Tree Physiology 32, 8393

doi:10.1093/treephys/tpr130

Research paper

Evaluation of four phloem-specific promoters in vegetative tissues

of transgenic citrus plants
M. Dutt, G. Ananthakrishnan, M.K. Jaromin, R.H. Brlansky and J.W. Grosser1
Citrus Research and Education Center, University of Florida-IFAS, 700 Experiment Station Road, Lake Alfred, FL 33850, USA; 1Corresponding author (jgrosser@ufl.edu)
Received July 8, 2011; accepted November 15, 2011; published online January 6, 2012; handling Editor Chunyang Li

Mexican lime (Citrus aurantifolia Swingle) was transformed with constructs that contained chimeric promoter-gus gene
fusions of phloem-specific rolC promoter of Agrobacterium rhizogenes, Arabidopsis thaliana sucrose-H+ symporter (AtSUC2)
gene promoter of Arabidopsis thaliana, rice tungro bacilliform virus (RTBV) promoter and sucrose synthase l (RSs1) gene
promoter of Oryza sativa (rice). Histochemical -glucuronidase (GUS) analysis revealed vascular-specific expression of the
GUS protein in citrus. The RTBV promoter was the most efficient promoter in this study while the RSs1 promoter could drive
low levels of gus gene expression in citrus. These results were further validated by reverse transcription real-time polymerase
chain reaction and northern blotting. Southern blot analysis confirmed stable transgene integration, which ranged from a
single insertion to four copies per genome. The use of phloem-specific promoters in citrus will allow targeted transgene
expression of antibacterial constructs designed to battle huanglongbing disease (HLB or citrus greening disease), associated
with a phloem-limited Gram-negative bacterium.
Keywords: Agrobacterium tumefaciens, AtSUC2, citrus, GUS, Mexican lime, rolC, RSs1, RTBV, transformation.

Introduction
In plant transformation studies, constitutive promoters are
commonly used to target gene expression throughout the
plant. These promoters can be obtained from numerous
sources such as viruses (the cauliflower mosaic virus (CaMV)
35S promoter (Odell etal. 1985) or figwort mosaic virus
(FMV) promoter (Maiti etal. 1997)); bacteria (the Agrobacterium
tumefaciens Ti plasmid mannopine synthetase (mas) promoter
(DiRita and Gelvin, 1987) or nopaline synthase (NOS) promoter (Bevan etal. 1983)); or plants (the Arabidopsis thaliana
Act 2 promoter (An etal. 1996) or Medicago truncatula MtHP
promoter (Xiao etal. 2005)). In certain cases constitutive
expression of a transgene may not be necessary, especially
in cases where gene expression in a particular organ is
sufficient to obtain desired results. Targeting transgenes in
vascular organs for example is sufficient to express defenserelated proteins and/or peptides which could potentially conferresistance to pathogens that attack the vascular tissues
(Guo etal. 2004).

Several promoters that target phloem-specific gene expression have been described. These promoter elements are generally associated with genes that express specifically in phloem
cells or from organisms that are phloem limited. The sucrose synthase protein has been observed to be localized in phloem cells
(Nolte and Koch 1993) and its expression has been closely
linked with vascular bundles (Hawker and Hatch 1965). Several
promoters derived from sucrose synthase genes such as sucrose
synthase l of rice (Wang etal. 1992) or maize (Yang and Russell,
1990) have been shown to be active in heterologous systems
(Yang and Russell 1990; Shi etal. 1994). In addition, the
Arabidopsis sucrose-H+ symporter AtSUC2 has been described
to be a phloem-loading transporter (Sauer and Stolz 1994) and
has been observed to target phloem-specific gene expression in
Arabidopsis, tobacco and strawberry (Truernit and Sauer 1995,
Imlau etal. 1999, Zhao etal. 2004). The Glycine max sucrosebinding protein (GmSBP2) promoter and the Robinia pseudoacacia inner-bark lectin promoter also expressed -glucuronidase
(GUS) in the phloem of transgenic tobacco (Yoshida etal. 2002,

The Author 2012. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

84 Dutt etal.
Waclawovsky etal. 2006). The phloem protein 2 is a major protein present in most plant species (for a review, see Dinant etal.
2003) and phloem-specific PP2 promoters have been isolated
and characterized (Jiang etal. 1999, Thompson and Larkins
1996, Guo etal. 2004). The Agrobacterium rhizogenes rolC promoter (Schmulling etal. 1989) is a strong bacterium-derived
phloem promoter. Several viruses also contain promoters that
contain cis elements resulting in phloem-specific expression.
Promoters from coconut foliar decay virus (Rohde etal. 1995),
rice tungro bacilliform virus (RTBV; Bhattacharyya-Pakrasi etal.
1993), commelina yellow mottle virus (Medberry etal. 1992) or
wheat dwarf geminivirus (Dinant etal. 2004) have been demonstrated to drive phloem-specific gene expression.
Transgenic approaches to engineer citrus plants that can
resist the many abiotic and biotic stresses have gained importance in recent years. This is due to numerous new problems
being faced by the industry. In Florida, the major disease currently affecting citrus is citrus greening or huanglongbing (HLB)
associated with Candidatus Liberibacter asiaticus, a phloemlimited bacterium (Chung and Brlansky 2009). This disease
results in substantial economic losses to Floridas citrus industry.
Huanglongbing affects all cultivated citrus varieties and genetic
resistance is not present in commercial orange and grapefruit
cultivars in Florida. Targeting of a defense-related protein to
combat HLB would be desirable to maximize its expression to
phloem and reduce or minimize expression in other parts of the
plant, including fruit and juice subsequently consumed by
humans (Shi etal. 1994). Targeting of the defense protein would
also decrease metabolic load on the plant (Glick 1995).
The purpose of this study was to evaluate the activity of four
phloem-specific promoters in citrus. We transformed in vitro
derived epicotyl segments of Mexican lime (Citrus aurantifolia
Swingle) and regenerated several plants with constructs containing rolC promoter of A. rhizogenes, RTBV promoter of the
rice tungro bacilliform virus, RSs1 promoter of rice and AtSUC2
promoter of A. thaliana.

specific oligonucleotide primers (AT-F and AT-R; presented in

Table 1). The forward primer introduced a HindIII site immediately
upstream of the promoter fragment while the reverse primer
introduced a BamHI site downstream. Similarly, RSs1 promoter
fragment (1931bp) was cloned from Oryza sativa Carolina Gold
using RSs1-F and RSs1-R primers, and rolC promoter fragment
(882bp) was cloned from A. rhizogenes plasmid pRiA4 using
RC-F and RC-R primers (Table 1). Both RSs1 and rolC promoters
were also modified to introduce a HindIII site immediately
upstream of the promoter fragment and a BamHI site downstream. The RTBV promoter was PCR amplified from plasmid
pMB1709 (Yin and Beachy 1995) using RTV-F and RTV-R primers to introduce KpnI immediately upstream of the promoter fragment and a BglII site downstream. All PCR products were
amplified with Ex Taq Polymerase (Clontech Laboratories, Inc.,
Mountain View, CA, USA). The promoter fragments were isolated,
purified and cloned into pGEM-T Easy plasmid vector (Promega
Corp., Madison, WI, USA). The cloned promoters were verified
first by restriction enzyme analysis and then by DNA sequencing
performed at the Interdisciplinary Center for Biotechnology
Research (ICBR), University of Florida, Gainesville, FL, USA.

Construction of expression vectors

Materials and methods

The 35S promoter of the nptII marker gene in pCAMBIA2300

(Cambia, Canberra, Australia) was excised as an EcoRI/NcoI
fragment and replaced with an NOS promoter to form the plasmid pCAM-NOS. A BamHI/EcoRI fragment containing a gus
gene with the CaMV 35S terminator (35S-3) from a pUC18derived plasmid pDRG was cloned into a unique BamHI/EcoRI
site of pCAM-NOS to form a promoterless binary plasmid,
pCAM-PROM. This binary plasmid was used for subsequent
cloning of all promoter fragments upstream of the gus gene to
produce the binary plasmids pCAM-AtSUC, pCAM-RSs1, pCAMrolC and pCAM-RTBV. pBI434 (Datla etal. 1991) containing a
gus-nptII fusion gene under the control of a 35S promoter was
used as control. Binary plasmids (Figure 1) were introduced into
A. tumefaciens strain EHA105 (Hood etal. 1993) by the freeze
thaw method (Burrow etal. 1990).

Cloning of promoter fragments

Plant transformation

Genomic DNA of A. thaliana Col 0 ecotype was used as template for isolation of AtSUC2 promoter. AtSUC2 sequence was
amplified by polymerase chain reaction (PCR) using AtSUC2-

Nucellar seedlings of Mexican lime (C. aurantifolia Swingle)

were used for transformation as described by Dutt and Grosser
(2009). Agrobacterium EHA105 cultures containing a binary

Table 1.Sequence of primers used to amplify the phloem-specific promoters and to detect the presence of nptII gene.
Promoter/gene

Name

Forward primer 53

Name

Reverse primer 53

Amplicon length (bp)

AtSUC2
RSs1
rolC
RTBV
35S
nptII

AT-F
RSs1-F
RC-F
RTV-F
35S-F
NP-F

AAGCTTGCAAAATAGCACACCATTTATG
TCAAGCTTCAATCCACCAAATCAAAC
AAAGCTTAAAGTTGGCCCGCTATTG
AGGATCCTTTGACAAACCAAGAAAGTAAG
AAGCTTCGGATTCCATTGCCCAGC
ATCCATCATGGCTGATGCAATGCG

AT-R
RSs1-R
RC-R
RTV-R
35S-R
NP-R

AGGATCCTTTGACAAACCAAGAAAGTAAG
AGGATCCCATGACTCAATTTCAGGAAC
TAGGATCCGTTAACAAAGTAGGAAACAGG
AGATCTTGCTCTCTTAGAAGTTTGAGC
CCCTCTAGACCATGGTGGAAGTATTTGA
AACTCGTCAAGAAGGCGATAGAAGGC

954
1931
882
770
650
450

Tree Physiology Volume 32, 2012

Evaluation of phloem-specific promoters in citrus 85

Figure 1.Schematic representation of the T-DNA region of the binary vectors used in this study. The binary vector contained a gus gene driven by
one of the test phloem-specific promoters. The T-DNA also contained nptII as a selectable marker gene driven by the NOS promoter. The arrow
indicates the unique EcoRI site. The control vector contains a fusion gus-nptII gene driven by a 35S promoter (pBI434).

plasmid were grown in liquid YEP medium supplemented with

100mgl1 kanamycin and 50mgl1 rifampicin for ~24h with
shaking. Two milliliters of overnight culture were pipetted into
48ml of YEP medium containing appropriate antibiotics and
100M acetosyringone. Cultures were incubated for an additional 3h at 28C. After centrifugation, the pellet was resuspended in liquid co-cultivation medium (CM). Optical density
(600nm) was measured with a CO8000 cell density meter
(WPA, Cambridge, UK) and adjusted to 0.3 before incubation
with cut epicotyl Mexican lime segments. Explants were incubated on solid CM medium for 2 days before transfer to shoot
regeneration (RM) medium. RM medium contained Murashige
and Skoog (MS) medium (Murashige and Skoog 1962) supplemented with 13.2M 6-benzylaminopurine and 2.5M naphthyleneacetic acid. The medium was supplemented with
0.5gl1 2-(N-morpholino) ethanesulfonic acid, 30gl1 sucrose
and 8gl1 agar. pH was adjusted to 5.8 before autoclaving.
Antibiotics added to cooled medium included kanamycin
(100mgl1) and timentin (400mgl1).

Transgenic plant regeneration

Emerging Mexican lime shoots in RM medium were excised and
placed onto shoot elongation medium (RMG) for an additional 4
weeks (Dutt and Grosser 2009). Antibiotics added to this
medium included kanamycin (75mgl1) and timentin
(200mgl1). Elongated shoots that survived selection were subsequently tested for nptII expression using PCR. nptII-positive
shoots were excised and transferred into rooting medium (RMM)
containing 50mgl1 kanamycin. After 2 months in this medium,

well-rooted shoots were transferred into a peat-based commercial potting medium (Metromix 500, Sun Gro Horticulture,
Bellevue, WA, USA) and acclimated to greenhouse conditions.

Polymerase chain reaction and Southern blot analysis

Genomic DNA from 12-month-old greenhouse-grown transgenic plants was isolated. Young leaves (100mg) were used
for DNA extraction using the GenElute Plant Genomic DNA
Miniprep Kit (Sigma-Aldrich Corp., St Louis, MO, USA). Duplex
PCR to confirm presence of promoter was carried out using
GoTaq Green Master PCR Mix (Promega Corp., Madison, WI,
USA) and the primers outlined in Table 1. Inaddition, primers
to amplify a fragment of the nptII genewere included. Amplified
DNA fragments were electrophoresed on a 1% agarose gel
containing GelRedTM NucleicAcid Gel Stain (Biotium Inc.,
Hayward, CA, USA) and visualized under ultraviolet light.
Southern blot analysis was carried out for confirmation of copy
number in selected transgenic citrus plants. Genomic DNA was
isolated using the Qiagen DNeasy Plant Maxi Kit (Qiagen, Valencia,
CA, USA). EcoRI digested genomic DNA (15g) was immobilized
on a positively charged nylon membrane and probed with a DIGlabeled gus probe. Following hybridization to the probe, chemiluminescence substrate CDP-Star was used for immunological
detection of hybridization signals using X-ray film autography.

Reverse transcription real-time PCR assay

RNA was isolated from 100mg of leaf tissue using an RNeasy Mini
Kit (Qiagen). After treatment with DNAse 1 (Qiagen) to remove contaminating DNA, RNA was quantified spectrophotometrically. RNA

Tree Physiology Online at http://www.treephys.oxfordjournals.org

86 Dutt etal.
concentration of each sample was adjusted to 500ngml1 and
quality checked by agarose gel electrophoresis. Reverse transcription real-time PCR (RT-qPCR) assay was designed using
the PrimerQuestSM online software (Integrated DNA Technologies
Inc., Coralville, IA, USA) to detect the gus gene. The probe was
labeled at the 5 end with FAM (6-carboxy-fluorescein) reporter
dye and at the 3 end with Black Hole Quencher (BHQ)-1.
The cytochrome oxidase gene (cox) (GenBank accession number CX297817) primers and probe designed by Li etal. (2006)
were used to quantify mRNA from citrus as an internal standard.
The cox probe was labeled at the 5 end with JOE (2,7 dimethoxy-4,5-dichloro-6-carboxyfluorescein) reporter dye and at
the 3 end with BHQ-2. All primers and probes were synthesized
by Integrated DNA Technologies Inc. The sequences of primers
and probes including the reporter fluorescent dye and the dark
quencher dye are shown in Table 2. Different concentrations of
primers and probes were tested and optimized. Total RNA from
each sample was used in 10-fold serial dilutions for optimization
and standardization. Initially, simplex PCR was performed with
the target gene alone, but subsequently the internal control cox
gene was combined and optimized in a single assay. Reverse
transcription real-time PCR reactions were performed with a final
volume of 20l using the TaqMan RNA-to-CtTM one-step kit
(Applied Biosystems, Foster City, CA, USA) according to the
manufacturers instructions. The one-step kit parameters consisted of 20min incubation at 48 C followed by 10min incubation at 95C and 40 cycles at 95C for 15s and 60C for
1min. Each RT-qPCR contained negative and non-template/water
controls in addition to the sample being tested. Experimental
sample no. 7 (a non-transgenic greenhouse plant sample) was
used as a calibrator sample. Experiments were repeated at least
twice with two replicates, and data were analyzed using Applied
Biosystems software Version 1.4.0. Relative quantitation was
measured using the comparative Cq method also referred to as
the 2Ct. The fold change in the relative expression was then
determined by calculating 2Ct (Livak and Schmittgen, 2001).

Evaluation of GUS expression

Leaves were histochemically stained for GUS activity as described
by Jefferson (1989) with minor modifications. X-Gluc (5-bromoTable 2.Primers used in real-time PCR assay of transgenic citrus plants.
Target Amplicon Primer/probe sequence 53
gene length
Forward
(bp)
Probe
Reverse
gus

87

cox

69

ACCTCGCATTACCCTTACGCTGAA
FAM- AGATGCTCGACTGGGCAGATGAACAT -BHQ1
GCCGACAGCAGCAGTTTCATCAAT
GTATGCCACGTCGCATTCCAGA
JOE-ATCCAGATGCTTACGCTGG-BHQ2
GCCAAAACTGCTAAGGGCATTC

Tree Physiology Volume 32, 2012

4-chloro-3 indolyl--d-glucuronide) dissolved in dimethyl sulfoxide was added at a final concentration of 1mgml1 in a phosphate
buffer solution (200mM NaH2P04, pH. 7.0; 10mM EDTA and
0.2% triton X-100). Vacuum infiltration of explants was carried
out for 5min in this solution before being incubated in the dark at
37C overnight. After incubation, explants were de-stained in
ethanol:acetic acid (3:1) for 12h to eliminate background chlorophylls and other pigments present in stained tissues. A quantitative fluorometric GUS assay was performed as outlined in the
FluorAce -Glucuronidase Reporter Assay Kit (Bio-Rad
Laboratories, Hercules, CA, USA). Approximately 2040g of
total protein obtained from leaf petioles was added to 500l of
assay buffer. Samples were incubated in a 37C water bath for
30min before the reaction was terminated by the addition of 1x
stop buffer. Total soluble protein of each sample was determined
using the Coomassie (Bradford) Protein Assay Kit (Fisher
Scientific Inc., Pittsburg, PA, USA). Relative GUS activity was calculated relative to the amount of total protein and reaction time
period and expressed in pmol MU/mg protein/min.

Northern blot analysis

Total RNA from 12-month-old greenhouse-grown transgenic citrus plants was isolated using an RNeasy Mini Kit (Qiagen).
Polymerase chain reaction was used to incorporate T7 promoter
sequence (5TAATACGACTCACTATAGGG3) at the 5 end of the
antisense strand of gus and cox fragments. Digoxigenin (DIG)labeled RNA probes were prepared according to the in vitro transcription labeling technique in the DIG Northern Starter Kit (Roche
Applied Science, Indianapolis, IN, USA) using the PCR product as
template. Total RNA (500ng) was subjected to formaldehyde
denaturation and was electrophoretically resolved in a 2%
agaroseformaldehyde denaturing gel with 1 MOPS buffer. The
RNA was transferred to a positively charged nylon membrane by
capillary transfer. Hybridizations were performed overnight at
68C as described in the DIG Northern Starter Kit. The chemiluminescence substrate CDP-Star was used for immunological
detection of hybridization signals using X-ray film autography.

Results
Production of transgenic plants
Agrobacterium-mediated transformation of Mexican lime epicotyl explants resulted in the production of a large number of
putative kanamycin-resistant transgenic plants. There was no
difference in ability to regenerate shoots following co-
cultivation and incubation with any of the vectors. In order to
confirm development of non-chimeric transgenic plants, shoots
were excised from epicotyl segments, bases were cut off and
transferred into RMG medium. Most shoots could be transferred into RMM medium within 4 weeks of transfer to RMG. It
was necessary to subculture several transgenic shoots twice
into fresh RMM medium before they could root and be trans-

Evaluation of phloem-specific promoters in citrus 87

ferred into soil. All plants grew normally and there was no phenotypic abnormality observed between transgenic plants and
non-transgenic controls. Rooted plants developed slowly in the
first 6 months of transfer to soil followed by rapid plant growth
and development. Six transgenic lines from each construct
were hardened off in the greenhouse.

Polymerase chain reaction and Southern blot analyses of

transgenic Mexican lime plants
Putative transgenic plants were evaluated by duplex PCR with
primers mentioned earlier. Results demonstrated the presence
of a test promoter in each transgenic plant evaluated. In addition, the nptII gene was also detected in transgenic plants that
were positive for the promoter (Figure 2). Stable gene integration
and copy number from four transgenic lines of each construct
was evaluated using Southern blot analyses (Figure 3). Genomic
DNA (15g) was digested with EcoRI and probed with a DIGlabeled gus probe. Among four transgenic plants analyzed containing the AtSUC2-gus construct (Figure 3a), line 2 was single
copy, lines 1 and 4 had two copies and line 3 had three copies
of the transgene stably incorporated into the genome. In transgenic lines containing the RSs1-gus construct (Figure 3b), line 1
was single copy, line 4 had two copies, line 3 had three copies
and line 2 had four copies of the transgene. With plants containing the rolC-gus construct (Figure 3c), line 4 was single copy
while line 2 had two, line 1 had three and line 3 had four copies
of the transgene. Lines 2 and 3 were single copy while lines 1
and 4 contained two copies of the transgene in plants containing the RTBV-gus construct (Figure 3d).

Analysis of GUS expression in transgenic Mexican

limeplants
Visualization of GUS activity was successfully done by overnight staining. We stained 6-week-old transgenic citrus plants.
Expression of the constructs was observed in leaves and
remained restricted to vascular tissues (Figure 4). Phloemspecific GUS expression was also observed in overnight
stained cross-sections of tender 6-week-old stems (Figure 5).
Histochemical GUS analysis demonstrated that staining of vascular tissues of young in vitro leaves was similar to that
observed using greenhouse plants (data not shown).
Four transgenic citrus plants obtained from each construct
were analyzed. Relative GUS activity ranging from 7 to
250pmolMU/mg/min was obtained after transformation using
gus gene-containing vectors. There was no significant difference in relative GUS activity of plants transformed with either
RTBV promoter or 35S control (pBI434; Figure 6). Of the four
phloem-specific promoters evaluated in this study, GUS activity
was highest in plants expressing RTBV promoter, followed by
rolC promoter, AtSUC2 promoter and RSs1 promoter. The RSs1
promoter was not very active in citrus (19pmolMU/mg protein/
min). GUS activity was not detected in plants transformed with
pC2300 that contained a construct with an nptII cassette only.
A comparison of relative GUS activity in stems, roots and
leaves of transgenic citrus revealed that plants transformed
with pCAM-rolC construct yielded about half the GUS activity
of pCAM-RTBV in leaves (Table 3). GUS activity was 10 times
lower in plants transformed with pCAM-RSs1 and 4 times
lower in plants with pCAM-AtSUC2. GUS activity levels were

Figure 2.Amplification products obtained from duplex PCR of transgenic Mexican lime genomic DNA with promoter-specific oligonucleotide primers as outlined in Table 1. A fragment of the nptII gene (450bp) was also amplified. M, 1kb marker; 14 are four individual transgenic lines containing the RSs1 promoter; 58 are four individual transgenic lines containing the AtSUC2 promoter; 912 are four individual transgenic lines
containing the RTBV promoter; 1316 are four individual transgenic lines containing the rolC promoter.

Figure 3.Southern hybridization analysis of total DNA of transgenic Mexican lime lines transformed with one of the four phloem-specific promoters. (a) AtSUC2, (b) RSs1, (c) rolC and (d) RTBV. The * indicates a line with single copy number.

Tree Physiology Online at http://www.treephys.oxfordjournals.org

88 Dutt etal.

Reverse transcription real-time PCR of transgenic

Mexican lime plants

Figure 4.Phloem-specific gus expression in 6-week-old transgenic

Mexican lime leaves. Leaves were incubated in the dark at 37C overnight in a phosphate buffer solution containing 1mgml1 X-Gluc. After
incubation, the explants were de-stained in ethanol:acetic acid (3:1) for
12h to eliminate background chlorophylls and other pigments present in
stained tissues. AtSUC2: transgenic leaf expressing GUS under control of
the AtSUC2 promoter; RSs1: transgenic leaf expressing GUS under control of the RSs1 promoter; rolC: transgenic leaf expressing GUS under
control of the rolC promoter; RTBV: transgenic leaf expressing GUS under
control of the RTBV promoter; 35S: transgenic leaf expressing GUS under
control of the 35S promoter; CON: leaf obtained from a non-transgenic
control at a similar stage of development.

Initially, primer evaluations and standardizations were performed by RT-qPCR with SYBR Green I dye (data not shown)
and then TaqMan RT-qPCR was performed as duplex reactions.
The optimized concentration of primers (300nM each both forward and reverse) and probe (150nM) provided good results
for the target gene. The internal control gene (cox) was optimized with primers (300nM each both forward and reverse)
and probe (150nM). No non-specific or cross-reaction/
amplification of targets was observed, and only targeted regions
of the gene were amplified by the duplex reactions. No signal
was detected using total RNA from healthy non-transgenic control plants or from a non-template control/water sample.
Using the 2Ct Ct method (Livak and Schmittgen 2001),
overall relative quantification level was highest (upregulated) in
plants expressing a gus gene driven by the 35S promoter followed by RTBV, rolC, AtSUC2 and RSs1. The relative quantification of the specific promoter varied among the individual lines
tested. The 35S and RTBV promoters had above log103.3 (relative quantification) and other promoters had log103.2 or below.
All promoters consistently expressed above log102.6. The cox
gene served as a good endogenous reference and was
expressed and detected consistently. The internal reference
gene measured 0 on a log10 scale. A greenhouse healthy control plant sample was used as a calibrator sample. Results are
shown in the graph/table by specific promoter (Figure 7).

Northern blot of transgenic Mexican lime plants

Figure 5.GUS expression in phloem tissues in a 6-week-old transgenic

Mexican lime stem cross-section. The plant was transformed with a construct containing the gus gene under control of the AtSUC2 promoter.

Northern blot was essentially performed to confirm relative levels of promoter-driven gus expression in different tissues of
transgenic Mexican lime plants in selected single copy transgenic plants obtained from each construct. We analyzed vascular leaf tissues and roots of greenhouse-derived plants in
order to evaluate expression levels. Blots were also probed
with a fragment of the cox gene. The cox gene served as a
loading control for amount of total RNA. Good expression levels were observed in leaf vascular tissues (Figure 8). gus
expression in roots was different from that observed in leaves.
Expression levels were relatively lower in roots with the exception of the rolC construct (Figure 9). As observed earlier using
fluorometric analysis, plants containing the RSs1-gus construct
had the lowest mRNA expression levels among all promoters
evaluated.

Discussion
similar in leaves and stem. GUS activity in roots followed a
different trend. Plants transformed with pCAM-rolC had relatively higher GUS activity than pCAM-RTBV while others
lower.

Tree Physiology Volume 32, 2012

Citrus in Florida is currently under a severe threat from citrus

HLB (greening disease) associated with the Gram negative,
phloem-limited bacterium Candidatus Liberibacter asiaticus,
which has now become endemic. Huanglongbing affects all

Evaluation of phloem-specific promoters in citrus 89

Figure 6.Fluorometric assay for relative GUS activity in fully expanded leaves of greenhouse grown Mexican lime plants. Midrib and petioles were
used for sampling after 1 year of transfer to the greenhouse. Vertical lines represent standard errors. pC2300: transgenic plants containing a nptII
cassette; pCAM-AtSUC: transgenic plants expressing GUS under control of the AtSUC2 promoter; pCAM-RSs1: transgenic plants expressing GUS
under control of the RSs1 promoter; pCAM-rolC: transgenic plants expressing GUS under control of the rolC promoter; pCAM-RTBV: transgenic
plants expressing GUS under control of the RTBV promoter; pBI434: transgenic plants expressing GUS under control of the 35S promoter.
Table 3.Relative GUS activity in stems, roots and leaves of transgenic
Mexican lime. GUS activity from individual promoter-gus constructs
isexpressed as a percentage of mean relative GUS activity from
RTBV-GUS.
Promoter construct1

Leaves

Stem

Roots

pCAM-AtSUC2
pCAM-RSs1
pCAM-RolC
pCAM-RTBV
pBI434

283
103
517
100
1035

254
103
447
100
843

485
215
1262
100
1485

1All

constructs contain the gus gene driven by an individual test promoter. The construct pCAM-AtSUC contains the AtSUC2 promoter,
pCAM-RSs1 contains the RSs1 promoter, pCAM-rolC contains the rolC
promoter, pCAM-RTBV contains the RTBV promoter and pBI434 contains the 35S promoter.

cultivated citrus varieties and cannot be currently controlled

due to a lack of resistant cultivars. The Asian citrus psyllid
(ACP) (Diaphorina citri Kuwayama) is responsible for its spread.
Infected psyllids and their nymphs transmit the bacterium into
phloem tissues of the plant (Xu etal. 1988, Manjunath etal.
2008). The disease is then spread to different parts of the
plant via phloem (Tatineni etal. 2008). Expression of a strong
antimicrobial product in phloem and especially in younger tissues could help control this disease.
Our present study was conducted to evaluate the performance of four phloem-specific promoters for subsequent
delivery of antimicrobial products against Candidatus
Liberibacter asiaticus. We selected promoters originating from

diverse sources (dicot and monocot plants, bacteria and virus)

for phloem-specific gene expression. We were able to successfully generate a population of transgenic Mexican lime
plants containing our promoter-gus constructs using a protocol that has been described previously (Dutt and Grosser
2009). Non-transgenic escape plants were successfully eliminated after multiple rounds of kanamycin-based selection.
Production of escape plants is a major problem in citrus transformation research (Domnguez etal. 2004) since non-transformed cells can be protected from the selective agent by
neighboring transformed cells (Jordan and McHughen 1988).
Use of reporter genes such as EGFP enables visual nondestructive identification of transgenic lines and can mitigate
the problem of escape plant regeneration (Dutt and Grosser
2009). When visual reporter genes are not used, a selection
regime that includes optimum levels of selection agent coupled with proper incubation time is necessary for efficient
selection (Mitic etal. 2004). We report herein the expression
patterns of several phloem-specific promoters in citrus. None
of the promoters were active in non-vascular tissues (data not
shown).
The 35S promoter is an efficient promoter and is constitutively expressed in citrus (Pena etal. 1995, Dutt etal. 2011).
High levels of gene expression occur by interaction of a
series of cis elements in the promoter (Benfey etal. 1989).
Yin etal. (1997) suggested that high levels of phloem-specific pararetrovirus (RTBV) expression are mainly due to three
cis elements: Box II, ASL box and GATA motif. Differences in

Tree Physiology Online at http://www.treephys.oxfordjournals.org

90 Dutt etal.

Figure 7.Quantification of gus activity using RT-qPCR. Total RNA from Mexican lime leaf midrib and petioles was used as template. The
sequence of primers used to amplify the gus gene is detailed in Table 2. Four independent lines were tested from each construct. Lanes 14
areindividual transgenic lines containing the AtSUC2 promoter; 58 are four individual transgenic lines containing the RSs1 promoter; 912 are
four individual transgenic lines containing the rolC promoter; 1316 are four individual transgenic lines containing the RTBV promoter; 1720 are
four individual transgenic lines containing the 35S promoter. Lane 21 is the calibrator sample. Total RNA from a Mexican lime plant transformed
with pC2300 (lane 22) and a water sample (lane 23) was also included to verify the accuracy of the amplification process.

Figure 8.Northern blot analysis of gus gene expression in leaf midrib

and petioles of transgenic Mexican lime. Total RNA (500ng) was
probed with a gus DIG-labeled RNA probe (top panel). Northern blot
was probed with the cytochrome oxidase gene (lower panel). AtSUC2:
transgenic plants expressing gus under control of the AtSUC2 promoter; RSs1: transgenic plants expressing gus under control of the
RSs1 promoter; rolC: transgenic plants expressing gus under control of
the rolC promoter; RTBV: transgenic plants expressing gus under control of the RTBV promoter; CON: leaf obtained from a non-transgenic
control at a similar stage of development.

Figure 9.Northern blot analysis of gus gene expression in roots of

transgenic Mexican lime. Total RNA (500ng) was probed with a gus
DIG-labeled RNA probe (top panel). Northern blots were probed with
the cytochrome oxidase gene (lower panel). AtSUC2: transgenic
plants expressing gus under control of the AtSUC2 promoter; RSs1:
transgenic plants expressing gus under control of the RSs1 promoter;
rolC: transgenic plants expressing gus under control of the rolC promoter; RTBV: transgenic plants expressing gus under control of the
RTBV promoter; CON: roots obtained from a non-transgenic control at
a similar stage of development.

tissue specificity between the two promoters (RTBV and

35S) are also due to the presence of different cis elements
such as activation sequence-1 (as-1) site, a CA-rich region
and a GATA region, both of which are key elements that bind
nuclear factors for constitutive expression in 35S (Lam and
Chua 1989).
Relatively lower levels of GUS expression were obtained
from plants transformed with the two plant-derived promoters.
The AtSUC2 promoter is localized in companion cells (Stadler
and Sauer 1996) and expressed strongly in midrib and secondary veins (Srivastava etal. 2008). GUS activity was
observed in both young and older leaves, contrary to that
reported in transgenic strawberries, where GUS activity was

absent in young leaves (Zhao etal. 2004). The RSs1 promoter

was the least effective of the four promoters evaluated in this
study in driving transgene expression. Monocot promoters that
exhibit a highly regulated expression pattern in monocots can
function at a reduced level in dicots (Hauptmann etal. 1988,
Shimamoto 1994).
The rolC promoter produced adequate levels of GUS expression in both leaves and roots of citrus. This promoter is activated by sucrose in phloem cells (Yokoyama etal. 1994). High
levels of sucrose in actively growing parts result in rapid translocation of photosynthates from source to sink tissues and play
a role in up-regulating gene expression. Activity of the rolC
promoter was superior to that of AtSUC2 and RSs1. Gene

Tree Physiology Volume 32, 2012

Evaluation of phloem-specific promoters in citrus 91

expression regulated by the rolC promoter has been reported
to be higher than the RSs1 promoter in both monocots and
dicots (Saha etal. 2007).
We further corroborated our observations on gus expression
in citrus by RT-qPCR. Protocols were optimized to detect variations among plants. Major differences were not observed
between various transgenic lines transformed with a specific
promoter, and variation observed in different groups was similar to that obtained in fluorometric assays.
Agrobacterium-mediated transformation is a random process,
and incorporation of a set number of transgenes is not currently
possible by this method (Nagaya etal. 2005). One to four copies of the gus gene were detected by Southern blotting. However,
none of these transgenic lines exhibited gene silencing. Gene
silencing occurs in plants containing numerous copies of a transgene integrated at one or multiple unlinked loci (Nagaya etal.
2005) or repetitive T-DNA structures (Jorgensen etal. 1996). In
many cases, multiple copies of a transgene result in gene silencing (Schubert etal. 2004). In citrus, we did not observe any
silencing when 14 copies of the transgene were present in the
genome. Similar results were obtained by Tang et al. (2007).
They observed post-transcriptional gene silencing in transgenic
lines with more than three copies of T-DNA.
To minimize variability of transgene expression and to confirm our results, we evaluated transgenic plants that were
observed to contain a single copy of a transgene stably
incorporated into the genome as evaluated through Southern
blot analyses. Our results mirrored those observed using
fluorometric GUS analysis. High levels of GUS expression were
observed in leaf petioles and veins and there was no difference in expression levels between this and stem phloem
tissues.
In conclusion, we evaluated four phloem-specific promoters
from diverse sources. Each of the promoters was able to drive
vascular-specific gene expression in vegetative parts of the plant.
Expression levels depended on the promoter, with a virus derived
promoter exhibiting the highest transgene expression, followed
by a bacterial rolC promoter. The two plant-based AtSUC2 and
RSs1 promoters were comparatively weak in directing vascularspecific gene expression. However, a weaker plant-based promoter that is able to drive adequate levels of gene expression
may be preferable to the consumer than stronger non-plantbased promoters. Citrus is a long-lived perennial, and further
analyses are required on transgene stability during different
growing seasons.

Acknowledgments
We thank Dr E. Etxeberria for providing us with facilities to
conduct GUS fluorometric analysis, Gary Barthe for excellent
technical assistance and Dr Roger Beachy for providing us with
the pMB1709 plasmid.

Funding
This work was partially supported by funds provided by the
Citrus Research and Development Foundation, Inc. (CRDF).

References
An, Y.Q., J.M. McDowell, S. Huang, E.C. McKinney, S. Chambliss and
R.B. Meagher. 1996. Strong, constitutive expression of the
Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. Plant J.
10:107121.
Benfey, R.N., L. Ren and N.H. Chua, 1989. The CaMV 35S enhancer contains at least two domains which can confer different developmental
and tissue-specific expression patterns. EMBO J. 8:21952202.
Bevan, M.W., R.B. Flavell and M.D. Chilton. 1983. A chimaeric antibiotic
resistance gene as a selectable marker for plant cell transformation.
Nature 304:184187.
Bhattacharyya-Pakrasi, M., J. Peng, J.S. Elmer, G. Laco, P. Shen, M.B.
Kaniewska, H. Kononowicz, F. Wen, T.K. Hodges and R.N. Beachy.
1993. Specificity of a promoter from the rice tungro bacilliform virus
for expression in phloem tissues. Plant J. 4:7179.
Burrow, M.D., C.A. Chlan, P. Sen and N. Murai. 1990. High frequency
generation of transgenic tobacco plants after modified leaf disk cocultivation with Agrobacterium tumefaciens. Plant Mol. Biol. Rep.
8:124139.
Chung, K.R. and R.H. Brlansky. 2009. Citrus diseases exotic to Florida:
Huanglongbing (Citrus Greening) Fact Sheet PP-210. http://edis.
ifas.ufl.edu/pp133.
Datla, R.S.S., J.K. Hammerlindl, L.E. Pelcher, W.L. Crosby and
G.Selvaraj. 1991. A bifunctional fusion between beta-glucuronidase
and neomycin phosphotransferase: a broad-spectrum marker
enzyme for plants. Gene 101:239246.
Dinant, S., A.M. Clark, Y. Zhu, F. Vilaine, J.C. Palauqui, C. Kusiak and
G.A.Thompson. 2003. Diversity of the superfamily of phloem lectins (phloem protein 2) in angiosperms. Plant Physiol.
131:114128.
Dinant, S., Ripoll, C., Pieper, M. and C. David. 2004. Phloem specific
expression driven by wheat dwarf geminivirus V-sense promoter in
transgenic dicotyledonous species. Physiol. Plant. 121:108116.
DiRita, V.J. and S.B. Gelvin. 1987. Deletion analysis of the mannopine
synthase gene promoter in sunflower crown gall tumors and
Agrobacterium tumefaciens. Mol. Gen. Genet. 207:233241.
Domnguez, A., M. Cervera, R.M. Prez, J. Romero, C. Fagoaga, J.
Cubero, M.M. Lpez, J.A. Jurez, L. Navarro and L. Pea. 2004.
Characterization of regenerants obtained under selective conditions
after Agrobacterium-mediated transformation of citrus explants
reveals production of silenced and chimeric plants at unexpected
high frequencies. Mol. Breeding 14:171183.
Dutt, M. and J.W. Grosser. 2009. Evaluation of parameters affecting
Agrobacterium-mediated transformation of citrus. Plant Cell Tiss.
Organ Cult. 98:331340.
Dutt, M., M. Vasconcellos and J.W. Grosser, 2011. Effects of antioxidants on Agrobacterium-mediated transformation and accelerated
production of transgenic plants of Mexican lime (Citrus aurantifolia
Swingle). Plant Cell Tiss. Organ Cult. 107:7989.
Glick, B.R. 1995. Metabolic load and heterologous gene expression.
Biotech. Adv. 13:247261.
Guo, H., X. Chen, H. Zhang, R. Fang, Z. Yuan, Z. Zhang and Y. Tian.
2004. Characterization and activity enhancement of the phloemspecific pumpkin PP2 gene promoter. Transgenic Res.
13:559566.
Hauptmann, R.M., M. Ashraf, V. Vasil, L.C. Hannah, I.K. Vasil and R.
Ferl. 1988. Promoter strength comparisons of maize shrunken I and

Tree Physiology Online at http://www.treephys.oxfordjournals.org

92 Dutt etal.
alcohol dehydrogenase I and 2 promoters in mono- and dicotyledonous species. Plant Physiol. 88:10631066.
Hawker, J.S. and M.D. Hatch. 1965. Mechanism of sugar storage by
mature stem tissue of sugarcane. Physiol. Plant. 18:444453.
Hood, E.E., S.B. Gelvin, L.S. Melchers and A. Hoekema. 1993. New
Agrobacterium helper plasmids for gene transfer to plants.
Transgenic Res. 2:208218.
Imlau, A., E. Truernit and N. Sauer. 1999. Cell-to-cell and long-distance
trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell
11:309322.
Jefferson, R.A. 1989. The GUS reporter gene system. Nature
342:837838.
Jiang, H., H.M. Qin, H.M. Yu and Y.C. Tian. 1999. Cloning and function
of the phloem protein gene promoter from Cucurbita maxima. J.
Agric. Biotechnol. 7:6368.
Jordan, M.C. and A. McHughen. 1988. Transformed callus does not
necessarily regenerate transformed shoots. Plant Cell Rep.
7:285287.
Jorgensen, R.A., P.D. Cluster, J. English, Q. Que and C.A. Napoli. 1996.
Chalcone synthase cosuppression phenotypes in petunia flowers:
comparison of sense vs. antisense constructs and singlecopy vs.
complex T-DNA sequences. Plant Mol. Biol. 31:957973.
Lam, E., and N.H. Chua. 1989. ASF-2: a factor that binds to the cauliflower mosaic virus 355 promoter and a conserved GATA motif in
Cab promoters. Plant Cell 1:11471156.
Li, W., J.S. Hartung and L. Levy. 2006. Quantitative real-time PCR for
detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. J. Microbiol. Methods 66:104115.
Livak, K.J. and T.D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2Ct method.
Methods 25:402408.
Maiti, I.B., S. Gowda, J. Kiernan, S.K. Ghosh and R.J. Shepherd. 1997.
Promoter/leader deletion analysis and plant expression vectors with
the figwort mosaic virus (FMV) full length transcript (FLt) promoter
containing single or double enhancer domains. Transgenic Res.
6:143156.
Manjunath, K.L., S.E. Halbert, C. Ramadugu, S. Webb and R.F. Lee.
2008. Detection of Candidatus Liberibacter asiaticus in Diaphorina
citri and its importance in the management of citrus huanglongbing
in Florida. Phytopathology 98:387396.
Medberry, S.L., B. Lockhart and N.E. Olszewski. 1992. The commelina
yellow mottle virus promoter is a strong promoter in vascular and
reproductive tissues. Plant Cell 4:185192.
Mitic, N., R. Nikolic, S. Ninkovic, J. Milju-Djukic and M. Nekovic. 2004.
Agrobacterium-mediated transformation and plant regeneration of
Triticum aestivum L. Biol. Plant. 48:179184.
Murashige, T. and F. Skoog. 1962. A revised medium for rapid growth and
bioassay with tobacco tissue cultures. Physiol. Plant. 15:473497.
Nagaya, S., K. Kato, Y. Ninomiya, R. Horie, M. Sekine, K. Yoshida and A.
Shinmyo. 2005. Expression of randomly integrated single complete
copy transgenes does not vary in Arabidopsis thaliana. Plant Cell
Physiol. 46:438444.
Nolte, K.D. and K.E. Koch 1993. Companion-cell specific localization of
sucrose synthase in zones of phloem loading and unloading. Plant
Physiol. 101:899905.
Odell, J.T., F. Nagy and N.H. Chua. 1985. Identification of DNA
sequences required for activity of the cauliflower mosaic virus 35S
promoter. Nature 313:810812.
Pena, L., M. Cervera, J. Jurez, C. Ortega, J. Pina, N. Durn-Vila and
L.Navarro. 1995. High efficiency Agrobacterium-mediated transformation and regeneration of citrus. Plant Sci. 104:183191.
Rohde, W., D. Becker and J.W. Randles. 1995. The promoter of coconut
foliar decay-associated circular single-stranded DNA directs

Tree Physiology Volume 32, 2012

phloem-specific reporter gene expression in transgenic tobacco.

Plant Mol. Biol. 27:623628.
Saha, P., D. Chakraborti, A. Sarkar, I. Dutta, D. Basu and S. Das. 2007.
Characterization of vascular-specific RSs1 and rolC promoters for
their utilization in engineering plants to develop resistance against
hemipteran insect pests. Planta 226:429442.
Sauer, N. and J. Stolz. 1994. SUC1 and SUC2: two sucrose transporters from Arabidopsis thaliana: expression and characterization in
bakers yeast and identification of the histidine-tagged protein. Plant
J. 6:6777.
Schmulling, T., J. Schell and A. Spena. 1989. Promoters of the rol A, B,
and C genes of Agrobacterium rhizogenes are differentially regulated
in transgenic plants. Plant Cell 1:665670.
Schubert, D., B. Lechtenberg, A. Forsbach, M. Gils, S. Bahadur and
R.Schmidt. 2004. Silencing in Arabidopsis T-DNA transformants
the predominant role of a gene-specific RNA sensing mechanism
versus position effects. Plant Cell 16:25612572.
Shi, Y., M.B. Wang, K.S. Powell, E. Van Damme, V.A. Hilder, A.M.R.
Gatehouse, D. Boulter, and J.A. Gatehouse, 1994. Use of the rice
sucrose synthase-1 promoter to direct phloem-specific expression
of -glucuronidase and snowdrop lectin genes in transgenic tobacco
plants. J. Exp. Bot. 45:623631.
Shimamoto, K. 1994. Gene expression in transgenic plants. Curr. Opin.
Biotechnol. 5:158162.
Srivastava, A.C., S. Ganesan, I.O. Ismail and B.G. Ayre. 2008. Functional
characterization of the Arabidopsis AtSUC2 sucrose/H+ symporter
by tissue-specific complementation reveals an essential role in
phloem loading but not in long-distance transport. Plant Physiol.
148:200211.
Stadler, R. and N. Sauer, 1996. The Arabidopsis thaliana AtSUC2
gene is specifically expressed in companion cells. Bot. Acta.
109:299306.
Tang, W., R.J. Newton and D.A. Weidner. 2007. Genetic transformation and gene silencing mediated by multiple copies of a transgene
in eastern white pine. J. Exp. Bot. 58:545554.
Tatineni, S., U.S. Sagaram, S. Gowda, C.J. Robertson, W.O. Dawson, T.
Iwanami and N. Wang. 2008. In planta distribution of Candidatus
Liberibacter asiaticus as revealed by polymerase chain reaction
(PCR) and real-time PCR. Phytopathology 98:592599.
Thompson, G.A. and B.A. Larkins. 1996. Phloem-specific promoter. US
patent US005495007A.
Truernit, E. and N. Sauer. 1995. The promoter of the Arabidopsis
thaliana SUC2 sucrose-H+ symporter gene directs expression of
beta-glucuronidase to the phloem: evidence for phloem loading and
unloading by SUC2. Planta 196:564570.
Waclawovsky, A.J., R.L. Freitas, C.S. Rocha, L.A.S. Contim and
E.P.B.Fontes. 2006. Combinatorial regulation modules on GmSBP2
promoter: a distal cis-regulatory domain confines the SBP2 promoter activity to the vascular tissue in vegetative organs. BBA-Gene
Struct. Expr. 1759:8998.
Wang, M.B., D. Boulter and J.A. Gatehouse. 1992. A complete sequence
of the rice sucrose synthase-1 (RSsl) gene. Plant Mol. Biol.
19:881885.
Xiao, K., C. Zhang, M. Harrison and Z.Y. Wang. 2005. Isolation and
characterization of a novel plant promoter that directs strong constitutive expression of transgenes in plants. Mol. Breeding
15:221231.
Xu, C.F., K.B. Li and C. Ke 1988. Further study of the transmission of
citrus huanglongbing by a psyllid, Diaphorina citri Kuwayama.
Proceedings of 10th Conference of the International Organization of
Citrus Virologists. pp 243248.
Yang, N.S. and D. Russell 1980. Maize sucrose synthase-1 promoter
directs phloem specific expression of gus gene in transgenic
tobacco plants. Proc. Natl Acad. Sci. USA 87:41444148.

Evaluation of phloem-specific promoters in citrus 93

Yin, Y. and R.N. Beachy. 1995. The regulatory regions of the rice tungro bacilliform virus promoter and interacting nuclear factors in rice
(Oryza sativa L.). Plant J. 7:969980.
Yin, Y., L. Chen and R.N. Beachy. 1997. Promoter elements required for
phloem-specific gene expression from the RTBV promoter in rice.
Plant J. 12:11791188.
Yokoyama, R., T. Hirose, N. Fujii, E.T. Aspuria, A. Kato and H. Uchimiya.
1994. The rolC promoter of Agrobacterium rhizogenes Ri plasmid is

activated by sucrose in transgenic tobacco plants. Mol. Gen. Genet.

244:1522.
Yoshida, K., T. Mohri, M. Nishiguchi and K. Tazaki. 2002. Robinia pseudo
acacia inner-bark lectin promoter expresses GUS also predominantly
in phloem of transgenic tobacco. J. Plant Physiol. 159:757764.
Zhao, Y., Q. Liu and R.E. Davis. 2004. Transgene expression in strawberries driven by a heterologous phloem-specific promoter. Plant
Cell Rep. 23:224230.

Tree Physiology Online at http://www.treephys.oxfordjournals.org