Está en la página 1de 42

Introduccin a la Genmica

Comparativa
Dr(c) Juan Pablo Crdenas A.
Centro de Bioinformtica y Biologa Genmica,
Fundacin Ciencia & Vida
Contenido
Introduccin
La variedad de la vida en el contexto
evolutivo
Genmica comparativa
Definiciones y clasificacin de los mtodos
Comparacin de secuencias cromosomales
Comparacin de contenidos gnicos




AAACACTTAGACAATCAATATAAAGATGAAGTGAA
CGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAAC
AAATCAAAGATCAAAAAAGGATAGAAGAACAAGAA
AAACCACAAACACTTAGACAATCAATATAAAGATG
AAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTG
CAGGAACAAATCAAAGATCAAAAAAGGATAGAAGA
ACAAGAAAAACCACAAACACTTAGACAATCAATAT
AAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGA
AAACTTGCAGGAACAAATCAAAGATCAAAAAAGGA
TAGAAGAACAAGAAAAACCACAAACACTTAGACAA
TCAATATAAAGATGAAGTGAACGCTCTTAAAGAGA
AGTTGGAAAACTTGCAGGAACAAATCAAAGATCAA
AAAAGGATAGAAGAACAAGAAAAACCACAAACACT
TAGACAATCAATATAAAGATGAAGTGAACGCTCTT
AAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAA
AGATCAAAAAAGGATAGAAGAACAAGAAAAACCAC
AAACACTTAGACAATCAATATAAAGATGAAGTGAA
CGCTCTTAAAGAGAAGTTGGAAAACTTGCAGGAAC
AAATCAAAGATCAAAAAAGGATAGAAGAACAAGAA
AAACCAC
Desde la secuencia hasta el
repertorio de funciones
Los seres vivos y sus diferencias en
el contexto evolutivo
Charles Darwin (1859)
Los seres vivos y sus diferencias en
el contexto evolutivo
Modelo de los Tres Dominios (Carl Woese, 1928-2012)
Los seres vivos en el contexto
evolutivo
Williams, Sobral, and Dickerman, J . Bacteriol., 2007
-proteobacterias
Brucella y Bartonella (patgenos) estn relacionados con
Rhizobios (especies simbiontes con vegetales) y especies de
vida libre.
Qu es lo que se conserva? Qu tienen Bartonella y
Brucella que no tienen las dems y viceversa?
Genmica comparativa
El estudio de la relacin entre los genomas de
diferentes especies o subespecies
Cmo vara el DNA, el contenido de genes o
su orden entre distintos organismos?
Porqu comparar?
Para observar cambios en el contenido u
expresin gentica como rasgos
fisiolgicos/evolutivos
Para extrapolar funciones conservadas desde
organismos modelo hacia organismos poco
estudiados
Para correlacionar variacin intra-especie en su
genotipo y fenotipo
Sus aportes
Mayor entendimiento acerca de:
Biodiversidad
Fundamentos de la fisiologa y regulacin
gnica
Elementos genmicos mviles (MGE) y
transferencia horizontal de genes (HGT)
Interaccin patgeno-hospedero
Aspectos evolutivos
Etc
reas de trabajo
Comparacin de regiones cromosmicas
Bsqueda de Sintenia y Regiones
diferenciales
Comparacin de secuencias codificantes
Familias de genes / protenas
Genes gnero-especficos
Bsqueda de regiones pequeas
Elementos regulatorios
Small RNAs
Mutaciones simples (SNPs)
Alineamiento de genomas
Programas
Mauve (http://gel.ahabs.wisc.edu/mauve/)
MUMmer (http://mummer.sourceforge.net/)
MegaBLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi)
Representaciones
Dot plot
ACT
MAUVE
Un caso hipottico
Los organismos A y B son muy relacionados, pero A
es un patgeno mientras que B no lo es.
Qu har que el organismo A sea un patgeno?
Genoma B
Genoma A
Un caso hipottico
Genoma A
G
e
n
o
m
a

B

B
A
Genoma A
G
e
n
o
m
a

B

B
A
Translocacin Inversin
In-del
Dot plot entre dos especies relacionadas
Smoot et al., PNAS, 2002
Regin Sintnica
Regin Diferencial
Dot plot entre dos especies no relacionadas
http://mbel.kaist.ac.kr/lab/nbt1010/nbt1010.html
RSA 493
RSA 331
Dugway
Alineamiento MAUVE: Coxiella burnetii
http://www.pasteur.fr/~tekaia/ACBCGA/TALKS/Setubal_CompBactGenomics.ppt
MegaBLAST
blast.ncbi.nlm.nih.gov/Blast.cgi?
Especializacin de BLASTn para comparar
grandes secuencias que estn muy
relacionadas
La visualizacin de sus resultados se puede
hacer por ACT
Para diversos sistemas (incluyendo Windows) y
de modo on-line
ACT para ver alineamiento de
genomas
http://www.sanger.ac.uk/Software/ACT/
http://www.webact.org/WebACT/home
ACT es un visor basado en Artemis
Lee archivos de distintos formatos: anotados
como EMBL y GenBank o secuencias en FASTA
Puede ayudar a la visualizacin de
comparaciones realizadas por MEGABLAST u
otra herramienta
http://sta.uwi.edu/fst/dms/icgeb/documents/ACT_talk_ICGEB_2009.ppt
www.WebACT.org
G+C


Features

Salmonella typhi vs. E. coli SPI-2
Blast hits
S.typhi
E.coli

Features


G+C
Sintenia
Genoma 1
Genoma 2
http://sta.uwi.edu/fst/dms/icgeb/documents/ACT_talk_ICGEB_2009.ppt
Genoma 1
Genoma 2
http://sta.uwi.edu/fst/dms/icgeb/documents/ACT_talk_ICGEB_2009.ppt
Buscando pseudogenes
Genoma 1
Genoma 2
http://sta.uwi.edu/fst/dms/icgeb/documents/ACT_talk_ICGEB_2009.ppt
Rearreglos
Genoma 1
Genoma 2
http://sta.uwi.edu/fst/dms/icgeb/documents/ACT_talk_ICGEB_2009.ppt
Inserciones-deleciones
Genoma 1
Genoma 2
Expansin de copias (parlogos)
http://sta.uwi.edu/fst/dms/icgeb/documents/ACT_talk_ICGEB_2009.ppt
Comparacin basadas en genes
Homlogos: genes con un ancestro comn, que
retienen en general la misma funcin
Ortlogos: homlogos desde especies
diferentes (especiacin)
Parlogos: homlogos dentro de una misma
especie (duplicacin) . Pueden ser antes o
despus de la especiacin
Xenlogos: homlogos que se comparten entre
especies por transferencia gentica lateral
(LGT)

Evento de
Especiacin
Ortologa
Paraloga (I)
Paraloga (II)
Xenologa
Buscando ortlogos
Rasgos deseados de buscadores de ortlogos
Capacidad para distinguir cundo se forman
parlogos dentro de un genoma determinado
Capacidad para agrupar genes con la misma
arquitectura de dominios (similitud global)
Mtodos
rboles filogenticos
BLAST
MCL
orthoMCL
Best bidirectional Hit (BBH)
BLAST
Genoma 1 Genoma 2
Best bidirectional Hit (BBH)
BLAST
Genoma 1 Genoma 2
Best bidirectional Hit (BBH)
BLAST
Genoma 1 Genoma 2
OrthoMCL, un algoritmo ms
exhaustivo
Li Li et al. Genome Res. 2003; 13: 2178-2189
OrthoMCL, un algoritmo ms
exhaustivo
Li Li et al. Genome Res. 2003; 13: 2178-2189
Comparacin de proteomas predichos
Williams, Sobral, and Dickerman, J . Bacteriol., 2007
Comparacin de proteomas predichos
COGs
http://www.ncbi.nlm.nih.gov/COG/
Clusters of Orthologous Groups
Utiliza genomas de organismos-modelo
Crea clasificaciones de protenas a partir de una
red formada por coincidencias de BLAST
todos-contra-todos
Modos de uso: COGNITOR RPS-BLAST
COGs
COG2813