Está en la página 1de 20

Ciencias Plan Electivo

Biologa
2008
Modelo del ADN
Replicacin del ADN
Ingeniera gentica
Gua Plan Electivo
BL11-1
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
2
CEPECH Preuniversitario, Edicin 2008
3
CEPECH Preuniversitario, Edicin 2008
2
CEPECH Preuniversitario, Edicin 2008
3
CEPECH Preuniversitario, Edicin 2008
2
CEPECH Preuniversitario, Edicin 2008
3
Introduccin
La presente gua tiene por objetivo proporcionarte distintas instancias didcticas relaciona-
das con el proceso de enseanza aprendizaje. Como cualquier otro material se requiere de
la mediacin del profesor y de tu estudio sistemtico.
Las guas del curso de Biologa estn organizadas de tal forma que primero se desarrollan
los contenidos, principalmente a travs de una invitacin a razonar los principales conceptos,
permitiendo un aprendizaje signicativo de stos. Para ello, nuestras guas muestran diversas
guras que estn asociadas a una serie de preguntas que permiten guiar la secuencia de la
clase. Finalmente, se presentan 10 preguntas de seleccin mltiple relacionadas con los con-
tenidos de la clase:
Estructura del ADN.
Replicacin del ADN.
Habilidades de la clase
Uno de los principales cambios que se producen con la PSU es el desarrollo de habilidades,
ms que el mero conocimiento. Con la cantidad de informacin que podemos acceder actual-
mente es necesario que el alumno sea capaz de construir su propio conocimiento y por ello
nuestra labor se centra en entregar las herramientas para que sea capaz autnomamente de
generar estas habilidades, las cuales se ordenan jerrquicamente:
Conocimiento: Se re ere a recordar informacin espec ca, datos, de niciones,
fechas, nombres, etc.
Comprensin: Se re ere a la habilidad de relacionar informacin, explicar con tus
propias palabras, identi car situaciones en otro contexto.
Aplicacin: Es la habilidad de usar la informacin, ideas o conceptos en situaciones
nuevas para resolver un problema o situacin.
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
2
CEPECH Preuniversitario, Edicin 2008
3
CEPECH Preuniversitario, Edicin 2008
2
CEPECH Preuniversitario, Edicin 2008
3
CEPECH Preuniversitario, Edicin 2008
2
CEPECH Preuniversitario, Edicin 2008
3
Anlisis: Es una habilidad superior que consiste en dividir un todo para descubrir
la relacin que se establece entre sus partes lo que determina la coherencia entre
ellas.
Los contenidos de esta clase los puedes encontrar en tu libro CEPECH entre las pginas 17
y 26.

Ideas fuerza


El ADN es la molcula que almacena la informacin gentica de los organismos.
La forma de organizacin del ADN responde al modelo enunciado por Watson y
Crick que en lo esencial plantea que se trata de una doble hebra, con direcciones de
crecimiento opuestas, donde las dos hebras se unen por puentes de hidrgeno de
manera complementaria.
El ADN se duplica o replica por el modelo semiconservativo, que signi ca que en las
hebras hijas la mitad de la informacin es original y la otra mitad nueva.
Aprovecha todas las instancias que te entregamos para que mejores tu aprendizaje. Tus progresos
pueden ser tan buenos como tu decidas que sean
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
4
CEPECH Preuniversitario, Edicin 2008
5
CEPECH Preuniversitario, Edicin 2008
4
CEPECH Preuniversitario, Edicin 2008
5
CEPECH Preuniversitario, Edicin 2008
4
CEPECH Preuniversitario, Edicin 2008
5
Modelo del ADN
El ADN (cido desoxirribonucleico) corresponde a una macromolcula de estructura com-
puesta. En ella concurren varios tipos de elementos que pasamos a revisar a continuacin. Para
ello completa con la palabra correspondiente las frases que aparecen a continuacin.
PURINAS
NH
2
N
N
N
C
C
C HC
CH
N
H
1
2
3
4
5
6
7
8
9
Adenina (A)
O
O
C
C
N
HN CH
CH
H
1
2
3
4
5
6
Uracilo (U)
PIRIMIDINAS
O
N
HN
N
C
C
C C
CH
N
H
1
2
3
4
5
6
7
8
9
Guanina (G)
H
2
N
O
O
C
C
N
HN C
CH
H
1
2
3
4
5
6
Timina (T)
CH
3
NH
2
O
C
C
N
N
CH
H
1
2
3
4
5
6
Citosina (C)
CH
Las bases nitrogenadas presentes en el
ADN se clasican en dos tipos: _____
_______ y __________. Las pricas
corresponden a la __________ (A)
y __________ (G), que se caracte-
rizan por la presencia de dos anillos
en su estructura. Las bases pirimdicas
corresponden a la __________ (C) y
la __________ (T) y se caracterizan
por la presencia de un solo anillo. Es
necesario mencionar que en el caso
del ARN la base timina es reemplazada
por __________ (U).
O
OH
H
H
H
H
H
OH
HOCH
2
desoxirribosa
La pentosa que forma parte del ADN es la __
________, que da la base del nombre para esta
molcula. El tomo de hidrgeno en la posicin
2 marca una diferencia importante con respecto
al ARN, ya que ste ltimo es una molcula ___
_______.
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
4
CEPECH Preuniversitario, Edicin 2008
5
CEPECH Preuniversitario, Edicin 2008
4
CEPECH Preuniversitario, Edicin 2008
5
CEPECH Preuniversitario, Edicin 2008
4
CEPECH Preuniversitario, Edicin 2008
5
En la estructura de los cidos nucleicos tambin participa un grupo fosfato, el cual es el mismo
para cualquier cido nucleico.
Los elementos anteriormente mencionados concurren a la formacin de los __________, las
unidades mnimas que permiten la organizacin de los cidos nucleicos.
A continuacin se presentan los cuatro nucletidos que forman el ADN.
Desoxiribosa
Nucletidos:
Fosfato
O
O O
O
P
5
CH
2
O
H H
H
H OH
4
1
2 3
H
N
N
N
N
NH
2
5
6
1
2
3
4
7
8
9
Adenina (A)
desoxiribosa
Fosfato
O
O O
O
P CH
2
O
H H
H
H OH
H
N
N
N
N
O
5
6
1
2
3
4
7
8
9
H
NH
2
Guanina (G)
Timina (T)
N
N
O
5
6
1
2
3
4
H
O
CH
3
H
O
H
H
H H
OH
O
O O
O
P CH
2
N
N
NH
2
5
6
1
2
3
4
O
H
Citocina (C)
desoxiribosa
Fosfato
O
O O
O
P CH
2
Fosfato
O
H H
H
H OH
Adenina:
Citosina:
Guanina:
Timina:
Desoxiribosa
El nombre que recibe un nucletido tiene relacin con la base nitrogenada que posee, ya que
ste es el nico elemento __________ dentro de l.
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
6
CEPECH Preuniversitario, Edicin 2008
7
CEPECH Preuniversitario, Edicin 2008
6
CEPECH Preuniversitario, Edicin 2008
7
CEPECH Preuniversitario, Edicin 2008
6
CEPECH Preuniversitario, Edicin 2008
7
Modelo de Watson y Crick
Este modelo tiene varias caractersticas.
Dos largas cadenas polinucleotdicas estn enrolladas
alrededor de un __________, formando una _____
_______________ hacia la derecha (dextrogira).
Las dos cadenas son __________, es decir, la orien-
tacin 5 a 3 va en sentidos contrarios.
Extremo 5 Extremo 3
A
T
C
G
A
T
Extremo 3
T
A
G
C
T
A
Extremo 5
cido fosfrico
Desoxirribosa
Base nitrogenada

Dimetro
Esqueleto
Azcar Fosfato
Eje Central
3,4 nm
20A
V
U
E
L
T
A

C
O
M
P
L
E
T
A
Las bases nitrogenadas de las dos cadenas yacen
formando estructuras planas y perpendiculares al
eje, estn apiladas unas sobre las otras, separadas
__________, y se encuentran en el interior de
la estructura.
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
6
CEPECH Preuniversitario, Edicin 2008
7
CEPECH Preuniversitario, Edicin 2008
6
CEPECH Preuniversitario, Edicin 2008
7
CEPECH Preuniversitario, Edicin 2008
6
CEPECH Preuniversitario, Edicin 2008
7
Las bases nitrogenadas de las cadenas opuestas estn apareadas como resultado de la formacin
de ____________________. En el ADN slo se permiten los emparejamientos __________
y __________.
G
C
3
G
C
C
G
A
T
G
C
A
T
T
A
G
C
A
A
T
C
3
5
5
A
T
C
T
G
C
G
G
Cada vuelta completa de la hlice tiene una longitud de 3,4 nm, de este modo cada vuelta de
la cadena contiene __________.
En cualquier segmento de la molcula, se observan un surco mayor y uno menor alternados
a lo largo del eje.
La doble hlice mide 2,0 nm de ancho.
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
8
CEPECH Preuniversitario, Edicin 2008
9
CEPECH Preuniversitario, Edicin 2008
8
CEPECH Preuniversitario, Edicin 2008
9
CEPECH Preuniversitario, Edicin 2008
8
CEPECH Preuniversitario, Edicin 2008
9
Replicacin del ADN
Helicasa

3
5
Direccin
general de la
replicacin
Topoisomerasas
Horquilla de
replicacin
Protenas de unin
a la cadena simple
ADN
polimerasa
ARN
primasa
ADN
ligasa
ADN
polimerasa
Cadena retrasada con
fragmentos de Okazaki
Cadena
adelantada
3
3
3
3
3
5
5
5
Cebador de
ARN
5
ARN
ADN
Fragmentos
de Okazaki

Cebador o
primer

La enzima __________ se encarga de desenrrollar el ADN aliviando la tensin del


superenrrollamiento. Esta accin es necesaria para que las enzimas puedan actuar sobre
el ADN y replicarlo.
Luego la enzima __________ contina con el desenrrollamiento y adems rompe
puentes de hidrgeno. La doble hebra se abre exponiendo los moldes, lo que se conoce
como ____________________.
Existen ______________________________ que son importantes para mantener
la estabilidad de la horquilla de replicacin.
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
8
CEPECH Preuniversitario, Edicin 2008
9
CEPECH Preuniversitario, Edicin 2008
8
CEPECH Preuniversitario, Edicin 2008
9
CEPECH Preuniversitario, Edicin 2008
8
CEPECH Preuniversitario, Edicin 2008
9
Las ADN polimerasas slo adicionan nucletidos sobre un fragmento previo de cido
nucleico, ya sea ADN o ARN, lo que se denomina __________ o __________. La
enzima responsable es __________.
Existen dos moldes para la sntesis de ADN, una hebra es de copia continua o _______
___ y la otra es discontinua o __________.
En la hebra de copia continua se agregan nucletidos por la actividad de la __________.
Esta misma enzima es capaz de corregir un error.
La hebra retrasada se sintetiza de una forma ms compleja. La ADN polimerasa agrega
nucletidos luego del cebador. Cuando la doble hebra se vuelve a abrir para exponer ms
del molde, se debe agregar un nuevo cebador y sintetizar el ADN correspondiente. Cada
segmento nuevo de ADN de la hebra retrasada se conoce como ________________
____________. A medida que avanza la copia de la hebra retrasada la ADN polimerasa
elimina los __________.
Los espacios que se generan en la hebra retrasada son unidos por la ___________.
Ingeniera gentica
A mediados de 1970 comienza una revolucin en biologa: la tecnologa del ADN recombinante.
Esta tcnica ha permitido realizar avances desde la biologa celular hasta la evolucin.
Se denomina ADN recombinante a las molculas de ADN producidas por la unin de seg-
mentos que provienen de diferentes fuentes biolgicas. Las tcnicas de construccin de ADN
recombinante se conocen como tcnicas de ingeniera gentica.
El desarrollo de esta tecnologa, que permite la obtencin de grandes cantidades de ADN que
codican para una protena especca, no slo ha facilitado la investigacin de la organizacin,
estructura y expresin gnica, sino que su aplicacin ha supuesto un espectacular avance en el
diagnstico de enfermedades metablicas e infecciosas y en la obtencin de frmacos y vacunas
recombinantes. En un futuro revolucionar el tratamiento de un gran nmero de enfermedades
mediante la terapia gnica.
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
10
CEPECH Preuniversitario, Edicin 2008
11
CEPECH Preuniversitario, Edicin 2008
10
CEPECH Preuniversitario, Edicin 2008
11
CEPECH Preuniversitario, Edicin 2008
10
CEPECH Preuniversitario, Edicin 2008
11
Existe una serie de pasos bsicos para la obtencin de ADN recombinante:
a. En primer lugar, se necesita disponer del fragmento de ADN a recombinar. ste se obtiene
de una fuente biolgica a travs de la utilizacin de ____________________ (enzimas que
cortan el ADN en sitios especcos conocidos).
+ Enzima de restriccin
5
3
5
3
5
3
3
5 5
3
3
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
10
CEPECH Preuniversitario, Edicin 2008
11
CEPECH Preuniversitario, Edicin 2008
10
CEPECH Preuniversitario, Edicin 2008
11
CEPECH Preuniversitario, Edicin 2008
10
CEPECH Preuniversitario, Edicin 2008
11
b. Una vez obtenido el fragmento, se inserta en otra molcula de ADN, que se denomina
__________, producindose as la molcula de ADN recombinante. Los vectores pueden
replicarse de manera autnoma en una clula hospedera, lo que permite la manipulacin y
multiplicacin de la nueva molcula de ADN recombinante construida.
un gen de inters
DNA de otro organismo
Ambos se tratan con enzima
de restriccin
Plsmido de una bacteria
Se mezcla, se permite que los
extremos complementarios se
apareen, y los extremos cortados
se unen con ligasa de DNA
(a)
(b)
(c)
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
12
CEPECH Preuniversitario, Edicin 2008
13
CEPECH Preuniversitario, Edicin 2008
12
CEPECH Preuniversitario, Edicin 2008
13
CEPECH Preuniversitario, Edicin 2008
12
CEPECH Preuniversitario, Edicin 2008
13
c. La molcula de ADN recombinante se transere a la clula hospedera, dentro de la cual se
replica intensamente, de tal forma que se generan numerosas copias, que se denominan
__________.
Fragmento 1 Fragmento 2
Fragmento 3 Fragmento 4
Sitios de escisin
Fragmento
de inters
Se corta con una enzima
de retriccin
Gen para resistencia
a antibitico
Las bacterias con el
plsmido viven y se
multiplican
Las bacterias sin el
plsmido no proliferan
Caja de Petri con el
medio que contiene
antibitico
(a)
(b)
(c)
DNA humano
d. Al replicarse las clulas hospederas, las clulas descendientes heredan el ADN recombi-
nante, crendose una poblacin de clulas idnticas, todas ellas portadoras de la secuencia
clonada. Las clulas ms usadas son las bacterianas.
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
12
CEPECH Preuniversitario, Edicin 2008
13
CEPECH Preuniversitario, Edicin 2008
12
CEPECH Preuniversitario, Edicin 2008
13
CEPECH Preuniversitario, Edicin 2008
12
CEPECH Preuniversitario, Edicin 2008
13
Preguntas propuestas
1. Qu protena es la encargada de romper los puentes de hidrgeno que unen las dos
hebras del ADN?
A) Topoisomerasa.
B) Primasa.
C) ADN polimerasa.
D) ARN polimerasa.
E) Helicasa.
2. La replicacin del ADN se dene como semiconservativa, lo que signica que
A) cuando se duplica el ADN, las hebras contienen slo ADN nuevo.
B) cuando el ADN se replica, el resultado es una mezcla desigual de ADN nuevo y
original.
C) luego de la replicacin, cada cadena de ADN contiene la mitad del ADN nuevo y
la otra mitad original.
D) cada cadena de ADN conserva completamente la informacin de la cadena origi-
nal.
E) cada cadena resultante sufre una dispersin con respecto a la cadena original.
3. En el modelo de ADN de Watson y Crick, las hebras se caracterizan porque
I. tienen una disposicin antiparalela.
II. se unen por puentes de hidrgeno entre las bases nitrogenadas.
III. se unen en forma exacta y complementaria.
A) Slo I
B) Slo II
C) Slo III
D) Slo I y II
E) I, II y III
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
14
CEPECH Preuniversitario, Edicin 2008
15
CEPECH Preuniversitario, Edicin 2008
14
CEPECH Preuniversitario, Edicin 2008
15
CEPECH Preuniversitario, Edicin 2008
14
CEPECH Preuniversitario, Edicin 2008
15
4. Qu cambio(s) debe(n) ocurrir para que el ADN se pueda replicar?
I. La doble hebra se debe desenrollar.
II. Se deben romper los puentes de hidrgeno.
III. El ADN se debe encontrar en el estado de cromatina.
A) Slo I
B) Slo II
C) Slo III
D) Slo I y II
E) I, II y III
5. Qu condiciones se deben cumplir para que ocurra replicacin del ADN?
I. Nucletidos libres.
II. Cebadores sobre los moldes de ADN.
III. Presencia de horquilla de replicacin.
A) Slo I
B) Slo II
C) Slo I y II
D) Slo I y III
E) I, II y III
6. En el marco de la ingeniera gentica las enzimas de restriccin tienen como obje-
tivo
A) generar copias de los fragmentos de ADN a recombinar.
B) cortar un segmento de ADN para recombinar.
C) unir segmentos de ADN a recombinar con ADN del vector.
D) degradar copias defectuosas de ADN recombinante.
E) limitar el nmero de copias que se hacen del ADN a recombinar.
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
14
CEPECH Preuniversitario, Edicin 2008
15
CEPECH Preuniversitario, Edicin 2008
14
CEPECH Preuniversitario, Edicin 2008
15
CEPECH Preuniversitario, Edicin 2008
14
CEPECH Preuniversitario, Edicin 2008
15
7. En cul de las siguientes situaciones se debe aplicar una mayor cantidad de energa para
separar las hebras del ADN?
A) 75% pares de bases AT y 25% pares de bases GC.
B) 50% pares de bases AT y 50% pares de bases GC.
C) 25% pares de bases AT y 75% pares de bases GC.
D) 80% pares de bases AT y 20% pares de bases GC.
E) 60% pares de bases AT y 40% pares de bases GC.
8. Qu pareja(s) de conceptos est(n) incorrectamente combinada(s)?
I. Pares de bases complementarias = adenina y citosina.
II. Bases = adenina, timina, citosina y guanina.
III. Cromosoma eucaritico = ADN y protenas.
A) Slo I
B) Slo II
C) Slo III
D) Slo I y II
E) Slo II y III
9. El uso de la terapia gnica en el futuro apuntar a
I. la ubicacin de genes defectuosos para reemplazarlos por los normales.
II. la identicacin de enfermedades genticas en personas que an no las hayan
desarrollado.
III. prevenir el desarrollo de enfermedades genticas.
A) Slo I
B) Slo II
C) Slo I y II
D) Slo II y III
E) I, II y III
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
16
CEPECH Preuniversitario, Edicin 2008
17
CEPECH Preuniversitario, Edicin 2008
16
CEPECH Preuniversitario, Edicin 2008
17
CEPECH Preuniversitario, Edicin 2008
16
CEPECH Preuniversitario, Edicin 2008
17
10. El proceso de replicacin semiconservativa se reere a que
A) cada nueva molcula de ADN contiene dos nuevas cadenas individuales de ADN
B) las enzimas encargadas de la sntesis de ADN utilizan nucletidos libres para
realizar la sntesis.
C) algunas bases nitrogenadas se aparean con bases nitrogenadas especcas.
D) cada una de las hebras de la cadena de ADN sirve de molde para formar una
cadena nueva.
E) se producen errores durante la replicacin de ADN.
Pregunta Alternativa Habilidad
1 Comprensin
2 Comprensin
3 Conocimiento
4 Comprensin
5 Comprensin
6 Comprensin
7 Aplicacin
8 Comprensin
9 Conocimiento
10 Comprensin
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
16
CEPECH Preuniversitario, Edicin 2008
17
CEPECH Preuniversitario, Edicin 2008
16
CEPECH Preuniversitario, Edicin 2008
17
CEPECH Preuniversitario, Edicin 2008
16
CEPECH Preuniversitario, Edicin 2008
17
Ampla tus conocimientos
De acuerdo con lo que has aprendido y lo que plantea tu libro de biologa, responde las
siguientes preguntas.
1. Cmo se descubri que los genes estn compuestos de ADN?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
2. Investiga en qu consiste el experimento de Avery.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
3. De qu forma el proceso de replicacin del ADN asegura la constancia gentica?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
4. A partir de la siguiente secuencia de ADN, determine la secuencia de la hebra de ADN
hermana y la secuencia del ARNm
5` CTGCCATTGTCACAGATACCGGATTAGGCCTAAAGCCC 3`
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
18
CEPECH Preuniversitario, Edicin 2008
19
CEPECH Preuniversitario, Edicin 2008
18
CEPECH Preuniversitario, Edicin 2008
19
CEPECH Preuniversitario, Edicin 2008
18
CEPECH Preuniversitario, Edicin 2008
19
5. Investiga acerca de las aplicaciones de la ingeniera gentica.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
6. Qu utilidad presentar en el futuro el uso de la terapia gnica? Qu enfermedades podrn
ser tratadas? Menciona algunos ejemplos.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
7. Investiga acerca de la tecnologa que ha llevado a la fabricacin industrial de insulina
humana.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
8. Investiga acerca del proyecto genoma humano.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g

a

2
0
0
8

Gua Plan Electivo
Biologa 2008
G
u

a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edicin 2008
18
CEPECH Preuniversitario, Edicin 2008
19
CEPECH Preuniversitario, Edicin 2008
18
CEPECH Preuniversitario, Edicin 2008
19
CEPECH Preuniversitario, Edicin 2008
18
CEPECH Preuniversitario, Edicin 2008
19

En la prxima clase, estudiars los siguientes temas:

Sntesis de protenas. Transferencia del mensaje gentico desde el


ADN a la maquinaria de sntesis de protenas.
- Correspondencia entre codn del ARNm, anticodn del ARNt
y el aminocido correspondiente.
- Traduccin del mensaje gentico durante la sntesis de prote-
nas.
- Interpretacin del signicado de una mutacin a nivel molecu-
lar.

Relacin entre estructura y funcin de las protenas.


- Albinismo y anemia falciforme.

Enzimas, como ejemplo de la importancia de la estructura tridi-


mensional de las protenas.
Consulta el ndice de tu libro para preparar estos temas.
Prepara tu prxima clase