Está en la página 1de 6

Colegio de los Sagrados Corazones (Padres Franceses)

Departamento de Ciencias
Desde el Corazn Promovemos la Excelencia

GENTICA MOLECULAR Y PROTEINAS


I. El flujo de la informacin gnica
En los aos veinte se encontr una molcula similar al ADN,
tambin un cido nucleico, que tena unidades similares pero con
diferencias en el azcar y en una de sus bases nitrogenadas, que se
llam cido ribonucleico (ARN). Esta molcula apareca en mayor
concentracin en aquellas clulas que mostraban una alta actividad de
sntesis de protenas. Lo interesante del ARN era que a diferencia del
ADN exclusivamente nuclear, pareca encontrarse tanto en el ncleo
como en el citoplasma de la clula. Teniendo presente que las protenas
se sintetizan justamente en el citoplasma, se postul que podra servir de
mediador entre el ADN y la sntesis proteica. En base a esta hiptesis,
un grupo de investigadores ide un experimento que aprovecha la
composicin particular que tiene el ARN: en vez de la base nitrogenada
timina, posee uracilo.
En el experimento se incubaron clulas con uracilo marcado
radiactivamente con tritio (un istopo del hidrgeno) durante 60 minutos,
lo que se llama "un pulso". Luego de retirar el nucletido radiactivo, se
reemplaz con uracilo normal, incubando por dos horas ms. Las clulas
se observaron mediante autoradiografa, una tcnica que permite
localizar marcas radiactivas, en dos momentos: inmediatamente tras el

Figura 1

pulso radiactivo y luego de las dos horas de incubacin con los nucletidos
normales. En la figura 1 se muestran los resultados.
Tal como muestran las autoradiografas, el uracilo (y por tanto el ARN)
migra desde el ncleo hacia el citoplasma. Con esto se confirma la posibilidad que
el ARN sirve de intermediario entre el gen del ADN y la sntesis de protenas. Con
posterioridad, a esta molcula se le llam ARN mensajero o ARNm.
De esta manera, el flujo de la informacin gnica se podra representar de
la siguiente manera:
Figura 2. El modelo de la accin gnica: el dogma central de la biologa molecular:
El ADN contiene la informacin gentica en forma de un cdigo de cuatro letras
(A,T,G,C)
Un tipo de cido ribonucieico llamado ARN mensajero toma esta informacin de la
molcula
de ADN (transcripcin) y la transporta hasta los ribosomas. C. En estos organelos
el mensaje portado por el ARN mensajero es
traducido expresndose en forma de polipptidos
(traduccin).
El modelo de la accin gnica,
esquematizado en la figura 2, llamado el dogma central de la biologa molecular, contiene varias ideas
importantes que es necesario subrayar.

El ADN controla el fenotipo de cada individuo a travs de la formacin de protenas que actan
desencadenando las reacciones bioqumicas propias de la especie a la que pertenece el ADN.
La formacin de determinada protena implica la ordenacin de los aminocidos que la constituyen
en una secuencia determinada.
La informacin codificada en la molcula de ADN se transmite al ARN mensajero (transcripcin) que
la lleva al sitio de sntesis proteicas (ribosomas).
Una vez en los ribosomas, el cdigo es traducido fielmente, formndose la protena indicada
(traduccin).
Observa cuidadosamente la figura 3 que seguramente te resulta familiar. Ella te permitir relacionar
el proceso de transcripcin y traduccin con las estructuras celulares en que ocurren (temas tratados
en 2 medio).

ARN
m

Figura 3

Transcripcin del cdigo

Conocido el flujo de la informacin gnica, explicaremos ahora cmo de produce el proceso de transcripcin ADN  ARN y
luego cmo el ARN es ledo para fabricar protenas especficas.

La formacin del ARNm, a partir de la molcula de ADN, empieza cuando sta se abre y, sobre una de las dos bandas, se va
construyendo la barra nica del ARNm. Este proceso de transcripcin est catalizado por una enzima, la ARN polimerasa y empieza
precisamente cuando esta enzima se
combina con una porcin de la
molcula de ADN conocida como
promotor.
Luego continua con el
"apareamiento"
de
las
bases
complementarias: guanina con citosina;
adenina con timina; y uracilo frente a
adenina. El producto de la transcripcin
es el ARNm que deja el ncleo y
transporta la informacin al citoplasma,
especficamente, a los ribosomas
donde tiene lugar a traduccin del
cdigo.
Figura 4. Transcripcin
Traduccin del cdigo
En 1908, el mdico ingls sir Archibald Garrod dict una serie de conferencias en las que estableca un nuevo concepto de las
enfermedades humanas que denomin "errores innatos del metabolismo". Se adelant en casi medio siglo al postular que ciertas
enfermedades, debido a la incapacidad del organismo para realizar determinados procesos qumicos, son hereditarias.
Garrod estudi la enfermedad llamada alcaptonuria; en ella los enfermos excretan un compuesto llamado cido homogentsico
que vuelve oscura a la orina. Este compuesto puede generar problemas visuales y artritis. Garrod supuso que las vctimas de esta
enfermedad excretaban esta sustancia debido a que la reaccin enzimtica necesaria para transformarla estaba bloqueada. El doctor
Garrod fue el primero en sugerir que los genes y las enzimas estaban relacionados y, por lo tanto, que los genes estaban ligados a las
reacciones qumicas del organismo.
En la dcada 1940-1950, G.W. Beadle y E.L. Tatum de la Stanford University, en California, trataron esporas de un hongo
Neurospora con rayos X o rayos ultravioleta para ver si las esporas expuestas a la accin de estos agentes haban mutado de algn
modo. Estos investigadores mostraron particular inters por comprobar si la capacidad de sintetizar sustancias haba sufrido alteracin.
Sobre la base de los resultados experimentales, Beadle y Tatum
propusieron la teora "un gen - una enzima", conocida en la actualidad como
teora "un gen - un polipptido". Esta postula que los genes ejercen su accin
controlando la formacin de polipptidos.
Al considerar la accin gnica que controla el fenotipo de los
individuos segn los descubrimientos mencionados, conviene preguntarse de
qu manera el ADN controla y regula la sntesis proteica.
Para abordar esta pregunta es necesario recordar los siguientes
hechos:
a) Las protenas son molculas que desempean mltiples y tiles funciones
en nuestro organismo. Son necesarias para el crecimiento y reparacin
de tejidos daados, incluyendo la cicatrizacin de heridas, reparacin de
la piel y elaboracin de anticuerpos. Las protenas son importantes
componentes de todas las membranas celulares y funcionan como
molculas transportadoras y receptoras. Otras protenas, fuera de la
clula, como el colgeno y la elastina, proporcionan al tejido conjuntiva su
resistencia, ayudando as a soportar todo el cuerpo. Un grupo amplio e
importante de protenas acta como enzimas, algunas de las cuales
funcionan extracelularmente, en tanto que muchas otras actan en el
Figura 5. Modelos 3D de cuatro protenas
interior de las clulas.
b) Las protenas son molculas complejas compuestas por secuencias determinadas de aminocidos. Existe una veintena de
aminocidos que pueden combinarse en innumerables formas, constituyendo protenas de variada estructura (Ver figura 5)
c) Los genes controlan la sntesis de protenas. Qu es exactamente un gen? Un gen es un segmento de una molcula de ADN que
lleva la informacin gentica codificada para la sntesis de una protena particular.
d) Un gen debe portar un cdigo para que se puedan unir ciertos aminocidos en una secuencia determinada.
Un cdigo es un sistema de smbolos utilizados para transferir informacin de una forma a otra. El lenguaje escrito es un tipo de
cdigo inventado por el hombre para expresar ideas y comunicarse entre s. Nuestro abecedario consta de 28 smbolos, que son las
letras; con ellas se pueden formar muchas palabras, simplemente, combinndolas. Evidentemente, cualquier persona que desconozca el
cdigo representado por el abecedario del idioma castellano es incapaz de interpretarlo.
La mayor parte de las palabras se forman con 2 ms letras. Por ejemplo pala, casa, casado, ramo. Palabras diferentes se
pueden construir a partir de las mismas letras con una simple reordenacin. As tenemos: pala/lapa, casa/saca, casado/sacado,
ramo/amor.
El trabajo realizado para descifrar el cdigo gentico ha sido uno de los captulos ms interesantes en la historia de la
investigacin biolgica. En 1961, Marshall W. Nirenberg y J. Heinrich Matthaei que investigaban en el Instituto Nacional de Salud de
Bethesda, Mariland, realizaron exitosamente los primeros experimentos tendientes a averiguar qu secuencia de bases codifican cada
uno de los 20 aminocidos.
El problema de fondo con la sntesis de protenas es que se trata de construir secuencias de polmeros de 20 tipos de
aminocidos distintos a partir de un plano entregado por el ARNm que posee secuencias de slo 4 tipos de bases nitrogenadas.

Evidentemente no puede existir una relacin uno a uno entre bases nitrogenadas y aminocidos, sencillamente porque slo hay
4 bases para 20 aminocidos. Si, por el contrario, la "traduccin" se hiciera a partir de pares de bases nitrogenadas, las combinaciones
posibles seran: AA, AT, AC, AG, TT, TA, TC, TG, CC, CT, CA, CG, GG, GT, GA, GC = 16 combinaciones. Es decir, tampoco sera posible
pues an sera necesario traducir otros 4 aminocidos.
Finalmente, si se usan tros o tripletes de bases nitrogenadas, como
por ejemplo, AAA, ATC, CGT, etc. las combinaciones posibles sobrepasan
ampliamente los 20 aminocidos que debe codificarse.
En efecto, los 20 aminocidos estn representados en el cdigo
gentico por la agrupacin de tres letras (triplete) de las cuatro existentes. Si
uno considera las posibilidades de arreglo de cuatro letras agrupadas de a tres
resulta que tenemos 64 posibilidades de palabras a codificar, o 64 posibles
codones (secuencias de tres bases en el ARNm que codifica para un
aminocido especfico o una secuencia de control).
El cdigo gentico se descubri en base a experimentos como el
siguiente.
Figura 6
Se fabric un ARNm construdo exclusivamente con guaninas, el que se "puso a trabajar" en un sistema de sntesis de protenas
in vitro. En la medida que las guaninas eran "ledas", se formaron polmeros de aminocidos o polipptidos formados exclusivamente por
el aminocidos leucina. Es decir, si el codon posee tres guaninas, el cdigo apunta "leucina" y lee el siguiente codon. Con distintas
combinaciones de bases en ARNm sintticos, fue posible conocer el
cdigo completo. (figura 6)
En la tabla de la figura 7 se resume el cdigo que permite
traducir los codones en aminocidos.
En la traduccin del cdigo, es decir, en el proceso mismo de
la sntesis proteica, interviene una variedad de sustancias y organelos:
ribosomas, ARNm, ARN de transferencia (ARNt), nucletidos del medio y
adems, una serie de protenas y enzimas citoplsmicas.
El ARNt es una molcula de una barra, torcida sobre su eje
como una horquilla para el pelo. Al final de la molcula se encuentra un
triplete de bases de citosina y guanina. Es aqu donde acta una enzima
activante para enlazar el aminocido apropiado. La energa para la
unin del aminocido al ARNt proviene de la conversin de ATP
(adenosn-trifosfato) a AMP (adenosn-monofosfato). Es decir, es un

proceso que requiere energa.


En el extremo, el ARNt tiene tres bases no apareadas
(el anticodn).
Estas tres bases encajan en el triplete
complementario a lo largo del ARNm (el codn). As, por ejemplo,
un ARNt con triplete AGU encaja en el punto del ARNm donde se
encuentra la secuencia de las bases ACU. Un ARNt con un
triplete de bases ACU se orientar en la molcula de ARNm en el
lugar donde aparece el triplete AGU (figura 8)
Los ribosomas son los organelos citoplasmticos que
sirven de sustrato fsico para la traduccin, es decir, es "donde" se
produce la sntesis proteica. Cada ribosoma est formado por una
subunidad liviana y una pesada. La subunidad liviana tiene una
hebra de ARN ribosomal y 21 protenas diferentes. La subunidad
pesada consiste en dos hebras de ARN ribosomal y 34 protenas
Figura 8
diferentes. La subunidad liviana tiene el sitio para que se pegue el ARNm. Tiene un rol crucial en la decodificacin del ARNm pues
monitorea el apareamiento de bases entre el codn del ARNm y el anticodn de ARNt. La subunidad pesada tiene dos sitios para el ARNt.
Cataliza la formacin de la unin entre dos aminocidos contiguos (enlace peptdico).

Cabe sealar que tanto el ARNt como el ARNr tienen origen en genes especficos del ADN, por lo que ambos provienen del
ncleo, al igual que el ARNm. (figura 10)
De esta manera la secuencia
Figura 11. Traduccin del ARNm
de bases existentes en la molcula de
ARNm, originalmente determinada por
la secuencia de bases de la molcula
de ADN, determina el tipo de ARNt.
Por supuesto, esto representa una
seleccin indirecta del tipo de
aminocido que formar parte de la
cadena proteica.
A medida que el ribosoma se
mueve a lo largo de la molcula del
ARNm, el cdigo es ledo por las
molculas de ARNt, formndose una
cadena creciente de polipptidos;
cuando sta se completa, se libera.
(figura 11)

I.

Replicacin del ADN

El modelo propuesto para la


estructura de la molcula de ADN no
slo satisface las propiedades fsicas y
qumicas observadas de la molcula y
los procesos conducentes a la sntesis
de protenas. Tambin, como modelo
cientfico,
permite
explicar
la
autoduplicacin o replicacin normal
de la molcula, es decir, la formacin
de dos molculas idnticas de ADN a
partir de una. Cabe recordar que este
proceso resulta imprescindible para
que la clula pueda realizar mitosis y
ocurre durante la etapa S de la
interfase. De no existir una duplicacin
previa del ADN de la clula madre, al
momento de dividirse, cada clula hija
recibira slo la mitad del material
hereditario, lo que las hara inviables.
De esta manera, la perpetuacin de la
vida -va divisin celular- se debe a la
capacidad
del
ADN
para
autoduplicarse.
De acuerdo con el modelo de Watson
y Crick, la duplicacin del ADN comienza con la
separacin de la molcula en dos bandas
debido al rompimiento de los enlaces de
hidrgeno
que
unen
las
bases
complementarias. Una vez expuestas, las
bases de cada una de las mitades separadas
pueden atraer a los nucletidos libres
existentes en el medio. Cada citosina expuesta
se unir a un nucletido de guanina; cada
Figura 9. Modelos de ribosomas
Figura 10.
Los 3 tipos
de ARN

timina a un nucletido de adenina, etc.


De esta manera, resultan dos molculas hijas, cada una de las cuales est conformada por una barra parental y otra nueva.
Este modelo de replicacin o autoduplicacin de la molcula de ADN se conoce como "replicacin semiconservativa". (figura 9)
El conocimiento bioqumico actual sobre el proceso de replicacin de la molcula de ADN es, bsicamente, el propuesto por
Watson y Crick. Al igual que en todas las reacciones biolgicas se requieren enzimas especiales. Una de stas, la ADN polimerasa, une
a los nucletidos de la nueva cadena de ADN a lo largo del molde de la cadena vieja.
Junto con estas enzimas, en el proceso de replicacin del material gnico acta todo un complejo de protenas y otras enzimas
que desempean variadas funciones. Esto, sin mencionar los nucletidos de adenina (ATP), de guanina (GTP), etc. que aportan la
energa para el proceso.

II.

Alteraciones en la lectura

Tal como se seal, el modelo de ADN de


Watson y Crick sugiere que se forma una copia exacta de
esta molcula cada vez que se autoduplica. Sin embargo,
debido a "accidentes moleculares" se producen "errores"
en el mensaje gentico con su correspondiente expresin
anormal en el fenotipo.
Las variaciones en el mensaje hereditario
llevado por el ADN reciben el nombre de mutaciones;
stas pueden aparecer debido a cambios en un gen segmento de la molcula de ADN- o a cambios en el
nmero o en la estructura de los cromosomas. Se habla
entonces de mutacin gnica y mutacin cromosmica.
Un gen puede resultar alterado por una
reordenacin accidental de las bases nitrogenadas que
constituyen el mensaje. Una analoga puede explicar esto:
la palabra 'tren" tiene un significado claro para todo el
mundo de habla hispana. Cuando t vez esta palabra la
interpretas correctamente. Supn ahora que se produce
una reordenain de letras que conforman esta palabra de
modo que resulta "en rt". Claramente, esto no tiene
ningn significado y no podemos interpretarlo. La
mutacin gnica tamin puede resultar por sustraccin o
adicin de una base del cdigo. Volviendo a nuestro
ejemplo, si a la palabra "tren" se quita la letra "t" o se le
agrega la letra "a" resultan palabras carentes de
significado.
Lo mismo sucede con el cdigo gentico; la
reordenacin de las bases nitrogenaas, la prdida o
ganancia de un nucletidos, la prdida o ganancia de un
triplete de bases alteran el cdigo gentico y la clula es
incapaz de interpretar el mensaje alterado. Esto significa
que no se producir la o las protenas de accin
enzimtica correspondientes, por lo cual la secuencia de
reacciones bioqumicas no se producirn, resultando un
individuo anormal.
Una cadena "mutante" del ADN puede diferenciarse de la cadena normal por un slo nucletido. Sin embargo, este pequeo cambio en
el mensaje hereditario tiene un efecto en la clula. Podra causar slo una pequea variacin en la estructura de una tena como una enzima.
Como resultado de este cambio podra verse afectada la actividad o la eficacia de esta enzima en la reaccin que cataliza.

Trabajo prctico 2: Sntesis de un pptido - la insulina


A partir de las instrucciones entregadas por el profesor acerca del plegamiento de protenas tras la sntesis de la cadena
aminoacdica y considerando la informacin contenida en esta gua, debers obtener la estructura de una molcula de INSULINA
(hormona relacionada con la regulacin de la glicemia) a partir de la secuencia simplificada de su gen.
Datos:
I. Gen de la insulina (ubicado en el cromosoma n 11)
Se han omitido las bases que originan tripletes de inicio y final
Los espacios disponibles bajo la secuencia son para anotar el cdigo del ARNm correspondiente (lnea superior), as como el orden de
los aminocidos (lnea inferior)

AAGCAGTTGGTTGTGGATACGCCGAGCGTGGATCAGCTCCGTGATATGGATCAGACGCCGCTCGCCCCG
________________________________________________________________________________________
________________________________________________________________________________________
AAGAAGATGTGTGGTTTCCGTTGTGCCGCCCTCCGTCTCCTGGATGTTCAGCCGGTTCAGCTCGATCCG
________________________________________________________________________________________
5

________________________________________________________________________________________
CCGCCGGGTCGTCCGAGCGATGTTGGTGATCGTGATCTCCCGAGCGATGTTTTCGCCCCGTATCAGCTC
________________________________________________________________________________________
________________________________________________________________________________________
GTTACGACGTGTAGCTAGACGAGCGATATGGTTGATC TCTTGATGACGTTG
________________________________________________________________________________________
________________________________________________________________________________________
II. Especificaciones de terminacin y plegamiento:
a)

Nmero de cadenas peptdicas independientes = 3, de las cuales slo dos terminan formando la insulina.
Cadena B: Fenilalanina 1 hasta Alanina 30
Cadena C: Treonina 1 hasta Arginina 35 (cadena que es cortada y perdida)
Cadena A: Glicina 1 hasta Asparagina 21

b)

Puentes dislfuro (entre cistenas):


Cys6 - Cys11 en la cadena A
Cys7 cadena A con Cys7 cadena B
Cys20 cadena A con Cys19 cadena B

c)

Nmero de segmentos que forman alfa-hlice = 3


Dos segmentos en la cadena A entre lo aminocidos Gly1 - Ile10, Ser12 - Glu17
Un segmento en la cadena B entre los aminocidos Ser 9 - Gly20
Tener presente que los aas hidrofbicos (Gly, Ala, Val, Leu, Ile, Trp, Pro, Met, Phe) se orientan hacia el interior de la protena,
mientras que los hidroflicos (Asn, Gln, Tyr, Cys, Ser, Thr) lo hacen hacia fuera

III. Especificaciones de diseo:

Los aminocidos pueden representarse como crculos u otro dibujo simple.


Cada cadena (A y B) debe representarse de un color distinto
Los 3 puentes dislfuro deben quedar destacados y las secuencias que forman hlices alfa pueden representarse como un espiral
simple
Es preferible realizar varios borradores hasta disear un modelo que cumpla con todas las especificaciones.
Basndose en el diseo REVISADO Y APROBADO por el profesor, construir un modelo 3D de la insulina, utilizando alambre,
plasticina y/o pelotitas de plumavit.

Anexo: Clasificacin y abreviaturas de los 20 aminocidos:


Polares
Con carga elctrica
No polares

Asparagina: Asn
cido asprtico: Asp
Glicina: Gly
Triptfano: Trp

Glutamina: Gln
cido glutmico: Glu
Alanina: Ala
Prolina: Pro

Tirosina: Tyr
Arginina: Arg
Valina: Val
Cistena: Cys

Serina: Ser
Lisina: Lys
Leucina: Leu
Metionina: Met

Treonina: Thr
Histidina: His
Isoleucina: Ile
Fenilalanina: Phe