Veterinary Dermatology 2003, 14, 269 273

Brief communication

Blackwell Publishing Ltd.

Expression of RANTES mRNA in skin lesions of feline

eosinophilic plaque
TOMOE KIMURA,* RUI KANO,* SADATOSHI MAEDA, HAJIME TSUJIMOTO,
MASAHIKO NAGATA and ATSUHIKO HASEGAWA*
*Department of Pathobiology, Nihon University School of Veterinary Medicine, 1866, Kameino, Fujisawa,
Kanagawa, 2528510, Japan
Department of Veterinary Internal Medicine, Graduate School of Agricultural and Life Sciences, The
University of Tokyo, 1-1-1 Yayoi Bunkyo, Tokyo 1138657, Japan
Animal Dermatology Center, ASC, 1-3-2, Higashicho, Jindaiji, Chofu, Tokyo, 182-0012, Japan
(Received 10 March 2003; accepted 20 June 2003)

Abstract One of the mechanisms of eosinophil infiltration is its induction by chemoattractants such as regulated
upon activation, normal T-expressed and secreted (RANTES) which is a cysteinecysteine chemokine that
mediates chemotaxis and activation of eosinophils in humans and mice. Skin lesions of feline eosinophilic plaque
are characterized by a predominant infiltration of eosinophils. The mechanism(s) of eosinophilic infiltration
in the skin and /or mucosa of cats is unknown. It is possible that RANTES is involved. To investigate the presence
of RANTES in the skin of cats with eosinophilic plaques and nonaffected skin, we cloned and sequenced
the full-length feline RANTES cDNA gene, in order to determine whether it is present in the skin of cats with
eosinophilic plaques and/or if it is present in normal adjacent skin. We were able to document the the expression
of RANTES mRNAs in skin with feline eosinophilic plaque as well as in normal cat skin. The full-length cDNA
sequence of the RANTES gene (742 bp) contained a single open reading frame of 276 bp encoding a protein
of 92 amino acids. The amino acid sequence of feline RANTES shared 67 and 74% sequence identity with that
of bovine and mouse RANTES genes, respectively. RTPCR analysis on RANTES mRNA in the skin of cats
with eosinophilic plaque revealed that its expression was higher in the eosinophilic plaque skin lesions than in
the normal skin. The result suggested that RANTES might play a role to induce eosinophil infiltration in feline
eosinophilic plaque lesions.
Keywords: cat, cDNA, RANTES, RTPCR.

INTRODUCTION
Feline eosinophilic plaques are a common skin reaction pattern in cats. One of the most striking features
of these lesions is prominently eosinophilic infiltration
of the skin. These lesions are common in cats with hypersensitivities to inhalants, foods or insects, especially to
fleas and mosquitoes.1 However, the precise mechanism
of eosinophil infiltration in the skin and mucosa of cats
is unknown.
Regulated upon activation, normal T-expressed and
secreted (RANTES), a member of the cysteine cysteine
(CC) chemokine family is a potent chemoattractant
for various inflammatory cells such as eosinophils,
memory T cells and monocytes, and may be potentially important in recruiting these cells to the site of
Correspondence: Rui Kano.
Present address: Department of Pathobiology, Nihon University
School of Veterinary Medicine, 1866, Kameino, Fujisawa Kanagawa,
252-8510, Japan, Tel.: +81 466 84 3649; Fax: +81 466 84 3649; E-mail:
kano@brs.nihon-u.ac.jp
2003 European Society of Veterinary Dermatology

inflammation.2 The production of RANTES by human

epidermal keratinocytes was reported to be associated
with eosinophil infiltration into the skin of people with
atopic dermatitis and allergic contact dermatitis.35
Therefore, the production of RANTES in feline skin
might also be related to the pathogenesis of feline
eosinophilic plaques. The purpose of this study was to
investigate the involvement of RANTES in feline
eosinophilic plaques. In this study, the feline RANTES
cDNA gene was cloned and sequenced. Expression of
RANTES mRNAs in feline normal skin and eosinophilic
plaque lesions was then analysed.

MATERIALS AND METHODS

Preparation of cDNA
The signalment of the cats and lesion locations is
summarized in Table 1. All eosinophilic plaque lesions
were diagnosed based upon compatible clinical and
histological findings (eosinophil infiltration in the
lesion).1 Skin biopsy specimens for were collected from
269

270

T. Kimura et al.

Table 1 Patients
No.

Breed

Sex

Age

Region

1
2
3
4
5
6
7

Cross-breed
Cross-breed
Cross-breed
Cross-breed
Cross-breed
Cross-breed
Abyssinian

M
M
F
UN
M
M
M

6
7
8
UN
11
14
8

Foreleg
Hindleg
Hindleg
Abdomen
Right ear
Abdomen
Hindleg

M, male; F, female; UN, unknown.

lesions and from normal skin; samples were collected

and homogenized in liquid nitrogen. Total RNA was
extracted from samples with RNeasy total RNA kit
(QIAGEN, Vallencia, CA, USA) as described previously.6
A series of 5- and 3-RACE-PCR experiment Kits
(GIBCOBRL, Tokyo, Japan) were carried out to determine the full-length cDNA sequence of the feline
RANTES gene. The sequences of gene-specific primers
were designed from the sequence of the partial feline
RANTES gene fragment previously reported.7
The 5- and 3-sides of the RANTES gene were,
respectively, determined according to the user manuals
of 5 RACE System for Rapid Amplification of cDNA
Ends (GibcoBRL, MD, USA) and 3 RACE System
for of Rapid Amplification of cDNA Ends (GibcoBRL).
The polymerase chain reaction (PCR) products of 5and 3-sides RANTES genes were sequenced by dideoxy chain termination method using an ABI PRISM
310 Genetic Analyser (ABI Prism, Foster City, USA).
Reverse transcriptionPCR assay of RANTES mRNA
in the feline normal skin and skin lesions of eosinophilic
plaque
Total RNA was extracted from the clinical samples
described above. The RNA was treated with DNAse
from RNase-Free DNase Set kit (Qiagen). Reverse
transcription of the poly(A)+ RNA was performed using
a Omniscript Reverse Transcriptase kit (Qiagen).
The nested primers were constructed from sequences
of the feline RANTES gene. The first primer pair was
1S (TGCCTCTGCATCCCCATATG, 117136 bp) and
1R (GTTGATGCCCTTGTCCCGACCCATTTCTTC,
288318 bp), and the second primer pair was 2S
(ATGCCTCGGACACCACCCCC, 134153 bp) and
2R (TGGGTTGGCACACACCTGGC, 267287 bp).
These primers were expected to amplify 201 and 153 bp
fragments of feline RANTES gene, respectively.
The cDNA samples (100 ng) were amplified by
PCR in a 30-L reaction mixture containing 10 m
TrisHCl (pH 8.3), 50 m KCl, 1.5 m MgCl2, 0.001%
gelatin, 200 m each deoxynucleoside triphosphate,
1.0 unit of Taq DNA polymerase (Takara, Kyoto, Japan)
and 0.5 g of a pair of primers. The first PCR amplification was carried out for 30 cycles consisting of template
denaturation (1 min at 94 C), primer annealing (1 min
at 58 C) and polymerization (2 min at 72 C). The 1 L
of a first PCR product was used for the template of a
second PCR amplification. The second PCR amplification was carried out for 35 cycles consisting of tem-

plate denaturation (1 min at 94 C), primer annealing

(1 min at 60 C) and polymerization (2 min at 72 C).
GAPDH was used for the positive transcription
control of RTPCR.8 The PCR products were analysed
on a 2% agarose gel.

RESULTS
Full-length feline RANTES cDNA
Using cDNA of feline eosinophilic plaque as a template, a full-length feline RANTES gene was cloned
using 5- and 3-RACE methods. The full-length cDNA
sequence of the RANTES gene (742 bp) contained a
single open reading frame of 276 bp coding a protein
of 92 amino acids beginning with a putative initiating
methionine (ATG) (Fig. 1). The sequence reported
was deposited in the DDBJ database (Accession no.
AB083479, feline RANTES gene, complete cds).
The amino acid sequence of feline RANTES shared
6774% sequence identity with that of bovine (GenBank
Accession no. AJ007043),9 human (NM_002985)10 and
mouse (M77747)11 RANTES (Fig. 2).
RANTES mRNA analysis by RTPCR
After RTPCR, RANTES mRNA was detectable in feline
normal skin and skin lesions of eosinophilic plaque
(Fig. 3), suggesting that RANTES mRNA is expressed
in feline skin. Moreover, RANTES mRNA was more
strongly expressed in feline eosinophilic plaque lesions
than in the normal skin even from the same patient cats
(Fig. 3).

DISCUSSION
Feline eosinophilic plaques are histopathologically
characterized by prominent eosinophilic infiltration,
however, the precise mechanism of eosinophil infiltration into these lesions is unknown. In people, the production of RANTES from keratinocytes is believed
to be a partial explanation for the eosinophilic infiltration
of people with atopic dermatitis and allergic contact
dermatitis.1,3,4 The goal of this study was to determine
if RANTES might be involved in the pathogenesis of
feline eosinophilic plaques. If RANTES are present in
eosinophilic lesions of cats, treatment strategies aimed
at manipulating the production of RANTES may present
new therapeutic options for cats with these lesions or
for cats with other eosinophilic diseases.
The full-length of sequence of feline RANTES gene
was determined and the amino acid sequence identity
of RANTES genes was shown to be relatively conserved
among humans, cats, cattle and mice. In particular, the
CC structure in these RANTES gene was highly conserved
(Fig. 2).2 These results suggest that feline RANTES
might play the same functions as human and mouse.
RTPCR analysis revealed that RANTES mRNA
was highly expressed in skin lesions of eosinophilic
plaques when compared with normal skin. This

2003 European Society of Veterinary Dermatology, Veterinary Dermatology, 14, 269 273

mRNA expression in feline eosinophilic plaque

271

Figure 1. Nucleotide sequence of feline

RANTES gene and predicted amino acid
sequence.

Figure 2. Comparison of homologous regions of the predicted protein sequences of RANTES among cats, cattle, human and mouse. Bovine
RANTES gene (GenBank Accession no. AJ007043), human RANTES gene (NM_002985) and mouse RANTES gene (M77747). Asterisk
indicates identity with the amino acid of the feline RANTES. The signal peptide is underline. Four cysteine residues conserved among species
are boxed.

suggests that feline RANTES might be involved in

the recruitment of eosinophils into the skin of cats with
eosinophilic skin disorders such as eosinophilic plaques.
Because RANTES is a potent chemoattractant for
eosinophils, its production in skin and mucosa in these
skin lesions may explain the marked eosinophilic
infiltrations seen.1 The findings of this pilot study are
encouraging. Now that RANTES has been identified in
lesions of eosinophilic plaques, the next step is to develop
antifeline RANTES antibodies for immunohistochemical staining techniques in order to identify the
cells responsible for the release of this chemokine in the
skin. Thereafter, we are going to investigate the RANTES
inducing factors in feline eosinophilic plaque by molecular
analysis.

In conclusion, RANTES has been shown to be an

important chemotactic mediator for the recruitment of
various inflammatory cells such as eosinophils, memory
T cells and monocytes to the site of inflammation.
Eosinophils are common inflammatory cells in cats with
skin disease. Although this study focused on eosinophilic
plaques, it is unlikely that the production of RANTES
is unique to this particular lesions. We hypothesize that
RANTES is likely to be involved in the development
of eosinophilic granulomas, eosinophilic ulcers and
military dermatitis, lesions of insect bite hypersensitivity
and possibly may have a role in feline atopic dermatitis.
Further investigation of RANTES and its role in the
development of eosinophilic skin lesions in cats may
eventually lead to the development of anti-RANTES drugs

2003 European Society of Veterinary Dermatology, Veterinary Dermatology, 14, 269273

272

T. Kimura et al.

Figure 3. Reverse transcription-PCR (RTPCR) analysis of feline

RANTES mRNA. (A) Skin lesion of feline eosinophilic plaque and
normal cat skin. The second PCR amplification was carried out for
35 cycles. Lanes 13: sample of normal cat skin. Lanes 410: sample
of skin lesion from patients 17. (B) Sample of the skin lesion and
normal skin from the same patients. The second PCR amplification
was carried out for 30 cycles. Lane 1: normal skin of the patient 1.
Lane 2: skin lesion of the patient 1. Lane 3: normal skin of the
patient 2. Lane 4: skin lesion of the patient 2. Lane 5: normal skin
of the patient 3. Lane 6: skin lesion of the patient 3. (C) GAPDH is
the positive transcription control.

REFERENCES
1. Scott, D.W., Muller, W.H. Jr, Griffin, C.E. Feline eosinophilic granuloma complex. In: Small Animal Dermatology,
6th edn. Philadelphia: WB Saunders, 2001: 114853.
2. Schall, J., Thomas, Greaves, R.D. RANTES. In:
Oppenheim, J.J., Feldmann, M., eds. Cytokine Reference:
A Compendium of Cytokines and Other Mediators of Host
Defense. San Diego: Academic Press, 2001: 1161 6.

3. Yamada, H., Matsukura, M., Yudate, T. et al. Enhanced

production of RANTES, an eosinophil chemoattractant
factor, by cytokine-stimulated epidermal keratinocytes.
International Archives of Allergy and Immunology 1997;
114 (Suppl. 1): 2832.
4. Sebastiani, S., Albanesi, C., De Pita, O. The role of
chemokine in allergic contact dermatitis. Archives of
Dermatological Research 2002; 293: 5529.
5. Schoder, J.-M., Mochizuki, M. The role of chemokines
in cutaneous allergic inflammation. Biological Chemistry
1999; 380: 88996.
6. Kano, R., Kubota, A., Nakamura, Y., Watanabe, S.,
Hasegawa, A. Feline ubiquitin fusion protein genes.
Veterinary Research eommunication 2001; 25: 61522.
7. Endo, Y., Mizuno, T., Nishimura, Y. et al. Molecular cloning
of feline CC-kemokine cDNAs. Veterinary Immunology
1998; 65: 11323.
8. Harley, R., Helps, C.R., Harbour, D.A. Cytokine mRNA
expression in lesions in cats with chronic gingivostomatitis.
Clinical and Diagnostic Laboratory Immunology 1999; 6:
4718.
9. Aust, G., Brylla, E., Lehmann, I. Cloning of bovine
RANTES mRNA and its expression and regulation in
ovaries in the periovulatory period. FEBS Letters 1999;
463: 1604.
10. Shall, T.J., Jongstra, J., Dyer, B.J. A human T cell-specific
molecule is a member of a new gene family. Journal of
Immunology 1988; 141: 101825.
11. Heeger, P., Wolf, G., Meyers, C. Isolation and characterization of cDNA from renal tubular epithelium encoding
murine RANTES. Kidney International 1992; 42: 2205.

Rsum L'un des mcanismes expliquant l'infiltration par les osinophiles est la prsence de chemoattractants
comme le RANTES (Regulated Upon Activation, Normal T Expressed and Secreted), qui est une CC chmokine
qui provoque la chmotaxie et l'activation des osinophiles chez l'homme et la souris. Les lsions cutanes de
plaques osinophilique fline sont caractrises par une infiltration massive d'osinophiles. Le(s) mcanisme(s)
de l'infiltration osiniophilique de la peau et des muqueuses chez le chat est (sont) inconnu(s). Il est possible que
le RANTES soit en cause. Afin d'tudier la prsence de RANTES dans la peau de chats prsentant une plaque
osinophilique, nous avons clon et squenc la totalit du gne du cDNA RANTES. Le RANTES a t recherch
au niveau des lsions et au niveau de la peau saine des chats atteints. La squence de cDNA du gne du RANTES
(742bp) contenait une sonde simple de 276bp codant pour une protine de 92 acides amins. La squence en acides
amins du RANTES flin partageait 67 et 74% d'identit avec celles du RANTES de boeuf et de souris. L'analyse
par RT-PCR de l'ARNm du RANTES dans la peau des chats plaque osinophilique a montr que cette expression tait plus importante en peau lse qu'en peau saine. Ces rsultats suggrent que le RANTES pourrait jouer
un rle dans l'infiltration osinophilique dans les lsions de plaque osinophilique chez le chat.
Resumen Uno de los mecanismos de infiltracin de ls eosinfilos es la induccin mediante quimioatractores
como el Regulado por Activacin, T Normal Expresado y Secretado (Regulated Upon Activation, Normal T
Expressed and Secreted, RANTES) que es una quemoquina CC que media la quimiotaxis y activacin de los
eosinfilos en humanos y ratones. Las lesiones cutneas de la placa eosinoflica felina se caracterizan por un
infiltrado con predominio de eosinfilos. Se desconoce el o los mecanismo(s) de la infiltracin eosinoflica en la
piel y/o mucosa de los gatos. Es posible que RANTES se encuentre implicado. Para investigar la presencia de
RANTES en la piel de gatos con placas eosinoflicas y en piel no afectada, en este estudio, se clon y secuenci
la totalidad del gen cDNA de RANTES felino, con el fin de determinar si se encuentra presente en la piel de gatos
con placas eosinoflicas y/o si se encuentra presente en piel adyacente normal. En este estudio pudimos documentar la expresin de mRNAs de RANTES en piel con placa eosinoflica felina as come en piel felina normal..
La secuencia completa de cDNA del gen de RANTES (742bp) contena una nica ventana de lectura de 276bp
que codifica una proteina de 92 aminocidos. La secuencia de aminocidos de RANTES felino comparta un
67 y 74 % de la identidad de la secuencia de genes de RANTES bovino y murino, respectivamente. El anlisis
de RT-PCR sobre mRNA de RANTES en la piel de gatos con placa eosinoflicas mostr que su expresin era
mayor que en piel normal. El resultado sugera que RANTES puede jugar un papel importante al inducir la
infiltracin de eosinfilos en las lesiones de placa eosinoflica felina
2003 European Society of Veterinary Dermatology, Veterinary Dermatology, 14, 269 273

mRNA expression in feline eosinophilic plaque

273

Zusammenfassung Einer der Mechanismen bei der Infiltration mit Eosinophilen ist die Auslsung durch chemoattraktive Substanzen wie RANTES (Regulated Upon Activation, Normal T Expressed and Secreted), ein
CC-Chemokin, welches Chemotaxis und Aktivierung von Eosinophilen bei Menschen und Musen vermittelt.
Hautvernderungen bei felinen eosinophilen Plaques sind vorrangig durch die Infiltration von Eosinophilen
charakterisiert. Mechanismen, nach denen die Infiltration mit Eosinophilen in die Haut oder/und Mukosa von
Katzen erfolgt, sind nicht bekannt. Es ist mglich, dass RANTES mitbeteiligt ist. In dieser Studie haben wir die
ganze Lnge des felinen RANTES cDNA Gens geklont und sequenziert, um herauszufinden, ob es in der Haut
von Katzen mit eosinophilen Plaques und/oder in der normalen angrenzenden Haut vorhanden ist. In dieser
Studie konnten wir die Expression von RANTES mRNS in der Haut mit felinen eosinophilen Plaques wie auch
in normaler Katzenhaut nachweisen. Die ganze Lnge der cDNA Sequenz des RANTES Gens (742bp) enthlt
einen einzelnen Open-reading-frame mit 276bp, der ein Protein mit 92 Aminosuren kodiert. Die Aminosuresequenz von felinem RANTES war zu 67, bezw. 74% mit Rinder- bezw. Maus-RANTES identisch. RT-PCRAnalyse von RANTES mRNA in der Haut von Katzen mit eosinophilen Plaques zeigte, dass seine Expression
in Haut mit eosinophilen Plaques hher als in normaler Haut war. Das Ergebnis weist darauf hin, dass RANTES
bei der Induktion der Eosinophilen-Infiltration von felinen eosinophilen Plaques vielleicht eine Rolle spielt.

2003 European Society of Veterinary Dermatology, Veterinary Dermatology, 14, 269273