Está en la página 1de 182

UNIVERSIDAD AUTONOMA DE COAHUILA

FACULTAD DE CIENCIAS QUIMICAS

BIOLOGIA MOLECULAR
ALUMNA: KRLA JOSEFINA SANTAMARIA LOPEZ
SEXTO SEMESTRE
QFB
ENERO-JUNIO 2014

Resumen
La pirosecuenciacin es un mtodo de secuenciacin de ADN basado en la monitorizacin a
tiempo real de la sntesis de ADN. Esta tcnica se conoce desde hace algunos aos, pero gracias al
impulso dado al desarrollo de nuevas tecnologas de secuenciacin ms eficientes y baratas se han
conseguido una serie de mejoras que han hecho posible la aplicacin de esta tcnica para la
secuenciacin a una escala genmica y con bajo coste. Existen varias tecnologas basadas en los
principios de la pirosecuenciacin, uno de ellas es el sistema GS FLX de Roche que a continuacin
describimos como ejemplo.
Concepto
Un aspecto importante de esta tcnica es que todos los pasos se realizan in vitro, a
diferencia de la tecnologa Sanger. Esta tcnica comienza con el procesado y adaptacin
del ADN para obtener una librera de pequeos fragmentos monocatenarios. Lo primero es
fragmentar el ADN a secuenciar mediante un proceso fsico conocido como nebulizacin
donde el ADN se rompe en fragmentos de 200 a 800 pares de bases aproximadamente.
Posteriormente, mediante protocolos estandarizados de biologa molecular, se aaden dos
pequeas secuencias adaptadoras a cada fragmento de ADN obtenido en la nebulizacin.
El adaptador A y el B. Las secuencias adaptadores estn diseadas para cumplir funciones
en los pasos de seleccin, amplificacin y secuenciacin.
El siguiente paso es seleccionar los fragmentos de ADN a los que se han unido
correctamente los adaptadores. Para esto, los fragmentos de ADN se unen a unas esferas
especiales por la parte 3 del adaptador B. Esta unin no es por complementariedad de
bases. Los fragmentos que solo contengan adaptador A no se unirn a las esferas y son
eliminados y los que contengan dos adaptadores B se unirn por dos puntos. Los
fragmentos de doble cadena unidos a estas esferas son sometidos a alta concentracin de
NaOH que provoca la separacin de las cadenas simples. Si el fragmento tiene dos
adaptadores B se separarn las cadenas pero ambas permanecern unidas a las esferas.
Como resultado de este sencillo proceso se liberan de las esferas los fragmentos de
cadena simple que tienen un adaptador de cada clase con el B situado en el extremo 5
del fragmento, ya que los fragmentos complementarios a estos permanecern unidos por
el extremo 3 del adaptador B.
Para el proceso de amplificacin, los fragmentos libres de cadena simple se unen a otras
esferas que tienen un gran nmero de secuencias complementarias del adaptador A. Esta
unin est optimizada para que solo se una un fragmento a una esfera. Una vez unidos los
fragmentos a las esferas se introducen en una emulsin de agua y aceite de forma que
cada esfera quede dentro de una gota con todos los reactivos y encimas necesarios para la
PCR. Tras una serie de termociclos de PCR se habrn generado en cada esfera un gran
nmero de secuencias de doble cadena idnticas y unidas por el adaptador A. De nuevo,
las esferas son sometidas a alta concentracin de NaOH para separar las cadenas
complementarias. El resultado es que cada esfera tiene adherido a su superficie un gran
nmero de cadenas simples idnticas unidas por el extremo 3.

Antes de empezar la secuenciacin en s misma se aaden cebadores complementarios al


adaptador B en posicin 5, ADN polimerasas y los cofactores necesarios para la sntesis
de la cadena complementaria a los fragmentos unidos a las esferas.
El siguiente paso es cargar las esferas en un dispositivo conocido como PicoTiterPlate
que es el que se introduce en el secuenciador. Este dispositivo consta de ms de un milln
de pocillos de 44 micras de dimetro de forma que solo quepa una esfera con fragmentos
de ADN por pocillo. Adems de las esferas con ADN, se introducen otro tipo de esferas que
contienen las enzimas necesarias para detectar la incorporacin de nucletidos durante la
sntesis de la cadena complementaria.
Estas enzimas son la sulfurilasa y la luciferasa. La sulfurilasa genera ATP a partir de
pirofosfato y la luciferasa se transforma en oxiluciferina en presencia de ATP con emisin
de luz. De esta forma se construye una cascada enzimtica que empieza cuando la ADN
polimerasa incorpora un nucletido a la cadena creciente complementaria del ADN a
secuenciar liberando un pirofosfato y termina cuando la luciferasa emite luz.
Una vez cargadas las esferas con ADN y las esferas con enzimas, el PicoTiterPlate se
introduce en el secuenciador. El secuenciador automatiza el proceso de secuenciacin, la
captura de imgenes y su interpretacin. El secuenciador vierte automticamente sobre
los pocillos los reactivos necesarios y un tipo de nucletido cada vez. As de forma cclica
se irn vertiendo As, Cs, Gs y Ts. En cada pocillo, la ADN polimerasa aadir uno o ms
nucletidos dependiendo de la secuencia que acta como molde y se emitir luz con una
intensidad proporcional al nmerro de nucletidos incorporados a la nueva cadena que se
va sintetizando durante el proceso de secuenciacin. El secuenciador consta de un sistema
ptico especial que recoge el patrn de destellos luminosos que se emiten en el
PicoTiterPlate. Mediante programas informticos se interpretan estos patrones de luz y
se generan unas grficas que indican si ha habido incorporacin o no de nucletidos y su
nmero.
Despus de esto se lava el exceso de nucletidos y reactivos y se repite el proceso con
otro tipo de nucletido de forma cclica hasta que finalice la sntesis de una cadena
complementaria a la cadena que acta como molde. El resultado es la secuenciacin de los
fragmentos que hay en cada pocillo.
En los adaptadores hay unas secuencias conocidas que sirven para calibrar los aparatos de
recepcin e interpretacin de imgenes. Uno de los defectos de este sistema es la prdida
de precisin en las regiones homopolimricas.
La posibilidad de automatizar y de paralelizar el proceso de secuenciacin que ofrece esta
tcnica es una de las principales ventajas frente a otros mtodos de secuenciacin. La
pirosecuenciacin permite la secuenciacin de grandes cantidades de ADN en menos
tiempo que otras tcnicas y con un coste menor.

4.1 Introduccin

La evaluacin de la inocuidad de los alimentos derivados de animales MG se


debe fundamentar en la comprensin de los mtodos de transgnesis y en las
aplicaciones previstas y los resultados posibles de la integracin y expresin
de los transgenes. Sobre esta base, la Consulta examin los posibles peligros
de la expresin de los transgenes para los animales y para los aspectos
ecolgicos relacionados con la salud humana. La Consulta tambin examin
las perspectivas futuras de la evolucin, utilizacin y supervisin de la
transgnesis con fines de produccin animal para el consumo humano.
La Consulta observ asimismo que se estaban obteniendo insectos
modificados genticamente, aunque por el momento no para la produccin de
alimentos. Aunque las cuestiones planteadas por los insectos modificados
genticamente requeran un debate, quedaban fuera del mbito de esta
Consulta de expertos.
4.2 Tcnicas y aplicaciones

4.2.1 Tcnicas
Para la transferencia de genes a animales se pueden utilizar varias tcnicas
(Houdebine, 2003). Difieren en su idoneidad para distintas clases de animales,
su eficacia de transformacin y sus repercusiones para la evaluacin del
riesgo.
La utilizacin del mtodo de transferencia de genes depende del conocimiento
de un gen codificador de un producto que confiera un rasgo de inters. El gen
que se debe transferir se incorpora a un vector de expresin que tambin
contiene elementos genticos para controlar su expresin. El uso de distintos
tipos de vectores de expresin ofrece ventajas metodolgicas para distintas
clases de animales y tambin afecta a la probabilidad de que se materialicen
peligros genticos o inmunolgicos posteriores. Los biotecnlogos pueden
transferir deliberadamente a un husped un:

Gen de fusin: Un gen que codifica un producto de inters con un elemento que regular
su expresin en el husped.
Transposn: Un elemento de ADN capaz de escindirse de un lugar del genoma e
insertarse en otro lugar, que se ha modificado para contener el gen de fusin.
Retrovirus: Un virus que se puede integrar en el genoma y expresarse por medio de los
procesos de replicacin de la clula husped y que se ha modificado para contener el gen
de fusin.

Muchos vectores de expresin contienen genes marcadores. Algunos genes


marcadores son simplemente informadores para la transferencia eficaz de un
gen, mientras que otros codifican productos gnicos, de manera que se

pueden seleccionar individuos transgnicos, por ejemplo mediante la aplicacin


de antibiticos.
Los mtodos habituales para la introduccin de un vector de expresin en el
husped son los siguientes:

Microinyeccin: Inyeccin directa del vector de expresin en vulos fecundados o clulas


husped utilizando una aguja fina de vidrio.
Electroporacin: Introduccin del vector de expresin en vulos fecundados o clulas
husped mediante la aplicacin de impulsos elctricos para inducir poros transitorios en la
membrana de las clulas husped.
Bombardeo de partculas: Fijacin del vector de expresin sobre partculas de oro e
introduccin en las clulas husped mediante el bombardeo con las partculas.
Transformacin celular, seguida de clonacin: Dado que es ms sencillo aadir genes a
clulas cultivadas o inactivarlos en ellas que con los vulos fecundados, los ncleos de las
clulas transformadas con xito se pueden transferir a vulos enucleados e implantarlos en
hembras receptoras para generar animales clonados de clulas somticas, que tambin
son transgnicos.
Transformacin de gametos: Se pueden introducir genes en oocitos o espermatocitos y
utilizar los gametos transformados para la fecundacin, generando un animal completo.

La aplicacin de cualquiera de estos mtodos dar lugar a la transformacin


eficaz de un pequeo porcentaje de los animales as producidos. Luego se
pueden identificar los individuos transgnicos y reproducirlos para obtener una
lnea transgnica.

Principales Criterios

Tamao

Tamao ideal: 20-25 nucletidos de


longitud
generalmente: 18-30 nucletidos de
longitud

Base en el extremo 3'

Debe ser una G o una C

Temperaturas de
fusin (Tm)

50-65 C

contenido GC

40-60%

autocomplementariedad

Debe ser evitada


Para minimizar la formacin de
estructuras secundarias y los dimeros
de primer

Similaridad

Debe tener un 100% de


apareamiento con el molde

Cebadores para PCR o para Secuenciacin


PCR:

Cuando el objetivo a amplificar es un locus, la posicin de los


iniciadores debe ser relativa a los codones de inicio y
terminacin. Es recomendable que el cebador "forward" se
encuentre mas o menos a 35 pb del inicio de la secuencia que
codifica, de la misma forma el cebador "reverse" debe
localizarse 35 pb despues de la regin que codifica.

SECUENCIACIN

Cuando el objetivo es obtener la secuencia de ADN es


recomendable que los cebadores se localicen por lo menos 50
pb antes de la regin que se desea secuenciar, esto para el
cebador "forward" cuando hay uno, y 50 pb despues de la
regin a secuencias para el cebador "reverse", cuando hay uno.
Es importante que el fragmento a secuenciar no sea muy
grande, debido a que los errores de lectura de secuencia
aumentan cuando los fragmentos son grandes, si es necesario
secuenciar un fragmento muy largo, es conveniente disear
cebadores internos, para obtener la secuencia en dos partes y
luego ensamblarla.
Temperatura de Asociacin

La temperatura de asociacin de los cebadores es uno de los


factores mas determinantes de la reaccin. Se recomienda que
se emplee como temperatura de asociacin la temperatura de
fusin -5C, aproximadamente. Existen muchos mtodos para
calcular la temperatura de fusin, pero siempre, despues de
efectuado el clculo es necesario ir al laboratorio y ensayar con
diferentes temperaturas de asociacin cercanas a la
temperatura de fusin para determinar la temperatura ptima
para cada reaccin.
Clculo de la temperatura de fusin (Tm) (2)

Existen muchos mtodos para estimar el valor de la


temperatura de fusin.
Para secuencias de 20 bp o menos, existe la siguiente
aproximacin:
Tm = 2C (A + T) + 4C (G + C)
donde se asume una concentracin de sal de 0.9M, tipica de
"dot blot" y otros ensayos de hibridizacin
A continuacin tenemos otra expresin para el calculo de Tm

Tm = 81.5 + 0.41(%GC) - 500/L + 16.6 log[M],


donde L se refiere a la longitud del oligonucletido, y [M] es la
concentracin de cationes monovalentes. Esta frmulas es
unicamente aplicable a asecuencias polinucleotidicas largas.
El mtodo mas preciso para estimar la Tm de oligonucletidos
est basado en el anlisis termodinmico del proceso de fusin
del cual se puede mostrar que,

Los cambios en la entalpia(


) y la entropia( ) de la
formacin del duplex se calculan a partir de parametros
termodinmicos de vecindades. R es la constante molar de los
gases (1.987 cal.K-1mol-1), y C es la concentracin molar del
oligonucleotido. Se puede adicionar un secundo trmino a la
ecuacin anterior para tener encuenta el efecto estabilizante de
la sal sobre el duplex:

Los efectos de Na+ y K+ son equivalentes dentro de los


margenes del error experimental.

HISTORIA
El desplazamiento de sustancias bajo la accin de un campo
elctrico fue citado por Reuss en 1809 en las memorias de la
Sociedad Imperial Natural (Moscow) (1809) 1.
All se describe la experiencia de la fig. 1, donde se observa el
comportamiento migratorio de pequeas partculas de arena en
un mbito de agua transparente contenido en un recipiente de
vidrio con un lecho de arena fina en su fondo y dos tubos
conteniendo electrodos de una batera.
El pasaje de la corriente produce un enturbiamiento en las
proximidades del polo positivo producido por la migracin de
partculas de arena muy pequeas que se movilizan por su carga
elctrica negativa.
Este experimento puede ser considerado como el primer
aporte bibliogrfico que revela la polarizacin de la slice, pues la
arena es dixido de silicio y fundida permite obtener los capilares
que se emplean en la electroforesis capilar.
Varios aos ms tarde, en 1816, fue observado el transporte
del agua por accin de la corriente galvnica generada por la
polarizacin negativa del capilar que une los dos recipientes
electrdicos.
La pared del capilar, sabemos hoy, adquiere carga negativa (al
pasaje de la corriente elctrica) producindose la polarizacin del
agua, la que por consiguiente tiende a desplazarse hacia el polo
negativo. Esta corriente lquida que se desplaza en sentido opuesto
a la direccin de la corriente elctrica, se designa con el nombre de
Fuerza electroendosmtica (FEO) (fig. 2)
Definicin de electroforesis

BIOQUIMIA VOL. 25 NO. 1 - 98 - 2000

Ha sido definida como el movimiento o desplazamiento


diferencial de especies cargadas (iones), sustancias neutras o
migracin pasiva, por atraccin o repulsin en un campo elctrico.
La electroforesis en solucin en medios libres sin elementos
soportes (agar, almidn, geles de poliacrilamida), fue desarrollada
por Tiselius 2, 3, el que resolvi mezclas de protenas en un tubo
aplicando un campo elctrico de corriente continua, no pulsante,
estudios que lo hicieron acreedor al Premio Nobel en Qumica.
Los problemas experimentales que se presentaron, estuvieron
vinculados a la difusin trmica y a la conveccin, lo que determin
el empleo de medios anticonvectantes como agar, agarosa y
poliacrilamidas en forma de geles.
Las tcnicas que ms se han desarrollado estn en la actualidad
aplicadas al campo de las protenas y productos de la biologa
molecular, como son los geles de agarosa y proliacrilamida en
placas o films de distinto espesor verticales u horizontales 4 (fig3).

Figura 1. Migracin de las partculas de slice

14

Figura 2. Fuerza electroendosmotica

Figura 3. Distintos tipos de electroforesis

Electroforesis capilar
El empleo de capilares para la separacin de sustancias neutras o
iones cargados elctricamente, apareci en 1967 en una experiencia
desarrollada por Hjerten empleando capilares milimtricos, los
que eran rotados a travs de su seccin longitudinal para evitar
los efectos de la conveccin.
Virtanen y Mikkers en 1979 desarrollaron las separaciones
empleando electroforesis en capilares de 200 m de dimetro
interno en vidrio y tefln respectivamente.
La separacin de cloruro, aspartato y glutamato por
isotacoforesis, hecha por Martin en 1942, los trabajos de
Konstantinov, Oshukova en 1963 y los de Evereast en su tesis
de graduacin en 1964, fueron los precursores en el empleo de
capilares y la medicin de la absorcin UV a travs del mismo,
permiti obtener los espectros caractersticos de la separacin 5.
Ms adelante, en 1980, Jorgenson y Lukacs empleando tcnicas
avanzadas en la obtencin de capilares de slica fundida emplean
dimetros de 75m y Jorgenson clarifica tericamente las
relaciones entre los parmetros operacionales y las cualidades de
la separacin revelando el elevado potencial analtico de esta tcnica.
Esta separacin de pptidos realizada sobre un capilar de slica
fundida a potenciales elevados 20 a 30 Kv en un campo de 400 a
500 v/cm refrigerados por aire, fue el lanzamiento de la EC 6.
Estos capilares de 75 a 100 cm de largo y con dimetros
internos de 50-70-100 m y de 300 a 400 de dimetro externo
son los que permiten una capacidad elevada de resolucin
N>200.000 platos/m.

La corriente electroendosmtica (FEO) generada por los grupos


silanol de la superficie interna del capilar da como resultado una
corriente plana del frente del lquido que contrasta con el frente
parablico de la cromatografa lquida de alta resolucin (fig. 4).
La ventaja de esta tcnica es que el capilar de slica fundida que
generalmente se cubre con una capa de polimina para darle mayor
rigidez y resistencia, tiene una ventana a travs de ella que permite
el pasaje de la luz UV de tal manera que la visualizacin es on-line.
Con esta tcnica descrita es posible separar cationes, aniones,
protenas, macromolculas y sustancias no cargadas en forma
simultnea.
Breves nociones tericas
La separacin por electroforesis est basada en la diferencia de
velocidad de los solutos en un campo elctrico. La velocidad de
un ion est dada por
v = e E (1)
donde:
v : velocidad inica
e : movilidad electrofortica
E : campo elctrico
Existe una relacin entre el voltaje aplicado y la longitud del
capilar en volts/cm, la movilidad de un in es una constante, la
que puede ser determinada por el coeficiente friccional a travs de
un medio elegido.
e x

fuerza elctrica (FE)

En el estado estacionario, las fuerzas son iguales y opuestas:


qE=6rv
(5)
q E = 6 r v e E
e=

qE
6 rE

e=

q
6 r

Con lo expuesto queda en evidencia que especies altamente


cargadas tienen movilidades elevadas.
La movilidad electrofortica se le encuentra usualmente en las
tablas de constantes fsicas.
Corriente electroendosmtica
El componente efector ms importante en la EC es la electroendosmosis o corriente electroendosmtica, o fuerza
electroendosmtica.
Surge como consecuencia de aplicar un campo elctrico que genera una doble capa elctrica entre la solucin y la pared del capilar.
En condiciones acuosas, la fase slida posee un exceso de
cargas negativas, como resultado de dos procesos fsico-qumicos,
la ionizacin de la superficie (que es un equilibrio cido-base) y
por otra parte la adsorcin de especies inicas sobre la superficie
del capilar.

(2)

fuerza friccional (FF)

La fuerza elctrica est representada en la siguiente ecuacin:


FE = q E

(3)

Y para un in esfrico la fuerza friccional est determinada por


la ecuacin:
(4)

Figura 4. Comparacin entre EC y HPLC

Figura 5. Desarrollo de flujo electroendosmtico


a) Superficie de slica fundida cargada negativamente (Si-O). b) Acumulacin de cationes hidratados cerca de la superficie. c) Flujo de cargas
hacia el ctodo luego de la aplicacin de un campo elctrico.

15

BIOQUIMIA VOL. 25 NO. 1 - 98 - 2000

FF = - 6 r v
donde:
q: carga inica
: viscosidad de la solucin
r: radio inico
v: velocidad del in

Estos procesos ocurren en el capilar al paso de la corriente


elctrica y la FEO se encuentra altamente controlada por los
numerosos grupos silanoles (SiOH) que tambin pueden existir
como SiO (fig. 5a).
Los crculos en grisado representan las molculas de slica
transformadas por hidratacin en silanoles en medio acuoso
cuando pasa la corriente elctrica (fig. 5b).
Los contraiones (cationes en la mayora de los casos) mantienen
el balance de cargas; ese potencial se llama potencial zeta. Cuando
se aplica el voltaje a travs del capilar, los cationes que forman la
doble capa elctrica migran hacia el polvo positivo (fig. 5 c).
Por consiguiente, la doble capa elctrica tiene un balance que
est a su vez en equilibrio con la pared que corresponde al
potencial zeta.
La magnitud de FEO puede ser expresada en trminos de la
movilidad y velocidad por la frmula siguiente:
VFEO = ( / ) E o
FEO = ( / )
donde:
VFEO: velocidad
FEO: movilidad FEO
: constante dielctrica
: potencial Z
A pH elevados los grupos silanol son desprotonados y la
FEO es significativamente mayor que a pH bajo donde son
protonados.
De la electroforesis en papel de filtro a la electroforesis
capilar 7

compuesto cargado positiva o negativamente ser hacia el ctodo


o el nodo segn acten las fuerzas (fig. 6).
Si consideramos un capilar de slice, el fenmeno es muy similar, pero la evaporacin es nula. En la pared del capilar, por pasaje
de la corriente elctrica se produce una capa elctrica negativa
(silanos) que condiciona la polarizacin del agua y
consecuentemente tiene lugar una corriente lquida en sentido
opuesto al campo elctrico aplicado.
La corriente lquida se transforma progresivamente en una
fuerza llamada fuerza electroendosmtica (FEO), que es
equivalente a la obtenida por accin de la bomba en Cromatografa
Lquida de Alta Presin (HPLC).
Esta corriente de lquido acta transportando a los compuestos
contenidos en el capilar, acorde a la carga elctrica que adquieren en
el campo elctrico (voltajes desde 20 a 50 V/cm).
El aparato para electroforesis capilar (EC)
Est constituido por una fuente de poder (FP) de alto voltaje (20
a 30 Kv) y de 0 a 200A, y un capilar de slica de 25 a 75 m de
dimetro interno y de 100 a 200 m de dimetro externo, el que
puede estar refrigerado por aire o lquido por efecto Peltier.
Los electrodos de platino se encuentran ubicados en el
recipiente que contiene el buffer, que adems de servir para su
contacto recibe los extremos del capilar.
El carrousel puede estar termostizado y contiene los buffers y
las muestras. Con un movimiento de ascenso y descenso puede
enviar cada una de las soluciones empleadas en la corrida al capilar
o a los recipientes electrdicos.
Los capilares de slica dejan pasar la luz ultravioleta visible a
distintas longitudes de onda, generando por arreglos de diodos,
los espectros para la identificacin de los compuestos separados
por electroforesis capilar (fig. 7).

BIOQUIMIA VOL. 25 NO. 1 - 98 - 2000

El papel de filtro es un conglomerado de fibras de celulosa que se


embeben en una solucin buffer: stas por su composicin
qumica, al paso de una corriente elctrica se polarizan
negativamente mientras que el agua se carga positivamente y migra
en sentido opuesto a la direccin de migracin de la corriente.
A esta corriente lquida, conocida como corriente
electroendosmtica, se suman o se oponen las corrientes de lquido
producidas por la evaporacin e (->) y e (< -), la migracin de un

Figura 6. Polarizacin de las fibres de celulosa ante el paso de una


corriente elctrica

16

Figura 7. Esquema de un aparato de electroforesis capilar

El explosivo avance de la electroforesis capilar se ha extendido


al rea biomdica, en el campo de las protenas, pptidos, ADN,
anlisis de lquidos de perfusin, monitoreo de drogas,
marcadores genticos tumorales y neurobioqumicos, drogas
xenobiticas, de abuso, y pericias forenses.
En el rea biofarmacutica, para el control de calidad de
productos farmacuticos y biotecnolgicos, quimioterpicos y de
estructura quiral.
En el rea de alimentos, se le aplica al fraccionamiento y
cuantificacin de aminocidos, hidratos de carbono, cidos
orgnicos, aditivos y contaminantes.
En el rea de control ambiental, permite la identificacin de
contaminantes y sus metabolitos, pesticidas, metales pesados e
hidrocarburos.
Como todo desarrollo de un rea analtica nueva, la
incorporacin de tcnicas acopladas como la espectroscopia de
masa, fluorescencia inducida por laser y otras variantes permiten
augurar un promisorio futuro.
Desarrollos tecnolgicos que contribuyeron a la EC
Seis desarrollos tecnolgicos han concurrido para el desarrollo
comercial de la instrumentacin, que constituye en la actualidad la
electroforesis capilar.
1. Los capilares de slica fundido revolucionaron la
cromatografa gaseosa (CG) y han producido la cmara de
separacin de la electroforesis capilar.
2. La disponibilidad de fuentes de potencia de alto voltaje 20 a
30 KV, altamente estabilizadas y automatizadas para el
mantenimiento estable de la tensin y corriente.
3. Los detectores desarrollados para la cromatografa lquida
de alta performance (HPLC), de absorbancia de alta
sensibilidad pudieron ser aplicados con modificaciones
pticas al tubo capilar.
4. Los desarrollos obtenidos por la electroforesis en geles
de tamizado molecular como los de poliacrilamida, agarosa
y otros, en las tcnicas de la separacin de protenas.
5. El desarrollo de los anfolitos, obtenidos por copulacin
del cido acrlico y las polietilen poliaminas que han permitido
generar ambientes de pH continuos y estables, donde se logra
separar protenas de puntos isoelctricos muy prximos.
6. El anlisis computacional aplicado a la resolucin de productos
obtenidos por separacin por HPLC o CE que pueden ser
estudiados, espectralmente a travs de software para tal fin.
ELECTROFORESIS CAPILAR: VENTAJAS
Las separaciones se realizan empleando mecanismos tradicionales,
en un mbito capilar, que adems ofrece ms facilidad y velocidad
que la cromatografa lquida de alta performance (HPLC).
Mientras elimina el problema de los solventes de la HPLC, la
toxicidad de los mismos y su costo, pues emplea soluciones
acuosas en su gran mayora con muy baja concentracin inica,
incorpora los principios de la automatizacin a travs de un hardware creado especialmente con un software altamente optimizado.
Las separaciones se obtienen en pocos minutos, on line con la

corrida, obtenindose simultneamente resultados cuantitativos, en


oposicin a los procedimientos tradicionales que utilizan horas o das.
VOLUMENES EMPLEADOS
El empleo de microvolmenes y la rapidez de la EC en oposicin
a la HPLC, consumiendo microlitros de muestra y volmenes
del orden de los nanolitros para las soluciones electrolticas, la
hacen una tcnica altamente verstil y econmica.
INSTRUMENTACION
Los aparatos desarrollados por la industria instrumental recin
aparecieron en 1988, y el primer simposio internacional del ao
siguiente, permiti mostrar los avances extraordinarios de este
logro analtico.
Los aparatos comerciales de EC comprenden dos
compartimentos electroforticos unidos por un compartimento
que contiene un capilar, a una fuente de alta tensin de 20 a 30 kv,
el que es sometido a la luz UV con un detector unido a un
registrador, que grafica las diferencias de absorbancia; a un sistema
de administracin de datos. Las terminales de salida permiten,
por su conexin, el registro del voltaje, tiempo de corrida, y
registro de la temperatura del capilar, a travs de un software que
est incluido en una workstation computarizada (fig. 8)

Figura 8. Carrusel para muestras en una EC

PRINCIPIO FISICOQUIMICO
Las molculas son separadas por las fuerzas del campo elctrico
aplicado. Recordemos que la electroforesis ha sido definida como
el movimiento diferencial de especies cargadas (iones) o no, por
atraccin o repulsin en un campo elctrico.
Las muestras separadas en el capilar son monitoreadas por el
detector (fig. 9)
Los picos del electrograma son similares a los de la HPLC, y se
generan como consecuencia de la concentracin de los analitos y
de su velocidad de migracin (fig. 9 bis).
Las muestras son introducidas en el capilar por electroforesis
o por electrocintica, o por desplazamiento por inyeccin.
Durante la inyeccin electrofortica, el capilar est sumergido
en la muestra y se aplica el alto voltaje.
Los iones de la muestra migran dentro del capilar en relacin
a sus movilidades electroforticas.
Si la fuerza inica de la solucin muestra es ms baja que el
buffer electrofortico, los cambios en el campo elctrico de la interfase

17

BIOQUIMIA VOL. 25 NO. 1 - 98 - 2000

Aplicaciones

I1I SIMPOSIO CIENTFICO EN BIOLOGA CELULAR Y MOLECULAR

pueden expresarse o no (DNA repetitivo, pseudogenes, etc.), por lo que


representan mejor al conjunto del genoma.
Otro aspecto importante es la naturaleza selectiva o neutra de los
marcadores. Por qu se insiste tanto en la ventaja de ser neutros respecto a la
seleccin natural?. La razn es tanto tcnica como metodolgica. Es un hecho
que es prcticamente imposible estimar la intensidad de la seleccin natural
sobre caracteres concretos en la propia naturaleza, fuera de los experimentos
controlados en el laboratorio, y mucho menos deducir cul fue en el pasado la
intensidad de sta (Endler, 1986). Todo ello lleva frecuentemente a un
razonamiento tautolgico: de acuerdo con los principios de la seleccin natural
aquellas alternativas favorecidas aumentarn su frecuencia, por ello todo gen
frecuente tiende a suponerse como selectivamente ventajoso; la tautologa
proviene de olvidar que los cambios en las frecuencias gnicas pueden
producirse por causas distintas a la seleccin. La evolucin puede producirse por
causas diferentes a la seleccin natural. Por tanto si es difcil saber en algunos
casos si un gen es adaptativo o no y siempre es extremadamente difcil estimar la
seleccin natural, es obvio que cualquier modelo que incluya este parmetro es
difcilmente comprobable experimentalmente. Sin embargo, para alternativas
selectivamente neutras (total o prcticamente neutras) los modelos estadsticos
que predicen su cambio no incluyen este parmetro, son de ms fcil aplicacin
y, fundamentalmente, permiten probar la hiptesis de su neutralidad. De hecho,
aunque a mediados de los 60 se haban desarrollado ya muchos modelos tericos
sobre la dinmica de los genes en las poblaciones, estas teoras eran usadas
raramente para interpretar los datos experimentales excepto en contadas
ocasiones. La situacin cambi abruptamente cuando se dispuso de datos
moleculares sobre el cambio evolutivo de los genes. Desde entonces las teoras
se usan profusamente para probar hiptesis alternativas sobre los mecanismos de
evolucin. La interaccin entre la teora y los datos ha estimulado el trabajo en
nuevas teoras matemticas sobre la evolucin molecular y la gentica de
poblaciones, que a su vez pueden usarse en la comprobacin de hiptesis. De
particular importancia ha sido el desarrollo de teoras para probar la hiptesis
nula sobre las mutaciones neutras (Nei, 1987). Los marcadores moleculares
incluyen todo tipo de secuencias: aquellas que son claramente adaptativas,
alternativas allicas neutras que no afectan la secuencia proteica codificada,
secuencias sin funcin (DNA repetitivo, pseudogenes, por ejemplo) que pueden
cambiar libremente, etc.

3.

MARCADORES MOLECULARES:
CARACTERSTICAS Y LIMITACIONES

Los marcadores moleculares de uso generalizado pueden clasificarse en


funcin de la tcnica empleada para la obtencin de los segmentos discretos de
DNA: aquellos que se obtienen tras la fragmentacin del genoma
correspondiente con endonucleasas de restriccin (restrictasas), y aquellos que
se obtienen por amplificacin selectiva de secuencias mediante la reaccin en
cadena de la polimerasa (PCR, polymerase chain reaction). En algunas tcnicas

250

Marcelino Prez de la Vega

se combinan estos dos procedimientos bsicos. Los polimorfismos obtenidos por


el primer procedimiento son conocidos como polimorfismos de longitud de
fragmentos de restriccin (RFLP, restriction fragment length polymorphisms).
En este caso los fragmentos discretos de DNA generados por una restrictasa s~m
separados por electroforesis en gel, visualizndose selectivamente determinados
fragmentos mediante la hibridacin con sondas marcadas. En el segundo
procedimiento se utilizan cebadores particulares en cada caso para amplificar por
replicacin selectiva segmentos discretos de DNA. En ambos casos podemos
visualizar polimorfismos de segmentos annimos, cuya secuencia, funcin y
naturaleza nos son desconocidas, o segmentos conocidos, genes conocidos o
parte de ellos, secuencias repetidas, etc. Ello depende de la utilizacin de sondas
o cebadores annimos, elegidos al azar entre miles posibles simplemente porque
generan un buen polimorfismo, o que corresponden a secuencias cuya naturaleza
conocemos.
Tanto en estudios tericos de tipo evolutivo como en la utilizacin
prctica de los marcadores moleculares es importante conocer dos de sus
caractersticas: el carcter dominante o codominante de cada tipo de marcador, y
el nivel de polimorfismo que genera. El carcter domnate o codominante
determina el nivel de facilidad con que pueden llevarse a cabo estimaciones de
parmetros genticos y evolutivos tan bsicos y de uso generalizado como, por
ejemplo, frecuencias de recombinacin, distancia de mapa, heterocigosidad,
distancia evolutiva, etc. El nivel de polimorfismo, y tambin la naturaleza del
propio marcador, determina su utilidad en funcin del conjunto de organismos a
estudiar. As, por ejemplo, un marcador que genere un nivel bajo de
polimorfismo puede ser til para estudiar especies o gneros dentro de una
familia, pero ineficaz para estudiar diferencias entre individuos de una misma
poblacin o entre descendientes de un cruzamiento. Esto ltimo es fcil de
comprender, si un marcador es poco polimrfico la mayora o todos los
individuos de una poblacin o especie tendrn el mismo fenotipo, lo que lo hace
poco til para diferenciar poblaciones o individuos.
Segn Lewontin (1974), inferir la historia de las poblaciones o razas y
obtener informacin sobre los procesos genticos de la especiacin requiere la
estimacin de frecuencia gnicas. La teora de la Gentica de poblaciones es un
ejercicio abstracto a no ser que se puedan determinar las frecuencias de alelos
alternativos en varios loci, en diferentes poblaciones y en momentos diferentes
de la historia de una poblacin. Hoy da disponemos de las tcnicas adecuadas
para poder hacerlo, pero es obvio que la estimacin de las frecuencias gnicas es
ms precisa en genes codominantes que dominantes. Con los primeros los
genotipos se observan directamente y la conversin de las frecuencias
genotpicas en gnicas es inmediata. Con los segundos slo podemos calcular las
frecuencias gnicas si se cumplen otros requisitos en la poblacin, por ejemplo
que se ajuste a panmixia, lo que no siempre ocurre en particular en especies
vegetales, o que los individuos hayan alcanzado una homocigosidad total, lo que
por ejemplo es frecuente es especies vegetales autgamas. Pero en cualquier
caso, para una muestra del mismo nmero de individuos, el error estadstico de
la estima es mayor con los dominantes que con los codominantes.

251

III SIMPOSIO CIENTFICO EN BIOLOGA CELULAR Y MOLECULAR

Veamos ahora los marcadores moleculares ms usados, o ms


prometedores, en los estudios poblacionales o evolutivos y los de mayor uso
aplicado. La Tabla 1 recoge algunas de las caractersticas de estos marcadores.
De los cuatro, los RFLP son los nicos que no implican alguna reaccin de PCR,
y fueron los primeros en usarse, generalizndose su uso durante los 80.
Tabla I. Comparacin de las caractersticas de los sistemas de marcadores
moleculares
RFLP

RAPD

AFLP

SSR

Principio tcnico

Restriccin
Transferencia
Hibridacin

Amplificacin con
cebadores al azar

Amplificacin
limitada de
fra_gmentos

Amplificacin
por PCR de
microsatlites.

Polimorfismos
detectados

Camb. puntuales
Deleciones
Inserciones

Camb. puntuales
Deleciones
Inserciones

Camb. puntuales
Deleciones
Inserciones

Node repeticiones

Naturaleza

Codominantes

Dominantes

Dominantes

Codominantes

Abundancia

AltaMuy alta

Muy alta

Alta

Nivel de
polimorfismo

Medio

Medio

Bajo

Alto

Cantidad de DNA
requerida

J.lg

ng

ng

ng

Conocimiento de
secuencias

No requerido

No requerido

No requerido

Requerido

Deteccin con
radiactivos

Si/no

No

Si/no

No

Costo

Medio

Bajo

Medio

Alto

Costo puesta
a punto

Medio/alto

Bajo

Medio/alto

Alto

Heterocigosidad*

0.41

0.41

0.32

0.60

Multiplicidad*

1-2

5-20

20-100

* Estimadas para soja. La multiplicidad hace referencia al nmero de loci que se pueden
estudiar en una sola reaccin. Modificado de Rafalski y Tingey, 1993, y Mazur y Tingey,
1995.

Esta tcnica detecta las diferencias en longitud de segmentos de DNA y la


prdida o ganancia de dianas para una restrictasa. Los cambios en la movilidad

252

Marcelino Prez de la Vega

electrofortica de un fragmento de DNA generados por una restrictasa indican


diferencias en la longitud del fragmento debidas a inserciones o deleciones. Los
cambios en el nmero de fragmentos junto con la aparicin de otros indican la
prdida o ganancia de dianas de restriccin para tal enzima causadas
generalmente por la sustitucin de bases en la diana (Figura 1). En lneas
generales la tcnica consiste en cortar DNA genmico extrado de una muestra
de tejido con una endonucleasa de restriccin. Muestras del DNA de cada
individuo pueden ser cortadas con diferentes enzimas y analizadas
separadamente. Los fragmentos obtenidos se separan por electroforesis en gel,
normalmente de a8arosa. Puesto que el genoma de un eucarionte superior puede
oscilar de 109 a 1O 1 pares de bases, una restrictasa genera un enorme nmero de
fragmentos discretos de muy diferentes tamaos. El resultado de la electroforesis
es por tanto un rastro continuo de fragmentos, lo que implica la necesidad de
usar un mtodo que muestre slo un conjunto de fragmentos. Para ello se
requiere de sondas especficas. Despus de la electroforesis los fragmentos son
desnaturalizados y transferidos y fijados a una membrana (blotting) manteniendo
el orden y posicin relativa del gel. Los fragmentos as fijados se visualizan
mediante la hibridacin con una sonda marcada. Las sondas pueden haberse
generado a partir de cDNA, que representa DNA codificante o de DNA
genmico nuclear, codificante o no codificante. En ambos casos las sondas
pueden ser de un gen conocido o de genes o segmentos annimos. Los filtros
pueden ser lavados para desprender la sonda y utilizados de nuevo con otra
sonda diferente. El resultado es que cada restrictasa y cada sonda genera un
patrn discreto de bandas en cada individuo de la poblacin.
La informacin obtenida con esta tcnica depende del nmero de sondas
y del nmero de restrictasas usadas. Cada sonda hbrida con un conjunto
diferente de fragmentos de DNA genmico y cada enzima corta el DNA
genmico en puntos diferentes. Los fragmentos de restriccin pueden asignarse a
loci genticos, y los datos interpretados en trminos genticos fcilmente,
estimando directamente los niveles de variacin gentica en poblaciones y
especies. Muchos de los fragmentos no codificantes pueden ser selectivamente
neutros y representar secuencias que divergen ms rpidamente que el cDNA.
Algunos son muy polimrficos y por tanto tiles para distinguir entre individuos,
razas, variedades, etc. Por otro lado las sondas cDNA representan secuencias
ms conservadas, lo que permite usarlas como marcadores a travs de grupos de
especies relacionadas. De hecho, restringiendo las condiciones para la
hibridacin se puede asegurar que una sonda obtenida en una especie hibride con
fragmentos homlogos u homelogos del genoma de otra especie, como ocurre
entre maz, arroz, trigo y otras gramneas. Para la estimacin de datos
poblacionales y evolutivos existen numerosos modelos matemticos (Nei y
Miller, 1990; Weir, 1990).

253

Definiciones (2)
Un plasmido, es una pieza de ADN, pequea y circular que se
encuentra frecuentemente en bacterias. Esta molcula, debido a los
genes que porta, puede por ejemplo ayudar a la bacteria a
sobrevivir en presencia de un antibitico.
Los plsmidos son importantes porque se pueden (1) aislar en grandes
cantidades, (2) cortar, dividir e insertarles cualquier pieza de ADN, (3)
devolverlo nuevamente a la bacteria donde se replicarn junto con el ADN
nativo y (4) ser aislados nuevamente, obtenindose billones de copias del
ADN que se les insert. Su tamao vara entre los 2.5 y las 20 Kb

BAC es el acrnimo de Bacterial Artificial Chromosome y en principio se


usa como los plsmidos, pudiendo construir BAC que porten ADN
humano, de ratn, etc., e insertarlos en una bacteria que hace de
hospedaje. Al igual que con los plsmidos, al proliferar la bacteria tambin
se replican los BACs. En este caso se trata de entre 100 a 400 kb que
pueden ser replicadas fcilmente usando BACs y sta ha sido una de las
formas en que se ha clonado grandes porciones del genoma humano

Proyecto OpenCourseWare- UNIA> Bioinformtica Bsica. Dr. Oswaldo Trelles

Recombinacin del ADN


Las tcnicas de recombinacin del ADN permiten transferir parte
de ADN de un organismo (normalmente el que se est estudiando)
a otro ms simple de manipular y reproducir, como una bacteria. Al
reproducirse la bacteria se reproduce el trozo de ADN en estudio
que luego se puede volver a separar (con lo que se tienen grandes
cantidades de ADN) y estudiar en detalle.
Para secuenciar necesitamos una buena cantidad de ADN, por lo que es necesario
hacer muchas copias del mismo. Para ellos se usan bacterias que crecen y se
dividen rpidamente, pero antes necesitamos incorporar el ADN a estudiar en ellas.

[ 0 ] Las enzimas de restriccin permiten la separacin (corte) del


ADN en posiciones especficas que reconoce (no necesariamente
alineadas). La lnea roja representa el punto de corte de una enzima
sobre la insulina a la izquierda- y el plsmido bacterial de E. Coli.
[ 1 ] El ADN queda separado en los
puntos de corte exponiendo sus
bases nitrogenadas
[ 2 ] Se usa ADN ligasa para unir el
trozo de ADN de la insulina y del
plsmido de E.Coli

[ 3 ] El vector de inserta en la clula e incorpora los genes que porta


en el ADN de la clula
[ 4 ] Si la clula acepta los genes extraos, los pasar a sus clulas
hijas en el proceso de divisin celular
Proyecto OpenCourseWare- UNIA> Bioinformtica Bsica. Dr. Oswaldo Trelles

Cmo se secuencia el ADN?


Histricamente hay dos mtodos de secuenciacin del ADN
Maxam & Gilbert, o secuenciacin qumica
Sanger, que usa dideoxynucleotidos.
Hoy en dia el Mtodo Sanger es el ms usado en los
laboratorios (aparte de las tcnicas de secuenciacin masiva)
Sanger y Gilbert compartieron el Nobel de Qumica en 1980

Las reacciones para secuenciar el ADN son similares a


cualquier reaccin PCR (Polimerasa Chain Reaction). La
mezcla incluye una muestra de ADN, nucletidos libres,
una enzima (generalmente una variante de la Taq
polimerasa) y un primer (una pieza pequea de 20 a 30
nt- de ADN de una sola hebra) que se pueda es capaz de
hibridar con una de las hebras de la muestra de ADN.
Se calienta la mezcla para separar las dos hebras de ADN,
lo que permite que el primer se ligue a la zona deseada y
la ADN-polimerasa inicie la elongacin del primer.
Si el trabajo se realizara sobre una muestra de un billn de
copias idnticas de ADN se obtendra un billn de copias
de una de sus hebras.

Proyecto OpenCourseWare- UNIA> Bioinformtica Bsica. Dr. Oswaldo Trelles

El mtodo Sanger (1)


En el mtodo Sanger sin embargo, las reacciones se realizan
en presencia de un dideoxyribonucleotido. ste es como
cualquier ADN regular, salvo que no tiene el grupo hidroxil 3',
por lo que, una vez que se aade al final de una cadena de
ADN, no tiene forma de continuar su crecimiento
Los dideoxynucleotidos son molculas similares a los nucltidos normales
pero les falta un grupo OH lo que impide que otros nucletidos se unan a l
deteniendo la replicacin del ADN.

Haciendo un smil con las piezas de un puzzle (4 tipos de


piezas que seran los nucletidos normales que se unen para
formar el ADN), los dinuclotidos de los cuales tambin hay
cuatro tipos (ACGT) les falta un borde y por lo tanto no
permiten que una nueva pieza se enganche a l, deteniendo
la replicacin del ADN.
A la izquierda se muestra un conjunto de piezas normales,
cuyo perfil se dibuja al lado. A la derecha la representacin
de lo que sera su correspondiente dinucletido

Proyecto OpenCourseWare- UNIA> Bioinformtica Bsica. Dr. Oswaldo Trelles

El mtodo Sanger (2)


La clave del mtodo est en que la mayor parte de los
nucletidos son regulares y que solo una pequea
fraccin de ellos son dideoxy nucleotides.
As al replicar hebras de ADN en presencia de dideoxy-T,
la mayor parte de las veces cuando se necesite una 'T'
para la nueva hebra, la enzima encontrar una T
correcta, y la replicacin continuar aadiendo ms
nucletidos.
Sin embargo, un porcentaje de las veces (proporcional a
la cantidad de dideoxy-T que se haya incluido) la enzima
colocar un ddT y el crecimiento de la hebra se detendr.
La Electroforesis en Geles se usa para separar fragmentos por su tamao.
Los productos de una determinada reaccin (hebras de diferente tamao) se
colocan en el gel y se induce su movimiento por carga elctrica.
Los fragmentos pequeos se mueven poco (poca carga) mientras que los mayores
aparecen en la parte superior.
Ahora con un dispositivo capaz de leer imgenes (o geles) como un escner y
estimando la carga de los fragmentos es posible deducir las posiciones de las
Timinas (T) en la secuencia original.

Proyecto OpenCourseWare- UNIA> Bioinformtica Bsica. Dr. Oswaldo Trelles

El mtodo Sanger (3)

Al colocarse los trozos replicados en el gel se observa


una figura como la de la izquierda (en la que se ha
coloreado cada nucletido).
Para secuenciar ADN, se hace la reaccin en
presencia de pequeas cantidades de los 4
terminadores dideoxi. Luego se usa un gel para
separar los resultados y a partir de l se lee la
secuencia usando el cdigo de colores (usualmente
rojo, verde, azul y amarillo) con que se han marcado
los dd. Pueden haber hasta 96 pistas de muestras
corriendo en un gel , que podra llegar a tener entre 3
y 4 metros de largo por unos 30 a 40 cms. de ancho.
El espacio entre bandas no es tan claro como sera
deseable, sino que aparece ms como en la figura
El ordenador interpreta la imagen de cada pista del gel
obteniendo la intensidad media de cada fila/columna
color dominante que permite deducir de que
nucletido se trata.
De esta forma se reconstruye la secuencia de ADN en
lecturas de fragmentos alrededor de 700 nucletidos.

Proyecto OpenCourseWare- UNIA> Bioinformtica Bsica. Dr. Oswaldo Trelles

Secuenciacin con tecnologas de alto rendimiento


Secuenciacin con tecnologas de alto rendimiento (HTS)

Applied Biosystems
ABI 3730XL
1 Mb / day

Para hacernos una idea de la rapidez


con que evoluciona la tecnologa,
observemos en las figuras el ABI-3730
de Applied Biosystems, posiblemente el
ms utilizado en la secuenciacin del
genoma Humano, con una capacidad
de 1 Mb por da (Un milln de bases).

Roche / 454
Genome Sequencer FLX
100 Mb / run

El AB-SOLID actual, en menos de 10


aos ha multiplicado por 1000 la
capacidad de secuenciacin
Illumina / Solexa
Genetic Analyzer
2000 Mb / run

Un genoma bacteriano tiene aproximadamente 6.5 MB (millones de bases


de DNA).

Applied Biosystems
SOLiD
3000 Mb / run

En algo ms de dos das es posible, con uno solo de estos secuenciadores,


leer alrededor de 30 millones de pares de bases (30 M bp) a un ritmo de 140
bp por segundo y a un costo aproximado de $0.11 por KB (kilo bases o
miles de bases). Con ello tendramos 5 lecturas para comprobar.

Proyecto OpenCourseWare- UNIA> Bioinformtica Bsica. Dr. Oswaldo Trelles

Next Generation Sequencing


Next Generation Sequencing
(NGS)

Illumina / Solexa
Genome Analyzer

Aplicaciones
 Identificacin de anormalidades
cariotpicas, tales como: trisoma,
monosoma, deleciones e inversiones
(cariotipado molecular)
 Nuevas tcnicas de diagnstico
 Mejorar el conocimiento sobre:
Nmeros de Solexa
8 pistas en cada flowCell
3 columnas por pista
110 posillos por columna
1 adquisicin (imgenes) por ciclo
36 ciclos
1 imagen por cada base (4 bases)
350x350 resolucin
4 MB por cada imagen
8 x 3 x 110 x 36 x 4 x 2 MB = 760 GBytes
Proyecto OpenCourseWare- UNIA> Bioinformtica Bsica. Dr. Oswaldo Trelles

 Los mecanismos de regulacin del


desarrollo humano
 La biologa de sistemas en las
clulas humanas
 Demanda y cobertura de nuevos mtodos
bioinformticos, por ejemplo para estimar
las alteraciones del ADN (DNA Aberrations
Copy Number Variations -CNVs) usando
arrays de SNPs y secuencias (NGS)

Aplicaciones (1)
La secuencia de nuestro genoma es 99.9% idntico al de cualquier otro ser
humano. La diferencia del 0.1% (3 millones de bases) est representada por:
... AAACGTCTA ...
... AAAC-TCTA ...
... AAACGTCTA ...
... AAAGCTCTA ...
... AAACGTCTA ...
... AAACATCTA ...
Inserciones / deleciones, Inversiones y Polimorfismos de una sola
base Single Nucleotide Polymorphisms o SNPs
Cmo se detectan?: Por comparacin de AND genmico proveniente
de distintos individuos (proyectos genoma)

Proyecto OpenCourseWare- UNIA> Bioinformtica Bsica. Dr. Oswaldo Trelles

Aplicaciones (2)
Identificacin de genes relacionados con enfermedades genticas:
Mayor rapidez
Enfermedades multignicas (SNPs)
Diabetes
Esquizofrenia
Identificacin y/o localizacin de genes de inters agronmico o veterinario.
Desarrollo de vacunas
Farmacogenmica
Uso de estrategias derivadas de la genmica para descubrir nuevos blancos
teraputicos
Identificar los genes que determinan la eficacia y toxicidad de medicamentos
especficos
Farmacogenmica (II)
Medicina personalizada
Determinar el perfil gentico de cada individuo en cuanto a la sensibilidad a una
determinada droga
Genes polimrficos involucrados en: metabolismo, transporte, blanco especficos,
receptores, enzimas, etc.
Bases de datos tiles
http://www.ncbi.nlm.nih.gov/
http://www.ncbi.nlm.nih.gov/Genomes/index.html
Test de Paternidad:
Comparando la secuencia de ADN de madre e hijo es posible identificar fragmentos en el ADN del
hijo que no aparecen en la madre y por tanto deben haber sido heredados del padre.
Se comparan estos fragmentos adquiridos por via paterna con el ADN del sujeto del test.
Proyecto OpenCourseWare- UNIA> Bioinformtica Bsica. Dr. Oswaldo Trelles

Transferencia de ADN a clulas animales


Las clulas animales pueden incorporar ADN por distintos mtodos como
microinyeccin directa, electroporacin, encapsulacin de ADN en membranas
artificiales (liposomas) seguido de su fusin con membranas celulares,
vectores basados en virus, YAC o mediada por clulas germinales. En general,
el ADN introducido por cualquiera de estos mtodos se integra en el genoma
del hospedador.
La transferencia de genes depende de la introduccin de secuencias de ADN
en el ncleo de una clula somtica, germinal, clula huevo fecundada o una
clula madre embrionaria, seguido de la integracin del ADN en un sitio del
cromosoma.

Vectores de transferencia gnica


Un vector de transferencia gnica es el vehculo empleado para introducir ADN
en una clula u organismo.
Existen dos grandes grupos de vectores, virales y no virales. Los primeros
incluyen todos aquellos que se han obtenido a partir de un virus tratando de
eliminar sus caractersticas patolgicas y de adaptarlos a su nueva funcin
como transportadores de material gentico heterlogo. Pretenden aprovechar
la ventaja que aportan los virus como vectores naturales que han sufrido
procesos de evolucin complejos a lo largo de millones de aos para optimizar
la funcin de introductores de material gentico en las clulas que invaden.
Los vectores no virales siguen una estrategia de sntesis en lugar de
modificacin. Parten de estructuras sencillas conocidas e intentan reconstruir
desde la base un sistema completamente artificial que posibilite el transporte
efectivo de genes en el interior de la clula. Existen tambin vectores
biolgicos no virales (bacterianos) como portadores de genes teraputicos, pero
son los menos estudiados.

Fig1. Tipo de vectores y proceso esquematizado de obtencin.

Las caractersticas de un vector ideal para poder adaptarlo luego a situaciones


concretas seran las siguientes:
-

Que sea reproducible


Que sea estable
Que permita la insercin de material gentico sin restriccin de tamao
Que alcance concentraciones elevadas (> 108 partculas/ml)
Que permita la transduccin tanto de clulas en divisin como
quiescentes
Que posibilite la integracin especfica de gen
Que reconozca y acte sobre clulas especficas
Que la expresin del gen pueda ser regulada
Que carezca de elementos que induzcan una respuesta inmune
Que pueda ser caracterizado completamente
Que sea inocuo y minimice sus posibles efectos secundarios
Que sea fcil de producir y almacenar a coste razonable

El vector es una parte importante en el sistema de transferencia gnica, pero


el sistema consta de dos componentes: el vector (vehculo de transporte) y el
cargo (material a ser transportado). El cargo a su vez se subdivide en: el
efector (gen a introducir) y el soporte (los elementos que condicionan su
expresin).
El cargo suele ser una estructura de tipo plasmdico (ADN bicatenario y
circular), aunque puede ser de diversa naturaleza y complejidad, desde un
simple oligonucletido hasta un cromosoma artificial, que permite incorporar
una cantidad elevada de material gentico con capacidad de perpetuacin en
el tiempo.
El efector que se utilice depender del efecto que se persiga. Si se pretende
compensar, sustituir o reparar un gen daado, el efector debe ser una copia
del gen intacto o un elemento que permita su reparacin. Si se pretende
inducir un efecto biolgico concreto (eliminar especficamente un tipo de
clulas, bloquear la expresin de un virus, inducir una respuesta inmune),
se pueden introducir genes naturales que potencien dicho efecto o genes que
originen nuevas actividades que den lugar al efecto perseguido.
El soporte es la base para el control de la expresin del transgen e incluye
distintos tipos de elementos reguladores. El primero y fundamental es el
promotor, la zona de ADN anterior al gen donde se recluta la maquinaria de
transcripcin. La naturaleza del promotor condiciona el tipo de regulacin de
la expresin gnica. Se pueden utilizar promotores constitutivamente activos o
promotores especficos, que slo son activos en un tipo celular concreto. De la
misma manera se pueden emplear promotores inducibles, que requieren la
presencia de un elemento concreto para ejercer su funcin. ste puede ser un
agente de adiccin exgena (control externo) o un agente determinado por
caractersticas fisiolgicas especiales (como por ejemplo promotores activos
ante situaciones de hipoxia). Otros elementos del soporte que pueden ser
importantes dependiendo de la funcionalidad perseguida son los potenciadotes
y represores de los promotores, secuencias de aislamiento (insulators) que
impiden las influencias de secuencias reguladoras prximas, secuencias de

integracin (para permitir la inclusin del material exgeno dentro del genoma
de la clula hospedadora), secuencias de recombinacin homloga (para
permitir el intercambio de material gentico con el genoma hospedador con
una regin especfica), secuencias de empaquetamiento (para introducir el
material gentico en el interior de un vector viral), secuencias
inmunoestimulantes (secuencias bacterianas del tipo islas CpG no metiladas
que sirven como coadyuvantes en las vacunas de ADN)
Los vectores son los encargados de asegurar la estabilidad del material
gentico transportado y de vencer todas las barreras biolgicas hasta alcanzar
su destino final, el ncleo de la clula diana, donde tiene lugar la regulacin
gnica. Tambin de ellos va a depender la va de administracin a utilizar.
En los casos de transferencia gnica en individuos postnatales, el vector ha de
solventar barreras en su camino hacia su destino funcional. Entre estas
barreras se incluyen: la estabilidad en el medio extracelular (para evitar su
degradacin y eliminacin), el reconocimiento de la clula diana (generalmente
mediante un receptor especfico), su unin a la membrana, su internalizacin
en la clula (normalmente utilizando un sistema de transporte vesicular como
la endocitosis), el escape de los sistemas de degradacin intracelular
(lisosomas) y su entrada final al ncleo, donde debe desmantelarse para
permitir que el material gentico que transporta gane acceso a su ubicacin
final y a la maquinaria de transcripcin.

Fig2. Puntos clave para regular la eficacia de un vector de transferencia gnica


que se introduce en el individuo

Transfeccin de clulas somticas animales


La transfeccin de clulas somticas es til para el cuidado medico y
veterinario de enfermedades genticas, y para otros propsitos teraputicos o
de mejoramiento de animales.
La transferencia de genes a clulas somticas puede hacerse en el laboratorio
(ex vivo) o directamente a las clulas en el cuerpo (in vivo). En la forma ex vivo,
se extraen clulas del individuo para ser transformadas (proceso por el cual se
transfiere exitosamente un gen a una clula) con el vector que contiene la
versin normal del gen. Este mtodo tiene la ventaja de que la transferencia de
genes es ms eficiente y permite la propagacin de las clulas transformadas
para generar grandes cantidades. La desventaja es que slo es utilizable para
el individuo especfico del cual se extrajeron esas clulas, adems de ser
costoso por la gran manipulacin y control de calidad requeridos. En el
mtodo in vivo se administra el vector (que contiene el gen normal) a los
individuos. Este mtodo puede utilizarse con muchos individuos, lo que
disminuye su costo y la infraestructura necesaria, pero resulta complicado de
controlar y la eficiencia es mucho menor.

Fig. 1. Sistemas para transferir genes a clulas somticas en individuos

Los vectores son los vehculos microscpicos que se utilizan para transferir
genes a las clulas, a continuacin se exponen sus caractersticas y su
relevancia. Hay tres principales tipos de vectores: virales, no virales y fsicos.
Virales: El mtodo ms eficaz para llevar genes sanos a las clulas daadas
es por medio de virus que han sido adaptados como vectores. Los virus son
tiles ya que pueden penetrar naturalmente las clulas, insertando en ellas su
material gentico.

Sin embargo, antes de poder usarlos como vectores deben modificarse para
eliminar los genes virales que les permiten replicarse y causar enfermedad. A
estos virus se les llama virus modificados o atenuados, y entre los ms
utilizados como vectores se encuentran los retrovirus, adenovirus y virus
adeno-asociados. Tambin se han desarrollado poxvirus (especialmente el
virus de la vaccinia) para vacunas y terapias gnicas. Actualmente, los
vectores virales son los ms eficientes para transformar clulas, aunque no
carecen de desventajas: son de manufactura costosa, hay lmites a la cantidad
de genes (es decir, la longitud de los fragmentos de ADN) que pueden ser
insertados en los vectores y que pueden llegar a desencadenar una respuesta
inmune (inmunogenicidad).
No virales: Bsicamente se trata de inyectar el fragmento de ADN que
contiene el gen de inters directamente a las clulas o empacado dentro de
otras molculas como son los liposomas (pequeas vesculas de grasa que
pueden transportar sustancias al interior de las clulas). Los vectores no
virales son menos eficientes para transformar clulas, pero no tienen limites
para el tamao del inserto (el tamao del ADN que se va a inyectar), son
menos inmunognicos y ms fciles de elaborar.
Fsicos: Involucran sobre todo inyectores sin aguja y electroporacin. Los
inyectores sin aguja utilizan alta presin para insertar el ADN en clulas de la
piel o en clulas en cultivo, mientras que la electroporacin utiliza pulsos
elctricos que abren temporalmente agujeros en las membranas de las
clulas, permitiendo insertar el ADN. Los mtodos fsicos an son ineficientes
en la transformacin y tienen un rango limitado de aplicacin.
Los riesgos de la terapia gnica continan siendo difciles de cuantificar. Por
ello cada ensayo debe comenzar lentamente, con un control muy cuidadoso de
la dosis de vectores que contengan los genes que se pretende insertar. Estos
riesgos tomaron una nueva dimensin en el otoo de 1999, cuando un joven
de 18 aos muri cuatro das despus de haber iniciado un tratamiento con
terapia gnica. Los mismos riesgos podemos asumir para el resto de especies
animales manipuladas genticamente.

Transgnesis
La transgnesis se puede definir como la introduccin de ADN extrao en un
genoma, de modo que se mantenga estable de forma hereditaria y afecte a
todas las clulas en los organismos multicelulares. Generalmente, en
animales, el ADN extrao, llamado transgen, se introduce en zigotos, y los
embriones que hayan integrado el ADN extrao en su genoma, previamente a
la primera divisin, producirn un organismo transgnico; de modo que el
transgn pasar a las siguientes generaciones a travs de la lnea germinal
(gametos).
Entre las aplicaciones de los animales transgnicos se pueden destacar:

La posibilidad de estudiar a nivel molecular el desarrollo embrionario y


su regulacin.
Manipular de forma especfica la expresin gnica in vivo.
Estudiar la funcin de genes especficos.

Poder utilizar a mamferos como biorreactores para la produccin de


protenas humanas.
La correccin de errores innatos de metabolismo mediante terapia
gnica.

La transgnesis se puede efectuar siguiendo dos estrategias comunes,


microinyeccin de zigotos y la manipulacin de clulas embrionarias, las
cuales se describen brevemente a continuacin:
1. Transgnesis por microinyeccin de zigotos
Desde que en 1982 se obtuviera un ratn transgnico, la produccin de
animales transgnicas es cada vez ms cotidiana, existiendo ya
animales transgnicos de las siguientes especies: ratn, rata, conejo,
cerdo,
vaca,
cabra
y
oveja.
La tcnica se realiza, fundamentalmente por microinyeccin y se realiza
de la siguiente forma:
o

En la primera fase, se aslan un nmero grande de vulos


fertilizados. Se consigue sometiendo a las hembras a un
tratamiento hormonal para provocar una superovulacin.
La fertilizacin puede hacerse in vitro o in vivo.
En la segunda fase, los zigotos obtenidos se manipulan uno a
uno y con una micropipeta a modo de aguja, se introduce una
solucin que contiene ADN.
En la tercera fase, estos vulos son reimplantados en hembras
que actuarn como nodrizas permitiendo la gestacin hasta
trmino.

Por ltimo, tras el destete de los recin nacidos, stos se chequean,


para ver si ha ocurrido la incorporacin del transgn.
2. Transgnesis por manipulacin de clulas embrionarias.
Una estrategia ms poderosa para la transgnesis implica la
introduccin de ADN extrao en clulas embrionarias totipotentes
(clulas ES) o clulas embrionarias madres (clulas EM).
Estas clulas se toman del interior de la blstula en desarrollo y se
pasan a un medio donde se tratan con distintos productos con lo que se
conseguir que las clulas no se diferencien, y se mantiene su estado
embrionario.
El ADN extrao se introduce en las clulas ES mediante diversas
tcnicas, posteriormente las clulas transfectadas son reintroducidas
en una blstula y sta reimplantada en una hembra.
Con esta tcnica los neonatos son quimeras; pero mediante el cruce de
stas se consiguen animales transgnicos con aquellas quimeras que
hayan incorporado el transgn en su lnea germinal

10

El ganado transgnico que se emplea para producir protenas teraputicas,


debe contener en el ADN extrao de sus clulas, adems del gen codificante de
la protena, una secuencia o promotor que haga que se exprese dicho gen en
unas
determinadas
clulas
solamente.
Por ejemplo, si se quiere que la protena se produzca junto con la leche, el
transgn se fusiona con una secuencia reguladora de una protena de la leche,
con lo que la protena slo se formar en las clulas de glndulas mamarias.
Esto es lo que se hizo con la oveja Tracy en 1992, la primera oveja que produjo
una protena humana, la alfa-antitripsina bajo la direccin del promotor ovino
de la beta-lactoglobulina. Dicha protena se produce en una cantidad de 35
g/l, la cual se emplea para curar el edema pulmonar.
Lo mismo se ha hecho para la famosa cerda Genie, que fabrica en su leche la
protena C humana que controla la coagulacin sangunea y es necesaria para
los hemoflicos.
Adems de estas tcnicas existen otras alternativas que se describirn ms
adelante, y algunas de las cuales son una combinacin.

Transferencia gnica por microinyeccin

Microinyeccin pronuclear: pequeas cantidades del ADN de inters


(transgen) eran inyectadas en el proncleo de un embrin al estado de
dos clulas. Aunque ampliamente aceptada y utilizada en forma
rutinaria en muchos laboratorios, ha habido muy poco progreso para
mejorar su eficiencia, la que se mantiene en el orden 0.1-5%,
dependiendo de la especie considerada.

En la dcada del 80 ocurri un importante avance en la tecnologa de


animales transgnicos que marc el curso de la investigacin en este campo
por al menos dos dcadas. Gordon y colaboradores describieron una tcnica
donde el ADN desnudo fue inyectado en el proncleo de un ovocito de ratn
recientemente fertilizado, el que posteriormente se transfiri a hembras
receptoras sincronizadas. Este experimento demostr que era posible usar un
plsmido recombinante como vector para transferir genes forneos
directamente hacia el embrin. El ADN inyectado de esta forma se integr en
el genoma y pudo ser heredado por la descendencia de los animales
transgnicos fundadores. La inyeccin de embriones al estado de una clula
fue clave para obtener una integracin temprana del transgen, permitiendo al
ADN forneo contribuir en el genoma de todas las clulas somticas y la lnea
germinal.
Generacin de los ratones transgnicos:
En una primera fase se aslan un nmero grande de ovocitos fertilizados, los
que se consiguen sometiendo a la hembras a un tratamiento hormonal para
provocar una mayor ovulacin.
En una segunda fase los ovocitos recin fertilizados se manipulan uno a uno,
y con una micropipeta a modo de aguja se introduce una solucin que
contiene ADN. El ADN purificado es inyectado directamente en el pronucleo

11

masculino de un zigoto, utilizando para ello un micromanipulador acoplado a


una pipeta con presin negativa y otro manipulador a acoplado a una aguja de
inyeccin

Fig3. Instrumental para microinyeccin pronuclear

Fig.4

Fig.5

Fig. 4 y 5. La figura de la izquierda (4) representa un dibujo esquemtico de


cmo se introduce el ADN por microinyeccin en el pronucleo del zigoto. A la
derecha (5) hay una foto tomada en tiempo real es la que se observa lo descrito
anteriormente.
En la tercera fase estos vulos son reimplantados en hembras que actuarn
como nodrizas permitiendo el trmino de la gestacin. Se implantan de 20-30
zigotos en el oviducto de una hembra semipreada (recientemente apareada
con un macho vasectomizado. Alrededor de 19 das ms tarde se nacen de 5-8
cras. Los animales transgnicos se identifican mediante anlisis de PCR a
partir de ADN extrado de las colas de los ratones de tres semanas de vida. Los
transgnicos son verificados posteriormente por Southernblots.

12

Fig.6. Implantacin de vulos transfectados e Identificacin de ratones


transgnicos nacidos mediante la tcnica de PCR
Los ratones positivos para la prueba PCR son cruzados con animales controles
para identificar a los fundadores, es decir, aquellos que tienen el transgen
insertado en su lnea germinal.
La eficiencia de transgnesis con este mtodo es menor al 5%. La integracin
del transgen en el genoma del ratn es al azar y los niveles de expresin son
variables.
En ciertos casos la integracin del transgen tambin ocurri despus de la
primera divisin del zigoto, lo que result en animales fundadores mosaicos.
Estos animales mosaicos an transmiten el transgen a la descendencia pero lo
hacen a una frecuencia menor al 50%. Desgraciadamente, la eficiencia para
generar animales transgnicos utilizando esta tecnologa es baja,
particularmente en animales de granja. La eficiencia de la inyeccin
pronuclear est controlada por una serie de factores como quedara
demostrado por los trabajos de Brinster y colaboradores en 1985, quienes
entregaron valiosa informacin sobre la integracin de los transgenes y
permitieron establecer que la concentracin y la forma (circular o linear) del
ADN eran los factores ms crticos para una eficiente integracin. No se
encontraron diferencias significativas cuando el proncleo femenino o
masculino era utilizado para la inyeccin, aunque este ltimo es preferido por
ser ms grande. Por otro lado, el cruzamiento de ratones hbridos (por ejemplo
C57BL x SJL) fue ms exitoso en la produccin de animales transgnicos que
las lneas consanguneas (C57Bl x C57Bl). El descubrimiento de la inyeccin
de proncleos como un nuevo mtodo para modificar el genoma de los
animales revolucion la forma en que los investigadores pudieron analizar la
expresin de los transgenes y paviment el camino para la generacin de los
primeros animales transgnicos de granja en 1985.
Desde entonces, la tecnologa ha sido implementada con xito en la mayora
de los animales domsticos como en conejos, por Buhler y colaboradores en
1990, ovejas, por Wright y colaboradores en 1991, cabras por Ebert y
colaboradores en 1991, vacas por Krimpenfort y colaboradores en 1991 y
cerdos por Wall y colaboradores en 1990. Sin embargo, adems de los
problemas asociados con la integracin de los transgenes hay ineficiencias
asociadas con la recoleccin, cultivo de los huevos fertilizados y transferencia

13

de los embriones hacia las hembras receptoras. Otros factores como el largo
perodo de gestacin y el bajo nmero de animales por generacin, sumado al
costo extra de cuidado de los animales, han contribuido a la lenta adopcin de
estas tecnologas, especialmente en los pases menos desarrollados.
Los primeros estudios realizados en animales de granja se enfocaron hacia el
uso de genes que controlan la productividad del animal, por ejemplo genes de
la hormona del crecimiento para incrementar la tasa de crecimiento y la
eficiencia de conversin por Pursel y Rexroad en 1993. Estos estudios
mostraron los problemas de la inyeccin pronuclear con relacin al control de
los niveles de expresin del transgen. Se encontr una gran variacin de
expresin en las lneas de animales transgnicos generados, siendo sta en
general muy pobre, especialmente si no todos los elementos reguladores del
transgen eran incluidos en la construccin gentica (plsmido). Esto llev a
que muchos investigadores dedicaran mayores esfuerzos a entender la forma
en que los transgenes se insertan en el genoma del animal y los factores que
afectan la expresin de los mismos. Esto explica por qu la mayora de los
experimentos dirigidos a alterar la composicin de la leche han sido realizados
principalmente en el ratn, aunque existen algunas notables excepciones tales
como la secrecin de protenas de valor teraputico como el factor IX de la
coagulacin en la leche de ovejas por Wright y colaboradores en 1991, el
activador de plasmingeno de tejido en la leche de cabras por Ebert y
colaboradores en 1991 y la lisozima humana en la leche de bovinos por
Krimpenfort y colaboradores en 1991. Sin embargo, dada la baja eficiencia de
esta tecnologa, sumado a los costos involucrados, es que ha habido una
bsqueda constante por nuevas alternativas.
En trminos generales, a continuacin se presenta una grfica con los niveles
de eficiencia de la tcnica para diferentes especies de animales:

Fig.7. Niveles de eficiencia de la microinyeccin pronuclear para diferentes


especies de animales.

14

- Microinyeccin de ADN en clulas embrionarias: manipulacin de las


clulas madre embrionarias de ratn (ES cells) apareci como una potencial
solucin para muchos de los problemas encontrados con la tcnica de
microinyeccin pronuclear.
Transformacin gentica mediante recombinacin homloga en clulas madre
embrionarias (ES cells). El aislamiento de clulas madre embrionarias de
ratn, en 1989 por Thompson y colaboradores, abri nuevas posibilidades
para estudiar la funcin gnica en animales transgnicos. Las clulas madre
embrionarias se obtienen desde el macizo celular interno de blastocistos y se
pueden mantener en cultivos sin perder su estado indiferenciado gracias a la
presencia en el medio de cultivo de factores inhibitorios de la diferenciacin.
Estas clulas pueden ser manipuladas in vitro va recombinacin homloga,
permitiendo as alterar la funcin de genes endgenos. Las clulas as
modificadas pueden ser entonces reintroducidas en blastocistos receptores
contribuyendo eficientemente a la formacin de todos los tejidos en un animal
quimrico incluyendo la lnea germinal. Esta tecnologa posibilita
modificaciones genticas muy finas en el genoma del animal, tal como la
introduccin de copias nicas de un gen. La incorporacin de una copia nica
de un gen en un sitio predeterminado del cromosoma tiene las ventajas de
permitir controlar el nmero de copias del transgen y se puede controlar la
insercin de este en un sitio favorable (transcripcionalmente activo) para su
expresin tejido-especfica.
Utilizando esta tecnologa ha sido posible anular la funcin de genes
endgenos del ratn mediante la integracin de un marcador de seleccin, lo
que ha permitido la generacin de varios cientos de ratones llamados knock
out que han servido como modelos de enfermedades genticas en humanos y
como modelos para analizar la funcin de genes endgenos (Melton, 1994;
Shastry, 1998; Kolb y col., 1999; Wallace y col., 2000).

Fig.8. Representacin de las tcnicas de microinyeccin pronuclear y


microinyeccin de clulas embrionarias

15

Transferencia gnica con transposones


Los transposones se definen como elementos transponibles que contienen
genes adicionales a parte de los necesarios para la transposicin y estn
dentro de secuencias repetidas. Dentro de esta categora se encuentran los
trasposones compuestos de procariotas, familia Tn3, elemento P de
Drosophila, secuencias Alu de mamferos, retrotrasposones

CLASE I: MEDIANTE DNA


Elementos IS (Is1, IS2, IS3, IS30,
IS200, etc)
Transposones compuestos (Tn5, Tn10,
etc)
I.I PROCARIOTAS
Transposones de la familia Tn3
Bacterifagos (Mu, lambda, P22, etc)
Sistemas de inversin
I.II. EUCARIOTAS

Elementos controladores del Zea mays


(Ac, Mu, Sm, etc)
Elementos P de Drosophila

CLASE II: MEDIANTE RNA


Superfamilia vrica
Retrovirus, LINE, Ty, ...
II.II EUCARIOTAS

Superfamilia no vrica
SINE Alu y B1 de mamferos,
pseudogenes procesados derivados de
la polimerasa II

Fig.9. Clasificacin de los elementos transponibles

16

Fig.10. Estructura bsica de los trasposones

Los trasposones son secuencias de material genmico que tienen la


capacidad del saltar fuera y dentro del genoma. Son capaces de
autorreplicarse e integrarse aleatoriamente en nuevos sitios dentro del
genoma (trasponerse o saltar). Pueden entrar en plsmidos y ser
propagados por ellos. Estas propiedades les confieren la capacidad de ser
transferidos exitosamente en clulas y genomas extraos.
La ingeniera gentica puede manipular estos trasposones para llevar a
cabo transferencia horizontal de genes. La transferencia horizontal de
genes es la transferencia de material gentico entre clulas y genomas que
pertenecen a especies no relacionadas, por procesos distintos a la
reproduccin. Un ejemplo de ello es el uso de los trasposones de
salmnidos para la transferencia gnica en vertebrados. Los trasposones
de vertebrados de la familia Tc1/mariner contienen como mnimo un gen
nico que codifica la enzima trasposasa flanqueada por dos repeticiones
terminales invertidas (tir). Cada una de las tir posee uno o varios sitios de
20-30 p.b. de interaccin con la trasposasa. La trasposasa interacciona
con estos sitios para cortar el trasposn, luego interacciona con secuencias
presentes en el genoma en otro locus y pega el trasposn en el nuevo
locus. En vertebrados todos los trasposones que se han detectado estn
inactivados por mutaciones. Sin embargo recientemente se ha obtenido un
trasposn activo de salmnidos mediante mltiple mutagnesis dirigida.
Dicho transposn denominado Bella durmiente o Sleeping beauty (SB)
se puede usar en todos los vertebrados analizados hasta el momento como
vehculo de incorporacin de nuevos genes y para inactivar genes en el
genoma por insercin.

17

Fig.11. Esquema de un procedimiento para integrar genes en clulas


usando trasposones.

18

Transferencia gnica con vectores virales


Los vectores virales son todos aquellos que han sido obtenidos a partir de
un virus, tratando de eliminar sus caractersticas patolgicas y adaptarlos
a una nueva funcin como transportadores de material gentico
heterlogo. Pretenden aprovechar las ventajas que aportan los virus como
vectores naturales que han sufrido procesos de evolucin complejos a lo
largo de millones de aos para optimizar su funcin de introductores de
material gentico en las clulas que invaden. Para modificar un virus y
transformarlo en un vector de transferencia gnica en animales, el primer
paso es bloquear su capacidad de propagacin eliminando los genes
responsables de su replicacin. El segundo paso es la eliminacin de parte
del genoma viral para crear espacio para introducir el material gentico de
inters (gen o genes, ms los elementos de control). Se han de eliminar
genes que no sean esenciales, y especialmente aquellos que puedan
resultar txicos o perjudiciales para el individuo a manipular.
La ventaja de los vectores virales en la gran eficacia de transferencia y la
posibilidad, en algunos casos, de integrar el transgen en el genoma de la
clula hospedadora. Por otro lado presentan desventajas como su falta de
especificidad celular en la mayora de los casos, la limitacin del tamao
(debido a que han de empaquetarlo en la cpsida), su elevada
inmunogenidad y el riesgo biolgico que conllevan (reconstitucin de
partculas replicativas por recombinacin, y oncogenidad inducida por
integracin inespecfica.
Se han usado retrovirus y lentivirus como vectores para integrar
transgenes en genomas animales. Esta tcnica se ha usado en ratones con
xito y se ha extendido a gallinas, vacunos y suinos.
-

Vectores retrovirales

Los retrovirus son virus de ARN con envuelta. Poseen una elevada eficacia de
transduccin en un gran nmero de tipos celulares, son capaces de integrarse
de forma estable en el genoma de las clulas que infectan sin expresar
ninguna protena viral inmunognica, y son relativamente poco patognicos,
con excepcin de algunos como el VIH. La mayora de ellos derivan del virus
de la leucemia murina (MuLV).
En general, su principal limitacin es que slo pueden transducir eficazmente
clulas en divisin, ya que el acceso al ncleo del complejo de preintegracin
requiere la ruptura de la membrana nuclear. Hay un tipo de retrovirus, los
lentivirus, que si que pueden infectar e integrarse en clulas quiescentes,
como el VIH y SIV, pero el riesgo inherente al uso de los mismos limita su
aplicacin.
Otro inconveniente que tiene el uso de retrovirus como vectores es la poca
estabilidad de las partculas y su baja tasa relativa de produccin. Esto ha
sido parcialmente resuelto con la sustitucin de la protena de la envuelta por
la glicoprotena G del virus de la estomatitis vesicular que posibilita la
obtencin de ttulos de hasta 109 p.i. /ml y estabiliza las partculas.

19

Debido a que estos virus tienen un rango de infectividad muy amplio, cuando
se quiere transducir selectivamente una poblacin celular, se le incorporan
ligandos heterlogos o anticuerpos monocatenarios que generan nuevas
especificidades. Son vectores que poseen protenas quimricas en la envuelta.
Contrario a la percepcin de muchos, los primeros animales transgnicos
fueron producidos hace ya casi 30 aos mediante la microinyeccin de ADN
viral (SV40) en la cavidad del blastocele de embriones de ratn (Jaenish y
Mintz, 1974). Los prximos intentos involucraron embriones de ratn
infectados con el retrovirus Moloney de la leucemia murina (MoMuLV), lo que
result en la transmisin estable hacia la lnea germinal (Jaenish, 1976). Esto
se logr reemplazando genes que no son esenciales para el virus por genes
heterlogos, aprovechando as la capacidad de los virus de infectar un amplio
espectro de clulas y con una gran eficiencia. Una de las grandes desventajas
de este mtodo radica en que la integracin del ADN se produce en diferentes
etapas del embrin en desarrollo, lo que implica que el ADN no se integra en
todas las clulas somticas o en la lnea germinal y por lo tanto no hay
transmisin del transgen a la descendencia. Adems, los animales generados
por este mtodo tienen a menudo ms de un sitio de integracin, lo cual
ocurre cuando ms de una clula del embrin es infectada por el virus
(Palmiter y Brinster, 1985). Esto implica que las lneas de ratones
transgnicos deben ser cruzadas para segregar los diferentes loci conteniendo
el transgen y poder as aislar lneas con un sitio de insercin nico.
Finalmente, los vectores retrovirales poseen una limitada capacidad de ADN
forneo que puede ser acomodado, alrededor de 8 kb, lo cual imposibilita
muchos experimentos especialmente con secuencias genmicas humanas que
pueden superar ampliamente este tamao.
-

Vectores Adenovirales

Los adenovirus son virus de DNA sin envuelta con un genoma bicatenario
hasta 36 kb. Se han seleccionado los serotipos 2 y 5 para la obtencin de
vectores por no estar asociados con ninguna enfermedad severa ni originar
tumores en animales. Pueden transducir un nmero bastante amplio de tipos
celulares distintos, tanto clulas en divisin como post-mitticas, con una
eficacia muy elevada. El genoma viral se mantiene epismico, lo que permite
una expresin gentica transitoria.
Originalmente la capacidad del vector para incorporar ADN era de hasta 8 kb.
Recientemente se ha conseguido eliminar casi todo el genoma viral,
manteniendo las secuencias de empaquetamiento y las secuencias terminales,
rindiendo vectores que pueden incorporar hasta 35 kb a los que se les ha
denominado vectores sin tripas (gutless).
La eliminacin de material genmico viral adems de aumentar la capacidad
del vector de incorporar ADN, disminuye el riesgo de induccin de respuesta
inmune. La mayora de la poblacin ha sido infectada en algn momento por
adenovirus y presenta una respuesta inmune inicial.
Una de las mayores ventajas de estos virus es su alta reproductividad con
ttulos de hasta 1010 p.i./ml, y su gran estabilidad, que les permiten ser
concentrados adicionalmente para alcanzar valores de 1012 p.i./ml.
Su falta de especificidad celular se compensa con el desarrollo de estrategias
de redireccionalidad. Quimeras que introducen ligandos especficos en
protenas de la cpside y molculas biespecficas que reconocen tanto la
cpside viral como el receptor seleccionado.

20

Vectores de virus adenoasociados


Los virus adenoasociados son parvovirus humanos no patolgicos. Son
pequeos virus sin envuelta con un genoma de ADN monocatenario, capaces
de infectar un gran nmero de clulas de origen diverso, tanto en divisin
como en su estado quiescente.
Pueden integrarse en la clula hospedadora en un lugar especfico del genoma,
eliminando la posibilidad de mutagnesis insercional. Otra ventaja en la
carencia de respuesta inmune observada in vivo.
Tiene una reducida capacidad de transporte (4,5 kb) y su reproduccin es
tediosa porque necesitan un virus de apoyo (adenovirus o herpesvirus), los
cuales son difciles de eliminar completamente.
Originalmente se descubri que al eliminar parte del genoma viral para
introducir el transgen se perda la capacidad de integracin especfica.
Recientemente se ha descubierto que la protena Rep78, en presencia de los
ITRs, es capaz de potenciar la integracin especfica en el genoma celular y
podra solucionar este problema.
La falta de especificidad celular ha sido solucionada empleando estrategias de
molculas biespecficas.

Fig.12. Vectores virales de transferencia gnica


Vectores virales quimricos
Consiste en la combinacin de varios vectores para compensar las limitaciones
que tienen por separado, y aprovechar las ventajas ms destacables que
poseen de forma individual. Un ejemplo es la quimera adenovirus-retrovirus,
en la que se utilizan dos tipos de vectores adenovirales: uno incorpora la
maquinaria de empaquetamiento retroviral, y el otro introduce el material

21

gentico equivalente a un vector retroviral. Se aprovecha la eficacia de


transduccin de los vectores adenovirales para cotransfectar con ambos
vectores, transformando las clulas diana en productoras de vectores
retrovirales. Los vectores as generados son capaces de infectar clulas vecinas
e integrarse en su genoma.

Transferencia gnica mediada por semen


Consiste en la introduccin de ADN forneo en gametos masculinos antes
del proceso de fertilizacin.
Las clulas espermticas estn consideradas por algunos autores como
clulas inertes dado que no cuentan con la mayora de la maquinaria
molecular y bioqumica que existe en las clulas somticas para permitir la
replicacin de ADN, la transcripcin de los genes y la sntesis de protenas.
Su morfologa es particular, y se caracteriza por un compartimento
extremadamente reducido y un ncleo que contiene en ADN compactado a
modo de cromatina condensada, conectados a un largo flagelo. Estas
observaciones de la morfologa llevan a la conclusin de que las clulas
espermticas tienen como nica misin actuar de vectores de su propio
genoma durante la fertilizacin. La primera evidencia de que las clulas
espermticas de mamfero podan incorporar ADN forneo cuando eran
incubadas en solucin con estas macromolculas
fue descrita por
Brackett et al. en 1971.
En 1989 Lavitrano y col. describieron la produccin de ratones
transgnicos mediante inseminacin artificial, utilizando semen que haba
sido incubado con ADN exgeno. Las clulas espermticas haban
incorporado ADN plasmdico. La generacin F1 contena el ADN exgeno.
La transferencia gnica mediada por semen en vertebrados se ha
desarrollado y sufrido muchos cambios en los ltimos aos. La incubacin
de las clulas espermticas con ADN forneo seguida de fertilizacin in
vitro o in vivo ha generado conejos, cerdos, ratones, ovejas, vacas, peces,
pollos transgnicos. La definicin y el establecimiento de los protocolos
segn la especie a transformar es y ser un tema valioso en biotecnologa.
Una ventaja de la transferencia gnica mediada con semen frente a la
microinyeccin, es que la segunda requiere manipulacin individual de los
embriones, mientras que con la segunda se pueden transformar
genticamente un alto nmero de embriones en un solo paso. Esto es
particularmente interesante cuando se quieren obtener especies acuticas
transgnicas.
Existen investigaciones que sugieren que el control y captacin del ADN
exgeno por parte de las clulas espermticas de mamferos est altamente
regulada y es muy especfica. De hecho, el fluido seminal antagoniza
fuertemente la unin de ADN forneo y bajo condiciones normales es una
fuerte proteccin de las clulas espermticas contra el ADN forneo.

22

Figura 3: Bacterias, plsmidos y protenas recombinantes

El plsmido recombinante puede aislarse de estas colonias y transferirse a otras clulas.


Por esta metodologa es posible introducir genes de inters en todo tipo de clulas, empleando los
vectores y las tcnicas propias de cada sistema. Podemos entonces generalizar los pasos de la ingeniera
gentica de la siguiente manera:
1) Identificar un carcter deseable en el organismo de origen.
2) Encontrar el gen responsable del carcter deseado (gen de inters).
3) Combinar dicho gen con otros elementos necesarios (vector) para que ste sea funcional en el
organismo receptor.
4) Transferir el gen de inters, previamente introducido en el vector adecuado, al organismo receptor.
5) Crecer y reproducir el organismo receptor, ahora modificado genticamente.
Las plantas transgnicas inicialmente se crearon como modelos para explicar los circuitos de
regulacin gentica y se prob la expresin de diversos tipos de genes en ellas. El ejemplo ms conocido
es una planta de tabaco (Nicotiana tabacum), que expresa el gen de la luciferasa de las lucirnagas, dando
como resultado una planta luminiscente. Estos sistemas transgnicos ayudaron a dilucidar los sistemas de
regulacin de la expresin gnica en eucariotas, este hecho abri las puertas a la elaboracin de plantas
transgnicas, tanto con fn de aplicarlas a la agricultura, como al comercio y medicina.
Posteriormente se dedicaron los esfuerzos, al aislamiento y caracterizacin, de genes de diferentes
fuentes biolgicas, para determinados fines agronmicos. Los primeros trabajos en el campo radic, en el
7

aislamiento de los genes de las protenas Cry de Bacillus thuringensis, una bacteria entomopatgena, y
son usadas en las plantas transgnicas como un bioinsecticida, llamado convencionalmente Bt; tambin se
trabaj en la construccin de genes que confieran a las plantas resistencia a herbicidas. El principal
trabajo, en lo que a resistencia a herbicidas se refiere, se hizo con el glifosfato, aunque tambin se
trabajaron otros herbicidas como el glufosinato. Las plantas con la tecnologa RoundupReady (RR) de
Monsanto son resistentes al glifosfato de la misma empresa, denominado Roundup y sus variedades
mejoradas.
La resistencia a Roundup est dada por la expresin de una protena bacteriana necesaria para la
sntesis de enzimas fotosintticas, la protena de origen celular es inhibida por el herbicida, pero no la de
origen bacteriano.
En la actualidad, las nuevas ofertas de Monsanto muestran plantas de maz, algodn y soya que
poseen ambas caractersticas: la resistencia a insectos y la tolerancia a herbicidas. Otras empresas han
generado plantas similares y con otras caractersticas, como el tomate "FlavrSavr de Calgene, el cual no
se ablanda y puede ser almacenado por mucho tiempo, se logro mediante la tecnologa de RNA
antisentido, la cual inhibe la protena responsable de la senescencia del fruto maduro.
Las plantas transgnicas no slo se utiliza para cultivos, sino que tambin se han utilizado para la
produccin de sustancias, como metabolitos y productos secundarios importantes. Uno de los avances
ms impresionantes de la biotecnologa vegetal ha sido la posibilidad de expresar vacunas contra una
amplia variedad de enfermedades en las plantas, incluso se han logrado expresar anticuerpos de
reconocimiento y prevencin del cncer.
Hoy, la ingeniera gentica se suma a las prcticas convencionales como una herramienta ms
para mejorar o modificar los cultivos vegetales.
Figura 4: Comparacin entre cruzamiento tradicional y biotecnologa

En este sentido, esta metodologa ofrece tres ventajas fundamentales respecto a las tcnicas
convencionales de mejora gentica basadas en la hibridacin:
+Los genes que se van a incorporar pueden provenir de cualquier especie, emparentada o no (por
ejemplo, un gen de una bacteria puede incorporarse al genoma de la soja).
+En la planta mejorada genticamente se puede introducir un nico gen nuevo preservando en su
descendencia el resto de los genes de la planta original.
+Este proceso de modificacin demora mucho menos tiempo que el necesario para el mejoramiento
por cruzamiento.
Podemos as modificar propiedades de las plantas de manera ms amplia, ms precisa y ms rpida.

3. PROCEDIMIENTOS PARA LA OBTENCIN DE PLANTAS TRANSGNICAS


3.1. GENERALIDADES
Principalmente se emplean tres mtodos para introducir genes ajenos en una planta. Todos estos
mtodos obtuvieron por primera vez, con ms o menos xito, plantas transgnicas en la dcada de los
ochenta y muchas de ellas se comercializaron en los noventa.
a) El mtodo se basa en el empleo de un vector vivo que lleve el material gentico a la clula
blanco. Existen dos formas de introducir material gentico por esta va:
1) Mediante virus genticamente modificados (que llevan los genes de inters en lugar de los genes
estructurales), los cuales insertan su genoma en el DNA celular para la replicacin y de esta manera se
consigue la expresin de los genes forneos.
2) el mecanismo natural de infeccin de la bacteria del suelo Agrobacterium tumefaciens que introduce
un gen de su plsmido en las clulas de la planta infectada. Recordemos que un plsmido es un fragmento
de ADN circular y extracromosmico que suele contener informacin no vital para la bacteria y cuyo
tamao es del orden del 1 al 3% del cromosoma bacteriano. Este gen se integra en el genoma de la planta
provocndole un tumor o agalla. Lo que se hace con A. tumefasciens, es crear una cepa recombinante de
sta (con los genes de inters) y se induce la formacin de tumores, en los cuales se encuentran clulas
modificadas por la interaccin, se aslan estas clulas y a partir de ellas se genera el individuo transgnico
(Fig 5). Se aplic con xito por primera vez en 1984 en el tabaco y el girasol. Las gramneas y en general
todas las monocotiledneas presentan gran resistencia a Agrobacterium por lo cual este mtodo es
bastante inviable en un extenso grupo de plantas de gran importancia econmica.

Figura 5: Resumen del proceso de DNA recombinante para crear plantas transgnicas

b) Otro mtodo empleado para transformar genticamente plantas es el uso de protoplastos, que
son clulas vegetales a las que se les ha liberado de la pared celular. De esta manera queda eliminada la
barrera principal para la introduccin de genes forneos. Mediante esta tcnica se consigui por primera
vez cereales transgnicos en 1988. Puede realizarse una transferencia directa de genes mediante la fusin
de protoplastos (la clula vegetal sin la pared) mediante qumicos como el PEG (polietilenglicol), de
donde se obtienen hbridos nucleares y luego clulas transgnicas por recombinacin; para este in
tambin puede emplearse liposomas.

c) La biolstica es otro mtodo difundido, consiste en bombardear las clulas con partculas
metlicas microscpicas recubiertas del DNA que se desea introducir. Si bien esta tcnica ha dado buenos
resultados, tiene un componente aleatorio de efecto muy fuerte que da un amplio margen a resultados
impredecibles y un incremento significativo en la tasa de mutacin celular. Igualmente costosos, pero con
menos problemas de efecto aleatorio, estn los mtodos de inyeccin (micro y macroinyeccin), estos
mtodos consisten en inyectar el material gentico forneo al ncleo de la clula mediante equipo
sofisticado. Los mtodos de microinyeccin tienen mayor eficacia que los de macroinyeccin por la
focalizacin dirigida de la insercin. Adicionalmente se emplean otros mtodos directos como la
10

transformacin del polen y la electroporacin, pero no son ampliamente utilizados. Microcan o can
de partculas que consiste en bombardear tejidos de la planta con micropartculas metlicas cubiertas del
fragmento de ADN que interesa se integre en el ADN de la planta. Es el procedimiento que ms xitos ha
conseguido y el que promete ms avances.
3.2. DESCRIPCIN DE LAS TECNICAS
3.2.1. Transferencia gentica con Agrobacterium tumefaciens
En 1970 se plante la hiptesis de que la enfermedad de las plantas denominada agalla del cuello
podra ser producida por la transferencia de material gentico entre una bacteria, Agrobacterium
tumefaciens, y las clulas vegetales. La agalla del cuello se caracteriza por la formacin de voluminosas
agallas, sobretodo en el cuello del tallo (zona de contacto entre el tallo y la raz), tambin en las races y el
tallo de numerosas plantas de inters agronmico. La enfermedad es de naturaleza tumoral y ya se haba
demostrado, a finales de los aos sesenta, que las clulas afectadas contienen unas sustancias, las opinas
(sustancias nitrocarbonadas), que no se encuentran en las clulas normales. Tambin se demostr que
existen varias clases de tumores en funcin de la concentracin de opinas y que es el material gentico de
la bacteria el que determina este carcter ya que estas observaciones se realizaron en tejidos cultivados in
vitro, es decir, en ausencia de bacterias. Se concluy que las clulas tumorales haban adquirido la
propiedad de sintetizar opinas durante la interaccin con la bacteria. Tambin se concluy que la
naturaleza de las opinas depende de la cepa bacteriana y tambin que cada cepa degrada especficamente
sus propias opinas. Quedaba demostrada la hiptesis de la transferencia de informacin entre la bacteria y
la clula vegetal.
Schell (1973) anunci el descubrimiento en cepas de Agrobacterium tumefasciens de un plsmido
de un tamao jams observado hasta entonces y que el plsmido llamado Ti (del ingls Tumour inducing)
es portador del carcter patgeno. Ms adelante se observ que todas las clulas de las agallas eran
portadoras de un fragmento del plsmido Ti que se denomin ADN-T (ADN transferido). Se demostr
despus que el plsmido tena varias funciones: la funcin de virulencia (Vir), responsable de la
transferencia del ADN-T, la oncgena (Onc), responsable del tumor (consecuencia de la sntesis de
auxina y citoquinina), la funcin que especifica la sntesis de opinas (Ops), molculas que sirven de
alimento a la propia bacteria, y la funcin catablica (Opc, opina catabolismo). En realidad se
encontraron varios segmentos Opc1, Opc2, que permiten la degradacin de las opinas producidas por el
tumor. Se ha de distinguir dos tipos de funciones: las funciones situadas fuera del segmento ADN-T (Vir,
Opc1,Opc2) que se expresan en la bacteria y las funciones controladas por el segmento ADN-T (Onc,
Ops) que se expresan en la clula vegetal despus de la transferencia de este segmento (Fig. 6).

11

Figura 6: Plsmido Ti de Agrobacterium tumefaciens

En resumen la bacteria no es patgena per se porque no segrega ninguna toxina que disuelva las
paredes celulares como hacen otras bacterias patgenas. Sus efectos se deben a la transferencia de un
segmento de ADN, el ADN-T, cuya expresin en las clulas vegetales es la causa de la enfermedad. La
supresin en el plsmido del segmento transferido hace que la bacteria sea inofensiva sin que ello se la
prive de la capacidad de transferir ADN a una clula vegetal. Por tanto se puede plantear su sustitucin
por un fragmento de ADN extrao.
El segmento ADN-T est delimitado en ambos extremos por unas secuencias determinadas de
nucletidos que actan a modo de seales. La seal "promotor" al principio y la "terminador" al final. La
regin transferida y que se integra en el genoma de la planta es la comprendida entre estas dos seales. En
teora era posible transferir cualquier gen extrao colocado entre estas dos secuencias. En 1983 se
introdujo un gen bacteriano que confera resistencia al antibitico cloramfenicol. Se escogi este gen slo
porque es fcil poner de manifiesto su expresin: las clulas que han integrado el gen sintetizan el enzima
cloramfenicol transacetilasa que gobierna la sntesis del antibitico. El gen empleado se expresa en la
bacteria Escherichia coli. Para que un gen pueda expresarse el enzima ARN polimerasa debe reconocer el
"promotor" y el "terminador". La ARN polimerasa del tabaco (una planta muy empleada en estos
experimentos de transferencia de genes) no reconoce los promotores y terminadores de E. coli y por
consiguiente no transcribe este gen. Para solucionar el problema se fabric un gen compuesto o quimrico
a partir del gen de la resistencia al cloramfenicol de E. coli, un promotor y terminador procedentes del
segmento ADN-T de Agrobacterium tumefaciens. El gen quimrico se reincorpor en un plsmido Ti
(Fig. 7).

12

Figura 7: Gen quimrico en el plsmido Ti de Agrobacterium tumefaciens.

De esta manera el gen quimrico funcion al poder ser detectada la actividad de la cloramfenicol
transcetilasa en tejidos tumorales. An quedaba una dificultad a salvar: la regeneracin de una planta
entera a partir de clulas transformadas. Como las clulas transformadas eran tumorales eran incapaces de
esta regeneracin y el siguiente paso consisti en eliminar los genes tumorales del segmento ADN-T. De
esta manera se pudo regenerar plantas enteras transgnicas que eran frtiles y con las que se pudo estudiar
la transmisin de caracteres a su descendencia. Adems si se escogen los promotores adecuados, es
posible expresar genes en rganos especficos, como races, semillas y tubrculos.
El gen de la resistencia a antibiticos no tiene inters agronmico por lo que haba que identificar,
aislar y clonar los genes que pudiesen mejorar las plantas cultivadas. En el caso de caracteres con base
gentica compleja (donde intervienen numerosos genes), como la resistencia de una planta al fro, es
mucho ms difcil la manipulacin gentica que con los caracteres que se expresan como consecuencia de
la actividad de un enzima.
El sueo de obtener plantas resistentes a los insectos fitfagos se ha hecho realidad con la
obtencin de plantas transgnicas portadoras de un gen bioinsecticida. Bacillus thruringiensis es una
bacteria grampositiva del suelo que en los estadios de esporulacin produce unos cristales de protenas de
propiedades insecticidas. Berliner en 1909 aisl la bacteria de los cadveres del gusano de la harina
(Ephestia kuehniella) procedente de Turingia. Al creerse que la bacteria era el causante de la muerte del
insecto, sugiri la idea de recurrir a B. thuringiensis para luchar contra la plaga de insectos. Los primeros
preparados comerciales aparecieron en 1938. Era prctica habitual en los agricultores tirar a voleo esporas
de B. thuringiensis sobre los cultivos pero se presentaba el inconveniente de tener que realizar la prctica
con una frecuencia mucho mayor que con los insecticidas qumicos. A estas protenas se las denomin cry
(del ingls crystal) por su capacidad de formar cristales o -endotoxinas por su acumulacin en el interior
de las bacterias y su carcter txico. Las protenas cry provocan la lisis de las clulas intestinales de los
13

insectos. Estos bioinsecticidas se caracterizan por su especificidad, pues slo son txicos en escarabajos,
moscas y mariposas (grupos de insectos causantes de la mayora de las plagas), y porque son
prcticamente inocuas en humanos. E. Schnepf y H. Whiteley aislaron en 1981 el primer gen que
codifica una protena insecticida. Se acababa de sentar las bases para que M.D. Chilton en 1983
obtuviera las primeras plantas transgnicas de tabaco utilizando Agrobacterium tumefaciens. Le siguieron
otros experimentos en diversos laboratorios de Europa y Amrica con el tomate y la patata. Estos
experimentos sirvieron para demostrar que la expresin de protenas insecticidas en plantas era posible y
proporcionaba un mtodo eficaz de lucha contra los insectos (Figura 8).
Figura 8: Obtencin de plantas transgnicas resistentes a los insectos mediante Agrobacterium
tumefaciens.

Todas estas investigaciones culminaron en 1996 con la entrada en el mercado de plantas


transgnicas (algodn, patata y maz) resistentes a insectos. A todas estas plantas transformadas se las
denomina Plantas Bt (de Bacillus thuringiensis).
En 1997 el 25% de los cultivos transgnicos comercializados portaban genes cry. El problema de
la aparicin de insectos resistentes a estas plantas se prev solucionarlo con la implantacin de distintas
protenas insecticidas en una misma planta transgnica o en plantas transgnicas plantadas en aos
alternativos.

3.2.2. Transferencia gentica con protoplastos


Como la formacin de agallas no se produca en prcticamente ninguna monocotilednea, se
investigaron al mismo tiempo otros mtodos que permitiesen generar plantas transgnicas en este grupo
que abarca a las gramneas, tan importantes en la nutricin humana. Los protoplastos son clulas de
14

cualquier tejido vegetal a las que se les ha liberado de la pared celular que es la barrera que impide el paso
de grandes molculas como el ADN. La pared celular se elimina digirindola con un enzima. El gen que
se ha de transferir se adiciona al medio de cultivo del protoplasto. Si se somete un protoplasto a descargas
elctricas creamos diminutos poros en la membrana por los cuales puede penetrar el ADN. A este mtodo
se le denomina electroporacin. Tambin podemos ayudar a introducir ADN en un protoplasto empleando
sustancias como el polietilenglicol que desestabiliza la membrana celular. Otro mtodo consiste en
emplear liposomas que contengan el ADN a transferir. La dificultad principal que plantea este mtodo
estriba en el escaso desarrollo de las plntulas generadas a partir de protoplastos.
En 1988 se obtuvo por primera vez cereales transgnicos a partir de la regeneracin de
protoplastos con genes exgenos en medio de cultivo para clulas vegetales.

3.2.3. Transferencia gentica con el "can de partculas" (Biobalstica)


Sanford, bilogo molecular de la Universidad de Cornell (EEUU) a principios de los aos
ochenta estaba buscando el mtodo definitivo para transformar cualquier tipo de plantas. En 1984
estableci contacto con E. Wolf director del centro de fabricacin de micropartculas de su misma
universidad. Entre ambos surgi la idea de bombardear clulas vegetales con ADN y como ste es una
molcula flexible y frgil decidieron enganchar ADN a micropartculas metlicas. En presencia de
cloruro de calcio y espermidina el ADN queda adherido a las micropartculas metlicas por interacciones
no covalentes. En las primeras pruebas se emple micropartculas de tungsteno de cuatro micrmetros de
di metro. Las partculas se proyectan sobre el tejido vegetal por el impulso de un chorro de aire
comprimido o la explosin de una carga de plvora (Fig. 9). Una vez dentro del tejido vegetal el ADN se
desprende de las micropartculas debido a las modificaciones del entorno inico. Cuando la cantidad de
partculas en una clula era superior a once haba pocas probabilidades de que la clula sobreviviera. Se
pens que el tungsteno podra ser ligeramente txico y por este motivo se emplearon posteriormente
micropartculas de oro. Una vez probada la penetracin de ADN quedaba por demostrar la transferencia
gentica. Adhirieron a las micropartculas metlicas ARN del genoma del virus del mosaico del tabaco.
Tres das despus del bombardeo de clulas de cebolla se observaron partculas vricas, lo que demostraba
que el material gentico introducido segua siendo funcional.

15

Figura 9: Microcan con partculas metlicas rodeadas de ADN

A partir de numerosos experimentos se cambiaron muchos factores para mejorar el rendimiento:


el tamao de las microbolas, su velocidad, la inmovilizacin de las clulas vegetales y la cantidad de
ADN transportado. Un problema que plantea esta tcnica es que se generan dos tipos de clulas: las
transformadas y las no transformadas dentro de un mismo rgano. Aparecen entonces competiciones
entre los dos tipos celulares disminuyendo la eficacia del mtodo.
Pero por otra parte se evita el problema mayor que supone la regeneracin de plantas a partir de
protoplastos.
3.2.4. Otras tcnicas de transferencia gentica
- Se ha intentado la transformacin directa depositando una solucin de ADN a transferir y de
polen sobre los estigmas. De esta manera se supone que el ADN penetrara a travs del tubo polnico
durante su desarrollo en el estigma. Los raros xitos conseguidos no han superado, hasta ahora, las
pruebas de la expresin de los genes en la descendencia.
- Tambin se ha intentado inyectar en una clula vegetal una solucin de ADN. La
microinyeccin se realiza bajo control microscpico y con microcapilares. La microinyeccin resulta
poco efectiva porque las puntas de los microcapilares se rompen y se obstruyen con facilidad adems se
necesitan inyectar al menos 10000 clulas, una a una, para tener la seguridad de que al menos una de ellas
ha incorporado el material gentico.
Despus de los expuesto podemos decir que el objetivo de todos estas tcnicas es la creacin de
una planta transgnica. El proceso completo lo podemos esquematizar en la siguiente figura.

16

17

Pirosecuenciacin

S Una alternativa ms moderna (1988) a la secuenciacin

Sanger, ms rpida y barata, aunque menos precisa

S Aprovecha el trifosfato que se libera cuando el dNTP se une a

la cadena, en forma de pirofosfato (PPi)


S Requiere de tres enzimas adicionales: ATP-sulfurilasa,
luciferasa y apirasa
S Requiere de dos sustratos adicionales: adenosin-fosfosulfato
(APS) y luciferina
S Con estas enzimas vamos a tener reacciones que de manera
natural generan seales luminosas, ahorrndonos las marcas
fluorescentes, y haciendo el proceso ms rpido y barato

a)

Partimos, como en Sanger, de una


secuencia plantilla y un primer,
pero con ms enzimas y sustratos,
y sin etiquetar los dNTPs

b)

La polimerasa une un dNTP,


liberando un PPi en el proceso

c)

La ATP sulfurilasa convierte el


PPi en ATP con ayuda del APS

d)

La luciferasa convierte el ATP en


luz, con ayuda de la luciferina

e)

Medimos un pulso de luz

f)

La apirasa se libra de los reactivos


sobrantes para que el sistema est
limpio para el siguiente dNTP

g)

El resultado final es, como en


Sanger, picos de intensidad

Pirosecuenciacin

S Ventajas
S Muy rpido (hasta 700Mbps por ejecucin)
S Ms barato que Sanger
S Precisin bastante alta

S Desventajas
S No puede generar secuencias muy largas (<1Kbs)
S Problemas para medir homopolmeros (secuencias de varios

nucletidos iguales)

Yeast Artificial
Chromosomes

Secondary article
Article Contents
. Introduction

Carlo V Bruschi, International Centre for Genetic Engineering and Biotechnology, Trieste, Italy
Kresimir Gjuracic, International Centre for Genetic Engineering and Biotechnology, Trieste, Italy

. Overview of Yeast Artificial Chromosomes (pYACs)


Plasmids
. Construction of Yeast Artificial Chromosomes
. Biological Features of YACs

Yeast artificial chromosomes are shuttle-vectors that can be amplified and modified in
bacteria and employed for the cloning of very large DNA inserts (up to 12 megabase pairs)
in the yeast Saccharomyces cerevisiae.

. Modifying YACs by Homologous Recombination


. Use of Yeast Artificial Chromosomes
. YAC Genomic Libraries
. Production of Transgenic Mice with YACs

Introduction

. YACs in the Construction of Mammalian Artificial


Chromosomes

Yeast articial chromosomes (YACs) are plasmid shuttlevectors capable of replicating and being selected in common
bacterial hosts such as Escherichia coli, as well as in the
budding yeast Saccharomyces cerevisiae. They are of
relatively small size (approximately 12 kb) and of circular
form when they are amplied or manipulated in E. coli, but
are rendered linear and of very large size, i.e. several
hundreds of kilobases (kb), when introduced as cloning
vectors in yeast. The latter process involves cleavage at
strategically located sites by two restriction enzymes, which
break them in two linear DNA arms. These are subsequently
ligated with the appropriate DNA insert before transformation into recipient yeast cells converted to spheroplasts,
where telomere sequences are added by the cells telomerase
enzymes. In this linear form, these specialized vectors
contain all three cis-acting structural elements essential for
behaving like natural yeast chromosomes: an autonomously
replicating sequence (ARS) necessary for replication; a
centromere (CEN) for segregation at cell division; and two
telomeres (TEL) for maintenance. In addition, their
capacity to accept large DNA inserts enables them to reach
the minimum size (150 kb) required for chromosome-like
stability and for delity of transmission in yeast cells. YACs
have several advantages over other large capacity vectors:
these include accommodation of DNA segments thousands
of kilobases in size and stable maintenance of cloned
eukaryotic DNA due to the compatibility with the yeast
replication machinery. Moreover, they are amenable to
large-scale plasmid amplication in E. coli and to creation of
specic genetic changes within the exogenous DNA
sequences by using the faithful and ecient yeast mechanism of homologous recombination.

Overview of Yeast Artificial


Chromosomes (pYACs) Plasmids
Many dierent yeast articial chromosomes exist as ongoing renements of the initial pYAC3 and pYAC4

plasmids (Figure 1) constructed by Burke et al. (1987). The


basic structural features of YACs were developed from the
yeast centromere shuttle-plasmids YCp series. These are
composed of double-stranded circular DNA sequences
carrying the b-lactamase gene bla and the bacterial pMB1
origin of replication, thus conferring resistance to ampicillin and the ability to replicate in bacteria, respectively.
They also include yeast ARS1 with its associated CEN4
DNA sequence, as well as the URA3 selectable marker. On
this basic scaold plasmid the yeast HIS3 is cloned, anked
by a telomere-like DNA sequence derived from the termini
of the Tetrahymena pyriformis macronuclear ribosomal
DNA, which allows the formation of functional telomeres
in yeast, that are adjacent to two recognition sites for the
BamHI restriction enzyme. Most of these YACs also
contain the cloning site in the middle of the SUP4
suppressor of an ochre allele of a tyrosine transfer RNA
(tRNA) gene; this enables restoration of the normal white
colour phenotype in otherwise red ade1 and/or ade2
nonsense mutants (Fischer, 1969). Accordingly, in the

ARS1

CEN4

bla

HindIII 8500
XhoI 8500

pMB1 ORI

SUP4 ochre
pYAC3
11400 bp

TEL

Sal I 3300

BamHI 8000
HIS3

URA3
TEL

BamHI 6100

HindIII 5500

XhoI 5500
Figure 1 Circular map of plasmid vector pYAC3. All the selectable
markers, the origins of replication for bacteria and yeast, and the yeast
chromosomal structural elements are indicated, together with the map
position of the major restriction sites.

ENCYCLOPEDIA OF LIFE SCIENCES / & 2002 Macmillan Publishers Ltd, Nature Publishing Group / www.els.net

Yeast Artificial Chromosomes

insertional inactivation cloning process, the SUP4 gene is


disrupted by the DNA insert, thus removing the suppression of the ade mutations and allowing their phenotypic
expression as red colour.

Construction of Yeast Artificial


Chromosomes
After plasmid DNA purication, two distinct digestions
are performed: the rst with BamHI that cuts twice
adjacent to the two telomeric DNA sequences anking
the HIS3 gene, which therefore is excised from the plasmid
and lost (Figure 2a). This rst digestion generates a long
linear fragment carrying telomeric sequences at each end.
The excision of the HIS3 gene is used as negative selective
marker for uncut pYAC molecules. The second digestion
consists of the opening of the cloning site within the SUP4
gene (Figure 2a). As a result of this second digestion, two
linear fragments are produced as left and right arms of the
future linear YAC (Figure 2b). The selective markers are
thus separated: TRP1 adjacent to ARS1 and CEN4 on the

left arm and URA3 on the right arm. Large DNA


fragments with ends compatible to the cloning site,
obtained from the desired genome source by digestion
with an appropriate restriction endonuclease, are ligated
with phosphatase-treated YAC arms, to create a single
yeast-transforming DNA molecule (Figure 2c). Primary
transformants can be selected for complementation of the
ura3 mutation in the host, and successively for complementation of the host trp1 mutation, thereby ensuring the
presence of both chromosomal arms. Transformant
colonies containing the exogenous DNA insert within the
SUP4 gene are detected by their red colour, due to the
inactivation of the suppressor activity and the consequent
accumulation of a red metabolic precursor in ade host cells.

Biological Features of YACs


The stability of YAC vectors in yeast per se is similar to that
of natural chromosomes (10 2 5/10 2 6) provided that all
three structural elements (ARS, CEN and TEL) are present
and functional and, in addition, that the minimal required
size is reached by the insertion of enough exogenous DNA.

Cloning site
TRP1/ARS1/CEN4
BLA/ORI

SUP4

Circular YAC
TEL

(a)

URA3

HIS3 TEL
BamHI
Treatment with
restriction nucleases

TEL

TRP1/ARS1/CEN4

Left YAC arm

URA3

TEL

Right YAC arm

(b)

DNA fragments

Ligation and
yeast transformation
TEL

TRP1/ARS1/CEN4

Insert DNA

URA3

TEL

(c)
Figure 2 Construction of the yeast artificial chromosome. (a) A circular YAC vector able to replicate in Escherichia coli due to the presence of bacterial
ori and bla gene (blue cylinder) and propagated in yeast cells as a linear molecule containing all necessary chromosomal elements: yeast centromere
CEN4 (orange circle), autonomous replication sequence ARS1 (dark green cylinder) and two Tetrahymena telomeric sequences TEL (orange ellipse)
functional in yeast after linearization with the BamHI restriction endonuclease. The yeast SUP4 gene (red cylinder) contains a cloning site used as a
colour marker for selection of YACs containing exogenous insert DNA. (b) DNA fragments with ends compatible to the YAC cloning site are prepared
from source DNA. After double digestion of the YAC vector, the markers used to select for transformants are separated on two chromosomal arms: TRP1 on
the left and URA3 on the right arm (light green cylinders). (c) Chromosomal arms ligated with exogenous DNA are selected after transformation of
appropriate yeast strain (ura3, trp1, ade2). Adapted from Burke et al., (1987).

ENCYCLOPEDIA OF LIFE SCIENCES / & 2002 Macmillan Publishers Ltd, Nature Publishing Group / www.els.net

Yeast Artificial Chromosomes

However, the genetic and biochemical background of the


host cell also plays an important role in determining the
stability of YACs. Indeed, several mutations are known to
aect YAC stability and segregation together with natural
chromosomes. For example, alterations in the expressions
of genes such as BUB1, BUB2 and BUB3, MAD1, MAD2
and MAD3, CDC6, CDC20, PDS1 and others lead to
chromosome losses, including YACs. Another important
consideration is that faithful duplication of YACs is
guaranteed only if other DNA sequences incompatible
with ARS do not exist on the construct. This point is
particularly relevant when unknown DNA inserts are
cloned in the YAC vector, as is the case for genomic
libraries, in which there could be cryptic or otherwise
unknown ARS-like sequences able to interfere with the
ARS function.

Modifying YACs by Homologous


Recombination
Depending on the experimental systems and the yeast
strains, dierent selectable markers and restriction sites are
appropriate on the YAC vectors. These can be constructed
in vitro by standard techniques and then used for
subcloning DNA fragments. Additionally, existing YAC
clones can be modied by homologous recombination in
yeast, a process called retrotting (Figure 3). Accordingly,
genetic markers can be modied by simply transforming
YAC-containing yeast cells with a disruption cassette
carrying the desired genetic marker anked by short DNA
sequences homologous to one of the markers present on
the articial chromosome. The same result can be obtained
by using one arm of the articial chromosome carrying the
new genetic marker as the transforming molecule. As
shown in Figure 3a, the introduction of the yeast LYS2 gene,
together with the mammalian selectable marker Neo, into
the URA3 gene on the right arm of a YAC is achieved by
using recombination techniques. Neo is the usual marker
gene for subsequent selection of mammalian cells after
YAC transfection (see below). Moreover, disruption of
this marker provides a selectable replacement marker for
introducing specic genetic changes within the exogenous
DNA insert (Figure 3).
A yeast integrative plasmid (YIp) carrying the mutated
copy of an exogenous DNA segment and the functional
copy of a previously disrupted marker can be used for this
purpose (Barton et al., 1990). After plasmid integration,
the target DNA is duplicated in tandem via homologous
recombination, generating a YAC with one wild-type and
one mutant copy of insert DNA (pop-in). At this stage,
YACs with only the mutated copy of the marker can be
obtained after spontaneous recombination within duplicated DNA regions (pop-out) by growing the transformed cells in the absence of selection pressure for several

generations (Figure 3b). However, the frequency is not very


high (from 10 2 4 to 10 2 5 per generation) and there is
approximately the same probability for both the mutated
and wild-type copy of the marker to remain within the cell
on the YAC vector. In the latter case it is necessary to
perform additional molecular tests of the obtained popouts.

Use of Yeast Artificial Chromosomes


YAC vectors were initially created for the cloning of large
exogenous DNA segments in S. cerevisiae but soon became
chromosomal-like platforms for a variety of in vivo
experiments. Applications of YACs range from generating
whole DNA libraries of the genomes of higher organisms
to identifying essential mammalian chromosomal sequences necessary for the future construction of specialized
mammalian articial chromosomes (MACs). The availability of YAC libraries has greatly advanced the analysis
of genomes previously cloned in cosmid vectors. For
example, YAC clones have been used as hybridization
probes for the screening of cDNA libraries, thus simplifying the characterization of unidentied genes. Another
major application of YACs is in the study of regulation of
gene expression by cis-acting, controlling DNA elements,
that are present either upstream or downstream of large
eukaryotic genes, after the transfer of these YACs from
yeast to mammalian cells. Recent technological developments allow the transfer of YACs into mouse embryonal
stem (ES) cells and the subsequent generation of transgenic
mice. Investigators have begun to employ these articial
chromosomes for the in vivo study of multigenic loci in
mammalian cells.

YAC Genomic Libraries


Bacterial articial chromosomes (BACs) and the P1derived articial chromosomes (PACs) can accommodate
inserts of exogenous DNA up to 300 kb. Although this
represents an average insert size close to the one obtained
after YAC preparation in vitro, it is possible to construct
YACs with megabase-long inserts using the precise
homologous recombination process of yeast. The prerequisite for this technique is the isolation of YAC clones
containing neighbouring genomic DNA inserts. Initial
screening for specic sequences usually results in several
clones, which most probably contain overlapping inserts.
Following insert ngerprinting by conventional Southern
hybridization or polymerase chain reaction (PCR)-based
methods, using tandemly repeated sequences as markers, it
is possible to obtain detailed physical maps allowing an
accurate alignment of two inserts by comparing their
individual restriction patterns. Further neighbouring

ENCYCLOPEDIA OF LIFE SCIENCES / & 2002 Macmillan Publishers Ltd, Nature Publishing Group / www.els.net

Yeast Artificial Chromosomes

LYS2/NEO

(a)

TEL TRP1/ARS1/CEN4
Insertion of the new selective marker by
homologous recombination (retrofitting)

Insert DNA

URA3

TEL

LYS2/NEO

TEL TRP1/ARS1/CEN4

LYS2/NEO

TEL

m
URA3
Integration of the plasmid carrying mutated
copy of exogenous DNA (pop-in)

TEL TRP1/ARS1/CEN4

m
Mutated copy

URA3

Wild-type copy

LYS2/NEO

TEL

Homologous recombination between repeated


copies of exogenous DNA (pop-out)
m
Mutated copy

TEL TRP1/ARS1/CEN4

LYS2/NEO

TEL

(b)

TEL TRP1/ARS1/CEN4

LYS2/NEO TEL

TEL TRP1/ARS1/CEN4
Homologous recombination between
overlapping insert DNA sequences

(c)

TEL TRP1/ARS1/CEN4

Parental YACs

LYS2/NEO TEL
Recombinant YAC
LYS2/NEO TEL

Figure 3 YAC modification by homologous recombination. (a) New selective markers LYS2 (blue cylinder) and NEO (red cylinder) are introduced into the
URA3 gene present on YAC by one-step disruption (transformation with disruption cassette or modified right YAC arm). (b) Inactivation of the URA3 gene
allows subsequent modification of the insert DNA by using linearized yeast integrative plasmid containing a functional copy of the URA3 gene and a
mutagenized copy of the exogenous DNA fragment. After plasmid integration (pop-in), two copies of target DNA are present (wild-type and mutated). A
YAC containing only the mutated copy of the exogenous DNA is obtained after homologous recombination and loss of the integrative plasmid carrying the
wild-type equivalent (pop-out). (c) Reconstruction of two smaller overlapping YACs into a larger recombinant YAC by recombination between
homologous regions of the insert DNA (violet cylinders).

DNA inserts can be found by chromosome walking


techniques that require novel sequence information to
design DNA probes at the ends of the existing contigs.
One of these techniques is screening by hybridization
using contig ends as probes; another is screening by
PCR techniques that allow the selective amplication
of sequences composed of two neighbouring contigs.
Once clones with overlapping inserts are found, a YAC
with a continuous contig can be obtained at high frequency
by inducing meiosis in diploid yeast cells formed after
mating two haploid strains containing one each of the two
4

YACs (Silverman et al., 1990). This allows meiotic


recombination to occur between the two homologous
overlapping sequences of the inserts, thus generating a
recombinant YAC harbouring both inserts and joined at
the point of crossing-over. To prevent the generation of
mitotically unstable dicentric or acentric YACs, the insert
DNA must be cloned in the same 5 to 3 vector orientation.
After meiotic division and sporulation, spores containing a
single recombinant YAC created by the precise physical
exchange of homologous insert DNA between two
parental YACs are frequently found among tetrads

ENCYCLOPEDIA OF LIFE SCIENCES / & 2002 Macmillan Publishers Ltd, Nature Publishing Group / www.els.net

Estrategia de clonado en plsmido


Pasos:
1. Construccin de vector recombinante.
2. Transformacin de clulas competentes.
3. Plaqueo en medio selectivo con antibitico (para
seleccionar las bacterias que adquirieron el plsmido) +
IPTG y X-Gal (para identificar las bacterias que tienen
el plsmido con inserto)

4. Validacin de la presencia de inserto


mediante:
a. digestin de plsmidos de colonias + con
ER y anlisis en gel de agarosa.
b. amplificacin del inserto a partir de las
colonias (colony PCR) y gel.

Otros Vectores de clonado

Fagos filamentosos (M13). Clonado en la forma


replicativa (RF, doble cadena circular) de fagos
filamentosos (M13).
Producen ADN simple cadena

Phagemids (pBs). Combina propiedades de


plsmidos y fagos filamentosos. Posee ori de fago
filamentoso (F1, M13) y ori de plsmido (pUC).
Producen ADN circular doble cadena o simple
cadena.

Vector-T: Plsmido con extremos 5- T simple cadena.


Permite clonar productos de PCR que contienen A simple cadena en extremo -3, sin previa
digestin del vector con ER.

Vector mixto (shuttle vector)


Se puede amplificar en dos organismos diferentes.
pMDS99. Posee un ori para replicacin en bacterias (ori P15A) y otro para la
replicacin en haloarqueas (ori pHV2). Tiene dos marcadores de seleccin:
Kanamicina R para bacteria y Mevinolina R para haloarqueas.

Construccin y anlisis de
genotecas de ADN genmico

En bacterifago
Capacidad de clonado ~ 25 kbp

Bibliotecas de csmidos
Digestin parcial del ADNg
con ER de corte frecuente
(Sau3A)

Purificacin de fragmentos
de ADNg del tamao
deseado

Expresin heterloga de protenas recombinantes


El gen clonado se expresa en un tipo celular diferente al organismo de origen.
Propsito: Obtener cantidad suficiente de la protena de inters para su caracterizacin y/ o
para su aplicacin biotecnolgica.

Elementos tpicos de un vector


de expresin
La secuencia nucleotdica del inserto se
debe clonar en fase con el codn de
inicio de la traduccin (ATG) del vector.

Expresin en bacterias. (E. coli)


Ventajas:
- Fisiologa y gentica muy conocida
- Fcil manipulacin en laboratorio
- Relativo bajo costo
Desventajas:
No produce muchas de las
modificaciones post-traduccionales
requeridas para la expresin de
protenas de eucariotas

- IPTG

+ IPTG

Plsmido de expresin pET


Promotor T7 y operador lac (regin reguladora)
rbs: sitio de unin al ribosoma
Sitios mltiples de clonado dentro del gen lacZ
(NdeI contiene codn inicio traduccin ATG)
His-tag: cola de polihistidina + codn stop (TGA)
Terminador transcripcional T7

Cassette mutagnesis y
disrupcin gnica

Cassette: fragmento de ADN


sinttico, lleva gen resistencia a Ab. Se
usan para reemplazar o interrumpir un
gen y generar una mutacin.
Disrupcin gnica por cassette
mutagnesis
Se anula la funcin de un gen dado por
mutagnesis por insercin. Genera
mutacin knockout (KO).
En procariotas (haploides) las clulas
KO son viables slo si el gen no es
esencial.
El plsmido con el cassette se linealiza
para impedir su replicacin en la
bacteria transformada, por la tanto, las
clulas resistentes surgen por RH y
poseen slo una copia del gen (la
mutante por insercin)

cada etapa de la reaccin. La automatizacin del proceso se debe


al descubrimiento de la enzima Taq polimerasa termoestable,
extraida del Thermus aquaticus2, que elimin el inconveniente de
agregar enzima fresca en cada paso de la reaccin.

Fig 1.- Equipo (maquina de PCR), utilizado para la amplificacin del


ADN. La maquina se programa con las temperaturas necesarias
para cada paso de la reaccin y todo el proceso de amplificacin se
realiza automticamente.

En la actualidad, la PCR es una tcnica de rutina indispensable en


laboratorios de investigacin mdica y biolgica con una gran
variedad de aplicaciones.
La clonacin del ADN para la secuenciacin, la filogenia basada en
el ADN, el anlisis funcional de genes, el diagnostico de trastornos
hereditarios, la identificacin de huellas genticas (usada en
tcnicas forenses y prueba de paternidad), taxonoma, la deteccin
y diagnostico de enfermedades infecciosas, son algunas de las
aplicaciones donde la PCR ha sido implementada como una
tcnica de gran valor.
Componentes de la PCR
Desoxinucletidos trifosfato (dNTPs). Es una mezcla de deoxi nucletidos que sirve de sustrato para la sntesis de nuevo ADN.

Iniciadores (primers). Dos oligonucletidos que son, cada uno,


complementarios a una de las dos hebras del ADN. Son secuencias
cortas, de entre 10-30 nucletidos, que son reconocidos por la
polimerasa permitiendo iniciar la reaccin. Deben estar enfrentados
(uno en cada hebra del ADN), para delimitar el fragmento a
amplificar).
ADN polimerasa. El descubrimiento en 1976 de la Taq polimerasa,
una ADN polimerasa extrada de la bacteria termfila Thermus
aquaticus que habita medios de muy alta temperatura (50-80 C),
elimin los grandes inconvenientes del mtodo de la PCR. Esta
ADN polimerasa es estable a altas temperaturas, permaneciendo
activa hasta despus de la desnaturalizacin del ADN
ADN molde. Molcula que contiene la regin de ADN que se va a
amplificar.
Etapas de la PCR
La PCR consiste en una serie de cambios repetidos de temperatura
llamados ciclos. Por lo general el nmero de ciclos es de 20 a 30,
cada ciclo consiste en tres cambios de temperatura. Las
temperaturas usadas y el tiempo aplicado en cada ciclo, dependen
de algunos parmetros en los que se incluye, la enzima usada para
la sntesis de ADN, la concentracin de iones divalentes y dNTPs
en la reaccin as como la temperatura de unin de los iniciadores
3
.

Desnaturalizacin del ADN


En la primera etapa, la reaccin es llevada a una temperatura de
94-96C y se mantiene entre 30 segundos y un minuto. A estas
temperaturas el ADN se desnaturaliza (se separan las dos hebras
que lo constituyen). La temperatura a la cual se decide llevar a cabo
esta etapa va a depender de la proporcin de Guanina-Citocina
(G-C) que tenga la hebra, as como tambin del largo de la misma.
Alineamiento/Unin del iniciador a la secuencia
complementaria

En la segunda etapa tambin conocida como hibridacin, los


iniciadores se unen a las regiones 3`complementarias que
flanquean el fragmento que se quiere amplificar. Para ello, es
necesario bajar la temperatura a 50-65C durante 20-40 segundos,
permitiendo as el alineamiento. La polimerasa se une entonces al
hibrido formado por la cadena molde y el iniciador y empieza la
sntesis del ADN. Los iniciadores actan como lmite de la regin de
la molcula que va a ser amplificada.
Extensin/Elongacin de la cadena
En la tercera etapa, la polimerasa sintetiza una nueva hebra de
ADN complementario a la hebra molde, aadiendo los dNTPs
complementarios en direccin 5` 3` uniendo el grupo 5`-fosfato
de los dNTPs con el grupo 3`-hidroxilo del final de la hebra de ADN
creciente. La temperatura en esta etapa depende de la ADN
polimerasa que se utilice. Para la Taq polimerasa, la temperatura
de mxima actividad est entre 74-80C, aunque por lo general se
usa 74C. El tiempo de elongacin va a depender del tipo de
polimerasa empleado, as como tambin del tamao del fragmento
de ADN que se requiere amplificar.
Elongacin final
En la cuarta etapa, la temperatura es regulada de 70-74C durante
5-15 minutos tras el ltimo ciclo de PCR, con el objeto de asegurar
que cualquier ADN de cadena simple restante sea totalmente
amplificado.
Por ltimo, el producto amplificado es mantenido a una temperatura
de 4C por un periodo indefinido lo cual permite conservar el
producto de la reaccin
Para comprobar que la PCR ha generado el fragmento de ADN
esperado, se emplean tcnicas como la electroforesis, que permite
separar los fragmentos de ADN generados de acuerdo a su tamao.
Por lo general se emplea la electroforesis en gel de agarosa para
fragmentos grandes, en acrilamida para fragmentos ms pequeos
y asociada a marcaje fluorescente as como la electroforesis
capilar3, 4

Fig 2.- Equipo de electroforesis utilizado para la separacin de los


productos amplificados por la PCR.
La deteccin del producto de la Reaccin en Cadena de la
Polimerasa se realiza normalmente mediante una corrida
electrofortica. Dependiendo del tamao del producto de la
amplificacin y la resolucin que se desea, se utilizan diferentes
matrices de separacin (agarosa, poliacrilamida) a distintas
concentraciones. La posterior visualizacin se puede realizar con
bromuro de etidio con una lmpara de luz UV, tincin de plata,
fluorescencia o radioactividad.
De igual forma, la identidad del producto puede ser confirmada
mediante hibridacin (unin complementaria) con una sonda
marcada radiactivamente, cuya secuencia de bases est contenida
en el fragmento de inters.
Los tamaos de los productos de PCR se determinan comparando
los mismos, con marcadores que contienen fragmentos de ADN de
tamao conocido los cuales se corren en el gel junto a los productos
de PCR.

Fig 4:_ Representa de manera esquemtica el proceso de


amplificacin a partir del ADN extrado de la muestra. En cada ciclo
se duplica el nmero de copias del ADN que se amplifica

Contaminacin en la PCR
La reaccin en cadena de la polimerasa PCR es una tcnica
altamente sensible y especifica, por lo que es muy importante evitar
contaminaciones que puedan dar origen a la amplificacin de ADN
no deseado.
La contaminacin con ADN extrao puede solucionarse con
protocolos y procedimientos que separen las reacciones pre-PCR
(mezcla de todos los componentes de la reaccin), del ADN molde.
Esto normalmente implica la separacin espacial de las reas de
realizacin de la PCR de los de anlisis o purificacin de los
productos, as como la limpieza exhaustiva de la superficie de
trabajo entre la realizacin de un PCR y el siguiente.

Tipos de PCR
PCR anidada
En esta variante de PCR, el producto de una amplificacin es
utilizado como molde para realizar una segunda amplificacin con
iniciadores que se ubican dentro de la primera secuencia
amplificada. Este tipo de PCR es altamente especfica 5
PCR in situ
Es una PCR que se realiza en preparaciones fijadas sobre un
portaobjeto. Consiste en una reaccin de PCR en secciones
histolgicas o clulas, donde los productos generados pueden
visualizarse en el sitio de amplificacin. Se realiza para ello una
primera amplificacin del ADN blanco y luego deteccin mediante
hibridacin in situ convencional con sondas de ADN/ARN. De esta
manera puede detectarse cantidades pequesimas del material
gentico 6

PCR multiplex
Es una PCR en la cual se amplifica ms de una secuencia en una
misma reaccin. Emplea dos o ms pares de iniciadores en un
nico tubo de reaccin con el fin de amplificar simultneamente
mltiples segmentos de ADN. Consiste en combinar en una nica
reaccin todos los pares de iniciadores de los sistemas que
queremos amplificar simultneamente, junto con el resto de los
reactivos de la reaccin en cantidades suficientes. La ventaja de
esta PCR es que se obtiene la informacin de varios loci en una
sola reaccin, utilizando menor cantidad de molde para el anlisis y
menor cantidad de reactivos. Se puede generar rpidamente la
construccin de una base de datos 7.
RT-PCR
Este tipo de PCR utiliza como molde inicial el ARN y se requiere de
una transcriptasa inversa, para realizar la conversin del ARN a un
tipo de ADN llamado ADNc (ADN complementario) 8.

PCR tiempo real


Es una reaccin de PRC cuya principal caracterstica es que
permite cuantificar la cantidad de ADN o ARN presente en la
muestra original 9. Se puede dividir en:
a- Tcnica basada en fluorocromos no especficos.
b- Tcnica basada en sondas especficas.
En las tcnicas basadas en fluorocromos no especficos, el ADN se
une al fluorocromo (por lo general SYBR Green) produciendo
fluorescencia que es medida por un termociclador apto para PCR
en tiempo real. Permite cuantificar slo una secuencia por reaccin,
pero tiene la ventaja de utilizar iniciadores normales para su
realizacin. Es mucho ms econmica que la PCR que utiliza
sondas especficas.

Las tcnicas basadas en sondas especficas utilizan una sonda


unida a dos fluorocromos que hibrida en la zona intermedia entre el
iniciador directo (forward) y el inverso (reverse). Cuando la sonda
esta intacta, presentan una transferencia energtica de
fluorescencia por resonancia (FRET). Dicha fluorescencia no se
produce cuando la sonda esta daada y los dos fluorocromos estn
distantes, producto de la actividad 5`3`exonucleasa de la ADN
polimerasa. Esto permite monitorizar el cambio de patrn de
fluorescencia y deducir el nivel de amplificacin del gen.

Random Primer PCR


Esta variante de la tcnica es muy sensible y especifica, es muy til
en el estudio y diagnstico de organismos de una misma especie
con variaciones genticas especificas. Su aplicacin permite la
amplificacin de molculas de ADN y genomas que varan entre
400 pares de bases hasta 40 Mega bases. La tcnica utiliza primes
que consisten en un pool de de secuencias de los extremos 3 del
ADN y una regin 5 constante para la deteccin del primer
incorporado 10.

Aplicaciones
El diagnstico molecular est revolucionando la prctica clnica de
enfermedades infecciosas. Sus efectos sern importantes en la
configuracin de la atencin de casos agudos donde oportunas y
precisas herramientas de diagnstico son esenciales para las
decisiones de tratamiento del paciente y los resultados. PCR es la
tcnica molecular ms desarrollada hasta ahora y tiene una amplia
gama de aplicaciones clnicas, incluyendo la deteccin de
patgenos especficos o de amplio espectro, evaluacin de las
infecciones emergentes, la vigilancia, la deteccin temprana de
agentes biolgicos y la creacin de perfiles de resistencia a los
antimicrobianos. Los mtodos basados en PCR tambin pueden
asociarse a los procedimientos tradicionales de diagnstico. Otro
avance de la tecnologa es necesario para mejorar la

automatizacin, optimizar la sensibilidad y especificidad y expandir


la capacidad para detectar varios organismos simultneamente. 11
La PCR convencional es utilizada como base para un gran nmero
de tcnicas en el laboratorio debido a su especificidad y rapidez.
Permite identificar especies de bacterias que producen
determinados cuadros infecciosos. Esto se consigue, amplificando
cierta zona del genoma bacteriano cuyo producto de PCR posea
caractersticas particulares que permitan identificar de una manera
inequvoca la bacteria o agente causal.
En el caso de infecciones virales, que implican la integracin del
genoma del patgeno en el ADN del hospedador, como es el caso
de la infeccin por VIH, la PCR cuantitativa posibilita la
determinacin de la carga viral existente y por tanto, del estadio de
la enfermedad 12, 13
De igual manera, la PCR es usada en servicios de donantes de
sangre para test de rutina. Mediante la implementacin de la PCR,
se pueden detectar infecciones peligrosas en el donante (HIV,
Hepatitis B) mientras an estn en el perodo de incubacin.
A su vez, en el diagnostico de enfermedades hereditarias
presentes en el genoma, en las cuales los procedimientos se
presentan largos y engorrosos, la PCR ha venido a facilitar este
problema, amplificando mediante iniciadores correspondientes los
diferentes genes para la identificacin de mutaciones existentes14.
En dermatologa, la aplicacin de la PCR en las enfermedades de
la piel ha permitido conocer los mecanismos ntimos de muchas
entidades, facilitando su diagnstico e incluso su tratamiento. Esta
tcnica es ampliamente utilizada en el diagnstico de enfermedades
de la piel producida por parsitos, virus y bacterias; tales como
leishmaniasis 15, lepra 16, oncocercosis 17 y virus de papiloma 18,
entre otras, ampliamente reportadas en la literatura.
En la fig 5 se muestra un ejemplo de una reaccin de polimerasa
utilizada para el diagnstico de leishmaniasis cutnea producida por
Leishmania braziliensis.
La reaccin se lleva a cabo un par de oligonucleotidos obtenidos a
partir de una secuencia repetida de ADN nuclear de Leishmania

Gua prctica sobre la tcnica de PCR 517

Captulo 17

Gua prctica sobre


la tcnica de PCR
Laura Espinosa Asuar

PCR son las siglas en ingls de Polymerase Chain Reaction o Reaccin en


Cadena de la Polimerasa. La idea bsica de la tcnica es sintetizar muchas
veces un pedazo o fragmento de ADN utilizando una polimerasa que puede
trabajar a temperaturas muy elevadas, ya que proviene de la bacteria Thermus aquaticus que vive a altas temperaturas (79C a 85C), de ah su nombre
comercial ms conocido: taq polimerasa. Cuando hacemos una reaccin de
PCR simulamos lo que sucede en una clula cuando se sintetiza el ADN y en
el tubo se mezclan todos los ingredientes necesarios para hacerlo: la polimerasa, el ADN del organismo que queremos estudiar donde se encuentra el
fragmento que queremos sintetizar , los oligonucletidos (llamados tambin
primers, iniciadores, cebadores, oligos, etc.) necesarios para que se inicie la
transcripcin, dinucletidos (dNTPs), y las condiciones para que la enzima
trabaje adecuadamente (cierto pH, determinadas cantidades de magnesio en
forma de MgCl2, KCl, y pueden necesitarse otras sales o reactivos, dependiendo
de cada polimerasa). Esta tcnica tan ingeniosa tiene muchsimas aplicaciones
distintas y se ha convertido en una herramienta muy importante en la biologa
molecular; sus aplicaciones van desde la gentica de poblaciones, evolucin
molecular y genmica hasta la medicina forense.
Pero cmo funciona el PCR? Supongamos que ya tenemos los tubos listos
con todo lo necesario para que la sntesis del fragmento que nos interesa que
se lleve a cabo (taq polimerasa, dinucletidos, ADN, agua, buffer con mag517

518 Las herramientas moleculares

nesio y otras sales, y oligonucletidos). El siguiente paso es colocar los tubos


en una mquina conocida como termociclador, que bsicamente sirve para
calentarlos o enfriarlos a temperaturas muy precisas. Cmo es que se amplifica el (o los) fragmento(s) que queremos? Primero, para hacer ms sencilla la
explicacin, vamos a suponer que esperamos un solo fragmento de un tamao
determinado, y lo que sucede es lo siguiente (ver el primer ciclo de la figura 1):
el termociclador calienta o enfra los tubos a tres temperaturas distintas, que
se repiten una y otra vez (lo que se llama los ciclos de reaccin), la primera es
a 95C (y a este paso se le llama desnaturalizacin) durante la cual las dobles
cadenas del ADN se abren o desnaturalizan, quedando en forma de cadenas
sencillas; despus el termociclador ajusta la temperatura en un intervalo entre 40 y 60C (llamada de alineamiento), a esta temperatura se forman y se
rompen constantemente los puentes de hidrgeno entre los oligonucletidos
y el ADN, y aquellas uniones ms estables (las que son complementarias)
durarn mayor tiempo, quedando los oligonucletidos alineados formando
una pequea regin de doble cadena. La polimerasa se une a este pequeo
pedazo de ADN de doble cadena y comienza a copiar en sentido 5 a 3; al
agregar unas bases ms, los puentes de hidrgeno que se forman entre las bases
estabilizan ms la unin y el oligonucletido permanece en este sitio para el
siguiente paso. Despus la temperatura sube a 72C (paso que se conoce como
extensin), ya que 72C es la temperatura en la cual la polimerasa alcanza su
mxima actividad, y contina la sntesis de los fragmentos de ADN a partir
de los oligonucletidos que ya se haban alineado.
En el primer ciclo, con estas tres temperaturas, se sintetizarn los primeros fragmentos a partir del ADN genmico. Estos primeros fragmentos no
tendrn el tamao esperado, sern un poco ms grandes ya que la taq copiar
hasta donde le sea posible, pero como veremos ms adelante, se obtendrn
en cantidades tan pequeas que al final no podremos detectarlos. Despus
se repiten una vez ms las tres temperaturas, pero en este segundo ciclo, los
oligonucletidos, adems de unirse al ADN que pusimos al inicio, tambin se
unirn a los fragmentos recin sintetizados del primer ciclo (ver segundo ciclo
de la figura 1), por lo tanto en este segundo paso la polimerasa sintetizar 2
fragmentos largos copiados directamente del ADN y 2 fragmentos del tamao
esperado, que es el tamao que hay entre los dos oligonucletidos que hemos
usado. De esta forma con cada ciclo aumentar el nmero de fragmentos del
tamao que queremos. Cabe mencionar que antes y despus de estos ciclos
se programan dos pasos, uno de 95C durante varios minutos para iniciar
con desnaturalizacin, y al final de los ciclos, un paso ltimo de extensin a

Gua prctica sobre la tcnica de PCR 519

Figura 1. Descripcin del proceso de un PCR en los primeros ciclos de reaccin.


Comnmente se utilizan 35 ciclos para amplificar el fragmento que se requiere
(modificada de Parkes, 2003)
Primer ciclo
Desnaturalizacin del ADN
Alineamiento de los oligos

Extensin
Se sintetizan dos fragmentos un poco ms
largos de lo esperado

Segundo ciclo

(Se muestra slo la alineacin y la extensin)

Se amplifica otra vez la cadena de ADN

Y se amplifican los fragmentos generados


en el primer ciclo. As se obtienen los 2
primeros fragmentos del tamao esperado

Tercer ciclo

(Se muestra slo la extensin)

Se sintetizan ms fragmentos del tamao experado, amplificndose los fragmentos largos de los ciclos
1y2

Se amplifican tambin los fragmentos del


tamao esperado obtenidos en el ciclo 2

Y por ltimo, se amplifican 2 fragmentos


largos sobre la cadena de ADN

Fuente: Parkes H. 2003. Food for Thought http://www.chemsoc.org/chembytes/ezine/1999/parkes_


may99.htm, accesado 08/03.

72C para permitir que la taq termine de sintetizar todos los fragmentos que
pueden haber quedado incompletos.

520 Las herramientas moleculares

Para este tipo de PCR es necesario que uno de los oligonucletidos tenga
la misma secuencia que se encuentra en una de las cadenas del ADN, y el otro
deber llevar la secuencia complementaria que estar al final del fragmento
que se quiere amplificar (por lo cual se les llama forward y reverse) para que
uno sea complementario a la cadena que forma el otro; si no es as no podra
amplificarse el sitio que se necesita. Como cada pedazo sintetizado sirve como
base para sintetizar otros en el siguiente ciclo, el nmero de copias aumentar en forma exponencial (ver tercer ciclo de las figuras 1 y 2). Con una sola
molcula de ADN, en el ciclo 1 se producen 21=2 nuevos fragmentos, en el
ciclo 2 sern 22, esto es, 4 fragmentos recin sintetizados, y as, con 35 ciclos
de PCR se producirn 21+22+ 234+235= 236 nuevos fragmentos, de los cuales
slo 70 sern fragmentos de un tamao mayor al esperado (2 por cada ciclo)
obtenidos al sintetizarlos directamente del ADN genmico; esta pequea
cantidad es casi imposible de detectar al analizar nuestros productos.

Tipos de tcnicas
El PCR tiene diferentes mtodos o aplicaciones en funcin de lo que nos interese investigar (como son los RAPDs, AFLPs, ISSRs, SSCP. vase los captulos
18 y 19 de este libro) y el primer paso es tener claro el tipo de informacin que
necesitamos para elegir o disear la estrategia ms apropiada para nuestro
trabajo. Brevemente podemos dividir la tcnica en dos categoras:
Figura 2. En una reaccin de PCR los fragmentos se amplifican en forma exponencial
(tomado de Vierstraete, 2001)
4to ciclo
Gen buscado

Ampliacin exponencial

3er ciclo
2do ciclo

Plantilla de ADN

1er ciclo

2 =
2 copias

Ciclo 35

22 =
8 copias

8 copias

16 copias

Gua prctica sobre la tcnica de PCR 521

1) PCRs para la amplificacin de un solo sitio conocido del genoma (locus).


Estos PCRs requieren conocer la secuencia que se trabaja (por ejemplo
cuando amplificamos un gen especfico como el 16S), en cuyo caso se
utilizan oligonucletidos diseados a partir de la secuencia de ese gen y
se obtiene un solo fragmento de un tamao ya conocido. Con este tipo de
PCRs es posible hacer filogenias, y para obtener los datos hay distintos caminos: desde hacer geles especiales que detectan cambios hasta de una sola
base entre las secuencias (SSCP), hasta utilizar enzimas de restriccin para
generar patrones de cada individuo, aunque lo ideal es obtener la secuencia
completa del gen que amplificamos, sobre todo cuando se desea responder
a preguntas relacionadas con las fuerzas evolutivas que han actuado sobre l.
El gen secuenciado puede ser analizado desde varias perspectivas y muchas
de ellas se encuentran en los diversos captulos de este libro.
2) PCRs en los que no es necesario conocer la regin que se est amplificando (se amplifican regiones no conocidas, como zonas hipervariables del
genoma), por lo cual no se sabe el tamao del fragmento (o fragmentos)
que se esperan. stos se utilizan para determinar polimorfismo genmico
y son los ms comunes para fingerprint, ya que es sencillo obtener los
datos (un gel de agarosa despus del PCR es suficiente), se observan varios
loci simultneamente y la informacin de las zonas variables permite
inferir los datos necesarios para anlisis de gentica de poblaciones. En
general este tipo de PCRs utiliza un solo oligonucletido con 2 caractersticas importantes: que sea de pequeo a mediano (de 6 a 18 bases) y
sobre todo que su secuencia est presente muchas veces en el ADN del
organismo que estudiamos. Existen zonas repetidas hipervariables del
ADN que pueden amplificarse de esta manera, por ejemplo los sitios
que sirven para iniciar la sntesis de ADN en los cromosomas, conocidas
como microsatlites. En el primer ciclo de reaccin lo que suceder es
que el oligonucletido utilizado hibridar en distintas zonas del ADN,
y primero comenzarn a sintetizarse fragmentos de tamaos variables e
indefinidos (hasta donde la polimerasa logre copiarlos). En el segundo
ciclo las cadenas sintetizadas a partir de las primeras copias formadas
sern del tamao que existe entre dos oligonucletidos que no estn muy
alejados entre s. Estos fragmentos se copiarn una y otra vez, y de esta
manera al final obtendremos muchos fragmentos de tamaos diferentes,
de los que conoceremos la secuencia con que inician y terminan, pero
no la secuencia completa de cada uno. En la figura 3 se explica con ms
detalle un PCR de este tipo.

522 Las herramientas moleculares


Figura 3. Los PCR que amplifican zonas no conocidas utilizan oligonuclotidos pequeos
y amplifican zonas repetidas en el genoma (tiomado de Harlocker, 2003)
Primer ejemplo
1

ADN
Reaccin de PCR

Fragmento A

Fragmento B

Supongamos que hacemos una reaccin de PCR con un individuo hipottico utilizando un oligo para
microsatlites. En este primer ejemplo el oligo ha hibridado en el ADN en 6 sitios diferentes, y al amplificar se generan 2 fragmentos:
1) Fragmento A es sintetizado a partir de la secuencia de ADN que se encuentra entre los oligos que se
han unido en las posiciones 2 y 5
2) El fragmento B es sintetizado a partir de los oligos unidos en las posiciones 3 y 6.
No hay productos de PCR entre las posiciones 1 y 4 ya que estn muy lejos entre s como para permitir
que ocurra la reaccin de PCR. Los oligos unidos a las posiciones 4 y 2 5 y 3 tampoco amplifican ya
que no estn orientados uno hacia el otro.

Segundo ejemplo
1

3
4

ADN
Reaccin de PCR

Fragmento B

En el segundo ejemplo hay que suponer que es un individuo que tiene un cambio en el segundo sitio, y
el oligo no se ha unido en la segunda posicin, por lo tanto slo se genera el fragmento B.

532 Las herramientas moleculares

de las bolsas (de marcas certificadas, libres de ADNasas, ARNasas y ADN),


con lo cual logramos eliminar la contaminacin.
Adems del control negativo que nos permite visualizar posibles casos de
contaminacin, una vez que se ha ajustado el protocolo de nuestro PCR es
siempre recomendable incluir un control positivo. ste es un tubo que contiene
ADN de una muestra que haya amplificado adecuadamente y cuyo patrn
de bandas es conocido. De esta manera, puede esperarse que si la reaccin
se llev a cabo correctamente, esta muestra siempre salga. En caso contrario,
si nuestro PCR no gener bandas en ninguna de las muestras, ni siquiera en
el control positivo, puede suponerse que el error radica en que se nos olvid
agregar algn ingrediente o bien que los ciclos de temperatura no se llevaron
a cabo adecuadamente, ya sea por problemas de la mquina o bien por error
al elegir el programa de amplificacin.

Mtodos para visualizar el PCR


Principios bsicos de la electroforesis
La idea ahora es poder analizar el o los fragmentos obtenidos en el PCR, y
la electroforesis, ya sea en geles de agarosa o de acrilamida, permite separar
estos fragmentos de acuerdo al tamao de cada uno. Tanto la agarosa como
la acrilamida forman una especie de red con agujeros de tamaos diferentes,
por la cual obligamos a pasar los fragmentos de ADN, jalndolos a travs
de corriente elctrica, hacia el polo positivo, ya que la carga de una molcula
de ADN es negativa por la presencia de grupos fosfato (P-). Los fragmentos
ms pequeos pasarn primero a travs de la red de agujeros, mientras que
los ms grandes se irn retrasando y atorando en los hoyos; de esta manera
los fragmentos de tamaos similares migrarn a ritmos similares. Si hay muchos fragmentos de un mismo tamao se agruparn todos juntos, por lo que
podremos verlos formando lo que llamamos una banda en el gel.
Hacemos nuestro gel con agarosa o acrilamida? Las molculas de acrilamida forman redes con tamaos de poros ms uniformes y ms pequeos que la
agarosa, por lo que este tipo de gel es til si los tamaos de los fragmentos que
manejamos son pequeos; la separacin puede ser tan fina que con algunas
tcnicas es posible separar molculas de ADN que tienen una sola base de
diferencia. El problema es que las tcnicas de acrilamida son muy laboriosas
y la tincin con plata (si no quiere usarse radioactividad) tiene muchos trucos, por lo que en este apndice slo anotaremos algunas recetas para lo ms

Gua prctica sobre la tcnica de PCR 533

sencillo, que son los geles de agarosa. Para ms informacin sobre geles de
acrilamida pueden consultarse los sitios de internet que sugerimos al final del
captulo. La agarosa no forma redes tan uniformes, pero permite separar las
molculas de ADN en un intervalo muy grande. Utilizarla es muy sencillo y
teir los geles tambin lo es.
a) Mtodos para geles de agarosa
Ser necesario tener en el laboratorio equipo que nos permita trabajar con
los geles: una cmara de electroforesis, una fuente de poder, un transiluminador de luz UV y equipo de fotografa (lo ms sencillo: una cmara polaroid, un
filtro para luz UV y un cono adaptado a la cmara, o tambin existen cmaras
especiales y equipo de cmputo especfico para ello) para guardar la imagen
del gel. Para empezar hay que preparar el buffer de corrida, el cual tendr el
pH requerido y los iones necesarios para que fluya la corriente y pueda migrar
el ADN. Si en lugar de buffer utilizramos agua, el ADN se quedara inmvil
y no veramos migracin en los geles, y si por el contrario utilizramos un
exceso de sales, el gel se calentara tanto que al final acabara por derretirse.
El buffer ms comn es el TBE (Tris Boratos EDTA), que por ser muy estable
puede reutilizarse varias veces. Tambin se utiliza con frecuencia el buffer TAE
(Tris Acetatos EDTA), que es menos estable que el TBE y tiende a ionizarse
ms rpido, pero permite obtener mejor separacin de bandas, sobre todo
si son de gran tamao (1 kb o ms). Las recetas para preparar stas y otras
soluciones estn al final de este apartado. Dependiendo del tamao de los
fragmentos que esperamos se utilizar una concentracin de agarosa mayor o
menor para obtener agujeros menos o ms grandes y una mejor resolucin de
nuestras bandas. Si no conocemos el tamao, se puede empezar con agarosa
al 1%, pero si se conoce, se puede usar esta tabla como gua:
Rango efectivo de separacin (kb)
30 a 1
12 a 0.8
10 a 0.5
7 a 0.4
3 a 0.2

Agarosa (%)
0.5
0.7
1.0
1.2
1.5

Fuente: Tomado de Sosnick, 2003.

La agarosa se disuelve en el mismo buffer que utilizaremos para la corrida,


y se calienta hasta ebullicin para disolver bien el polvo. Hay que tener cuidado

534 Las herramientas moleculares

de retirarla del calor o del microondas en cuanto comienza a hervir, pues podra
derramarse. Si es un gel muy importante, en el laboratorio pesamos el matraz
donde se prepara el gel antes y despus de calentarlo, y le agregamos el agua
que haya perdido durante el calentamiento, para asegurar que la concentracin de agarosa sea la correcta. La solucin se agitar suavemente para evitar
la formacin de burbujas, y cuando se enfre un poco (aprox. 60C) se vierte
de una sola vez en el contenedor de geles al que ya le colocamos el peine para
que se formen los pozos en donde cargaremos las muestras. Si quedan algunas
burbujas, rpidamente con la punta de una pipeta podemos picarlas y quitarlas;
si se dejan pueden hacer que la electroforesis no migre en forma homognea.
Cuando se enfre y solidifique agregamos el buffer necesario hasta cubrir BIEN
el gel (hemos visto que de esta forma el peine se puede quitar ms fcilmente), y
despus se retira el peine con cuidado para no romper el fondo de los pozos.
b) Cargando el gel
Con una pipeta, cada muestra se vierte en un pozo, mezclada previamente
con 1 2 microlitros de colorante de corrida (receta al final). Generalmente los
colorantes de corrida llevan alguna sustancia espesa, como glicerol o sacarosa,
que permite que la muestra caiga hacia el fondo del pozo, y los colorantes
(como el xilen-cianol o azul de bromofenol) nos dan una idea de cmo van
migrando los fragmentos (en un gel de agarosa al 1%, el azul de bromofenol
migra junto con los fragmentos de 300 pb, y el xilen-cianol migra igual que
los fragmentos de 4 kb). No es necesario utilizar toda la muestra de PCR en
una corrida, puede utilizarse del 10% al 20% de la cantidad total del PCR que
hicimos (i.e. si en total son 50 l, se cargarn 5 l de muestra).
Nosotros en un parafilm depositamos unas gotitas de colorante (las necesarias para el nmero de muestras que usemos) y despus agregamos la
gotita de la muestra a cargar sobre la gota de colorante. Con cuidado de no
hacer burbujas las mezclamos subiendo y bajando con la pipeta. La punta
de la pipeta se mete un poco en el pozo (sin romperlo!) y lentamente se
vaca la pipeta para cargar el gel. Para que las muestras no se derramen y no
se mezclen unas con otras hay que evitar llenar el pozo hasta arriba. Por lo
menos un carril del gel siempre deber tener un marcador de peso molecular
(muchas casas comerciales los venden) como control para saber el tamao de
las bandas que tendremos. Tampoco debe olvidarse poner en el gel los controles negativo y positivo. El PCR sobrante lo guardamos congelado a -20C
por si lo necesitamos despus. Cuando el gel est listo se conectan los cables,
lo ms comn es un cable rojo para conectarlo al polo positivo y uno negro

Gua prctica sobre la tcnica de PCR 535

en el negativo. El ADN migrar hacia el polo positivo ya que los fosfatos de


la molcula le confieren carga negativa, por lo que hay que asegurarse que
la corrida del gel sea HACIA el cable rojo, o polo positivo. Para el voltaje, se
recomienda utilizar 5 volts por cada centmetro que exista entre los dos electrodos de nuestra cmara (i.e. si la cmara mide 30 cm se correr a 150V), esta
medida se aplica cuando tenemos fragmentos grandes, de ms de 2 kb; para
un PCR con fragmentos pequeos, de 100 pb hasta 1 kb, nosotros utilizamos
casi siempre 90 a 100 volts para geles chicos y/o grandes, y los dejamos 1 2
horas, dependiendo del largo del gel.
c) Tincin del gel
Lo ms comn es utilizar bromuro de etidio, que es una molcula con dos
propiedades importantes: se intercala en las bases del ADN y brilla con luz
UV a una longitud de onda determinada (264-366 nm) con lo cual podemos
observar las bandas de ADN en el gel. El bromuro de etidio es un mutgeno
y es altamente txico, por lo cual es necesario utilizar guantes y bata para su
manejo. Es recomendable apartar un rea del laboratorio y material exclusivo
para su uso. Los geles con bromuro debern juntarse y desecharse con alguna
compaa de desechos txicos, as como las puntas y guantes contaminados.
Las soluciones con bromuro pueden inactivarse, al final hay una lista de 3
sitios en los que dan indicaciones de cmo hacerlo. Si de derrama una pequea cantidad, hay que absorber muy bien con toallas de papel y despus
con alcohol (las toallas se juntan en una bolsa para inactivar el bromuro que
quede en ellas). Cuando no estamos seguros si algo est o no contaminado
con bromuro lo exponemos a la luz UV y si no hay fluorescencia es que no hay
bromuro. Hay dos maneras de teir el gel: cuando la agarosa est a unos 60C,
antes de vertirla, se aade el bromuro de etidio directamente para que quede a
una concentracin de 0.5 g/ml en el gel. De esta forma al terminar la corrida
puede verse el gel. La desventaja es que el bromuro retarda la migracin de las
molculas de ADN, y adems la cmara de electroforesis queda contaminada
con el bromuro, es por esto que hay quien prefiere teirlo despus de la corrida:
el gel se sumerge en una solucin de 0.5 g/ml de bromuro de etidio por 30 a
40 mn y as no se contaminan las cmaras y el ADN migra ms rpido, pero
es un mtodo ms lento. Para los dos mtodos ser necesario preparar una
reserva de bromuro de etidio como se indica al final del captulo.Al terminar
se pone el gel en el transiluminador para verlo. La luz UV puede daar la piel
y los ojos, por lo que ser necesario protegerse a travs de un acrlico especial
y protectores de la cara y/o los ojos.

542 Las herramientas moleculares

raramente ms de cien caracteres (Sanderson y Donoghue, 1989). Los datos


moleculares tambin tienen la ventaja de trabajar directamente con la base
gentica de la variacin, mientras que la base gentica de la mayora de los
caracteres morfolgicos se asume. Asimismo, en el acercamiento molecular
los caracteres se pueden seleccionar y definir de una manera relativamente
objetiva (Hillis y Wiens, 2000).
En los estudios morfolgicos, en cambio, los caracteres deben ser descubiertos y delimitados generalmente sin ningn criterio explcito para la
seleccin o la codificacin del carcter, por lo que tienen el potencial de ser
arbitrarios. Por ejemplo, los morfologistas no divulgan generalmente sus
criterios para incluir o excluir caracteres y cuando se dan los criterios, varan
considerablemente entre estudios (Hillis y Wiens, 2000).
Sin embargo, tienen la ventaja de permitir un muestreo taxonmico mucho ms cuidadoso que el que se realiza con anlisis moleculares, lo que es
importante para las revisiones sistemticas, los estudios de la evolucin del
carcter y la valoracin filogentica. Asimismo, los especmenes de museo
ofrecen muchos caracteres morfolgicos para una gran cantidad de taxa,
mientras que un muestreo de este tipo para un estudio molecular puede ser
difcil por el alto costo de la secuenciacin, la necesidad de material relativamente fresco y la inaccesibilidad de las reas donde se distribuyen algunos
de ellos (Hillis y Wiens, 2000).
La morfologa es tambin la nica manera en que la mayora de los taxa
fsiles pueden analizarse filogenticamente y las especies extintas no slo
representan una gran proporcin de la biodiversidad de la tierra, sino que
tambin pueden ser cruciales para el entendimiento de las relaciones entre
los taxas vivos (Smith, 1998).
De lo anterior se puede apreciar que tanto los acercamientos moleculares
como morfolgicos tienen ventajas y desventajas; que ambos enfoques siguen
desempeando un papel crucial en casi todos los grupos de organismos y
que hasta nuestros das las especies se describen y se identifican con base en
ambas clases de datos.

Marcadores moleculares
Los marcadores moleculares son una herramienta necesaria en muchos
campos de la biologa como evolucin, ecologa, bio-medicina, ciencias
forenses y estudios de diversidad. Adems se utilizan para localizar y aislar
genes de inters. En la actualidad existen varias tcnicas moleculares que

Breve revisin de los marcadores moleculares 543

nos permiten conocer cmo se encuentran las proporciones de genes en


las poblaciones naturales de manera indirecta, como con los anlisis de
protenas, o de manera directa con estudios de ADN. Los diferentes tipos
de marcadores se distinguen por su capacidad de detectar polimorfismos en loci nicos o mltiples y son de tipo dominante o co-dominante
(Simpson, 1997).
ADN nuclear (nADN)
En eucariontes, la mayor parte de la informacin gentica se encuentra contenida en el ncleo de la clula. El nADN se encuentra empaquetado y asociado
a protenas histonas, conformando los cromosomas.
El nADN contiene regiones nicas de una sola copia y no nicas
duplicadas o regiones repetitivas (Stansfield, 1992). Se considera que los
organismos diploides tienen dos copias de cada regin gentica (locus) en
los pares homlogos de los cromosomas, llamadas alelos, sin tener en cuenta
si contienen regiones codificantes (exones) o no codificantes (intrones o
regiones intergnicas).
ADN de cloroplasto (clADN)
En los organismos fotosintticos con cloroplastos existe un ADN tpicamente
bacteriano circular, de 120 a 200 kb (Brown et al. 1979), con intrones y exones que se considera muy conservado, ya que se trata fundamentalmente del
mismo genoma desde las hepticas hasta las plantas superiores. Cada cloroplasto contiene varias regiones nucleotdicas, cada una con 8 a 10 molculas
de ADN. Un organismo unicelular como Euglena puede contener de 40 a 50
cloroplastos, por lo que la celula entera puede contener ms de 500 copias del
genoma del cloroplasto (Stansfield, 1992).
ADN mitocondrial (mtADN)
El genoma mitocondrial (mtADN) tiene un tamao de 15 a 17 kb (Brown et
al. 1979) y su longitud vara considerablemente entre especies: 20 micrmetros en Neurospora; 25 micrmetros en levaduras; 30 micrmetros en plantas
superiores; 5 micrmetros en algunos animales metazoarios (multicelulares).
Se considera que la mayora del mtADN de hongos y plantas no codifica, ya
que el mtARN contiene intrones. El mtARN de animales carece de intrones y

544 Las herramientas moleculares

se transcribe como ARN policistrnico que se parte en ARN monocistrnico


antes de la traduccin (Stansfield, 1992).
Las molculas de cloroplasto y mitocondria son especialmente importantes para trazar historias filogeogrficas y de estructura poblacional gentica
estrechamente relacionada al linaje, porque son de herencia uniparental y
no recombinan. Tambin nos permiten inferir cambios demogrficos y de
dispersin entre especies (Dirienzo y Wilson, 1991).
ADN ribosomal (RADN)
El rADN puede encontrarse en mitocondrias, cloroplasto y ncleo. Contiene la
informacin para el ARN que conforma los ribosomas, por lo que es informacin
que se transcribe pero no se traduce. El rADN se presenta en repeticiones tndem
y est formado por tres subunidades altamente conservadas (18 rADN, 5.8 rADN
y 28 rADN), separadas por dos espaciadores con elevadas tasas de sustitucin
(ITS1 e ITS2). Estas repeticiones en tandm se encuentran conservadas a lo largo
de todo un genoma y evolucionan concertadamente, lo que se atribuye a eventos
recombinatorios como entrecruzamiento desigual y conversin gnica. Estas
secuencias, por la baja tasa de sustitucin que presentan, son extremadamente
tiles en el planteamiento de hiptesis de relaciones filogenticas de taxa con
tiempos de divergencia muy antiguos (Hills et al., 1991).

Isoenzimas/aloenzimas
Las isoenzimas fueron originalmente definidas como formas moleculares
mltiples de las enzimas que tienen funciones idnticas o similares y estn
presentes en el mismo individuo (Market y Moller, 1959).
Las isoenzimas pueden presentar varias formas allicas, conocidas como
aloenzimas (Prakash et al., 1969). En su mayora son selectivamente neutras
y se utilizan como marcadores hereditarios para cuantificar las frecuencias
allicas y genotpicas de los individuos, que son los estimadores bsicos de la
composicin gentica de una poblacin. En estudios de gentica las isoenzimas
fueron usadas desde 1966, cuantificando la variacin gentica en poblaciones
humanas y de Drosophila y un poco ms tarde en estudios de plantas superiores
(Harris, 1966; Johnson et al., 1966; Hubby y Lewontin, 1966; figura 1).
La aplicacin de las isoenzimas est dirigida a la cuantificacin de heterocigosis, diversidad gentica, diferenciacin gentica y otras medidas de variacin
gentica intra e interpoblacional. Tambin han sido aplicadas exitosamente

Breve revisin de los marcadores moleculares 545

para evaluar y entender aspectos de biologa evolutiva como los sistemas de


reproduccin y patrones de fecundacin cruzada, relaciones entre fenotipo y
ambiente, filogenias, endemismo, diversidad en plantas clonales y apomcticas e interacciones planta-animal (Prez-Nasser y Piero, 1997) (vanse los
captulos 6 y 7 de este libro).
Por ejemplo, en el estudio de los sistemas reproductivos de plantas las aloenzimas tienen las siguientes ventajas: 1) son expresadas codominantemente,
por lo que los genotipos homcigos y hetercigos pueden ser distinguidos
con mucha precisin, y es poco probable que afecten el comportamiento del
polinizador; 2) muchos de sus loci son polimrficos, casi cualquier especie
presenta al menos uno o dos; 3) probablemente no estn sujetas a fuertes
fuerzas selectivas, por lo que se consideran buenos marcadores (Brown et al.
1989); 4) la tcnica es barata en comparacin con otras.
Por otro lado, presentan algunas limitaciones: revelan poca variacin y la
tcnica es muy laboriosa, requiere de mucho tiempo y entrenamiento y, sobre
todo, es poco reproducible entre laboratorios.
En la electroforesis de enzimas se utilizan cuatro mtodos principales:
a) gel de almidn (horizontal y vertical); b) gel de poliacrilamida; c) gel de
agarosa y d) gel de acetato de celulosa. La electroforesis horizontal en geles
de almidn sigue siendo la preferida, ya que es relativamente barata, de fcil
manipulacin, buena resolucin, no es txica y se puede analizar de forma
rpida la variacin para uno o varios loci.
Para un locus dado, el nmero de bandas vara entre individuos homcigos
y hetercigos (figura 1) y tambin vara en funcin de la estructura cuaternaria
de la enzima; si es monomrica los individuos homcigos representan una
sola banda y los hetercigos presentan dos bandas; si es una enzima dimrica,
los hetercigos presentan tres bandas (dos homodmeros de los padres y un
producto adicional de movilidad intermedia); en las enzimas tetramricas se
observan 5 bandas en los individuos hetercigos.

RAPD s
Los RAPDs (polimorfismos de ADN amplificados al azar) son marcadores
que amplifican aleatoriamente segmentos de ADN en una gran variedad de
especies. Los RAPDs se basan en la probabilidad estadstica de que se presenten sitios complementarios al oligonucletido de 10 pares de bases (pb) a lo
largo del genoma. El polimorfismo de las bandas entre los individuos se debe
a cambios en la secuencia de los nucletidos en los sitios de acoplamiento del

546 Las herramientas moleculares


Figura 1. Patrones de la fosfoglucosa isomerasa para ecotipos de arroz rojo y variedades
de arroz en gel de almidn de papa agarosa al 12% (foto de Ortiz et al., 2002)

oligonucletido y por insercin o delecin de los fragmentos en estos sitios


(Williams et al., 1990; figura 2).
Estos marcadores son dominantes, es decir, no pueden discernir los homcigos dominantes de los hetercigos para un segmento particular (Whitkus
et al., 1994; Backeljau et al., 1995), por lo que la estimacin de las frecuencias
allicas se debe hacer de manera indirecta, asumiendo equilibrio de HardyWeinberg (Aagaard et al., 1998).
Los RAPDs son tiles en la elaboracin de mapas genticos, en el estudio
de parentesco y en el anlisis de la estructura poblacional, ya que ayudan a
estimar tamao efectivo, aislamiento reproductivo y niveles de fecundacin
cruzada (Otero et al., 1997; Parker et al., 1998; vanse tambin los captulos
2, 3 y 6 de este libro). Dado el gran polimorfismo que detectan una de sus
mejores aplicaciones es la identificacin gentica de individuos, que incluye
casos de clones, hbridos somticos y mutantes. Otra aplicacin paralela es
la deteccin de uniformidad gentica con un marcador eficiente y rpido,
lo cual puede ser til en la determinacin de estabilidad en programas de
reforestacin (Otero et al., 1997).

Breve revisin de los marcadores moleculares 547

Entre las principales ventajas de los RAPDs esta que amplifican regiones
tanto codificantes del ADN como las no codificantes y revelan niveles de
variacin ms altos que los RFLPs e isoenzimas (Williams et al., 1990; Lynch
y Milligan, 1994; Otero et al., 1997; Russell et al., 1997; Parker et al., 1998);
es una tcnica relativamente fcil que no necesita conocimiento previo de la
secuencia de ADN, no requiere la construccin o el mantenimiento de una
librera genmica, el nmero de loci que puede ser examinado es ilimitado y
no requiere pruebas radiactivas (Reiter et al., 1992; Whitkus et al. 1994).
Sin embargo los problemas prcticos detectados con los RAPDs son la
presencia de bandas errneas (artefactos), la reproducibilidad de los resultados y la comigracin de bandas. Asimismo, muchos de los alelos raros
presentes en las poblaciones estudiadas con RAPDs no son detectados o
pueden ser mal interpretados (Zhivotovsky, 1999). Por otro lado, como los
loci son dominantes, los RAPDs dan menos informacin gentica por locus
que los marcadores codominantes.
Al analizar los datos obtenidos con RAPDs se deben tener en cuenta dos
supuestos: 1) cada uno de los marcadores representa un locus mendeliano en
el cual el marcador visible, el alelo dominante, est en equilibrio de HardyWeinberg con un alelo recesivo y 2) los alelos marcados para diferentes loci
no migran a la misma posicin en el gel (Lynch y Milligan, 1994).
Figura 2. Patrones de bandeo con RAPDs en Ferocactus robustus en gel de agarosa
y tincin con bromuro de etidio (foto de Israel Carrillo).

548 Las herramientas moleculares

Microsatlites
Los microsatlites o secuencias simples repetidas (SSRs; Litt y Luty, 1989) son
secuencias de ADN formadas de 1 a 4 pares de bases, por ejemplo mononucletidos (TT)n, dinucletidos (AT)n, o tetranucletidos (AAGG)n. Estos loci se
encuentran en regiones codificantes y no codificantes del ADN y es probable
que se formen por eventos de rompimiento que generan polimorfismos con
valores superiores al 90% (Armour et al., 1994; Coltman et al., 1996; Gupta
et al., 1996; figura 3).
Los microsatlites de ADN nuclear han sido detectados en mltiples
grupos de plantas y animales, y han sido utilizados fundamentalmente para
estudios de variacin gentica intra e interespecfica (Edwars et al., 1991;
Armour et al., 1993; Devey et al., 1996; Queller et al., 1993; Weight y Bentzen,
1994), anlisis de linajes (Queller et al., 1993) y de sistemas reproductivos
(Awadalla y Ritland, 1997). Recientemente se han encontrado microsatlites
en algunos organelos citoplasmticos, como el cloroplasto (SSRc; Powell
et al., 1995a, b; Vendramn et al., 1996; figura 3 ) y la mitocondria (SSRm;
Soranzo et al., 1998) lo que ha enriquecido la fuente de estudios evolutivos,
ya que estos organelos son heredados uniparentalmente y no estn sujetos
a recombinacin, por lo que los cambios acumulados que observamos en
las poblaciones se deben slo a los procesos de mutacin y demogrficos
(Echt et al., 1998). Esto permite contestar preguntas evolutivas muy puntuales relacionadas con el monitoreo del flujo gentico, introgresin (Vendramin et al., 1998), anlisis de paternidad (McCracken et al., 1999), para
hacer inferencias de parmetros demogrficos y para determinar patrones
evolutivos de los procesos histricos del origen de especies, formas o razas
(Golstein et al., 1996).
Los microsatlites han tomado ventaja sobre otros marcadores genticos
como los AFLPs, RAPDs, RFLPs, debido a que: i) tienen el ms alto grado
de polimorfismo; ii) segregan de manera mendeliana y son codominantes;
iii) la presencia de un solo locus gentico por microsatlite hace que la lectura de las bandas sea clara y fcil de interpretar y iv) son selectivamente
neutros (Golstein y Pollock, 1994; Vendramin et al., 1996). Adems, para
trabajar con SRR es necesario conocer la secuencia de la regin a analizar
para contar con primers especficos que amplifiquen la regin repetitiva
(el microsatlite) responsable de la variacin observada, que adems es
homloga para diferentes especies o incluso gneros (Golstein et al., 1996).
Esto es, los microsatlites son especficos para ciertos grupos de especies y

Breve revisin de los marcadores moleculares 549

homlogos entre s (Vendramin et al., 1996), lo que permite hacer estudios


comparativos entre especies o gneros de un mismo grupo. Por otra parte,
se han realizado estimaciones de las tasas de mutacin de estas regiones y se
ha llegado a la conclusin de que los microsatlite del ADN nuclear tienen
tasas de mutacin de 1x 10 -3 a 1x 10 -6 (Wiessenbach et al., 1992; Weber y
Wong, 1993), ms altas que las que se presentan en el ADN de cloroplasto
las cuales segn Provan et al. (1999) son de 3.2-7.9 x 10-5. Conocer las tasas
de mutacin nos brinda una base importante para realizar anlisis robustos
de la genealoga de las poblaciones que nos hablen acerca de la historia
evolutiva de las especies, ventaja muy importante sobre otros marcadores
genticos.
Otra ventaja que presenta el uso de microsatlites con relacin al uso
de secuencias, es que la mutacin es homognea: en la mayora de los
SSR las mutaciones son de un paso (una unidad repetitiva) siguiendo el
modelo mutacional SSM de Ohta y Kimura (1973). Sin embargo el nmero
de mutaciones vara si se trata de diferentes tipos de microsatlites, por
ejemplo, Golstein et al. (1995b) mencionan que las mutaciones de repeticiones formadas por dinucletidos o trinucletidos son de dos pasos
o incluso de mltiples pasos, lo que ha sido confirmado por estudios en
trinucletidos. Por ejemplo, en el humano el microsatlite formado por
las repeticiones CAG asociado con un desorden neurolgico, puede
mutar de pocos a cientos de alelos (Ashley y Warren 1995). Sin embargo
este comportamiento asimtrico del tamao de las mutaciones de SSR ha
sido raramente reportado.
Al ser los microsatlites altamente polimrficos, pueden ser ventajosos
con relacin al uso de secuencias, aunque la variacin del ADN nuclear debe
analizarse con precaucin, ya que pudo haberse generado por duplicaciones
o por la presencia de familias multignicas (Rieseberg,1991), que generan
un alto grado de homogeneidad dentro y entre especies, proceso conocido
como evolucin concertada. Estos fenmenos pueden distorsionar la historia
evolutiva de los organismos en estudio y confundir las relaciones filogenticas
(Rieseberg et al., 1991b). Es decir, se pueden presentar aparentes reticulaciones
o escenarios de hibridizacin introgresiva. Finalmente, los microsatlites han
sido utilizados para hacer reconstrucciones de rboles de genes con base en
la teora de coalescencia (vase el captulo 4 de este libro). Los fragmentos
son separados en geles de acrilamida y son visualizados con nitrato de plata
o radioactividad.

550 Las herramientas moleculares


Figura 3. Patrones del microsatlite Pt63718 de cloroplasto en Pinus strobiformis en gel de
acrilamida al 6% y tincin con nitrato de plata (foto de Alejandra Moreno Letelier)

ISSRs
Es un marcador molecular conocido como secuencias repetidas intersimples.
Esta es una tcnica relativamente nueva y es similar a los RAPDs, excepto que
en los ISSRs el primer es un di trinucleotido repetido (Culler y Wolfe, 2001
vase el captulo 19 de este libro).
Los dos mtodos que se utilizan en la electroforesis de ISSRs son: a) gel de
agarosa visualizado con bromuro de etidio, y b) geles de acrilamida teidos
con nitrato de plata.
Las bandas que se obtienen con este marcador van de 100 a 2000 pb. La
variacin allica en los ISSRs consiste de la presencia o ausencia de los productos amplificados.
Comparada con los primers de los RAPDs las secuencias de los ISSRs es
usualmente larga lo que resulta en una mayor reproductibilidad de las bandas.

Breve revisin de los marcadores moleculares 551

Los ISSRs han sido utilizado en especies cultivadas desde 1994, pero
slo recientemente se han utilizado en estudios de la variacin poblacional
en especies silvestres (Wolfe y Liston, 1998; Wolfe et al. 1998 a,b). Hasta la
fecha slo existen algunos estudios donde se ha comparado directamente la
variacin gentica, incluyendo estimaciones de la tasa de fecundacin cruzada (que tradicionalmente se estima con marcadores codominantes) y se ha
utilizado esta tcnica en especies donde la variacin poblacional con enzimas
es pequea o no existe. Dada la alta variacin gentica entre individuos de
una misma poblacin, sera recomendable utilizar estos marcadores para
anlisis de paternidad.
Entre las ventajas principales de los ISSRs es que tienen un gran nmero
de bandas polimorficas. En un estudio realizado en Viola pubescens una planta
cleistogamica se report una gran variacin gentica. A nivel de especie, el
100% de los loci fueron polimorficos an cuando los primers (se utilizaron
tres) fueron seleccionados al azar. Dentro de cada poblacin cerca del 71%
de 83 loci fueron polimorficos (Culley y Wolfe 2001). Adems es una tcnica
relativamente fcil de montar, altamente repetible y ya existen primers universales para plantas.
Figura 4. Patrones de ISSRs en Opuntia rastrera en gel de agarosa al 1.5% y tincin con
bromuro de etidio (foto de Lucia Plasencia)

552 Las herramientas moleculares

Por otro lado las limitaciones de los ISSRs son: que las bandas son ledas
como marcadores dominantes, es decir cuando tenemos la presencia de la
banda no se sabe si el individuo es homcigo dominante o hercigo, que la
diversidad gentica est basada considerando que cada banda representa un
locus con dos alelos y que el alelo dominante esta en equilibrio de HardyWeinberg con un alelo recesivo y por ltimo que es una tcnica relativamente
cara, ya que involucra el uso de geles de poliacrilamida y para su visualizacin
nitrato de plata.

RFLP s
El anlisis de polimorfismos de la longitud de los fragmentos de restriccin
(RFLPs) fue el primer marcador de ADN utilizado por bilogos poblacionales
(Parker et al., 1998). Este mtodo expresa diferencias especficas del ADN que
fueron reconocidas por enzimas de restriccin particulares (endonucleasas).
Cada una de las endonucleasas (de origen bacteriano), reconoce y corta solamente una secuencia especfica de bases nitrogenadas en el ADN, siempre
y cuando stas no estn protegidas (metiladas). Por consiguiente cualquier
ADN que no est metilado puede ser reconocido y cortado en fragmentos de
longitud definida; y cualquier mutacin dentro de esos sitios, podra cambiar
el patrn del fragmento y permitir que se detecte un RFLP al comparar dos o
ms genomas (Valadez y Kahl, 2000). Para detectar RFLPs hay dos tcnicas:
southern blots e hibridizacin, y PCR.
Southern blots e hibridizacin
Es necesario en primer lugar aislar el ADN del organismo de inters (vase el
captulo 15 de este libro, purificarlo y cortarlo con una o ms endonucleasas
de restriccin. Los fragmentos resultantes se separan en geles de agarosa por
electroforesis y se transfieren a una membrana que puede ser de nylon o de
nitrocelulosa (southern blotting). La subsecuente hibridacin con una sonda
marcada y deteccin con autorradiografa, luminografa o quimioluminiscencia
har visible un fragmento de ADN especfico, que puede ser comparado con
el fragmento resultante de otros genomas tratados de la misma forma (Parket
et al., 1998). La sonda marcada se obtiene de fragmentos de ADN nuclear, de
organelos o bien de ADN complementario, tambin denominado ADN copia
(ADNc) que es una molcula de una sola hilera producida en el laboratorio
usando mRNA como molde y transcripcin reversa (vase el captulo 15 de este

Breve revisin de los marcadores moleculares 553

libro). Para el caso de obtenerla a partir de ADN nuclear, se requiere construir


una biblioteca genmica mediante el aislamiento, restriccin y clonacin del
ADN en un vector apropiado (Valadez y Kahl, 2000), que se explica a continuacin. Las bibliotecas de ADN son colecciones de vectores recombinantes, que
cuentan con secuencias de ADN insertadas. La figura 5 muestra la construccin
de una biblioteca de ADNc en el vector lambda gt10. En la figura se puede observar cmo, mediante ADN transcriptasas, polimerasas o ligasas se construye
un fragmento de ADN (el de inters) y se inserta en el fago a utilizar (parte A
de la figura); una vez obtenido el fago se procede a infectar una colonia de E.
coli en una caja de Petri. Cada infeccin producir una placa caracterstica en
la caja de Petri (en una caja de Petri de 150 mm pueden caber 50 mil placas).
Una vez que las placas se han formado se coloca un filtro de nitrocelulosa en
contacto con las colonias de la caja de Petri. El ADN transferido al filtro es
desnaturalizado y fijado en el filtro mediante el uso de luz ultravioleta. De
esta forma el filtro puede ser hibridizado con una sonda radiactiva de ADNc
de inters y sometido a autorradiografia; una mancha en la autorradiografia
permitir identificar la placa de la caja de Petri que contiene el fago con el
ADN de inters. El fago puede entonces ser extrado del agar de la caja de Petri
y reinfectar a E. coli. La repeticin de este proceso de separacin de un fago
recombinante, permite clonar el ADN que contiene el fago. Este proceso ha
permitido desarrollar bibliotecas de ADN de diferentes tejidos.
RFLP-PCR
El segundo mtodo que se utiliza para la tcnica de RFLPs es la PCR. Los
RFLPs son causados por rearreglos del ADN, tales como prdidas, inserciones
o sustituciones de secuencias o nucletidos nicos, lo que genera una ganancia
o prdida de sitios de restriccin. Esto es detectado a travs de diferencias
en el peso molecular de los fragmentos homlogos de restriccin del ADN
genmico (figura 6).
Con el producto amplificado de PCR se realiza una digestin con diferentes
enzimas de restriccin. Los fragmentos resultantes de la digestin son separados por electroforesis en geles de agarosa teidos con bromuro de etidio o
con acrilamida teidos con nitrato de plata (Karl et al., 1992); este mtodo es
ms barato y rpido que el anterior.
Los RFLPs generalmente se han utilizado para construir mapas genticos,
para la clonacin de genes basados en mapas y para ayudar a resolver problemas taxonmicos o filogenticos.

554 Las herramientas moleculares


Figura 5. Construccin de una biblioteca de ADN en el vector lambda gt10 (A).
En (B) se muestra en forma esquematizada el cernimiento para obtener la clona pura
A

B
mARN

+ oligo (dT)

AAA

mARN

AAA
Transcriptasa de reversa dNTPs

mARN

AAA
TTT
ARNasa HPolimerasa
de ADN
dNTPs
AAA
TTT
Ligasa Eco Rl

cADN
mARN
cADN
GGAATTCC
CCAATTCC

GGAATTCC
CCAATTCC

Caja de E. coli infectadas


con el fgo

Transferencia al filtro

ADN fijo en el filtro


Hibridizacin con ADN o ARN

Digestin por Eco Rl


GGAATTCC
GG

COS

GG
CCAATTCC
Eco Rl dirigido, ? GT 10, Ligasa
de ASDN
Inserto

Seal en la placa donde


est el fango
Autorradiografa

COS

Paquete de ADN recombinante


de ? gt 10 en el fago

Autorradiografa

Biblioteca de ? gt 10

El grado de polimorfismo detectado con esta tcnica difiere ampliamente


entre las especies dependiendo de la sonda utilizada. Entre las principales
desventajas que presenta est el requerimiento de grandes cantidades de ADN
de buena calidad para la deteccin de loci de copias nicas, adems requiere de
muchas manipulaciones y solamente se detecta una fraccin de la variabilidad
de secuencias existentes en el genoma, es decir, su informacin es limitada.

AFLP s
Los AFLPs (polimorfismos de longitud de los fragmentos amplificados)
son una tcnica que combina la digestin de dos enzimas de restriccin,
generalmente Mse I que reconoce y corta 4 pb y Eco RI que reconoce y
corta 6 pb dentro de una secuencia, con la unin de secuencias especficas
al nucletido ligado a los extremos de los fragmentos de restriccin y dos

Breve revisin de los marcadores moleculares 555

Figura 6. Patrones de PCR-RFLPs del intrn de la mitocondria NAD1B2f y NAD1C1r


digerido con la enzima Hae III en Pinus pinceana en gel de acrilamida al 5%
y tincin con nitrato de plata (foto de Miroslava Rentera Alcntara)

amplificaciones de PCR usando primers marcados basados en las secuencias


ligadas. La primera amplificacin se lleva a cabo con el uso de iniciadores
que contienen una base extra en el extremo 3, lo que produce un conjunto de
fragmentos que adems de llevar la secuencia complementaria al iniciador,
complementan a la base extra adicionada. Posteriormente estos productos
amplificados sirven para hacer la segunda amplificacin en la que se consideran iniciadores con dos o tres bases extras. Los fragmentos resultantes
son complementarios, adems del iniciador, a las extensiones consideradas,
razn por la cual slo una porcin del genoma fragmentado es finalmente
amplificado (Vos et al., 1995).

556 Las herramientas moleculares


Figura 7. Patrones de AFLPs en Allium sativum en gel de acrilamida y tincin con nitrato de
plata (foto de Meryem Ipek)

Esta tcnica detecta mltiples loci polimrficos y es til para generar


huellas genticas y mapeo; tambin se ha utilizado para la caracterizacin
de germoplasma, estudios filogenticos en plantas, bacterias, hongos y en
estudios de gentica de poblaciones.
Entre las ventajas que se pueden encontrar en los AFLPs est que no
requieren ninguna informacin previa de la secuencia para su anlisis; se
producen una gran cantidad de bandas polimrficas; la tcnica es altamente
reproducible y existen kits estandarizados. Sin embargo, requiere gran nmero
de pasos para producir resultados.
Aunque actualmente el equipo es sofisticado y se necesita la radiactividad
para generar los AFLPs, el mtodo se puede automatizar fcilmente para el

Breve revisin de los marcadores moleculares 557

alto rendimiento del procesamiento de muestras. Las marcas fluorescentes


estn substituyendo a la radiactividad y el nmero de datos producidos en
un tiempo corto compensa los costos.
Las bandas observadas en los geles de AFLPs son clasificadas como presencia o ausencia de cada individuo y el anlisis se desarrolla como un sistema
dominante recesivo (Simpson, 1997).

Secuenciacin de ADN
Los anlisis ms detallados de diferenciacin de ADN pueden obtenerse secuenciando la regin de inters para diferentes individuos. Hasta hace poco
tiempo, el uso extenso de secuencias de ADN para los estudios de poblaciones
no haban sido prcticos porque los fragmentos de ADN para cada individuo tenan que ser aislados para libreras de ADN subgenmico despus de
haber sido identificados por southern blotting e hibridizacin. Sin embargo,
actualmente el uso de secuencias es muy comn: se ha aplicado en anlisis
de gentica de poblaciones y problemas taxonmicos.
Este mtodo incluye cuatro pasos: i) identificar secuencias que tenga la
variacin necesaria; ii) aislar y purificar un nmero elevado de la secuencia (ya
sea por clonacin o amplificacin); iii) secuenciar; iv) alinear la secuencia (con
los programas MALIGN, Clustal V para Macintosh ver. 1.5, JACK ver. 4.2).
Las tcnicas que existen para secuenciar son la qumica, la enzimtica y
la automtica.
La qumica diseada por Alan Maxan y Walter Gilbert consiste en dividir el
ADN en cuatro muestras y tratar cada una con agentes qumicos que rompen
el ADN especficamente en una base, bajo condiciones en las que solo unos
pocos nucletidos del fragmento se afectan. Los fragmentos se marcan con
radiactividad y se auto radiografan.
En el mtodo enzimtico de Fred Sanger el ADN a ser secuenciado se utiliza
como patrn de referencia para producir una sntesis in vitro, mediante una
polimerasa y una rplica de ADN que inicia la sntesis del ADN siempre en
el mismo sitio. El punto crtico es el uso de trifosfato de dideoxirribonuclesido: la deoxirribosa no cuenta con el grupo 3-OH, de tal forma que cuando
el nucletido es incorporado a la cadena de ADN, se bloquea la adicin del
siguiente nucletido, por lo que cada molcula de ADN sintetizada va a terminar aleatoriamente en dicho nucletido. Esta sntesis se lleva a cabo en cuatro
muestras; en cada muestra se incorpora un dideoxinuclesido con una base
diferente (ddATP, ddCTP, ddTTP, ddGTP) y los otros tres deoxinucletidos

558 Las herramientas moleculares

normales. Los fragmentos sintetizados durante el proceso van a terminar en


sitios diferentes de la cadena del ADN, generando una escalera de molculas
de ADN que pueden ser detectadas por auto radiografa. Las cuatro muestras
se corren en electroforesis en lneas paralelas para determinar el orden de los
nucletidos, identificando la secuencia de ADN que ser complementaria al
ADN que sirvi de modelo para la sntesis (figura 8).
Figura 8. Mtodo se secuenciacin enzimtica de ADN. 1) Sntesis en presencia del ADN de
inters, polimerasa, un fragmento de ADN como iniciador, nucletidos y dideoxinucletidos
atpicos; 2) Sntesis por separado para cada nucletido, generando fragmentos de ADN con
el dideoxinucletido incorporado; 3) separacin de los fragmentos en un gel
para identificar la secuencia

A
A
T
T

C
C

G
G

Polimerasa

ddATP

1
5
3

GGATTG A
CGTAACT

+ dd AT P

C A A G C A

+ dd C T P

+ dd T T P

+ dd G T P

C A A G C C A A G C A T
C A A C G A T

C A A CG A TTG A
A

GT T C T A A C T
C A A
ADN Polimerasa
+ dATP
dCTP
dTTP
dGTP

C A A A
C A A C G A T T G

G
A
G
T
T
A
C
G

Breve revisin de los marcadores moleculares 559

Recientemente se ha introducido la secuenciacin automtica que utiliza la


reaccin de Fred Sanger pero con fluorescencia en vez de radiactividad, que se
detecta por medio de un lser. Cada emisin fluorescente es transmitida como
una seal directamente a la computadora donde un programa la interpreta y
la codifica como un nucletido particular (Swofford et el., 1996; Griffiths et al.,
1996; Ferl et al., 1991). La captura de secuencias se hace ms rpida debido a
que incorporan programas que leen los nucletidos directamente desde el gel
(figura 9). Entre las principales ventajas que tiene la secuenciacin de ADN es su
alta reproducibilidad y que es codominante; su mayor limitante es su alto costo
pero es la mejor alternativa entre los mtodos con istopos radiactivos.
Figura 9. Ejemplo de patrones de secuenciacin automtica

Microarrays (microarreglos)
El microarray es un arreglo de cientos de millares de secuencias de ADN inmovilizadas y bien ordenadas en forma de matriz adheridas a una superficie slida,
generalmente de cristal. Cada secuencia corresponde a un gen diferente. Esta
tcnica es utilizada para detectar niveles de expresin de los genes colocados en
el microarray. Esto se logra extrayendo el mARN de la clula de inters o de algn
tejido particular, sometindolo a transcripcin inversa para obtener cADN (vase el captulo 16 de este libro)y combinando ste con un marcador fluorescente
(usualmente los tintes de cianina Cy3 y Cy5) para generar una sonda, que es hibridizada sobre la matriz del microarray, de manera que para cada gen se detecta
el grado de fluorescencia, lo cual da el nivel de expresin del gene.

560 Las herramientas moleculares

Los microarrreglos pueden ser divididos en dos tipos principales que difieren en su construccin: spotted microarrays (microarreglos punteados) y
arreglos de oligonucletidos de alta densidad. Los microarreglos punteados
usan generalmente muestras de ADN de 500 a 5000 bases (Ekins et al., 1999)
producidos por PCR a partir de bibliotecas o de bases de datos como GenBank, UniGene, dbEST, etc. Las secuencias son depositadas sobre la superficie
slida por un robot en lugares definidos. Hay dos mtodos de depositar los
puntos:
Distribuidor activo: basado en la tecnologa de las impresoras de inyeccin
de tinta.
Distribuidor pasivo: aplica la solucin de ADN con un alfiler que toca la
superficie slida. Se puede obtener una mayor densidad de manchas usando
este mtodo.
La superficie slida generalmente es un portaobjetos especialmente
cubierto pero tambin se pueden usar membranas de nylon y portaobjetos
cubiertos de oro. El tamao de los puntos de la matriz tpicamente vara de 80
a 150 m de dimetro y en un solo portaobjetos cabe un mximo de 80,000
puntos. En los microarrays punteados es comn comparar las expresiones
genticas de dos muestras biolgicas (tejido con tumor vs. tejido sin tumor,
por ejemplo) en un mismo portaobjetos, as que el mRNA es preparado
para que los dos niveles de expresin puedan ser medidos (Schena et al.,
1995; figura 9).
Por su parte, los microarreglos de oligonucletidos de alta densidad son
construidos comercialmente y tienen una precisin y densidad muy alta al
usar oligonucletidos cortos de 20 a 25 bases.
Dos de las compaas que construyen estas clases de micrroarreglos son
Affymetrix y Agilent Technologies. Los microarreglos de Affymetrix son los
ms populares y son conocidos como GeneChipsTM, producidos sintetizando
decenas de miles de oligonucletidos cortos in situ usando tcnicas de fotolitografa. Affymetrix produce diferentes microarrays, cada uno con diferente
composicin de genes (Lockart et al., 1996).
Los microarreglos necesitan ser ledos por un instrumento apropiado para
convertir la distribucin de florescencia o radioactividad en una imagen de
computadora. En el caso de las sondas fluorescentes, se pueden usar escners
de lser o cmaras CCD. En la imagen de computadora cada intensidad del
punto corresponde a un nivel de expresin de la sonda. Puesto que un punto
contiene mltiples pixeles, es normal promediar todos los pixeles de un mismo
punto junto con los pixeles del borde exterior. Sin embargo, la cuantificacin

Breve revisin de los marcadores moleculares 561

Figura 10. Tcnica de microarrays para detectar niveles de expresin de genes


(tomada de la pgina web del Instituto de Neurobiologa, UNAM)
Preparar la coleccin de ADNc
en una micromatriz

Preparar la sonda de ADN


complementario (ADNc)
Normal

Tumor

RT/PCR
Mercado con
compuestos
fluorescentes

Combinar en
cantidades
iguales

Hibridar la sonda
a la micromatriz

SCAN

Tecnologa de micromatrices

del grado de fluorescencia est sujeta a las fluctuaciones de intensidad dentro


de cada punto, aunque stas pueden ser superadas con las tcnicas desarrolladas por Brown et al. (1999).
Los microarreglos de Affymetrix presentan problemas similares, pero
tambin se han desarrollado algoritmos para combatirlos.
Esta tecnologa permite a los investigadores estudiar la relacin de genes
individuales de enfermedades (por ejemplo el cncer), y despus aplicar el
conocimiento al tratamiento de pacientes.
Tambin se ha utilizado en el estudio de tejidos finos, en clulas normales
durante el desarrollo y estudios de animales transgenicos.
La tecnologa de los microarreglos tambin tiene uso potencial en el
desarrollo de nuevas drogas as como en la investigacin de farmacogenmicos (cuyo fin es encontrar la correlacin entre las respuestas teraputicas
a las drogas y los perfiles genticos de los pacientes) y de toxicogenmicos
(cuya meta es encontrar correlaciones entre los toxicantes y los cambios en
los perfiles genticos de los objetos expuestos a los toxicantes; Leming Shi,
1998, 2002).

562 Las herramientas moleculares

Los dos grandes problemas que se presentan con los datos de microarreglos
son por un lado los niveles de expresin, que varan de experimento a experimento, y por las diversas fuentes de errores aleatorios y sistemticos durante
el anlisis. Por otro lado, hay un pequeo nmero de muestras comparado
con el gran nmero de variables, lo que causa que las tcnicas estadsticas
tradicionales fracasen. Otra gran limitante de los microarrays proviene, irnicamente, de su productividad notable, y actualmente los cientficos apenas
pueden hacer frente al volumen enorme de informacin producida por los
microarreglos, adems de tener un alto costo.

Bibliografa
Aagaard J.E., V.K. Krutovskii y H.S. Strauss. 1998. RAPDs and allozymes exhibit
similar levels of diversity and differentiation among populations and races of
Douglas-fir. Heredity 81:69-78.
Armour A. L., R. Neuman, S. Gobert y A.J. Jeffreys. 1994. Isolation of human simple
repeat loci by hybridization selection. Human Molecular Genetics 3(4):599-605.
Ashley C.T. y S.T. Warren. 1995. Trinucleotide repeat expansion and human disease.
Annual Review Genetics 29:703-728.
Ayala F.J. 1984. Gentica Moderna. Fondo Educativo Interoamericano, Barcelona.
Avise, C.J. 1994. Molecular markers, natural history and evolution. Chapman & Hall,
New York.
Backeljau T., L. De Brun, H. De Wolf, K. Jordaens, S. Dongen, R. Verhagen y B. Winnepenninckx. 1995. Random amplified polymorphic DNA (RAPD) and parsimony
methods. Cladistics 11:119-130.
Berovides V. y M.A. Alfonso. 1995. Biologa evolutiva. Pueblo y Educacin, La Habana.
Brettschneider R. 1998. Molecular tools for screening biodiversity in plants and animals.
Chapman & Hall, Londres.
Brown A.H.D. 1979. Enzyme polymorphisms in plant populations. Theoretical Population Biology 15:1-42.
Brown W.M., M. George Jr. y A. C. Wilson. 1979. Rapid evolution of mitochondrial
DNA. Proc. Natl. Acad. Sci. USA 76:1967-1971.
Brown, P.O. y D. Botstein. 1999. Exploring the new world of the genome with DNA
microarrays. Nature Genetics 21: 3337.
Coltman D.W., D.W. Bowen y J.M. Weith. 1996. PCR primers for harbour seal (Phoca
vitulina concolour) microsatellites amplify polymorphic loci other pinniped species. Molecular Ecology 5:161-163.

+2

)
4
!

6$
1
$
'
!
2 02 $
2( /

+2

&=

!
&
95 4=6I2;

&

! *

( &

&
#

0
D

) /

I2

/
!

1
$

1
!

+2

!
;$

:
9

899

:;

"
9

:;

4 2

'

1
@
/

2
!

&

&

899

14
2

+
$

/
!

6)

1
E
2

"
%
%

2
(

!
+

!
!

96$

/
!

& 6 $

9 /

/
$

= $

%
/

&

!;

D
$

;$

9
$

)
!

/
-

&
/

$
$

$
9

?!

&

#
!

/
1
1

1
E
@

!
&

( !

;
#

ELECTROFORSIS

Illn Morales Becerril

ELECTROFORESIS
La electroforesis es una tcnica para la separacin de molculas segn la movilidad de estas en un
campo elctrico a travs de una matriz porosa, la cual finalmente las separa por tamaos
moleculares y carga elctrica, dependiendo de la tcnica que se use.

La tcnica clsica utiliza una tira recubierta de una sustancia porosa impregnada de un electrolito.
Sus extremos se sumergen en dos depsitos independientes que contienen ambos al electrolito y
estn unidos a los electrodos del generador de corriente. La muestra se deposita en forma de un
pequeo trazo transversal en la tira. La distancia de migracin se mide en relacin un marcador
interno. Las placas son reveladas con sales de plata, azul de Coomassie, o reactivos en particular.

Fundamentos y Conceptos Bsicos


La electroforesis capilar (CE) es una tcnica de separacin que se ha desarrollado gracias a los
avances de la cromatografa lquida de alta eficacia junto con los procedimientos ms tradicionales
de electroforesis. Esta tcnica permite separar bastante bien biomolculas, donde la cromatografa
lquida se muestra menos eficaz, y compuestos de pequea masa molecular, difciles de estudiar
por los procedimientos clsicos de electromigracin en soporte.

La electroforesis capilar constituye una adaptacin particular de la tcnica de electroforesis. Esta


tcnica separativa se basa en la migracin de las especies de la muestra en disolucin, portadoras

ELECTROFORSIS

Illn Morales Becerril

de una carga elctrica global, bajo el efecto de un campo elctrico y en contacto con un soporte
(medio de desplazamiento) adecuado.

En electroforesis capilar la tira se reemplaza por un tubo capilar abierto en sus extremos, fabricado
con un dimetro pequeo (15 a 150m). El capilar oscila entre 20 y 80cm, y est lleno de una
solucin buffer. Un detector se encuentra ubicado en un extremo del capilar, cerca del
compartimiento catdico. La seal obtenida es la base de la obtencin del electroferograma, que
muestra el registro de la composicin de la muestra. Solo las especies que se dirigen hacia el
ctodo sern detectadas.

Mtodos de Deteccin
En la deteccin UV-Vis se mide la intensidad de la luz que pasa a travs del capilar en una
pequea zona en la que se ha eliminado el revestimiento opaco.

La deteccin por fluorescencia resulta ms sensible si se emplea una fuente lser muy intensa,
asociada a menudo a un procedimiento de preformacin de derivados de los analitos portadores
de un fluorforo.

Tcnicas Electroforticas
Electroforesis capilar en zona o en disolucin libre (CZE)
Es el procedimiento de electroforesis ms habitual, en el cual el capilar es recorrido por el
electrolito a travs de un medio buffer que puede ser cido (fosfato o citrato), bsico (borato), o
anftero (carcter cido y bsico). El flujo electroosmtico crece con el pH del medio
electrofortico.

ELECTROFORSIS

Illn Morales Becerril

Electroforesis capilar electrocintica micelar (MEKC)


En esta variante del procedimiento anterior se aade a la fase mvil un compuesto catinico o
aninico para formar micelas cargadas. Estas pequesimas gotitas inmiscibles con la disolucin
retienen a los compuestos neutros de un modo ms o menos eficaz, por afinidad hidrfilahidrfoba. Se puede utilizar este tipo de electroforesis para molculas que tienen tendencia a
migrar sin separacin, como es el caso de algunos enantiomeros.
Electroforesis capilar en gel (CGE)
Esta es la transposicin de la electroforesis en egel de poliacrilamida o de agarosa. El capilar est
relleno con un electrolito que contiene al gel. Se produce un efecto de filtracin que ralentiza a las
grandes molculas y que minimiza los fenmenos de conveccin o de difusin. Los
oligonucletidos, poco frgiles, se pueden separar de este modo.
Isoelectroenfoque capilar (CIEF)
Esta tcnica, tambin conocida como electroforesis en soporte, consiste en crear un gradiente de
pH lineal en un capilar con pared tratada que contiene un anftero. Cada compuesto migra y se
enfoca al pH que tenga igual valor que su punto isoelctrico (al pI su carga neta es nula).
Seguidamente, bajo el efecto de una presin hidrosttica y manteniendo el campo elctrico, se
desplazan las especies separadas hacia el detector. Las altas eficiencias obtenidas con este
procedimiento permiten separar pptidos con pI que apenas difieren entre s 0.02 unidades de pH.

Electrocromatografa Capilar
Este tipo de separacin asocia la electromigracin de los iones, propio de la electroforesis, y los
efectos de separacin entre fases presentes en la cromatografa. La tcnica consiste en la utilizacin
de un capilar relleno con una fase estacionaria, cuyo papel es doble: acta como material selectivo
que debe, por otro lado, participar en la migracin del electrolito.

El factor de separacin es muy elevado, pero existen un cierto nmero de problemas que limitan
su aplicacin, como el efecto de los modificadores orgnicos sobre el flujo electroosmtico y la
dificultad de un control preciso del volumen de muestra introducido en el capilar.

Curso: Introduccin a la Bioinformtica

Introduccin al diseo de primers


INTRODUCCIN
Esta gua es una breve aproximacin al diseo de primers, utilizando programas
bioinformticos y pretende dar una orientacin a aquellas personas que estn incursionando
por primera vez en esta amplsima disciplina que es la Bioinformtica. Si esta gua orienta y
ayuda al cientfico a realizar sus propios primers o cebadores, ha logrado su cometido.
En la primera parte de esta gua, revisaremos algunos conceptos generales pertinentes
al diseo de primer y a la amplificacin enzimtica de ADN mediante PCR, y en la segunda se
detalla un taller que le permitir poner en prctica la mayora de los conceptos revisados.
PARTE I
Fundamentos tericos de la amplificacin enzimtica de ADN mediante la Reaccin en
Cadena de la Polimerasa (PCR; polymerase chain raction)
La Reaccin en Cadena de la Polimerasa es una tcnica que ha revolucionado el modo
de manipular, clonar y detectar fragmentos de ADN, lo que le ha valido a su descubridor K. B.
Mullis el Premio Nobel. Despus de su descubrimiento en 1983, se ha convertido en una de las
tcnicas bsicas de Biologa Molecular, ampliamente utilizada debido a su rapidez,
especificidad, flexibilidad y aplicabilidad. Entre sus aplicaciones generales encontramos la
generacin de sondas, clonacin, secuenciacin, diagnstico clnico y tipificacin de individuos
y microorganismos, siendo entonces muy utilizada en medicina forense y en estudios
filogenticos.
Un ciclo de PCR comienza con un calentamiento inicial que desnaturaliza el ADN
blanco a 94-95 C o ms. Este primer paso del ciclo dura en promedio 90 s a 3 minutos. En el
proceso de desnaturalizacin, las dos cadenas del ADN se separan una de la otra y permiten
que la matriz (template) se encuentre como cadena simple, necesaria para la actividad
llevada a cabo por la polimerasa termoestable durante los pasos de amplificacin.
En el siguiente paso del ciclo, la temperatura se reduce a un valor que oscila en el
rango de los 40 C a los 60 C. A esta temperatura, cada uno de los oligonucletidos (primers)
hibrida con la secuencia complementaria en cada una de las cadenas simples de ADN, que se
han separado en el paso anterior, y sirven como cebadores para la sntesis, por la polimerasa
termoestable.
La sntesis de ADN se inicia cuando la temperatura de la reaccin llega al valor ptimo
para la actividad de la polimerasa. Para la mayora de las polimerasas esta temperatura se
encuentra en, aproximadamente los 72 C. Luego se permite la sntesis durante 30 s a 2 min.
Este paso completa un ciclo y el siguiente ciclo se inicia con el retorno a los 94-95 C para la
desnaturalizacin.
La cantidad de amplificado resultante va a depender de la disponibilidad de sustrato
para la reaccin por eso, los oligonucletidos y los desoxirribonucltidos trifosforilados se
Lic. en Gentica Ernesto Martn Giorgio

Curso: Introduccin a la Bioinformtica

aaden en exceso respecto al ADN a amplificar. Como es fcil inferir, la concentracin de ADN,
oligonucletidos, de y ADN polimerasa activa disminuyen despus de cada ciclo debido a la
sntesis que se est produciendo por lo que la reaccin lleva a un mximo de amplificacin,
luego del cual el rendimiento y el nmero de copias obtenidas no aumentan. A esto se lo
conoce como el efecto Platteau.
En la reaccin de PCR ideal, existen tres fragmentos de cidos nucleicos. El fragmento
de ADN de doble cadena a ser amplificado (molcula blanco o target) y dos oligonucletidos de
cadena simple que hibridizan en alguna regin del ADN blanco (iniciadores o primers).
Adems estn presentes: un componente proteico (la enzima ADN polimerasa),
desoxirribonucletidos trifosfatos (dATP, dCTP, dTTP y dGTP), buffers y sales.
Los primers se aaden en un vasto exceso comparado con el ADN blanco a ser
amplificado. Estos se hibridizan a las cadenas opuestas del blanco y se orientan enfrentndose
con sus respectivos terminales 3, de manera tal que la sntesis llevada a cabo por la ADN
polimerasa se extiende a travs de todo el segmento del ADN blanco situado entre ellos.
Recordemos que la enzima ADN polimerasa cataliza el crecimiento de cadenas de ADN nuevas
en la direccin 5 > 3.

La primera ronda de sntesis resulta en la generacin de cadenas de ADN nuevas sin


una longitud determinada, las cuales como las cadenas parentales, se pueden hibridizar a los
primers luego de la desnaturalizacin e hibridizacin. Estos productos se acumulan con una
progresin aritmtica a travs de los ciclos siguientes.
Sin embargo, el segundo ciclo de desnaturalizacin, hibridizacin y sntesis, produce
dos productos de cadena simple que componen en conjunto un producto de doble cadena en
el cual posee la longitud exacta del fragmento original delimitado entre los primers. Cada
cadena de este producto discreto es complementaria a uno de los dos primers incluidos en la
reaccin y puede en consecuencia participar como blanco en los ciclos subsiguientes.

Lic. en Gentica Ernesto Martn Giorgio

Curso: Introduccin a la Bioinformtica

La cantidad de este producto se duplica con cada ciclo subsiguiente, acumulndose


exponencialmente. As, treinta ciclos de desnaturalizacin, hibridizacin y sntesis resultan
tericamente en un factor de amplificacin de 236 veces (68 billones de copias) del producto
molecular original.
Una PCR ideal debera ser altamente especfica, fiel y de gran rendimiento. Cada uno
de estos parmetros est influido por varios componentes de la propia reaccin por lo que
muchos casos ajustando las condiciones para la mxima especificidad no se obtiene buen
rendimiento, o bien optimizando para la fidelidad no se obtiene buena eficiencia. En
consecuencia, cada vez que se optimiza una PCR hay que tener en cuenta distintos aspectos
que hacen que dicha reaccin sea exitosa.
Cules son los factores de los que depende una PCR exitosa?
Aunque el concepto de la PCR es simple, el desarrollo de una reaccin exitosa depende de
un nmero de factores. Algunos de ellos son:
-

Diseo de los oligonucletidos iniciadores o cebadores (primers):

El diseo cuidadoso de primers es uno de los aspectos ms importantes de la PCR. Primers


mal diseados pueden amplificar otros fragmentos de ADN distintos a los buscados
(amplificacin inespecfica). En el diseo de los mismos algunas reglas se han demostrado
como tiles, por ejemplo:
I Cada primer individual debe contar con una longitud de 18-24 bases.
II Se debe mantener un contenido de G:C (Guanina:Citosina) entre 40 y 60 %.
III Los dos primers del par deben de tener temperatura de fusin Tm cercanos, dentro de
los 5 C.
IV La secuencia de los primers individuales debe iniciarse y terminarse con 1 o 2 bases
pricas.
V Evitar regiones con potencialidad para formar estructuras secundarias internas.
VI Evitar poli X.
VII Secuencias adicionales pueden ser agregadas en el extremo 5 del primer (no incluir
cuando se estima la Tm del primer).
VIII Se pueden agregar degeneraciones en algunas posiciones del primer:
a - Se incrementa el riesgo de amplificacin inespecfica.
b - Se disminuye la concentracin en la mezcla de cada uno de los primers posibles
c - No se recomienda utilizar ms de 64 primers diferentes en la mezcla.
d - Cdigo IUPAC/IUB:
A
C
G
T
N
M
V

adenina
citosina
guanina
timidina en el ADN
Uracilo en el ARN
AoCoGoT
AoC
A o C o G; no T

Lic. en Gentica Ernesto Martn Giorgio

R
W
S
Y
K
H
B
D

AoG
AoT
CoG
CoT
GoT
A o C o T; no G
C o G o T; no A
A o G o T; no C

Hasta mediados de la dcada de los 60, los marcadores usados en gentica y


mejora animal estaban controlados por genes asociados a caracteres polimrficos, en
general fciles de identificar visualmente (fenotipo), pero solo un pequeo nmero de esos
marcadores morfolgicos permitan encontrar asociaciones significativas entre estos y los
caracteres con importancia econmica.
Por sus limitaciones surgieron los marcadores isoenzimticos o marcadores de
protenas, que eran accesibles a un mayor nmero de especies y brindaban mejores
resultados. Se expresan en forma codominante, son compatibles con el normal
funcionamiento de la protena y son relativamente abundantes, pero son tcnicas muy
caras y dificulta los proyectos de mapeos, adems no ms del 3% del ADN genmico es
finalmente traducido a protenas y que slo unas pocas de estas pueden mutar sin alterar la
viabilidad de los animales. Los primeros marcadores fueron los grupos sanguneos y luego
otros marcadores polimrficos bioqumicos o las inmunoglobulinas pero presentaban escasa
variantes polimrficas lo que limito su uso y aplicaciones Dejaron de utilizarse y aparecen as
nuevos marcadores moleculares.

MARCADORES MOLECULARES
Con el advenimiento de las tcnicas de biologa molecular aparecieron diversos
mtodos de deteccin de polimorfismo gentico directamente a nivel de ADN: los
marcadores genticos moleculares basados en ADN que sirven de referencia para detectar
la transmisin de un segmento de cromosoma de una generacin a otra.
El trmino marcador se utiliza aqu en el sentido de marcador gentico, y muchas
veces se lo utiliza como sinnimo de marcador de locus; un locus polimrfico que indica el
genotipo del individuo que lo lleva (con este
propsito se utilizan marcadores en gentica de
poblaciones), o el genotipo de uno o de varios
loci

ligados

al

marcador.

Inicialmente

el

descubrimiento de las enzimas de restriccin


Un marcador es un
polimorfismo, pero
no
siempre
un
polimorfismo
sirve
de marcador.

permiti el anlisis de los polimorfismos de longitud


de los fragmentos de restriccin. Posteriormente,
con el desarrollo de la reaccin en cadena de la
polimerasa
mtodos

(PCR),
de

se

desarrollaron

deteccin

de

nuevos

marcadores

moleculares.
Los marcadores ideales cumplen una serie de caractersticas, entre las que se encuentran:

Elevada capacidad de detectar altos niveles de polimorfismo,

Alta heredabilidad,

Gran capacidad para acceder a todas las regiones del genoma,

Independencia del estado fsico y de desarrollo del individuo,

Facilidad de obtencin,

Deteccin por mtodos econmicos,

Independencia de las condiciones ambientales y

La posibilidad de determinacin en cualquier tipo de clulas que contenga


ncleo.

Estas constituyen algunas de las ventajas de los marcadores moleculares sobre los
morfolgicos e isoenzimas; otras radican en su capacidad de deteccin de mutaciones
silenciosas, que no originan cambios de aminocidos.
Los polimorfismos detectados en el ADN se deben a diferencias al nmero de
determinadas regiones no codificantes dispersas en el genoma (regiones repetidas) o a
mutaciones puntuales.
En funcin de estas caractersticas se pueden clasificar los diferentes mtodos de
deteccin de polimorfismos:
A-

los marcadores asociados a variaciones debidas al nmero de repeticiones en su

secuencia (microsatlites y minisatlites) y


B-

los marcadores que detectan cambios puntuales en el genoma (RFLP, AFLP, RADP,

SNP, etc.), que pueden ser detectables o no, por enzimas de restriccin.

A- MARCADORES ASOCIADOS A VARIACIONES DEBIDAS AL NMERO DE REPETICIONES


EN SU SECUENCIA

ADN REPETITIVO DENTRO DE UN GENOMA


Se conoce que una gran proporcin variable del genoma eucariota est
compuesto por secuencias repetitivas de ADN, las cuales difieren en el nmero y la
composicin de nucletidos.

Secuencias repetitivas en tndem (se presenta un resumen en el siguiente cuadro)


ADN satlite

ADN altamente repetitivo

Minisatlites

ADN telomrico

VNTR

SSLP, SSR o STR

Microsatlites

Son secuencias muy conservadas.

Contribuye a la estabilidad del cromosoma.


ADN moderadamente repetitivo
ADN moderadamente repetitivo

MINISATLITES o VNTR (nmero variable de repeticiones en tndem)


(Variable Number of Tandem Repeats)

En 1980 A. R. Wyman y R. White descubrieron, por azar, la primera regin


hipervariable del ADN humano, y subsecuentemente se fueron hallando otras regiones de
ese tipo cerca de los genes de la globina, la insulina, la mioglobina y otros. Estas secuencias
no codificantes e hipervariables del ADN (de una longitud aproximada de entre 6 y 25 pb)
repetidos en tndem un nmero variable de veces (VNTR), estn ubicados en regiones
centromricas y telomricas de los cromosomas y forman secuencias de entre 5 y 50 kb de
longitud.
Ejemplo: 7 repeticiones en tndem de la secuencia de 16 pares de bases
5GACTGCCTGCTAAGATGACTGCCTGCTAAGATGACTGCCTGCTAAGATGACTGCCTGCTAAG
ATGACTGCCTGCTAAGATGACTGCCTGCTAAGATGACTGCCTGCTAAGAT

Figura 1. VNTR (nmero variable de


repeticiones en tndem).

Se genera de este modo una gran cantidad de alelos diferenciados por el nmero
de repeticiones que posee cada uno. Esta ltima caracterstica genera un alto porcentaje
de heterocigosis (generalmente mayor al 80%) alcanzado para estos loci, lo que los
convierte en marcadores altamente informativos en estudios de anlisis de ligamiento y
pruebas de identificacin.
En estas tcnicas, los sitios de restriccin de las enzimas se encuentran flanqueando
las secuencias repetidas en tndem y se visualizan mediante transferencia de Southern
usando secuencias VNTR como sonda observando un patrn de bandas. Las sondas
moleculares desarrolladas por Jeffreys y colaboradores en el ao 1985 a partir de secuencias
repetitivas de un intrn de la mioglobina humana, dieron origen a la tcnica conocida
como fingerprinting de ADN. La misma ha revolucionado el campo de la medicina forense

y los estudios de paternidad en todo el mundo. El fingerprinting de ADN es el patrn de


bandas nico (huella molecular) es especfico de cada individuo (excepto para los gemelos
monocigticos) obtenido por la hibridacin de muestras de ADN digerido con sondas
capaces de detectar mltiples minisatlites a lo largo del genoma.
Una limitacin importante del anlisis de huellas moleculares de ADN con VNTR es
que precisa una muestra relativamente grande de ADN (100.000 clulas o 50g) y el ADN
debe estar relativamente intacto.
Hasta el momento, se han descripto y mapeado cientos de loci de VNTR en el
genoma humano y de algunos animales, aunque se calcula que su nmero podra ser de
varios miles por genoma.

MICROSATELITES o SSR (secuencias simples repetidas) (simple sequence repeats)


o SSLP (polimorfismo de longitud de secuencias simples) (simple sequence length
polymorphisms) o STR (repeticiones simples en tndem) (short tandem repeat)

Los microsatlites, tambin conocidos como SSR, SSLP o STR, consisten en pequeas
secuencias con 2-5 nucletidos repetidos en tndem, altamente variables en tamao. Se
identificaron en el ao 1989 al descubrirse que existan zonas del ADN no codificante. Se
llamaron primero VNTR (variable number of tandem repeats), pero luego fue reemplazada
por la de microsatlite o STR (Short Tandem Repeat) para los segmentos mas cortos y para
los mas largos la denominacin VNTR o minisatlites.
En genomas eucariotas las secuencias de los microsatlites son muy frecuentes, bien
distribuidas y mucho ms polimrficas que los minisatlites, constituyendo la clase de
marcadores moleculares ms polimrficos que se conocen.
Se ha sealado que los elementos ms repetidos en mamferos son extensiones de
dinucletidos (CA)n y (GA)n y los ms tpicos constan de 10-30 copias de una repeticin que
usualmente no son superiores a 4 pb de longitud.
Por el momento, se desconoce exactamente el origen y la funcin de estas
secuencias repetidas. Respecto a su origen, la aparicin inicial de los microsatlites pudo
deberse al azar, o podran haber surgido como producto de mutaciones en la secuencia
poli-A en el extremo 3.
Esta fuente de mutacin y cambio en el nmero de repeticiones podra proveer una
fuente de variacin cuantitativa para una rpida adaptacin evolutiva de las especies a
cambios ecolgicos. La nutricin y el estrs podran incrementar la velocidad de mutacin
en los microsatlites debido a un descenso de la regulacin de reparacin de errores. De
esta forma, el estrs que acompaa al cambio evolutivo podra inducir en una poblacin el
incremento de mutaciones requeridas para adaptarse al cambio.

Los microsatlites han demostrado ser los marcadores ms informativos para estudios
poblacionales a nivel de subespecie. La mayora de los estudios realizados hasta el
momento con este tipo de marcadores se basa en el anlisis de frecuencias allicas, con la
finalidad en un principio de la creacin de mapas genticos y posteriormente para la
determinacin de QTLs (Quantitative Trait Loci).
Los microsatlites se encuentran en los genomas de todos los eucariotas. Por medio
de la tcnica de PCR se amplifican estos pequeos segmentos para el anlisis de los
polimorfismos utilizando un par de oligonucletidos especficos complementarios a las
secuencias nicas que flanquean el microsatlite. Los fragmentos amplificados presentan un
polimorfismo extensivo resultante de la diferencia en el nmero de elementos simples
repetidos. El resultado de la amplificacin se fracciona en un gel de acrilamida-urea para
determinar

el

genotipo

de

cada

individuo.

As,

cada

regin

microsatlite,

independientemente de la secuencia repetida, constituye un locus altamente variable,


multiallico y de gran contenido informativo.

Figura 2. Deteccin mediante PCR de distintos alelos de un polimorfismo microsatlite y anlisis de


genotipos de microsatlites marcados con fluorescencia.

Los microsatlites presentan la ventaja de estar distribuidos al azar, en intrones,


regiones codificantes o intergnicas; aunque con una leve tendencia a presentar una
mayor densidad en la regin distal (telomrica) de los cromosomas.
El anlisis de PCR se usa de manera rutinaria en casos forenses para generar perfiles
de ADN a partir de muestras degradadas o antiguas. Los microsatlites han reemplazado a
los VNTR en la mayora de los laboratorios. Es menos costoso y mucho ms rpido. Los
resultados de los anlisis de STR se analizan e interpretan usando estadstica, probabilidad y
gentica de poblaciones.

B- MARCADORES QUE PRESENTAN CAMBIOS PUNTUALES EN EL GENOMA

RFLP: Polimorfismo de Longitud de Fragmentos de Restriccin. (Restriction Fragment Length


Polimorphism)

A finales de la dcada del 60, el descubrimiento de las endonucleasas de bacterias


(enzimas de restriccin con muy alta especificidad), las cuales cortaban el ADN en
secuencias definidas de usualmente 4-8 pb, conllev al desarrollo de tcnicas para el
aislamiento y la manipulacin de fragmentos de ADN. Una de las mayores aplicaciones de
esta tcnica fue el ensamblaje de los mapas genticos con el polimorfismo en longitud de
los fragmentos de restriccin.
Esta tcnica explota las variaciones en las secuencias del ADN por la creacin o
abolicin de sitios para el corte de las endonucleasas, dadas por los cambios de bases, las
adiciones o deleciones de fragmentos de ADN entre y en estos sitios. Adems, algunas
endonucleasas son incapaces de cortar el ADN si la secuencia de reconocimiento contiene
uno o ms sitios de citosina metilada, por lo tanto tales enzimas pueden detectar
polimorfismo si hay variaciones en los patrones de metilacin.
El estudio de los polimorfismos de este tipo consiste en el anlisis en cuanto a nmero
y tamao de los fragmentos de ADN que se originan al digerir con las mencionadas enzimas
el material genmico o un fragmento amplificado del genoma, de manera que un sitio de
restriccin polimrfico o una delecin o insercin entre dos sitios de corte ser detectado
como un polimorfismo en la longitud de los fragmentos de restriccin generados a nivel
fenotpico. La tcnica consta de las siguientes etapas (figura 3): digestin del ADN con
enzimas de restriccin; separacin por electroforesis de los fragmentos resultantes;
transferencia de los fragmentos separados a membranas de nitrocelulosa (Southern Blotting)
e hibridacin con sondas moleculares radiactivas y exposicin de la membrana a un filme
de rayos X. La identificacin del polimorfismo tambin puede hacerse por PCR. Este mtodo
se ha empleado en la caracterizacin de los genes de algunas de las protenas lcteas
bovinas.
El uso de los RFLP como marcadores para trazar la transmisin de los genes asociados
a ellos, es de una utilidad considerable en gentica pues tienen como ventajas el no estar
influenciados por el ambiente, no depender del estado ontognico del animal, permitir un
anlisis de todo el genoma, poder ser detectados en estadios muy tempranos del desarrollo
independientemente de la expresin del gen, una vez heredados, y adems poseen la
caracterstica de ser codominantes en la expresin fenotpica, es decir, permiten discernir
entre el individuo homocigtico dominante y el heterocigtico; son muy comunes y
cualquier gen debe tener sitios de restriccin polimrficos en una vecindad de varios cientos
de pares de bases.

Pero tienen como desventajas que son muy costosos, necesitan de un personal
calificado y entrenado para trabajarlo, precisan el uso de radioactividad y adems,
consumen mucho tiempo. En animales domsticos se ha realizado este tipo de anlisis del
ADN desde 1985, con numerosos trabajos en una amplia diversidad de especies.
Otras de las aplicaciones de esta tecnologa ha sido el desarrollo de detallados
mapas de ligamiento en una amplia variedad de organismos. Aunque sta es la ms
conocida, el RFLP se ha empleado tambin en la caracterizacin del genoma de organelos,
en la identificacin de lneas o individuos y en las investigaciones sobre el tema de la
diversidad gentica. La identificacin y el mapeo de RFLP han revolucionado la gentica
humana por el desarrollo del diagnstico asistido por marcadores y la deteccin de una
amplia variedad de enfermedades hereditarias. A pesar de haber sido ignorados este tipo
de marcadores en sus inicios por los genetistas veterinarios, los mismos mtodos para el
mapeo en humanos son empleados para estudios de diferentes especies animales, respecto
a los sitios polimrficos, producindose una revolucin en el mejoramiento animal por la
introduccin de la seleccin asistida por marcadores (Marker Asisted Selection: MAS).

Figura

3.

A:

esquemtica

Representacin
del

principio

gentico del RFLP.


B: Gel de azarosa 1.5% teido
con

bromuro

conteniendo

de
los

etidio

productos

obtenidos de ADN de diferentes


individuos, amplificados por PCR

RAPD: Amplificacin aleatoria de ADN polimrfico (Random Amplified Polymorphic DNA)

La tcnica RAPD, conocida tambin como AP-PCR es bsicamente una variacin


del protocolo de la PCR con dos caractersticas distintivas: utiliza un cebador nico (en lugar
de un par de primers) con una secuencia arbitraria, por lo tanto desconocida. Para que

ocurra la amplificacin, dos secuencias complementarias al cebador arbitrario deben estar


lo suficientemente adyacentes (~400pb) y en orientacin opuesta que permita la
amplificacin exponencial por la ADN-polimerasa (Figura 4).
En los RAPD se emplean cebadores cortos (10 pares de bases) que se utilizan de
forma individual en reacciones de PCR con un nivel de especificacin muy bajos. De esta
manera se genera un patrn de bandas sencillos que depender de la capacidad de los
cebadores para encontrar zonas en el ADN, parcial o totalmente complementario.

Figura 4. Deteccin de un loci


polimrfico a travs de la tcnica
RAPD.

(las lneas

horizontales

representan los cromosomas de


las

lneas

consanguneas

de

ratones C3Hy B6

Durante la fase de alineamiento de la reaccin de PCR-RAPD, el cebador o primer


arbitrario se unir a los sitios de la secuencia complementaria en el ADN molde
desnaturalizado. Si dos molculas se alinean con el molde en cadenas opuestas, con la
orientacin apropiada y con una distancia amplificable (menor o igual a 2500 bases)
entonces ser amplificado un fragmento discreto de ADN. Cada primer es potencialmente
capaz de amplificar un nmero de fragmentos (1-10 o ms) de diferentes loci durante la
misma reaccin de PCR resultando en varias bandas. Los segmentos amplificados pueden
ser visualizados en un gel de agarosa teido con bromuro de etidio o en geles de
poliacrilamida de alta resolucin visualizados por autorradiografa o teidos con plata
detectndose el polimorfismo como ausencia o presencia de bandas de un fragmento
particular.
Los polimorfismos RAPD resultan de la diferencia de secuencias en uno o ambos sitios
de unin de los primers, los cuales evitan el alineamiento de la secuencia molde. Otras
fuentes de polimorfismo RAPD pueden incluir diferencias de apenas un par de bases
(mutaciones puntuales) que son suficientes para causar complementariedad del primer en
el sitio de iniciacin; deleciones o inserciones adyacentes en el sitio de iniciacin de modo

que provoquen la accin de la ADN-polimerasa, por lo que los marcadores RAPD tienen
naturaleza binaria, el segmento amplificado est presente o no; son marcadores dominantes
porque solo se amplifica una variante allica, aquella que cumple con los requisitos de
complementariedad entre el cebador y las cadenas de ADN a una distancia menor o igual
a 2Kb.
La distribucin de marcadores RAPD a lo largo del genoma es una consideracin
importante cuando se evala la utilidad de estos marcadores, los cuales estn ampliamente
ubicados ms o menos al azar por todo el genoma. Existen reportes que verifican su
presencia en el genoma de numerosas especies. Los RAPDs se han utilizado tambin para la
caracterizacin racial en ganado bovino.
Una caracterstica importante en cualquier marcador gentico es que posean una
reproducibilidad consistente.
Para

esta

tcnica

no

es

necesario

conocer previamente la secuencia del ADN.


Esta

tcnica

se

diferencia

fundamentalmente de otras y muestra ventajas,


por ejemplo, sobre RFLP, en que no se basa en
hibridacin sino en la amplificacin de ADN, lo
que implica simplicidad y rapidez, lo cual se

En este tipo de marcadores factores


como calidad y concentracin del ADN
molde, presencia de contaminantes
precipitables con etanol, concentracin
de cloruro de magnesio, contenido de
G+C en los primers y su concentracin y
la eficiencia del termociclador, influyen
en la amplificacin y afectan la
sensibilidad de la reaccin, adems de
la fuente de la ADN polimerasa.

debe a la posibilidad de detectar polimorfismo por la visualizacin directa de las bandas en


el gel, eliminando todas las etapas de transferencia de ADN para membranas (Southern
Blot), hibridacin con sondas especficas y autorradiografa; no requiere del desarrollo de
una librera de sondas especficas, sino que un conjunto de primers arbitrarios puede utilizarse
para cualquier organismo; se elimina la necesidad de istopos radiactivos, se requiere 10-3
veces menos concentracin de ADN que para RFLP y la principal desventaja es el bajo
contenido de informacin gentica por loci asociado a la dominancia de los marcadores
RAPD, adems de que para su desarrollo requiere que se garanticen condiciones de
adecuada repetibilidad, adems de ser un mtodo muy trabajoso y costoso.

AFLP: Polimorfismos de longitud de fragmentos amplificados (Amplified fragment length


polymorphisms)

Se basa en la amplificacin arbitraria de fragmentos de restriccin de ADN ligados a


adaptadores: se utilizan cebadores semiespecficos con secuencia complementaria al
adaptador en el extremo 5. Estos marcadores combinan dos enzimas de restriccin,
(generalmente la EcoR1 y la Mse1) y dos amplificaciones de PCR usando primers marcados.
Se generan patrones de bandas complejos en donde es fcil encontrar polimorfismos

10

claramente diferenciales. Consiste en la amplificacin de mltiples regiones arbitrarias del


genoma.
Involucra cuatro etapas:

digestin con dos enzimas de restriccin, una de corte raro (reconoce secuencias de
6pb) y otra de corte frecuente (reconoce secuencias de 4pb);

acoplamiento de adaptadores especficos de doble cadena a los extremos de los


fragmentos de restriccin;

amplificacin selectiva de fragmentos con cebadores especficos. Se lleva a cabo con


el uso de iniciadores que contienen una base extra en el extremo 3 lo que produce un
conjunto de fragmentos que adems de llevar la secuencia complementaria al primer o
iniciador, complementan a la base extra adicional. Hay una segunda amplificacin en la
cual se conocen iniciadores con dos o tres bases extras. Los fragmentos son
complementarios a las extensiones consideradas.

separacin de los fragmentos por electroforesis en geles de poliacrilamida.

Se pueden utilizar varios mtodos para revelar el patrn de bandas: empleo de


istopos radiactivos y la tincin con nitrato de plata.
Mediante la seleccin del nmero de nucletidos selectivos es posible controlar el
nmero de fragmentos a amplificar, en una relacin inversamente proporcional. El
polimorfismo es detectado por la presencia o ausencia de bandas debido a mutaciones en
los sitios de restriccin o en secuencias adyacentes a estos, los cuales se complementan o se
diferencian de los nucletidos selectivos aadidos a los cebadores de la PCR, y por
inserciones o deleciones dentro del fragmento amplificado.
Tiene como ventajas que se obtiene un alto grado de polimorfismo, un mayor nmero
de marcadores por gel analizado y no requiere del conocimiento de la secuencia de ADN.
Debido a la cantidad de marcadores que pueden ser generados, el mapeo gentico
puede realizarse con mayor rapidez y ms fcilmente. Es una tcnica para estudios de
biodiversidad. Comparado con RFLP es ms rpido, menos laborioso y provee mayor
informacin. Revela fundamentalmente el polimorfismo dominante, que puede ser por la
presencia o ausencia del sitio de restriccin o por una simple variacin de un nucletido en
el genoma.
Los marcadores AFLP pueden ser aislados del gel y usarlo como sondas para
caracterizar nuevos clones, o secuenciarlos para disear cebadores y emplearlos en otras
tcnicas basadas en PCR.

11

Figura 5. Representacin esquemtica de los AFLP

SSCPs: Polimorfismo de Conformacin de las Cadenas Simples

El ADN de cadena simple tiende a doblarse y formar estructuras complejas


estabilizadas por enlaces intramoleculares dbiles, especialmente por puentes de
hidrgeno. Consiste en la deteccin de las diferencias entre fragmentos de ADN
amplificados, con distinta secuencia. Esto permite la deteccin de mutaciones puntuales de
ADN sin necesidad de conocer su secuencia y son capaces de identificar entre el 30 y 70%
de todos los polimorfismos debidos a una mutacin simple. Su deteccin se lleva a cabo en
un gel de acrilamida en condiciones no desnaturalizantes. Los primers pueden estar
radioactivamente marcados, o puede realizarse la deteccin de los productos amplificados
por tincin con plata y siempre deben incluirse muestras controles para identificar el tipo
salvaje del mutado.

12

SSCP es simple y adecuadamente sensible para fragmentos de hasta 200pb de


longitud, y

han sido utilizados en la identificacin de variantes allicas de las protenas

lcteas, pero para el desarrollo de esta metodologa se requiere una amplia batera de
oligonucletidos que encarece su utilizacin.

SNPs: Polimorfismo de nucletido simple (Single Nucleotide Polymorphism)

Se consideran la ms reciente generacin de marcadores moleculares, basados en


la identificacin de la sustitucin de un nucletido por otro, representando solamente dos
alelos simples. Su frecuencia oscila entre 1 cada 600 y 1 cada 1000 pares de bases. Ellos
incluyen la tcnica clsica de RFLPs pero no exactamente detectando la aparicin o
abolicin de un sitio de restriccin. Constituye una ventaja el hecho de que puedan ser
detectados sobre arrays (chips) de fase slida sin necesidad del empleo de electroforesis
en geles.
El mtodo ms directo para la deteccin es la secuenciacin de segmentos de ADN,
previamente amplificados por PCR, de varios individuos que representen la diversidad de la
poblacin. Se disean cebadores para amplificar fragmentos de ADN de 400-700 pb,
derivados fundamentalmente de genes de inters o de secuencias reportadas en bases de
datos correspondientes a secuencias expresadas (expressed sequence tag, EST). Los
productos amplificados se secuencian en ambas direcciones y sus secuencias se comparan
en busca de polimorfismos.
El microarray es un arreglo de
cientos a millares de secuencias
de
ADN
inmovilizadas
y
ordenadas en forma de matriz
adheridas a una superficie
slida (generalmente de cristal).
Cada secuencia es un gen
diferente.

La mayora de los mtodos de deteccin de


SNPs se basan en la amplificacin usando multiplex
de una secuencia diana y la hibridacin con
oligonucletidos anclados al microarray, cada uno
de los cuales est terminado en un nucletido
polimrfico.
Un paso sencillo de extensin del primer se

lleva a cabo sobre el array, usando una mezcla de cuatro dideoxinucletidos marcados
con fluorescencia. Las marcas se adicionan a los cebadores que se unen perfectamente al
ADN, no siendo as con aquellos que no lo hacen en el extremo 3. La lectura de la
presencia o ausencia de fluorescencia en el array permite obtener el tipo de cada SNP
sobre el array.
Cualquiera de los cuatro nucletidos puede estar presente en cualquier posicin en
el genoma, por lo tanto se debe suponer que cada SNP tendra cuatro alelos. Tericamente
esto es posible, pero en la prctica la mayora de los SNP tienen solamente dos variantes, la
secuencia original y la versin mutada. Esto se debe a la va en que estos aparecen y se
distribuyen en una poblacin. Un SNP se origina cuando una mutacin puntual ocurre en el

13

genoma, convirtiendo un nucletido en otro. Si la mutacin ocurre en las clulas


reproductivas de un individuo, pudiendo ser heredada por uno o ms descendientes y
despus de muchas generaciones, el SNP puede establecerse en la poblacin. Para que se
produzca un tercer alelo, una nueva mutacin debe ocurrir en la misma posicin en el
genoma de otro individuo, y este individuo y su descendencia deben reproducirse de forma
tal que el nuevo alelo quede establecido. Esto no es imposible, pero es poco probable, por
lo tanto la mayora de los SNP son biallicos.

Figura 6. Los SNP son marcadores basados en la identificacin


de la sustitucin de un nucletido por otro.

Los SNP pueden aparecer tanto fuera de los


genes (que no afecten la produccin o funcin de
alguna protena) como en un gen especfico, donde
pueden ubicarse en regiones codificantes (relacionados
con cambios en la cantidad de protena producidas) o
no codificantes (que afectan solo la secuencia de aminocidos).
Estos han sido empleados como marcadores para el diagnstico de rasgos
especficos por ser abundantes en el genoma bovino, genticamente estables y de anlisis
fcilmente automatizable, lo que ha permitido adems, su utilizacin como marcadores
para la identificacin animal y pruebas de paternidad en ganado bovino.
Un haplotipo es una combinacin de alelos
de diferentes loci de un cromosoma que son
trasmitidos juntos, estn ligados en un mismo
cromosoma. Un haplotipo puede ser un locus, varios
loci, o un cromosoma entero dependiendo del
nmero de eventos de recombinacin que han
ocurrido entre un conjunto dado de loci.
Figura 7. Un haplotipo es un conjunto especfico de SNP y otras variantes genticas observadas en un
cromosoma individual o en parte de un cromosoma.

Dada la alta variabilidad allica, la probabilidad de que dos individuos no


relacionados presenten un mismo haplotipo, es prcticamente nula. Es por esto que el
estudio de haplotipos se ha convertido en una herramienta til en la determinacin de
relaciones genticas entre individuos. Los SNPs (polimorfismos de nucletido simple) se
heredan en grupos que se encuentran estrechamente relacionados en el ADN. A este grupo
de SNPs que se heredan en bloque, es a lo que hemos denominado haplotipos.

14

EST: Etiquetas de secuencia expresada (Expressed sequence tags)

Los EST son secuencias cortas obtenidas de clones de ADN complementario (ADNc) y
sirven como pequeos identicadores del gen. Puede usarse como un marcador, para
buscar el resto del gen o para ubicarlo en un segmento ms grande de ADN.
Tpicamente tienen entre 200 y 400 nucletidos de longitud. Los datos de los EST son
capaces de proporcionar una estimacin aproximada de los genes que estn expresados
activamente en un genoma bajo una condicin siolgica en particular.
Esto debido a que las frecuencias para ESTs particulares reejan abundancia en los
ARNm de una clula, que corresponde con los niveles de expresin de genes bajo esa
condicin. Otro potencial benecio del muestreo por EST es que, al secuenciar clones de
ADNc de manera aleatoria es posible encontrar nuevos genes. Sin embargo la utilizacin de
EST tambin presenta varios inconvenientes, para el anlisis de perles de expresin. Tienen
como desventaja:

Baja calidad, debido a que se generan de forma automatizada, sin vericacin


(conlleva a altos ndices de error)

Errores de lectura

Contaminacin

comn

por

vectores

de

secuencia,

intrones

(de

ARN

no

empalmado), ARN ribosomal, ARN mitrocondrial entre otros.


A pesar de estas limitaciones, la tecnologa EST es todava ampliamente utilizada,
debido a que las bibliotecas de EST pueden ser generadas fcilmente de diferentes tipos de
clulas (tejidos, rganos). Adems facilita la identicacin exclusiva de un gen de una
biblioteca de ADNc. Aunque los EST son propensos a errores, una coleccin completa de EST
contiene informacin muy til.
La rpida acumulacin de secuencias de EST, ha impulsado el establecimiento de
bases de datos pblicas y privadas para almacenar los datos. Genbank tiene una base de
datos EST, dbEST (http://www.ncbi.nlm.nih.gov/projects/dbEST/).
Uno de los objetivos de las bases de datos de EST es organizar y consolidar un gran
nmero redundante de datos para mejorar la calidad de la informacin.
Este proceso incluye el preprocesamiento de los datos el cual remueve vectores
contaminantes y enmascara repeticiones. Despus sigue un proceso de agrupamiento o
clustering que agrupa secuencias EST asociadas a genes nicos.
El siguiente paso es obtener el consenso mediante la fusin de secuencias
redundantes, superposicin de EST y errores de lectura.
Una vez que la secuencia de codicacin es identicada puede ser anotada
traducindola a una secuencia de protenas para bsqueda de similitudes en base de
datos.

15

Tabla 1: Comparacin de algunos marcadores genticos


Caracterstica

RFLP

SSR

RAPD

AFLP

Isoenzimas

STS / EST

Annimo /
gnica

Annimo

Annimo

Annimo

Gnica

Gnica

El nmero mximo
terico de posibles
loci en el anlisis

Limitado por el
sitio de
restriccin
(nucletidos)
polimorfismo
(decenas de
miles)

Limitado por el
tamao del
genoma y el
nmero de
repeticiones
simples en un
genoma
(decenas de
miles)

Limitado por el
tamao del
genoma, y por
el polimorfismo
de nucletido
(decenas de
miles)

Limitado por el
sitio de
restriccin
(nucletidos)
polimorfismo
(decenas de
miles)

Limitado por el
nmero de
genes de
enzimas y
ensayos
histoqumicos
enzimticos
disponibles (3050)

Limitado por el
nmero de
genes
expresados
(10.000-30.000)

Dominio

Codominante

Codominante

Dominante

Dominante

Codominante

Codominante

Raro muy raro

Ocasional a
frecuente

Raro

Raro

A travs de
gneros

Dentro de los
gneros o
especies

Dentro de las
especies

Dentro de las
especies

A travs de las
familias y
gneros

A travs de las
especies
relacionadas

Reproducibilidad

Alto a muy alto

De medio a alto

Bajo a medio

De medio a alto

Muy alto

Alto

Cantidad de
muestra requerida
por muestra

2.10 mg de ADN 10-20 ng de DNA 2-10 ng de DNA

0.2-1 g de ADN

Varios mg de
tejido

10-20 ng de DNA

Origen

Alelos nulos

Transferibilidad

No aplicable
No aplicable
(presencia /
(presencia /
ausencia tipo de ausencia tipo de
deteccin)
deteccin)

Facilidad de
desarrollo

Difcil

Difcil

Fcil

Moderado

Moderado

Moderado

Facilidad de
ensayo

Difcil

Fcil a
moderado

Fcil a
moderado

De moderada a
difcil

Fcil a
moderado

Fcil a
moderado

Automatizacin /
multiplex

Difcil

Posible

Posible

Posible

Difcil

Posible

Genoma y el
potencial de
mapeo de QTL

Bueno

Bueno

Muy bueno

Muy bueno

Limitado

Bueno

Potencial de
mapeo
comparativo

Bueno

Limitado

Muy limitada

Muy limitada

Excelente

Buena a muy
buena

Mapeo de genes
candidatos
potenciales

Limitado

Intil

Intil

Intil

Limitado

Excelente

Potencial para el
estudio de la
variacin gentica
adaptativa

Limitado

Limitado

Limitado

Limitado

Bueno

Excelente

Desarrollo

Moderado

Caro

Barato

Moderado

Barato

Caro

Ensayo

Moderado

Moderado

Barato

Moderado a
cara

Barato

Moderado

Equipo

Moderado

Moderado a
cara

Moderado

Moderado a
cara

Barato

Moderado a
cara

RFLP polimorfismo en la longitud de fragmentos de restriccin; SSR - repeticiones de secuencia simple


(microsatlites); RAPD amplificacin al azar de ADN polimrfico; AFLP - polimorfismo de longitud de
fragmentos amplificados; STS - sitio de secuencia de etiquetado; EST - etiquetas de secuencias expresadas.
Fuente: http//www.fao.org

17

3.

Ventajas y desventajas de la PCR como mtodo de

clonacin

3.1

Principales ventajas de la reaccin

I.
Rapidez y sencillez de uso.
La PCR permite clonar ADN en pocas horas, utilizando equipos relativamente poco
sofisticados. Una reaccin de PCR tpica consiste en 30 ciclos de desnaturalizacin,
sntesis y reasociacin. Cada ciclo dura tpicamente de 3 a 5 minutos y se utiliza un
termociclador que lleva un microprocesador para programar los cambios de temperaturas
y el nmero de ciclos deseado. Esto supera ampliamente el tiempo requerido para la
clonacin en clulas, que suele ser de semanas, o incluso meses. Por supuesto, el
diseo y sntesis de los oligonucletidos cebadores tambin lleva tiempo, pero este
proceso ha sido simplificado gracias a la aparicin de programas informticos para el
diseo de los cebadores, y a la proliferacin de casas comerciales especializadas en la
sntesis de oligonucletidos por encargo. Una vez que se pone a punto, la reaccin puede
ser repetida de forma sencilla.

II.
Sensibilidad.
La PCR puede amplificar secuencias a partir de cantidades nfimas de ADN diana,
incluso a partir de ADN contenido en una sola clula. Esta elevada sensibilidad ha
permitido el desarrollo de nuevos mtodos para el estudio de la patognesis molecular y
la aparicin de numerosas aplicaciones (ciencia forense, diagnstico, estudios de
paleontologa molecular, etc) donde las muestras pueden contener muy pocas clulas.
Sin embargo, el hecho de que el mtodo tenga una sensibilidad tan elevada significa
tambin que se deben extremar las precauciones para evitar la contaminacin de la
muestra con ADN extrao.

III.
Robustez.
La PCR permite la amplificacin de secuencias especficas de material que contiene ADN
muy degradado, o incluido en un medio que hace problemtica su purificacin
convencional. Esto hace que el mtodo resulte muy adecuado para estudios de
antropologa y paleontologa molecular, por ejemplo para el anlisis de ADN recuperado
de individuos momificados y para intentar identificar ADN de muestras fsiles que
contienen poqusimas clulas de criaturas extintas hace ya mucho tiempo. El mtodo se
ha empleado con xito tambin para la amplificacin de ADN de muestras de tejidos
fijadas con formol, lo cual ha tenido importantes aplicaciones en patologa molecular.

3.2

Principales desventajas de la reaccin

I.
Necesidad de disponer de informacin sobre la secuencia del ADN diana
Para poder construir oligonucletidos especficos que acten como cebadores para la
amplificacin selectiva de una secuencia particular de ADN se necesita disponer de
alguna informacin previa sobre la propia secuencia a amplificar. Esto implica, por regla
general, que la regin de inters ya haya sido parcialmente caracterizada, a menudo
mediante la aplicacin de mtodos de clonacin basados en sistemas celulares. Sin
embargo, y para casos concretos, se han desarrollado varias tcnicas que reducen o
incluso hacen desaparecer esta necesidad de disponer de informacin previa sobre la
secuencia del ADN diana.

II.
Tamao corto de los productos de la PCR
Una desventaja clara de la PCR como mtodo de clonacin de ADN ha sido el tamao de
las secuencias de ADN que permite clonar. A diferencia de la clonacin de ADN en
clulas, donde pueden clonarse secuencias de hasta 2 Mb, la informacin de que se
dispone sobre la mayor parte de secuencias clonadas por PCR sita el tamao de los
fragmentos clonados entre 0 y 5 Kb, tendiendo hacia el extremo inferior. Los fragmentos
pequeos se amplifican muy fcilmente, pero conforme aumenta su tamao se hace ms
difcil obtener una amplificacin eficiente. En la actualidad sin embargo ya es posible
amplificar secuencias por PCR de tamaos entre 20 y 40 Kb.

III.
Infidelidad en la replicacin del ADN
La clonacin del ADN en clulas pasa por la replicacin del ADN in vivo, proceso
asociado a una gran fidelidad de copiado debido a la existencia, en la clula, de
mecanismos de lectura y correccin de errores. Sin embargo, cuando el ADN se replica in
vitro la tasa de errores cometidos durante el copiado se dispara. Ya se ha comentado
anteriormente que la Taq polimerasa utilizada en la reaccin no tiene actividad
exonuclesica.

IV.
Peligro de contaminacin
La facilidad con que se amplifica el ADN exige evitar el peligro de contaminacin
inherente al poder multiplicador de la reaccin. En un tubo en el que se ha realizado una
reaccin de PCR hay tal cantidad de ADN, que al salir caliente del termociclador y abrir
este, el vapor alcanza el ambiente del laboratorio. "Si se pasa un papel de filtro por los
pomos de las puertas, o la superficie del termociclador, se puede rescatar suficiente ADN
como para obtener una seal".

10

4.

Aplicaciones de la PCR

Construccin de bibliotecas de ADNc


Una biblioteca de ADNc es el conjunto de clones obtenidos a partir de los ARNm de un
tejido determinado de un organismo completo.
El ADNc se sintetiza a partir de un mensajero y un cebador por accin de la transcriptasa
inversa.
Los clones de ADNc tienen una utilidad especial, ya que al proceder de los mensajeros
correspondientes, carecen de intrones. Los procariotas carecen de intrones en sus
mensajeros y por eso no son capaces de procesar los ARNm eucariticos correctamente.
Si lo que se pretende es expresar un gen eucariota en un sistema procaritico, se deber
clonar a partir de su ADNc y no de su secuencia genmica.
La mayora de los genes eucariticos clonados han sido aislados a partir de bibliotecas
de ADNc. La elaboracin de una biblioteca de ADNc implica el aislamiento de la
poblacin total de mensajeros celulares y su transcripcin revertida a ADN.

Figura 3
Modo de accin de la transcriptasa inversa en el proceso de construccin de una biblioteca de ADNc.
i)

La transcriptasa inversa utiliza el ARNm como molde para sintetizar una hebra de ADN
complementaria utilizando como cebador una cola de oligo-dT

ii)

La misma polimerasa (gracias a su actividad ARNasa) destruye la hebra de ARNm molde y forma
una especie de "gancho" dejando un extremo 3' OH libre. El gancho servir de cebador a la ADN
polimerasa I para sintetizar la segunda cadena del ADNc y posteriormente se eliminar por la accin
de la nucleasa S1 que corta especficamente cadenas sencillas del ADN.

iii)

El ADNc as obtenido ser convenientemente tratado para ser incorporado a un vector y ser clonado
in vivo para obtener una biblioteca de ADNc.

11

4.2. Clonacin de secuencias desconocidas de ADN que


flanquean una regin conocida.

Una de las limitaciones con la que se encuentra la reaccin de la PCR estndar es que
amplifica secuencias de ADN comprendidas entre dos cebadores convergentes, es decir,
cada uno de ellos inicia la sntesis del ADN en la direccin del otro (extremos 3' OH
enfrentados). Muchas veces puede interesar conocer qu tipo de secuencias de ADN no
caracterizadas ocupan la regin adyacente externa a una regin conocida (por ejemplo,
conocer la regin reguladora flanqueante de un gen de secuencia ya conocida). Una
variante de la tcnica estndar, la PCR inversa, lo permite.
El mtodo se basa en el empleo de cebadores divergentes, es decir, cebadores cuyos
extremos 3' OH se dirijan hacia el exterior de la secuencia conocida. Con cebadores de
este tipo, una reaccin PCR estndar no funciona. En la PCR inversa, se trata el ADN
con una enzima de restriccin de forma que la regin deseada quede comprendida en un
pequeo fragmento de restriccin, al que se permite la circularizacin por
complementariedad de los extremos cohesivos. Una vez circularizado el fragmento, se
procede a una reaccin de PCR estndar utilizando los cebadores divergentes, que ahora
s permiten que se desarrolle la reaccin.

Figura 4
Clonacin de secuencias de ADN flanqueantes a
partir de un molde circularizado.
Las regiones X e Y representan las secuencias
desconocidas que se desea clonar. Los cebadores
se disean de forma que se unan a la secuencia de
ADN caracterizada, pero con sus extremos 3'
orientados en sentidos opuestos. Tras la
recuperacin de la secuencia caracterizada y de sus
regiones flanqueantes en forma de un fragmento de
restriccin, se circulariza la molcula, de manera que
las secuencias flanqueantes quedan en contacto y
los extremos 3' de los cebadores quedan orientados
para que pueda tener lugar ahora la PCR estndar.

13

4.3

Secuenciacin del ADN y obtencin de sondas para

hibridaciones

El mtodo de secuenciacin de ADN requiere que el ADN est en forma de cadena


simple antes de su utilizacin. Pese a que la desnaturalizacin del ADN de los productos
de PCR puede proporcionar los sustratos monocatenarios necesarios para la
secuenciacin, la calidad de la secuencia de ADN aumenta si el producto de partida es
monocatenario en origen.
La PCR asimtrica es una variante de la PCR estndar que permite generar un gran
nmero de molculas de ADN de banda simple que se pueden utilizar directamente para
secuenciar o como sondas para hibridaciones.
El mtodo consiste en poner proporciones diferentes de cebadores de manera que uno
de los dos est a concentracin limitante. As, hasta los primeros 20 a 25 ciclos se
amplifican las dos hebras del ADN, pero al agotarse uno de los cebadores, los 5 a 10
ciclos siguientes sern de ADN de banda simple. La concentracin de uno de los
cebadores suele fijarse en 100 veces la concentracin del otro; utilizando, por ejemplo,
una relacin de 50 picomoles de un cebador y 0,5 del otro, se obtiene despus de 30
ciclos, de 1 a 3 picomoles de ADN de banda simple.

Figura 5
Esquema del procedimiento empleado en la PCR asimtrica para generar ADN de
banda simple

14

4.4.2 Huella del ADN


Las secuencias del genoma humano que se estudian para obtener la huella gentica de
un individuo corresponden a regiones altamente variables del genoma, caracterizadas
normalmente por ser ADN no codificante, es decir sin informacin para la elaboracin de
protenas o ARN. Estas regiones no codificantes tienen un margen de variacin ms
amplio que las regiones codificantes ya que las mutaciones que han sufrido a lo largo de
la evolucin no han sido cribadas por la seleccin natural y por ello, constituyen regiones
hipervariables del genoma.
Las regiones hipervariables del genoma estn formadas por distintas repeticiones de una
secuencia unidad cuyo nmero de pares de bases puede ser pequeo, entre 2 y 7 pares
de bases, son las secuencias microsatlite, o de mayor tamao, entre 10 y 60 pares de
bases llamadas en este caso secuencias minisatlite. Las unidades de repeticin de cada
una de estas regiones hipervariables se disponen una a continuacin de la otra en el
genoma o en tndem, siendo muy alto el nmero de veces que se repiten las secuencias
unidad de los loci minisatlites y mucho menor el nmero de repeticiones de las
secuencias de los loci microsatlites. El nmero de repeticiones consecutivas en una
posicin genmica en particular varia de individuo a individuo.
Marcadores genticos consistentes en la unidad repetitiva pueden ser utilizados como
sondas radiactivas para detectar un gran nmero de variantes polimrficas, exclusivas y
nicas de cada individuo, pero que a la vez presentan una gran estabilidad somtica
entre distintos tejidos, incluyendo los germinales.
El patrn de restriccin observado en un individuo al ser tratado su ADN con una enzima
de restriccin que no corte dentro de la unidad repetida, y posteriormente transferido el
ADN a nailon e hibridado con una sonda radiactiva de un minisatlite, se denomina
huella gentica o huella de ADN (ADN "fingerprint") (porque arroja un perfil propio de
cada individuo). La probabilidad estimada experimentalmente de que una sola banda de
las mltiples que se observan en un individuo est presente en otro individuo tomado al
azar es aproximadamente de 0,2; de esto se deduce que es bajsima la probabilidad
(5x10-19) de encontrar otro individuo sin parentesco directo con el primero y con una
huella gentica idntica.
La huella gentica es completamente especfica del individuo. No hay diferencia en los
patrones de restriccin de ADN obtenida de distintos fluidos corporales, sangre o semen
de un mismo individuo. Tampoco la hay entre gemelos univitelinos.
Cuando se preparan y analizan de forma rigurosa, las huellas de ADN pueden
proporcionar identificaciones fiables de los individuos. Una pequea cantidad de sangre,
de saliva o de semen que puedan ser encontrados en las ropas de una vctima o de un
sospechoso de haber cometido un crimen dan suficiente ADN como para aplicar esta
metodologa.
Las aplicaciones de la tcnica de anlisis de huellas en el ADN son muy numerosas,
cabe destacar las siguientes:
-

Diagnstico de paternidad biolgica y parentesco biolgico


Identificacin de vestigios biolgicos tales como sangre, semen, saliva, races de
cabello, tejidos, piezas dentales, etc., en procedimientos penales (por ejemplo en
la identificacin de individuos sospechosos de delitos), as como identificacin de
individuos post-mortem.
18

Sondas unilocus
Adems de las sondas que reconocen muchas regiones hipervariables dispersas por el
genoma (multiloci), existen otras que detectan un solo lugar en el genoma, igualmente
hipervariable (unilocus). Con las sondas unilocus hay solamente dos bandas de distinto
tamao por individuo (alelo paterno y materno).
Una de las ventajas que ofrece la utilizacin de sondas unilocus es que dan lugar a
patrones de ADN con menos bandas y por tanto ms fciles de interpretar que los que
proporcionan las sondas multiloci. El anlisis con sondas unilocus requiere adems
menos ADN.
Al marcar un nico locus se renuncia al poder de identificacin individual de la huella de
ADN. El problema queda resuelto utilizando varios marcadores diferentes (de 5 a 10, por
ejemplo) originando as un nmero no muy elevado de bandas especficas que tambin
resulta fcil de interpretar y que dan mayor solidez al diagnstico.

a)

b)

Figura 9
a) Anlisis de la movilidad de los fragmentos de restriccin originados en una regin unilocus para
identificar los alelos paternos (P) y maternos (M) de los cuatro hijos de un matrimonio. Una muestra
del ADN de los implicados se trata con una enzima de restriccin que no corte dentro de la regin
hipervariable, se corren las muestras en un gel de agarosa, se desnaturaliza el ADN y se transfiere a
nailon. La identificacin se hace por hibridacin con la sonda unilocus marcada radiactivamente. Los
alelos paterno y materno pueden ser identificados en todos los hijos excepto en el primero de ellos,
en el que aparece un nuevo alelo.
b) Determinacin de la paternidad entre dos posibles padres, P1 y P2, de un nio (N) empleando una
mezcla de cinco sondas unilocus. El padre P2 muestra total identidad con la mitad de las bandas
observadas en el nio.

21

Amplificacin de minisatlites y microsatlites por PCR


El anlisis de regiones hipervariables del genoma utilizando sondas multiloci o unilocus
requiere elevadas cantidades de ADN que adems debe de haber estado conservado en
condiciones ptimas.
Alec Jeffreys, en los aos noventa propuso combinar el mtodo de la PCR con la
obtencin de la huella gentica del individuo: amplificacin de minisatlites por PCR
(Minisatellite Variant Repeat-Polymerase Chain Reaction, MVR-PCR). El procedimiento a
seguir en el laboratorio consiste en amplificar una secuencia de minisatlite mediante
PCR y generar posteriormente un perfil de ADN.
El perfil de ADN basado en la amplificacin tiene la ventaja de ser ms sensible que el
proporcionado por las tcnicas de Souther e hibridacin. Permite la identificacin de
individuos por huella gentica incluso en aquellos casos en que el material gentico de
que se dispone es muy escaso (por ejemplo, cuando el resto biolgico es una sola raz de
cabello, o la saliva depositada en la boquilla de un solo cigarrillo) o bien cuando el resto
biolgico proporciona ADN muy degradado, tal como sucede en manchas de sangre
sometidas a la radiacin solar o a temperaturas muy altas, o se trata de restos biolgicos
post mortem.
La amplificacin de microsatlites (STR) es otro sistema utilizado por criminalistas y
est adquiriendo cada vez ms importancia en ciencia forense. A causa del pequeo
tamao de los framentos, los sistemas STR se hacen muy apropiados para el anlisis de
especmenes viejos o mal conservados.

Figura 10
Alec Jeffreys ha amplificado por PCR
distintos
minisatlites.
Una
vez
amplificados,
los
minisatlites
se
caracterizan con el mtodo de Souther.
Mediante PCR se pueden amplificar
restos de ADN degradado y obtener
informacin a partir de poca cantidad de
ADN. La fotografa muestra una
membrana con hibridacin de varios

22

Extraccin y Purificacin de ADN

A continuacin se recogen los principios de algunos de los mtodos de extraccin y


purificacin de cidos nucleicos que ms se emplean en la actualidad.

Mtodos de extraccin
Para extraer los cidos nucleicos del material biolgico es preciso provocar una lisis
celular, inactivar las nucleasas celulares y separar los cidos nucleicos de los restos
de clulas. El procedimiento de lisis idneo suele consistir en un equilibrio de
tcnicas y ha de ser suficientemente fuerte para romper el material inicial complejo
(un tejido, por ejemplo), pero suficientemente suave para preservar el cido nucleico
diana. Entre los procedimientos usuales de lisis figuran los siguientes:

rotura mecnica (trituracin, lisis hipotnica, etc.);

tratamiento qumico (detergentes, agentes caotrpicos, reduccin con tioles,


etc.);

digestin enzimtica (Proteinasa K, etc.).

Es posible romper la membrana celular e inactivar las nucleasas intracelulares al


mismo tiempo. Por ejemplo, una misma solucin puede contener detergentes que
solubilicen las membranas celulares y sales caotrpicas fuertes que inactiven las
enzimas intracelulares. Tras la lisis celular y la inactivacin de las nucleasas, los
restos de clulas se eliminan fcilmente por filtracin o precipitacin.

Mtodos de purificacin
Los mtodos empleados para purificar los cidos nucleicos de extractos celulares
suelen ser combinaciones de dos o ms tcnicas de las siguientes:

extraccin/precipitacin;

cromatografa;

centrifugacin;

separacin por afinidad.

En los prrafos siguientes se describen brevemente estas tcnicas (Zimmermann et


al., 1998).

Extraccin/precipitacin
A menudo se efecta una extraccin con disolventes para eliminar los
contaminantes de los cidos nucleicos. Por ejemplo, suele emplearse una
combinacin de fenol y cloroformo con objeto de eliminar las protenas. Para
concentrar los cidos nucleicos suele realizarse una precipitacin con isopropanol o
etanol. Si la cantidad de cido nucleico diana es escasa, puede aadirse a la mezcla

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

un portador inerte (como el glucgeno) para favorecer la precipitacin. Tambin


puede realizarse una precipitacin selectiva con concentraciones salinas elevadas
(precipitacin salina) o una precipitacin de las protenas mediante cambios del pH.

Cromatografa
Pueden emplearse diversas tcnicas cromatogrficas de separacin: permeacin
sobre gel, intercambio inico, adsorcin selectiva o unin por afinidad. La
permeacin sobre gel aprovecha las propiedades de las partculas porosas del gel
para tamizar molculas. Se emplea una matriz con poros de tamao definido, que
dejan pasar las molculas ms pequeas por difusin, pero no las ms grandes, que
quedan eluidas en el volumen vaco. As pues, las molculas quedan eluidas por
orden de tamao decreciente. La cromatogrfica de intercambio inico es otra
tcnica, que se basa en la interaccin electrosttica de la molcula diana con un
grupo funcional de la matriz en columna. Los cidos nucleicos (polianiones lineales
con fuerte carga negativa) pueden eluirse de las columnas de intercambio inico con
simples Tampones salinos. En la cromatografa de adsorcin, los cidos nucleicos
se fijan selectivamente en slice o vidrio, en presencia de determinadas sales (por
ejemplo, sales caotrpicas), mientras que otras molculas biolgicas no se fijan. A
continuacin, los cidos nucleicos pueden eluirse con agua o un tampn hiposalino y
se obtiene una muestra que puede emplearse directamente en las aplicaciones
posteriores.

Centrifugacin
La centrifugacin selectiva constituye un mtodo de purificacin eficaz. As, por
ejemplo, la ultracentrifugacin en gradientes autogenerados de CsCl con fuerzas g
elevadas se lleva empleando mucho tiempo para purificar plsmidos. La
centrifugacin suele asociarse a otros mtodos, como la cromatografa de columna
centrifugada, en cuyo caso se combina la permeacin sobre gel y la centrifugacin
para separar el ADN o ARN de contaminantes ms pequeos (sales, nucletidos,
etc.), intercambiar tampones o seleccionar segn el tamao. Algunos procedimientos
combinan la adsorcin selectiva en matriz cromatogrfica (vase el apartado anterior
Cromatografa) y la elucin por centrifugacin para purificar de forma selectiva un
tipo de cido nucleico.

Separacin por afinidad


En los ltimos aos, cada vez son ms los mtodos de purificacin que combinan la
inmovilizacin por afinidad de cidos nucleicos y la separacin magntica. Por
ejemplo, los ARNm poli A + pueden unirse a partculas magnticas revestidas de
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

estreptavidina mediante oligo dT marcados con biotina, y el complejo de partculas


puede eliminarse de la solucin (y de los contaminantes libres) con un imn. Esta
tcnica en fase slida simplifica la purificacin de los cidos nucleicos, pues permite
sustituir las etapas de centrifugacin, extraccin orgnica y separacin de fases por
una operacin de separacin magntica, nica y rpida.

Mtodo de extraccin y purificacin con CTAB


El protocolo del mtodo del bromuro de cetil-trimetil amonio (CTAB) fue elaborado
por Murray y Thompson en 1980 (Murray y Thompson, 1980) y publicado
posteriormente, en 1987, por Wagner y sus colaboradores (Wagner et al., 1987). El
mtodo es adecuado para extraer y purificar ADN de vegetales y alimentos
derivados de vegetales y est especialmente indicado para eliminar los polisacridos
y los compuestos polifenlicos, que, de otro modo, alteraran la pureza del ADN y,
por tanto, su calidad. Este procedimiento se ha aplicado con frecuencia en gentica
molecular de los vegetales y ha sido probado en ensayos de validacin para detectar
OGM (Lipp et al., 1999; 2001). Se han elaborado algunas variantes adicionales para
adaptar el mtodo a una amplia gama de matrices de alimentos transformados o sin
transformar (Hupfer et al., 1998; Hotzel et al., 1999; Meyer et al., 1997; Poms et al.,
2001).

Principios del mtodo del CTAB: lisis, extraccin y precipitacin


Las clulas vegetales pueden lisarse con el detergente inico bromuro de cetiltrimetil amonio (CTAB), que forma un complejo insoluble con los cidos nucleicos en
medio hiposalino. De ese modo, los polisacridos, los compuestos fenlicos y los
dems contaminantes permanecen en el sobrenadante y pueden eliminarse por
lavado. El complejo de ADN se solubiliza aumentando la concentracin salina y se
precipita con etanol o isopropanol. En esta seccin se describirn los principios de
las tres etapas principales: la lisis de la membrana celular, la extraccin del ADN
genmico y su precipitacin.
Lisis de la membrana celular: Tal como se ha mencionado anteriormente, la
primera etapa de la extraccin del ADN es la rotura de la membrana celular y
nuclear, para lo cual la muestra homogeneizada se trata primero con el tampn de
extraccin, que contiene EDTA, Tris-HCl y CTAB. Todas las membranas biolgicas
presentan la misma estructura general, integrada por molculas de lpidos y de
protenas, unidas por interacciones no covalentes.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

ADN
Membrana

nuclear

Figura 1. Representacin simplificada de las membranas celulares1.


Tal como muestra la figura 1, las molculas lipdicas estn ordenadas en una doble
capa continua, en la que las molculas protenicas estn disueltas. Las molculas
lipdicas estn formadas por extremos hidrfilos, denominados cabezas, y
extremos hidrfobos, denominados colas. En este mtodo, el detergente (CTAB)
contenido en el tampn de extraccin provoca la lisis de la membrana. Dado que la
composicin de los lpidos y del detergente es similar, el componente de CTAB del
tampn de extraccin captura los lpidos que integran la membrana celular y nuclear.
La figura 2 ilustra el mecanismo de solubilizacin de los lpidos con un detergente.

Figura 2. Solubilizacin de los lpidos.

Las ilustraciones que figuran en esta pgina y en las siguientes proceden del Genetic Science
Learning Center, Universidad de Utah, http://gslc.genetics.utah.edu.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

La figura 3 ilustra cmo se libera el ADN genmico cuando el detergente captura los
lpidos y las protenas al entrar en contacto la membrana celular y el tampn de
extraccin con CTAB. Con una concentracin salina (NaCl) determinada, el
detergente forma un complejo insoluble con los cidos nucleicos. El EDTA es un
componente quelante, que se une al magnesio, entre otros metales. El magnesio es
un cofactor de la desoxirribonucleasa. Al unir el magnesio al EDTA, la actividad de la
desoxirribonucleasa presente disminuye. El Tris-HCl confiere a la solucin la
capacidad de amortiguar el pH (un pH inferior o superior daa el ADN). Es
importante sealar que, como los cidos nucleicos se degradan fcilmente en esta
fase de la purificacin, debe reducirse al mnimo el tiempo transcurrido entre la
homogeneizacin de la muestra y la adicin de la solucin tampn con CTAB. Una
vez que se han roto las membranas de la clula y de los orgnulos (como los que se
encuentran alrededor de las mitocondrias y los cloroplastos), se purifica el ADN.

Figura 3. Rotura de la membrana celular y extraccin del ADN genmico.


Extraccin - En esta etapa, se separan los complejos formados por los cidos
nucleicos y el CTAB de los polisacridos, los compuestos fenlicos, las protenas y
los dems lisados celulares disueltos en la solucin acuosa. Es especialmente
importante eliminar los polisacridos y los compuestos fenlicos, pues pueden inhibir
numerosas reacciones enzimticas. En concentraciones hiposalinas (NaCl < 0,5 M),
los contaminantes de los complejos de cidos nucleicos no precipitan y pueden
eliminarse

extrayendo

la

solucin

acuosa

con

cloroformo.

El

cloroformo

desnaturaliza las protenas y facilita la separacin de las fases acuosa y orgnica. La


fase acuosa suele constituir la fase superior. No obstante, si dicha fase es densa
debido a la concentracin salina (> 0,5 M), formar la fase inferior. Adems, si el pH
de la solucin acuosa no se ha equilibrado debidamente (pH 7,8 8,0), los cidos
nucleicos tendern a repartirse en la fase orgnica. Si es preciso, la extraccin con

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

cloroformo se realizar dos o tres veces, con objeto de eliminar por completo las
impurezas de la capa acuosa. Para perfeccionar la extraccin de los cidos
nucleicos, puede retroextraerse la fase orgnica con una solucin acuosa, que se
aade a continuacin al extracto anterior. Una vez purificados los complejos de
cidos nucleicos, puede procederse a la precipitacin, ltima etapa del
procedimiento.
Precipitacin - En esta ltima etapa se separan los cidos nucleicos del detergente,
para lo cual la solucin acuosa se trata primero con una solucin de precipitacin
compuesta por una mezcla de CTAB y NaCl en concentracin elevada (NaCl >
0,8 M). Una alta concentracin salina es necesaria para que se forme un precipitado
de cidos nucleicos. Puede ser preferible emplear acetato de sodio en lugar de NaCl
por su capacidad tampn. En estas condiciones, el detergente, que es ms soluble
en alcohol que en agua, puede eliminarse por lavado, mientras que los cidos
nucleicos precipitan. El posterior tratamiento con etanol al 70 % permite una mayor
purificacin o elucin de los cidos nucleicos de la sal residual.

Cuantificacin del ADN mediante espectrofotometra


El ADN, el ARN, los oligonucletidos e incluso los mononucletidos pueden
cuantificarse directamente en soluciones acuosas, en forma diluida o sin diluir,
midiendo la absorbancia A (o densidad ptica, DO) de luz ultravioleta (tambin
puede hacerse en el intervalo visible). Si la muestra es pura, es decir, no contiene
cantidades significativas de contaminantes como protenas, fenol o agarosa, la
medicin espectrofotomtrica de la irradiacin ultravioleta absorbida por las bases es
sencilla y exacta. En este mtodo, los tampones acuosos con escasa concentracin
inica (por ejemplo, tampn TE) resultan idneos. La concentracin de cidos
nucleicos suele determinarse midiendo a 260 nm y comparando con un blanco. La
interferencia de contaminantes puede determinarse calculando un cociente. Dado
que las protenas absorben a 280 nm, se emplea el cociente A260/A280 para calcular
la pureza de los cidos nucleicos. Los cocientes respectivos del ADN y el ARN puros
son aproximadamente de 1,8 y 2,0. Una absorcin a 230 nm significa que la muestra
est contaminada con hidratos de carbono, pptidos, fenoles, compuestos
aromticos u otras sustancias. El cociente A260/A230 de las muestras puras es de 2,2
aproximadamente.
Cuando la cantidad disponible de cidos nucleicos es escasa, puede emplearse el
mtodo de la placa de agarosa con bromuro de etidio. Permite calcular la cantidad
de cidos nucleicos a partir de la intensidad de la fluorescencia emitida por el
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

10

bromuro de etidio irradiado con luz UV, comparndola con unos patrones de
concentracin.

Principios de la cuantificacin de ADN por espectrofotometra


El espectrofotmetro se funda en la transmisin de la luz a travs de una solucin
para determinar la concentracin de un soluto presente en la misma. El aparato
funciona conforme a un principio sencillo: se irradia una muestra con una radiacin
luminosa de longitud de onda conocida y se mide la energa luminosa transmitida
con una clula fotoelctrica situada detrs de la muestra.
Tal como muestra la figura 4, el espectrofotmetro de haz nico consta de una
fuente luminosa, un prisma, un recipiente con la muestra y una clula fotoelctrica.
Los distintos elementos estn conectados a los sistemas elctricos o mecnicos
adecuados para controlar la intensidad luminosa y la longitud de onda y para
convertir en variaciones de tensin la energa recibida en la clula fotoelctrica. Las
variaciones de tensin se miden en un contador o se registran en un ordenador para
su posterior anlisis.

F
i
g
Figura 4. Representacin esquemtica de la transmisin de la luz.
Cada molcula absorbe la energa radiante a una longitud de onda especfica, a
partir de la cual es posible extrapolar la concentracin de un soluto en una solucin.
Con arreglo a la ley de Lambert-Beer, existe una relacin lineal entre la absorbancia
A (tambin denominada densidad ptica, DO) y la concentracin de la
macromolcula, conforme a la ecuacin siguiente:
A = DO = lc

(1)

donde es el coeficiente de extincin molar, c es la concentracin y l es el paso de


luz de la cubeta. Las protenas y los cidos nucleicos absorben la luz en el intervalo

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

11

ultravioleta, a longitudes de onda comprendidas entre los 210 y los 300 nm. Tal
como se ha sealado anteriormente, la absorbancia mxima de las soluciones de
ADN y ARN corresponde a 260 nm y la de las soluciones de protenas, a 280 nm.
Dado que las soluciones de ADN y ARN absorben parcialmente la luz a 280 nm y las
que contienen protenas hacen lo propio a 260 nm, el cociente de los valores
obtenidos a 260 nm y a 280 nm (A260/A280) proporciona una estimacin del grado de
pureza de los cidos nucleicos. Los cocientes A260/A280 respectivos del ADN y el
ARN puros son aproximadamente de 1,8 y 2,0. Con un paso de luz de 10 mm y una
longitud de onda de 260 nm, una absorbancia A = 1 corresponde aproximadamente
a 50 g/ml de ADN bicatenario, 37 g/ml de ADN monocatenario, 40 g/ml de ARN o
30 g/ml de oligonucletidos. Si la muestra tambin contiene protenas, el cociente
A260/A280 ser considerablemente inferior a dichos valores y no podr determinarse
con exactitud la cantidad de cidos nucleicos. Debe precisarse que la
espectrofotometra no permite identificar de forma fiable impurezas de ARN
presentes en las soluciones de ADN. Puede emplearse la absorbancia a 325 nm
para poner de manifiesto la presencia de restos en la solucin o la suciedad de la
cubeta.

Determinacin de la concentracin de cidos nucleicos


Eleccin de la cubeta. La cantidad de solucin de cidos nucleicos necesaria para
medir la absorbancia A depende de la capacidad de la cubeta. Debe elegirse una
cubeta apropiada atendiendo al intervalo de concentracin de la muestra, el factor
de dilucin y el volumen de la muestra. En la mayor parte de los procedimientos
empleados para detectar OGM, el volumen de ADN genmico disponible vara entre
50 y 100 l. Para la cuantificacin espectroscpica de pequeos volmenes de
cidos nucleicos se emplean diversos tipos de cubetas de microvolumen, cuya
capacidad oscila entre 5 y 70 l.
Preparacin. Para calibrar el espectrofotmetro es importante:

establecer el paso de luz correcto;

establecer el factor correcto (ADN bicatenario, ADN monocatenario o ARN);

medir la solucin en blanco (establecer la referencia), que ser agua o solucin


tampn (A260 = 0);

cerciorarse de que la referencia establecida se renueva peridicamente;

medir una cantidad conocida de cidos nucleicos puros para comprobar la


fiabilidad de la referencia establecida.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

12

Medicin en una muestra desconocida. Para medir la concentracin, se utilizan


cantidades determinadas de solucin de ADN en funcin de la capacidad de la
cubeta empleada (por ejemplo, 5 l de ADN diluidos en 195 l de agua si la
capacidad de la cubeta es inferior a 0,2 ml). Despus de calibrar el
espectrofotmetro y de aadir la solucin de cidos nucleicos, se tapa la cubeta, se
mezcla la solucin y se mide la absorbancia. Con objeto de reducir los errores de
pipeteado, debe efectuarse la medicin al menos dos veces y siempre con 5 l de
solucin de ADN, como mnimo. Se desaconsejan los valores de A260 inferiores a
0,02 o comprendidos entre 1 y 1,5 (segn el instrumental empleado) por el elevado
margen de error que entraan.
La concentracin c de un cido nucleico determinado presente en una solucin se
calcula conforme a las ecuaciones siguientes:

ADN monocatenario:

c(pmol/l) = A260/0,027

ADN bicatenario:

c(pmol/l) = A260/0,020

ARN monocatenario:

c(pmol/l) = A260/0,025

Oligonucletido:

c(pmol/l) = A260100/1,5NA+0,71NC+1,20NG + 0,84NT

donde A260 es la absorbancia medida a 260 nm.


El cuadro 2 recoge un ejemplo de los valores de la absorbancia de ADN de timo de
ternera muy purificado, en suspensin en un tampn TNE 1x, considerando que el
ADN de referencia es ADN bicatenario, con una A260 = 1 a 50 g/ml, en una cubeta
cuyo paso de luz es de 10 mm. La concentracin nominal de ADN era de 25 g/ml.
Cuadro 2. Valores de la absorbancia de ADN de timo de ternera muy purificado, en
tampn TNE 1x.
Longitud de
onda
325
280
260
230

Absorbancia
0,01
0,28
0,56
0,30

A260/A280

Conc. (g/ml)

2,0
-

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

28
-

Sesin n 4

Soluciones Electroforesis

Protocolo y Tcnicas

Cultek

Electroforesis de Protenas

Las protenas son molculas cuya carga neta depende del contenido de una serie de aminocidos (fundamentalmente cido glutmico, cido
asprtico, lisina, arginina e histidina) y del grado de ionizacin de stos al pH considerado (figura 7).

Fig. 7. Principales aminocidos responsables de la carga neta de una protena, dependiendo del pH.
En los soportes no restrictivos (en los que el entramado no interfiere en la migracin, ya que el tamao de las protenas es muy pequeo en
comparacin con el tamao de poro del soporte), la separacin depende de la densidad de carga de las molculas y, as, cuanto mayor sea la
densidad, mayor ser la velocidad de migracin en un campo elctrico hacia el polo que determine su carga neta.
La primera etapa del proceso es la aplicacin de la muestra. En papel o acetato de celulosa, esto se puede efectuar de forma puntual (permite el
anlisis de varias muestras simultneamente en pequeas cantidades) o longitudinalmente (permite el estudio de una sola muestra pero en mayor
cantidad). La muestra se aplica disuelta en el tampn de electroforesis, del que est impregnado el soporte y que se encuentra en los reservorios de
la cubeta, y se deposita en una pequea zona, lo ms estrecha posible, en el centro o en un extremo del soporte (si se conoce cul va a ser la
direccin de desplazamiento de la misma) y de forma perpendicular a la direccin del campo elctrico. Conviene evitar la proximidad de los bordes
del papel, ya que all el campo elctrico no es homogneo y se distorsionan las bandas segn avanzan. El volumen que se aplica suele ser inferior a
10 L y si se necesitan mayores volmenes porque la muestra se encuentre muy diluida, pueden hacerse aplicaciones sucesivas sobre la misma
zona, dejando secar entre aplicacin y aplicacin. Es necesario humedecer el soporte (papel o acetato de celulosa) para que sea conductor; para
ello, se impregna el soporte de tampn de electroforesis por ambos extremos y de forma simultnea para que por capilaridad se desplace hacia la
zona de aplicacin de la muestra.
En los geles de agarosa, se perfora el gel con ayuda de un troquel o una pipeta de dimetro adecuado y se elimina esa porcin por succin. La
perforacin puede ser cilndrica o rectangular, dependiendo del nmero y cantidad de muestra a analizar y la muestra se deposita en el orificio
practicado sin que llegue a rebosar. En este caso, el tampn est embebido en el soporte (agarosa).
En todos los casos, la zona de aplicacin debe ser lo ms estrecha posible, para aumentar la resolucin y evitar solapamientos entre bandas que
migren en posiciones cercanas.
La electroforesis termina cuando se haya producido la mxima separacin de los componentes de la muestra, pero sin sobrepasar los lmites del
soporte. Para evitar que se sobrepasen estos lmites, se utilizan los marcadores electroforticos que son molculas coloreadas con una movilidad
electrofortica superior a cualquier componente de la muestra (poseen elevada carga respecto a su tamao). Entre los marcadores ms utilizados se
encuentran la dinitrofenil-lisina (DNP-Lys) y el azul de bromofenol.
Una vez acabada la electroforesis, se procede a la etapa de tincin. El soporte se retira de la cubeta y se sumerge en un recipiente que contiene una
disolucin de un colorante que se une de manera especfica a los componentes de la muestra y que precipita a los componentes separados en la
posicin en la que se encuentren. Las disoluciones ms utilizadas en el caso de protenas son el Negro Amido al 1% (p/v) en cido actico y el Azul
de Coomasie al 0.1% (p/v) en metanol/agua/cido actico (9:9:2 v/v/v).
Si la electroforesis se pretende desarrollar a escala preparativa, ha de utilizarse un papel de mayor grosor (175 gr/cm2), en lugar del utilizado en la
electroforesis analtica (85-100 gr/cm2; 0.15mm de espesor), lo que permite la aplicacin de una mayor cantidad de muestra (50-100L).
Inmunoelectroforesis.
Es una combinacin de una electroforesis en geles de agarosa seguida de una inmunodifusin (figura 8). En la primera parte, se realiza una
aplicacin puntual de la muestra, por lo que al final las distintas protenas estarn distribuidas a lo largo del gel segn el eje de migracin. Acabada
la electroforesis, y sin efectuar la tincin, se practica en el gel un canal (trinchera) paralelo a la direccin de migracin con un bistur de doble hoja
(la separacin de las hojas determina la anchura de la trinchera) en el que se deposita un antisuero que contenga anticuerpos especficos frente a
una o varias de las protenas separadas en la electroforesis.
Los geles se mantienen as a temperatura ambiente (20-22C) durante 24-48 horas. Los anticuerpos y las protenas (que actan como antgenos)
difunden, y si se encuentran en la proporcin adecuada, producen complejos antgeno-anticuerpo insolubles que precipitan y aparecen en el gel
como bandas elipsoidales.
Estos complejos solamente se producen cuando ambos compuestos se hallan en lo que se conoce como relacin de equivalencia y que no son
idnticas para todas las protenas presentes en la muestra; por eso, deben determinarse en experimentos preliminares las cantidades idneas de
antisuero y de la muestra, as como las distancias entre el pocillo de aplicacin de la muestra y la trinchera, ya que si las distancias son muy
pequeas, el antgeno (las protenas) difunde rpidamente y puede no formarse el precipitado, y si la distancia es mayor de la idnea, hay que
emplear mayor cantidad de antisuero y la duracin del proceso se alarga.
Una vez formadas las bandas de precipitacin, el gel puede lavarse para eliminar las protenas que no hayan inmunoprecipitado y, posteriormente,
teirse como se ha descrito anteriormente. Cada protena de la muestra produce una banda de precipitacin independiente, por lo que es posible
identificar el nmero de constituyentes de la muestra que son reconocidos por los anticuerpos.

02.2006

www.cultek.com

Pgina 1 de 17

Soluciones Electroforesis

Protocolo y Tcnicas

Cultek

La gran especificidad y sensibilidad de las reacciones de precipitacin, permite diferenciar substancias con movilidades electroforticas idnticas y
detectar componentes que se encuentren en concentraciones mnimas (g).

Fig. 8. Fases de una inmunoelectroforesis (IEF).


El nmero de bandas observado en una IEF debe entenderse como el nmero mnimo de componentes presentes, es decir, puede haber ms
componentes que no sean detectados por el antisuero empleado o que no hayan alcanzado la relacin de equivalencia antgeno-anticuerpo
adecuada.
La IEF es una tcnica principalmente cualitativa, que se desarrolla en condiciones nativas y es especialmente apropiada para el anlisis de lquidos
fisiolgicos y extractos celulares. Permite identificar substancias en mezclas muy complejas y en concentraciones muy bajas. Sin embargo, requiere
que dichas substancias sean inmunognicas y depende de los anticuerpos utilizados, por lo que es difcil de estandarizar.
Electroforesis en Geles de Poliacrilamida (PAGE).
Se utiliza mayoritariamente para la separacin de protenas, aunque tambin puede ser til para cidos nucleicos. Los geles de poliacrilamida son
soportes restrictivos del tipo II, por lo que, adems de evitar la conveccin y minimizar la difusin, participan directamente en el proceso de
separacin.
Se preparan de modo que sus poros sean de un tamao comparable al de las protenas, de manera que produzcan un efecto de tamizado molecular;
la separacin electrofortica depende entonces de la densidad de carga de las molculas y de su tamao, por lo que dos protenas con idntica
densidad de carga, pero de tamao diferente pueden ser separadas, ya que el soporte dificulta ms el avance de la de mayor tamao.
Son qumicamente inertes frente a las molculas biolgicas, transparentes y estables en un amplio intervalo de valores de pH, temperatura y fuerza
inica; son tambin resistentes a agentes desnaturalizantes (urea, detergentes), no presentan efecto EEO y son mecnicamente estables, por lo que
pueden ser deshidratados y reducidos a una fina pelcula, lo que facilita su almacenamiento.
Preparacin del soporte. El soporte se prepara a partir del monmero de acrilamida (figura 9) que forma largas cadenas lineales, con
abundantes grupos polares que las hace solubles en medios acuosos.
Al no estar las cadenas unidas entre s, formaran un gel sin consistencia mecnica y totalmente inmanejable. Para evitar esto, se utiliza otro
monmero, la N,N-metilen-bisacrilamida que forma parte de dos cadenas que quedan as unidas covalentemente.

Fig. 9. Estructura de la acrilamida, bisacrilamida y poliacrilamida


En funcin de la concentracin de acrilamida se obtienen entramados ms o menos densos, mientras que la cantidad de bisacrilamida condiciona
el grado de entrecruzamiento de las cadenas. Ambos componentes determinan, en conjunto, las caractersticas fsicas del gel resultante: su
resistencia mecnica, fragilidad, elasticidad, grado de reticulacin (tamao de poro), etc.
02.2006
www.cultek.com
Pgina 2 de 17

Soluciones Electroforesis

Protocolo y Tcnicas

Cultek

La polimerizacin de la acrilamida se obtiene por la adicin de catalizadores de la polimerizacin que inician y aceleran el proceso de formacin de
un gel tridimensional. Normalmente, el proceso se inicia con la adicin de persulfato amnico a una disolucin acuosa (tampn) de ambos
monmeros (acrilamida + bisacrilamida), seguido de la adicin de TEMED (N,N,N,N-tetrametilendiamina) que acta como propagador de la
reaccin de polimerizacin a pH bsico (el pH cido retarda la polimerizacin). Por lo tanto, ajustando las concentraciones de persulfato y TEMED
puede controlarse la velocidad de polimerizacin. Siempre debe evitarse la presencia de oxgeno, pues inhibe la polimerizacin; por ello, la mezcla
de polimerizacin debe desgasificarse a vaco (lo que impide, adems, la formacin de burbujas durante la polimerizacin que distorsionan el gel y
alteran el campo elctrico). La temperatura ptima de polimerizacin es de 25-30C y el proceso ocurre en pocos minutos, aunque conviene
dejarlo transcurrir ms tiempo para que no queden restos de monmeros o de pequeas cadenas libres.
Los monmeros (ya sea en polvo o en disolucin) son neurotxicos por absorcin a travs de la piel o por inhalacin. Por ello, deben manejarse
en una campana extractora con guantes y mascarilla. Una vez realizada la polimerizacin, la toxicidad se reduce al mnimo, pero es recomendable
continuar manipulando el gel con guantes, debido a la posible presencia de radicales libres.
El tamao de poro de los geles de poliacrilamida viene determinado por la concentracin total de monmeros. As, un gel de poliacrilamida se
define por el reticulado (%T) que es la concentracin total de monmeros (acrilamida + bisacrilamida; % p/v) y la dureza (%C) que viene dada
por la relacin de la cantidad de bisacrilamida al total de monmeros (es un valor bastante constante y, normalmente, inferior al 1%).
Incrementando %T el tamao de poro decrece (los geles con %T inferiores a 2.5-3.0% son casi lquidos y los geles con un %T del 30% presentan
un reticulado tan denso que molculas tan pequeas como 2000-3000 Da difcilmente pueden atravesarlos). El tamao medio de poro es 800,
50 y 20 para valores de 2.5, 7.5 y 30%T respectivamente. En la tabla I se muestran los tamaos aproximados de un conjunto de protenas y
los geles que se suelen utilizar para su anlisis.
Tabla I. Tamao aproximado de algunas protenas y concentraciones de acrilamida (%T) utilizada en PAGE,
en funcin de los distintos tamaos
Protena

M (kDa)

Longitud ()

Albmina

69

150

38

Transferrina

90

190

37

1300

185

185

B1 lipoprotena
B

Dimetro ()

Inmunoglobulina

160

235

44

Fibringeno

400

700

38

Concentracin de acrilamida (%T)

kDa

3-5

>100

5-12

20-150

10-15

10-80

>15

<15

Al polimerizar la acrilamida, adquiere la forma del recipiente, por lo que es necesario un molde para preparar el gel; los hay de dos tipos:
8 Tubo. Consiste en un tubo de vidrio de dimensiones variables, aunque normalmente es de 15-20 cm de largo 0.5-0.8 cm de dimetro interno,
abierto por los extremos. Se tapa el orificio inferior y se rellena con la disolucin de polimerizacin sobre la que se deposita una pequea
cantidad de butanol (con esto se evita que al polimerizar el gel forme menisco y se excluye el oxgeno que interfiere en la polimerizacin). Una
vez formado el gel, se elimina el butanol y se retira la tapa inferior del tubo. En la actualidad, la utilizacin de PAGE en tubo ha quedado
restringida a la primera dimensin en electroforesis bidimensionales, PAGE preparativa y algunos casos muy especficos de anlisis de protenas
radioactivas.
8 Placa. Es la forma ms habitual en la que se desarrolla la PAGE. Puede llevarse a cabo en posicin horizontal o vertical (dependiendo del tipo de
cubeta empleada), aunque lo ms habitual (sobre todo para la separacin de protenas) es el modo vertical (figura 10).

Fig. 10. Preparacin del gel para una


electroforesis en placa.
Elementos para
ensamblar el molde.
Los espaciadores
(sujetados con pinzas de presin) colocados
sobre los cristales forman el molde. Adicin de
la solucin de monmeros.
Colocacin del
peine en la parte superior.
El gel formado
presenta los pocillos donde aplicar las
muestras. Las dimensiones habituales de los
geles son: 10-20 cm (L) 10-15 cm (A) 0.51.5 mm (E).

02.2006

www.cultek.com

Pgina 3 de 17

Soluciones Electroforesis

Protocolo y Tcnicas

Cultek

Si se aumenta la longitud del gel, aumenta la resolucin de la electroforesis, aunque tambin se incrementa su duracin. Asimismo, cuanto mayor
sea la anchura del gel, mayor ser el nmero de pocillos y, por lo tanto, el de muestras que se pueden analizar simultneamente y en idnticas
condiciones. El espesor del gel y las dimensiones de los pocillos viene determinado por el grosor de los espaciadores y el tamao del peine
determina la cantidad de muestra que puede aplicarse.
Una modalidad de la electroforesis vertical es la realizada con geles en gradiente en los que la concentracin de acrilamida (%T) aumenta
progresivamente desde la parte superior del gel hasta la inferior, es decir, el tamao de poro decrece de forma inversa. Este gradiente de
concentracin de acrilamida puede ser lineal o no (cncavo, en pasos, etc.), aunque los primeros son los ms utilizados. Con estos geles el
intervalo de tamaos de protenas que pueden separarse se incrementa considerablemente frente a los geles homogneos y presentan una mayor
resolucin. Adems, las molculas de la parte delantera de la banda se frenan ms (encuentran antes los poros ms pequeos) que las molculas
de la parte trasera, con lo que las bandas se estrechan, concentrndose sobre su parte delantera, produciendo bandas muy finas y con una gran
resolucin.
En la cubeta, el tampn del reservorio superior cubre el gel y los pocillos en los que se ha de cargar la muestra. Con el fin de que sta, disuelta en
el mismo tampn, no difunda al depositarla en los pocillos, se le puede aadir un compuesto que aumente su densidad (normalmente, glicerol o
sacarosa). El volumen de muestra que puede aplicarse a cada pocillo depende del tamao de la propia muestra y del pocillo, pero oscila entre 10100L con un mximo de 200L. En el tampn de la muestra, tambin se aade el marcador electrofortico (el ms utilizado es el azul de
bromofenol) para poder determinar el final del proceso.
PAGE en condiciones no desnaturalizantes. La modalidad ms sencilla es la descrita en apartados anteriores en las que la muestra se carga
directamente en el gel en el cual se va a producir la separacin, por lo tanto, la concentracin del gel es uniforme y hay un nico tampn. La
PAGE se desarrolla en condiciones en las que no se altera la conformacin nativa de las protenas separadas, por lo que finalizada la electroforesis,
pueden realizarse estudios de funcionalidad de dichas protenas separadas (actividad enzimtica, capacidad de unin de anticuerpos, unin a
receptores, etc.)
Otra modalidad de electroforesis no desnaturalizante es aquella en la que el tampn presente en los reservorios es diferente al que impregna el
gel, el cual tampoco es homogneo, ya que, en realidad, hay dos geles diferentes en uno solo: una zona de resolucin (donde tiene lugar la
separacin de las protenas) que se polimeriza sin colocar el peine (por lo que la parte superior presenta un frente plano) y otra pequea zona de
concentracin de 1-3 cm, que se polimeriza sobre la anterior (quedan fundidas), que contiene los pocillos de aplicacin de la muestra y cuya
finalidad es concentrar la muestra en la zona de contacto con la zona de resolucin (figura 11).
Este hecho es debido a que la zona de concentracin tiene un tamao de poro muy grande (2.5-3.0%T), por lo que no es restrictiva frente al de la
zona de resolucin cuyo tamao de poro s es restrictivo.

Fig. 11. PAGE en condiciones no desnaturalizantes en sistemas de tampn discontinuo.


PAGE en condiciones desnaturalizantes. En presencia de algunos compuestos qumicos, las protenas pierden su estructura nativa; tales
compuestos, llamados agentes desnaturalizantes, producen el desplegamiento de la protena que queda, as, sin la organizacin tridimensional
caracterstica de su funcionalidad biolgica.
En algunas protenas hay puentes disulfuro entre los residuos de Cys (para formar cistinas) de una misma cadena polipeptdica (puentes
intracatenarios) o de diferentes cadenas (puentes intercatenarios) de algunas protenas con estructura cuaternaria. Estos puentes se pueden
romper mediante tratamiento con determinados agentes reductores, como por ejemplo, el -mercaptoetanol (-ME) o el ditiotreitol (DTT).
Otros agentes desnaturalizantes de protenas, son la urea y determinados detergentes. La urea interfiere con las reacciones hidrofbicas de las
protenas y debe incluirse en el tampn de la muestra y en todos los que se empleen para la preparacin de los geles; las principales aplicaciones
de la urea es en la separacin de las histonas, as como de protenas nucleares y ribosomales (ya que tienen mucha tendencia a agregar y son
insolubles) y para el anlisis conformacional de protenas (mediante geles con gradientes transversales de urea).
Los detergentes afectan a la estructura nativa de las protenas y a las interacciones con otras molculas (protenas, lpidos, etc.), ya que las
interacciones hidrofbicas de las protenas son sustituidas por interacciones detergentes-protena. Existen tres tipos principales de detergentes:
8 Detergentes no inicos. Son dbilmente desnaturalizantes y no alteran la carga de las protenas a las que se unen; se pueden utilizar en geles
con urea y en electroenfoque. Los ms empleados son el Triton X-100 y el Octilglucsido, particularmente para solubilizar protenas de
membrana. Se utilizan a concentraciones de 0.1-3.0% (p/v) y deben incluirse en el tampn de la muestra y en el del gel.
8 Detergentes inicos. Pueden tener carga positiva (catinicos) que se usan para la separacin de protenas muy cidas o muy bsicas; el ms
utilizado es el cetiltrimetilamonio (CTAB). Otros poseen carga negativa y un fuerte carcter desnaturalizante; el ms empleado es el
dodecilsulfato sdico o lauril sulfato sdico (SDS)
8 Detergentes anfteros. Son dbilmente desnaturalizantes y no afectan a la carga de las protenas; algunos, como el 3-(cloroamido propil)dimetilamonio-1-propanosulfato (CHAPS) solubilizan muy bien las protenas de membrana. Son compatibles con la utilizacin de urea y su uso
es frecuente como alternativa a los detergentes no inicos.
PAGE-SDS. Permite el clculo de parmetros moleculares (al contrario que el resto de los tipos de electroforesis), pues los complejos SDSprotena se separan estrictamente segn su tamao molecular. El SDS interacciona con las protenas formando complejos de caractersticas
02.2006
www.cultek.com
Pgina 4 de 17

Soluciones Electroforesis

Protocolo y Tcnicas

Cultek

comunes independientemente de las de cada protena.


Las protenas unen una molcula de SDS por cada dos aminocidos, lo que implica que las cargas propias de las protenas quedan enmascaradas
o anuladas; asimismo, la molcula de SDS proporciona una carga negativa, por lo que los complejos SDS-protena estn cargados negativamente
de forma uniforme (la carga por unidad de masa es prcticamente constante para todos los complejos).
Como ya se ha comentado, la movilidad electrofortica en una PAGE es funcin del tamao y de la carga por unidad de masa; como sta es
constante para todos los complejos SDS-protena (que, adems, tienen la misma forma elipsoide), esta movilidad es solamente funcin de la masa
molecular, es decir, cuanto menor sea la masa molecular de la protena, mayor ser la movilidad de la misma y viceversa.
En resumen, la SDS-PAGE es la electroforesis ms utilizada para el anlisis de protenas debido a:
8 La gran mayora de las protenas son solubles en SDS.
8 Todos los complejos SDS-protena tienen carga negativa y migran, por lo tanto, en el mismo sentido.
8 Su densidad de carga es muy elevada, por lo que su velocidad de migracin tambin lo es y las electroforesis son muy rpidas.
8 La separacin depende de un parmetro fsico-qumico, como es la masa molecular, que se puede calcular.
8 Los complejos SDS-protena se tien fcilmente.
La preparacin de la muestra es de la mxima importancia para asegurar que todo lo comentado anteriormente se cumple. Al tampn en el que va
disuelta la muestra (Tris HCl; 0.05M, pH = 6.8) se aade un exceso de SDS (2% p/v); para facilitar la unin del SDS a las protenas, la muestra se
calienta a 100C durante al menos 3-5 minutos y, opcionalmente, se aade -ME (5% v/v) DTT (20 mM) si se requieren condiciones reductoras.
Para incrementar la densidad de la disolucin de la muestra, se aade glicerol o sacarosa al 10% (p/v) y como marcador azul de bromofenol al
0.001% (p/v).
La cantidad de muestra que se aade depende de la sensibilidad de la tincin posterior que se vaya a utilizar, pero como regla general y para
geles de 2020 cm de 1.5mm de espesor y tincin con azul de Coomasie, se suele aadir entre 1-10g de muestra (ms de 100g de protena
supone una sobrecarga del gel).
El SDS debe incluirse en el tampn de los reservorios, en los de los geles (de concentracin y de resolucin) y en el de la muestra para mantener
las condiciones desnaturalizantes. La PAGE-SDS puede realizarse en condiciones reductoras o no reductoras; la ausencia de reductores se traduce
en que si las protenas poseen puentes disulfuro, el SDS slo producir una desorganizacin parcial de la estructura (figura 12). Si son dos o ms
las cadenas unidas por puentes disulfuro intercatenarios, en presencia de SDS, quedarn ms o menos desplegados en funcin de la posicin de
los puentes disulfuros (figura 13).

Fig. 12. Efecto del SDS y del DTT en la movilidad electrofortica de protenas monomricas. En una protena nativa de 25 kDa, carente de
puentes disulfuro, el tratamiento con SDS (
) SDS+DTT (
) producen idntico resultado. La protena con un puente disulfuro
intracatenario, en presencia de SDS se desnaturaliza parcialmente, manteniendo sin desplegar la zona que abarca el disulfuro. El tratamiento con
SDS+DTT rompe el puente disulfuro y permite el despliegue total de la protena.
02.2006
www.cultek.com
Pgina 5 de 17

Soluciones Electroforesis

Protocolo y Tcnicas

Cultek

Fig. 13. Efecto del SDS y del DTT en la movilidad electrofortica de protenas oligomricas.
Una vez finalizada la PAGE, se separa el gel de las placas de vidrio haciendo palanca con una esptula y se visualiza con un colorante; el ms
utilizado es el azul de Coomasie con el que se pueden visualizar 0.1-0.5 g de protena por banda. Otro mtodo de tincin es con sales de plata,
que tiene como principal ventaja su elevada sensibilidad (hasta 0.1ng de protena por banda), aunque tiene como desventajas que es muy
laboriosa y cara, presenta elevado background, baja reproducibilidad, algunas protenas no se tien y, sobre todo, no es totalmente especfico de
protenas, ya que algunos lipopolisacridos, cidos nucleicos y polisacridos tambin se tien.
Un mtodo de sensibilidad comparable a la tincin con sales de plata, emplea compuestos fluorescentes que se unen especficamente a las
protenas (la unin puede realizarse antes o despus de la electroforesis), como el cloruro de dansilo (detecta hasta 10ng de protena por banda),
la fluorescamina (detecta hasta 3-5ng de protena por banda) y el MDPF (2-metoxi-2,4-difenil-3(2H) furanona; detecta hasta 1ng de protena por
banda).
Una vez teido el gel de poliacrilamida, la imagen que se obtiene es un conjunto de bandas coloreadas sobre un soporte transparente. Su anlisis
permite identificar el nmero mnimo de componentes (bandas) de cada muestra. Cada banda se caracteriza por su movilidad electrofortica
relativa (Ur)

Ur =

L muestra
L marcador

L muestra Longitud recorrida por la muestra

L marcador Longitud recorrida por el marcador

La PAGE es un criterio de pureza negativo, es decir, permite saber si una muestra no es homognea (porque aparecen varias bandas en un gel)
pero no permite establecer que sea homognea (puede haber varias protenas que tengan la misma movilidad electrofortica y apareceran como
una sola banda).

02.2006

www.cultek.com

Pgina 6 de 17

Soluciones Electroforesis

Protocolo y Tcnicas

Cultek

En las condiciones de la SDS-PAGE, si se representan los valores de logaritmo del peso molecular (logM) frente a la movilidad electrofortica (Ur)
de un conjunto de protenas, se obtiene una relacin lineal (figura 14). Normalmente, se utiliza un conjunto de protenas de peso molecular
conocido (marcadores de peso molecular) que se someten a SDS-PAGE en el mismo gel que se analizan las protenas cuyos peso molecular se
desea conocer.

Fig. 14. Clculo de pesos moleculares de protenas por SDS-PAGE.


Es importante sealar que la relacin lineal entre logM y Ur se mantiene para una concentracin dada de poliacrilamida (%T) y slo en un corto
intervalo de peso molecular. De forma general, en geles del 15%T la relacin lineal es vlida para protenas comprendidas entre 12 y 45 kDa; en
geles del 10%T, el intervalo lineal va entre 15 y 70 kDa, y en los del 5%T, entre 25 y 200 kDa.
Hay protenas con un comportamiento anmalo en SDS-PAGE; en las glicoprotenas y las lipoprotenas, que llevan unidos azcares o lpidos, la
parte no proteica no une SDS y puede impedir el acceso del mismo a la protena. Por ello, las glicoprotenas y lipoprotenas unen menos SDS que
la mayora de las protenas; esto hace que la relacin carga/tamao sea menor y, por lo tanto, tengan menor movilidad electrofortica y se
comporten como si tuvieran mayor tamao.
Electroforesis bidimensional.
Es una sucesin de dos electroforesis distintas (o en distintas condiciones) realizadas sobre una misma muestra. En la primera de ellas (primera
dimensin) se separan los componentes de la muestra segn un criterio (carga, tamao o pI), y en la segunda (segunda dimensin) segn un
parmetro distinto del anterior. De esta manera, se combinan dos modos de separacin diferentes y se consigue el mximo de resolucin posible
mediante tcnicas electroforticas.
La primera dimensin puede llevarse a cabo, por ejemplo, en condiciones no desnaturalizantes y la segunda en condiciones desnaturalizantes; las
protenas ribosomales se separan en un gel discontinuo en la primera dimensin, seguido por otro continuo en la segunda, y ambos en presencia de
urea; las histonas se separan en geles con urea y cido en la primera dimensin y utilizando tritn/cido/urea en la segunda.
Sin embargo, normalmente, la idea de electroforesis bidimensional suele referirse a la combinacin de los dos tipos de electroforesis ms
resolutivos: electroenfoque (primera dimensin) y SDS-PAGE (segunda dimensin) (figura 15).
La electroforesis bidimensional puede considerarse como un criterio de pureza positivo debido a su gran poder de resolucin, aceptndose que la
aparicin de una sola mancha indica una muestra homognea.

Fig. 15. Electroforesis bidimensional. Primera dimensin (SDS-PAGE). En el pocillo I se aplica el marcador de pesos
moleculares y en los pocillos II y III la muestra. El carril del pocillo III (sombreado) se corta y el resto del gel se tie.
El carril III se coloca sobre un nuevo gel que se ha polimerizado sin pocillos, donde se desarrolla la segunda
dimensin (EEF) perpendicularmente a la primera. Obsrvese que algunas bandas producen ms de una mancha en
la segunda dimensin.
02.2006
www.cultek.com
Pgina 7 de 17

Soluciones Electroforesis

Protocolo y Tcnicas

Cultek

Fig. 23. Iluminacin y fotografa de geles de agarosa. Iluminacin incidente. Iluminacin por transmisin (transiluminacin). Videocmara con la
imagen del gel sobre el transiluminador. Las flechas amarillas representan la radiacin emitida (fluorescencia) por los complejos DNA-BrEt.
Electroforesis en geles de agarosa en condiciones desnaturalizantes.
Se lleva a cabo en modo submarino como ya se ha descrito. Se utiliza para la separacin de fragmentos de DNA monocatenario grandes (1000-2000
nucletidos) y especialmente para el anlisis de mRNA, que se transfiere posteriormente a membranas para su deteccin (Northern Blot). La
transferencia e hibridacin son similares a las descritas para el DNA, pero teniendo en cuenta que el mRNA es monocatenario.
Para lograr una buena separacin y para calcular con fiabilidad los tamaos es necesario que las molculas estn completamente desnaturalizadas,
ya que la estructura secundaria y terciaria de los cidos nucleicos est mantenida esencialmente por el apareamiento (tanto inter- como
intracatenario) de bases complementarias; para asegurar esta desnaturalizacin se utilizan agentes desnaturalizantes como la temperatura, el pH
bsico y diversos agentes qumicos dependiendo del soporte y del cido nucleico. No pueden utilizarse agentes desnaturalizantes que rompan los
puentes de hidrgeno (urea, formamida) ya que afectan tambin a la agarosa (sus fibras se mantienen mediante puentes de hidrgeno).
Transferencia a membranas (Southern y Northern Blot).
Las molculas de DNA o RNA separadas en los geles de agarosa pueden ser transferidas a membranas de nitrocelulosa o de nylon. La transferencia
se realiza tras la desnaturalizacin del DNA o RNA. La unin a la membrana ocurre a travs del esqueleto azcar-fosfato de la molcula de DNA o
RNA, quedando libres y expuestas las bases nitrogenadas. Esto permite localizar e identificar secuencias especficas en los fragmentos transferidos,
incubando la membrana con sondas especficas radiactivas o de otra naturaleza, que hibridan con la secuencia complementaria, revelando su
posicin por autorradiografa de la membrana.
De esta manera puede identificarse un fragmento especfico de DNA o RNA entre toda la poblacin de estructuras separadas por electroforesis y
transferidas a la membrana. La sensibilidad del mtodo es muy elevada y pueden detectarse <0.1pg de DNA o RNA usando una sonda marcada con
32

P (figura 24); por ejemplo, una secuencia nica de 1.000pb presente en el genoma humano (1 parte en 3 millones) puede ser detectada por este
mtodo a partir de 10g de DNA genmico.
Las membranas de nitrocelulosa dan mejor resolucin que las de nylon, pero stas ltimas presentan varias ventajas por lo que su uso es ms
extendido: tienen una mejor consistencia (las de nitrocelulosa son bastante frgiles y pueden desmenuzarse con la manipulacin) y poseen mayor
capacidad de unin de DNA, pudiendo ser utilizadas para hibridaciones sucesivas; adems, producen poca fluorescencia de fondo (fluorescencia
inespecfica) al ser iluminadas con radiacin UV, lo que es muy til para la deteccin de bandas de DNA.

02.2006

www.cultek.com

Pgina 14 de 17

Soluciones Electroforesis

Protocolo y Tcnicas

Cultek

La desnaturalizacin de los fragmentos de DNA, previa a la transferencia, se realiza introduciendo el gel en una disolucin de NaOH que se
neutraliza posteriormente. Las cadenas de DNA desnaturalizadas no deben ser muy largas para que la transferencia sea efectiva y, as, fragmentos
mayores de 15-20kb deben ser fragmentados previamente con radiacin UV o tratamiento cido.
La transferencia puede realizarse por capilaridad, por electroforesis (electrotransferencia), por centrifugacin o por succin (mediante una bomba de
vaco), aunque los dos ltimos sistemas necesitan dispositivos especficos, por lo que su uso es ms restringido. Normalmente, la
electrotransferencia se utiliza cuando la separacin del DNA se ha realizado en geles de poliacrilamida (dado que el reticulado es ms denso que el
de la agarosa). El tiempo de transferencia depende del grosor del gel, del porcentaje de agarosa y del tamao de los fragmentos de DNA. Una vez
en la membrana, el DNA se fija a ella mediante calentamiento a 80C o iluminacin con radiacin UV.
Al igual que en el Western Blot, las regiones de la membrana no ocupadas por el DNA transferido deben bloquearse, para evitar que al aadir la
sonda, sta se una inespecficamente a la membrana y produzca un fondo en el revelado. Para realizar este bloqueo, la membrana se sumerge en
una disolucin que contenga substancias de elevado peso molecular, como ficoll (400kDa), polivinilpirrolidona (360kDa) o seroalbmina bovina
(66kDa), adems de DNA heterlogo de diversos orgenes (bacteriano, timo de ternera, esperma de salmn, etc.).
La formacin de las estructuras hbridas (heterodplex) entre la sonda y la secuencia complementaria buscada es muy dependiente de las
condiciones experimentales (particularmente de la temperatura); para realizarla se utilizan dos sistemas: en el primero, la membrana se introduce
en una bolsa de plstico hermtica que contiene la disolucin con la sonda, controlndose la temperatura por inmersin en un bao termostatizado;
el segundo, utiliza hornos de hibridacin, introduciendo las membranas en botellas que contienen la disolucin de la sonda.

Fig. 24. Esquema de desarrollo de un Southern Blot (izquierda) y un Northern Blot (derecha).
Electroforesis en campos pulsantes (PFGE).
Con las electroforesis descritas hasta ahora, se pueden separar fragmentos de hasta 20kpb, e incluso hasta 50kpb con geles de agarosa de muy
baja concentracin. Schwartz y Cantor desarrollaron en 1984 un sistema denominado electroforesis en gel de campo pulsante (PFGE) con el que
consiguieron separar cromosomas de levadura de varios cientos de kpb. La PFGE consigue la separacin de grandes fragmentos de DNA induciendo
su reorientacin mediante cambios peridicos en el campo elctrico, cuya duracin determina el intervalo de tamaos que se pueden separar
(cuanto mayor sea el tamao de los fragmentos a separar, mayor ha de ser la duracin de los campos aplicados.
En una PFGE los fragmentos se someten a dos campos elctricos de distinta orientacin. Al aplicarse el primero (E1) durante cierto tiempo, los
fragmentos se estiran y se orientan segn la direccin de dicho campo. Si ahora se aplica un segundo campo (E2), perpendicular al anterior, se
obliga a los fragmentos de DNA a relajarse y elongarse y alinearse de acuerdo con este segundo campo elctrico. Cuanto menos tarde una molcula
en reorientarse, antes migra en la direccin de E2; el tiempo que se consume en esta reorientacin depende del tamao de los fragmentos,
tardando ms los mayores. Aplicando sucesivos cambios de campo elctrico (E1/E2/E1/E2/E1/E2 etc.) se consigue la separacin de los fragmentos
en funcin de su tamao.
El ngulo que forman las direcciones de los campos elctricos E1 y E2 se denomina ngulo de reorientacin, y determina lo que deben girar los
fragmentos de DNA cada vez que cambia la orientacin del campo. Normalmente se utilizan ngulos >100; cuando se opera a un ngulo fijo, ste
es de 120, aunque si el dispositivo permite seleccionar diferentes ngulos, se trabaja entre 100 y 120; esto es particularmente til para la
separacin de fragmentos muy grandes de DNA (>2Mb).
La duracin de los campos elctricos que se alternan se denomina duracin del pulso y determina el intervalo de los tamaos de DNA que se pueden
separar; estos intervalos son muy variables, desde fracciones de segundo para fragmentos muy pequeos hasta 1-2 horas para fragmentos muy
grandes (>5Mb) (Tabla III).
Para una duracin de pulso dada, aquellos fragmentos de gran tamao que no hayan tenido tiempo a reorientarse en la nueva direccin del campo
no se separan, pero no permanecen inmviles en el gel; se mueven muy lentamente, pero juntos, sin resolverse en bandas distintas y aparecen
como una zona ms o menos ancha en la parte superior del gel; dicha zona se denomina zona de compresin.
Es importante destacar que la utilidad de la PFGE es anloga a la de la electroforesis convencional, salvo que los fragmentos de DNA separados son
de mayor tamao. Esto hace que la transferencia a membranas no pueda hacerse directamente, ya que para tamaos superiores a las 20kb los
fragmentos se han de dividir en otros menores mediante radiacin UV o tratamiento con cido (HCl). Tambin puede ser utilizada para electroforesis
bidimensionales, cambiando las condiciones en cada dimensin; esto permite el mapeo gentico de grandes regiones de DNA o de cromosomas
enteros pequeos.

02.2006

www.cultek.com

Pgina 15 de 17

Soluciones Electroforesis

Protocolo y Tcnicas

Cultek

El equipo necesario para realizar una PFGE se diferencia notablemente del de otras electroforesis, tanto en la cubeta como en la fuente de
alimentacin. La cubeta tiene un conjunto de electrodos en lugar de un par, cuya disposicin y diseo posibilitan las distintas orientaciones del
campo elctrico; los electrodos de platino son de mayor grosor que en el resto de las electroforesis, ya que los cambios peridicos de polaridad
producen una marcada corrosin de los mismos. La cubeta tiene, adems, un sistema de recircularizacin del tampn a temperatura estrictamente
controlada, de modo que no se produzcan variaciones de temperatura en el gel (Figura 25). La preparacin de los geles de agarosa no difiere de los
ya descrito para otras electroforesis de DNA; se utilizan geles de agarosa al 0,5-1,0% (2020 1515 cm), de bajo flujo electroendosmtico y
elevada resistencia (Figura 26).
Tabla III. Relacin entre la duracin del pulso y la resolucin en una PFGE.
Duracin
del pulso
0,3seg
0,5seg
0,8seg
5seg
25seg
45seg
100seg
125seg
20min
30min
40min
75min
90min
100min
180min

Intervalo de
separacin
1-10kb
5-30kb
30-50kb
20-100kb
40-400kb
40-600kb
40-1.000kb
100-1.600kb
1-2,5Mb
1,6-3Mb
1,6-6Mb
2-9Mb
1-10Mb
3-13Mb
3-13Mb

Resolucin
mxima
1-10kb
10-25kb
35-50kb
60-90kb
200-300kb
400-550kb
700-900kb
800-1.200kb
1,6-2,5Mb
2,5-3Mb
2,5-6Mb
3-6Mb
6-9Mb
7-10Mb
10-13Mb

Duracin del
proceso (h)
1
2
3
4
6
10-24
17-40
17-40
100-140
100-140
140
140-170
185
190-200
190-200

Voltaje (V)
450
450
450
300
300
300
165-200
165-200
165-200
165-200
30
30
30
30
27

Fig. 25. Cubeta utilizada en una PFGE con simetra hexagonal. Tapa Fig. 26. Preparacin de un gel de agarosa para PFGE. A la agarosa
con cable de conexin incorporado, por lo que retirando la tapa se fundida se vierte sobre la bandeja que lleva adosada el molde. B
desconecta la corriente. Dispositivo hexagonal con los electrodos colocacin del peine, soportado en los extremos sobre el molde. C
embutidos. Plataforma con el gel incorporado. Cubeta con el una vez gelificada la agarosa se retira el molde quedando el gel
sistema refrigerante (serpentn) en su base. El conjunto se ensambla sobre la bandeja, que se coloca en la cubeta.
segn esta dispuesto en la figura (sobre, sobre y sobre los
anteriores).
02.2006
www.cultek.com
Pgina 16 de 17

Soluciones Electroforesis

Protocolo y Tcnicas

Cultek

La preparacin y aplicacin de la muestra es la fase ms delicada de la PFGE por el gran tamao de las estructuras que se manejan, lo que las hace
fcilmente fragmentables. El DNA suele cargarse en el gel como una disolucin concentrada (de mucha viscosidad), junto con agarosa fundida o
embebido en pequeos bloques o tacos de agarosa slida (Figura 27). La utilizacin de una u otra forma depende del tamao del DNA a analizar y
de la naturaleza de la muestra. Los fragmentos de 200-300kb pueden cargarse como disoluciones directamente en el gel, pero para fragmentos
mayores de 500kb no se suele emplear el DNA aislado como tal y s las propias clulas que lo contiene.

Fig. 27. Preparacin de la muestra para PFGE en


bloques de agarosa. A partir de un bloque grande, que
contiene las clulas cuyo DNA se desea analizar, se
cortan pequeos tacos (parte superior) del tamao de
los pocillos practicados en el gel (parte inferior). Todos
los procesos de lisis celular y digestiones enzimticas se
realizan sobre el taco de agarosa.

02.2006

www.cultek.com

Pgina 17 de 17

SECUENCIACIN DE ADN

Una tcnica propia de la Ingeniera Gentica es la determinacin de la


secuencia de nucletidos de un ADN, conocida como secuenciacin de dicho
cido nuclico.
Se ha conseguido gracias a las enzimas de restriccin y a la
posibilidad de obtener numerosas copias de un cido nuclico por clonacin.
Se pueden conseguir muchos fragmentos, de diversos tamaos y lo que
se trata es de recomponer la molcula original como si se tratase de un puzzle.
As se han secuenciado genes, desde virus hasta el genoma humano.
El mtodo ms usado para la secuenciacin es el conocido como
tcnica de terminacin de cadena de Sanger, la cual se ha perfeccionado
conocindose actualmente como la tcnica del didesoxi.
Se denomina as por ser necesario los didesoxirribonucletidos (figura
1), que han perdido su grupo alcohol OH del carbono 3'. En la figura 2 vemos
un nucletido normal con el grupo alcohol en el carbono 3'.

Figura 1

Como los nucletidos se unen por este grupo OH del carbono 3', hay
que pensar que si nos encontramos con un didesoxinucletido ser imposible
que se una otro nucletido y la cadena terminar aqu
Abreviadamente,
ste
sera
el
mtodo
a
seguir:
Como la tcnica se basa en la sntesis de ADN, para hacer la reaccin de
secuenciacin se necesita:

Como "molde" se utiliza una de las cadenas del fragmento de ADN que
se va a secuenciar.

Biologa
y
Geologa

SECUENCIACIN DE ADN

Se necesita un "cebador" (pequea hebra de ADN de reducido nmero


de nucletidos) para iniciar la sntesis. Es un corto oligonucletido
complementario del extremo de la cadena.

Tambin desoxinucletidos de las cuatro bases: dAMP, dTMP, dGMP,


dCMP.
Por ltimo didesoxirribonucletidos de una base en cada una de las
cuatro reacciones de secuenciacin: didesoxi de ADENINA (ddATP)
didesoxi de TIMINA (ddTTP) didesoxi de CISTEINA (ddCTP)
didesoxi de GUANINA (ddGTP)

Biologa
y
Geologa

Al aadir la ADN-polimerasa, comienza la polimerizacin en el cebador,


pero cesa al incorporarse un didesoxinucletido (Figura 4).

Posicin 5

Posicin 10

Figura 4
Posicin 14

SECUENCIACIN DE ADN

Se produce un conjunto de cadenas dobles cuyas longitudes dependen


de la situacin del didesoxinucletido incorporado. En el caso expuesto en el
dibujo, esta reaccin de secuenciacin se hace con un didesoxi de ADENINA,
lo que significa que cuando se incorpore esta Adenina no podr continuarse la
polimerizacin de nuevos nucletidos, nos queda por tanto un pequeo
fragmento de ADN que termina en la ADENINA, lo que nos dice que en el ADN
original, en ese lugar estar el nucletido complementario que lleva TIMINA.
En el caso expuesto deducimos tres fragmentos con 5, 10 y 14
nucletidos (sin contar el cebador) en cuyos extremos tenemos ADENINA.
Deben prepararse cuatro reacciones de secuenciacin, cada una con un
didesoxirribonucleotido distinto. Los fragmentos resultantes se separan por
tamao mediante electroforesis, se autorradiografan, y la sucesin de bandas
de cada una de las cuatro reacciones, comparndolas entre s,dan la secuencia
del ADN. (Figura 5)

COMENTARIO
1. Qu importancia tiene el uso de didesoxirribonucletidos?
2. Qu posible aplicacin se le puede dar a este mtodo?
3. Qu es la Taq ADN polimerasa? Para qu se emplea?

Biologa
y
Geologa