Documentos de Académico
Documentos de Profesional
Documentos de Cultura
doi:10.1093/treephys/tpr130
Research paper
Mexican lime (Citrus aurantifolia Swingle) was transformed with constructs that contained chimeric promoter-gus gene
fusions of phloem-specific rolC promoter of Agrobacterium rhizogenes, Arabidopsis thaliana sucrose-H+ symporter (AtSUC2)
gene promoter of Arabidopsis thaliana, rice tungro bacilliform virus (RTBV) promoter and sucrose synthase l (RSs1) gene
promoter of Oryza sativa (rice). Histochemical -glucuronidase (GUS) analysis revealed vascular-specific expression of the
GUS protein in citrus. The RTBV promoter was the most efficient promoter in this study while the RSs1 promoter could drive
low levels of gus gene expression in citrus. These results were further validated by reverse transcription real-time polymerase
chain reaction and northern blotting. Southern blot analysis confirmed stable transgene integration, which ranged from a
single insertion to four copies per genome. The use of phloem-specific promoters in citrus will allow targeted transgene
expression of antibacterial constructs designed to battle huanglongbing disease (HLB or citrus greening disease), associated
with a phloem-limited Gram-negative bacterium.
Keywords: Agrobacterium tumefaciens, AtSUC2, citrus, GUS, Mexican lime, rolC, RSs1, RTBV, transformation.
Introduction
In plant transformation studies, constitutive promoters are
commonly used to target gene expression throughout the
plant. These promoters can be obtained from numerous
sources such as viruses (the cauliflower mosaic virus (CaMV)
35S promoter (Odell etal. 1985) or figwort mosaic virus
(FMV) promoter (Maiti etal. 1997)); bacteria (the Agrobacterium
tumefaciens Ti plasmid mannopine synthetase (mas) promoter
(DiRita and Gelvin, 1987) or nopaline synthase (NOS) promoter (Bevan etal. 1983)); or plants (the Arabidopsis thaliana
Act 2 promoter (An etal. 1996) or Medicago truncatula MtHP
promoter (Xiao etal. 2005)). In certain cases constitutive
expression of a transgene may not be necessary, especially
in cases where gene expression in a particular organ is
sufficient to obtain desired results. Targeting transgenes in
vascular organs for example is sufficient to express defenserelated proteins and/or peptides which could potentially conferresistance to pathogens that attack the vascular tissues
(Guo etal. 2004).
Several promoters that target phloem-specific gene expression have been described. These promoter elements are generally associated with genes that express specifically in phloem
cells or from organisms that are phloem limited. The sucrose synthase protein has been observed to be localized in phloem cells
(Nolte and Koch 1993) and its expression has been closely
linked with vascular bundles (Hawker and Hatch 1965). Several
promoters derived from sucrose synthase genes such as sucrose
synthase l of rice (Wang etal. 1992) or maize (Yang and Russell,
1990) have been shown to be active in heterologous systems
(Yang and Russell 1990; Shi etal. 1994). In addition, the
Arabidopsis sucrose-H+ symporter AtSUC2 has been described
to be a phloem-loading transporter (Sauer and Stolz 1994) and
has been observed to target phloem-specific gene expression in
Arabidopsis, tobacco and strawberry (Truernit and Sauer 1995,
Imlau etal. 1999, Zhao etal. 2004). The Glycine max sucrosebinding protein (GmSBP2) promoter and the Robinia pseudoacacia inner-bark lectin promoter also expressed -glucuronidase
(GUS) in the phloem of transgenic tobacco (Yoshida etal. 2002,
The Author 2012. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
84 Dutt etal.
Waclawovsky etal. 2006). The phloem protein 2 is a major protein present in most plant species (for a review, see Dinant etal.
2003) and phloem-specific PP2 promoters have been isolated
and characterized (Jiang etal. 1999, Thompson and Larkins
1996, Guo etal. 2004). The Agrobacterium rhizogenes rolC promoter (Schmulling etal. 1989) is a strong bacterium-derived
phloem promoter. Several viruses also contain promoters that
contain cis elements resulting in phloem-specific expression.
Promoters from coconut foliar decay virus (Rohde etal. 1995),
rice tungro bacilliform virus (RTBV; Bhattacharyya-Pakrasi etal.
1993), commelina yellow mottle virus (Medberry etal. 1992) or
wheat dwarf geminivirus (Dinant etal. 2004) have been demonstrated to drive phloem-specific gene expression.
Transgenic approaches to engineer citrus plants that can
resist the many abiotic and biotic stresses have gained importance in recent years. This is due to numerous new problems
being faced by the industry. In Florida, the major disease currently affecting citrus is citrus greening or huanglongbing (HLB)
associated with Candidatus Liberibacter asiaticus, a phloemlimited bacterium (Chung and Brlansky 2009). This disease
results in substantial economic losses to Floridas citrus industry.
Huanglongbing affects all cultivated citrus varieties and genetic
resistance is not present in commercial orange and grapefruit
cultivars in Florida. Targeting of a defense-related protein to
combat HLB would be desirable to maximize its expression to
phloem and reduce or minimize expression in other parts of the
plant, including fruit and juice subsequently consumed by
humans (Shi etal. 1994). Targeting of the defense protein would
also decrease metabolic load on the plant (Glick 1995).
The purpose of this study was to evaluate the activity of four
phloem-specific promoters in citrus. We transformed in vitro
derived epicotyl segments of Mexican lime (Citrus aurantifolia
Swingle) and regenerated several plants with constructs containing rolC promoter of A. rhizogenes, RTBV promoter of the
rice tungro bacilliform virus, RSs1 promoter of rice and AtSUC2
promoter of A. thaliana.
Plant transformation
Genomic DNA of A. thaliana Col 0 ecotype was used as template for isolation of AtSUC2 promoter. AtSUC2 sequence was
amplified by polymerase chain reaction (PCR) using AtSUC2-
Table 1.Sequence of primers used to amplify the phloem-specific promoters and to detect the presence of nptII gene.
Promoter/gene
Name
Forward primer 53
Name
Reverse primer 53
AtSUC2
RSs1
rolC
RTBV
35S
nptII
AT-F
RSs1-F
RC-F
RTV-F
35S-F
NP-F
AAGCTTGCAAAATAGCACACCATTTATG
TCAAGCTTCAATCCACCAAATCAAAC
AAAGCTTAAAGTTGGCCCGCTATTG
AGGATCCTTTGACAAACCAAGAAAGTAAG
AAGCTTCGGATTCCATTGCCCAGC
ATCCATCATGGCTGATGCAATGCG
AT-R
RSs1-R
RC-R
RTV-R
35S-R
NP-R
AGGATCCTTTGACAAACCAAGAAAGTAAG
AGGATCCCATGACTCAATTTCAGGAAC
TAGGATCCGTTAACAAAGTAGGAAACAGG
AGATCTTGCTCTCTTAGAAGTTTGAGC
CCCTCTAGACCATGGTGGAAGTATTTGA
AACTCGTCAAGAAGGCGATAGAAGGC
954
1931
882
770
650
450
Figure 1.Schematic representation of the T-DNA region of the binary vectors used in this study. The binary vector contained a gus gene driven by
one of the test phloem-specific promoters. The T-DNA also contained nptII as a selectable marker gene driven by the NOS promoter. The arrow
indicates the unique EcoRI site. The control vector contains a fusion gus-nptII gene driven by a 35S promoter (pBI434).
well-rooted shoots were transferred into a peat-based commercial potting medium (Metromix 500, Sun Gro Horticulture,
Bellevue, WA, USA) and acclimated to greenhouse conditions.
86 Dutt etal.
concentration of each sample was adjusted to 500ngml1 and
quality checked by agarose gel electrophoresis. Reverse transcription real-time PCR (RT-qPCR) assay was designed using
the PrimerQuestSM online software (Integrated DNA Technologies
Inc., Coralville, IA, USA) to detect the gus gene. The probe was
labeled at the 5 end with FAM (6-carboxy-fluorescein) reporter
dye and at the 3 end with Black Hole Quencher (BHQ)-1.
The cytochrome oxidase gene (cox) (GenBank accession number CX297817) primers and probe designed by Li etal. (2006)
were used to quantify mRNA from citrus as an internal standard.
The cox probe was labeled at the 5 end with JOE (2,7 dimethoxy-4,5-dichloro-6-carboxyfluorescein) reporter dye and at
the 3 end with BHQ-2. All primers and probes were synthesized
by Integrated DNA Technologies Inc. The sequences of primers
and probes including the reporter fluorescent dye and the dark
quencher dye are shown in Table 2. Different concentrations of
primers and probes were tested and optimized. Total RNA from
each sample was used in 10-fold serial dilutions for optimization
and standardization. Initially, simplex PCR was performed with
the target gene alone, but subsequently the internal control cox
gene was combined and optimized in a single assay. Reverse
transcription real-time PCR reactions were performed with a final
volume of 20l using the TaqMan RNA-to-CtTM one-step kit
(Applied Biosystems, Foster City, CA, USA) according to the
manufacturers instructions. The one-step kit parameters consisted of 20min incubation at 48 C followed by 10min incubation at 95C and 40 cycles at 95C for 15s and 60C for
1min. Each RT-qPCR contained negative and non-template/water
controls in addition to the sample being tested. Experimental
sample no. 7 (a non-transgenic greenhouse plant sample) was
used as a calibrator sample. Experiments were repeated at least
twice with two replicates, and data were analyzed using Applied
Biosystems software Version 1.4.0. Relative quantitation was
measured using the comparative Cq method also referred to as
the 2Ct. The fold change in the relative expression was then
determined by calculating 2Ct (Livak and Schmittgen, 2001).
87
cox
69
ACCTCGCATTACCCTTACGCTGAA
FAM- AGATGCTCGACTGGGCAGATGAACAT -BHQ1
GCCGACAGCAGCAGTTTCATCAAT
GTATGCCACGTCGCATTCCAGA
JOE-ATCCAGATGCTTACGCTGG-BHQ2
GCCAAAACTGCTAAGGGCATTC
4-chloro-3 indolyl--d-glucuronide) dissolved in dimethyl sulfoxide was added at a final concentration of 1mgml1 in a phosphate
buffer solution (200mM NaH2P04, pH. 7.0; 10mM EDTA and
0.2% triton X-100). Vacuum infiltration of explants was carried
out for 5min in this solution before being incubated in the dark at
37C overnight. After incubation, explants were de-stained in
ethanol:acetic acid (3:1) for 12h to eliminate background chlorophylls and other pigments present in stained tissues. A quantitative fluorometric GUS assay was performed as outlined in the
FluorAce -Glucuronidase Reporter Assay Kit (Bio-Rad
Laboratories, Hercules, CA, USA). Approximately 2040g of
total protein obtained from leaf petioles was added to 500l of
assay buffer. Samples were incubated in a 37C water bath for
30min before the reaction was terminated by the addition of 1x
stop buffer. Total soluble protein of each sample was determined
using the Coomassie (Bradford) Protein Assay Kit (Fisher
Scientific Inc., Pittsburg, PA, USA). Relative GUS activity was calculated relative to the amount of total protein and reaction time
period and expressed in pmol MU/mg protein/min.
Results
Production of transgenic plants
Agrobacterium-mediated transformation of Mexican lime epicotyl explants resulted in the production of a large number of
putative kanamycin-resistant transgenic plants. There was no
difference in ability to regenerate shoots following co-
cultivation and incubation with any of the vectors. In order to
confirm development of non-chimeric transgenic plants, shoots
were excised from epicotyl segments, bases were cut off and
transferred into RMG medium. Most shoots could be transferred into RMM medium within 4 weeks of transfer to RMG. It
was necessary to subculture several transgenic shoots twice
into fresh RMM medium before they could root and be trans-
Figure 2.Amplification products obtained from duplex PCR of transgenic Mexican lime genomic DNA with promoter-specific oligonucleotide primers as outlined in Table 1. A fragment of the nptII gene (450bp) was also amplified. M, 1kb marker; 14 are four individual transgenic lines containing the RSs1 promoter; 58 are four individual transgenic lines containing the AtSUC2 promoter; 912 are four individual transgenic lines
containing the RTBV promoter; 1316 are four individual transgenic lines containing the rolC promoter.
Figure 3.Southern hybridization analysis of total DNA of transgenic Mexican lime lines transformed with one of the four phloem-specific promoters. (a) AtSUC2, (b) RSs1, (c) rolC and (d) RTBV. The * indicates a line with single copy number.
88 Dutt etal.
Initially, primer evaluations and standardizations were performed by RT-qPCR with SYBR Green I dye (data not shown)
and then TaqMan RT-qPCR was performed as duplex reactions.
The optimized concentration of primers (300nM each both forward and reverse) and probe (150nM) provided good results
for the target gene. The internal control gene (cox) was optimized with primers (300nM each both forward and reverse)
and probe (150nM). No non-specific or cross-reaction/
amplification of targets was observed, and only targeted regions
of the gene were amplified by the duplex reactions. No signal
was detected using total RNA from healthy non-transgenic control plants or from a non-template control/water sample.
Using the 2Ct Ct method (Livak and Schmittgen 2001),
overall relative quantification level was highest (upregulated) in
plants expressing a gus gene driven by the 35S promoter followed by RTBV, rolC, AtSUC2 and RSs1. The relative quantification of the specific promoter varied among the individual lines
tested. The 35S and RTBV promoters had above log103.3 (relative quantification) and other promoters had log103.2 or below.
All promoters consistently expressed above log102.6. The cox
gene served as a good endogenous reference and was
expressed and detected consistently. The internal reference
gene measured 0 on a log10 scale. A greenhouse healthy control plant sample was used as a calibrator sample. Results are
shown in the graph/table by specific promoter (Figure 7).
Northern blot was essentially performed to confirm relative levels of promoter-driven gus expression in different tissues of
transgenic Mexican lime plants in selected single copy transgenic plants obtained from each construct. We analyzed vascular leaf tissues and roots of greenhouse-derived plants in
order to evaluate expression levels. Blots were also probed
with a fragment of the cox gene. The cox gene served as a
loading control for amount of total RNA. Good expression levels were observed in leaf vascular tissues (Figure 8). gus
expression in roots was different from that observed in leaves.
Expression levels were relatively lower in roots with the exception of the rolC construct (Figure 9). As observed earlier using
fluorometric analysis, plants containing the RSs1-gus construct
had the lowest mRNA expression levels among all promoters
evaluated.
Discussion
similar in leaves and stem. GUS activity in roots followed a
different trend. Plants transformed with pCAM-rolC had relatively higher GUS activity than pCAM-RTBV while others
lower.
Figure 6.Fluorometric assay for relative GUS activity in fully expanded leaves of greenhouse grown Mexican lime plants. Midrib and petioles were
used for sampling after 1 year of transfer to the greenhouse. Vertical lines represent standard errors. pC2300: transgenic plants containing a nptII
cassette; pCAM-AtSUC: transgenic plants expressing GUS under control of the AtSUC2 promoter; pCAM-RSs1: transgenic plants expressing GUS
under control of the RSs1 promoter; pCAM-rolC: transgenic plants expressing GUS under control of the rolC promoter; pCAM-RTBV: transgenic
plants expressing GUS under control of the RTBV promoter; pBI434: transgenic plants expressing GUS under control of the 35S promoter.
Table 3.Relative GUS activity in stems, roots and leaves of transgenic
Mexican lime. GUS activity from individual promoter-gus constructs
isexpressed as a percentage of mean relative GUS activity from
RTBV-GUS.
Promoter construct1
Leaves
Stem
Roots
pCAM-AtSUC2
pCAM-RSs1
pCAM-RolC
pCAM-RTBV
pBI434
283
103
517
100
1035
254
103
447
100
843
485
215
1262
100
1485
1All
constructs contain the gus gene driven by an individual test promoter. The construct pCAM-AtSUC contains the AtSUC2 promoter,
pCAM-RSs1 contains the RSs1 promoter, pCAM-rolC contains the rolC
promoter, pCAM-RTBV contains the RTBV promoter and pBI434 contains the 35S promoter.
90 Dutt etal.
Figure 7.Quantification of gus activity using RT-qPCR. Total RNA from Mexican lime leaf midrib and petioles was used as template. The
sequence of primers used to amplify the gus gene is detailed in Table 2. Four independent lines were tested from each construct. Lanes 14
areindividual transgenic lines containing the AtSUC2 promoter; 58 are four individual transgenic lines containing the RSs1 promoter; 912 are
four individual transgenic lines containing the rolC promoter; 1316 are four individual transgenic lines containing the RTBV promoter; 1720 are
four individual transgenic lines containing the 35S promoter. Lane 21 is the calibrator sample. Total RNA from a Mexican lime plant transformed
with pC2300 (lane 22) and a water sample (lane 23) was also included to verify the accuracy of the amplification process.
Acknowledgments
We thank Dr E. Etxeberria for providing us with facilities to
conduct GUS fluorometric analysis, Gary Barthe for excellent
technical assistance and Dr Roger Beachy for providing us with
the pMB1709 plasmid.
Funding
This work was partially supported by funds provided by the
Citrus Research and Development Foundation, Inc. (CRDF).
References
An, Y.Q., J.M. McDowell, S. Huang, E.C. McKinney, S. Chambliss and
R.B. Meagher. 1996. Strong, constitutive expression of the
Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. Plant J.
10:107121.
Benfey, R.N., L. Ren and N.H. Chua, 1989. The CaMV 35S enhancer contains at least two domains which can confer different developmental
and tissue-specific expression patterns. EMBO J. 8:21952202.
Bevan, M.W., R.B. Flavell and M.D. Chilton. 1983. A chimaeric antibiotic
resistance gene as a selectable marker for plant cell transformation.
Nature 304:184187.
Bhattacharyya-Pakrasi, M., J. Peng, J.S. Elmer, G. Laco, P. Shen, M.B.
Kaniewska, H. Kononowicz, F. Wen, T.K. Hodges and R.N. Beachy.
1993. Specificity of a promoter from the rice tungro bacilliform virus
for expression in phloem tissues. Plant J. 4:7179.
Burrow, M.D., C.A. Chlan, P. Sen and N. Murai. 1990. High frequency
generation of transgenic tobacco plants after modified leaf disk cocultivation with Agrobacterium tumefaciens. Plant Mol. Biol. Rep.
8:124139.
Chung, K.R. and R.H. Brlansky. 2009. Citrus diseases exotic to Florida:
Huanglongbing (Citrus Greening) Fact Sheet PP-210. http://edis.
ifas.ufl.edu/pp133.
Datla, R.S.S., J.K. Hammerlindl, L.E. Pelcher, W.L. Crosby and
G.Selvaraj. 1991. A bifunctional fusion between beta-glucuronidase
and neomycin phosphotransferase: a broad-spectrum marker
enzyme for plants. Gene 101:239246.
Dinant, S., A.M. Clark, Y. Zhu, F. Vilaine, J.C. Palauqui, C. Kusiak and
G.A.Thompson. 2003. Diversity of the superfamily of phloem lectins (phloem protein 2) in angiosperms. Plant Physiol.
131:114128.
Dinant, S., Ripoll, C., Pieper, M. and C. David. 2004. Phloem specific
expression driven by wheat dwarf geminivirus V-sense promoter in
transgenic dicotyledonous species. Physiol. Plant. 121:108116.
DiRita, V.J. and S.B. Gelvin. 1987. Deletion analysis of the mannopine
synthase gene promoter in sunflower crown gall tumors and
Agrobacterium tumefaciens. Mol. Gen. Genet. 207:233241.
Domnguez, A., M. Cervera, R.M. Prez, J. Romero, C. Fagoaga, J.
Cubero, M.M. Lpez, J.A. Jurez, L. Navarro and L. Pea. 2004.
Characterization of regenerants obtained under selective conditions
after Agrobacterium-mediated transformation of citrus explants
reveals production of silenced and chimeric plants at unexpected
high frequencies. Mol. Breeding 14:171183.
Dutt, M. and J.W. Grosser. 2009. Evaluation of parameters affecting
Agrobacterium-mediated transformation of citrus. Plant Cell Tiss.
Organ Cult. 98:331340.
Dutt, M., M. Vasconcellos and J.W. Grosser, 2011. Effects of antioxidants on Agrobacterium-mediated transformation and accelerated
production of transgenic plants of Mexican lime (Citrus aurantifolia
Swingle). Plant Cell Tiss. Organ Cult. 107:7989.
Glick, B.R. 1995. Metabolic load and heterologous gene expression.
Biotech. Adv. 13:247261.
Guo, H., X. Chen, H. Zhang, R. Fang, Z. Yuan, Z. Zhang and Y. Tian.
2004. Characterization and activity enhancement of the phloemspecific pumpkin PP2 gene promoter. Transgenic Res.
13:559566.
Hauptmann, R.M., M. Ashraf, V. Vasil, L.C. Hannah, I.K. Vasil and R.
Ferl. 1988. Promoter strength comparisons of maize shrunken I and
92 Dutt etal.
alcohol dehydrogenase I and 2 promoters in mono- and dicotyledonous species. Plant Physiol. 88:10631066.
Hawker, J.S. and M.D. Hatch. 1965. Mechanism of sugar storage by
mature stem tissue of sugarcane. Physiol. Plant. 18:444453.
Hood, E.E., S.B. Gelvin, L.S. Melchers and A. Hoekema. 1993. New
Agrobacterium helper plasmids for gene transfer to plants.
Transgenic Res. 2:208218.
Imlau, A., E. Truernit and N. Sauer. 1999. Cell-to-cell and long-distance
trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell
11:309322.
Jefferson, R.A. 1989. The GUS reporter gene system. Nature
342:837838.
Jiang, H., H.M. Qin, H.M. Yu and Y.C. Tian. 1999. Cloning and function
of the phloem protein gene promoter from Cucurbita maxima. J.
Agric. Biotechnol. 7:6368.
Jordan, M.C. and A. McHughen. 1988. Transformed callus does not
necessarily regenerate transformed shoots. Plant Cell Rep.
7:285287.
Jorgensen, R.A., P.D. Cluster, J. English, Q. Que and C.A. Napoli. 1996.
Chalcone synthase cosuppression phenotypes in petunia flowers:
comparison of sense vs. antisense constructs and singlecopy vs.
complex T-DNA sequences. Plant Mol. Biol. 31:957973.
Lam, E., and N.H. Chua. 1989. ASF-2: a factor that binds to the cauliflower mosaic virus 355 promoter and a conserved GATA motif in
Cab promoters. Plant Cell 1:11471156.
Li, W., J.S. Hartung and L. Levy. 2006. Quantitative real-time PCR for
detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. J. Microbiol. Methods 66:104115.
Livak, K.J. and T.D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2Ct method.
Methods 25:402408.
Maiti, I.B., S. Gowda, J. Kiernan, S.K. Ghosh and R.J. Shepherd. 1997.
Promoter/leader deletion analysis and plant expression vectors with
the figwort mosaic virus (FMV) full length transcript (FLt) promoter
containing single or double enhancer domains. Transgenic Res.
6:143156.
Manjunath, K.L., S.E. Halbert, C. Ramadugu, S. Webb and R.F. Lee.
2008. Detection of Candidatus Liberibacter asiaticus in Diaphorina
citri and its importance in the management of citrus huanglongbing
in Florida. Phytopathology 98:387396.
Medberry, S.L., B. Lockhart and N.E. Olszewski. 1992. The commelina
yellow mottle virus promoter is a strong promoter in vascular and
reproductive tissues. Plant Cell 4:185192.
Mitic, N., R. Nikolic, S. Ninkovic, J. Milju-Djukic and M. Nekovic. 2004.
Agrobacterium-mediated transformation and plant regeneration of
Triticum aestivum L. Biol. Plant. 48:179184.
Murashige, T. and F. Skoog. 1962. A revised medium for rapid growth and
bioassay with tobacco tissue cultures. Physiol. Plant. 15:473497.
Nagaya, S., K. Kato, Y. Ninomiya, R. Horie, M. Sekine, K. Yoshida and A.
Shinmyo. 2005. Expression of randomly integrated single complete
copy transgenes does not vary in Arabidopsis thaliana. Plant Cell
Physiol. 46:438444.
Nolte, K.D. and K.E. Koch 1993. Companion-cell specific localization of
sucrose synthase in zones of phloem loading and unloading. Plant
Physiol. 101:899905.
Odell, J.T., F. Nagy and N.H. Chua. 1985. Identification of DNA
sequences required for activity of the cauliflower mosaic virus 35S
promoter. Nature 313:810812.
Pena, L., M. Cervera, J. Jurez, C. Ortega, J. Pina, N. Durn-Vila and
L.Navarro. 1995. High efficiency Agrobacterium-mediated transformation and regeneration of citrus. Plant Sci. 104:183191.
Rohde, W., D. Becker and J.W. Randles. 1995. The promoter of coconut
foliar decay-associated circular single-stranded DNA directs