárnoslos. Si ya
es imposible ser original, explotemos el discurso desde dentro.
El cuento de hadas es un discurso plástico; si le creemos a
Umberto Eco, admite toda suerte de modificaciones porque se
construye a partir de una serie de acciones simples que Vladimir
Propp se ocupó de catalogar cual entomólogo preocupado. Veamos
como ejemplo tres reescrituras de la Caperucita. Ya son distintas
a las dos más conocidas, la de Perrault y la de los Grimm, pues
el escritor francés permite que el lobo se meriende a la niñita,
mientras que los Grimm, en un alarde de poder autoral, dotaron al

15/09/2014 17:00:26

cuento de un cazador para rescatar a la indefensa. Escojamos tres
autores disímiles: Roald Dahl, Angela Carter y Luisa Valenzuela.
Dahl lo hace en clave infantil, satirizando los valores de la niñez.
Su Caperucita es una asesina despiadada, que no sólo se fabrica un
abrigo con la piel del lobo, sino que se da el lujo de construirse una
maleta con el cuero del más pequeño de los tres cochinitos (cabría
preguntarnos qué pensaría Cri-Cri del cuento de Dahl).
Carter, por el contrario, explota la vertiente erótica del cuento
“original” y, en sus cuatro variaciones de la Caperucita, el encuentro
con el lobo, sin dejar de ser violento, incluye otro tipo de matices.
Puede ser que el lobo y la abuela conformen el mismo personaje (a
quien Caperucita tiene que vencer) o que Caperucita deba aprender
a yacer con el lobo para salvar la vida. Puede ser incluso que se
trate de una loba, quien no se halla del todo cómoda en el mundo
humano, limítrofe, marginada por unos y otros.
Valenzuela juega a desaparecer los límites entre el lobo, la
abuela, Caperucita y el lector. La protagonista puede ser los tres
personajes o ninguno. El bosque es a la vez un desierto y un jardín.
Quizá nunca llegue a casa de la abuela; quizá, si llega, sea peor
para ella.
Los tres autores, en tres épocas diferentes y con propósitos distintos, se valen del cuento original como marco para volcar preocupaciones estéticas particulares. Toda reescritura tiene un dejo de
ironía, y las reescrituras del siglo xx se caracterizan por faltarle el
respeto a los textos, buscarles las costuras. La pluma del escritor
juega a hacerle cosquillas a los personajes empolvados hasta
volverlos temibles o ridículos. Todas las reescrituras beben de
textos más antiguos. Ya se trate de las rimas para niños perversos
de Dahl, las películas de Shrek o la serie de televisión Once Upon a
Time, la simbología del cuento de hadas se halla presente con un
propósito concreto: provocar el asombro del espectador.
¿Por qué hablar de cuento de hadas y no de mito o leyenda?
Porque lo que hace especial al género es el asombro que pretende
provocar. Por ello se le ha llamado también, en sucesivos intentos de estudio, “cuento maravilloso”. ¿No es el asombro el último
bastión a defender en la era de la tablet y las redes sociales? Es él
quien se coloca detrás de las pupilas que se dilatan cada vez que
el niño escucha, embelesado, “Había una vez…”, y es a él a quien
recordamos cuando permitimos que el niño que guardamos en las

pliego16_finales.indd 77

77

15/09/2014 17:00:26

78

pliego16_finales.indd 78

partes más recónditas de nosotros mismos, encerrado con llaves
sangrantes, se asome a escuchar otra vez el mismo cuento, quizás
no de la misma forma, dispuesto a sorprenderse.
No tengo duda de que el asombro nos hace más humanos.
Las reescrituras del cuento de hadas nos entregan una doble
sorpresa: la que sentimos al reconocer el cuento “tradicional”
(reconocer al niño que fuimos mientras lo escuchábamos) y
la que se produce al descubrir las modificaciones que el autor,
hábil prestidigitador, ha efectuado para nosotros. Sea en forma
paródica o terrorífica, nos regocijamos con goce arcaico como se
regocijaban los hombres de las primeras hogueras, dispuestos a
recoger las migajas de sentido ocultas entre el bosque y el palacio.

15/09/2014 17:00:26

Entreacto
Salvador Calva Carrasco

79

Soy Macbeth, rey de Escocia, y me arrepiento. En mi juventud, seducido por la tragedia, admiré a los personajes de Shakespeare. Lear
y Julio César fueron mi inspiración y mi sueño; pero ninguno como
Macbeth. Ensayé con horror y dedicación sus líneas. Pronto los espejos disimularon mi rostro. Así, nuestro ascenso a los escenarios
fue inevitable. Los aplausos, las críticas y las dilatadas temporadas
desairaron a la ficción. El teatro era un arte sin muros. Prodigué
tiempo y memoria a un personaje más hecho de tinta que de polvo.
Era tal su requisa, que pronto la vida me pareció una impostura.
Entre galas y esplendores tuve que reducir las jornadas de trabajo
para recuperar a toda costa mi personalidad. En un par de semanas
sus facciones se disolvían, sus ojos negros se tornaban café claro
y la sonrisa volvía a mi boca. Buscaba campos abiertos y atardeceres con sol. Cualquier sitio era mejor que el teatro. Entonces
soñaba con recuerdos propios y una obra que actuar.
Pero la materia de la que estamos hechos: el tiempo, y nuestros
dioses: los astros, nos orillan a la finitud y a la desdicha. Ayer el director anunció una temporada más. Mi corazón estuvo a punto de
florecer. Creí que el terreno recuperado se perdía en una sola jugada.
Dentro de mí, o quizá yo mismo, me complacía de la victoria.
Del pasado y del presente es posible escapar, no así del futuro.
Tengo la esperanza de vivir sin el recuerdo de Macbeth. La realidad
o el teatro, lo ignoro, me orilla a tramar una jugada no prevista.
La esperanza está en la carne de Duncan. Si el rey cae, nunca más
tendré que matarlo; su sangre no enturbiará cada noche mi alma.
Truenos y relámpagos…
(Se abre el telón)

pliego16_finales.indd 79

15/09/2014 17:00:26

80

Sibila
Demian Marín

I will show you fear in a handful of dust.
T. S. Eliot

En esta jaula nos vamos consumiendo. Nuestra piel cuelga de los
barrotes. Somos seres inmundos con poderes que no pedimos.
Nuestra garganta envejece hasta enmudecer. El cuerpo se cae a pedazos. Después de tantos siglos, nuestro canto se pierde en el silencio.
Pero los hombres siguen llegando, siguen pidiendo un designio.
Cuando la edad apaga nuestro canto, escribimos los acertijos en
hojas de roble.
*
En una caverna fría y solitaria, hombres de diversas latitudes
visitan una jaula que cuelga del techo. En la penumbra de la jaula
yace una anciana moribunda. Ella les anuncia el destino en forma
de acertijo. Su futuro se encuentra allí, encerrado en una maraña de palabras, en un puño de sonidos que cobran forma sólo
cuando se cumplen los augurios. Los hombres salen con azoro,
con un secreto agradecimiento y con la profunda impotencia que
otorga la incomprensión.
*
Yo, Apolo, he visto en los ojos de esa mujer la misericordia y el
amor. Yo, dios benévolo, le ofrecí el gran poder de la profecía. La
nombré Sibila, porque de esta manera todos sabrán de ella, del
poder que le he regalado, por el bien de los hombres. Yo, dios de la
luz, me he maravillado con sus embrujos.

pliego16_finales.indd 80

15/09/2014 17:00:26

—¿Deseas algo? —pregunté—. ¿Algo que pueda ofrecerte a
cambio de tus encantos?
Yo, Apolo, hijo de Zeus, estaba dispuesto a ofrecer cualquier
cosa con tal de poseerla.
—Pide lo que sea —le dije—, cualquier cosa te será concedida.
—¿Cualquier cosa? —preguntó Sibila.
—Cualquier cosa —dije ardiendo de pasión.
Ella tomó un puñado de arena.

81

*
Nacimos en lugares remotos que hemos olvidado. Nuestro
recuerdo no va más allá de este sitio, no se atreve a navegar aguas
subterráneas. Somos despojos de nosotras mismas, elevadas como
deidades que asquean. Somos muchas y a la vez somos una: la
sibila, la anciana de mil años que conoce el destino de los hombres.
*
Las supersticiones no hacen daño, a menos que se vuelvan realidad.
Nosotros no creíamos en esas supercherías que se hablaban acerca
de las sibilas. No creímos que alguien del pueblo podría convertirse en una de ellas.
Mi madre anunció la muerte de mi padre. Era de esperarse.
Ambos eran viejos ya. La muerte rondaba desde hacía tiempo.
La tragedia, la funesta sorpresa, fue escuchar la predicción de las
circunstancias.
Con un dulce canto, desconocido para nosotros, mi madre
anunció:
los cascos destrozan el cráneo
el tiempo se desboca
una llama se apaga
Comprendí sus extrañas palabras al día siguiente. Mi padre iba
caminando de regreso a casa. Un patricio perdió el control
de su caballo. Pasó encima de mi padre. Una muerte inmediata.
*
Los restos de la última sibila se vuelven la carroña de la que toma
su lugar. Pronto la nueva termina por devorar el cadáver de la vieja.
El hambre aparece.

pliego16_finales.indd 81

15/09/2014 17:00:26

82

Durante un año, quizá dos, la nueva grita, desfallece, su cuerpo
se reduce a un esqueleto envuelto en pellejo. Algunas sibilas han
llegado a arrancarse los dedos, las manos. Su propia carne es sucedánea del hambre que, irremediablemente, vuelve a aparecer.
Un año, quizá dos. La sibila clama por comida. Los escasos
visitantes le arrojan frutos, semillas. La sibila alcanza a tomar algunos, se los lleva a la boca con sonoras carcajadas. El hambre
desaparece. Y al día siguiente, regresa, como si nunca la hubiera
abandonado.
Así pasa un año, quizá dos. El hambre, omnipresente durante
todo ese tiempo, de repente se va. Y no vuelve más.
*
Habitamos un lugar que con los años se vuelve gigante. Cantamos
los designios hasta no poder más. Nuestros cantos regresan con
el eco de la jaula y de los años. Ecos repetidos, siempre repetidos.
Palabras que carecen de significado. El destino es un ciclo irritante:
las mismas palabras, los mismos cantos. Sólo el nuestro es diferente.
*
Pide cualquier cosa.
¿Cualquier cosa?
Lo que desees.
Quiero vivir tantos años como granos de arena tenga en la mano.
*
Mi madre dejó de ser mi madre ese día. Le pregunté si había sido
un demonio el que hablaba a través de ella o, peor, si el demonio se
había hospedado en su cuerpo de forma definitiva. Mi madre, que
no era mi madre, no dijo nada.
Al pueblo llegó la noticia de que allá en la montaña, en la caverna donde habitaba la bruja que llamaban sibila, ésta dejó de escribir.
Los supersticiosos decían que cuando una bruja moría, otra
aparecía en algún lugar cercano. Decían que el lugar donde la nueva bruja surgía se volvía maldito, y que grandes tragedias ocurrían
allí. Decían que eso pasaba cada mil años.
La bruja que fuera mi madre, antes de ir por su cuenta a su
encierro en la caverna, anunció con un canto:

pliego16_finales.indd 82

15/09/2014 17:00:26

el estupor galopa a su encuentro
su fuete es el fuego
su brida la desolación

83

*
Aquí aprendimos del oído, comprendimos el verdadero fin de
palabras que se encierran como erizos. Aquí sedujimos al paseante
con ecos, con frases que pronto se convertían en realidades, en la
propia realidad de quien pregunta. Aquí recogimos los restos
de una vieja civilización y dijimos con orgullo: aquí aprendemos del oído y comprendemos, poco a poco, el verdadero fin de
palabras que se encierran.
*
Hay un roble a la entrada de la caverna. La sibila, cuando ha
perdido la voz, demanda hojas de este árbol. En las hojas escribe
varios versos y los libera al viento. Las hojas que caigan más cerca
del visitante son las que marcan su destino.
En invierno, el roble se queda sin hojas. Los visitantes dejan
de venir, por falta de hojas, por causa del frío. Los pocos torpes
que suben la montaña han visto gruesos témpanos de hielo colgar
de la jaula donde se encuentra suspendida la sibila. No comprenden cómo pueda sobrevivir a los inviernos más crudos en esa,
de por sí, fría y húmeda caverna.
Durante el otoño, cuando el viento mece las ramas del roble y el
suelo se cubre de hojas, no hay día que no se aparezca algún hombre
deseoso de conocer su futuro.
*
Nunca había sentido tanta repugnancia. Nunca me había sentido
tan ultrajada por las palabras de Apolo.
—¿Ves esta arena? —le dije—. Si yo vivo tantos años como granos de arena tengo en la mano, mi virginidad será tuya.
Apolo extendió su brazo. Deposité la arena en su mano.
—Así será —dijo.
—Tu deseo se ha cumplido. Ahora ven a mí, hermosa Sibila.
De sólo pensarlo me daban ganas de vomitar. Apolo, lascivo, se
acercó a mí.
—Ven aquí, Sibila, ven a darme lo que ya es mío.

pliego16_finales.indd 83

15/09/2014 17:00:26

84

*
Hay veces que miramos nuestro destino, como si fuéramos
cualquiera de los que vienen a vernos. Nos preguntamos a nosotras
mismas (con sonrisa cómplice) por lo que va a pasar, por nuestro
inevitable futuro. La eterna visión de lo mismo, de la misma
existencia en esta jaula, del proceso de envilecimiento de nuestro
cuerpo, la imagen perenne de la tortura que significa la vida, nos
hace olvidar, por siglos, la sonrisa cómplice de este ruin juego.
*
Era mi madre, pero no tenía opción. Debíamos expulsarla del
pueblo. Tapié la casa, pasé los días siguientes con los vecinos. La
que antes fuera mi madre recorrió las calles, cantó a gritos terribles
profecías, soltó siniestras carcajadas. Nadie salió en todo ese
tiempo. Nadie hizo nada por ella.
Mi madre gritó, blasfemó, dio puntapiés en las casas hasta que
se cansó. Después se fue. Todos sabíamos a dónde se había ido. La
vida sin ella volvió a la normalidad. Regresé a mi casa, traté de
retomar mis actividades. La gente del pueblo apoyó mi duelo. Todos
sentíamos el vacío que mi madre había dejado en la comunidad.
Sabíamos que, con el tiempo, todo se olvidaría.
Pero nada se olvidó. A las pocas semanas, un terrible incendio
acabó con el pueblo.
*
Los niños, por juego o por maldad, suben la montaña, se internan
en la caverna, se esconden y ríen. La sibila cuelga en una jaula. No
tiene más hogar que ese medio metro cuadrado que la delimita. Los
niños la miran, cuchichean, se burlan de ella. Su vida es demasiado
nueva. No tienen interés por el destino. La sibila musita, pero su
voz se apaga. La alegría de los niños opaca la vieja voz de la sibila.
Pero, en pequeños lapsos de silencio, alcanza a oírse el murmullo.
—Quiero morir. Quiero morir. Quiero morir...
*
La agonía. Los hombres nos visitan. Vienen en busca de su futuro,
en busca de nuestras palabras que se hacen realidad. Nosotras,
desde el encierro, dictamos el destino de los hombres con pala-

pliego16_finales.indd 84

15/09/2014 17:00:26

bras de fuego. Palabras incomprensibles. Palabras peligrosas. La
agonía. Los hombres vienen en nuestra búsqueda, siempre agónicos, siempre inquietos. La agonía de no saber si alcanzarán a
comprender nuestras palabras.

85

*
Yo, Apolo, hijo de dioses, cumplí mi promesa. Novecientos noventa
y nueve granos de arena en la hermosa y perfecta palma de su
mano. Novecientos noventa y nueve años por delante. Novecientos
noventa y nueve años para amarnos.
Yo, Apolo, dios de la profecía, enceguecido por la lujuria, he
sido engañado por Sibila.
—He cumplido mi promesa —le dije—. Ahora tú cumple la tuya.
—No —dijo Sibila—. No —dijo, y huyó.
Por eso, padre mío, yo, Apolo, tu humilde hijo y servidor, te pido
justicia, te pido que intercedas por mí, por este ultraje cometido.
—Sibila pidió larga vida —dijo Zeus—, nunca pidió juventud. Su
deseo será cumplido.
*
No comemos, no bebemos, no dormimos. La muerte puebla nuestros pensamientos. Es lo único que pensamos. Morir es ahora
nuestra más grande ilusión. En nuestra mano todavía hay polvo.
El polvo que aleja a la muerte e invita a la decrepitud. Nuestra mano
está manchada con polvo, con motas de polvo. Por alguna razón,
que ya hemos olvidado, ese polvo es nuestra desgracia.
*
He ido a la caverna de la sibila. He preguntado por el futuro del ser
humano. La sibila contestó:
un dios vendrá para morir
y será más grande
que los inmortales
Después exhaló su último suspiro. O eso pareció, porque el
mundo, por un instante, quedó en silencio.

pliego16_finales.indd 85

15/09/2014 17:00:26

86

Flebas
Rodrigo Círigo

para evitar complicaciones
te sacaron los ojos con un hacha
mientras decían Tan alto y hermoso
pero tú
acostumbrado a morder sal
no te quejabas
ni siquiera cuando clavaron perlas
en tus órbitas como tiburones
murmurando Alto y hermoso Eres alto y hermoso
como un consuelo
una lamentación
dedicada a ellos mismos
porque no eras su semejante
no eras la roca ni la espuma
ni el milagro de sus gargantas
Alto y hermoso
Tan alto y hermoso

pliego16_finales.indd 86

15/09/2014 17:00:26

Andrónico (fragmento)
Mónica Perea

87

Andrónico se estrenó el 15 de septiembre de 2014, en el teatro El Milagro.
Dirección: Sixto Castro Santillán.
Diseños: Natalia Sedano.
Reparto: David del Águila, Isaí Flores, Jesús Iván García Montes, Gonzalo Guzmán, Sergio
Jaramillo, Cut López, Oscar Serrano Cotán.
Asistente de Dirección: Ulises Galván.

ii. ¿Qué hay para perder?
¿Qué es lo que engrandece a un hombre, Andrónico?
¿Son acaso los muertos que lleva en su espalda?
¿O son las batallas que gana sin que le importe otra cosa que vencer?
¿Sabes, siquiera, cuánto dolor cabe en el vientre de una madre?
Ningún hombre será capaz de sentir algo semejante.
Por eso pueden acabarse entre ustedes,
porque no saben del sufrimiento que implica engendrar una vida.
¿Cuánto dolor cabe en una guerra?
¿Cuántas vidas más van a perderse por el enemigo?
A veces, el enemigo está lejos, en otras tierras.
A veces, el enemigo está en tu propia casa,
en tu propia cama y duerme bajo tus sábanas.
¿Qué es lo que hace grande a un hombre?
¿Cuántos más van a seguir jugando a la guerra?
Y mientras ustedes juegan a matarse,
¿a qué jugamos nosotras?
Andrónico, tú que has perdido hijos en la batalla,
no me arrebates a éste de las manos.
Ten respeto por quien lo llevó nueve meses en el vientre.
Ten respeto por esta mujer
a quien sólo le quedan sus hijos.
v. Voz muda
Quisiera…

pliego16_finales.indd 87

Me gustaría decirles que fueron los hijos de Tamora.
Ella, que también es mujer, no tuvo compasión de mí.

15/09/2014 17:00:26

88

Esa arpía me entregó a sus hijos como premio por acabar
[con mi esposo.
El mismo que desafió a su propio hermano por tenerme a su lado.
Tan sólo por eso.
Quisiera gritar la verdad,
que el bosque entero compadezca a los nuestros,
que sea el desierto el que nos haga justicia,
que la sierra devore a ese par de hermanos doblemente malditos,
que las bestias de la selva devoren sus entrañas.
Acabaron con mi esposo,
cortaron mi lengua y saciaron su sed de mi cuerpo
al mismo tiempo que me ahogaba
entre los gritos mudos de mi propia sangre
que me escurría de la boca, bañando mis pechos.
Pechos separados por sangrienta humillación.
Primero Demetrio,
luego Quirón,
y los dos al mismo tiempo.
Moribundos perros hambrientos de carne.
Bestias que a plena luz del día
traicionan a quienes les han perdonado la vida.
Al tratar de defenderme, cortaron mis manos, padre.
Esas manos con las que aliviaba tus heridas cuando volvías
[de la guerra.
Las manos con que preparaba la comida que te ofrecía
[cuando estabas en casa.
Las manos que jamás conocieron cuerpo de hombre.
Las que nunca cometieron pecado alguno,
las que tampoco pudieron amar a Bassiano.
¡Mis manos, padre, mis manos!
Con las que desollaría a esos hermanos malditos.
Sabe Dios si al menos él me escucha.
Frente a ti, Andrónico, no puedo sino callar y, a tu lado,
llorar en silencio la desgracia que cayó sobre los nuestros.
vi. Una mano por dos cabezas
Tito Andrónico envió su mano al emperador.
Esa mano que tenía cientos de vidas terminadas.

pliego16_finales.indd 88

15/09/2014 17:00:26

La mano de diez años de victorias.
La mano que acarició a Lavinia cuando niña.
La mano que siempre alimentó a su familia.
La mano que trajo honores a los suyos.
La mano de innumerables enemigos muertos.
La mano que rechazó el poder.
La misma mano que prefirió a Saturnino.
Esa mano fue devuelta.

89

Marcio
Quinto
Una mano por dos cabezas.
Las de sus hijos degollados.

vii. Bastardo

Negro y bastardo.
El poder que lleva a los hombres a la ruina.
Negro y bastardo.
El hijo que desobedece a su padre.
Negro y bastardo.
El fruto de un amor prohibido.
Negro y bastardo.
El naciente primogénito de la ciudad.
Negro y bastardo.
El hijo engendrado por Tamora y Aarón.
Negro y bastardo.
El día en que Tito lo perdió todo.

viii. La venganza toca a tu puerta
Ladran los perros.

No muerden.
Todavía.

La Venganza toca tu puerta.
Desesperación.
¡Adelante!
Jamás llega sola.

pliego16_finales.indd 89

15/09/2014 17:00:27

Crimen y Violación.

90

Embriagarse de placer con esa reina.
Regodearse en sus hijos.
Recibirlos como reyes.
Honores merecen.
La reina Venganza se va.
Deja a sus hijos,
Crimen y Violación.
Ladran como perros.
ix. La cena está servida

Tito el loco, lo llaman.

No saben que está más cuerdo que nunca.
Crimen y violación.

Viste de chef.
Prepara la cena.
Crimen
Y
Violación

Con la mano que le queda, amasa los ingredientes.
Un banquete.
Un festín.
¿Qué se celebra?
Venganza es la señora de la fiesta.
Ladran los perros.
La cena está servida.
Todos los comensales a la mesa.
Andrónico mismo preparó todo con su única mano.
Rabiosos y hambrientos.
Los perros muerden la carne,
la trituran en su boca, la devoran
hasta hacerla llegar a sus estómagos.
¿Una reconciliación?

pliego16_finales.indd 90

15/09/2014 17:00:27

Crimen
Y
Violación

91

Crimen y violación son el plato fuerte.
¿Qué nos preparó Tito para el postre?
Venganza que se come al calor de la sangre
tan hirviente que quema la lengua.
Lengua que Lavinia no posee.
Tampoco tiene manos.
Despojada de su inocencia.
Es arrancada de lo único que le queda.
Gran emperador, según la leyenda,
¿Virginio hizo bien
en matar a su hija con su propia mano
por haber sido violada y deshonrada?
Hizo bien, Andrónico.
Ella no debía sobrevivir a la propia vergüenza.
Ni a la de su padre.
Tampoco debía propiciarle más dolor a su padre.
¿Satisfecho?

Razones poderosas.

¡Muere Lavinia!
¡Mueran contigo tu vergüenza
y el dolor de tu padre!
¿No se dignan a comer vuestras altezas?
¿Por qué?
¿Por qué mataste a tu hija, Andrónico?
No ha sido él,
fueron Quirón y Demetrio.
Perros de la noche.
De eso es la carne que devoraron.
Pestilente y repugnante carne de perro.
Alcanza a tu hijos, Tamora.

pliego16_finales.indd 91

15/09/2014 17:00:27

Venganza.

92

La cabeza de Tamora rueda por el piso.
Antes de que Tito pueda patearla
la suya le hace compañía segundos después.
Las cabezas quedan en el piso mirándose frente a frente.
x. Recapitulación
Tito ganó en la guerra.
La guerra acabó con Tito.
¿Cuántos hijos perdió Tito Andrónico en la guerra?
Veintidós.
¿Cuántos hijos perdió Tito Andrónico en la paz?
Dos de ellos por su propia mano.

Cuatro.

¿Qué extremidades se perdieron en esta obra?
Mano de Lavinia.
Mano de Tito Andrónico.
Lengua de Lavinia.
Tito ganó en la guerra.

¿Qué se ganó en la guerra?

Sangre de tu sangre derramada por tu pueblo.

La guerra acabó con Tito.

¿Qué se ganó en la paz?

Sangre de tu sangre derramada por los tuyos.
¿Cuándo ganaremos la paz?
Sangre de tu sangre como moneda corriente.
Derramada sin piedad.
Tito ganó en la guerra.
La guerra acabó con Tito.

pliego16_finales.indd 92

15/09/2014 17:00:27

3:23 - 4 :391
David Alejandro Martínez

Min.
3:23

—Leopoldo,2 ¿cómo va ese hígado? 3

Min.
3:25

—Pues muy mal y no estoy precisamente paranoico.a

El entrevistador toma un libro de la mesa,
abre la solapa y lee. Panero lleva un cigarro
a la boca y con su antena llameando
inspecciona la atmósfera. Se rasca, sorbe
un vaso en el que queda atrapado el insecto.

93

a. Huyendo de la muerte
encontré el ciervo de la
locura
irreal para perseguirlo con
mi desdicha
con mi desdicha concreta,
presente
en donde lavan sus pies los
dioses.

1. Entrevista de Fernando Sánchez Dragó para el programa Negro sobre Blanco
emitida el 26 de septiembre de 1999 con Leopoldo María Panero Blanc. Ver en:
http://www.youtube.com/watch?v=amKAfNVpIh8
2. Leopoldo Ma. Panero es un poeta.
Los poetas, como los perros, deben morder la piel / llevarse un buen trozo de
carne entre los dientes / si quieren sonreír y estar tranquilos. Calmar las encías.
Soñar / con que alguien les dé una palmada detrás de las orejas. / A Leopoldo
María Panero le gustan los hombres gordos / que se juntan alrededor de un asador
para hablar de deportes / los domingos; le gustan las mujeres que acarrean las
cervezas para esas reuniones. / Sus hijos: muchachos en trajes de Zara que aspiran
a ser abogados y doctores / con suéteres de lana. Le gustan los domingos porque
su dueño / hace carne asada y a él le toca algo más que los huesitos. / Hijo de perra,
poeta, que nos comería a todos sin dudarlo porque a Leopoldo / María Panero /
siempre le apetece / llevarse un trozo bueno de carne entre los dientes.
3. Prometeo yace desnudo, un águila cae del cielo contra el hombre, su carne
palpitante, el hígado. Propiedades curativas: cero. Al menos que sea de bacalao.
Castigo ejemplar para ayudarte a crecer. No se puede hacer mucho cuando eres
niño: cierro los ojos, me guardo; debajo de la cama tu cuerpo negro. He crecido
con las culpas de mis padres y por eso mi aliento agrio.
También existe otra explicación: Águila contra el hombre, título. Autor, Leopoldo.

pliego16_finales.indd 93

15/09/2014 17:00:27

94

Min.
3:30

—¿Cuántas Coca-colas4 bebes al día?

Min.
3:33

—No, no les digas Coca-colas que
tienen alcohol. El título de este libro
mío de cuentos de terror de las ediciones de Roger, viene de un verso que
hice, que dice cuando el veneno b entra
en sangre mi cerebro es una rosa.

Unge sus labios. Fernando Sánchez
Dragó mueve sus noventa y tantos kilos
de un lado a otro de la silla. Da nombres,
entrevistas y homenajes. Comienza una
pregunta que capta la atención de Panero
a la mitad.
Min.
4:26

b. Nada hay ya turbio
nada hay ya
parecido a la vida
ni un muslo de mujer, ya ni
una duda
nada hay ya
sino el poema como un
pus, como una ortiga
cercenando mi mano.

—…¿Ese ser a ratos no tiene que ver
con la locura? 5 ¿Cuándo eres más tú?

4. Primer principio del apocalipsis. No hay nada de malo en soltar los perros y
salir corriendo tras de ellos. Esto es la carrera absurda de la vida como quien se
apresura para entrar antes al vagón y salir después; como quien quiere ser amigo
de todos y no sabe que desaparecen al doblar la esquina; quien lleva los pantalones
puestos, la camisa remangada y cree (confundido por el entusiasmo) que conoce
todos los nombres de las calles; quien, llegado el momento, no se dará cuenta
de que lo primero que dejará de escuchar será el sonido de los refrigeradores y
entonces tanta carne y tanta Coca-cola serán la miel negra de un panal echándose
a perder en la boca.
5. Drama en un solo acto. / Acto único. // Escena 1 El quicio de la puerta para
perderse. La luz de un anuncio de neón: El Corazón Sagrado de Jesús. Restaurante
de comida china. —Quisiera ser pelirroja. Suerte de enano el día que cobra su
quincena. Mancha de Caín en una servilleta. —¿Lleva rollitos primavera su combo? Sanatorio / sanitario. Hotel por horas: televisión con cable, baño, cama
limpia. —Dos, por favor, para llevar. —Al final, en el recuerdo, nos reuniremos
en la misma ausencia. Sube las escaleras queriendo encontrar algo lustroso al
final del pasillo. Un filme porno detrás de la puerta. Ruido blanco. Aire blanco.
Sueltan un suspiro y descansa. Ponen en reversa la cinta. // Escena 2 Sala de
espera bien preparada. Cuatro máquinas de refrescos. Bajo ciertas circunstancias
lo último son las proteínas y los asientos cómodos. Los gorros de las enfermeras son
como barcos que están a punto de hundirse en un mar en calma. —¿Qué hacemos
aquí?, ¿qué estamos mirando? Un espectador de la tercera fila se levanta tapando
con su culo el zumbido de las balastras, entonces la iluminación es más débil. Se
llevan al paciente. // Escena 3 Tres actrices: una de ellas visiblemente más joven.
Las otras dos podrían ser la misma, pero la del cabello rojo está mojada. Una

pliego16_finales.indd 94

15/09/2014 17:00:27

Min.
4:29

—No creo en la locura. Al menos no creo en la locura como
una deficiencia orgánica, es
decir, como enfermedad. Creo
que es un proceso, son problemas
humanos que luego se transforman
en psiquiátricos. c En la calle nos
vuelven locos y en el manicomio nos
rematan el trabajo.

95

c. Mi pensamiento está
contra mí
y las águilas desgarran mi
pensamiento
que cae de mi boca
como los hombres
reptan a lo largo del verso.

—Sí, era Sherlom Homes. —No, era Cherlo Hom —la otra. —¡Ja, ja, ja, ja, ja! —la
más joven. —¡No! —una. La más joven —¡Bobita! —Sí, era el detective súper
famoso —la otra. —¡Inglés! —la una. La otra —Hablan en francés. La más joven
—¡Tú lo hiciste! La una —¡No, tú lo hiciste! ¡Tú lo hiciste! ¡Sí!— Entra el hombre en
cuestión. El juego: quién gana y quién pierde se repite una vez y otra. // Escena 4 El
colchón recubre la habitación. Alguien duerme. Pasan las horas. Se acomoda a uno
y otro lado: boca arriba, feto, sobre su brazo derecho, a sus anchas. Se oyen gritos
que no lo llaman, sigue dormido. Pasan dos, cinco días y él duerme. El pelo le crece,
la barba también. Un grito: su nombre. Despierta impetuosamente, se levanta y
acomoda una silla frente a la rendija de donde sale la mano de un dios enano.
Permanece inmóvil. Gritos. Horas, días y sigue sentado de la misma manera en que
abordó la silla por primera vez. No despega siquiera los labios. El pelo continúa
creciendo y la barba le sirve de bufanda en tiempo de invierno. Un viento frío se
cuela como lengüeta afilada. Si no tiene cuidado le cortará otro dedo. Se pone
rígido; de pronto otra pastilla naranja con su nombre. Reacciona y se acomoda
en el colchón, donde permanece como muerto, como lo ha venido haciendo. //
Escena 5 Televisión empotrada; el cable se atraviesa en la pared como el recorrido
de un insecto. Entre los cuatro m2 una cama limpia y dos cuerpos respirando con
dificultad. Primer principio agonal: no se puede ocupar el mismo espacio al mismo
tiempo. Se llevan las manos el uno al otro como lo harían el padre y el hijo en un
incendio queriendo calmar las llagas. Silencio prolongado. La ausencia se extiende.
La pared es blanca como la boca de los niños que guardan el vacío para escuchar
por el quicio de la puerta mientras juegan. En la pantalla, ceniza. // Escena 6 La
cordura es sólo la ilación de eventos aislados, quizás, que en un contexto familiar,
inmediato, nos parece la natural respuesta a éste o aquél acontecimiento.

pliego16_finales.indd 95

15/09/2014 17:00:27

Colaboradores
Dulce Alcántara (DF, 1988) Participó en el 9º
Festival Latinoamericano de Poesía “¡Ser al fin una
palabra…!” (2013). Ha publicado en Katharsis xxi,
Infame, mis C lánea y las Memorias del Festival.
Marina Azahua Ensayista, historiadora y
traductora. Su libro más reciente es Retrato
involuntario. El acto fotográfico como forma de
violencia (Tusquets, 2014).
Herson Barona (DF, 1986) Fue una joven promesa
rota, porque ya ni siquiera es joven y ha dejado de
prometer, aunque sigue estando roto. Actualmente
es jefe de redacción de la revista Tierra Adentro.
Bernardo Barrientos (DF, 1987) Criado por una
mujer que considera el confinamiento solitario
como una forma de vida completamente natural,
no le busca ruido al chicharrón. Ama la lucha libre
mexicana, el barrio y la literatura.
Salvador Calva Carrasco (Guerrero, 1985) Poeta
diletante, narrador por insistencia. Actualmente
espera la publicación de su primer libro de cuentos:
Personajes.
Rodrigo Círigo (DF, 1992) Poeta y traductor.
Ganador del concurso 39 de Punto de Partida en
traducción literaria. Dos veces becario de poesía en
el Curso de creación literaria de la f,l,m. (Xalapa).
Su poesía se incluyó en Telescopio: Antología de
escritores nacidos en los noventa.
Samuel Espinosa Mómox (Puebla, 1985) Ha
sido beneficiario del Programa Jóvenes Creadores
del FONCA y del PECDA en el área de poesía.
Actualmente es becario de la f,l,m. en el área de
poesía.
Jorge Gutiérrez Reyna (Monterrey, 1988)
Licenciado en Lengua y Literatura Hispánicas por
la UNAM. Ha publicado su trabajo en la antología
Familiaridades / Extrañamientos. Muestra de literatura joven de México y en las revistas Fundación
y Este País.
Jorge Luis Herrera Licenciado en Historia del Arte
y maestro en Letras Mexicanas. Ha colaborado con
textos y fotograf ía en múltiples libros, suplementos
culturales y revistas. Ha publicado Voces en
espiral. Entrevistas con escritores mexicanos
contemporáneos y Cuando estés en el cielo.
Lola Horner Narradora y ensayista. Ha publicado
textos en diversos medios electrónicos e impresos.
Su novela Pócimas contra el divorcio resultó
seleccionada en la primera convocatoria Edebé
para publicación infantil y juvenil.

pliego16_finales.indd 96

Arturo Loera (Chihuahua, 1987) Autor de los
libros El poema vacío (ICM/CONACULTA, 2013)
y Cámara de Gesell (Premio de Poesía Editorial
Praxis, 2013).
Ana Laura Magis Weinberg Lectora, traductora,
y escritora. Estudió Letras Inglesas en la UNAM y
fue becaria en el área de narrativa de la f,l,m. Sus
obras se han publicado tanto en papel como en
línea (http://lauramagis.wordpress.com).
Demian Marín (Toluca, 1979) Ha perdido gran
parte de su vida viendo películas y jugando cualquier
cantidad de juegos con reglas preestablecidas.
Escribe morbo y para tener groupies por todo el
mundo.
Javier Márquez (DF, 1987) Teatrista y docente. The
Jöker Jack. La última carcajada de Heath Ledger
(Premio Nacional de Dramaturgia Joven G.M.C.,
2012). Caín (Premio a Mejor Obra. Festival Nacional
e Internacional de Teatro Universitario, 2011).
David Alejandro Martínez (1987) Estudió
literatura en Chihuahua, de donde es originario.
Escribe crítica literaria, ensayo y poesía. Becario
de investigación de la f,l,m.
Mariana Oliver (DF) Estudió la maestría en
Literatura Comparada en la UNAM; es editora de
la sección literaria de la revista Cuadrivio y becaria
de la f,l,m.
Mónica Perea (Estado de México, 1986)
Dramaturga, productora, docente y directora
de Teatro en bici. Cursó la carrera de Literatura
Dramática y Teatro en la UNAM. Beneficiaria
FOCAEM de dramaturgia en 2010 con la obra
Tláloc y Chaak. De cómo el mundo se quedó sin
agua.
René Rueda (Chilpancingo, 1984) Estudió Letras
Hispánicas en la UAM-I. Becario de la f,l,m. en el
área de narrativa.
Santiago Ruiz Velasco (DF, 1983) Estudió
Matemáticas y Letras Hispánicas en la UNAM. Se
ha fogueado, a falta de becas, en talleres literarios
de prestigio y el hondo bajofondo donde el barro
se subleva. Ha colaborado en varias revistas
nacionales, un libro colectivo y antologías. Se le
encuentra en @s_ruizvelasco, si se le busca.
Haydeé Salmones (DF, 1989) Alguna vez estudió
literatura y fue rescatista de autores decimonónicos
en la UNAM, pero hoy tiene una pug y se
desempeña como ángel del hogar. Es becaria de la
f,l,m. en el área de narrativa.
Érika Téllez (DF, 1988) Poeta y narradora.

15/09/2014 17:00:27

Sign up to vote on this title
UsefulNot useful