Está en la página 1de 364

J.

Roberto Brcena - Horacio Chiavazza


EDITORES
Comisin Permanente de los Congresos Nacionales de Arqueologa Argentina
Comisin Organizadora del XVII Congreso Nacional de Arqueologa Argentina
Presidentes de los Congresos precedentes I a XVI; 1970/2007
J. Roberto Brcena - Horacio Chiavazza
Juan Pablo Aguilar
Jorge Garca Llorca
J. Roberto Brcena - Horacio Chiavazza
Presidentes:
Secretario de
comunicacin
y edicin:
Tesorero:
Miembros:
Editores:
Pablo A. Cahiza, Sebastin A. Carosio,
Lourdes Iniesta, Luis Maferra, Mara Rosa Martnez,
Mara Jos Ots, Mara Pannunzio de Mulle,
Cristina Prieto, Lorena Puebla, Marcos Quiroga,
Claudio Revuelta, Vanina Victoria Terraza,
Vanina Tobar, Valeria Zorrilla
Agradecemos la colaboracin de nuestras instituciones, Universidad Nacional de Cuyo y
Consejo Nacional de Investigaciones Cientficas y Tcnicas, Facultad de Filosofa y Letras
e Instituto de Ciencias Humanas Sociales yAmbientales, como asimismo a laANPCyTy la
Municipalidad de la Ciudad de Mendoza, al igual que a todos los que aportaron para hacer
posible el Congreso y la edicin de esta publicacin.
Reservados todos los derechos. Queda rigurosamente prohibida, sin la autorizacin escrita del
autor, bajo las sanciones establecidas en las leyes, la reproduccin parcial o total de esta obra por
cualquier medio o procedimiento, incluidos la reprografa y el tratamiento informtico.
Primera Edicin: 500 ejemplares
Impreso enArgentina - Printed inArgentina
ISBN: 978-987-9126-83-7
978-987-9126-87-5 (Tomo IV)
Queda hecho el depsito que marca la Ley 11.723
Nota Editorial
Han transcurrido tres aos desde el ltimo XVI Congreso Nacional de Arqueologa
Argentina, realizado en San Salvador de Jujuy, que permiti una puesta a punto de las
investigaciones regionales, manifestada en centenares de ponencias y en la edicin de los tres
volmenes de los resmenes expandidos del evento.
Hoy, octubre de 2010, nos complacemos por estar desarrollando el XVII Congreso
Nacional por primera vez en nuestra ciudad de Mendoza, avizorando con las tambin centenares
de ponencias convocadas, por ms de mil investigadores, un panorama de significativos avances
cientficos de los estudios arqueolgicos nacionales e internacionales relacionados.
Dichos estudios se reflejan en veintisiete simposios, dos mesas redondas, seis mesas de
comunicaciones sobre reas del pas, una mesa de estudiantes y una sesin de presentaciones
grficas, propias de un Congreso rico en aportes multidisciplinares, con importante participacin
de investigadores nacionales y extranjeros, cuya presencia agradecemos especialmente.
Semejante aportacin de esfuerzos implic para nosotros que buscramos el adecuado
correlato de extensin y difusin. Por lo tanto, junto con facilitar la participacin de estudiantes y
egresados recientes de las especialidades desarrolladas en la reunin, pretendimos ofrecer un
espacio de publicacin, que sumara a la novedad de edicin previa al Congreso, la primicia de la
necesaria evaluacin externa.
Por esta razn, con la importante colaboracin de los coordinadores de las sesiones en
que est dividido el Congreso, pautamos la publicacin del libro que reuniera los aportes como
artculos breves, que fueran aceptados luego de ser evaluados por coordinadores de sesin y
asesores externos a las mismas, asegurando con tal procedimiento que si ste se cumpla
acabadamente alcanzaramos la garanta necesaria sobre la excelencia del producto intelectual
ofrecido, aportando con esto un nuevo modo de presentacin.
Merced a la ardua labor del colectivo de organizadores, coordinadores y evaluadores,
pudimos cumplir con nuestro cometido, alcanzando la presentacin de estos cinco volmenes del
libro del Congreso la calidad de haber sometido a evaluacin las presentaciones de los autores,
reuniendo en esta oportunidad ms de trescientos cincuenta de ellas que, distribuidas en captulos
siguiendo el orden de simposios y mesas, nos permite ofrecer ms de dos mil quinientas pginas de
la produccin de la Arqueologa Argentina y Regional sudamericana, con la conviccin de que
constituyen una nueva puesta a punto de la situacin de la disciplina y sus avances en el pas junto
con la continental relacionada.
Debemos a la vez congratular y agradecer particularmente a nuestros colegas y a los
alumnos avanzados que han participado activamente, no slo para hacer posible el desarrollo del
Congreso sino tambin y principalmente para que alcanzramos esta forma de expresin duradera
de los resultados de mltiples proyectos de investigacin, denotando la excelencia y significacin
de nuestro mbito cientfico en el concierto de la ciencia nacional y sudamericana.
Les invitamos por lo tanto a la lectura atenta que merecen estas contribuciones rigurosas
garantizadas mayoritariamente por la revisin crtica de pares evaluadores, cuya labor
agradecemos, recorriendo un camino particular del conocimiento aportado por la Arqueologa
cientfica, reconociendo los novedosos abordajes metodolgicos y tcnicos presentados.
TOMO IV - V
La presentacin de un libro, mxime de ste que involucra cinco volmenes, es un hecho
gratificante por s y lo es ms por el esfuerzo que representa la labor de sus autores, siendo
asimismo de fundamental valor las contribuciones econmicas que lo hicieron posible y que
agradecemos, como los aportes de nuestras instituciones organizadoras del Congreso Facultad
de Filosofa y Letras de la Universidad Nacional de Cuyo e Instituto de Ciencias Humanas,
Sociales y Ambientales del Consejo Nacional de Investigaciones Cientficas y Tcnicas, los del
CONICET y de la ANPCyT, como as el que contramos adems con el marco apropiado para los
eventos, brindado por nuestra anfitriona, la Municipalidad de la Ciudad de Mendoza.
No es menor asimismo el contexto del bicentenario, los bicentenarios diramos, de nuestras
patrias latinoamericanas, que nos impuls a resaltar el contexto del ao en que desenvolvimos el
Congreso, titulando el trabajo de todos como Arqueologa Argentina en el Bicentenario de la
Revolucin de Mayo, 1810-2010.
Nos parece significativo igualmente que hayamos alcanzado con nuestro XVII Congreso
Nacional de Arqueologa Argentina los cuarenta aos desde la realizacin del primero de ellos,
situacin que implica una recapitulacin sobre la ciencia arqueolgica en Argentina, recordando
tantos y tan excelentes colegas y aportes, rememorando a muchos maestros hoy desaparecidos,
agradeciendo tanto esfuerzo y labor que nos permite continuar avanzando, pasando la posta, como
hacemos en este octubre de 2010, a una nueva reunin trienal, a un prximo XVIII Congreso
Nacional de Arqueologa Argentina, en alguna provincia del pas, bajo el cuidado de otro grupo
de organizadores.
Nos sentimos honrados, junto con nuestros colegas y alumnos de la Comisin
Organizadora del XVIICNAA, por haber recibido el honor de organizar y desarrollar este
Congreso en nuestra querida Ciudad de Mendoza, pudiendo a su vez ejercer la responsabilidad de
editar los mltiples tomos del libro con los artculos breves sobre los aportes de tantos autores, lo
que agradecemos poniendo el producto a vuestra disposicin.
En la espera que esta reunin oficie de marco amigable para la reflexin dialogada sobre
el lugar en que nos encontramos y hacia donde nos dirigimos en la arqueologa argentina, es que
les deseamos el ms fructfero de los trabajos.
Muchas gracias
Dr. J. Roberto Brcena Dr. Horacio Chiavazza
Editores
Presidentes del XVII CNAA
TOMO IV - VI









CAPTULO 27
SIMPOSIO 27

UTILIZACIN DE INDICADORES FSICOS, QUMICOS Y
BIOLGICOS EN LA RESOLUCIN DE PROBLEMAS
ARQUEOLGICOS

Coordinadores
Dbora M. Kligmann
CONICET - Instituto de Arqueologa, FFyL, UBA
Marcelo R. Morales
CONICET - Instituto de Arqueologa, FFyL, UBA
Evaluadores
Marcelo R. Morales
CONICET - Instituto de Arqueologa UBA
Silavana Buscaglia
Departamento de Investigaciones
Prehistricas y Arqueolgicas
Instituto Multidisciplinario de Historia
y Ciencias Humanas
CONICET
Marcelo Cardillo
Departamento de Investigaciones Prehistricas y
Arqueolgicas
Instituto Multidisciplinario de Historia y Ciencias
Humanas
CONICET
Vernica Seldes
CONICET Instituto Nacional de Antropologa y
Pensamiento Latinoamericano
Vernica Lema
Departamento Cientfico de Arqueologa -
Laboratorio de Etnobotnica y Botnica Aplicada-
FCNYM (UNLP)

Mara Marschoff
Departamento de Investigaciones Prehistricas y
Arqueolgicas
Instituto Multidisciplinario de Historia y Ciencias
Humanas
CONICET









NDICE

ANLISIS DE PROCEDENCIA DE OBSIDIANAS DEL ALERO CUEVAS,
PROVINCIA DE SALTA, ARGENTINA: APLICACIN Y COMPLEMENTARIEDAD
DE MTODOS FSICO QUMICOS Y MACROSCPICOS
Cecilia Mercuri y Federico Restifo ............................................................................................................. 1389

PALEOESCATOLOGA MOLECULAR. ADN ANTIGUO EN COPROLITOS
Y SEDIMENTOS ARQUEOLGICOS: POSIBILIDADES, DIFICULTADES
Y PRIMEROS RESULTADOS EN ARGENTINA
Martn H. Fugassa y Andrea Cumino .......................................................................................................... 1395

ESTIMACIN DE CRONOLOGA RELATIVA MEDIANTE
ESTUDIOS APLICADOS SOBRE MATERIALES DE HIERRO
PROVENIENTES DE LA GUARDIA DE SAN MIGUEL DEL
MONTE (PROVINCIA DE BUENOS AIRES)
Luis P. Traversa, Mara Ins Casadas y Mara Eugenia Peltzer ................................................................. 1399

TRAS LAS HUELLAS DEL FUEGO. APORTES DEL ANLISIS DE
MICROCARBONES A LA ARQUEOLOGA DEL VALLE DE AMBATO
(CATAMARCA)
Henrik B. Lindskoug .................................................................................................................................. 1405

GEOFSICA APLICADA A LA ARQUEOLOGA: LA LOCALIZACIN
DEL FUERTE SANCTI SPRITUS (1527-1529), PUERTO GABOTO,
PROVINCIA DE SANTA FE
Gabriel Cocco, Guillermo Frittegotto, Nstor Bonomo,
Matas de la Vega, Patricia Martinelli y Ana Osella .................................................................................. 1411

ANTIGUOS CANALES? IDENTIFICACIN DE CANALES
DE RIEGO MEDIANTE BIOINDICADORES. EL CASO DE PEAS COLORADAS
M. Lorena Cohen, Lorena Grana y Nora Maidana ................................................................................... 1417

ANLISIS DE PROCEDENCIA DE OBSIDIANAS DEL ALERO CUEVAS,
PROVINCIA DE SALTA, ARGENTINA: APLICACIN
Y COMPLEMENTARIEDAD DE MTODOS FSICO QUMICOS
Y MACROSCPICOS
Cecilia Mercuri
*
y Federico Restifo
*
*


Introduccin
En los ltimos aos, los anlisis de procedencia de materias primas lticas han cobrado relevancia. Una de las
rocas ms propicias para el estudio de la organizacin tecnolgica, disponibilidad y/ o accesibilidad de las
materias primas, grado de movilidad del grupo, estrategia de subsistencia (Earle y Ericson 1977, entre otros) es
la obsidiana. Por un lado, esta materia prima y/ o sus productos han sido bienes exticos objeto de extensas redes
de circulacin en todo el mundo (Earle y Ericson 1977, entre otros). Y por otro lado, es un material
geolgicamente escaso y de localizacin concentrada. sta roca gnea volcnica extrusiva perteneciente al grupo
de los silicatos presenta una serie de elementos minoritarios con concentraciones menores al 1% (que
comnmente se denominan elementos traza) cuyas concentraciones son especficas de cada formacin o parte de
formacin geolgica (Zumberge 1974), por lo que es posible asignar la pertenencia de una muestra a una fuente
en particular, dando precisiones slo sobre la relacin entre dos localidades geogrficas, que despus se discuten
dentro del contexto de estudio.

En lneas generales, en un primer acercamiento, los conjuntos arqueolgicos, se analizan macroscpicamente.
Esto es tambin as para el registro de las materias primas lticas, el cual se hace a partir de la coleccin de
referencia. Esto es as incluso cuando se analizan obsidianas (Psota 1990). Rojas y colaboradores (2004) dividen
los mtodos de anlisis de las obsidianas en tres grupos generales: descripcin fsica, anlisis fsico qumico y
radioactividad natural. En el primer grupo se incluyen los estudios macro y microscpicos y entre los segundos,
los anlisis de procedencia.
En este trabajo, explicamos y comparamos cmo funcionan un mtodo fsico qumico (XRF), y la descripcin
macroscpica, luego ejemplificamos con el caso de estudio de dos niveles arqueolgicos de distintos fechados
del sitio Alero Cuevas y la aplicacin de stos mtodos.

Mtodos analticos para la determinacin de rocas

Anlisis por Fluorescencia de Rayos X
La espectroscopa por fluorescencia de rayos X (XRF) es ampliamente utilizada para el anlisis elemental
cualitativo y cuantitativo de muestras ambientales, geolgicas, biolgicas e industriales entre otras. Comparada
con otras tcnicas (AAS, ICPS, NAA), tiene la ventaja de ser no destructiva, multielemental, rpida y positiva en
su relacin costo efectividad (Tykot y Ammerman 1997), pero es menos precisa que los otros mtodos.

La identificacin de elementos por mtodos que involucran rayos- X es posible gracias a la radiacin
caracterstica que emiten los tomos desde el interior de sus cortezas electrnicas bajo ciertas condiciones:
cuando el haz de un electrn de alta energa choca contra un material, uno de los resultados es la eyeccin de
fotoelectrones desde la corteza interior de los tomos. El electrn eyectado deja un espacio en la estructura
electrnica del tomo. Luego de un breve perodo, los electrones atmicos se reacomodan con un electrn de
mayor energa, llenando la vacante. Durante la relajacin, el tomo deviene fluorescente, es decir, emite un fotn
de rayos- X cuya energa es igual a la diferencia en energas de los estados inicial y final. Detectar ese fotn y
medir su energa nos permite determinar el elemento y la transicin electrnica especfica de la cual se origin
(Jenkins 1988). El espectro de rayos X adquiridos durante ese proceso muestra un nmero de picos
caractersticos. La energa de los picos permite la identificacin de los elementos presentes en la muestra
(anlisis cualitativo), mientras que la intensidad de los picos provee la concentracin de elementos relevante o
absoluta (anlisis semi-cuantitativo o cuantitativo).


*
CONICET- Instituto de Arqueologa, Universidad de Buenos Aires. 25 de Mayo 217, 3 piso. Ciudad Autnoma de Buenos Aires.
ce_mercuri@yahoo.com.ar, federicorestifo@gmail.com.
*
CONICET- Instituto de Arqueologa, Universidad de Buenos Aires. 25 de Mayo 217, 3 piso. Ciudad Autnoma de Buenos Aires.
ce_mercuri@yahoo.com.ar, federicorestifo@gmail.com.
TOMO IV - 1389
CAPTULO 27 - SIMPOSIO 27
Los anlisis cuantitativos por XRF requieren la calibracin de los parmetros de medicin, lo cual se puede
hacer segn parmetros empricos, que se basa en el anlisis de estndares con composiciones elementales
conocidas, fundamentales sin estndar, que se sustentan en algoritmos matemticos que describen la fsica de
la respuesta del detector a los elementos puros.

Deben considerarse dos tipos de lmites en la deteccin: en el instrumental y en el mtodo. Este ltimo se
relaciona con la preparacin de las muestras y el tiempo de anlisis. La superficie de los tems bajo estudio
deben estar limpias y libres de etiquetas. Si los artefactos hubieran sido rotulados, es mejor dejarlos as, ya que al
remover la sigla a veces quedan residuos y es preferible que la ubicacin de sta sea obvia (la presencia de
pintura se refleja en elevados niveles de titanio, zinc o plomo). Las muestras seleccionadas para el anlisis por
XRF deben tener un tamao no menor a 10 mm de dimetro y un mnimo 1,5 mm de espesor. Las muestras ms
pequeas tienden a mostrar distorsin en los valores de los elementos pero, en muchos casos, pueden ser
caracterizadas con cierto grado de confiabilidad. De todos modos, el uso de especimenes pequeos no es
recomendable en reas regiones donde el universo de las fuentes de obsidiana no es bien conocido (Skinner y
Thatcher s/ f).

Los resultados analticos de las superficies lenticulares o biconvexas son comparables a aquellos de superficies
planas o las pldoras (formada con la muestra pulverizada), por lo que son viables los estudios de caracterizacin
no destructivos (Hughes 1986).

Anlisis Macroscpico a Ojo Desnudo
En esta metodologa deben considerarse un conjunto de rasgos que caractericen las rocas. Es oportuno destacar
que este es un anlisis subjetivo de modo que las variables registradas y la manera de hacerlo dependern de las
necesidades y objetivos de equipos de investigacin particulares y principalmente del conjunto a analizar.

Es importante aclarar que la precisin de este mtodo depende, no slo del conocimiento que se tenga de la
coleccin de referencia, sino tambin de las caractersticas de las rocas a analizar. No todos los conjuntos tienen
el mismo potencial, hay obsidianas que son macroscpicamente muy difciles de diferenciar unas de otras, pero
cuando el conjunto presenta cierta variabilidad macroscpica el mtodo es viable (cf. Psota 1990). El tiempo que
lleva el anlisis est relacionado con el tamao de la muestra, ya que, en principio, se analizan todas las piezas
del conjunto. Los especimenes deben tomarse y examinarse sobre una mesa, (preferentemente blanca para no
interferir con el registro de algunas de las variables como el color), y con luz apropiada.

Algunas de las variables que pueden tomarse en cuenta se basan en el anlisis macroscpico de rocas y minerales
que realizan los gelogos. As, se registran propiedades pticas tales como brillo, transparencia, color,
inclusiones, vetas, corteza. Asimismo, tambin se tienen en consideracin propiedades fsicas tales como
fractura, textura, homogeneidad.

A partir de estas observaciones se realiza la comparacin con la coleccin de referencia. Es conveniente que en
sta estn disponibles piezas de distintos tamaos y espesores en funcin de tener mayor comparabilidad.

Caso de estudio: cuenca hdrica de Santa Rosa de los Pastos Grandes
La cuenca de Santa Rosa de los Pastos Grandes (SRPG, ver figura 1), se ubica a unos 240 Km hacia el NO de
Salta Capital. Con una superficie aproximada de 300 km (Lpez 2008) y a una altura promedio mayor a 4000
msnm, la cuenca se conforma por las aguas que recoge de los nevados homnimos, las cuales forman una amplia
vega (Vilela 1969). Conecta la Puna Argentina con los Valles Mesotermales (Norte del Valle Calchaqu) y el
Norte de Chile, siendo a su vez, una zona de transicin hacia la Puna Sur (Lpez 2008).

Durante la campaa arqueolgica realizada en Abril de 2004, se detect un amplio alero de toba dactica blanco
amarillento muy claro en un faldeo de cerro de la Quebrada de las Cuevas, al cual se denomin Alero Cuevas
(AC, ver figura 1). ste se ubica en un lugar de alta visibilidad, a ms de 5 m del fondo de la misma y su
localizacin, permite una buena visual de la Quebrada y sus recursos potenciales.

El Alero, de 19,3 m de frente, presenta una estratigrafa compleja y una secuencia de fechados larga, que va
desde los 9650 100 a 643 35 (Lpez 2007 y 2008). Lpez (2007) sostiene que la recurrencia en las
ocupaciones se relaciona con una serie de ventajas tales como la cercana a recursos bsicos, la alta visibilidad de
gran parte de la Quebrada y sobre todo por brindar abrigo.

TOMO IV - 1390
Cecilia Mercuri y Federico Restifo
Como ya se mencion, en este trabajo se presentan y discuten los resultados de las capas fechadas en 2020 60
(LP- 1671, 1 sigma 100 AC- 60 DC), por un lado y la capa F4 con fechados de 8504 52 AP (AA 71136 NSF,
cal 7600-7490 AC), 8838 52 AP (AA 71136 NSF, cal 8210-7750 AC) y 9650 100 AP (LP 1736, cal 9300-
8750 AC), por el otro.

El conjunto se abord primeramente de manera macroscpica, y luego se enviaron muestras de obsidiana al
laboratorio de la MURR (Missouri University Research Reactor), en EEUU, para el anlisis fsico qumico. La
eleccin de este laboratorio tuvo que ver con que disponen de una amplia coleccin de referencia calibrada para
la zona en cuestin.

A partir de esta primera clasificacin se formaron 5 grupos segn sus caractersticas macroscpicas (ver tabla 1).
Realizamos el trabajo de comparacin con nuestra muestra de referencia y asignamos procedencia potencial a los
grupos. Este paso nos permiti seleccionar el conjunto que queramos enviar para analizar. Por un lado,
queramos confirmar la presencia de algunas, y por otra esclarecer la de otras que no era clara o no se presentaba
en nuestra coleccin (Tabla 1).

El trabajo de comparacin lo realizamos contemplando las muestras de los dos niveles arqueolgicos que
estudiamos, de modo que pudiramos observar la recurrencia de ciertas materias primas en ambos conjuntos y
plantear hiptesis sobre las estrategias implementadas en dos momentos diferentes de la ocupacin del alero. La
eleccin de las piezas que analizamos por XRF tuvo que ver con esta recurrencia.

Caractersticas
G
r
u
p
o

B
r
i
l
l
o
C
o
l
o
r
T
r
a
n
s
p
a
r
e
n
c
i
aI
n
c
l
u
s
i
o
n
e
s
V
e
t
a
s
C
o
r
t
e
z
a
T
e
x
t
u
r
a
,

h
o
m
o
g
e
n
e
i
d
a
dF
r
a
c
t
u
r
a
F
u
e
n
t
e

p
o
t
e
n
c
i
a
l

F
u
e
n
t
e

1 mucho Traslcid
o
Si Negras, muy
pequeas.
Burbujas
pequeas.
no no Suave, pero
con
irregularidades
.
Concoida
l
Quirn Quirn
2 mucho Traslcid
o
Si - Si, blancas
paralelas.
No influyen
en la
transparecia
.
no Suave Concoida
l
- Quirn
3 mucho Negro
traslcido
Si,
aunque
con
vetas.
Tiene una
microvescula
.
Si, paralelas
negras.
no Muy suave Concoida
l muy
linda.
Zapaler
i
Zapaler
i
4 jabonos
o
Gris Apenas
(hay
que
ponerla
a
trasluz)
.
Pequeas,
doradas.
Grises
paralelas.
? Tendiente a
suave
Concoida
l
Archiba
rca
5 poco Gris muy
oscuro
Apenas
(hay
que
ponerla
a
trasluz)
.
Negra,
pequea y
aislada
- - Tendiente a
suave.
Concoida
l
Purulla Archiba
rca
Tabla 1. Caractersticas macroscpicas de la muestra analizada por XRF.

Discusin y palabras finales
Ambos mtodos parten del conocimiento de una amplia coleccin de referencia de las fuentes de obsidianas.
Amplia no en un sentido cuantitativo, sino, ms importante, cualitativo. Es decir, que en la coleccin est
representada la variedad observable (independientemente del nivel de anlisis) en las rocas.
TOMO IV - 1391
CAPTULO 27 - SIMPOSIO 27
Ahora bien, las muestras que se envan para anlisis de XRF pueden ser relativamente escasas con respecto al
conjunto ltico de un sitio. Este dato, no obstante es muy poco claro en la bibliografa consultada, ya que por lo
general se muestra la cantidad de elementos analizados, pero no se aclara qu porcentaje representa. Este es un
punto que no ha sido tenido en cuenta y lo que suele primar es la cantidad sobre la calidad (muchas veces no se
indica si las piezas provienen de capa o de superficie). Contrariamente, en los anlisis macroscpicos, en
principio se clasifican y tratan de determinar todos los artefactos, de modo que el porcentaje de representacin de
la muestra analizada sera cercano al 100% (aunque habra que descartar los no identificados).

Es importante destacar que ambos mtodos son no destructivos. No obstante, una vez que uno manda muestras a
laboratorios extranjeros, muchas veces hay que abonar extra para recuperarlas y a esto se suman posibles
inconvenientes con el correo postal, por lo que lo ptimo es elegir muy bien la muestra a analizar y realizarle
todos los anlisis que requiera antes de enviarla.

La mayor ventaja, de XRF es que se logra una determinacin con confiabilidad que alcanza el 99% y es
independiente de la variabilidad macroscpica de rocas del conjunto y de la regin. Sin embargo, si bien el
anlisis es fsico qumico, la eleccin de las muestras es macroscpica por lo que debe ser realizada con seriedad
y detalle. El anlisis a ojo desnudo es altamente dependiente de la variabilidad macroscpica de las rocas del
conjunto y de la regin, por lo que si las rocas no presentan caractersticas macroscpicas diagnsticas, se hace
muy dificultoso su estudio y la determinacin de grupos que ayuden en la seleccin de muestras a analizar con
mtodos fsico qumicos. Sin embargo, en algunos casos se ha llegado al 89% de xito en la identificacin
macroscpica de obsidianas (ver Bettinger et al 1984 citado en Psota 1990). No obstante, se vuelve a reiterar que
esto es muy dependiente del conjunto bajo anlisis y de las caractersticas de las rocas de la regin de estudio.

En nuestro caso de estudio, dos conjuntos lticos del sitio Alero Cuevas, pudimos por un lado, confirmar la
presencia de las variedades Quirn (que se encuentra a ms de 30 km del sitio) y Zapaleri (a unos 300 km), y por
otro lado, descubrimos la existencia de la variedad
Archibarca (Tabla 1 y figura 1), que se localiza a
unos 150 km, aproximadamente, y no haba sido
detectada en el rea.

Ahora bien, la seleccin de la muestra fue realizada
macroscpicamente a partir de semejanzas que
pudieron ser observadas a ojo desnudo, pero somos
conscientes que habra que verificar y hacer un
estudio ms fino analizando fsico- qumicamente
las obsidianas de los dos conjuntos por separado.
De acuerdo con el primer acercamiento que
efectuamos, descripcin macroscpica a ojo
desnudo, el grupo 5 fue asignado tentativamente a
la variedad Cueros de Purulla, ya que se asemeja a
la muestra de esta materia prima que tenemos en
nuestra coleccin de referencia, pero result
provenir de Archibarca, en el lmite entre las
provincias de Salta y Catamarca, por lo que no
puede descartarse la presencia diferencial de
distintas variedades de obsidianas slo
diferenciables por mtodos fsico qumicos, en los
dos conjuntos.

En suma, es relevante que se utilicen estos mtodos
complementariamente. Lo mejor es no quedarse
con una nica metodologa y los anlisis
macroscpicos no son para desestimar, ya que si
bien no tienen la resolucin de los fsico- qumicos,
operan en distinto nivel y son muy importantes
para una primera clasificacin de las rocas del
conjunto. Y tal vez lo principal es qu se hace con
la informacin obtenida por estos mtodos.
TOMO IV - 1392
Cecilia Mercuri y Federico Restifo
Agradecimientos
A todos aquellos que leyeron versiones anteriores de este trabajo e hicieron comentarios. Al CONICET por las
becas que nos permiten realizar estos estudios. Todo lo aqu vertido es de nuestra exclusiva responsabilidad.

Bibliografa
Earle, T. K. y J. E. Ericson (editores). 1977. Exchange System in Prehistory. Academic Press, New York.
Hughes, R. E. 1986. Diachronic Variability in Obsidian Procurement Patterns in Northeastern California and
Southcentral Oregon. University of California Publications in Anthropology 17, Berkeley, California.
Jenkins, R. 1988. X-Ray Fluorescence Spectrometry. J. Wiley & Sons, Inc, New York.
Lpez, G. E. J. 2007. Ocupaciones Humanas a lo largo del Holoceno en Pastos Grandes, puna de Salta: el caso
arqueolgico del sitio multicomponente Alero Cuevas. En Tras las Huellas de la Materialidad. Resmenes
ampliados del XI Congreso Nacional de Arqueologa (III): 145- 150. Jujuy.
2008. Arqueologa de Pastos Grandes, Puna de Salta: Ocupaciones humanas y evolucin a lo largo del
Holoceno. Tesis para optar al grado de Doctor en Filosofa y Letras. Facultad de Filosofa y Letras. UBA. Ms.
Psota, S. 1990. Reexamining the Potential to Visually Source Western Great Basin Obsidians. Trabajo
presentado en la 24 Annual Meeting of Society for California Archaeology, Foster City.
Rojas A., C., V. A. Pea Rodrguez y M. Delgado A. 2004. Caracterizacin de obsidianas arqueolgicas
peruanas: redes de intercambio. Revista de Investigacin de Fsica vol 7, N 1, 2: 51- 58.
Skinner, C. E. y J. J. Thatcher. s/ f. Introduction to Obsidian Characterization Studies.
http://www.obsidianlab.com/info_xrf.html (15 de Octubre de 2008).
Tykot, R. y A. J. Ammerman. 1997. New directions in Central Mediterranean obsidian studies. Antiquity 71
(274): 1000- 1006.
Zumberge, J. H. 1974. Geologa Elemental. C.E.C.S.A. Mxico, D. F. 3 impresin.
TOMO IV - 1393
CAPTULO 27 - SIMPOSIO 27
PALEOESCATOLOGA MOLECULAR. ADN ANTIGUO EN COPROLITOS Y
SEDIMENTOS ARQUEOLGICOS: POSIBILIDADES, DIFICULTADES Y
PRIMEROS RESULTADOS EN ARGENTINA
Martn H. Fugassa
*
y Andrea Cumino
**



Los estudios paleoparasitolgicos que se realizan en Patagonia estn dirigidos a aportar informacin
ecolgica y cultural humana como as tambin sobre la historia evolutiva de parsitos y biogeografa de
otros hospedadores mamferos. Sin embargo, el grado de resolucin de las preguntas a responder est
condicionado por los mtodos con que se cuenta y la calidad de las muestras disponibles. La introduccin
de tcnicas moleculares es crtica para avanzar en el aporte de informacin ms detallada y con menor
incertidumbre. Aunque la inclusin de las tcnicas de ADN antiguo supone desafos tanto en
infraestructura, equipamiento, recursos humanos y logstica, los resultados obtenidos mediante el estudio de
ADN antiguo, fundamentalmente desde mediados de los aos 90 en otros pases, justifican el esfuerzo. La
mayor sensibilidad como especificidad de la tcnica redunda en un aumento significativo de la calidad de la
informacin recuperada de los materiales arqueolgicos. Aqu se describe el mtodo de extraccin y
amplificacin de ADN antiguo aplicados en el Lab. de Paleoparasitologa. Asimismo, se enumeran las
medidas de prevencin de contaminacin aplicadas antes y durante el examen molecular. Finalmente, se
describen los primeros resultados conseguidos en coprolitos procedentes de Patagonia (provincia de Santa
Cruz) y que previamente han sido motivo de estudios paleoparasitolgicos con microscopa ptica.

Introduccin
La historia de la paleoescatologa molecular (estudio de restos arqueolgicos o paleontolgicos asociados al
sistema digestivo mediante tcnicas moleculares) procede de la interseccin de los estudios moleculares en
restos humanos antiguos restos seos y tejidos- en busca de agentes infecciosos (Ferreira et al. 2000) y el
desarrollo de la parasitologa molecular, desde mediados de la dcada del 1980 aunque la tecnologa de la PCR
se incluy a inicios de los aos 1990.

A partir del trabajo de Loreille y colaboradores (Loreille et al. 2001) en letrinas del siglo XIV en Blgica,
siguieron otros trabajos (Iiguez et al. 2002, 2006, entre otros). Durante la ltima dcada el Laboratorio de
Microbiologa Molecular y el Laboratorio de Paleoparasitologa de la Fundacao Oswaldo Cruz, establecieron el
primer laboratorio de ADN antiguo dedicado a parsitos en Latinoamrica.

En la actualidad, y con el apoyo de los laboratorios de Brasil, en Mar del Plata se est conformando un rea de
trabajo en ADN antiguo. Como sucedi cuando se comenz con los estudios paleoparasitolgicos en la UNMdP,
surge reflexionar los motivos por los cuales an no se ha establecido un laboratorio semejante en Argentina. Sin
dudas, no es la falta de muestras o lo poco confiable de los resultados, que son respaldados por una base
emprica y terica en continuo crecimiento en reas como la microbiologa, parasitologa y gentica. Podran
argumentarse diversas causas aunque algunas seguramente son decisivas. La ausencia de investigadores
formados en la interseccin de las ciencias moleculares, biolgicas y humanas, la escasez de espacio para el
crecimiento de los grupos en las universidades y centros de investigacin en los grandes centros urbanos y el
tiempo de consolidacin de un laboratorio novedoso y la puesta a punto de las tcnicas - que pueden exceder los
tiempos de los informes-, son algunas de las causas que inciden simultneamente en la generacin de la
disciplina en el pas.

Como se mencion, el primer trabajo a nivel internacional se comunic en el 2001 (Loreille et al. 2001). Este se
realiz sobre huevos aislados de Ascaris lumbricoides de muestras arqueolgicas y no estrictamente de
coprolitos o sedimentos. Los trabajos subsiguientes se ejecutaron sobre coprolitos y se dirigieron a la deteccin
de Enterobius vermicularis y Ascaris lumbricoides (Iiguez et al 2006, Leles et al. 2008, entre otros).
Actualmente, una gran cantidad de informacin metodolgica est disponible para su aplicacin en
paleoescatologa a partir de las investigaciones moleculares en huesos antiguos, en contextos forenses y en heces
de especies silvestres.

*
CONICET-Laboratorio de Zoonosis Parasitarias, UNMdP. E-mail: mfugassa@mdp.edu.ar y mhfugassa@hotmail.com
**
CONICET-Laboratorio de Zoonosis Parasitarias, UNMdP. E-mail: acumino@gmail.com

TOMO IV - 1395
CAPTULO 27 - SIMPOSIO 27
En el presente trabajo se comunican los resultados preliminares de un rea novedosa en el pas, la
paleoescatologa molecular. En paleoescatologa molecular, como tcnica de alta sensibilidad y especificidad, el
establecimiento de un laboratorio especializado es complejo. Por ello se pretende tambin describir y reflexionar
brevemente sobre las estrategias para su establecimiento y consolidacin.

Materiales y Metodologa
Debido a que el tiempo para la puesta en funcionamiento de nuevas tcnicas resulta crucial para la supervivencia
del proyecto, se decidi iniciar los ensayos con muestras arqueolgicas que haban sido examinadas al
microscopio ptico y para las cuales se conoca las especies o gneros parasitarios (Tabla 1; Fugassa 2006). Esto
disminuira la incertidumbre sobre los resultados obtenidos. De esta manera, las muestras resultaban un control
positivo antiguo con el cual probar tcnicas, modificaciones y primers especie-especficos para diversos
parsitos (Trichurs sp., capilaridos, ancilostmidos y Ascaris lumbricoides) y humano para corroborar el origen
de las muestras.


Muestra Tipo de material Posible origen Localidad
216 Coprolito Humano Orejas de Burro I, Santa Cruz.
16 Coprolito Camlido CCP7, Santa Cruz.
15 Coprolito Mylodon sp. CCP7, Santa Cruz.
395 Coprolito Humano CCP5, Santa Cruz.
37 Coprolito Humano CCP7, Santa Cruz.
51 Sedimento pelvis Humano Nombre de Jess, Santa Cruz.
30 Coprolito Humano CCP7, Santa Cruz.
21 Coprolito Humano CCP7, Santa Cruz.
Tabla 1. Muestras arqueolgicas utilizadas.

Se tomaron diversas precauciones para prevenir la contaminacin por ADN moderno segn diversas
recomendaciones (Drancourt & Raoult 2005, Marota & Rollo 2002). Las extracciones se realizaron en el
Laboratorio de Zoonosis Parasitaria (UNMdP) y las PCR en un rea distante, en el cuarto estril del
Departamento de Biologa de la UNMdP. Todos los instrumentos e insumos utilizados fueron estriles y de
grado molecular.

Se proces en condiciones de esterilidad 0,5 g del interior de cada coprolito y se hidrat en buffer PBS 1X.
Posteriormente se tomaron 200 l del sedimento para extraer el ADN total, conservndose a -20C el restante
sedimento. Para conseguir la ruptura de las clulas y paredes de los huevos, se procedi a aplicar tres ciclos de
congelamiento en nitrgeno lquido y calentamiento a 100C durante cinco minutos. El ADN se extrajo
utilizndose un kit comercial para materia fecal: kit Qiamp DNA Stool Mini Kit (Qiagen). Se siguieron las
sugerencias del fabricante excepto en el tiempo de exposicin a proteinasa K, que fue de 12 hs a 55-60C y
(Leles 2008). Se midi la concentracin de ADN en el eluato y el nivel de pureza en espectrofotmetro,
determinndose la relacin de absorvancia Abs260/280. Se realiz electroforesis en agarosa 1% para determinar
la calidad del ADN presente.

Las amplificaciones de ADN se realizaron en un volumen final de 25 l, conteniendo 1 l de ADN extrado;
2,5 l de buffer Taq 10x; 1mg/ml BSA; 200 M dNTP; 1,5mM MgCl2 y 1,5U Taq polimerasa (Fermentas). Se
utiliz 0,6uM de cada primers seleccionados de los utilizados en paleoparasitologa y parasitologa clnica (Tabla
2). Las condiciones de termociclado fueron: una desnaturalizacin inicial a 94C durante 5 min. Seguida por 35
ciclos compuestos por una desnaturalizacin a 94C por 1min, una hibridacin a 48-50C durante 1 min y una
elongacin a 72C durante 1 min.

Los productos de las PCR se sometieron a electroforesis, sembrndose 14 l en agarosa 2,5% con buffer TBE
1X. Se visualizaron con SybrGold (Invitrogen).

Resultados y Discusin
De las ocho muestras contempladas en la primera experiencia que aqu se comunica, hasta el momento tres
muestras proveyeron resultados positivos. La muestra 51, consiste en sedimentos de la pelvis de un esqueleto
asignado a europeo mediante ADN (Guichn et al. 2006) y paleoparasitologa (Fugassa et al. 2006). El sitio
Nombre de Jess corresponde al primer asentamiento europeo en Magallanes, a finales del siglo XVI. Se
TOMO IV - 1396
Martn H. Fugassa y Andrea Cumino
corrobor la presencia de ADN humano (Figura 1a) aunque no pudo conseguirse amplificar ADN de los
parsitos hallados al microscopio (Fugassa et al. 2006) y por PCR (Leles et al. 2009). Esto probablemente se
deba a que los primers para Ascaris lumbricoides utilizados son distintos a los empleados en Leles et al. (2009).
Respecto de la existencia de Trichuris trichiura, los primers disponibles son efectivos para fragmentos de ADN
de alrededor de 1000 pb (Cutillas et al. 2004) siendo poco frecuente en escenarios arqueolgicos fragmentos de
ADN de tal tamao. Actualmente existen nuevos primers cortos que se espera probar en el futuro inmediato.


Organismo Secuencia Tamao del
producto de PCR
(pb)
Referencia
ATGCTAAGTTAGCTTTACAG Homo sapiens
ATTCCCCTAAAAATCTTTGA
92 Pbo (1990)
GTAGGTGAACCTGCGGAAGGATCATT Trichuris sp.
AACAACCCTGAACCAGACGT
1000 Cutillas et al.
(2004)
GTTAGGTTACCGTCTAGTAAGG Ascaris
lumbricoides CACTCAAAAAGGCCAAAGCACC
142 Loreille et al.
(2001)
ACGTCTGGTTCAGGGTTGTT Ancylostomatidae
(Nematoda) TTAGTTTCTTTTCCTCCGCT
410-310 y 650-580 Newton et al.
(1998)
TTTTTTGGGCATCCTGAGGTTTAT Capillariidae
(Nematoda) TAAAGAAAGAACATAATGAAAATG
450 Zhu et al.
(2000)
Tabla 2. Primers utilizados en los ensayos.

La muestra 216, consistente en un coprolito recuperado del sitio Orejas de Burro I, Santa Cruz, fue primeramente
asignado a felino aunque su morfologa aparentemente coincida con uno humano o de cnido. Al microscopio se
hallaron huevos de Trichuris sp. aunque este resultado no pudo confirmarse mediante ADN, probablemente por
las razones mencionadas para la muestra 51. Sin embargo, la reaccin positiva para ADN humano (figura 1b) y
negativa en la reaccin control, respaldan que el coprolito pertenezca a un humano.

La muestra 37 pertenece a una capa con un fechado asociado de 8920 200 aos AP (Civalero y Franco 2003).
Debido a la diversidad de parsitos hallada en el coprolito durante la observacin microscpica, resultaba
importante su examen molecular. La muestra fue PCR positiva para el segmento humano (92 pb) (Figura 1c).
Tambin fue positiva para capilridos, obtenindose en electroforesis la banda especfica 450 pb esperada
(Figura 1d) y una banda entre 500-600 pb registrada en ancilostmidos (Figura 1b).

Las muestras restantes an no brindaron resultados positivos para ninguna secuencia especfica. Probablemente
debido a una mala conservacin de ADN ya que las pruebas de inhibidores demostraron su ausencia en presencia
de BSA 1mg/ml con controles modernos. Sin embargo, nuevos experimentos son necesarios.

Los resultados que sugieren la identidad humana de las muestras sern corroborados mediante la secuenciacin
de los fragmentos obtenidos. La posibilidad de corroborar la identidad de las muestras es un factor crucial para la
interpretacin ecolgica y cultural de los resultados paleoparasitolgicos. La inclusin de los estudios
moleculares permite avanzar y superar el margen de incertidumbre (mayor o menor segn cada muestra) sobre
su origen zoolgico.

Si bien los parsitos detectados mediante PCR haban sido registrados al microscopio ptico, permitieron poner a
punto la tcnica, probar los primers especie-especficos y evaluar la calidad del ADN en las muestras
arqueolgicas de los sitios estudiados. La identificacin de fragmentos de 450 pb en una muestra de ca. 8700
aos de antigedad supone buenas expectativas. En la muestra 37 haba sido identificadas larvas compatibles con
ancilostmidos (Ancylostomatidae, Nematoda) aunque los rasgos que son criterios taxonimcos no estaban bien
conservados. La deteccin de una banda a 500-600 pb esperable cuando se usan primers espece-especificos para
Ancylostoma sp. permiten corroborar parcialmente el resultado. La corroboracin final provendr de la
secuenciacin de los fragmentos obtenidos y de nuevas repeticiones de los experimentos realizados.

Como se mencion al comienzo, el establecimiento de un laboratorio de paleoescatologa molecular en
Argentina tiene mltiples cuestiones que deben resolverse para que pueda materializarse y consolidarse. Los
TOMO IV - 1397
CAPTULO 27 - SIMPOSIO 27
resultados preliminares descriptos son un ejemplo del potencial de la aplicacin de tcnicas moleculares en
arqueologa, especficamente en paleoparasitologa y de forma amplia, para la arqueologa ambiental.

En el CNAA realizado en Ro Cuarto, Crdoba, en el 2004 se present el primero trabajo paleoparasitolgico
realizado en Argentina. Desde entonces, la informacin paleoparasitolgica crece incesantemente. Se espera que
esta comunicacin, la primera en paleoescatologa molecular en Argentina, corra la misma suerte.

Agradecimientos
La consolidacin de la paleoparasitologa en Argentina no sera posible sin el apoyo de los arquelogos con
quienes colaboramos. Los trabajos de laboratorio son posibles mediante el apoyo econmico de CONICET,
Universidad Nacional de Mar del Plata y FONCyT (PICT 1576). Se agradece la colaboracin del Instituto de
Investigaciones Biolgicas (IIB) de la UNMdP.

Bibliografa
Civalero MT y Franco NV. 2003. Early human occupations in western Santa Cruz province, southernmost South
America. Quaternary International 109-110: 77-86.
Cutillas C, Oliveros R, de Rojas M, Guevara DC. 2004. Determinaion of Trichuris skrjabini by secuencing of the
ITS1-5.8S-ITS2 segment of the ribosomal DNA: comparative molecular study of different species of Trichurids.
Journal of Parasitology 90(3): 648-652.
Drancourt M y Raoult D. 2005. Paleomicrobiology: current issues and perspectives. Nature 3: 23-35.
Ferreira LF, Britto C, Cardoso MA, Fernandes O, Reinhard K, Arajo A. 2000. Paleoparasitology of Chagas
disease revaled by infected tises from chilean mummies. Acta Tropica 75:79-84.
Fugassa MH. 2006. Tesis doctoral: Enteroparasitosis en Poblaciones Cazadoras-Recolectoras de Patagonia
Austral. Facultad de Ciencias Exactas y Naturales. Universidad Nacional de Mar del Plata.
Fugassa, M.H., Arajo, A., Guichn, R.A. 2006. Quantitative paleoparasitology applied to archaeological
sediments. Memorias do Instituto Oswaldo Cruz, 101 (Suppl. II): 29-33.
Guichn, R.A., Suby, J., Casali, R., Fugassa, M.H. 2006. Health at the time of native-european contact in
Southern Patagonia. Memorias do Instituto Oswaldo Cruz, 101 (Suppl. II): 97-105.
Iiguez AM, Vicente ACP, Arajo A, Ferreira F, Reinhard K. 2002. Enterobius vermicularis: specific detection
by amplification of an internal region of 5S ribosomal RNA intergenic spacer and trans-splicing leader RNA
anlisis. E. vermicularis: specific detection by PCR and SL1 RNA analysis. Experimental Parasitology 102: 218-
222.
Iiguez AM, Reinhard K, Gonalves MLC, Ferreira LF, Arajo A, Vicente ACP. 2006. SL1 RNA gene recovery
from Enterobius vermicularis ancient DNA in pre-columbian human corpolites. International Journal for
Parasitology 36:1419-1425.
Leles D. 2008. Diagnstico paleoparasitolgico molecular de Ascaris lumbricoides (Linnaeus, 1758). Escola
Nacional de Sade Pblica Sergio Arouca. Fundacao Oswaldo Cruz.
Leles D, Arajo A, Ferreira LF, Vicente AC, Iiguez AM. 2008. Molecular paleoparasitological diagnosis of
Ascaris sp. from coprolites: new scenary of ascariasis in pre-Columbian South America times. Mmorias do
Instituto Oswaldo Cruz 103(1): 106-108.
Leles D, Fugassa MH, Arajo A, iiguez AM. 2009. First ancient DNA paleoparasitological analysis in
Patagonia, Argentina. III Paleopathology Meeting in South American. Necochea, Argentina.
Loreille O, Roumat E, Verneau O, Bouchet F, Hanni C. 2001. Ancient DNA form Ascaris: extraction
amplification and sequences from eggs collected in coprolites. International Journal of Parasitology 31:1101-
1106.
Marota L y Rollo F. 2002. Molecular paleontology. Celular and Molecular Life Sciences 59: 97-111.
NewtonLA, Chilton NB, Beveridge I, Hoste H, Nansen P, Gasser RB. 1998. Genetic markers form strongylid
nematodes of livestock defined by PCR-based restriction analysis of spacer rDNA. Acta Tropica 69: 1-15.
Pbo S. 1990. Amplifyng ancient DNA. In: Pbo S. PCR protocols: a quide to methods and applications.
California: Academic Press.
Zhu X, Spratt DM, beveridge I, Haycock P, Gasser RB. 2000. Mitochondrial DNA polymorphism within and
among species of Capillaria sensu lato from Australian marsupials and rodents. International Journal of
Parasitology 30: 933-938.
TOMO IV - 1398
Martn H. Fugassa y Andrea Cumino
ESTIMACIN DE CRONOLOGA RELATIVA MEDIANTE ESTUDIOS
APLICADOS SOBRE MATERIALES DE HIERRO PROVENIENTES DE LA
GUARDIA DE SAN MIGUEL DEL MONTE (PROVINCIA DE BUENOS AIRES)
Luis P. Traversa
*
, Mara Ins Casadas
**
y Mara Eugenia Peltzer
**


Resumen
En este trabajo se presentan los avances en las investigaciones del ao 2009 sobre distintos elementos metlicos
hallados en las excavaciones arqueolgicas realizadas en la Escuela N 16 de San Miguel del Monte. Los
estudios interdisciplinarios realizados por el LEMIT muestran tcnicas electroqumicas de limpieza sobre los
elementos metlicos analizados y estudios metalogrficos con el fin de estimar una cronologa aproximada de
orgenes y usos, estableciendo mediante la evaluacin de sus resultados las diferentes tipologas y
representatividad arqueolgica.

Introduccin
En las excavaciones arqueolgicas realizadas en la Escuela N 16 de San Miguel del Monte, Provincia de
Buenos Aires (Argentina), fueron descubiertos cimientos y materiales que corresponderan a la Maestranza de la
Guardia del Monte y a la Iglesia de la Divina Pastora. Estos emplazamientos funcionaron en el lugar durante
los siglos XVIII a XIX. El edificio correspondiente a la Iglesia de la Divina Pastora de Monte, originalmente
erigido hacia 1745, habra sido reconstruido por mandato de Juan Manuel de Rosas en el ao 1829 y demolido a
principios del siglo XX para la edificacin de la Escuela que hoy persiste (Casadas et al, 2004).

Objetivos
Recabar informacin acerca de la caracterizacin tecnolgica, microdureza y datacin de elementos de hierro
hallados en las excavaciones mencionadas. De estos materiales se presentan por una parte los metales
clasificados hasta el momento (desde el Instituto Cultural) y por otra parte, los resultados de los anlisis
realizados por el LEMIT.

Clasificacin de metales
Los trabajos arqueolgicos efectuados por personal del Instituto Cultural en cuanto anlisis y clasificacin de
materiales fueron realizados tanto sobre los elementos hallados en los sondeos realizados (Casadas et al, 2005),
como en los elementos extrados de los volquetes. Estos volquetes consistieron en montculos de tierra extrada
del desmoronamiento del patio de la escuela y dejados por personal de la municipalidad en un sitio cercano. Esta
tierra fue zarandeada por el equipo de investigacin y all se hall importante cantidad de material arqueolgico
del cual proceden las dos piezas metlicas analizadas en el presente trabajo.

Desde el Instituto Cultural fueron relevadas hasta el momento 553 piezas metlicas, las cuales corresponden a
materiales hallados en el Sondeo 2 (61 clavos y 78 fragmentos varios, ascendiendo a un total de 139
elementos) y a materiales procedentes de Volquetes (212 clavos, 198 fragmentos varios, 4 elementos
identificados como hoja de cuchillo, hacha de mano, hebilla cinturn y 2 ornamentos de lmpara de aceite.
Total 414 elementos).

Los datos porcentuales de los materiales analizados se muestran en el Grfico 1.

Caracterizacin Tecnolgica del Hierro y Ubicacin Temporal
El hierro primario se obtiene a partir del mineral que se encuentra en la corteza terrestre, compuesto
mayoritariamente por xido de hierro con xido de silicio (Fe2O3 + SiO2), por reduccin en estado slido.
Como consecuencia de este proceso el mineral se convierte en una esponja metlica con contenido variable de
inclusiones.



*
Laboratorio de Entrenamiento Multidisciplinario para la Investigacin Tecnolgica (LEMIT) direccion@lemit.gov.ar;
**
Instituto Cultural de la Provincia de Buenos Aires. mariacasadas@yahoo.com.ar; mepeltzer@yahoo.com.ar
TOMO IV - 1399
CAPTULO 27 - SIMPOSIO 27
0
50
100
150
200
250
300
1 2 3
Serie1

Grfico 1. Clavos, 2. Fragmentos Varios, 3. Elementos identificados

De acuerdo a la tecnologa empleada en la fabricacin de metales, que ha ido cambiando a lo largo del tiempo,
pueden distinguirse tres tipos de procesos que originan hierros de distintas caractersticas mecnicas y
metalogrficas, por lo cual surge una alternativa de inters para su datacin. Esos procesos son:
Prepudelado o forja catalana
En un principio, el hierro primario era calentado a la mayor temperatura posible (700 -800 C) para el momento
histrico en que se emplea esta tcnica. En estas condiciones la masa metlica era sometida a golpes de martillo
lo que provocaba la deformacin del metal, hacindolo ms plstico y provocando la fragmentacin y en cierta
medida la salida de las inclusiones frgiles. De esta manera se otorgaba una mayor continuidad metlica a la
pieza elaborada, observndose una estructura ferrtica con inclusiones diseminadas.
Pudelado
Durante el siglo XVIII, con el avance de la tecnologa, se alcanzan mayores temperaturas, logrndose la fusin
del hierro. No obstante, el sobrecalentamiento no era suficiente para lograr la decantacin y escorificacin de los
xidos. Entonces, para ayudar a la separacin la masa era sometida a agitacin o batido con esptulas de madera
hmeda, obtenindose un material con menor contenido de inclusiones que en el proceso precedente.
En el transcurso del proceso la slice se recombina formando silicatos, que al tener mayor ductilidad, acompaan
la deformacin del metal durante el posterior trabajado en caliente, apareciendo en forma de bandas inter
granulares.
Hierros Modernos
Durante la segunda mitad del siglo XIX, desarrollos logrados paralelamente en Inglaterra y Alemania (Bessmer-
Thomas y Siemens-Martin) permitieron realizar el proceso de afino del hierro en estado lquido aplicando un
sobrecalentamiento suficiente, como para facilitar la decantacin de los xidos. Luego con la aplicacin de
procesos de aceracin secundaria y metalurgia de cuchara se obtuvieron aceros con menor contenido
inclusionario y consecuentemente, una mayor dureza que fueron utilizados durante buena parte del siglo XX.

Anlisis de las piezas
Las piezas cuyo estudio se indican a continuacin fueron elegidas al azar de la totalidad de las muestras
obtenidas en las excavaciones, solamente se tuvo en cuenta para su eleccin que por su morfologa una podra
ser de hierro y la otra, por su diseo, de latn.
Pieza N 1
Hoja de cuchillo con espesor de 2,5 mm con proceso corrosivo (Imagen 1), proveniente de volquete.


Imagen 1. Pieza N 1

TOMO IV - 1400
Luis P. Traversa, Mara Ins Casadas y Mara Eugenia Peltzer
Estudios Metalogrficos
Se realizaron cortes longitudinales y transversales de partes del material, posteriormente pulidos y atacados con
Nital, habiendo sido observados y fotografiados al microscopio. Las piezas fueron sometidas a un proceso de
limpieza mediante tcnica catdica (Traversa et al, 2003).

En las observaciones al microscopio efectuadas sobre un corte longitudinal (Imagen 2) se aprecia el tamao, la
forma y dos tipos de inclusiones: xidos y silicatos, los que estn orientados en la direccin de deformacin
formando cadenas continuas y paralelas. Las cadenas se mantienen luego de ser atacado el corte con Nital al 2%.
En el corte transversal, tambin con ataque de Nital al 2% (Imagen 3), se detect la distribucin de las
inclusiones, observndose adems algunos granos de ferrita recristalizados y muy bajo contenido de perlita.


Imagen 2. Corte longitudinal (16X). Se ve Imagen 3. Corte transversal con ataque (16X)
la forma, el tamaos e inclusiones. Se observan las inclusiones y granos.

Ensayos de micro dureza
Luego de aplicar 300 gr de carga sobre la pieza, durante 5 segundos de aplicacin se obtuvieron valores de 150
Hv.

Datacin
De acuerdo a los estudios metalogrficos y los valores de micro dureza puede considerarse que la muestra
estudiada corresponde a un hierro antiguo del siglo XIX (Traversa et al, 200).

Pieza N 2
Ornamento correspondiente a posible lmpara de aceite proveniente del volquete, antes de la limpieza catdica
(Imagen 4). La limpieza con tcnica catdica (Traversa et al, 2002), permiti visualizar una pieza decapada del
color caracterstico de los latones -aleacin base cobre, teniendo al cinc como elemento de aleacin- (Imagen 5).



Imagen 4 Imagen 5

En los cortes realizados en la pieza 2, puede verse mediante fotomicrografas, el corte sin ataque (Imgen 6) con
gran cantidad de poros e inclusiones no metlicas. Mientras que en el mismo corte atacado con un reactivo Cu
TOMO IV - 1401
CAPTULO 27 - SIMPOSIO 27
ml (Hcl, Fe(III) y Alcohol, el cual es una solucin de Alcohol y Cloruro Frrico (HCl, Fe (III), se observ una
estructura dendrtica, clsica de los latones 70/30 fundidos, presentando gran cantidad de inclusiones en borde de
grano.

Imagen 6. Corte sin ataque (16X) Imagen 7. Corte atacado con reactivo frrico y alcohol (16X)

Ensayos de micro dureza
Los valores de micro dureza fueron de 170 Hv, con una carga de 300 gr durante 5 segundos de aplicacin.

Datacin
De acuerdo a los resultados de micro dureza y los estudios metalogrficos que indican que las estructura es tpica
de los latones, puede ubicarse la fabricacin de esta pieza a principio del Siglo XX

De acuerdo a los resultados de micro dureza y los estudios metalogrficos, la ubicacin temporal de la
fabricacin de esta pieza correspondera a principios del silgo XX.

Otros metales hallados en el sitio Escuela N 16 corresponden a distintos elementos de hierro (Imagen 8), a
diferentes elementos metlicos (Imagen 9) como reloj, arma, monedas, y a una hebilla de cinturn (Imagen 10)









Imagen 8. Elementos de hierro Imagen 9. Elementos metlicos


Imagen 10. Hebilla de cinturn




TOMO IV - 1402
Luis P. Traversa, Mara Ins Casadas y Mara Eugenia Peltzer
Conclusiones
En los casos en estudio se muestra como los trabajos interdisciplinarios entre la arqueologa histrica y el
anlisis realizado por medio de ensayos, mtodos y tcnicas de laboratorio, se pueden evaluar materiales
metlicos que presentan inters arqueolgico y con la obtencin de los resultados arribar, en muchos de los
casos, a datos significativos para la investigacin local y regional, ya que se puede llegar a datar su antigedad.

En los trabajos que se efectan se aplican tcnicas de evaluacin habituales, como son los estudios
metalogrficos o la determinacin de durezas, lo cual permite de acuerdo a los conocimientos disponibles,
definir perodos de manufactura de las piezas. Debe hacerse notar que en toda etapa tecnolgica existe una
superposicin en el uso de la tecnologa existente y de la nueva, lo cual puede muchas veces llevar a definiciones
incorrectas de la etapa de elaboracin pero, al interactuar con datos obtenidos desde otras especialidades, el
problema puede acotarse significativamente.

En el caso que nos ocupa, sobre los materiales de Hierro provenientes del sitio arqueolgico referido, los
resultados de los estudios metalogrficos realizados han sido comparados con la tecnologa empleada en la
fabricacin de metales, permitiendo arribar a una aproximacin en su datacin, ubicando cronolgicamente las
muestras analizadas como elaboradas en los siglos XIX y XX.

Agradecimientos
Los autores agradecen al Personal del rea Metalurgia del LEMIT por los ensayos realizados sobre las piezas
metlicas.

Bibliografa
Casadas M.I. y M. E. Peltzer, 2004. Rescate Arqueolgico en el Casco Urbano de la Ciudad de San Miguel del
Monte. Problemticas de la Arqueologa Contempornea, publicacin del XV Congreso Nacional de
Arqueologa Argentina, editado por la Universidad Nacional de Ro Cuarto, compiladores Antonio Austral y
Marcela Tamagnini, Ro Cuarto, Crdoba, pp. 223-227
Casadas M.I., M. E. Peltzer y N. Prieto, 2005. Resultado de los Anlisis Realizados sobre Materiales
Constructivos Procedentes de las Excavaciones Arqueolgicas en la Escuela N: 16 de San Miguel del Monte,
Provincia de Buenos Aires. Metodologas Cientficas Aplicadas al Estudio de los Bienes Culturales, Actas del
Primer Congreso de Arqueometra, Editado por Facultad de Humanidades y Artes, Rosario, pp. 167-176.
Traversa L.P., J. L. Sarutti, O. Otero y N. H. Russo, 2003. Restauracin Electroqumica y Restauracin de Piezas
de Hierro de Interes Arqueolgico. Sptimo Encuentro de Historia Regional del Sur Santafesino y Norte
Bonaerense.
Traversa L.P., J. L. Sarutti, J. L. Vetere y L. Terminillo, 2000. Restauracin y Estudio de Piezas de Hierro,
Elaboradas entre los siglos XVII y XVIII. Jornadas SAM 2000 - IV Coloquio Latinoamericano de Fractura y
Fatiga, Bariloche, Argentina.
Traversa L., R. Vetere y H. Russo, 2002. Limpieza mediante tcnicas electroqumicas de piezas arqueolgicas
metlicas corrodas. Actas del Primer Congreso Nacional de Arqueologa Histrica, Mendoza, Argentina, pp.
533-538.
TOMO IV - 1403
CAPTULO 27 - SIMPOSIO 27
TRAS LAS HUELLAS DEL FUEGO.
APORTES DEL ANLISIS DE MICROCARBONES A LA
ARQUEOLOGA DEL VALLE DE AMBATO (CATAMARCA)
Henrik B. Lindskoug
*


Introduccin
La Pedoantracologa es un campo relativamente reciente y su aplicacin a casos en la Argentina es un paso
nuevo en la Arqueologa regional. Se trata del estudio, identificacin y fechado de carbn vegetal microscpico
recuperado en suelos. Nos ofrece un mtodo complementario para la reconstruccin de la vegetacin basado en
el mtodo de polen y provee de registros con una resolucin alta a escala local (Di Pasquale et al 2008; Thinon
1978). Presentamos aqu los estudios preeliminares que estamos llevando a cabo en el Valle de Ambato,
provincia de Catamarca, a fin de generar informacin acerca de fuegos silvestres del pasado y aportar datos
paleoambientales del rea.

Los contextos que asociamos a los momentos finales de la ocupacin Aguada en Ambato muestran, en su mayor
parte, situaciones que sugieren un abandono brusco. Se caracterizan por la presencia de techos quemados y
colapsados, lo que gener la rotura de piezas, algunas de ellas an con contenido. A este hecho se suma una
distribucin de objetos en reas de actividades como si estuvieran en uso, tales como conjuntos de vasijas,
morteros y manos, fogones sin limpiar, etc. Tambin asociados a estos contextos, se observa el derrumbe de los
muros. Este escenario sugiere un abandono no planificado de los sitios (Laguens 2006). Con respecto a las
dataciones absolutas realizadas para estos eventos, stas arrojaron resultados entre 1000 100 d.C. (Gordillo
2005; Marconetto 2007) indicando la contemporaneidad de los mismos.

El anlisis de sedimentos muestreados fuera de sitios permite monitorear frecuencias de microcarbones. Estas
pueden indicar eventos de fuegos pretritos y complementar informacin ya disponible sobre perodos de sequa
en la regin (Marconetto 2009). Tambin aporta informacin acerca de la naturaleza de los fuegos que afectaron
los sitos arqueolgicos (Lindskoug y Mors 2010). Manejamos la hiptesis de que incendios forestales pudieron
afectar la regin hacia finales del primer milenio, con el consecuente incendio de asentamientos.

Como antecedente de la Pedoantracologa se mencionan los estudios de polen que incluan el conteo de
microcarbones, particularmente en sedimentos de lagos. El trabajo pionero de Iversen (1941) fue uno de los
primeros en realizar este tipo de estudios. El primer trabajo definido como pedoantracolgico corresponde a
Thinon (1978) quien hace una propuesta metodolgica que servir de base a posteriores trabajos. Entre los
estudios mas reciente de pedoantracologa en sedimentos secos y en paisajes montaosos, podemos mencionar
Carcaillet y Thinon (1996) quienes desarrollaron una de las tcnicas ms empleadas actualmente.

El fuego incrementa el magnetismo en los suelos y genera diversos cambios en el sedimento. Por lo que otro
mtodo de identificacin de incendios en el pasado es el uso de magnetmetro para identificar cambios en el
magnetismo del suelo producido por fuegos intensos (Linford y Canti 2001; Peters et al 2001).

Naturaleza de los fuegos
Uno de los problemas relevantes sobre los que trabajamos es el anlisis de la naturaleza de los fuegos que
afectaron la regin del Ambato a fines del primer milenio. Estos pudieron ser de carcter natural, accidental o
intencional, por lo que las diferencias tendrn implicancias significativas en la comprensin del proceso de
abandono en Ambato. El hecho de estar ligados a cuestiones paleoambientales o ser intencionales cambia la
perspectiva para entender el proceso.

En el primer caso, el vnculo entre sequas e incendios naturales ha sido tratado ampliamente en la bibliografa
(Whitlock et al 2003; Long y Whitlock 2002; Meyer y Pierce 2003). Dado que se han detectado indicadores de
aridez para nuestra rea de estudio mediante el anlisis de la anatoma de leos carbonizados de Geoffroea
decorticans recuperados en contextos finales de la ocupacin (Marconetto 2010), las condiciones para la
ocurrencia de incendios creemos estuvo dada. La naturaleza de estos fuegos pueden deberse a un origen natural o

*
Museo de Antropologa, Facultad de Filosofa y Humanidades, Universidad Nacional de Crdoba, CONICET.
henrikblindskoug@gmail.com
TOMO IV - 1405
CAPTULO 27 - SIMPOSIO 27
antrpico. Las fuentes naturales de ignicin estn principalmente vinculadas a actividades volcnicas -descartada
para nuestra rea de inters- o rayos, asimismo a combustiones accidentales de origen antrpico. En ambos casos
las condiciones de humedad son un factor importante (Carcaillet 1998:389) pues los incendios, son ms
frecuentes cuando hay una gran cantidad de combustible disponible.

En el caso de incendios intencionales, stos pueden estar ligados tanto a conflictos externos como a prcticas
sociales, ideolgicas y simblicas (Verthoeben 2000). Respecto a la problemtica arqueolgica planteada para
Ambato, planeamos verificar la existencia de incendios forestales, y de descartarla pasar al anlisis de otro tipo
de variables.

Pedoantracologa /Estudios de microcarbones
El estudio de microcarbones ha sido utilizado por varios autores a fin de analizar regmenes de fuegos (Patterson
et al 1987). Whitlock y Millspaugh (1996) y Clark (1988a) han desarrollado tcnicas y modelos tericos sobre la
dispersin de carbn post incendios y su acumulacin durante y despus de los eventos de combustin. Whitlock
ha realizado numerosos estudiosos empleando conteos de microcarbones como dato para analizar fuegos
prehistricos, cambios climticos e historia de la vegetacin en EEUU (Whitlock et al 2003, Long y Whitlock
2002). Meyer y Pierce (2003) han hecho estudios para reconstruir la historia de fuegos silvestres relevando
muestras en sedimentos aluviales y coluviales. En el caso de Argentina, Huber y Markgraf (2003) han realizado
estudios acerca del impacto europeo en los regimenes de fuego natural y de la dinmica de la vegetacin en el
sur de Patagonia.

Existe una diferencia entre la Arqueoantracologa (las muestras obtenidas son resultado de la seleccin de
especies para consumo del hombre) y la Pedoantracologa. Esta ltima se basa en la identificacin y datacin de
los carbones recuperados en paleosuelos. Los carbones estudiados son resultado de incendios naturales o
provocados para ampliar campos de cultivos. La ventaja es que la muestra no esta distorsionada por la seleccin
de especies por parte del hombre. En los casos en que es posible la identificacin debido al tamao de la muestra
esta se determina taxonmicamente, o simplemente se trabaja con conteos (Talon et al 1998; Abdoun et al 2000).

Algunas Cuestiones Acerca del Carbn Recuperado en Suelos
Segn Patterson et al (1987) este tipo de anlisis debe contemplar diversas cuestiones. La combustin y la
produccin de carbn, los procesos tafonmicos que afectan al material, la dispersin, la depositacin y la
preservacin. Adems de estos procesos el conjunto estar tambin afectado por la toma de muestras. Pueden
interferir en el anlisis el muestreo, la preparacin y el conteo.

La seleccin de las reas off site a muestrear deben estar guiadas por la historia geolgica reciente de la regin de
modo de lograr las mejores zonas de trampa. Otra cuestin en el proceso de muestreo de los sitios
seleccionados para el estudio es la posible mezcla de estratos debida a procesos naturales como la bioturbacin,
la que puede ser frecuente, por lo cual es una variable a considerar al realizar las calicatas de extraccin de
material.

El tamao de los microcarbones puede indicar tambin la distancia a la fuente de los fuegos. Generalmente
fragmentos grandes indican una fuente ms cercana y fragmentos chicos que se dispersan con el viento
fuentes de ignicin mas alejadas. As, segn los tamaos de los fragmentos, se puede ver si el fuego es de origen
local o regional, como es discutido en Patterson et al (1987 y Clark (1988a). Clark (1988a) por su parte, ha
desarrollado modelos y formulas de transporte de carbn, aunque hay que tener en cuenta que solamente son
modelos y hay diversidad de factores que afectan los procesos de depositacin de los carbones y la
fragmentacin del los mismos.

Un problema relevante es la identificacin de los microcarbones de origen vegetal, dado que al observarlos en
lupa y microscopio es normal que se confundan con otros elementos negros. En el caso en que se observe
anatoma vegetal este problema no es tal, aunque esto depende a veces del tipo de sedimento. Algunos
microcarbones pueden estar sucios, esto es, que su anatoma est encubierta por sedimentos altamente
arcillosos por ejemplo, y eso dificulta la identificacin. Tambin es necesario contar con un anlisis de la matriz
de modo de poder conocer la presencia de minerales oscuros que interfieran en los conteos. Segn los estudios
experimentales del Umbanhowar y McGrath (1998) es posible diferenciar tres tipos de microcarbones asociados
a diferentes tipos de vegetacin. Microcarbones que provienen de pastos, son ms largos (562m) y tiene una
relacin largo:ancho mayor a los que proceden de hojas (380 m; 1.91) o de madera (348 m; 2.13)
TOMO IV - 1406
Henrik B. Lindskoug
(Umbanhowar y McGrath 1998). No obstante, la anatoma de las clulas, de ser observable, es el mejor
indicador.

Preparado de Muestras
Un problema que los investigadores enfrentan es la falta de una mtodo de extraccin y conteo universal de
microcarbones para estudiar regimenes de fuego en el pasado. El mtodo ms comn para reconstruir historias
de fuegos ha sido la preparacin de slides para anlisis de polen (Whitlock y Millspaugh 1996), de este modo
se puede hacer el extraccin de las muestras y conteo de polen y microcarbones en una sola muestra/preparado,
lo cual insume mayor tiempo. Segn Turner (2007:32) quien realiz una interesante evaluacin de diferentes
mtodos, hay varios problemas con este mtodo. Los elementos mayores a 180 m se elimina en el proceso de
limpieza de muestras para polen y, por otra parte, la preparacin de muestras para conteo de polen es muy
riguroso e implica muchos pasos, por lo que es muy probable que resulte en la fragmentacin de los
microcarbones dando una sobreestimacin del numero de elementos de carbn (Clark 1984 en Turner 2007:36).

Entre los mtodos que se emplean, podemos mencionar: 1) el basado en cortes petrogrficos Petrographic Thin
Sections desarrollado por Clark (1988b); 2) Oregon Sieving Technique sugerido por Millspaugh y Whitlock
(1995); 3) blanqueo y filtrado (Bleaching and filtering (Rhodes 1996, 1998); 4) el mtodo basado en la
separacin de densidad fue empleado por primera vez por Clark (1984), pero la tcnica no est aun lo
suficientemente afinada segn Turner (2007:44); 5) Turner y colaboradores (2008) continuaron desarrollando la
tcnica y durante el proceso surgi el separacin de densidad y blanqueo (Turner 2007; Turner et al 2008); 6)
Otra tcnica es la empleada por Carcalliet y Thinon (1996) que implica grandes sondeos para toma de muestras
de sedimento, flotacin de las mismas y luego datacin con AMS y es la ms empleada entre investigadores
europeos, aunque se recupera el material de mayor tamao.

Tcnicas de Conteo
Como se mencion, no existe tampoco un mtodo estandarizado para la cuantificacin de microcarbones. Tres
mtodos fueron especficamente desarrollados para este fin 1) Absolute abundance measures, 2) Point count y 3)
Area measurment.
La medida de la abundancia absoluta (Absolute abundance measures) fue propuesta por Patterson y
colaboradores (1987) e involucra el conteo total de todas las partculas, independientemente del tamao que
posean. Clark (1982) utiliz el mtodo de Conteo de puntos (Point count), esta tcnica provee una manera rpida
de medir el cantidad de carbn en una muestra. La tcnica emplea una grilla (en el ocular del microscopio) y se
elige un nmero de puntos estandarizados normalmente 11- sobre los cuales se realiza el conteo de partculas de
carbn (Turner 2007:38). El conteo por reas (Area measurment) es el tercer mtodo empleado para conteo de
microcarbn y fue desarrollado por Waddington (1969) para el conteo de polen y luego aplicado a este tema, se
basa en el clculo de porcentaje de rea que ocupan las partculas en el preparado. Otra propuesta es el anlisis
de imgenes de software (Image anlisis software) aplicado por Horn et al (1992) y luego desarrollado por otros
investigadores. El problema con esta tcnica, aun en desarrollo, es que el software realiza conteos en base al
color de las imgenes tomadas del microscopio, no discriminando el material que corresponde o no a restos de
carbn vegetal.

Afinando tcnicas: Caso de Ambato
Dada la diversidad metodolgica referida al tema que nos ocupa y la incidencia de diferentes factores como la
geologa local, la topografa, el tipo de sedimentos, etc., y al no contar con experiencias previas para la regin
hemos comenzado a experimentar diversas alternativas.

Como primer intento y a fin de familiarizarnos con las muestras, seleccionamos como potencial lugar de trampa
de microcarbones la base de la primera terraza del Ro de los Puestos en el valle de Ambato. Gran parte de este
tipo de estudios se realiza en fondos de lagunas, depresin topogrfica inexistente para nuestra zona de inters.
Muestreamos sedimento cada 5 cm en un perfil de 1,10 m, desde la superficie actual hasta un estrato de
sedimento orgnico sobre el cual realizamos una datacin LP- 2211: 2370 60 aos AP. Si bien no podemos
asegurar que la continuidad de deposicin est ntegramente representada, emplearemos este estrato como
marcador de mbito local para futuros muestreos y el material recuperado ser datado por AMS de modo de
poder establecer correlaciones con incendios forestales pasados.

Las 21 muestras recuperadas de este procedimiento, comenzaron a procesarse. Con el objeto de tener una
primera aproximacin, se realizaron preparados con aceite y con agua destilada para ser observados en
TOMO IV - 1407
CAPTULO 27 - SIMPOSIO 27
microscopio ptico a 40x, 100x, 400x, se realizaron observaciones ensayando diferentes tipos de luz -incidente y
transmitida- y se tomaron fotomicrografas de las mismas.

Fue destacable que todas las muestras contenan abundantes partculas negras, no obstante no necesariamente
correspondan a trazas de carbn vegetal. La presencia de abundante cantidad de biotita (mica negra) en el suelo
dificultaba la identificacin del carbn.

Estas muestras tambin fueron analizadas para ver el contenido de material orgnico. Se realizaron anlisis de
fosfatos y susceptibilidad magntica a fin de aportar mayor informacin al anlisis paleoambiental del rea e
identificar otros biomarcadores. Estos anlisis nos pueden ayudar identificar cambios en condiciones
ambientales, como ciclos hmedos y secos y pocas de erosin.

Con el fin de entrenarnos en la deteccin de microcarbones en los preparados, analizamos sedimentos
recuperados en zonas recientemente afectadas por incendios forestales en las sierras de Crdoba. Muestreamos
en regiones cuya topografa y formacin forestal no fuera muy diferente a la fisonoma de Ambato. Tanto
nuestra zona de estudio como las sierras cordobesas corresponden a las Sierras Pampeanas, asimismo la
vegetacin tanto de los muestreos actuales como parte del sector oriental del valle de Ambato corresponden a la
Provincia Chaquea (Cabrera 1976). En cuanto a la vegetacin en Ambato para finales del primer milenio, no
presenta diferencias significativas a la actual (Marconetto 2008).

El sedimento recuperado en las 4 estaciones de muestreo afectadas recientemente por el fuego fue tomado en
superficie hasta 10 cm de profundidad, esto nos aseguraba el contenido de residuos vegetales carbonizados.
Realizamos preparados en portaobjetos para ser observados bajo el microscopio con las mismas tcnicas que
empleamos para la observacin de material recuperado en Ambato.

El resultado de la observacin de muestras actuales evidenci abundante material, esto sobre todo debido a que
el terreno -dado el escaso tiempo transcurrido desde los incendios, un mes- aun no haba sido muy afectado por
factores como vientos, lluvias, etc. Tambin se evidenci que era posible observar rastros de la anatoma de los
restos vegetales carbonizados muy fragmentados. Asumimos que lo mismo ocurrir con restos entrampados en
sedimentos resultantes de combustiones pasadas ya que la estructura anatmica se conserva perfectamente a
pesar de la accin del fuego y el tiempo transcurrido, siendo esto la base de los anlisis antracolgicos
(Marconetto 2008).

En base a esto, hemos comenzado a ensayar algunas tcnicas que nos permitan clarificar las muestras tomadas en
Ambato a fin de separar partculas negras que dificulten la observacin, como por ejemplo minerales como
(biotitas), partes de insectos, probando con diferente tipos de flotacin del sedimento y filtrando con papel filtro
de diferentes tamaos.

Si bien esta investigacin se encuentra en una fase inicial y experimental, creemos estos estudios pueden resultar
en un interesante aporte a las preguntas planteadas en le marco de nuestro proyecto de investigacin acerca del
fin de las ocupaciones Aguada en el valle de Ambato.

Bibliografa
Abdoun F., M. Thinon, y M. Alifriqui. 2000. La pdoanthracologie, outil palocologique des regions sches.
Libre dActes de II Colloque International dAnthracologie. Paris.
Cabrera A.1976. Regiones fitogeogrficas argentinas. Enciclopedia Argentina de agricultura y jardinera 2da Ed.
2: 1-85.
Carcaillet, C. 1998. A Spatially Precise Study of Holocene Fire History, Climate and Human Impact within the
Maurienne Valley, North French Alps. Journal of Ecology 86(3): 384-396.
Carcaillet, C. y M. Thinon. 1996. Pedoanthracological contribution to the study of the evolution of the upper
treeline in the Maurienne Valley (North French Alps): methodology and preliminary data. Review of
Palaeobotany and Palynology 91 (1-4): 399-416.
Clark, J. S. 1988a. Particle Motion and the Theory of Charcoal Analysis: Source Area, Transport, Deposition,
and Sampling. Quaternary Research 30: 67-80.
Clark, J. S. 1988b. Stratigraphic Charcoal Analysis on Petrographic Thin Sections: Application to Fire History in
Northwestern Minnesota. Quaternary Research 30: 81-91.
Clark, R.L. 1982. Point count estimation of charcoal in pollen preparations and thin sections of sediments. Pollen
et Spores 24: 523-535.
TOMO IV - 1408
Henrik B. Lindskoug
Clark, R.L. 1984. Effects on charcoal of pollen preparation procedures. Pollen et Spores 26: 559-576.
Di Pasquale, G., M. Marziano, S. Impagliazzo, C. Lubritto, A. De Natale y M. Y. Bader. 2008. The Holocene
treeline in the Northern Andes (Ecuador): First evidence from soil charcoal. Palaeogeography,
Palaeoclimatology, Palaeoecology 259:17-34.
Gordillo, I. 2005. Dimensin temporal del sitio La Rinconada: Su interpretacin y aportes a la historia del
Perodo Medio. La Cultura de La Aguada y sus expresiones regionales. V Mesa Redonda La Cultura de la
Aguada y su dispersin: 159-171. EDULAR. Universidad Nacional de La Rioja. La Rioja.
Horn, S. P., R. D. Horn y R. Byrne. 1992. An Automated Charcoal Scanner for Paleoecological Studies.
Palynology 16: 7-12.
Huber, U. M. y V. Markgraf. 2003. European impact on fire regimens and vegetation dynamics at the steppe-
forest ecotone of southern Patagonia. The Holocene 13(4): 567-579.
Iversen, J. 1941. Landnam i Danmarks Stenalder: En pollenanalytisk Undersgelse over det frste Landbrugs
Indvirkning paa Vegetationsudviklingen. Land occupation in Denmark's Stone Age. Danmarks Geologiske
Undersgelse, 11 (66) :7-65.
Laguens, A. G. 2006. Espacio social y recursos en la Arqueologa de la desigualdad social, 2006. Contra la
tirana tipolgica en arqueologa: una visin desde Suramrica. Editado por C. Gnecco y C. H. Langebaek, pp.
99-119. Universidad de los Andes, Facultad de Ciencias Sociales, CESO, Ediciones Uniandes, Bogot.
Linford, N.T. y M. G. Canti. 2001. Geophysical Evidence for Fires in Antiquity: Preliminary Results from an
Experimental Study. Paper Given at the EGS XXIV General Assembly in The Hague, April 1999.
Archaeological Prospection 8: 211-225.
Lindskoug, H. B., V. Mors. 2010. Cenizas de qu carbones? Anlisis de residuos de combustin en el sitio
piedras blancas, Dpto. Ambato, Catamarca. Libro de 3 Congreso Argentino de Arqueometra. En prensa.
Long, C. J. y C. Whitlock. 2002. Fire and Vegetation History from the Costal Rain Forest of the Western Oregon
Coast Range. Quaternary Research 58: 215-225.
Marconetto, M. B. 2007. Aportes de la Antracologa a la cronologa del Valle de Ambato, 2007.
Paleoetnobotnica del cono sur: Estudios de casos y propuestas metodolgicas. Compilado por B. Marconetto, P.
Babot y N. Oliszewski, pp. 197- 218. Museo de Antropologa, FFyH, UNC y Ferreyra editor, Crdoba.
Marconetto M.B 2008. Recursos Forestales y el proceso de diferenciacin social en tiempos prehispnicos. Valle
de Ambato, Catamarca. BAR South America Archaeology Series. 3 A. Izeta editor. Oxford.
Marconetto, M. B. 2009. Rasgos anatmicos asociados al estrs hdrico en carbn vegetal arqueolgico, Valle de
Ambato (Catamarca), fines del primer milenio. Darwiniana 47(2): 247-259.
Marconetto, M.B. 2010. Paleoenvironment and Anthracology: Determination of variations in humidity based on
anatomical characters in archealogical plant charcoal. Journal of Archaeological Science. En prensa.
Meyer, G. A. y J. L. Pierce. 2003. Climatic controls on fire-induced sediment pulses in Yellowstone National
Park and central Idaho: a long-term perspective. Forest Ecology and Management 178: 89-104.
Millspaugh S. H. y C. Whitlock. 1995. A 750-year fire history based on lake sediment records in central
Yellowstone National Park, USA. The Holocene 5(3): 283-292.
Patterson, W. A., K. J. Edwards y D. J. Maguire. 1987. Microscopic charcoal as a fossil indicator of fire.
Quaternary Science Reviews 6: 3-23.
Peters, C, M.J. Church y C. Mitchell. 2001. Investigation of Fire Ash Residues Using Mineral Magnetism.
Archaeological Prospection 8: 227-237.
Rhodes, A.N., 1996. Moorland fire history from microscopic charcoal in soils and lake sediments. Tesis
doctoral, no publicada, Universidad de Newcastle upon Tyne, Newcastle upon Tyne, Reino Unido.
Rhodes, A. N. 1998. A method for the preparation and quantification of microscopic charcoal from terrestrial
and lacustrine sediment cores. The Holocene 8(1): 113-117.
Talon, B., C. Carcaillet y M. Thinon. 1998. tudes pdoanthracologiques des variations de la limite suprieure
des arbres au cours de l'Holocene dans les alpes franaises. Gographie physique et Quaternaire 52(2):195-208.
Thinon, M., 1978. La pdoanthracologie: une nouvellemthode d'analyse phytochronologique depuis le
nolithique. Comptes Rendues de l'Acadmie Des Sciences Paris, Srie D 287: 12031206.
Turner, R. 2007. Late Quaternary fire histories in the Eastern Mediterranean region from lake sedimentary
micro-charcoals. Tesis doctoral, no publicada, Universidad de Plymouth, Plymouth, Reino Unido.
Turner, R., A. Kelly y N. Roberts. 2008. A critical assessment and experimental comparision of microscopic
charcoal extraction methods. Charcoal from the Past: Cultural and Palaeoenvironmental Implications.
Proceedings of the Third International Meeting of Anthracology, Cavallino Lecce (Italy), June 28
th
July 1
st

2004. Editado por: G. Fiorentino y D. Magri. BAR International Series 1807.
Umbanhowar Jr., C. E., M. J. McGrath. 1998. Experimental production and analysis of microscopic charcoal
from wood, leaves and grasses. The Holocene 8(3): 341-346.
TOMO IV - 1409
CAPTULO 27 - SIMPOSIO 27
Verthoeben M. 2000. Death, fire and abandonment. Ritual practice at late Neolithic Tell Sabi Abyad, Syria.
Archaeological Dialogues 7:46-65.
Waddington, J.C.B. 1969. A stratigraphic record of the pollen influx to a lake in the Big Woods of Minnesota.
Geological Society of America Special Paper 123: 263-283.
Whitlock, C. y S. H. Millspaugh. 1996. Testing the assumptions of fire-history studies: an examination of
modern charcoal accumulation in Yellowstone National Park, USA. The Holocene 6(1): 7-15.
Whitlock, C., S. L. Shafer y J. Marlon. 2003. The role of climate and vegetation change in shaping past and
future fire regimes in the northwestern US and the implication for ecosystem management. Forest Ecology and
Management 178: 5-21.







TOMO IV - 1410
Henrik B. Lindskoug
GEOFSICA APLICADA A LA ARQUEOLOGA: LA LOCALIZACIN
DEL FUERTE SANCTI SPRITUS (1527-1529), PUERTO GABOTO,
PROVINCIA DE SANTA FE
Gabriel Cocco
*
, Guillermo Frittegotto
**
, Nstor Bonomo
***
,
Matas de la Vega
***
, Patricia Martinelli
***
y Ana Osella
***


Resumen
En el marco de un proyecto de investigacin arqueolgica Localizacin del primer asentamiento espaol en el
Ro de la Plata, localidad de Puerto Gaboto
1
, se realizaron prospecciones geofsicas con el objetivo de detectar
estructuras de tierra cruda que pudieran corresponder al Fuerte Sancti Spritus (1527-1529), el asentamiento
espaol establecido por Sebastin Caboto en la confluencia de los ros Carcara y Coronda, en el rea donde
actualmente se encuentra la localidad de Puerto Gaboto, Departamento San Jernimo, provincia de Santa Fe.
Como resultado de la aplicacin de tres mtodos de prospeccin geofsica complementarios entre s y de la
realizacin de excavaciones arqueolgicas en concordancia con dichas prospecciones, se localizaron estructuras
geomtricas y lineales de tierra cruda apisonada (tapia) correspondientes al asentamiento espaol del siglo XVI.

Las investigaciones arqueolgicas
El proyecto fue iniciado en el ao 2006 con el objetivo de localizar y recuperar evidencias arqueolgicas
referidas al Fuerte Sancti Spritus (1527-1529). En esta primera etapa se demarc un rea de estudio de 17,5
kilmetros cuadrados sobre la desembocadura del ro Carcara, efectundose dentro de ella prospecciones
areales, recolecciones de superficie y pozos de sondeos; todo ello con el fin de identificar sitios arqueolgicos y
analizar su distribucin dentro del paisaje.

Como resultado se localizaron diversos sitios arqueolgicos donde se conservan evidencias materiales que
pueden ser asociadas a las poblaciones aborgenes locales as como al primer asentamiento espaol en la cuenca
del Ro de La Plata. De los numerosos sitios arqueolgicos que fueron identificados en el rea prospectada a
ambas mrgenes del ro Carcara, fue en el sector sureste de la localidad de Puerto Gaboto donde se localizaron
evidencias de la presencia espaola. Las mismas proceden del sitio Eucaliptus, donde se realizaron pozos de
sondeo que posibilitaron recuperar materiales de origen europeo (cuentas de collar de vidrio, cermica vidriada y
maylica) asociados a artefactos de manufactura local (cermica indgena) que fueron relacionados con el
asentamiento espaol del siglo XVI.

A partir de los resultados obtenidos, en una segunda etapa de investigacin se plante como objetivo el estudio
del sitio Eucaliptus con el fin analizar los procesos culturales relacionados con la presencia espaola en la
Cuenca del Ro de La Plata a principios del siglo XVI y de las ocupaciones posteriores (Frittegotto et al. 2009).
Desde el inicio del proyecto se requiri del aporte de otras disciplinas como la historia, la geologa y la geofsica,
y la aplicacin de una metodologa integradora de las disciplinas intervinientes que permitiera ofrecer una
perspectiva ms amplia para la interpretacin y anlisis de las evidencias arqueolgicas.

De acuerdo a los antecedentes histricos (Medina 1908) la estructura del Fuerte Sancti Spritus y de las viviendas
de este mismo asentamiento haban sido construidas con madera y tierra cruda (adobe y tapia). Por otra parte, el
asentamiento tuvo una existencia breve. En el trmino de casi tres aos se sucedieron una serie de hechos que
modificaron ostensiblemente las relaciones entre los grupos locales y los miembros de la expedicin de Caboto
que culminaron con el ataque, incendio y destruccin de todo el asentamiento espaol. Durante la segunda etapa
del proyecto, teniendo en cuenta la posibilidad de que se conserven estructuras en el sitio donde estuvo situado el
asentamiento, se consider necesario la realizacin de prospecciones no intrusivas. Para ello, se solicit la
intervencin del equipo de geofsica aplicada y ambiental del Departamento de Fsica de la Facultad de Ciencias
Exactas y Naturales de la UBA.

Desde el punto de vista metodolgico este tipo de intervenciones no invasivas en el terreno posibilitaron la
deteccin de rasgos de origen antrpico y permitieron seleccionar con mayor precisin los sectores a excavar

*
Dpto de Estudios Etnogrficos y Coloniales, Ministerio de Innovacin y Cultura de la Pcia. de Santa Fe - gabrielcocco@gmail.com
**
Universidad Abierta Interamericana guillefri@yahoo.com.ar
***
Geofsica Aplicada y Ambiental - Dto. de Fsica - FCEN - UBA/ CONICET - osella@df.uba.ar
TOMO IV - 1411
CAPTULO 27 - SIMPOSIO 27
potencialmente pasibles de contener evidencias que se relacionen con el asentamiento espaol de principios del
Siglo XVI, puntualmente, la identificacin de estructuras de tierra cruda.
Los mtodos geofsicos
Para el presente trabajo se utilizaron tres mtodos de prospeccin geofsica, complementarios entre s: georadar
(GPR), electromagntico de fuente controlada (EMI) y geoelctrica (Osella 2009).

El mtodo de Georadar consiste en enviar hacia el subsuelo un pulso electromagntico emitido por un dipolo
oscilante ubicado en la superficie de la tierra, y medir el intervalo de tiempo entre su emisin, reflexin en una
dada interfaz, y recepcin, esto ltimo llevado a cabo a travs de otra antena. Con este intervalo de tiempo y
suponiendo conocida la velocidad de propagacin en el subsuelo, se calcula la profundidad del reflector. En el
mtodo EMI se utilizan dos bobinas mviles. Una de ellas transmite un campo magntico alterno, primario, que
induce corrientes en el subsuelo. Estas corrientes, a su vez, producen un campo secundario que es detectado por
la otra bobina. En presencia de un cuerpo enterrado, el campo secundario depende de la resistividad elctrica y la
permeabilidad magntica del mismo respecto de las del medio que lo contiene. Variando la frecuencia de la
seal, se vara la profundidad de penetracin. Un rango adecuado para prospecciones superficiales abarca entre
300 y 50000 Hz. Para el mtodo geolectrico se emplea una fuente controlada de corriente, la cual se inyecta en
la tierra a travs de un par de electrodos. Se realizan mediciones de diferencia de potencial entre otro par de
electrodos y con las mediciones de la corriente se determina la resistividad aparente. Utilizando un sistema
multielectrodo, se pueden obtener tomografas elctricas en 2D y 3D.

Descripcin del trabajo Geofsico
Se midi con EMI, GPR y Geoelctrica, un rea de 35m por 30m, en x e y, respectivamente. Esta rea se dividi
en 2 sectores, el sector 1 que va de x=17 a 35m, y el sector 2 que va de x=0 a 17m (Figura 1).



Figura 1: Esquema del sector relevado con los mtodos geofsicos

Para los sondeos de georadar se utiliz un equipo Pulse EKKO Pro, con antenas de 500 MHz. Se realizaron
barridos a lo largo de lneas paralelas espaciadas 1 m, en dos direcciones ortogonales entre s, con un intervalo de
muestreo de 0.025 cm. Para el mtodo electromagntico se us un equipo multifrecuencial GEM-2, con
frecuencias entre 300 y 40000 Hz. Tambin se realizaron barridos en dos direcciones perpendiculares entre s, en
este caso con un espaciamiento de 0.5 m. Para geoelctrica se utiliz un equipo multielectrdico automtico
Saris. Se realizaron 9 lneas en configuracin dipolo-dipolo, con aberturas de 0.75 m.

Resultados
Las figuras 2 y 3 muestran algunas vistas en planta de los datos de GPR, representativas de los principales
resultados. En cada una, el tiempo (o profundidad aparente) es constante. Para obtener la profundidad aparente
aproximada en cada planta es necesario multiplicar al tiempo en cuestin por la mitad del tiempo representativo
de ida y vuelta, es decir (5.5+/-0.8) cm/ns si se considera el anteriormente mencionado. Las figuras estn
encolumnadas: la primer columna corresponde a los sondeos realizados a lo largo de la direccin x, mientras
TOMO IV - 1412
Gabriel Cocco, Guillermo Frittegotto, Nstor Bonomo, Matas de la Vega, Patricia Martinelli y Ana Osella
que la segunda a los sondeos realizados a lo largo de la direccin y. En algunas de las figuras, con lneas
punteadas de colores, se sealaron los principales rasgos asociados con las anomalas detectadas. En el resto no
se incluy esta marcacin por ser los resultados evidentemente similares a los ya indicados.




Figura 2. Plantas de promedios espaciotemporales de las amplitudes de
los datos GPR en el Sector 1: a) t = 8.6 ns, b) t = 9.6 ns.


Figura 3. Plantas de promedios espaciotemporales de las amplitudes
de los datos GPR en el Sector 2. a) t = 2.0 ns, b) t = 7.6 ns

Las plantas de los datos muestran un conjunto de rasgos lineales, la mayora de ellos con orientaciones de
aproximadamente 45 respecto de los bordes de ambos sectores, adems de algunas anomalas relativamente
pequeas en extensin. Muchos de estos rasgos son bastante rectos, y forman ngulos de 90 entre s, lo que
indica una probabilidad alta de que tengan origen cultural.

En el Sector 2, el mtodo EMI no brind resultados significativos. En el Sector 1, se detectaron varias anomalas
cuyas orientaciones coinciden con las de los rasgos obtenidos con GPR en el Sector1 (Figura 4).
TOMO IV - 1413
CAPTULO 27 - SIMPOSIO 27

Figura 4. Planta de la componente del campo magntico secundario en cuadratura con el campo
EMI primario, para el Sector 1, a una frecuencia representativa .Las lneas punteadas indican las
anomalas coincidentes con las halladas con el georadar.

Finalmente, otro resultado interesante es que cerca de las posiciones donde las distintas lneas de geoelctrica
intersectan los rasgos de posible origen cultural, en la mayora de los casos se observa un incremento de la
resistividad elctrica del subsuelo. Dos ejemplos de esto se muestran en la Figura 5.





Figura 5. Modelos de resistividad del subsuelo bajo las lneas de geoelctrica (a) x=6m, (b) x=9m y (c) y=12m. Las lneas
indican alas anomalas encontradas, cuyas ubicaciones coinciden con las hayadas con los otros dos mtodos.

Contrastacin arqueolgica de los estudios geofsicos
A los fines de poder corroborar y testear arqueolgicamente los resultados alcanzados con los mtodos
geofsicos, se realizaron excavaciones arqueolgicas en el Sector 2 del rea prospectada. Inicialmente se
plantearon cuatro cuadrculas de 1 metro de lado sobre uno de los rasgos lineales detectados por geofsica. En las
(a)
(c)
(b)
TOMO IV - 1414
Gabriel Cocco, Guillermo Frittegotto, Nstor Bonomo, Matas de la Vega, Patricia Martinelli y Ana Osella
cuadrculas B8 y B9, a partir de los 25 cm de profundidad, se comenz a visualizar un cambio en el sedimento en
sentido horizontal, cuyo lmite era una lnea que tena la misma orientacin que uno de los lados del rasgo
formando un ngulo de 45 con respecto a la traza urbana de Puerto Gaboto y direccin Norte-Sur. A medida
que se profundizaba el rasgo se haca cada vez ms visible, hasta que a los 55 cm de profundidad aparece un
sedimento limoso de color anaranjado claro consolidado conformando una estructura similar a la de un muro.
Posteriormente se decidi ampliar las excavaciones para seguir la trayectoria de este rasgo y determinar si
efectivamente se trataba de una estructura antrpica. Como resultado, en el sector sureste del sitio se excavaron
13 cuadrculas donde se localizaron dos rasgos de estructuras de tierra cruda que tienen una orientacin Norte-
Sur (ver figura 6) y que se encuentran asociados a material arqueolgico de manufactura local y europea. Entre
ambos rasgos se localiz una capa con carbn de 20 cm de espesor que contiene restos de cuentas de vidrio
fundidas y restos de madera quemada. En las excavaciones realizadas se puede observar que estas estructuras
aparecen asociadas a un registro arqueolgico cuya variabilidad artefactual se vincula a diversos tipos de cuentas
de vidrio (Chevron, Nueva Cdiz, tubulares, circulares, entre otras); cermica vidriada, maylica y doce dados
confeccionados en hueso.

Figura 6: cuadrculas excavadas y rasgos geofsicos detectados.

Estas estructuras halladas se localizan entre los 50 y 90 centmetros de profundidad y estn compuestas por loess
de la formacin Tezanos Pinto apisonado. Se diferencia del sedimento que contiene los restos arqueolgicos, el
cual est compuesto por material coluvial. De acuerdo a los estudios geolgicos realizados por el gelogo Carlos
Ramonell, en los perfiles naturales del rea donde se sita el sitio la formacin Tezanos Pinto que se localiza en
estratos ms profundos a unos 120 cm de profundidad. Este tipo de sedimento habra sido utilizado ya que sera
mas apto para construir muros o paredes de tierra apisonada (tapia) por su mayor plasticidad y capacidad de
compactacin.

Por otra parte, se plante una trinchera en otro sector del sitio donde tambin se localizaron estos mismos rasgos
a una profundidad de 50 cm. El ms visible es el del sector Oeste donde se observa la lnea que marca la
discordancia entre dos tipos de sedimentos; siendo el de la estructura ms consolidado.

En la figura 7 se pueden observar las lneas paralelas que marcan la trayectoria de las estructuras de tierra cruda
localizadas en las excavaciones, las cuales se corresponden con los rasgos detectados por las prospecciones
geofsicas, visibles en los grficos del georadar (GPR).

TOMO IV - 1415
CAPTULO 27 - SIMPOSIO 27

Figura 7: grfico de GPR con la superposicin de reas excavadas y rasgos lineales localizados


Consideraciones finales
La implementacin de las prospecciones geofsicas y la contrastacin realizada mediante las excavaciones
arqueolgicas pusieron en evidencia una serie de estructuras geomtricas y lineales asociadas a artefactos de
origen europeo. Las mismas se corresponden con las expectativas de hallazgo para un asentamiento espaol de
este tipo donde se utilizaron materias primas locales para la construccin de estructuras con una tecnologa
fornea.

Las prospecciones geofsicas utilizando los mtodos de georadar (GPR), electromagntico de fuente controlada
(EMI) y geoelctrica resultaron una herramienta eficaz para la localizacin de estructuras de tierra cruda
correspondientes al asentamiento espaol, las cuales por su naturaleza constructiva y materia prima utilizada
tienen una baja visibilidad en el terreno. Asimismo, la deteccin de estos rasgos de origen antrpico previo a la
realizacin de excavaciones posibilita una mejor seleccin de los sectores a excavar y planificar los pasos a
seguir teniendo para la preservacin del sitio.

Bibliografa
Frittegotto, G., G. Cocco, F. C. Letieri, M. Perez, M. E. Aztiz 2009. Proyecto de Arqueologa: Localizacin del
primer asentamiento espaol en el Ro de La Plata, localidad de Puerto Gaboto, Santa Fe. Informe Final (2da
Etapa). Ms. en archivo: Consejo Federal de Inversiones. Bs As.
Medina, J. T. 1908. El veneciano Sebastin Caboto al servicio de Espaa y especialmente su proyectado viaje a
las Molucas por el Estrecho de Magallanes y al reconocimiento de la Costa del Continente hasta la
Gobernacin de Pedrarias Dvila. Dos volmenes. Santiago de Chile.
Osella, A. 2009. Prospeccin geofsica en Puerto Gaboto. Informe. Proyecto de Arqueologa: Localizacin del
primer asentamiento espaol en el Ro de La Plata, localidad de Puerto Gaboto, Santa Fe (2da Etapa). Ms. CFI.
Bs As.
TOMO IV - 1416
Gabriel Cocco, Guillermo Frittegotto, Nstor Bonomo, Matas de la Vega, Patricia Martinelli y Ana Osella
ANTIGUOS CANALES? IDENTIFICACIN DE CANALES DE RIEGO
MEDIANTE BIOINDICADORES. EL CASO DE PEAS COLORADAS
M. Lorena Cohen
*
, Lorena Grana
**
y Nora Maidana
***


Introduccin
Observaciones realizadas mediante fotografa satelital y luego en terreno en la puna meridional argentina, ms
precisamente en Antofagasta de la Sierra, al NO de la Pcia. de Catamarca, revelaron la presencia de surcos y
reas de encharcamiento que no parecen corresponderse a geoformas naturales provocadas por erosin. Nos
interesa particularmente comprobar la hiptesis de la existencia de canales trazados por la mano humana. Con
este objetivo, encaramos el estudio de estas estructuras utilizando la informacin provista por bioindicadores, en
este caso, los ensambles de diatomeas recuperados de diversos sectores del sitio. Consideramos que el modo ms
acertado para lograr evidencia certera del origen de estos conductos es a partir de la determinacin de diatomeas
lo cual cobra peso al ser interpretado en un contexto arqueolgico particular que describiremos ms adelante.

Peas Coloradas
Esta localidad se halla en un sector de la cuenca denominado, por su topografa, Sectores Intermedios (3550 a
3800 msnm). Sin embargo, el nombre puede referirse tambin a su posicin relativa en la Cuenca, pues
actualmente es una va de trnsito para el desplazamiento desde la villa Antofagasta de la Sierra hasta las vegas
puneas de altura de Quebrada Seca y Real Grande (por arriba de los 4000 msnm); formando parte de una de los
principales medios de circulacin de la regin y es el nico que comunica los microsectores del fondo de cuenca
(3400 a 3550 msnm) con la quebrada de altura (3800 a 4600 msnm) del ro Las Pitas (Podesta 1990 ms). Por la
banda Este de Peas Coloradas pasa el ro Las Pitas, afluente del Punilla, que es el ro principal de la cuenca.

Peas Coloradas se encuentra conformada por un grupo de 4 peas de ignimbrita volcnica que se yerguen unos 15 m
a modo de acantilado, desde una superficie llana arenosa y abierta, cuyo nico recorte prximo est dado por el
quiebre de pendiente de las terrazas prximas a la margen izquierda de Las Pitas. Este sitio ha sido conocido
arqueolgicamente a partir de los imponentes paneles con representaciones rupestres que se inician cerca de los 4000
aos AP., abarcando motivos ubicados en el perodo Temprano Formativo, en el Tardo e incluso en tiempos de
presencia Inca en la regin (Aschero 1999; Aschero 2000; Podesta 1990ms). En los ltimos aos, una de nosotras
viene trabajando con la espacialidad (sensu Soja 1995) del sitio PC3c, ubicado en la cumbre de la Pea Colorada 3
(Cohen et al. .2007; Cohen 2009 a y b; 2010). Se trata de un emplazamiento de aproximadamente 26 estructuras desde
donde se alcanza una visin panormica circular, logrando un amplio control visual del paisaje circundante. Sin
embargo, las construcciones no pueden ser visualizadas desde el entorno debido a la combinacin de una serie de
factores: las estructuras semisubterrneas y subterrneas estn ubicadas en una microtopografa relativamente
deprimida de la cima, el material constructivo es la misma piedra que constituye la pea a lo que se suma la presencia
de bordos de material detrtico rodeando a algunos recintos. Otro atributo del emplazamiento es la restriccin natural
del acceso a la cima, que slo se logra desde el Este, ya que gran parte del permetro de la pea tiene pendiente
abrupta, excepto ese sector. Ms all de esto, hay una muralla acotada hacia el borde Este de la Pea que favoreci la
restriccin del paso a la cumbre. Con lo anteriormente expresado se sostiene que el sitio PC3c, en donde se mira sin ser
visto, tiene una cualidad diferenciada con respecto a los sitios prximos, significando un quiebre en la reciprocidad de
la mirada (siguiendo a Foucault 1975) lo cual posibilitaba el control visual del paisaje de quienes habitaron la cima
(Cohen 2009a; 2010).

La capacidad de controlar visualmente desde la cumbre al entorno prximo ha sido vinculada con el avistaje de
las sendas de circulacin y el control de las pasturas, cultivos y agua. La inferencia de la existencia de cultivos
para consumo o forraje en el rea prxima al sitio PC3c est dada por la presencia de grandes bloques con
morteros fijos, de palas en superficie, de las estructuras de piedra cuadrangulares semejantes a cuadros de cultivo
mostradas en las antiguas fotografas de Weiser (1923) y, finalmente, lo que aqu nos ocupa, el trazo de un surco
seco que tiene conexin con una canal actual y por lo tanto, una posible toma del ro Las Pitas. ste se desprende

*
CONICET. Inst. Superior de Estudios Sociales- Inst. de Arqueologa y Museo de la UNT. marialorenacohen@yahoo.com.ar
**
Becaria ANPCyT- FONCyT. FFyL, UBA. lorenaggrana@yahoo.com.ar
***
CONICET. Depto de Biodiversidad y Biologa Experimental, FCEyN, UBA. nim@bg.fcen.uba.ar
1
El Proyecto es llevado a cabo por Guillermo Frittegotto, Fabin Letieri y Gabriel Cocco, est impulsado por el Ministerio de Innovacin y
Cultura de la Provincia de Santa Fe y financiado por el Consejo Federal de Inversiones.
TOMO IV - 1417
CAPTULO 27 - SIMPOSIO 27
del actual canal activo que pasa frente a Peas Coloradas 1 y 2 y corriendo con cierto quiebre en su direccin,
por el frente de Peas Coloradas 3 y 4 (figura 1). Si este paisaje productivo tuvo ciertamente relacin con el sitio
de la cumbre PC3c, podramos suponer una edad de 850 60 aos AP, fecha obtenida para el sitio segn
datacin
14
C (Cohen 2009b).

Don Ernesto Morales (propietario de la localidad Peas Coloradas) sostiene ser el responsable de la
construccin del canal activo actual sin hacer referencia al surco seco bajo estudio. Teniendo en cuenta la
ubicacin del surco seco, cuyo trazo se desprende del actual canal activo, podramos llegar a sostener que el
origen de la toma de agua del surco seco provenga tal vez de una zona cercana, o la misma, a la del canal
construido o reactivado por Don Morales ubicada aproximadamente a 1,1 km al NO.

Contrariamente a las carcavas generadas por la erosin pluvial, el surco seco se desarrolla a lo largo de una
planicie aterrazada sobre una superficie plana con un mnimo de inclinacin negativa hacia el ro, ubicado 10 m
abajo. Lo que nos permitira descartar la accin de una erosin pluvial y su consiguiente escorrenta y proponer,
ms bien, que se tratara de una estructura construida con la intencin precisa de conducir el agua por un sector
aterrazado por arriba de la vega. Esto permite generar una mayor superficie irrigada capaz de sostener un paisaje
productivo de cultivos comestibles o de forraje, tal como sugieren las evidencias arqueolgicas presentadas ms
arriba (un puesto de avistaje prximo, morterales, y posibles cuadros de cultivo). Una interesante lnea de
evidencia para contrastar la presencia del canal es mediante el anlisis del ensamble de diatomeas provenientes
de muestras de sedimento de diferentes sectores del surco.


Figura 2: A- Surco seco de Este a Oeste ubicado cerca del sitio Peas Coloradas. B-Observaciones desde la fotografa
satelital de Peas Coloradas. C- vista area de la Pea Colorada 3, se observa el sitio PC3c. (extrado de Cohen 2010).

Antecedentes
Los estudios de los sistemas de riego prehispnicos estn cobrando un rol importante dentro de las
investigaciones arqueolgicas de las sociedades agrcolas. Diversos investigadores han propuesto distintas vas
de anlisis, por ejemplo Quesada (2001) ha propuesto el registro y anlisis de las redes de riego y la
reconstruccin de los paisajes agrcolas para la regin de Tebenchique (situada tambin en el Departamento de
Antofagasta de la Sierra) mediante el relevamiento planialtimtrico y el diseo de las estructuras. En la localidad
Antofagasta de la Sierra, Tchilinguirian y Olivera (2000) realizaron anlisis de calidad de agua para riego por
ensayos de infiltracin y anlisis qumicos actuales de los caudales y anlisis de suelos, elaborando un mapa solo
para el sector de fondo de cuenca de la regin. Por ltimo, para el mismo sector, Salminci (2010) ha propuesto
recrear el flujo hidrco de diversos sistemas de canales mediante el anlisis de imgenes satelitales y un posterior
analisis planimtrico para complementar los aportes de Tchilinguirian y Olivera (op. cit.).

Las diatomeas son buenos bioindicadores dado que proveen informacin sobre un conjunto integrado de
condiciones ambientales de los cuerpos de agua (Stevenson y Yangdong 2000). Tienen una alta abundancia
numrica, una respuesta rpida y directa a los cambios fsicos, qumicos y biolgicos de los ecosistemas, lo cual
nos permite inferir directamente, entre otras cosas, la salinidad, el pH, la alcalinidad, el estatus nutricional e
indirectamente, la paleoproductividad de las aguas, parmetros con los que se pueden hacer reconstrucciones de
la evolucin de cuerpos de aguas (lagos, lagunas, ros, etc.) (Renfrew y Bahn 1993; Martinez Macchiavello et al.
TOMO IV - 1418
M. Lorena Cohen, Lorena Grana y Nora Maidana
1999; Maidana 2005), posibilitando precisar nuestras inferencias sobre los cambios y la distribucin de recursos
hdricos. En este caso en particular, el anlisis de los ensambles de diatomeas recuperadas de distintos sectores
nos permite investigar la posible presencia y distribucin de canales.

Los anlisis diatomolgicos de sedimentos de sitios arqueolgicas en Argentina han sido llevados a cabo desde
hace tiempo. En un comienzo, significaron simples listados de las especies identificadas, agregados como
apndices sin aportar otra informacin a los problemas arqueolgicos (por ejemplo Frenguelli 1940; Menghin y
Brmida 1950, segn Martinez Macchiavelo et al. 1999). Recin a partir de la dcada de 1990, los anlisis
diatomolgicos comenzaron a enriquecer las discusiones arqueolgicas, respondiendo a diversas problemticas
como los procesos de formacin de sitio (Kligmann 2003; Vasquez, indito), la procedencia de materias primas
cermicas (de la Fuente 1996; Sola y Morales 2007) y por ltimo, reconstrucciones paleoambientales asociadas a
sitios arqueolgicos (Maidana y Kligmann 1996; Gonzlez y Maidana 1998; Ratto 2000; Morales 2004; Olivera
et al. 2004; Grana y Morales 2005; Yacobaccio y Morales 2005; Grana 2007, entre otros). Hasta el presente, y a
pesar de la creciente importancia del anlisis diatomolgico para resolver diferentes cuestiones arqueolgicas, no
hemos podido hallar referencias sobre el anlisis de diatomeas como mtodo para la determinacin de la
existencia de antiguos canales de conduccin de agua y posiblemente de riego.

Hemos hallado estudios previos sobre estructuras hidrulicas antiguas en la cuenca del ro Punilla
(Tchilinguirian y Olivera 2000; Salminci (com per), y para el ro Las Pitas, una referencia simblica de stas a
travs de las maquetas de sistemas hidrulicos en Aschero et al. (2009). Sin embargo nuestro aporte es diferente
al de los trabajos anteriores constituyendo una primera aproximacin que emplea la determinacin de diatomeas
para comprobar la existencia de hipotticos canales antiguos.

Mtodos del trabajo
Se realizaron transectas perpendiculares en dos sectores del hipottico canal, tomando una muestra de sedimento
superficial y una subsuperficial en cada punto dentro de la transecta. En total se recolectaron 17 muestras. Se
procesaron los sedimentos para la identificacin y cuantificacin de las diatomeas, siguiendo el protocolo
estndar de Battarbee (1986) segn el cual se trata a las muestras con agua oxigenada (H
2
O
2
) al 30%. El material
ya libre de materia orgnica, se neutraliz mediante tres lavados con agua destilada. Por ltimo, se
confeccionaron preparaciones permanentes utilizando Naphrax

como medio de montaje.

Se realizaron observaciones con microscopio ptico, con una magnificacin de 1000X. La identificacin
taxonmica se realiz a partir de las caractersticas particulares de las valvas (largo, ancho, cantidad de estras en
10 m, presencia o ausencia de rafe, entre otras variables) y se consult bibliografa taxonmica y ecolgica
especializada, tanto en floras estndar (Lowe 1974; De Wolf 1982; Germain 1981; Round et al. 1990; Straub
1990; Krammer y Lange-Bertalot 1991-96; Vos y De Wolf 1993; Van Dam et al. 1994; Lange- Bertalot 2000)
como en floras del rea bajo estudio (Rumrich et al. 2000; Seeligmann y Maidana 2003; Daz y Maidana 2005;
Seeligman et al. 2008).

Para lograr interpretaciones ms slidas sobre la evolucin y las caractersticas del antiguo canal, se tomaron
muestras de sedimentos superficiales, tambin siguiendo transectas, en diversos canales de riego actualmente
activos y con diferentes usos. Este conocimiento aporta herramientas de comparacin y brinda mayor certeza a
las inferencias paleoambientales.

Algunos resultados y una conclusin preliminar
En todas las muestras estudiadas se hallaron tanto valvas completas como fragmentos de estas. A medida que
nos acercamos al centro del canal disminuye la cantidad de fragmentos de valvas y aumenta el de valvas
completas, lo que permiti una ms precisa identificacin a nivel especfico. Este aumento de valvas completas
en la parte central del canal permite inferir la existencia de un cuerpo de agua, no necesariamente permanente
pero que al menos permiti el desarrollo de algas como las epfitas Cocconeis placentula y Planothidium
lanceolatum y, por otro lado, a situaciones de menor erosin en relacin con los bordes y la zona exterior del
canal. Esto ltimo puede deberse a actividades de mantenimiento que suelen darse en las orillas del mismo
(Purdue et al. 2009). En el sector exterior al canal se identificaron especies que suelen ser formas tolerantes a la
desecacin (como Hantzschia spp), por lo que se las puede relacionar con ambientes de orilla, hmedos, sin una
presencia permanente de agua.

Por consiguiente, teniendo en cuenta los resultados obtenidos hasta el momento podemos sostener que en el
surco efectivamente hubo agua, posiblemente proveniente de la canalizacin artificial del ro que se halla al
TOMO IV - 1419
CAPTULO 27 - SIMPOSIO 27
menos 10 m ms abajo. Tambin, teniendo en cuenta el contexto arqueolgico en el que se enmarca, postulamos
que esto se dio en otros tiempos, previos al siglo XX, probablemente correspondindose con la ocupacin del
sitio Peas Coloradas 3 cumbre, sitio desde el cual podan controlarse muy bien los recursos asociados al manejo
del agua: cultivos, forrajes y acceso al pastizal.

Por ltimo, este trabajo permite no slo confirmar la presencia efectiva de un canal cercano al sitio sino tambin
trazar nuevas expectativas a futuro para analizar con otros proxies (relevamiento planialtimtricos de todas las
estructuras prximas al canal que nos ocupa, sedimentologa, anlisis de fsforo, materia orgnica y fitolitos de
los posibles campos irrigados y el avance en las comparaciones con otros canales activos de la zona. Todo esto
nos permitir ampliar los estudios sobre los sistemas de riego prehispnicos y sus relaciones con las sociedades
agropastoriles.

Bibliografa
Aschero, C. A. 1999. El Arte Rupestre del desierto Puneo y el Noroeste Argentino. En: Arte Rupestre en los
Andes de Capriconio. Museo Chileno de Arte Precolombino; pp 97-135
Aschero, C. A.; 2000. Figuras humanas, camlidos y espacios en la interaccin circumpunea. En: Arte en las
Rocas. Arte rupestre, menhires y piedras de colores en Argentina; pp15-44. Eds. M. Podest y M. De Hoyos.
S.A.A. y A.A.I.N.A.P.L. Buenos Aires.
Aschero C., A. R. Martel y S. M. L. Lpez Campeny 2009. El sonido del agua arte rupestre y actividades
productivas. El caso de Antofagasta de la Sierra, Noroeste Argentino. Pp. 257-270 En: Crnicas sobre la piedra.
Arte rupestre de Las Amricas. Editado por M. Sepulveda, L. Briones y J. Chacama. Universidad de Tarapac.
Battarbee, R. 1986. Diatoms Analysis. En: Handbook of Holocene paleoecology and paleohydrology, Editado
por B. E. Berlung, J. Wiley & Sons, pp: 527-570. New York.
Cohen, M. L. 2009 a. Perspectivas espaciales desde el sitio Peas Coloradas 3 cumbre (PC3-c) Antofagasta de la
Sierra. Catamarca. En: Actas del 1 Congreso Latinoamericano y 2 Nacional de Arqueometra Vol 2: pp 477-
487. Comisin Nacional de Energa Atmica (CNEA) Bs.As.
Cohen, M. L. 2009 b. Fotografas y algo mas imgenes de Antofagasta en 1923 como aporte para el planteo
de hiptesis y la bsqueda de evidencias contrastadotas. En Libro de resmenes de las VIII Jornadas de
comunicaciones de la Fac. de Cs. Nat. e I.M.L. y 1 Interinstitucional, pp109.
Cohen, M. L. 2010. Jerarquas, Estrategias de Control y su Espacialidad. Perspectivas desde el sitio Peas
Coloradas 3-cumbre- (Antofagasta de la Sierra, Catamarca.Tesis para optar al grado de Doctora en Filosofa y
Letra de la UBA
Cohen, M. L.; L. Quiroga; G. Ortiz; E. Del Bel; S. M. L. Lpez Campeny; S. MArtinez, L. Chavez;S. V.
Urquiza; M. A. Ruberto; Z. G. Flores Vera; P. Gmez Sanchez; J. Medina Chueca; S. Rodriguez Curletto; S.
Quilodrn. 2007. Espacialidad del sitio Peas Coloradas 3 cumbre (PC3- c), Antofagasta de la Sierra. Catamarca.
Metodologa de anlisis y una propuesta interpretativa. En Libro de resmenes de las VIII Jornadas de
comunicaciones de la Fac. de Cs. Nat. e I.M.L. y 1 Interinstitucional, pp 27.
De Wolf, H. 1982. Method of coding of ecological data from diatoms for computing utilization. Med. Rijks Geol.
Dienst 36: 9599.
Daz, C. y N. Maidana. 2005. Diatomeas de los Salares Atacama y Punta Negra. II Regin- Chile. Centro de
Ecologa Aplicada Ltda. Santiago, Chile.
Foucault, M. 1975. Vigilar y Castigar: nacimiento de la prisin. Siglo Veintiuno. Madrid
Germain, H. 1981. Flore des diatomes. Societe Nouvelle des editions Boube. Paris
Gonzlez, M. y N. Maidana. 1998. Post- Wisconsinian paleoenvironments at Salinas del Berbedero basin, San
Luis, Argentina. Journal of Paleolimmology 20: 353-368.
Grana, L. G. 2007 Diatomeas Fosiles: Un acercamiento a la relacin entre la Sociedad y el Ambiente durante el
Holoceno en Antofagasta de la Sierra, Puna Meridional. Tesis de licenciatura de la carrera de Ciencias
Antropolgica. Facultad de Filosofa y Letras. Universidad de Buenos Aires. Ms.
Grana, L. y M. Morales. 2005. Primeros resultados paleoambientales del anlisis de diatomeas fsiles del
Holoceno Medio y Tardo de la cuenca del ro Miriguaca, Antofagasta de la Sierra, Puna catamarquea. Entre
pasados y presentes. Trabajos de las VI Jornadas de Jvenes Investigadores en Ciencias Antropolgicas. Coord.
por A. Cetti, A. Re, D. Rindel y P. Valeri. Instituto Nacional de Antropologa y Pensamiento Latinoamericano.
CD-Rom pp342-409, Buenos Aires.
Kligmann, D.2003. Procesos de formacin de sitios arqueolgicos: tres casos de estudio en la Puna Meridional
Catamarquea Argentina. Tesis doctoral, Facultad de Filosofa y Letras UBA. Ms.
Krammer, K. y H. Lange-Bertalot. 1991-1996. Bacillariophyceae. Tomos 1, 2, 3 y 4. Ssswasserflora vom
Mitteleuropa Jena, Fisher.
TOMO IV - 1420
M. Lorena Cohen, Lorena Grana y Nora Maidana
Lange-Bertalot, H. 2000. Diatoms of Europe. Diatoms of the European Inland Waters and Comparable
Habitats. Vol. 2:1-256. Gantner-Verlag, Ruggell. Alemania.
Lowe, R. L. 1974. Environmental requirements and pollution tolerance of freshwater diatoms. National
Environmental Research Center. U. S. Environmental Protection Agency. Cincinnati, Ohio.
Maidana, N. 2005. Apuntes de Identificacin de Diatomeas continentales. Curso de posgrado. Ms.
Maidana, N. y D. Kligmann.1996. Informe del sitio arqueolgico Alero Circunferencia (Humahuaca, Jujuy):
Anlisis de diatomeas. En: Pintoscayoc, Arqueologa de Quebradas de Altura. Humahuaca. M. I. Hernandez
Llosa. Tesis doctoral, Facultad de Filosofa y Letras UBA. Ms.
Martinez Macchiavello, J.C., G. De La Fuente y N. Ratto. 1999. La utilizacin del anlisis de diatomeas
(Bacillariophyta) en la investigacin arqueolgica: una perspectiva interdisciplinaria Arqueologa 9:49-69.
FFyL. UBA
Morales, M. 2004. Casi invisible: Diatomeas, ambientes locales y grupos humanos del Holoceno Medio en la
Puna desrtica. Tesis de licenciatura de la carrera de Ciencias Antropolgica. Facultad de Filosofa y Letras.
Universidad de Buenos Aires. Ms.
Olivera, D., P. Tchilinguirian y L. Grana. 2004. Paleoambiente y arqueologa en la Puna Meridional Argentina:
archivos ambientales, escalas de anlisis y registro arqueolgico. Relaciones de la Sociedad Argentina de
Antropologa XXIX: 229-247.
Podesta, M.; 1990 (MS): Regin de Antofagasta de la Sierra (Pcia. de Catamarca) Sitio Pea Colorada 3.
Informe de Beca CONICET posdoctoral
Purdue L., W. Miles, K. Woodson, A. Darling y J.-F. Berger. 2009 Micromophological study of irrigation canal
sediments: Landscape evolution and Hydraulic management in the middle Gila River Valley (Phoenix Basin,
Arizona) during the Hohokam occupation. Quaternary International , doi: 10.1016/j.quaint.2009.11.011
Quesada, M. 2001. Tecnologa agrcola y produccin campesina en la Puna de Atacama. I milenio d.C. Tesis de
licenciatura indita. Escuela de Arqueologa, Universidad Nacional de Catamarca, San Fernando del Valle de
Catamarca. MS.
Ratto, N. 2000. La estructura del registro arqueolgico en la cuenca superior del valle de Chaschuil (Depto.
Tinogasta, Catamarca). Arqueologa 10: 39-79. Fac. Filosofa y Letras. UBA
Renfrew, C. y P. Bahn. 1993. Arqueologa. Teora,. Metodologa y Prctica Editorial Akal. Madrid
Round, F. E., R. M Crawford y D. G. Mann. 1990. The Diatoms. Cambridge. Cambridge University Press.
Rumrich, U., Lange Bertalot, H. y M. Rumrich. 2000. Diatomeen der Anden. Von Venezuela bis
Patagonien/Feuerland. Und zwei weitere Beitrage. ARG Ganter Verlag K. G.
Seeligmann, C. y N. Maidana. 2003. Diatomeas (Bacillariophyceae) de ambientes acuticos de altura de la
Provincia de Catamarca (Argentina). Boletn de la Sociedad Argentina Botnica 38 (1-2): 39-50.
Seeligmann C.; N. Maidana y M. Morales. 2008 Diatomeas (Bacillariophyceae) de humedales de altura de la
Provincia de Jujuy-Argentina. Boletin de la Sociedad Argentina de Botnica 43(1-2):1-17
Stevenson, R. y Yangdong Pan. 2000. Assessing environmental conditions in rivers and streams with diatoms.
En: The Diatoms, Applications for Environmental and Earth Sciences. Editado por E. F. Stoermer and John P.
Smol, pp. 11-40 Cambridge University Press, London. UK.
Straub, F. 1990. Diatomes et reconstitution des environnements prhistoriques. Archologie neuchathloise 10.
Hauterive-Chaprveyers 4 :17-30
Soja, W; 1995: Postmodern Geographies.The reassertion of space in critical social theory. Verso. London-New York.
Sol P y M. Morales. 2007 Indicadores Biolgicos y Mineralgicos en un tiesto estilo Incaico hallado en
Susques, Puna Argentina.. Intersecciones en Antropologa. Facultad de Ciencias Sociales vol. 8 p.361-364.
Tchilinguirian P. y D. Olivera 2000 De Aguas Y Tierras: Aportes Para La Reactivacin De Campos. Relaciones
de la sociedad argentina de antropologa XXV: 99-117 Buenos Aires
Vasquez F. Indito Procesos de formacin en ambientes de altura: El caso del sitio El Zorro. (Puna Meridional
Catamarquea). Tesis de licenciatura de la carrera de Ciencias Antropolgica. Facultad de Filosofa y Letras.
Universidad de Buenos Aires. MS
van Dam, H., A. Mertenes, y J. Sinkeldam. 1994. A coded checklist and ecoogical indicator values of fresh water
diatoms from the Netherlands. Journal of Aquatic Ecology, 28:117-133.
Vos, P. C. y H. De Wolf.1993. Diatoms as tool for reconstructing sedimentary environments in coastal
wetlands; metodological aspects. Hidrobiologa 269/270:285-296. Belgium. Kluwer Academic Publishers.
Weiser, V. 1923. Coleccin fotogrfica de la V expedicin al Noroeste. Museo de Ciencias Naturales de La
Plata. Coleccin Muiz Barreto.
Yacobaccio, H. y M. Morales. 2005. Mid- Holocene environment and human occupation of the Puna (Susques,
Argentina). Quaternary International 132: 5-14.

TOMO IV - 1421
CAPTULO 27 - SIMPOSIO 27









CAPTULO 28
MESA REDONDA 1

LA REPRESENTACIN DEL PASADO Y LA ARQUEOLOGA EN LOS
MUSEOS

Coordinadoras
Mara L. Endere
CONICET. PATRIMONIA-INCUAPA. UNCPBA
Mara Gabriela Chaparro
CONICET. PATRIMONIA-INCUAPA. UNCPBA
Evaluadores
Valeria Palavecino
ISHIR (Investigaciones socio-histricas regionales) CESAL CONICET
Universidad Nacional del Centro de la Pcia. de Buenos Aires
Silvia Soria
Universidad Nacional de Salta Museo de Arqueologa de Alta Montaa
Alejandra Pupio
Departamento de Humanidades - Universidad Nacional del Sur
NDICE

VISIONES Y PROTAGONISTAS EN TORNO A UNA IDEA
DE UN MUSEO EN LOS ANTIGUOS
Celina San Martn y Victoria Horwitz ......................................................................................................... 1427

LA REPRESENTACIN DEL PASADO ABORIGEN DESDE
EL CRUCE DISCIPLINAR DE LA MUSEOGRAFA, HISTORIOGRAFA
Y LA DIDCTICA. EL CASO DEL MUSEO ETNOGRFICO
Y COLONIAL JUAN DE GARAY
Marina Benzi, Paula Busso y Rosa Garca ................................................................................................ 1433
VISIONES Y PROTAGONISTAS EN TORNO A LA IDEA DE UN
MUSEO EN LOS ANTIGUOS
Celina M. San Martn y Victoria D. Horwitz
*


Este trabajo muestra el peso de las visiones adquiridas y de los posicionamientos en relacin a la idea de
un museo en Los Antiguos. Describe lo generado a partir de la interaccin con la comunidad en relacin
a la idea de crear un museo, as como el tipo de contribucin que puede aportar el anlisis de las
experiencias e informacin generadas en el contexto de entrevistas y encuestas. Atendiendo a inquietudes
locales, advertimos que la idea de la creacin de un museo significa un proyecto de importancia para una
pequea parte interesada de sus habitantes. Sin embargo la representacin del pasado, tema en el cual
estamos interesadas, no apareca asociado a la idea de un museo sino que, las diferentes visiones
asociadas a la historia y al pasado proponan cierto desafo a la hora de pensar tal proyecto. Entendemos
que aunque todos los grupos sociales participan en la construccin del pasado desde el presente, no todos
lo hacen igualmente posicionados (Popular Memory Group 1982). Encontramos que las personas que
abiertamente expresan la necesidad de crear un museo lo relacionan con la apropiacin de objetos
arqueolgicos pero no con el conocimiento de la historia regional. En consonancia con esto, la mayora
de las personas concuerda con la importancia de tener un museo pero tampoco adjudican a ste una
relacin con la historia del lugar, sino que destacan como relevante all la reunin y coleccin de objetos.
Sin embargo, las diferencias respecto este ltimo aspecto se encuentran en la apropiacin de
determinados objetos por determinadas personas: por ejemplo la cantidad o el tipo de objetos que tiene.
Pudimos advertir dos posicionamientos en relacin a coleccionar objetos la cual sera una prctica
histrica que pareciera estar hasta cierto punto legitimada socialmente. Por un lado, las pocas personas
que tienen mucho, que no parecen conectar sus colecciones con un pasado indgena local y por otro lado,
las muchas personas que tienen poco, que tienen una postura crtica sobre qu clases de objetos se
apropian y exponen, y que en este caso s guardan relacin con un pasado local olvidado.

Crear o no, un museo
Primeros Pasos
En el inicio del proyecto de investigacin arqueolgica
1
(enero 2005) nos contactamos con el Secretario
de Cultura de Los Antiguos, quien entre otras cosas estaba interesado en un anlisis de opinin general
para decidir la mejor forma de encarar un proyecto de museo histrico regional. Aunque no estaba en los
planes pensar un museo, la idea de realizar una encuesta y relevar informacin acerca de cmo se
relaciona la gente con su pasado nos pareci interesante. Durante los meses de febrero de 2006 y 2008,
realizamos las primeras encuestas persiguiendo dicho objetivo. A continuacin presentamos una tabla
donde se muestran algunos de los temas y preguntas que formaron parte de la encuesta durante la cual se
entrevist al uno por ciento de la poblacin
2
. Ms abajo se pueden apreciar los grficos que ilustran los
datos obtenidos.



*
Instituto de Arqueologa, Facultad de Filosofa y Letras (UBA). celinasanmartin@hotmail.com, vhorwitz@retina.ar
1
Los trabajos de investigacin a los cuales hacemos referencia en este trabajo fueron financiados por: (i) Agencia Nacional de Promocin
Cientfica PICT 2006-00668, (ii) Universidad de Buenos Aires UBACyT F061 y UBACyT F039, (iii) Conicet PIP-CONICET 02288.
2
Encuestamos a 40 personas al azar tomando como base que la poblacin de Los Antiguos ronda los 4000 habitantes estimamos que nuestra
muestra representa el 1% de la poblacin. Sobre ese 1% estimamos los porcentajes que presentamos.
TOMO IV - 1427
CAPTULO 28 - MESA REDONDA 1
Tema Preguntas realizadas al entrevistado Respuestas
1- La forma en que la
poblacin actual
aprehende el pasado
del lugar.

Dnde, cmo o de quin aprendi lo que conoce
acerca del pasado de esta regin? Marcar una o
ms opciones entre: escuela, familia, amigos,
biblioteca, conferencias, eventos difusin, otros.

De 40 respondieron 14 personas.
9 escuela. 6
conferencias.
9 familia. 6
difusin/eventos.
9 amigos. 12 otras.
11 biblioteca 26 Ninguna.
2- Conveniencia de
crear un museo.

Qu opina acerca de la creacin de un museo en
Los Antiguos? Marcar una: Muy importante,
importante, poco importante, nada importante.
De 40 respondieron 40 personas.
36 Muy importante. 1 poco
importante.
3 importante. 0 nada
importante.
3- Quin debera estar
a cargo del museo.
Quin debera estar a cargo: Marcar una o ms
opciones entre: Municipalidad, Provincia, o la
Nacin.

De 40 respondieron 37 personas.
25 Municipalidad. 16 Nacin.
18 Provincia. 3 Ns/Nc.
4- Conocimiento de
las tareas de
funcionamiento del
museo.

Cules seran las especialidades que deberan
ser contempladas para que un museo pueda
funcionar adecuadamente? Importancia de las
mismas. Por ejemplo en lo concerniente a:
Gobierno, Administracin, Conservacin,
Curadura, o Educacin (marcar una o ms).
De 40 respondieron 13 personas.
10 Gobierno. 5
Curadura.
7 Administracin. 6
Conservacin.
3 Educacin. 27
Ninguna.






Segn el Grfico 1 notamos que aunque muy pocas personas contestaron esta pregunta (solo un 35%), quienes lo
hicieron aunque relacionaron el aprendizaje del pasado con las categoras propuestas tambin nos dijeron que
haba otros medios a partir de los cuales se aprehende el pasado. Segn el Grfico 2 un alto porcentaje de la
poblacin manifest la importancia de un museo, sin embargo, fueron pocas las personas que expresaron una
opinin clara sobre quin debera hacerse cargo (Grfico 3). Por ltimo, aunque nuevamente fueron pocas las
personas que contestaron la pregunta acerca de las tareas en un museo, advertimos que en general no existe un
criterio para opinar sobre los varios aspectos administrativos y de funcionamiento, ya que en general se
desconocen cules seran (Grfico 4). En sntesis, de estos primeros pasos lo que qued en claro es que en
general la visin que prima de un museo es muy estrecha. Como veremos a continuacin este desconocimiento
est ligado a una idea preponderante del museo como un lugar de coleccin y reunin de objetos.

TOMO IV - 1428
Celina San Martn y Victoria Horwitz
Segundos Pasos
En un segundo contexto de trabajo de campo, ampliamos la metodologa de trabajo y durante febrero del 2009 y
enero-febrero del 2010 mantuvimos charlas y entrevistas con ms de 30 personas acerca de sus recuerdos del
pasado
3
. La poblacin entrevistada se caracteriz por haber vivido en la zona durante su infancia y ser miembros
de la sociedad local en la actualidad. En su mayora cuentan entre 60 y 90 aos de edad. Desde el principio se
prioriz el sujeto testimonial y por ello se pregunt acerca de las vivencias. El tema que funcion como carta de
presentacin fue la historia y ocupacin de la zona cordillerana del noroeste de la actual provincia de Santa Cruz.
Las preguntas se encaminaron inicialmente hacia el conocimiento de la presencia de ocupantes en la zona y a la
identificacin de stos en trminos identitarios, por ejemplo quines eran y qu tipo de relaciones se
establecieron en el lugar. El hecho de iniciar los dilogos con preguntas abiertas sobre un tema nos permiti
rastrear memorias privadas y pblicas respecto de la representacin del pasado. Durante las entrevistas y charlas
se repiti una misma metodologa de trabajo durante la cual se introduca, en la medida de lo posible, el tema sin
cerrar la posibilidad de que el entrevistado proponga sus propios focos de inters. Las preguntas orientadoras
cumplieron la funcin de guiar y retomar el eje temtico durante el dilogo; sin embargo uno de los principales
objetivos fue atender a las clasificaciones locales sobre las cuales estamos indagando sus sentidos y usos
discursivos y prcticos. Entre los temas se incluyeron los siguientes:

Trayectorias personales. Hacer una antropologa de la prxis social: formas de transitar el espacio social.
Experiencias familiares del pasado. Los abuelos. La niez.
Concepciones del tiempo y de la historia, emergencia de posibles mitos, leyendas, cuentos, historias.
Recuerdos acerca de las relaciones mantenidas entre la gente de la zona. Intercambios, organizacin social
inicial.
La forma en que aparece reconocida, negada, opacada, invisibilizada la identidad indgena. Proceso de
construccin otros/nosotros.

Preguntas orientadoras:
Qu sabe del origen de Los Antiguos en tanto espacio ocupado/habitado?
Cundo llegaron a la zona? dnde vivan? qu actividades diarias realizaban?
Siempre vivieron en la zona? se movieron de un lugar a otro? cundo?
Dnde se instalaron? cuntos eran? permanecan durante todo el ao en el mismo lugar?
Conoci a sus abuelos? cmo eran ellos? eran de ac?
De nio a qu jugaba? con quien jugaba? tena hermanos? qu le gustaba ms hacer? fue a la escuela?
dnde? quines eran sus maestros? con quienes? qu enseanzas considera importantes? es verdad que
haba misioneros que visitaban la zona?
Cmo era este lugar cuando era chico? qu decan sus abuelos? por qu habran elegido este lugar para
vivir? cmo es ahora? qu atractivos tiene el pueblo para usted ahora?
Y sabe/ha escuchado de la presencia de indgenas/paisanos por la zona?

Visiones del pasado
Lo que advertimos a partir de un primer anlisis cualitativo es, que muchas de las personas que lamentan la
prdida y olvido de lo que consideran parte de su pasado, desconocen el rol que podra tener un museo en este
respecto. Esta afirmacin es comprensible siempre y cuando revisemos cual ha sido y es la visin imperante del
pasado local y sus protagonistas y, por otro lado, cules y de quienes son las visiones o experiencias que han
cado en el olvido. Iniciamos dicha revisin con una contextualizacin histrica, es decir, dotando de un sentido
histrico a lo que nos dicen del pasado y a la vez por una contextualizacin social de lo dicho en el presente.
Contexto Histrico.

Los relatos de las personas entrevistadas posibilitaron una aproximacin al pasado de los abuelos y de los padres.
Se trata de un perodo histrico comprendido entre fines del siglo XIX y principios del siglo XX, marcado por
coyunturas tales como la denominada Conquista del Desierto y el inicio de un proceso de despliegue y
conformacin de la agencia estatal y otras instituciones (Delrio 2005). Entendemos a estos ltimos como agentes
de un proceso de constitucin de la memoria nacional que mediante ritos, conmemoraciones y nominaciones
forjan un espacio nacional social compartido (Norah 1989). Durante el proceso de memorizar los relatos refieren
tanto a una memoria pblica y compartida, como a una memoria, subjetiva y privada. Por ejemplo, encontramos

3
Esto quiere decir que realizamos un trabajo de registro cualitativo con la idea de crear un vnculo ms estrecho con las personas con las
cuales mantuvimos ms de un entrevista y/o charla.
TOMO IV - 1429
CAPTULO 28 - MESA REDONDA 1
que todas las personas recuerdan los actos escolares, la presencia policial en la frontera, el momento en que se
fiscalizaron las tierras. No obstante, hay otra memoria, ligada a una experiencia privada y familiar que podemos
reconocer como trayectorias personales (Ramos y Delrio 2005). En general se coincide en un momento que se
recuerda como la llegada de pobladores durante el cual se menciona la continua llegada al lugar de distintos
ocupantes: indios venidos del norte (de ambos lados de la cordillera), paisanos, baqueanos, argentinos,
chilenos, a los cuales se suman nacionalidades europeas: ingleses, rusos, alemanes, galeses, todos
estos grupos venan a buscar tierras, huyendo o por trabajo. En los relatos se cuenta que estos ocupantes
llegaron al rea, durante el perodo histrico mencionado, bajo distintas motivaciones: instalarse como gran
propietario y/o administrador de estancias, hacerse de un pedazo de tierra y organizar una pequea chacra,
ofrecerse como puestero o pen, poner un comercio. El rea de intercambio social y econmico comprenda
buena parte de la zona al oeste del ro Jeinemeni, el cual funcionara desde 1903 como lmite argentino-chileno
segn el discurso oficial. Sin embargo, las delimitaciones nacionales no funcionaran como tales en tanto no
estuviera visible la presencia estatal en la zona
4
.

La Presencia Indgena en los Relatos: Posicionamientos, Apropiaciones y Vacios
En las narrativas del pasado advertimos una ambivalencia y contradiccin constante entre visibilizar la presencia
indgena y negarla en el momento que las personas caracterizaron como de llegada de colonos/ocupantes. Dichos
momentos se describen como de poblamiento y los indgenas desaparecen del discurso en tanto pobladores.
Durante el proceso de recordar se entrecruza una memoria pblica y una memoria privada, y los recuerdos son
en parte una tensin y bsqueda de acuerdo entre una y otra memoria, aunque en muchas ocasiones la
imposicin de la primera acaba por silenciar o negar la segunda. Las diferencias se observan, entonces en las
desiguales y diferentes trayectorias de las personas que atraviesan dicho espacio nacional impuesto: Cules son
las estrategias y resistencias, negociaciones, que las personas practican a travs de dicho espacio? y cmo
quedan finalmente posicionados en el presente? y cul es la relacin que lograron construir con dicho pasado?,
en qu lugar se encuentran a s mismos hoy?

El pasado se interpreta y construye desde el presente, sin embargo, la historia en tanto hechos que ocurrieron limita
esta interpretacin y en cierto punto nos fuerza a buscar un consenso sobre lo ocurrido (Briones 1994). En buena
medida este es nuestro posicionamiento y por esto escuchamos y atendemos las voces y los silencios y olvidos que en
el presente representan un pasado borrado. Por eso nuestra investigacin, entre la historia y la memoria, comienza
desde el hecho de identificar posicionamientos presentes en relacin con trayectorias pasadas.

Los indgenas desaparecieron en tanto figura protagonista de la historia y quedaron anclados en un pasado sin
continuidad ya que fueron sometidos a un proceso de expropiacin, durante el cual se impusieron ciertas
representaciones ideales de aboriginalidad (Briones 2004). Desde la imposicin de una matriz de sentido estatal
nacional (Delrio 2005) se impulsaron mquinas territorializadoras capaces de generar y distribuir posiciones y
lugares determinados en las estructuras sociales (Grossberg 1992). Al inmigrante colono Europeo se le daba un
lugar primordial civilizatorio, al indgena, brbaro un lugar marginal, desde el cual deba civilizarse, con
todo lo que ello implicaba, para volverse sujeto de derechos (Bandieri 2005). Desde esta matriz de sentido y
sistema de relaciones impuesto por la hegemona del estado-nacin-territorio (Delrio 2005) se invisibiliz la
presencia indgena, y por ello la posibilidad de rastrear continuidades y transformaciones identitarias debe
realizarse a partir de una crtica a estas estructuras de sentido y valoraciones sociales que se impusieron sobre la
autonoma y libre determinacin de los grupos culturales por s mismos. Un anlisis crtico debe dar cuenta de
las formas de clasificacin y representacin impuestas y el modo en que las personas se han apropiado de estos
lugares, legitimando y fortaleciendo dichos sentidos; o resistiendo y creando otros nuevos, que tenemos la
intencin de continuar indagando.

Un primer posicionamiento prctico discursivo lo advertimos en las personas reconocidas y autoreconocidas
como grandes coleccionistas de la zona y a las cuales hemos entrevistado, que legitiman el acopio de objetos a
partir de la identificacin de un indgena ideal, arqueologizado, anclado en un pasado lejano sin presente (Vidal
1993, Azar et al. 2007). En su relato remarcan el exterminio o la extincin de indios a partir de diversos

4
El establecimiento de la frontera chileno argentina es uno de los aspectos a problematizar, en el contexto de conformacin de estados
nacionales anteriormente mencionado, en relacin a las implicancias y sentidos histricos que tal acontecimiento contrajo. Entendemos la
frontera como un espacio social con un proceso histrico particular (regional), que tiene como protagonistas a las instituciones y al ejercicio
y prctica de la membreca a la nacin en tanto ciudadano que socialmente comienza a construirse (Baeza 2009). La presencia estatal no
signific el colapso del espacio regional, pero si su transformacin; dicha continuidad invita a pensar la particularidad de este proceso.

TOMO IV - 1430
Celina San Martn y Victoria Horwitz
hechos: campaas militares (desde Rosas hasta Roca), persecuciones y matanzas de la dcada del 20 del siglo
XX. A su vez, durante estas narraciones apelan a otros supuestos que terminan de eclipsar la presencia indgena:
la idea que la mezcla es degenerativa entonces contribuye a la desaparicin del aborigen o, la idea de que los
indgenas autnticos son los que viven en el campo, en los toldos, se visten con pieles y cazan animales con arco
y flecha. Este distanciamiento permiti y permite al coleccionista apropiarse de los restos dejados o
abandonados por el indgena, y justifican la recoleccin de los mismos argumentando que lo hacen para su
mejor conservacin. En buena medida estas concepciones sostenidas por el discurso cientfico de fines del siglo
XIX y principios de siglo XX, fueron las que legitimaron la prctica coleccionista durante aos (Podgorny 2002)
y contribuyeron a invisibilizar -negar, silenciar, olvidar, ocultar- lo indgena en su mltiples formas.

Advertimos otro posicionamiento que expresa vacos, negaciones, silencios y/o silenciamientos ante las
preguntas que refieren a la presencia indgena. Entre estas personas, algunas identificaron como indgena o
indio a sus abuelos o a sus tos, incluso excepcionalmente alguien lleg a representarse a s mismo como la
ltima indgena. Esta referencia en el discurso est marcando resistencia a aceptar la idea, antes referida, de
extincin o exterminio , pero, a su vez acenta la idea de la prdida ya que los indios eran sus tos o
abuelos, y excepcionalmente alguien se construye paradjicamente como el ltimo indio remarcando esta
sensacin de algo que se est extinguiendo. Advertimos que este sentido hegemnico se cuela en la experiencia
de las personas y a travs del mismo las personas se expresan. Pero la paradoja es que siempre hay alguien
creyndose el ltimo indio. La paradoja se da entre esa sensacin de continuidad y prdida. Al mismo tiempo,
otro de los sentidos hegemnicos que imperan es la negativa a considerar la existencia, transformacin y
continuidad de indgenas en el presente. El borramiento desde lo discursivo que se practic sobre lo indgena (al
finalizar las campaas militares) en tanto colectivo, en tanto organizacin social, es precisamente lo que ha
posibilitado y legitimado las apropiaciones materiales y simblicas del primer grupo sobre el segundo grupo.

Lo que notamos en muchos de los relatos es la nostalgia recurrente de la prdida, de lo que ya no se puede ser
(en tanto ser social), y por otro lado, una especie de culto a ese ser ideal imaginado: el indio o el tehuelche,
que por lejano y sin vida, se objetiv y, en consecuencia, se volvi posible de saquear, coleccionar y exponer.
Quienes se manifestaron a favor de un museo dejaron en claro que no imaginan un museo sin esos objetos
particulares acaparados por los coleccionistas locales, para quienes se vuelven interlocutores imprescindibles.
Estos objetos son valorados por la comunidad y constituyen el meollo significativo de lo que consideran debera
ser un museo. Sin embargo, aunque los actuales coleccionistas admiten que dichos objetos deberan estar en
museos, al mismo tiempo tienen una idea muy personal de cmo deberan mostrarse. En su discurso y en su
prctica los coleccionistas emparentan los objetos arqueolgicos a lo paleontolgico y a lo geolgico
mientras que lo escinden de lo antropolgico e histrico
5
. El valor de dichos objetos se construye a partir de
lo que representan en s mismos como antigedad del pasado y responde a un valor establecido por este mercado
de antigedades/colecciones. En contra de esta posicin identificamos un segundo posicionamiento que rechaza
abiertamente la apropiacin de lo que podramos denominar objetos arqueolgicos y es particularmente adversa
a la perturbacin y falta de resguardo de los restos humanos. A diferencia de los coleccionistas, este segundo
grupo relaciona estos objetos con su propio pasado y construye su valor a partir de reconocer en esos objetos
parte de su propio pasado ligado a la historia pasada. Los ministros no debieran haber permitido que se
terminen los toldos/ por lo menos quedaba como un recuerdo
6
refera Herminia Olivares respecto de los toldos
en los cuales habra pasado su infancia, denunciando a lo largo de su discurso la apropiacin material cometida y
el olvido, es decir, la falta de reconocimiento (recuerdo) actual de ese pasado.

Discusin final
En la introduccin de este trabajo nos referimos a la desigualdad de condiciones y posicionamientos para
representar el pasado, a lo largo del mismo hemos analizado lo que sucede cuando no todos los grupos sociales
pueden constituirse a s mismos en protagonistas del pasado. Las expropiaciones que han sufrido histricamente
ciertos grupos sociales, de las cuales an contina siendo complejo referir, continan reproducindose en el
presente. Advertimos que se han constituido movilidades estructuradas de pensamiento y accin que permiten a
determinado conjunto (primer posicionamiento) apropiarse de lo que entendemos como objetos de un pasado
compartido. En cambio, otro conjunto (segundo posicionamiento) desconocen sus derechos en torno a expresarse
respecto a lo que creen debera hacerse con estos objetos, es decir, reprimen manifestar su pensamiento en
relacin al lugar social e histrico al cual se los ha circunscripto en tanto protagonistas marginales. Es como una

5
Agradecemos los comentarios de Victoria Fernndez al respecto.
6
Turno 316 de la entrevista realizada a Herminia Olivares el 15 de febrero de 2010 en Los Antiguos.
TOMO IV - 1431
CAPTULO 28 - MESA REDONDA 1
autocensura que al momento de hablar con nosotros se expresa en el rechazo de lo que hacen y dicen otros,
seguido de un silencio respecto a las convicciones propias.

En relacin a los aspectos revisados consideramos que sera relevante generar mbitos de discusin a nivel
comunitario acerca de las concepciones de museo y el pasado all representado para encarar una propuesta
compartida
7
. Creemos que un museo debe ser un espacio donde el pasado regional de todos sus protagonistas
pueda estar representado, respetando la multiplicidad de voces que lo conforman, pero al mismo tiempo
consensuando la historia compartida. Sostenemos que esta dinmica es permanente por lo cual el museo tambin
podra convertirse en un lugar que ofrezca espacios para repensar y expresar el pasado, y las diferentes
trayectorias segn las diferentes perspectivas que existiesen en el presente.

Bibliografa
Azar, P., Nacach, G. y Navarro Floria, P. 2007. Antropologa, genocidio y olvido en la representacin del otro
tnico a partir de la conquista. En Paisajes del progreso. La resignificacin de la Patagonia Norte, 1880-1916.
Navarro Floria, P. (compilador): 79-134. Educo, Neuqun.
Baeza, B. 2009. Fronteras e identidades en Patagonia central (1885-2007). Prohistoria, Rosario.
Bandieri, S. 2005. Historia de la Patagonia. Editorial Sudamericana, Buenos Aires.
Briones, C. 2004. Construcciones de aboriginalidad en Argentina. Socit suisse des Amricanistes/
Schweizerische Amerikanisten-Gesellschaft, Bulletin (68): 73-90.
Briones, C. 1994. Con la tradicin de todas las generaciones pasadas gravitando sobre la mente de los vivos:
usos del pasado e invencin de la tradicin. Runa XXI: 99-129.
Delrio, W. 2005. Memorias de expropiacin. Sometimiento e incorporacin indgena en la Patagonia 1872-
1943. Universidad Nacional de Quilmes, Bernal.
Grossberg, L. 1992. We gotta get out of this place. Popular conservatism and postmodern culture. Routledge,
New York & London.
Norah, P. 1989. Between Memory and History: Les Lieux de Mmorie. Representations 26: 7-24.
Podgorny, I. 2002. Ser todo y no ser nada El trabajo de campo en la Patagonia argentina a fines del siglo XIX
en Historia y estilos de trabajo de campo en Argentina. (Comps). Visacovsky, S. y Guber, R. Antropofagia,
Buenos Aires.
Popular Memory Group. 1982. Popular Memory: Theory, Politics, Method. En Making Histories. Studies in
history writing and politics. (eds.). Johnson, R.; McLennan, G.; Schwartz, B. y Sutton, D. Univ. of Minnesota
Press, Minneapolis.
Ramos, A. y Delrio W. 2005. Trayectorias de oposicin. Los mapuches y tehuelches frente a la hegemona en
Chubut. En Cartografas Argentinas. Polticas indigenistas y formaciones provinciales de alteridad. Briones,
Claudia (editora), 79-117. Antropofagia, Buenos Aires.
Vidal, H. 1993. A travs de sus cenizas. Imgenes etnogrficas e identidad regional en Tierra del Fuego
(Argentina). Tesis para optar por el grado de Magister en Antropologa, FLACSO.

7
Tenemos pensado organizar un taller de historia oral abierto a la comunidad.
TOMO IV - 1432
Celina San Martn y Victoria Horwitz
LA REPRESENTACIN DEL PASADO ABORIGEN DESDE EL CRUCE
DISCIPLINAR DE LA MUSEOGRAFA, HISTORIOGRAFA Y LA
DIDCTICA. EL CASO DEL MUSEO ETNOGRFICO Y COLONIAL
JUAN DE GARAY
Marina Benzi, Paula Busso, Rosa Garca
*


Investigar el pasado y presentarlo en los museos deberan ser tareas paralelas, en el sentido que toda puesta
museogrfica debera (re)presentar los avances de las investigaciones de las disciplinas que en ella intervienen.
Sin embargo esto no siempre se condice con la realidad, as, vemos en las salas de muchos museos visiones ya
superadas o anacrnicas de planteos disciplinares.

Esta situacin obedece a mltiples causas entre las cuales lo presupuestario no es una cuestin menor, sin
embargo pensamos que la deconstruccin y el anlisis de la trama de los discursos museolgicos y la
comprensin de las representaciones del pasado que en ellos operan posibilitan redimensionar, enriquecer y
resignificar las visiones que desde el mismo museo se pueden elaborar del pasado
1
. En este sentido (Golln
1997, Golln y Dujovne 2001, 2010) realizan propuestas y anlisis interesantes en los artculos Proyecto para
el Museo etnogrfico, De lo hegemnico a lo plural: un museo universitario de antropologa y El museo
etnogrfico: funciones, diagnstico y propuestas.

Esta ponencia pretende ser el punto de partida para repensar algunas cuestiones necesarias para la definicin de
un proyecto museogrfico para el Museo Etnogrfico de la ciudad de Santa Fe, ya que el mismo implica un
proceso de investigacin, proceso que, necesariamente tiene que involucrar miradas pluridisciplinarias para
hacer que la exposicin resultante sea comprensible y accesible a los horizontes a los cuales est destinada.
Especficamente, procuramos aproximamos al anlisis de las representaciones acerca de los pueblos originarios
que operaron/an en el Museo Etnogrfico desde su creacin; transitando la historia del Museo con respecto a
estas cuestiones con miras a plantear una nueva exhibicin.

Si bien es cierto que existen profundas relaciones entre museos, enseanza e historia, el carcter y la densidad
que stas tienen han sido y siguen siendo objeto de numerosas polmicas dentro del campo de la historiografa y
de la didctica museogrfica, por ello tambin pretendemos que este trabajo abra la reflexin acerca de la manera
en que se ha presentado en el Museo Etnogrfico la historia de los pueblos originarios, en el mbito de la
provincia de Santa Fe. Llevado al plano de la museografa didctica, estos objetivos nos obligan a preguntarnos
no slo qu representaciones del pasado indgena ha transmitido y transmite el Museo Etnogrfico y Colonial
Juan de Garay?, sino tambin qu nuevas perspectivas didcticas nos planteamos actualmente en el marco de
un proceso de construccin a futuro de un nuevo guin museogrfico? .

Museos Histricos, Etnogrficos y Arqueolgicos
Al ser una construccin social, la puesta museogrfica conformada en gran parte por la cultura material-
plasma el discurso del museo. En l, los objetos museables son ordenados de acuerdo a una voluntad que sugiere
un sentido de pasado; aun en los museos donde no existe un mensaje evidente o donde los objetos aparecen
como unidades aisladas, ya que no se establece explcitamente la relacin entre ellos y la pertenencia a un
determinado contexto de produccin, hay operando detrs de estos planteos una visin particular de lo que es un
museo y para qu o quines se expone.
Ejemplos de situaciones como stas las encontramos en muchos museos histricos de la Argentina donde slo
encuentran lugar los "ganadores de la historia". Aquellos que fueron vencidos tambin lo fueron del honor
que significaba aparecer representados en sus vitrinas. Los lugares reservados para los rechazados o marginados
del proyecto de Estado Nacional decimonnico fueron los museos etnogrficos o antropolgicos. Las culturas

*
Departamento de Estudios Etnogrficos y Coloniales de Santa Fe. Museo Etnogrfico y Colonial Juan de Garay. Ministerio de
Innovacin y Cultura de la Provincia de Santa Fe. etnosfe@santafe-conicet.gov.ar
Marina Benzi: marinabenzi@yahoo.com.ar; Paula Busso: pgbusso@hotmail.com y Rosa Garca: rosarosahistoria@hotmail.com
1
No obstante, hay un acuerdo importante en la consideracin de los museos como espacios culturales con una destacable misin en la
sociedad, pues las actividades que planifican y desarrollan aportan al proceso educativo e histrico del grupo social donde est instituido y
del cual representa, de forma general o especfica, parte de su cultura, su historia e idiosincrasia. Se puede mencionar respecto a cuestiones
vinculadas con museo y educacin algunos trabajos de referencia bsica como el de Garca Blanco (1988) en Espaa, Dujovne (1995, 2010)
en Argentina, Santacana Mestre y Serrat Antol (2005), Asensio y Pol (2002).
TOMO IV - 1433
CAPTULO 28 - MESA REDONDA 1
aborgenes expuestas en las salas de estos museos son el "otro extico", lo raro, lo curioso, lo ajeno, lo que ha
quedado fuera de la lnea eurocntrica de desarrollo. Este otro era una existencia concreta que no poda
negarse totalmente, por ello, se le encuentra un espacio en el cual se exhibir su produccin pero separado de la
historia oficial y La cultura por ella reconocida (Busso 2005).

En la Argentina la llamada historia oficial no le hace lugar al pasado anterior a la conquista, as nacen los
museos etnogrficos, con una existencia diferenciada de los histricos. .Al momento de creacin de los mismos,
se daba por hecho la extincin de este pasado aborigen, en congruencia con el proyecto de Estado-Nacin,
donde lo brbaro quedaba atrs y prenda un modelo cultural europeo, de primaca blanca, cristiana y culta y
en donde la ciencia positiva era el modelo de conocimiento vlido. La historia oficial, consagrada y celebrada
durante casi todo el siglo XX, colabor en la construccin de una supuesta identidad nacional, la del hombre
blanco civilizado, de acuerdo a la idea de progreso de la poca (Podgorny 1999). Esta identidad excluye y
margina a otros actores sociales que por discriminacin tnica o de clase o de gnero quedan afuera de la
versin oficial; al mismo tiempo que se presenta un proceso histrico sin conflictos (Busso 2005).

El Museo Etnogrfico de Santa Fe
El 23 de julio de 1940 se crea el Departamento de Estudios Etnogrficos y Coloniales (DEEC), del cual
dependen el Museo Etnogrfico de la ciudad de Santa Fe y el Parque Arqueolgico Santa Fe la Vieja en
Cayast. Al frente de este organismo es puesto Agustn Zapata Gollan
2
quien ser su director hasta 1986, ao de
su muerte. En 1941 el Ministerio de Instruccin Pblica crea el Museo Etnogrfico, tal como se explica en el
mencionado decreto para que el Departamento de Estudios Etnogrficos y Coloniales realice eficazmente y en
toda su amplitud, los fines que inspiraron su creacin, debe contar con los medios necesarios para formar un
Museo Etnogrfico. (Busso y Aimini 2008). En 1950 se le pone el nombre de Juan de Garay respondiendo a
visiones laudatorias de la historia oficial. Cuando en 1949 Zapata Gollan localiza y excava el sitio de Santa Fe la
Vieja se recuperan materiales arqueolgicos de los grupos socioculturales que convivieron en la antigua ciudad
y por decreto de la Provincia se establece que el cuidado y la conservacin del sitio debe estar a cargo del DEEC;
por ello se traslada el material de las excavaciones de Santa Fe la Vieja al Museo Etnogrfico de Santa Fe y se
inaugura en 1952 el edificio que actualmente ocupa. A pesar de que en la Ley de creacin del DEEC
3
se
especifica que entre sus objetivos estar el de establecer vinculaciones con instituciones de la misma ndole, en
especial con las instituciones cientficas y universitarias, el Etnogrfico de Santa Fe tiene una trayectoria
autnoma con respecto a las instituciones universitarias
4
. En el camino de desarrollo de este museo tiene una
fuerte presencia la figura de Agustn Zapata Gollan, quien fuera su director por ms de cuatro dcadas, y el cual
ha dejado una impronta casi biogrfica en la institucin. La creacin del museo reconoce como hecho fundante
el descubrimiento de las ruinas de Santa Fe la Vieja, cuestin que tuvo suficiente peso para establecer y
mantener un museo etnogrfico y colonial provincial.

Representaciones del pasado: el Museo Etnogrfico
Correspondera ahora analizar el impacto que todos estos aspectos tienen en la propuesta museogrfico/
didctica: tanto nuestras concepciones acerca de la naturaleza del conocimiento la epistemologa-, como
nuestras ideas acerca de la educacin y el aprendizaje y tambin nuestras consideraciones acerca del sentido, los
destinatarios y la funcin de los museos, darn forma a la concepcin que tengamos acerca de qu y cmo se
ensea/aprende en el museo (Hernndez Xavier 1998). Explicitar las concepciones terico-epistemolgicas que
sustentan nuestro conocimiento histrico y didctico, harn conciente y coherente la propuesta museogrfica. El
discurso museogrfico vehiculiza concepciones didcticas e histricas, analizarlo supone conocer tanto las
caractersticas propias de la historia y la didctica como ciencias, como hacer inteligible la lgica y organizacin
interna que vinculan a los objetos museables dentro de la puesta museogrfica.

En la exhibicin del Museo Etnogrfico de Santa Fe prevalece lo arqueolgico sobre las dems disciplinas
sociales, como la etnografa o la antropologa; el espacio de lo distinto, de lo etnogrfico, se basa en el modelo
decimonnico, donde las ciencias sociales toman como paradigma cientfico las ciencias naturales (positivismo-
evolucionismo), de esta forma perdura la influencia de las disciplinas contemporneas y tradicionales de ese

2
Agustn Zapata Gollan (1895-1986) se destac en las diversas actividades que desarroll como historiador, periodista, artista plstico,
escritor, profesor y arquelogo.
3
Ley n 2902 de la Legislatura de la Provincia.
4
A diferencia de lo que sucede con otros museos como del Museo Etnogrfico Juan B. Ambrosetti de Buenos Aires, el Museo de La Plata,
del Museo de Antropologa de Crdoba.
TOMO IV - 1434
Marina Benzi, Paula Busso, y Rosa Garca
momento: la antropologa biolgica, la medicina, la arqueologa entre otras
5
. Coherente con esta adscripcin al
paradigma decimonnico, existe una relacin de subsidiariedad que se plantea entre las ciencias historia o
arqueologa y otras ciencias sociales, como la antropologa y la etnografa.

La exposicin del Museo Etnogrfico revel hasta prcticamente la dcada del 90 una lgica taxonmica con
escasa o nula informacin acerca del contexto o el significado de esos objetos. El material procedente de sitios
indgenas del museo fue ordenado por colecciones y expuesto total o parcialmente. El mismo estaba compuesto
por: Coleccin del DEEC, materiales recolectados en excursiones realizados por Zapata Gollan durante la dcada
del 40 y donaciones realizadas al DEEC en dcadas subsiguientes (7.000 piezas procedentes de sitios
arqueolgicos del Departamento Garay, San Javier, La Capital y San Jernimo), Coleccin Largua de
Crouzeilles, recolectados por Amelia Largua de Crouzeilles y donados al DEEC (4.000 piezas procedentes de
paraderos indgenas del Departamento La Capital -Los Periquillos, Arroyo leyes, El aromal, Aadir- y San
Jernimo -Desvo Arijn, Omb de Basualdo-), Coleccin Garca Ban (piezas de diversas procedencias
colectadas en interior de la provincia de Santa Fe), Coleccin Rodrguez Sager (piezas de diversos sitios, la
mayora de las cuales no conservan su lugar de procedencia) (Letieri et al. 2009).

Afirmbamos anteriormente que la organizacin de este Museo estuvo fuertemente marcada por la impronta de
Zapata Gollan por lo que resulta importante detenerse en sus escritos donde se refiere a los pueblos originarios.
En Los Guaranes antecedentes histricos (Zapata Gollan 1989) encontraremos algunos puntos a destacar
sobre su concepcin de los pueblos indgenas que se replican en la puesta museogrfica. Alguno de estos puntos
son: 1- gran importancia a la ubicacin geogrfica de estos pueblos, tal como se observa en la cartografa de los
siglos XVII y XVIII. Por ejemplo, los Guaranes, en la poca de la conquista se extendan desde el Amazonas
por el norte hasta el ro de la Plata por el sur, y desde el litoral atlntico de Brasil por el este hasta los
contrafuertes de los Andes bolivianos por el oeste (Zapata Gollan 1989: 223). 2- enumeracin detallada de los
nombres los pueblos segn la informacin aportada por las fuentes histricas, Irala da nombre de Guaranes de
las islas a los que tenan su hbitat en las islas del Paran; de Carios a los del Paraguay. () Schmidl llama
Carios a los Guaranes del Paraguay y Tupes a los del Brasil. () Ruy Daz de Guzmn al referirse al ataque
de los Agaces dice que son Payagus (Zapata Gollan 1989:221).

La exposicin del Museo se mantuvo sin alteraciones profundas hasta 1987 en que hay una merma del material
expuesto, ya que una parte es trasladado al museo de sitio de Santa Fe la Vieja. Hacia 1990, hay iniciativas de
romper con la exposicin por colecciones y organizar los objetos pre-hispnicos segn su lugar de procedencia
departamental de los departamentos de la Provincia de Santa Fe-. En ocasin de modificaciones edilicias en
1999, se realiza una nueva reformulacin parcial de la muestra correspondiente al material aborigen acorde con
los avances disciplinares y de las investigaciones arqueolgicas que se venan desarrollando desde el propio
Museo; as, estas vitrinas plasman el inters en mostrar la profundidad histrica de la presencia de los pueblos
indgenas (2000 a. p. a por lo menos 500 a. p.) y al mismo tiempo el inters en mostrar la importancia del trabajo
del arquelogo y desmitificarlo. Los nuevos textos que se elaboran son claros y estn enriquecidos con mapas y
fotografas que contextualizan el mbito de vida de las poblaciones indgenas, aunque en este rediseo no hay
elementos que articulen o establezcan claramente la relacin entre el trabajo del arquelogo y los materiales
expuestos. El replanteo de las vitrinas resulta imprescindible si se aspira a que el museo sea una institucin que
divulgue un conocimiento cientfico actualizado, sin embargo las reformulaciones introducidas siguieron siendo
parciales y algunas vitrinas continuaron presentando planteos meramente descriptivos.

La puesta museogrfica hoy sigue teniendo vacos de informacin, algunos objetos estn expuestos sin cartelas
ni referencias, y se puede observar diferentes lgicas expositivas o modificaciones parciales sin un proyecto de
conjunto
6
Podemos afirmar que actualmente hay intentos de reformulacin pero son parciales, y el conjunto no
logra hacer discernible el mensaje global. En el recorrido expositivo las vitrinas de inicio- no hay articulacin
entre las vitrinas que brinden al visitante claves para la comprensin del proceso histrico o directamente hay

5
La etnografa, como la etnologa y la antropologa tomaran mayor relevancia luego de la segunda guerra mundial y de la liberacin de la
colonias europeas en frica y Oceana. La mirada hacia el otro se modifica, el eje cambia de lugar, para observarnos a nosotros, donde lo
diferente no pertenece a lo extrao ni a lo lejano culturalmente ni geogrficamente (Lischetti 2007; Menndez 2002).
6
Por ejemplo, en las vitrinas que se exponen objetos pertenecientes a la parcialidad guaran, se habla de los guaranes pero no se los ha
nombrado anteriormente, se da por supuesto que el visitante sabe a quienes se refiere y la cartelas solo hacen una referencia descriptiva de
tcnicas cermicas ignorando el contexto social de produccin. Vemos que en la secuencia de la lgica del recorrido de la sala del museo se
cambia el lenguaje a uno que responde a artes plsticas, se desliza el eje hacia lo esttico/tecnolgico por sobre ejes arqueolgicos que haban
predominado en vitrinas anteriores.
TOMO IV - 1435
CAPTULO 28 - MESA REDONDA 1
carencias informativas, en algunos casos no se relacionan objetos con contextos de produccin/uso y se ignora el
presente etnogrfico de las comunidades aborgenes, por lo cual se nos trasmite la idea de un tiempo suspendido,
sin cambio.

El Museo exhibe material arqueolgico de los pueblos originarios junto con el colonial, lo que resulta en
algunos aspectos positivo ya que no se da la escisin que mencionramos anteriormente entre museos histricos
y etnogrficos o arqueolgicos. Sin embargo, si profundizamos la mirada vemos que el material arqueolgico
procedente de Santa Fe la Vieja, correspondiente al perodo colonial temprano, es mucho ms abundante que el
expuesto de las comunidades que vivieron antes de la llegada del europeo. En la exposicin actual el eje
ordenador esta dado por un criterio de tiempo cronolgico
7
, los pueblos originarios estn representados al inicio
y al cierre del recorrido de la sala. Si bien las ltimas vitrinas fueron agregadas en la dcada del 90 con la
intencin de no seguir reproduciendo la idea de que la historia de los pueblos originarios que habitaron/habitan
el territorio de la provincia se clausura con la llegada de los espaoles; el mayor espacio de la muestra, est
destinado al perodo hispnico. Las comunidades aborgenes no son abordadas en su riqueza y diversidad tnica
y cultural, sino que de modo descriptivo se hace mencin a esta pluralidad, sin darle al visitante la informacin
necesaria para apreciar, conocer y valorar esa diversidad. El proceso de cambio y transicin que se abre con la
conquista y colonizacin del territorio santafesino queda sesgado, apenas se registran los cambios en las formas
de produccin de la cermica (tcnicas, formas y decoracin). La presencia de las comunidades aborgenes en la
actualidad se presenta en una ltima vitrina, que cierra el recorrido sugerido por el Museo, pero que resulta
insuficiente y en donde la voluntad y opinin de estos pueblos se desdibuja al conservar la actitud de hablar
sobre ellos.

La ausencia de contextualizacin de los objetos, presupone que el visitante posee informacin previa de los
mismos, este hecho lo liga con concepciones elitistas de Museo, donde los visitantes son nicamente expertos o
conocedores de los temas abordados. El hecho de que no exista un eje comn a lo largo de la puesta
museogrfica, atenta contra la construccin de una mirada integral de las sociedades aborgenes, donde al
visitante slo le quedan aspectos fragmentarios de su produccin cultural, como las tcnicas de elaboracin de
cermica, pero descontextualizadas del sentido y la funcin que tenan para la comunidad.

Pensando lo etnogrfico
Para pensar el sentido de lo etnogrfico, partimos del nombre de la institucin Museo Etnogrfico y Colonial
Juan de Garay, es esta misma denominacin la que nos lleva a abrir una serie de interrogantes: a qu se debe
este nombre?, qu se entiende al momento de su creacin por etnogrfico?, cul es el modelo de lo
etnogrfico?, cmo entendemos en la actualidad lo etnogrfico o la etnografa?, qu espacio ocupa lo
etnogrfico en el museo?, acaso los objetos de la vida cotidiana de Santa Fe la Vieja no conforman parte de lo
que entendemos por etnogrfico?. Los mtodos de hilar, de cocinar, de labrar la tierra, de comer, de asistir a ritos
religiosos, entre otros cmo los entendemos?, dnde los ubicamos? Cmo los damos a conocer, como
etnogrfico y/o como colonial? La denominacin de colonial en este museo de que est dando cuenta?, de un
perodo temporal histrico?, de un modo de vida colonial, es decir europeo, en estas tierras lejanas?, cmo se
comprende la dualidad y ambivalencia de la idea de museo etnogrfico y colonial?.

El recorte museogrfico ubica la tradicin europea dentro del espacio colonial, por lo tanto, aquellos que no lo
son, se encuentran dentro del espacio etnogrfico (los aborgenes originarios, los grupos indgenas que
convivieron con los europeos, los esclavos africanos, los mestizos, los gauchos, entre otros). Siguiendo el
recorrido de exhibicin aquello que se entiende por etnogrfico para la institucin, aparece de manera esparcida
en diferentes momentos: antes, durante y despus de la conquista y colonizacin espaola. Lo etnogrfico
abordara con exclusividad los grupos aborgenes, desde lo prehispnico, la convivencia entre lo hispano y lo
aborigen, las comunidades desde el siglo XVI hasta la actualidad en dos paneles; y el gaucho, exhibiendo
aquellas formas de vida campestre de la zona litoralea.

Consideraciones finales
La exhibicin de los objetos aborgenes en el Museo Etnogrfico de Santa Fe, atraviesa en sus casi setenta aos
de vida por distintas etapas, desde la exposicin en base a criterios exclusivamente estticos o bajo la intencin

7
En cuanto a la periodizacin otra observacin pertinente es que en las cartelas explicativas el uso de la denominacin de prehispnico,
cuestionable a nuestro entender, en tanto ese perodo histrico-temporal adquiere identidad no por s sino en funcin del perodo posterior: el
perodo hispnico, lo cual tambin refuerza la idea de que los pueblos originarios no tienen historia.
TOMO IV - 1436
Marina Benzi, Paula Busso, y Rosa Garca
de exponer todo o la mayor parte de su patrimonio, hasta reformulaciones parciales en base a los avances
disciplinares y nuevas concepciones didcticas aunque, hasta el momento, no se concibi un proyecto integrador
que llevara a un anlisis profundo de lo que se expone y cmo se lo expone y obligara al replanteo de para qu y
quines se expone.

Al transitar la historia de la puesta museogrfica vemos que a pesar de estas reformulaciones parciales, del hecho
de haber superado la exposicin por colecciones y de haber avanzado en planteos que facilitan la comprensin
de la exposicin por parte del pblico visitante dejando atrs la concepcin de museo depsito, , prevalece la
mirada arqueolgica por sobre la que pueden aportar otras disciplinas sociales y perduran vacos de
informacin sobre el contexto de uso/produccin/funcin o sentido social y cultural de los objetos expuestos, es
decir, no se reconstruye el vnculo entre el objeto y el contexto socio cultural que lo produjo. Esto sumando al
hecho de que no exista un eje comn a lo largo de la puesta museogrfica, atenta contra la construccin de una
mirada integral de las sociedades aborgenes.

La impronta de las concepciones de Zapata Gollan sobre los pueblos indgenas que marcaron la puesta
museogrfica en gran parte de la historia del museo son superadas pero aun se observa una falta de
contemporaneidad en la comunicacin museogrfica sobre la realidad de los pueblos originarios, condenndolos
a su sola presencia en el pasado o en un tiempo ahistrico; este hecho no slo responde a la lgica de una
ideologa hegemnica que se permeara en las instituciones , sino tambin a la complejidades propias en las
relaciones entre el estado y las comunidades aborgenes y la organizacin de las propias comunidades que no
han facilitado su visualizacin en los Museos.

La creacin en el ao 1992 de un rea de Servicios Didcticos nos habla claramente de la intencin de mejorar la
calidad de la experiencia educativa del museo, pero creemos que la potencialidad educativa de los mismos
depende de la capacidad que tengan de poner en cuestin y en tensin la compleja trama de funciones que
vinculan a la investigacin, la conservacin y la educacin dentro de los museos con la comunidad y de plasmar
los resultados del trabajo conjunto en una exhibicin comprensible para el pblico visitante.

Bibliografa
Asensio, M y Pol E. 2002. Nuevos escenarios en educacin. Aprendizaje informal sobre el patrimonio, los
museos y la ciudad. Aique. Buenos Aires.
Busso, P. 2005. Construcciones de sentido y representaciones del pasado en los Museos. Tesina de la Carrera
de Investigacin Educativa. Universidad Nacional del Comahue Escuela Marina Vilte (CTERA). Buenos
Aires.
Busso P. y Aimini R. 2008. La hora musoea: los museos del Departamento de Estudios Etnogrficos y
Coloniales de Santa Fe. Clio y Asociados. La Historia enseada 12: 11- 28. Universidad Nacional del Litoral.
Santa Fe.
Dujovne, M. 1995. Entre musas y musaraas. Una visita al Museo. Fondo de Cultura Econmica. Buenos Aires.
Dujovne, M. 2001. Ir al Museo. Notas para docentes. Ministerio de Educacin de la Nacin. Universidad
Nacional de Buenos Aires.
Garca Blanco, A. 1988. Didctica del museo, el descubrimiento de los objetos. Ediciones de la Torre. Madrid
Hernndez Xavier. 1998. Museologa y didctica. Consideraciones epistemolgicas. Iber Revista de Didctica
de las Ciencias Sociales, Geografa e Historia 15: 31- 37 Editorial Grao. Barcelona.
Letieri F., Cocco G. y Frittegotto G. 2009. Proyecto acondicionamiento, registro, catlogo e inventario
digitalizado del Patrimonio Arqueolgico de Santa Fe la Vieja para su disponibilidad en Internet. Ministerio de
Innovacin y Cultura de la Prov. De Santa Fe y Consejo Federal de Inversiones. Informe Manuscrito en Archivo
Consejo Federal de Inversiones.
Lischetti, M. [1997] 2007. Caracterizacin de la antropologa como ciencia. Antropologa. Eudeba. Buenos
Aires.
Menndez E. 2002. El malestar actual en la antropologa o de la casi imposibilidad de pensar lo ideolgico.
Revista de Antropologa Social 11: 39-87.
Morales Moreno, L. G. La crisis de los museos de historia.
http://www.museoliniers.org.ar/museologia/ICOFOM_MoralesMoreno-es.pdf. S/F. Consultado en Marzo 2010.
Prez Gollan, J. A. 1997. Proyecto para el museo etnogrfico. Noticias de Antropologa y Arqueologa 17.
Buenos Aires.
Prez Gollan J. A. y Dujovne M. 2001. De lo hegemnico a lo plural: un museo universitario de antropologa.
Entrepasados: X: 20-21.
TOMO IV - 1437
CAPTULO 28 - MESA REDONDA 1
Prez Gollan J. A. y Dujovne M. Del museo etnogrfico: funciones, diagnstico y propuestas. En:
http://museoetnografico.filo.uba.ar/portalMuseo.html. Consultado Marzo 2010
Podgorny, I. 1999. Arqueologa de la educacin. Textos, indicios, monumentos. Sociedad Argentina de
Antropologa. Buenos Aires.
Santacana Mestre, J. y Serrat Antol. 2005. Museografa didctica. Ariel. Barcelona.
Zapata Gollan, A. 1989. Caminos de la colonia. Obra Completa. Tomo 3. Universidad Nacional del Litoral.
Santa Fe.





TOMO IV - 1438
Marina Benzi, Paula Busso, y Rosa Garca









CAPTULO 29

MESA REDONDA 2

ARQUEOLOGAS ACADMICAS Y ARQUEOLOGAS NATIVAS.
NUEVAS TENDENCIAS Y DILOGOS EN LA REGIN CUYANA.

Coordinadores y evaluadores
Ivana Carina jofr
Colectivo de Arqueologa. Escuela de Arqueologa
CONICET UNCa
Diego Escolar
CONICET/IANIGLA
Universidad Nacional de Cuyo
Soledad Biasatti
Colectivo de Arqueologa
CEEMI-CONICET UNR
NDICE

QUEREMOS QUE LAS COSAS ARQUEOLGICAS SE QUEDEN AQU.
REPRESENTACIONES SOCIALES DE LA APROPIACIN SIMBLICA
Y MATERIAL DEL PASADO INDGENA EN RODEO, SAN JUAN
Soledad Biasatti y Carina Jofr .................................................................................................................. 1443

LO LDICO Y LO ARQUEOLGICO: UNA RELACIN POSIBLE
Mara Cecilia Hope y Jaquelina Marcela Salinas ...................................................................................... 1449

CONSTRUYENDO NUEVAS FORMAS DE DILOGO:
UNA ARQUEOLGA INDISCIPLINADA TRANSDISCIPLINAR
EN EL NORTE DE SAN JUAN
Mara Soledad Galimberti, Fernando Lucero, Ana Bertazzo y Cristian Naranjo ...................................... 1453


REFLEXIONAR DESDE LA EXPERIENCIA: ALGUNAS DIFICULTADES
DE LA CONSTRUCCIN COLECTIVA DE UN MUSEO LOCAL
(RODEO, SAN JUAN)
Soledad Biasatti, Fausto Battaggia, Bruno Rosignoli y Alejandro Bruno ................................................. 1459

ARQUEOLOGAS NATIVAS COMO UNA ELABORACIN COLECTIVA
Y LA MILITANCIA EN LA INVESTIGACIN
Ivana Carina Jofr, Mara Beln Guirado Lpez, Luciano Bonfatti,
Selene Araya Lisette y Pablo Daniel Aroca Negron .................................................................................. 1465
QUEREMOS QUE LAS COSAS ARQUEOLGICAS SE QUEDEN AQU.
REPRESENTACIONES SOCIALES DE LA APROPIACIN SIMBLICA Y
MATERIAL DEL PASADO INDGENA EN RODEO, SAN JUAN
Soledad Biasatti

y Carina Jofr



Coleccionismos, ciencia, estado y vecinos accionando
De cmo llegamos a conocernos
Por aquellos das de Febrero de 2008, camino al Chinguillo hicimos una parada obligada en Rodeo para visitar
algunos lugares. Aos anteriores, en nuestras fugaces paradas en la localidad principal de Iglesia para llegar a
Malimn, Colanguil y Angualasto habamos tenido noticias de que en la Unin Vecinal de Rodeo se exhiban
algunas piezas arqueolgicas recuperadas por vecinos en la zona. En esta ocasin no quisimos perder la
oportunidad de ver de qu se trataba.

La sola idea de una muestra arqueolgica en un centro vecinal pareca de por s bastante auspiciosa, teniendo en
cuenta que en la provincia de San Juan, exceptuando la muestra arqueolgica de la Unin Vecinal de la Villa de
Calingasta, aunque armada por profesionales de la Universidad Nacional de San Juan y con otros fines, todos los
dems museos o muestras que presentan piezas arqueolgicas, y particularmente piezas indgenas, pertenecen a
particulares privados o estatales. Ambos tipos de museos y muestras arqueolgicas albergadas ocasionalmente en
edificios pblicos o casas privadas, se inscriben en una larga historia de coleccionismo que en la provincia se
remonta a mediados y finales del siglo XIX, poca en que los discursos de las clases sociales acomodadas locales
hacen sus primeros intentos por organizar el patrimonio de la nacin. El cuerpo del indio muerto y sus
pertenencias formaron parte de este inventario patrimonial, en este caso, an antes del establecimiento de la
arqueologa disciplinar. Por esta razn para entender la historia disciplinar de la arqueologa en San Juan es casi
imposible hacer caso omiso al papel desempeado por los coleccionistas.

Una vez en las precarias instalaciones de la Unin Vecinal de Rodeo, Mariela una pobladora del lugar que
trabaja hace algunos aos en la institucin, nos permiti entrar y ver los objetos que se exhiban en polvorientas
vitrinas y estanteras improvisadas con maderas clavadas en falsa escuadra. Grandes ollas apoyadas en las
estanteras y en el suelo con telaraas y tierra de haca mucho tiempo mostraban un cuadro poco alentador. Al
parecer, varios aos atrs, profesionales de la Universidad Nacional de San Juan haban realizado tareas de
conservacin en algunas de estas piezas, llevando a cabo, incluso, un inventario con la finalidad de tener un
registro de algunas piezas de la coleccin que, segn ellos advertan, posean cierto valor cientfico por sobre
otros objetos de presencia corriente en la zona. Las marcas de ese inventario se observan an en algunas piezas
de las colecciones pertenecientes al actual presidente de la Unin Vecinal de Rodeo. Desafortunadamente no se
sabe con exactitud que sucedi finalmente con aquel inventario. La cartelera indicando asignacin cultural
Angualasto 1200 d.C. tambin revelaba que la organizacin y seleccin de objetos responda a una
representacin arqueolgica cientfica. Aquella impresin nos alej de la idea de encontrar all, por lo menos
hasta ese momento, historias de coleccionismos locales con sus propios modos de representacin y marcas
interpretativas, quizs distintas a las que habamos visto hasta el momento en otras muestras abiertas al pblico
en distintas localidades y en la capital provincial (Biasatti y Aroca 2007; Jofr et al 2009).

Las piezas arqueolgicas pegadas con gomas adherentes en los soportes que forraban internamente las vitrinas
llamaron nuestra atencin. Se nos explic que era una manera de evitar que el pblico pudiera llevarse las
piezas. Entre los objetos expuestos se observaba el cuerpo deteriorado de un pequeo nio de escasos meses de
edad. Podamos ver all los mismos elementos claves que se encontraban en la muestra museogrfica del
Instituto de Investigaciones Arqueolgicas y Museo Prof. Mariano Gambier (en adelante IIAM-UNSJ). El
discurso cientfico articulando los objetos en una seriacin tipolgica ms o menos coherente con el modelo
histrico-cultural, distanciada de la narrativa local, y apelando a la clasificacin etiquetadora del objeto y, an
ms, del sujeto, ambos clausurados en un pasado pasivo. La vitrina a la vez que presenta al objeto, oculta a los

* Cayana: Colectivo de Arqueologa CONICET - UNR solebiasatti@yahoo.com.ar
** Cayana: Colectivo de Arqueologa. Escuela de Arqueologa, CONICET UNCa ivcajofr@gmail.com
Este trabajo fue presentado originalmente en Congreso Interocenico: La Travesa de la Libertad ante el Bicentenario en el Simposio: Los
Archivos Antropolgicos de la Nacin: Escrituras, Cuerpos, Artefactos y Museos, llevado a cabo del 10 al 12 de Marzo de 2010 en
Mendoza, Repblica Arqueologa.
TOMO IV - 1443
CAPTULO 29 - MESA REDONDA 2
sujetos. La presencia de un nio indio en la vitrina es su propia negacin como sujeto, es su clausura como
cosa que se asemeja a la olla para poder ser incorporado al inventario de la coleccin arqueolgica.

Un coleccionismo privado pero con marcas comunitarias
Desde mediados del XX el Sr. Prez Martn, un vecino destacado de Iglesia por su participacin activa en
distintos planos de la vida social de la Comunidad de Rodeo, llev a cabo la recoleccin de objetos
arqueolgicos indgenas procedentes de distintos lugares del departamento, incluyendo en algunas ocasiones
objetos de otras regiones del pas. La coleccin del Sr. Prez Martn, quien adems fue el primer presidente de la
Unin Vecinal de Rodeo creada en la dcada de los 60, fue exhibida por algn tiempo, junto a objetos
pertenecientes a otros vecinos de la zona, en las instalaciones de la antigua iglesia del pueblo de Rodeo con el
objetivo de compartir estos objetos con los vecinos de la comunidad. Posteriormente, en la dcada de 1980
estas colecciones pasaron a ser albergadas y exhibidas en las instalaciones de la Unin Vecinal de Rodeo, una
institucin orientada a la administracin del agua potable en la localidad. En aquel tiempo tambin se sum la
coleccin del Sr. Oscar Varela, la cual tambin rene un importante cmulo de objetos, en su integridad
provenientes del Departamento de Iglesia; al tiempo que se fueron sumando otras piezas encontradas
fortuitamente en la zona y que fueron cedidas temporariamente a la institucin para su exhibicin juntos a las
colecciones ya existentes.

En una visita posterior a Rodeo nos acercamos de manera ms formal a charlar con el el Sr. Varela presidente de
la Unin Vecinal con la intensin de conocer un poco ms a fondo la historia y el sentido de las colecciones
arqueolgicas que habamos podido ver. Sabamos que gran parte de los objetos de la vecinal pertenecan a una
coleccin formada por l, quin adems era identificado por algunos vecinos como un gran aficionado a la
arqueologa. Oscar nos cuenta que siempre le gust salir a buscar restos, desde su poca de niez en la
Estancia de sus padres all en los alrededores de Angualasto. Pero aclara que sus motivaciones siempre fueron
muy distintas a las de aquellos otros coleccionistas, aficionados y traficantes de la zona. Nos dice que siempre
quiso que estas cosas se preserven y por eso quera salvarlas de su destruccin, evitando que fueran rotas,
vendidas y sacadas del lugar a travs de turistas y otros traficantes de piezas que se aprovechan de la mala
situacin de la gente aqu.

Muchas veces los objetos antiguos son encontrados en laboreos y obras de construccin, eso es muy comn
aqu dice Oscar. Justamente hace unos das me llamaron de all de una casa porque encontraron dos vasijas
grandes me seala el dimetro de las vasijas con las manos- que estaban enterradas. No obstante, l intentaba
distanciarse de estas situaciones que lo ponan en un lugar comprometido frente a las autoridades competentes.

En el ltimo tiempo hubo un allanamiento domiciliario en donde se decomisaron piezas arqueolgicas, hecho
que tom conocimiento pblico en la provincia mediante un escndalo meditico
1
y sirvi para que los
pobladores de Iglesia tomaran conciencia de la desventajosa situacin en la que se hallaban frente a los aparatos
de administracin y legalidad estatal. Estos ltimos como reguladores de las formas correctas en que estas
tenencias de objetos y colecciones arqueolgicas y paleontolgicas pueden llevarse a cabo.
Hay s! Cuando yo me enter de eso que pas aqu en Iglesia (), yo le dije a mi esposa. Mir si ahora me
caen a m tambin con que tengo piezas sin declarar. No vaya a ser Por esa razn tambin, Oscar cuenta que
desde hace un tiempo junto con directivos de la Comisin de la Unin Vecinal se les ocurri hacer una especie
de convenio escrito y firmado con los vecinos que traan piezas arqueolgicas para exhibir en la vecinal junto a
las dems colecciones. Por medio de este acuerdo, que oficia de declaracin escrita entre la Vecinal y los
pobladores, estos ltimos no pierden la tenencia de las piezas si no que las ceden temporariamente para su
exhibicin. Oscar nos explica que esta es una manera de respetar el derecho de los vecinos sobre lo que ellos
creen como propio.

Pero indagando un poco ms en este discurso para s mismo (Baudrillard 1990: 118) de Oscar, en tanto
coleccionista, encontramos otros sentidos que tambin estn impregnados de un discurso para los dems, ya
sea incorporando juicios valorativos desprendidos de discursos conservacionistas y proteccionistas bastante
divulgados en el departamento de Iglesia a travs de las instituciones gubernamentales y de la Administracin
del Parque Nacional San Guillermo. Para explicar el trfico o intercambio de piezas arqueolgicas Oscar recurre

1
Vase Diario de Cuyo del da 1 de diciembre de 2007.
TOMO IV - 1444
Soledad Biasatti y Carina Jofr
a los estereotipos sociales ms divulgados por la propaganda proteccionista: la gente de aqu no tiene respeto
por estas cosas, no les importa y esto siempre ha sido as.

Las prcticas de venta y circulacin de objetos arqueolgicos como algo que siempre ha estado presente, sin un
origen, las naturaliza como prcticas ahistricas, desprovistas de una interpretacin que las relacione a las
condiciones de expropiacin en las que cobraron presencia. La accin recae sobre los pobladores de la zona,
quienes -presuntamente- desconocen el valor que estos objetos revisten para el estado y para la ciencia. Por
no estar bien informados son incapaces de otorgarles significado por fuera de un valor de mercado. En este
sentido, usualmente en la zona, los indios son alteridades remotas en el tiempo que se presentan como
extraas a la experiencia histrica de los pobladores, quienes fueron despojados de sus marcas tnicas nativas
tempranamente durante la colonia espaola y posteriormente fueron asimilados al campesinado mestizo
(identificado como hijos de europeos). Esta es una plataforma de extraamiento hecha cuerpo e impuesta por
los aparatos de ordenacin social colonial y republicana, ella hace posible una cosificacin fetichizada que
naturaliza a los sujetos aborgenes del pasado y su produccin cultural como elementos posibles de ser
apropiados para la produccin de mercancas
2
.

En reiteradas oportunidades Oscar retoma un tema muy importante para l y muchos pobladores de Iglesia, el
tema del reclamo de restitucin de lo perdido. En nuestras siguientes visitas a Rodeo y otras localidades de
Iglesia aparece un denominador comn en el que coinciden los diferentes y variados puntos de vista e
interpretaciones que hemos podido escuchar: Las cosas que se llevan son de aqu y deben estar aqu no afuera
(), () queremos que las cosas arqueolgicas se queden aqu, () tengamos un lugar que sea nuestro
para poderlas tener ac en Iglesia y que nos se las lleven (). Estas expresiones replantean crticamente el
despojo y lo subvierten planteando la restitucin de lo perdido. Lo llamativo del caso es que esa prdida es en
s misma la condicin de posibilidad de la crtica, de ah que lo que no est sigue estando aunque de otra forma
y bajo otra condicin.

Por qu no devuelven todas las cosas que se llevaron de Iglesia los arquelogos y otros que tienen museos?
Yo no quiero que pase eso con mis piezas. Por eso yo lo nico que les exijo a ustedes es que las piezas queden a
mi nombre. Porque si ms adelante tambin la comisin de la Vecinal que est ahora se va, quien sabe que
pueda pasar con la coleccin. En cambio si yo las tengo a mi cargo las voy a cuidar para que no se pierdan y no
se vayan de aqu (Entrevista realizada a Oscar Varela, Rodeo, Febrero de 2008).

Del trabajo colectivo a la creacin de un museo
Nuestro trabajo est orientado a un dilogo (Freire 2001)
3
, por eso nuestras propuestas tericas y elecciones
metodolgicas deban, en este como en otros casos, trascender el texto escrito, pero Cmo hacerlo? Ese era
precisamente el desafo. En este recorrido que venamos haciendo, el hecho de encontrar un grupo de vecinos
que deliberadamente haban acopiado piezas arqueolgicas en una sala para ser exhibida/compartida con el resto
de la comunidad nos pareci una provocacin a nuestro trabajo como Colectivo.

Durante el 2008 realizamos actividades con esta institucin vecinal, entre estas se encuentran, por ejemplo, la
realizacin del inventario de las piezas arqueolgicas y elaboracin de planillas de registro, segn lo establece la
Ley Nacional de Proteccin del Patrimonio Arqueolgico y Paleontolgico (Ley N 25. 743). El inventario en
marcha para su inscripcin en el registro nacional de piezas arqueolgicas le permiti a la Unin Vecinal

2
Sin embargo, y de manera antagnica a lo dicho, hemos podido constatar que las tradiciones simblicas locales muestran un poder
subrepticio para simbolizar el mismo silenciamiento del indio no tan muerto, a travs de distintas imgenes que, incluso, evocan su
demonizacin (Jofr ms.). As por ejemplo, las imgenes se seres oscuros aparecidos en antiguas casas de indios, de alguna manera,
problematizan con su misma presencia el entretejido de las marcas tnicas locales frente a un cuerpo extrao de metforas modernas (Jofr
ms.). Los arquelogos, historiadores y coleccionistas locales provenientes de las clases sociales privilegiadas tambin operaron sobre esta
lgica de apropiacin/expropiacin. En este punto, lo indgena arqueolgico comienza a ser visto localmente como una riqueza, igualado a
una mercanca, un fetiche (Marx 1964) que encubre intencionadamente las relaciones de dominacin/subordinacin que operan en la realidad
social.
3
En tanto Colectivo de Investigacin-Accin-Militante entendemos nuestra prctica arqueolgica como siendo parte de un pensar nuestra
historia como enlazada a un tiempo anterior que le da origen y la constituye inevitablemente, de esta forma dejamos de tratar con un pasado
de miles de aos para involucrarnos con un pasado que se haya inscripto en la memoria social de las prcticas y saberes de los sujetos de las
comunidades. Desde una postura dialgica, damos cuenta de una arqueologa que parta de la articulacin de los distintos saberes en tensin,
en un lugar donde las memorias del pasado se vuelven una parte activa en el proceso de constitucin de sujetos histricos presentes,
recobrando memorias de dominacin y resistencias, de quiebres y continnums, de valores y sentidos, de dilogos y silencios (Jofr et al.
2008).

TOMO IV - 1445
CAPTULO 29 - MESA REDONDA 2
habilitar la exhibicin de las piezas, sin poner en riesgo su tenencia legal de las colecciones como entidad
comunitaria. Esta primera muestra fue muy bien recibida en la Unin Vecinal y en la comunidad de Rodeo en
general (Jofr et al. ms.) de hecho fue incorporada en los folletos tursticos, las escuelas de la zona comenzaron a
visitarla y se coloc un cartel en la entrada, etc.

Quisimos avanzar un poco ms en estas ideas que iban tomando otra forma entre la gente de la Unin Vecinal y
nosotros. De esta manera nos propusieron formular un proyecto de museo de la Unin Vecinal lo cual nos
gener ansiedades, preocupaciones, discusiones, dudas Un museo? nuestros trabajos previos en la
provincia nos haban dejado un diagnstico un tanto desalentador sobre la mirada que los pobladores en cada
localidad tenan sobre los museos Cmo tomar esa categora y resignificarla? As fue que nos embarcamos
en este proyecto de re-significar lo que era un museo para nosotros y para ellos vaciarlo y llenarlo de
contenido nuevamente.

Para nosotros un museo significaba un espacio de apropiacin/expropiacin por parte del estado nacional, un
lugar donde el pasado permanece encerrado y cerrado en una vitrina, donde la historia se cuenta cortada por
cuadros cronolgicos, donde los cuerpos humanos se exhiben bajo el membrete de momia, etc, etc. Pero para
la gente de la Unin Vecinal, como para muchos pobladores de Rodeo, el museo significa la posibilidad de
ubicar las piezas arqueolgicas que forman parte de algunas colecciones privadas y que quieren ser mostradas,
compartidas, as como tambin un lugar donde derivar aquellos hallazgos fortuitos que son denunciados y
llevados a la capital sanjuanina segn los procedimientos legales.

Una de las ms fuertes demandas que los pobladores de esta zona tienen para los arquelogos es que se llevan
todo y, por ello, que los vecinos quieran tener un museo para que los turistas y los que vienen de afuera
puedan ver la riqueza cultural de la zona tambin puede ser visto como una autodeterminacin, una forma de
apropiacin simblica y material de la cultura material indgena, frente a una larga historia de saqueo perpetuado
por la ciencia y el estado; aunque la propia idea encarne en s misma a aquella historia de colonialismos
enraizados en las relaciones sociales. El desafo ha sido ensayar las maneras a travs de las cuales esos
colonialismos no se reproduzcan. De esta forma, el museo vecinal puede significar la posibilidad de poder contar
la historia local en primera persona, de decir los nombres y apellidos de los que encontraron cada pieza y porqu
decidieron donarlala posibilidad de que los vecinos se sientan interpelados a participar y ser capaces de contar,
por ejemplo, porqu esa pieza es importante para la historia de Rodeo, de Iglesia, etc. Qu lugar ocupa en la
historia lo que me cont mi abuelo de esta ollita? Esto es un ensayo colectivo que va tomando cuerpo en cada
entrevista, en cada reunin, en cada encuentro con los pobladores.

Ahora que estamos embarcados en este proyecto sentimos con gran intensidad que esto que proponemos
tericamente tiene posibilidad de asidero concreto en la prctica y que ms all de las recurrentes autocrticas
hacia nuestra propia formacin- podemos usar aquellos saberes del modo que ms nos apasione/ensee/sea til
/nos ayude a pensar otra historia
4
.

Conclusiones. Retomando algunas ideas
Si bien las investigaciones han sealado que la idea de exponer objetos de colecciones o rarezas en un
museo es un fenmeno que surge en Europa en la poca del Renacimiento, este inters luego va adoptando
diferentes sentidos hasta que a mediados del siglo pasado un museo es una coleccin de objetos que se muestra
al pblico general en forma de exhibicin permanente que se organiza gracias a un cuerpo de cientficos
(Podgorny, 2000). De todos modos, muchos de los objetos han llegado a formar parte de los museos gracias a
prcticas de coleccionismo aficionado. Sin embargo, siguiendo con la autora la emergencia del museo
moderno -en Argentina, por ejemplo- no cancela los sentidos anteriores. Si bien en la actualidad los sentidos de
los museos se han diversificado, mayormente, han sido espacios ligados a un cuerpo cientfico o grupos de
sabios detrs de los cuales se han albergado discursos hegemnicos (nacionalistas, academicistas, etc.). En San
Juan los objetos arqueolgicos han formado parte de este mismo derrotero que delimita aquello aficionado de
aquello cientfico.


4
En este sentido se lleva a cabo actualmente el proyecto denominado Historias locales narradas a travs de los objetos: Muestra
arqueolgica en la Unin Vecinal de Rodeo (San Juan) financiado por el Ministerio de Educacin de la Nacin a travs del Programa de
Voluntariado Universitario, edicin 2009, y por el Ministerio de Cultura de la Nacin a travs de la Convocatoria de Becas Grupales del
Fondo Nacional de las Artes. Este proyecto se desarrolla en colaboracin mutua entre el Colectivo de Arqueologa Cayana (con lugar de
trabajo en la Escuela de Arqueologa de la Universidad Nacional de Catamarca) y la Unin Vecinal de Rodeo.
TOMO IV - 1446
Soledad Biasatti y Carina Jofr
En la provincia, los coleccionistas provenientes, en su mayora, de las clases sociales privilegiadas tambin operaron
sobre aquella lgica de apropiacin-expropiacin orientada por los intereses de la bsqueda paterna de la autenticidad
con valor cientfico funcional al orden moderno (Baudrillard 1990) acumulando una serie de objetos arqueolgicos
como parte de sus colecciones privadas que, posteriormente, fueron exhibidos al pblico a travs de museos.

No obstante lo dicho, y aunque los museos desde sus orgenes han tenido funciones hegemnicas legitimadoras y
conservadoras de los estados nacionales, pensamos que estos tambin pueden operar en sentido contrario. As,
por ejemplo, en San Juan, conviven y se expresan otros modos de apropiacin de la cultura material indgena que
decodifican de manera distinta estas relaciones histricas hegemnicas ya que los objetos y sitios arqueolgicos
(devenidos en patrimonio arqueolgico) poseen sentidos sociales presentes que los sujetos disputan en funcin
de determinados intereses (histricos, polticos, econmicos y culturales). Dichos lugares y elementos
patrimonializados en tanto enrazan en el presente la memoria histrica de un grupo estn caracterizados por
su capacidad de conservar pero tambin por instalar nuevas narraciones y sentidos sobre el pasado de las
comunidades (Escolar 2003, Jofr et al. 2009).

Basados en nuestras investigaciones previas del contexto provincial sostenemos que de manera conjunta, los
arquelogos profesionales, los museos estatales y privados y los organismos de administracin y control del
patrimonio arqueolgico, en lneas generales, durante mucho tiempo coincidieron en no reconocer otros
discursos que involucren ideas y sentidos diferentes acerca de lo arqueolgico, lo indgena, y lo patrimonial,
situacin que ha ido progresivamente cambiando de matices. Segn lo mencionado, nos parece importante
destacar que estas colecciones de la Unin Vecinal de Rodeo, no slo han tenido como finalidad conservar
materiales hallados en los sitios arqueolgicos sino que tambin contienen a otros elementos que renen
determinadas caractersticas para el coleccionista (Biasatti 2008; Baudrillard 1990), estas son interpretaciones
que contienen y producen representaciones sociales determinadas. Por eso hemos considerado los relatos locales
sobre el pasado como construcciones sociales donde los sujetos ponen en juego sus visiones e interpretaciones
acerca de ellos mismos, los otros sociales y culturales y las realidades sociales que los atraviesan. A travs de
ellos, los sujetos elaboran y negocian formas de comprender comportamientos y valores tanto individuales como
colectivos (Pizarro 2006) que les permiten especificarse como grupos sociales con una identidad que le es
propia. Por eso, en tanto representaciones de la dinmica social (Escolar 2003), los relatos locales, en este caso
aquellos que cristalizan tambin materialmente en los coleccionismos locales, contienen hechos y opiniones que
son producidos por gramticas y convenciones sociales, es decir, que no tienen una existencia como objetos
libres (Tonkin 1995) y, por tanto, deben ser comprendidos dentro de sus propios modos de verdad y horizontes
de produccin. De este modo, por ejemplo, relatos locales e historias cientficas no seran formas contrapuestas
sino dos movimientos complementarios y no menos vlidos o verdaderos en el proceso de representacin social
(Escolar 2003) implicando distintos criterios de verdad.

En el caso presentado, y a diferencia de otros registrados en la Provincia de San Juan, la exhibicin de los
objetos arqueolgicos, el acopio de objetos estuvo orientada por la intencionalidad manifiesta de vincular estas
prcticas de coleccionismo con una tarea de tipo comunitaria mediada por una organizacin de tipo vecinal. Por
eso consideramos que la iniciativa de la Unin Vecinal de Rodeo, la de llevar a cabo por su cuenta (y ya casi
desde hace ms de veinte aos) el recoleccin y resguardo de colecciones arqueolgicas provenientes de la
regin con la intensin a futuro de lograr la construccin de un Museo Local en donde los pobladores pudieran
administrar su patrimonio arqueolgico y desde all pudieran contar a su modo la historia que les es propia sin
perder la posesin sobre las colecciones, resulta un proyecto contra-hegemnico altamente significativo en este
contexto poltico-social.

Para concluir a travs de esta experiencia de trabajo colectivo hemos intentado mostrar un recorrido que no es
slo terico, sino que es constitutiva y eminentemente prctico, puesto que marca una trayectoria de trabajo de
investigacin-accin no intervencionista, pero s militante. Y es militante porque busca redefinirse
constantemente en el dilogo con otras voces, con otras miradas, con otras subjetividades, con otras experiencias
que pugnan por definir lo real y verdadero en contextos de injusticias histricas que hacen situar nuestro rol
como investigadores inmersos en la trama social.

Bibliografa
Baudrillard, J. 1990(1968) El sistema de los objetos. Siglo XXI Editores.
Biasatti, S. y P. Aroca. 2007. Museos, colecciones y coleccionistas: Reflexiones sobre el patrimonio
arqueolgico en la Provincia de San Juan. Ponencia presentada en XVI Congreso Nacional de Arqueologa
Argentina. Jujuy. Ms. Indito.
TOMO IV - 1447
CAPTULO 29 - MESA REDONDA 2
Biasatti, S. 2008. Pre-sented Significations: On private collections museums and its social meanings (San Juan
Province, Argentina). En: Actas del Sixth World Archaeological Congress, pg. 94. Dubln, Irlanda.
Escolar, D. 2003. Arquelogos y Brujos: La disputa por la imaginacin histrica en la etnognesis huarpe. En
Relaciones de la Sociedad de Antropologa XXVIII: 23-43.
Freire, P. 2001(1970). Pedagoga del Oprimido. Siglo Veintiuno Editores, Buenos Aires.
Jofr, I. C., S. Galimberti, M. Morales, R. Castillo y O. Varela. 2008 Colecciones: Historias con Sentido. Una
experiencia de trabajo en conjunto con la Unin Vecinal de Rodeo del Departamento Iglesia, San Juan.
En: Libros de resmenes del IX Congreso Argentino de Antropologa Social, Mesa de Trabajo: Arqueologas
Educadas. Experiencias de trabajo y reflexin crtica de los modos de pensar el pasado y de los modos hacer el
presente a travs de la prctica arqueolgica. Posadas, Misiones, 5 al 8 de Agosto de 2008. Ms. indito.
Jofr, I. C.; S. Biasatti, M. S. Galimberti, P. Aroca y G. Gonzlez. 2008. Doble aprendizaje en las escuela rurales
del Norte de San Juan. En: Actas del IX Congreso Argentino de Antropologa Social, Mesa de Trabajo:
Arqueologas Educadas. Experiencias de trabajo y reflexin crtica de los modos de pensar el pasado y de
los modos hacer el presente a travs de la prctica arqueolgica. Posadas, Misiones, 5 al 8 de Agosto de 2008.
Edicin digital online: Pgina web http://www.caas.org.ar/
Jofr, I. C. 2009. Hombres oscuros, luces extraas y mujeres pjaro entre las cosas de indios: Relaciones
otras asechando los sentidos de la experiencia moderna en el norte de San Juan, Repblica Argentina. Ms.
Indito.
Jofr, I. C.; S. Biasatti; G. Compay; G. Gonzlez; M. S. Galimberti; N. Najle y P. Aroca. 2009. La cayana:
entre lo arqueolgico y lo cotidiano. Tensiones y resistencias en las versiones locales del patrimonio
arqueolgico en el norte de San Juan. Revista Relaciones de la Sociedad de Antropologa Argentina edicin
2008. Tomo XXXIII: 181-207.
Marx, K. 1964. El Capital. Crtica de la Economa Poltica, Tomo I. Fondo de Cultura Econmica, Mxico D.F.
Pizarro, C. 2006. Ahora ya somos civilizados. La invisibilidad de la identidad indgena en un rea rural del
Valle
de Catamarca. Coleccin Thesys 10. Editorial de la Universidad Catlica de Crdoba.
Podgorny, I. 2000. El argentino despertar de las faunas y de las gentes prehistricas. Coleccionistas, museos,
estudiosos y universidad en la Argentina, 1875-1913, Buenos Aires: Libros del Rojas/ Eudeba.
Tonkin, E. 1995. Narrating our Pasts: the Social Construction of Oral History. Cambridge Studies in Oral and
Literate Culture 22, Cambridge University Press.
TOMO IV - 1448
Soledad Biasatti y Carina Jofr
LO LDICO Y LO ARQUEOLGICO: UNA RELACIN POSIBLE
Mara Cecilia Hope
*
y Jaquelina Marcela Salinas
**


Resumen
En este trabajo presentamos las conclusiones de dos talleres que se realizaron con nios y nias en el mes de
enero de 2010 en la localidad de Rodeo, San Juan. Estos talleres se inscriben en un marco de actividades que el
Colectivo de Arqueologa: Cayana viene realizando en los Departamentos de Jchal e Iglesia en dicha provincia.

El objetivo de los talleres fue aproximarnos a las representaciones que los nios construyen en relacin a lo
arqueolgico y al museo. Para indagar en esta construccin, utilizamos lo ldico como una estrategia didctica
que nos ha permitido acceder a las significaciones que los nios, como interlocutores vlidos de su cultura,
manifiestan en el juego, el teatro, el dibujo y la pintura entre otras. De esta manera, todos los integrantes de los
talleres tanto nios como adultos, exploramos otra posibilidad de construccin colectiva del conocimiento.

Introduccin
El presente trabajo resulta de una experiencia que forma parte de los proyectos del Colectivo de Arqueologa:
Cayana. Entre los objetivos propuestos por el grupo, realizamos talleres ldicos de dibujo y pintura con nios
entre cuatro y once aos, en la localidad de Rodeo, San Juan, durante enero de 2010. Actividades similares se
han venido desarrollando anteriormente en escuelas rurales del norte de San Juan, especficamente en los
departamentos de Jchal e Iglesia.

El primer taller se realiz en la Unin Vecinal y el segundo en la colonia de vacaciones que funciona en el Club
Sportivo San Martn de dicha localidad. Mientras que los dos talleres fueron realizados con un objetivo comn:
visualizar las representaciones que los nios construan de lo arqueolgico en relacin a lo local.

La importancia de introducir lo ldico en los talleres tuvo como finalidad el poder plantear a travs del juego
formas novedosas de ver objetos, personas y eventos (Schwartzman 1993) dando as un carcter transformador a
las formas tradicionales de plantear lo arqueolgico.

En este sentido, planteamos una definicin antropolgica del juego, considerndolo una actividad colectiva cuya
cualidad principal es el entretenimiento y la diversin, y que por eso tiene, ante todo, un carcter ldico. A su
vez, el juego permite la educacin e insercin del individuo en la sociedad por medio de la aceptacin de las
normas culturales que se manifiestan en la realizacin de actividades especficas implicadas en su ejercicio como
una actividad primordial (Ramos Ramrez y Martnez Martnez 2000). Al mismo tiempo, el juego posibilita
cambios y transformaciones de las normas sociales que se reproducen como lo instituido y lo verdadero.

Schwartzman (1993), destaca tres procesos caractersticos del juego: la transformacin, la imitacin en los
trminos de los propios jugadores y la combinacin de objetos, roles, situaciones y experiencias. El juego es la
combinacin de fragmentos de experiencias sociales y afectivas vividas cotidianamente por el nio. Estos
talleres ldicos nos permitieron acercarnos a los nios y a sus experiencias cotidianas, mientras que a su vez, nos
habilit a tender lazos sociales que trasciendan la propia actividad ldica.

Entre lo ldico y lo arqueolgico
Dentro de la lnea de investigacin metodolgica del Colectivo Cayana, consideramos a los nios como
interlocutores vlidos en la construccin del conocimiento acerca de las representaciones de lo arqueolgico y de
los museos en el marco de su cotidianeidad. Es decir, estos ltimos, a travs de sus experiencias tematizan al
patrimonio arqueolgico inscribindose en matrices discursivas que poseen su propia historia y desde donde

*
Estudiante avanzada de Antropologa. U. N. R. Colectivo de Arqueologa: Cayana, Escuela de Arqueologa, Universidad Nacional de
Catamarca. mceciliahp@yahoo.com.ar
**
Licenciada y Profesora en Antropologa. U. N. R. Colectivo de Arqueologa: Cayana, Escuela de Arqueologa, Universidad Nacional de
Catamarca. jaquelinasalinas@hotmail.com

TOMO IV - 1449
CAPTULO 29 - MESA REDONDA 2
tambin otras voces dicen a travs de ellos, tejiendo as tramas de interaccin social vinculadas a diversos planos
y registros de la vida de los sujetos (Jofr et.al. 2009).

Podemos decir entonces que la experiencia ldica nos permiti acceder a distintos planos de nuestra tarea de
investigacin-accin-militante. As por ejemplo, primero, pudimos acceder a identificar algunos aspectos de una
objetivacin local de lo que se considera arqueolgico. Pudimos ver en los dibujos y en su posterior explicacin,
que los nios poseen nociones sobre los objetos arqueolgicos que representaron como: puntas de flechas,
vasijas, collares, momias, ollas, con la particularidad de que todos estos objetos se dibujaban en la montaa, en
su lugar de hallazgo original. Estas representaciones construidas por los nios manifiestan un quiebre con la
visin tan difundida de que los objetos arqueolgicos slo pueden/deben encontrarse en los museos. Como se
dijo anteriormente, en estas representaciones aparecen objetos arqueolgicos de indios, pero no los sujetos
sociales que los hicieron: los indios. En este sentido sealado podemos llegar a pensar que lo indgena es parte
de una experiencia cotidiana por encontrarse en las inmediaciones de sitios y lugares arqueolgicos, pero al
mismo tiempo es concebido como algo externo, diferente, de otro tiempo (Jofr et. al. 2008)

En segundo trmino, y relacionado estrechamente a lo anterior, pudimos identificar en los dibujos de los nios
elementos del entorno cotidiano y de su naturaleza, es decir representaciones ms o menos afines en un sentido
local. As es frecuente que aparezca: el agua, ya sea en ros, diques o piletas, la montaa, los animales y
vegetacin.

Y en tercer trmino, vinculado a lo anterior, las nociones de patrimonio cultural que se manifiestan
recurrentemente en los dichos en trabajos realizados por los nios en los diferentes talleres aparecen relacionadas
a la idea de lo propio y lo prohibido, en relacin a la tenencia de un objeto arqueolgico. As, por ejemplo, en el
taller que se realiz en el Club Sportivo San Martn de la localidad de Rodeo, se les pregunt a los nios si
posean objetos arqueolgicos en sus casas. Al manifestar un nio que tena vasijas, la coordinadora del grupo
(docente de la colonia de verano) lo hizo callar inmediatamente. En trabajos anteriores del Colectivo Cayana se
ha podido interpretar que la gente del lugar interpreta al patrimonio arqueolgico como algo prohibido, distante
en el tiempo y en el espacio, pero al mismo tiempo se lo considera como algo propio porque es del lugar y parte
de las historias de las comunidades. (Jofr et al 2009), lo cual puede tener relacin con este tipo de
comportamientos que pudimos observar tambin en la colonia de verano.

Dinmica de los talleres
Los talleres fueron realizados bajo la dinmica del juego a travs de distintos modos de expresiones artsticas
(dibujo, pintura, baile, teatro). Esta forma de trabajo pone de relieve algunas cuestiones: el juego es visto como
actividad libre, placentera y espontnea (Schwartzman, 1993) y a su vez permite un acercamiento al nio y sus
modos de expresin desde un lugar no autoritario.

El primer taller se realiz en la Unin Vecinal de la localidad de Rodeo. Participaron del mismo
aproximadamente once nios entre cuatro y doce aos edad de dicha localidad y cuatro adultos del Colectivo
Cayana. En primer lugar nos agrupamos en una ronda en donde todos nos fuimos presentando y a partir de un
juego nos enumeramos para dividirnos en dos grupos de trabajo conformados por dos adultos integrantes de
Cayana y nios de diversas edades.

El primer grupo plante a los dems qu les gustara ver en un museo? cmo les gustara que fuese?, luego
de la consigna nos sentamos en el suelo con un afiche, tmperas y crayones para que todos dibujen en relacin a
lo planteado. Prim el uso de las tmperas y los dibujos realizados fueron: juegos infantiles con nios (hamacas,
toboganes, subibajas), montaas, animales (la llama en un corral y huevos de gallina), piedras (collares de
piedras), vegetacin (rboles, pinos) y agua (pileta de natacin).

El segundo grupo no se plante una consigna sino que el dibujo era libre, los nios comenzaron por dibujar
elementos relacionados a su localidad como las montaas, el dique, las acequias, sauces, lamos, el sol, animales
(llama, caballos, perros, mariposas), familias y casas . Dibujaron al museo como una casa vaca y al pie de las
montaas ubicaron los objetos arqueolgicos: ollas, collares, la momia Cerro del Toro y tambin dibujaron
sobre piedras (obtenidas del patio de la Unin Vecinal) a modo de petroglifos, que cuando se les pregunt en
donde queran ubicarlos decidieron ponerlos al pie de la montaa. Al finalizar el dibujo se les pregunt qu
actividades les gustara que se realicen en el museo? para lo cual platearon: charlar, pintar, jugar, ver pelculas.

TOMO IV - 1450
Mara Cecilia Hope y Jaquelina Marcela Salinas
Luego de trabajar con los dos grupos se realiz una exposicin de lo trabajado en la sala donde se encuentra
montada la muestra arqueolgica actual, denominada Colecciones: Historias con Sentido. Un representante de
cada grupo fue comentando todo lo dibujado. Las dos lminas fueron colgadas en la sala y quedaron formando
parte de la muestra.


El segundo taller, en el Club Sportivo San Martn, tuvo como disparador una obra de teatro con payasos, en
donde la temtica giraba alrededor de la restitucin de una nariz arqueolgica muy viejsima
1
. A partir de esta
obra se re-trabaj la temtica de lo arqueolgico. El total de nios era aproximadamente de doscientos, los cuales
variaban entre edades de seis a catorce aos pertenecientes al departamento de Iglesia.

Los grupos de trabajo ya estaban divididos previamente por edades y sexos agrupados de esta forma por los
docentes de la colonia. Cada grupo contaba a su vez, con dos o tres coordinadores de la colonia y un integrante
de Cayana. Un grupo trabaj con dos de los actores de la obra de teatro, dicho grupo organiz y puso en escena
otra obra de teatro con una temtica local, haciendo nfasis en la expropiacin.Los dems grupos trabajaron
con afiches y collage, algunos incorporaron elementos de la naturaleza (ramas, tierra, pastos, hojas). En estos
grupos surgieron diferentes temticas algunas con consignas y otras libres.

Entre los ejes podemos sealar:
Paisaje local: montaas, animales (llama, vicua, suri, gato, perro, cndor, palomas, etc.), casas, iglesia,
acequias, el dique Cuesta del Viento, el ro, frutas (manzanas, parral de uvas), horno de barro
Lo arqueolgico: piedras dibujadas, ollas, collares, punta de flecha, momias.
Experiencias recientes relacionadas con la obra de teatro: payasos, la nariz arqueolgica, globos

Entre estos ejes creemos que surge una relacin que los vincula con un sentido de pertenencia entre el contexto
local, cotidiano y arqueolgico. Nos parece relevante destacar que en la mayora de los trabajos no aparecen
dibujados nios ni adultos quedando fuera del paisaje local. En los comentarios finales de los dibujos y las
reflexiones de los nios aparece tambin la temtica de lo prohibido en relacin a la tenencia de los objetos
arqueolgicos.





1
No nos detendremos en esta experiencia porque la misma es retomada en otro trabajo denominado Construyendo Nuevas formas de
dilogo: Una Arqueologa Indisciplinada, Transdisciplinada en el Norte de San Juan de Mara Soledad Galimberti; Fernando Lucero, Ana
Bertazzo y Cristian Naranjo, en esta misma Mesa Redonda.
TOMO IV - 1451
CAPTULO 29 - MESA REDONDA 2
Conclusin
Consideramos importante sostener la forma de taller con actividades ldicas para acceder a las representaciones
de los nios en relacin a lo arqueolgico. Entendemos que en la dinmica de estos talleres, la posicin del
adulto no es la del poseedor de los conocimientos a transmitir, sino un integrante ms del juego: Un juego en el
que la regla es interior al juego y no su lmite previo. Y en el que la responsabilidad no existe como adecuacin a
las formas, sino como habilitacin a un espacio afectivo/pensante capaz de asumir las consecuencias inesperadas
de una situacin compartida. (Taller de los sbados 2008:7).

Sin embargo, dentro de la dinmica de los talleres hubo una diferenciacin importante entre las actividades
realizadas en la Unin Vecinal y en el Club Sportivo San Martn. En este ltimo, todos los grupos estuvieron
acompaados por la figura de coordinadores de la colonia quienes, de alguna manera, influyeron mayormente en
los dibujos de los chicos en relacin a qu dibujar, cmo dibujar, qu materiales utilizar, etc. En parte, esto
modific la espontaneidad de los nios en la realizacin de sus trabajos, preocupados en cumplir las consignas
para el coordinador.

A partir de esta experiencia pensamos que es posible establecer una relacin entre lo ldico y lo arqueolgico, ya
que el juego proporciona un abordaje diferente y enriquecedor de las normas socialmente establecidas de
aprendizaje. Creemos que a travs del juego aprendemos, investigamos y creamos nuevos caminos de accin y
militancia entre todos. Dentro de esta lnea de investigacin seguiremos avanzando, desde nuestro lugar de
trabajo, en el Colectivo de Arqueologa: Cayana.

Agradecimientos
Este trabajo fue realizado en el marco del proyecto Historias locales narradas a travs de los objetos: Muestra
arqueolgica en la Unin Vecinal de Rodeo (San Juan) financiado por el Ministerio de Educacin de la Nacin
a travs del Programa de Voluntariado Universitario, edicin 2009, y por el Ministerio de Cultura de la Nacin a
travs de la Convocatoria de Becas Grupales del Fondo Nacional de las Artes. Dicho proyecto se desarrolla en
colaboracin mutua entre el Colectivo de Arqueologa: Cayana (con lugar de trabajo en la Escuela de
Arqueologa de la Universidad Nacional de Catamarca) y la Unin Vecinal de Rodeo.

Bibliografa
Jofr, I.C., Biasatti, S.; Galimberti, S.; Aroca, P. y G. Gonzlez. 2008. Doble aprendizaje en las escuelas rurales
del Norte de San Juan. Actas del IX Congreso Argentino de Antropologa Social. Misiones.
http://www.acaas.org.ar/
Jofr, I.C; Biasatti, S.; Compay, G.; Gonzlez, G.; Galimberti, S.; Najle, N. y Aroca, P. 2009. La cayana:
entre lo arqueolgico y lo cotidiano. Tensiones y resistencias en las versiones locales del patrimonio
arqueolgico en el norte de San Juan. Revista Relaciones de la Sociedad de Antropologa Argentina edicin
2008. Tomo XXXIII: 181-207. Buenos Aires.
Ramos Ramirez J. y J. Martnez Martnez. 2000. Diversas miradas sobre el juego. Editorial Tierra Firme,
Mxico.
Schwartzman, S. 1993. Cuando el Canal era un ro sobre el comportamiento ldico infantil en nios
preescolares de un rea marginal, Provincia de Santa Fe. Memoria de Ttulo para optar al Grado de
Antroplogo, Escuela de Antropologa, Facultad de Humanidades y Artes, Rosario.
Taller de los sbados. 2008. Un elefante en la Escuela. Editorial Tinta Limn, Buenos Aires.


TOMO IV - 1452
Mara Cecilia Hope y Jaquelina Marcela Salinas
CONSTRUYENDO NUEVAS FORMAS DE DILOGO:
UNA ARQUEOLGA INDISCIPLINADA TRANSDISCIPLINAR
EN EL NORTE DE SAN JUAN
Mara Soledad Galimberti
*
, Fernando Lucero*, Ana Bertazzo**
y Cristian Naranjo***


Resumen
Desde el ao 2006 el Colectivo de Arqueologa Cayana viene desarrollando actividades en la provincia de San
Juan en el marco de varios proyectos de investigacin
1
. Como parte del trabajo de campo realizado en Enero de
2010 se present una obra de teatro para nios en la Colonia de Verano en Rodeo, departamento Iglesia. Esta fue
creada, dirigida y actuada por miembros estables del Colectivo con la intencin de explorar nuevas formas de
dialogo con la comunidad. Esta experiencia estuvo orientada a romper con los marcos terico-epistemolgicos
tradicionales fundados, entre otras cosas, en un distanciamiento de los arquelogos/as con los contextos y grupos
sociales con quienes trabaja, y tambin a re-definir las relaciones entre prctica arqueolgica / participacin
local, estableciendo lenguajes otros para el tratamiento de tpicos vinculados con el pasado indgena local.

Saberes y haceres colonizados: La construccin de subjetividades hegemnicas
El proceso mundial de colonialidad/modernidad (Dussel 1994; Mignolo 2001; Quijano 1992;) instal la
racionalidad como estadio superior del conocimiento invalidando todos los dems modos de conocer. La ciencia,
como la nica forma legtima de conocer, se organiz sobre la base de los principios de universalidad,
objetividad, exterioridad y neutralidad (Gnecco 2004), dando lugar no solo a la separacin entre los sujetos y sus
valoraciones en la produccin de conocimiento sino tambin entre los sujetos y el mundo circundante. El
discurso cientfico, constituido en la creencia de poseer un lenguaje universal con el cual generar conocimiento
objetivo, neutral y absoluto sobre el en-s de las cosas (Castro Gmez S/F), se instaur como el nico discurso
posible, colonizando las mentes, las prcticas, los lenguajes y los saberes dentro y fuera de las disciplinas
acadmicas.

El modelo epistmico desplegado por la modernidad/colonialidad occidental, la Hibris del Punto Cero que define
Castro Gmez (S/F)
2
, no solo permiti la consolidacin del proyecto imperial y civilizatorio de Europa en
Amrica sino que instal y arraig tipos hegemnicos de subjetividad y conocimiento que marcaron nuestra
historia sudamericana.

Por un lado, la Universidad como locus de enunciacin privilegiado (Gnecco 2003a) reprodujo, y sigue
reproduciendo, el modelo epistmico de occidente tanto en el tipo de pensamiento disciplinar que representa
como en la forma en que organiza sus estructuras; la universidad se inscribe en la estructura triangular de la
colonialidad: la colonialidad del ser, la colonialidad del poder y la colonialidad del saber (Castro Gmez S/F:
79-80. Resaltado en el original). Siguiendo al autor dentro de la Universidad

los conocimientos tienen unas jerarquas, unas especialidades, unos lmites que marcan la diferencia entre unos
campos del saber y otros, unas fronteras epistmicas que no pueden ser transgredidas, unos cnones que definen
sus procedimientos y sus funciones particulares (Castro Gmez S/F :81)

Por otro lado -o por el mismo- la Arqueologa en tanto disciplina moderna y colonial, reprodujo los principios de
universalidad, exterioridad, objetividad y neutralidad, estableciendo una praxis que no slo desestim otras
formas de conocimiento del pasado indgena sino que estableci las fronteras epistmicas y los procedimientos y

*
Cayana Colectivo de Arqueologa, Escuela de Arqueologa, Universidad Nacional de Catamarca.
**
Cayana Colectivo de Arqueologa, Facultad de Ciencias Sociales, Universidad Nacional de San Juan.
***
Cayana Colectivo de Arqueologa, Facultad de Filosofa, Humanidades y Artes, Universidad Nacional de San Juan.
1
PID 25995603: "Investigacin Arqueologa en San Juan: Investigacin y Transferencia educativa para la promocin sociocultural". SeCyT.
UNCa.2006-2010; Proyecto de Voluntariado Universitario: Historias locales narradas a travs de los objetos: Muestra arqueolgica en la
Unin Vecinal de Rodeo (San Juan) financiado por la Secretara de Polticas Universitarias del Ministerio de Educacin de la Nacin y por
el Fondo Nacional de las Artes. Secretara de Cultura de la Presidencia de la Nacin.
2
La Hybris como el pecado entre los griegos clsicos de querer asemejarse a los dioses y el Punto Cero como el pecado de pretender
observar el mundo desde un locus neutral, objetivo y absoluto, fue el primer imaginario que permiti la consolidacin del poder econmico y
poltico de las elites criollas blancas del SXVIII en Amrica Latina (Castro Gmez S/F :57)
TOMO IV - 1453
CAPTULO 29 - MESA REDONDA 2
metodologas que no pueden ser trasgredidas. El propio devenir histrico disciplinar instal en nuestras mentes
algunas de las premisas bsicas que como profesionales, se pretende, no deberamos desconocer. En primer
lugar, que deberamos ocuparnos de describir, interpretar, comprender las materialidades de las sociedades, esa
propiedad que dio especificidad a la Arqueologa. En segundo lugar, que esa materialidad pertenecera al pasado,
que en el contexto local, debera referir slo a los tiempos prehispnicos, es decir indgena. En tercer lugar, y en
una combinacin de las dos anteriores (materialidad + pasado + indgena), que el espacio geogrfico por
excelencia para la investigacin arqueolgica local seran los espacios rurales donde los sitios y objetos
pertenecientes a las sociedades indgenas prehispnicas resistieron el paso del tiempo. Estas proposiciones, en la
tradicin arqueolgica local estableceran, o sealaran, que hacer arqueologa sera salir al terreno a prospectar,
a hacer recolecciones de material de superficie o hacer excavaciones sistemticas en lugares donde se supone, o
se sabe, existen restos materiales de sociedades indgenas del pasado.

Una praxis arqueolgica tal, fundada en un deber ser (Dussel 1994) involucrara, adems, la idea de una
disciplina asptica que rechaza la valoracin y la accin (Gnecco 2003a, 2003b) formada, a su vez, por
intermediarios neutros en los procesos de construccin de interpretaciones acerca del pasado. sta ha sido una de
las formas en que nos hemos mantenido al margen del mundo social, desvinculndonos de los otros sujetos, del
presente y de los problemas y conflictos sociales. Una prctica sostenida, por un lado, en la creencia en una
capacidad exclusiva (la acadmica) de crear conocimiento sobre el pasado -entendida esta capacidad como una
reflexividad terica privilegiada- y, por otro, en la presuposicin de que quienes nos rodean, nada tienen para
decirnos. Pero tambin se trata de una prctica mediada por el convencimiento que ya no hay nadie que pueda
decirnos nada sobre el pasado prehispnico, configurando la idea de un pasado indgena clausurado.

Nuestra experiencia de trabajo en la provincia de San Juan, sin embargo y pese a todas las prescripciones,
siempre estuvo orientada a romper con los marcos terico-epistemolgicos tradicionales. Desde un inicio, y cada
mas vez mas acentuadamente a lo largo del devenir de nuestro trabajo, construimos un primer indisciplinamiento
que nos permiti romper con la creencia de la exclusividad disciplinar: formar un grupo de trabajo integrado
por profesionales y estudiantes de Arqueologa, Antropologa, Historia, Trabajo Social y Sociologa y por todos
aquellos que, desde diferentes mbitos sociales, tuvieran ganas de hacer y decir cosas sobre el pasado indgena
local. Esto nos permiti romper con el distanciamiento entre las disciplinas pero tambin romper la distancia
entre stas y los contextos y grupos sociales con quienes se trabaja. Pero sobre todo, nos permiti re-definir las
relaciones entre praxis acadmica / participacin local estableciendo lenguajes otros, para el tratamiento de
tpicos vinculados con el pasado indgena local. La intencin de este trabajo es contar una experiencia que nos
reuni como seres humanos en una accin colectiva plural, permitindonos la exploracin de nuevas formas de
dilogo con la comunidad con quien trabajamos.

Explorando nuevas formas de dialogo: una experiencia transdisciplinar
La obra de teatro llevada a cabo en el mes de Enero en la Colonia de Verano en el Club Sportivo San Martin de
la localidad de Rodeo, Provincia de San Juan, surge como una adaptacin de las producciones teatrales del
elenco de Payasos del Centro Cultural El Barro
3
. El texto original de la obra est orientado a abordar aquellas
problemticas sociales que involucran a los nios en su cotidianidad ms cercana, hacindolos partcipes y
actores del desarrollo de la trama puesta en escena. Estas problemticas hacen referencia a la violencia entre
pares, al autoritarismo, al engao, al maltrato, apuntando a la reflexin y participacin del nio y la nia para su
resolucin en el transcurso de la obra. El nfasis est puesto en la transmisin de valores como la solidaridad, el
compaerismo y la igualdad, jugando con la idea de sorpresa como eje fundamental y promoviendo las
sensaciones de felicidad y goce como necesidades primordiales de todos y todas.

En base al texto original, en esta oportunidad, se intent elaborar un escrito para nios con elementos
contextualizados en Rodeo y sus alrededores, en una realidad particular, teniendo en cuenta las caractersticas de
su entorno, sus problemticas y sus espacios locales, enfatizando en la provocacin de reacciones ante la idea de
despojo de lo propio Esta categora ha sido definida por nosotros (Ver por ejemplo Jofr et al 2009) como
expropiacin de la materialidad indgena en base al recorrido de investigacin del Colectivo Cayana. Hemos
argumentado que, tradicionalmente, las comunidades del Norte de San Juan fueron colocadas en un lugar de
recepcin pasiva de los discursos y relatos hegemnicos producidos por la arqueologa y re-estructurados por el

3
El cual trabaja la participacin y expresin a travs de talleres artsticos con nios, nias, adolescentes y adultos de las Villas Rodrguez
Pinto, San Roque y Barrio Wilkinson, ubicadas en el departamento de Rivadavia de la Provincia de San Juan. Cito en calle Ignacio de la
Roza 271 oeste, Rivadavia. Correo electrnico culturaelbarro@hotmail.com
TOMO IV - 1454
Mara Soledad Galimberti, Fernando Lucero, Ana Bertazzo y Cristian Naranjo
Estado provincial, implicando una cosificacin del Patrimonio Arqueolgico como objetos del pasado, con valor
cientfico y potencialidad para instrumentar el desarrollo cultural de las comunidades. Esta situacin creemos se
articula en una compleja red de interacciones sociales que generan una relacin excluyente entre los pobladores
de las comunidades que poseen, aunque sea negada, una relacin tradicional de larga data con la cultura material
indgena. De all que hemos propuesto que patrimonializacin se convierte en un equivalente de
expropiacin, al mismo tiempo que la designacin de lo arqueolgico implica su separacin del mundo
cotidiano, tiempo-espacio en donde esta cultura material puede ser experienciada, vivida. Sin embargo, una
patrimonializacin de la cultura material arqueolgica en San Juan que ha servido para perpetuar las relaciones
de hegemona/subordinacin ha servido tambin para la generacin, por parte de las comunidades, de sentidos
locales propios anclados en su experiencia con el mundo, distancindose y generando alternativas al estado de
patrimonializacin (dominacin-expropiacin) al que son expuestas. Es por ello que las problemticas
culturales, sociales y econmicas de la regin integran tambin al pasado de las comunidades y las
materialidades arqueolgicas adquieren significaciones particulares en esta compleja red de relaciones sociales,
en donde los pobladores interactan con el estado provincial y nacional, las organizaciones no gubernamentales
y los capitales transnacionales (Jofr et al 2009).

El proceso de produccin del texto y la puesta en escena de la obra signific la valoracin de una serie de
emociones y sensaciones re-encontradas, que transitaron entre el miedo al ridculo, la risa, la ansiedad, los
nervios, el placer, la felicidad y el compromiso. El elenco de payasos estuvo constituido por miembros estables
del Colectivo Cayana quienes interpretamos a Gregorio, Chichita, Pepa y Chicho y el desarrollo de la obra se
bas en una historia contada-actuada por nosotros mismos en la caracterizacin de dichos personajes.

En la trama de la historia, dos de nosotros (Gregorio y Chichita) traamos una sorpresa en una caja para los
nios/as, haciendo alusin a algo muy viejsimo que perteneca a sus antepasados (una nariz de payaso
arqueolgica) y era parte de su historia local. El conflicto se presenta cuando Pepa y Chicho dan cuenta del valor
que esto les representa y expropian la caja con la nariz ancestral, para as intentar intercambiarla por algo
material (en este caso caramelos). El pblico aqu interacta con los payasos decidindonos qu hacer ante tal
situacin, ayudndonos a buscar la sorpresa, denunciando a los ladrones -expropiadores- en fin dndole curso
a la historia que ellos mismos eligen en base a sus cotidianidades y significaciones. La historia se resuelve
cuando Chicho y Pepa, al reflexionar sobre sus propias acciones, animados, impulsados y desafiados por las
reacciones de desaprobacin, protesta y rechazo del pblico, devuelven la sorpresa y cuentan lo sucedido ante
sus compaeros y los nios/as presentes. Una vez restituida la nariz, el pblico decide qu hacer con ella, cmo
se cuidar aquello que es considerado propio y quienes lo harn.

Transgrediendo los lmites disciplinares: el teatro callejero como una construccin comunicacional de una
arqueologa inquieta.
Nuestra actividad en la Colonia de Verano en Rodeo parti de la idea de pensar al teatro como un fenmeno
dialctico que posibilite el pronunciamiento del mundo (Dacal 2006: 115 - 116), esto es pensarlo y vivirlo
experiencialmente como una forma de dilogo, que por eso se torna verbal, corporal y inminentemente emotivo.
Un dilogo que se construye colectivamente como una forma comunicacional dinmica entre sujetos histricos
presentes que, desde sus propios lugares, suean, crecen y construyen realidades sociales particulares y por qu
no? tambin realidades distintas, menos injustas y ms plurales.

La experiencia vivenciada se inscribi dentro de la metodologa del teatro callejero, entendido este como todo
teatro no realizado dentro de un recinto teatral propiamente dicho (Dacal 2006: 13). Este es un teatro de
riesgo, de vigorosa atencin por parte de quienes lo dramatizan y que est emparentado directamente con la
improvisacin. Tiene un texto que lo sustenta pero ste puede y debe sufrir modificaciones, ya que el contacto
con el pblico es tal que impacta, logrando as que se produzcan alteraciones en la propia trama y direccin de la
historia escenificada. Esto se explicita en la prdida de la posicin pasiva del pblico. El teatro callejero
construye un pblico y ste, entonces y a su vez, construye un teatro (...) transformando a la representacin
teatral en una vvida y nutriente ceremonia (Dacal 2006: 13).

La creacin del texto surge inevitablemente de la voz popular, en cualquiera de sus formas y tiempos. Desde que
se crea, pasando por el entrenamiento hasta la accin concreta, el texto del teatro callejero mantiene su condicin
dinmica. Todo ello es la razn fundamental por la que el pblico mantiene contacto y construye el devenir de la
historia dramtica ya que se siente identificado en ese texto. La materia prima de este teatro son justamente los
emergentes de las comunidades donde est inserto. Esta caracterstica hace ms fuerte aun el vnculo que se crea
con el pblico, ya que se comienza a trabajar con lo cotidiano de la comunidad abarcando los distintos espacios
TOMO IV - 1455
CAPTULO 29 - MESA REDONDA 2
temporales desde la nocin comunitaria. Es por esto que su valor artstico ha sido notorio toda vez que su
prctica supo conectarse con la memoria colectiva y con la realidad sociopoltica de la comunidad (Dacal
2006: 13). El teatro es una herramienta comunicacional en la que la memoria juega un papel principal, ella se
torna viva y presente en un proceso continuo de escenificaciones donde se construye y se vuelve a reconstruir.
All, el pblico presente participa activamente en la re-significacin popular de la trama y se encuentra incluido
como protagonista de una historia propia, con la cual se identifica y donde puede redefinir su accin. Es por eso
que una de las cualidades que se encuentran en este modo de hacer teatro es su libertad; su libertad para ser y
hacer, para crear y re-crear, dejando libre la capacidad de soar, de denunciar y reclamar lo propio y expulsar lo
ajeno, ya sea explicita o simblicamente. Dentro de este marco, el teatro callejero permite que el pblico sea
participante activo de su propio ser histrico, aqu y ahora, de una manera crtica y analtica. La practica
teatral, en esta perspectiva, contribuye a formar sujetos colectivos con capacidad de pensamiento y accin
(Dacal 2006: 68)

Consideraciones finales: transgredir para crear
Dentro de estos lmites acadmico-disciplinares una experiencia como la desarrollada en la Colonia de Verano
de Rodeo se nos presenta como una alternativa fuera de los cnones establecidos, como una especie de
transgresin de los contornos que nos marca nuestra pertenencia a la disciplina y a la universidad. Sin embargo
en un modelo de dilogo transdisciplinar de saberes (Castro Gmez S/F) esto es posible: el Teatro o cualquier
otra forma de arte puede de ser explorada como formas otras de construccin colectiva, como lenguajes de
sensibilidades y cuerpos, como lenguajes otros (Grosso 2009) donde la risa, el ridculo, las emociones, permiten
dialogar y tender puentes con otros sujetos y con nosotros mismos.

Un modelo de este tipo permite embarcarnos en una manera diferente de hacer arqueologa porque

la transdisciplinariedad afecta el quehacer mismo de las disciplinas () introduce un viejo principio ignorado
por el pensamiento analtico de las disciplinas: la ley de la coincidencia oppositorium. En el conocimiento, como
en la vida, los contrarios no pueden separarse. Ellos se complementan, se alimentan mutuamente; no puede
existir el uno sin el otro, como quiso la lgica excluyente de la ciencia occidental. En lugar de separar, la
transdisciplinariedad nos permite ligar (link) los diversos elementos y formas del conocimiento, incluyendo ()
los conocimientos que la modernidad haba declarado como dxicos (Castro Gmez S/F: 86).

Pero sobre todo permite comenzar a transitar los caminos de la decolonizacin de las instituciones
productoras/administradoras del conocimiento y con ello, la senda de la decolonizacin del conocimiento

si la primera ruptura epistemolgica fue con la doxa en nombre de la episteme para subir al punto cero (la
modernidad/colonialidad frente al ideas medievales), el gran desafo que tienen ahora las ciencias humanas es
realizar una segunda ruptura epistemolgica, pero ahora ya no con la doxa sino frente a la episteme, para bajar
del punto cero. El ideal ya no sera el de la pureza y el distanciamiento, sino el de la contaminacin y el
acercamiento (Castro Gmez S/F: 89)

Pero esta posibilidad de ir ms all de las categoras de anlisis y de las disciplinas modernas, no es ()
negarlas () porque stas tengan que ser rebasadas por algo mejor (Castro Gmez S/F: 90). Es simplemente
una ampliacin del campo de visibilidad abierto por la ciencia occidental moderna, dado que sta fue incapaz
de abrirse a dominios prohibidos, como las emociones, la intimidad, el sentido comn, los conocimientos
ancestrales y la corporalidad (ibidem).

Con esta actividad, el Colectivo abri el espacio para explorar otras formas de percibir, comunicar, escuchar,
indagar, intentando buscar formas otras de vinculacin -o vinculaciones otras- con la comunidad a partir de
tpicos relacionados con el pasado local, en este caso, pero tambin abiertos a infinitos temas posibles. De esta
forma, fuimos partcipes -personas y personajes- en la construccin de impresiones/sensaciones colectivas acerca
de lo indgena, de lo patrimonial, de lo arqueolgico, de lo propio, de lo ajeno; abrindonos la posibilidad de
construirnos en una historia que ya no nos es ajena, permitindonos sentirla y vivirla como propia.

Esta experiencia de la cual intentamos dar cuenta aqu tambin dio lugar a pensar y construir el guin de una
segunda Muestra de la Unin Vecinal de la localidad de Rodeo en base a la trama de la obra de payasos. La
Historia de la Nariz representa las historias de expropiacin vividas y contadas por los pobladores; la nariz,
metafricamente, representa lo propio, representa la bsqueda activa de aquello que es quitado; impulsa, desde la
TOMO IV - 1456
Mara Soledad Galimberti, Fernando Lucero, Ana Bertazzo y Cristian Naranjo
movilizacin de los sentires y los haceres -a veces silenciosos y otras veces no tanto- la crtica social de las
situaciones y relaciones de dominacin que intervienen en el acto histrico de la expropiacin.

Agradecimientos
Agradecemos a las/os coordinadoras/es de la Colonia de Verano por permitirnos realizar esta actividad, por su
predisposicin y buena onda. A los chicos por regalarnos sus sonrisas y por sobre todo prestarnos atencin y
participar. A Rogelio Castillo por las tantas idas y vueltas que compartimos juntos, a Mariela Morales por sus
recibimientos siempre tan amables y su ayuda invaluable y a Alberto Varilla por ensearnos un poco de lo
mucho que sabe, por sus visitas y esas historias siempre cautivantes.

El presente trabajo fue preparado a partir del trabajo de campo realizado en el marco del Proyecto de
Voluntariado Universitario: Historias locales narradas a travs de los objetos: Muestra arqueolgica en la Unin
Vecinal de Rodeo (San Juan). Secretara de Polticas Universitarias. Ministerio de Educacin de la Nacin.
2009-2010; y Proyecto: Historias locales narradas a travs de los objetos: Muestra arqueolgica en la Unin
Vecinal de Rodeo (San Juan). Becas Proyectos Grupales. Fondo Nacional de las Artes. Secretara de Cultura.
Presidencia de la Nacin.2009-2010.

Bibliografa
Castro-Gmez, S. S/F. Decolonizar la universidad. La hybris del punto cero y el dilogo de saberes. En:
http://www.ram-wan.net/restrepo/decolonial/14-castro-descolonizar%20la%20universidad.pdf Pagina consultada
15 de Febrero de 2010.
Dacal, E. 2006. Teatro de la Libertad. Teatro callejero en la Argentina, desde el Movimiento Grupal de los 80.
Pp. 13 116. Editorial Madres de Plaza de Mayo. Buenos Aires, Argentina.
Dussel, E. 1994. 1492: El encubrimiento del otro: hacia el origen del mito de la modernidad. Plural Editores. La
Paz. En: http://gpcriticolatinoamericano.blogspot.com Pgina consultada en el 1 de Julio de 2008.
Gnecco, C. 2003a. El erotismo de la desnudez arqueolgica. Arqueologa al desnudo. Reflexiones sobre la
prctica disciplinaria. Editado por C. Gnecco y E. Piazzini. Pp.5-24. Editorial Universidad del Cauca. Cali.
2003b. Arqueologa en Colombia: el proyecto cientfico y la insubordinacin histrica. En: Arqueologa al
desnudo. Reflexiones sobre la prctica disciplinaria. Editado por C. Gnecco y E. Piazzini. pp.:203-221. Editorial
Universidad del Cauca. Cali
2004. Arqueologa ex cntrica en Latinoamrica. Hacia una arqueologa de las arqueologas
Sudamericanas. Editado por A. F. Haber. pp.:169-183. Uniandes. Bogot.
Grosso, J.L. 2009. Smbolo, Cuerpos y Emociones. Conversaciones antropolgicas en el reverso escritural de las
ciencias sociales. Economa y Sociedad en Amrica Latina. Coordinado por J. Navarrte. Congreso Pre-ALAS
Per, Universidad Ricardo Palma, Lima
Jofr, I. C.; S. Biasatti; G. Compay; G. Gonzlez; S. Galimberti; N. Najle y P. Aroca. 2009. La cayana: entre
lo arqueolgico y lo cotidiano. Tensiones y resistencias en las versiones locales del patrimonio arqueolgico
en el norte de San Juan. Revista Relaciones de la Sociedad de Antropologa Argentina edicin 2008. Tomo
XXXIII: 181-207.


TOMO IV - 1457
CAPTULO 29 - MESA REDONDA 2
REFLEXIONAR DESDE LA EXPERIENCIA: ALGUNAS DIFICULTADES DE LA
CONSTRUCCIN COLECTIVA DE UN MUSEO LOCAL (RODEO, SAN JUAN)
Soledad Biasatti
*
, Fausto Battaggia**, Bruno Rosignoli**
y Alejandro Bruno


Resumen
En el marco de los trabajos realizados como acompaamiento al proyecto de creacin de un museo arqueolgico
local en la Unin Vecinal de Rodeo de la Provincia de San Juan, nuestro grupo Cayana: Colectivo de
Arqueologa ha llevado adelante diferentes actividades (de investigacin, gestin, difusin, formacin,
conservacin, entre otras). Luego de una serie de intervenciones pretendemos dar cuenta de algunas de las
dificultades que han surgido en los trabajos de campo as como tambin los modos de repensarlas como partes de
un proceso de construccin colectiva de conocimiento que se pretende a largo plazo.

Introduccin
El proyecto de acompaar un museo local -que ya se vena gestando en la institucin previamente a nosotros - en
la Unin Vecinal de Rodeo (provincia de San Juan
1
) se enmarca dentro de una serie de actividades de
investigacin-accin que se desarrollan en la regin desde el ao 2006. Nuestro grupo de trabajo, al que le dimos
el nombre de Cayana: Colectivo de Arqueologa est conformado por arquelogos, antroplogos, socilogos,
pobladores locales, artesanos, maestros, miembros de asociaciones, estudiantes de Trabajo Social, Antropologa,
Arqueologa e Historia, etc y apunta a un tipo de construccin colectiva y dialgica del conocimiento (Biasatti
et.al. 2006). Particularmente, en dicha institucin vecinal se albergan una serie de colecciones arqueolgicas
cedidas por algunos pobladores de la localidad. Este trabajo conjunto
2
viene desarrollndose desde el ao 2008
(Jofr y Biasatti 2010) entendiendo que la creacin de un museo puede aportar a la
resignificacin/reapropiacin de los sentidos sociales de lo arqueolgico a travs de este espacio.

Desde los inicios se pusieron en juego nuestros pre-supuestos sobre museos tradicionales (como instituciones
normativas que reproducen y legitiman un relato sobre una historia unilineal) y los recorridos previos por
algunos museos de la provincia de San Juan donde nos encontramos con algunos elementos de estos museos
tradicionales a travs de los discursos desplegados en salas sucesiva y cronolgicamente ordenadas por
culturas que desaparecen con la llegada de los espaoles (Jofr 2009), instituciones que, al erigirse como
voces autorizadas se declaran como los encargadas de llevar adelante una obra civilizadora (Gambier y
Michieli 1985: 7). Sin embargo, a travs de otras maneras de hacer (Grosso 2007) nos dimos el lugar para
desplegar diferentes posibilidades y darle un nuevo significado -colectivamente- a esta nocin de museo.

En particular, este museo local viene a responder a dos tipos de demandas concretas de la comunidad sobre el
destino de aquellas piezas recolectadas, aos atrs, por los vecinos. Por un lado, las demandas expresan
queremos que las cosas arqueolgicas se queden aqu, y por otro, la mirada de los pobladores locales hacia
los arquelogos que no se lleven las cosas. Ambas interpelaciones nos reafirmaban la necesidad de construir
otro tipo de vnculo entre la comunidad y nuestro grupo. El eje central de tal vnculo es proponer otras relaciones
en donde lo arqueolgico oficie, de algn modo, como excusa para re-situarse en la propia historia y
modificar las relaciones asimtricas planteadas por otros modos de hacer acadmicos tradicionales. Esto se
llevara adelante mediante una reconstruccin de las memorias ancladas en la materialidad arqueolgica a travs
de las mltiples interpretaciones narradas por los pobladores sobre su pasado y presente.


*
CONICET - UNR - Cayana Colectivo de Arqueologa, solebiasatti@yahoo.com.ar
**
Facultad de Humanidades y Artes de la UNR - Cayana Colectivo de Arqueologa, f_battaggia@hotmil.com, brosignoli@hotmil.com,
ale_b_2086@hotmil.com

1
La localidad de Rodeo tiene una poblacin aproximada de 2.400 habitantes y es la cabecera del Departamento Iglesia, el cual cuenta con
una poblacin total de casi 7 mil habitantes (segn datos censales de 2001). Se encuentra ubicada a 195 kilmetros de capital de la provincia
2
Dichas actividades se llevan adelante en el marco del proyecto denominado Historias locales narradas a travs de los objetos: Muestra
arqueolgica en la Unin Vecinal de Rodeo (San Juan), dirigido por Ivana Carina Jofr, financiado por el Ministerio de Educacin de la
Nacin a travs del Programa de Voluntariado Universitario, edicin 2009, y por el Ministerio de Cultura de la Nacin a travs de la
Convocatoria de Becas Grupales del Fondo Nacional de las Artes. El mismo se desarrolla en colaboracin mutua entre Cayana: Colectivo de
Arqueologa, la Escuela de Arqueologa (UNCa) y la Unin Vecinal de Rodeo.
TOMO IV - 1459
CAPTULO 29 - MESA REDONDA 2
Sin embargo, no solamente es una tarea con dificultades al interior de las comunidades donde llevamos adelante
nuestros trabajos sino que esta lnea de investigacin recibe crticas dentro de la propia comunidad cientfica de
arquelogos; quienes en reiteradas presentaciones en congresos (Biasatti et. al. 2009; Jofr et.al. 2009; Jofr y
Biasatti 2010) acusan a este tipo de trabajos, por ejemplo, de no pertenecer al campo de la arqueologa por no
emplear determinadas metodologas (excavaciones, prospecciones), de ser un discurso utpico e imposible de
llevar a la prctica concreta, que la eleccin de incorporar relatos orales constituye una cuestin de moda.

Este conjunto de elementos (desconfianza, miedo al saqueo de piezas arqueolgicas, deslegitimacin de los
saberes locales a travs de voces autorizadas, embates dentro de la disciplina) nos impuls a preguntarnos
sobre la posibilidad de pensar este museo buscando trascender una situacin que se despliega a travs de tres
planos de crtica: desde las comunidades hacia los arquelogos, desde nuestras investigaciones hacia otros
trabajos tradicionales y desde ciertos sectores de la comunidad arqueolgica hacia este tipo de construccin
colectiva. Esto se constituye, entonces, como un desafo para llevar a la prctica nuestros saberes especficos
disciplinares y trascender la instancia de la mera crtica a nivel discursivo a travs de prcticas concretas que nos
siten en otros tipos de socializaciones.

De la propuesta terica a las actividades: el ciclo de cine-debate
La propuesta terico-epistemolgica adoptada nos conduce a un trabajo metodolgico junto con los vecinos de la
comunidad, lo cual conlleva una dinmica de constante reformulacin como parte del mismo trabajo de campo
de aquellas planificaciones o cronogramas que se pretenden preestablecer. Las reformulaciones son el modo de
llevarlo adelante - justamente - porque se hace con la comunidad y no sobre ella: pensar en y desde la
situacin; es decir, sin predeterminar prcticas, ni sujetos a priori (Situaciones 2004).

Pensar en la construccin colectiva de conocimiento con las comunidades puede traer algunas reminiscencias
romnticas/idealistas desde un punto de vista discursivo y/o retrico, sin embargo reconocemos que la
comunidad de Rodeo est conformada por sectores heterogneos, con distintos intereses y adems, no todos se
sienten habilitados al momento de participar en un proyecto de museo. Sin embargo, es nuestro objetivo poder
abrir el juego a otros sectores y no solamente a aquellos ocupados del turismo, la cultura, la educacin o el
patrimonio o que tengan una relacin ms directa con lo arqueolgico. A su vez, teniendo en cuenta la
dimensin poltica de nuestro trabajo consideramos que existen grupos con intereses incompatibles (por ejemplo,
determinados entes estatales y gubernamentales, empresas trasnacionales de alto impacto en la regin, etc.).
Partiendo de estos planteos, es que intentamos organizar el trabajo de campo y las actividades de manera de
encaminarnos hacia dicha construccin colectiva, en este caso, a partir de un proyecto de museo que permita
comenzar a revertir las relaciones asimtricas histricamente reafirmadas por la arqueologa local.

Una de las actividades realizadas durante el trabajo de campo de Enero del 2010
2
, consisti en el desarrollo de
un ciclo de cine-debate con sede en la Unin Vecinal de Rodeo. Si bien el ciclo cont con proyecciones
regulares durante todo el mes, aqu slo analizaremos la primera jornada del mismo, las tareas de difusin
previas, as como tambin las discusiones posteriores al interior del grupo, en tanto instancias donde el trabajo
se nos vuelve sobre nosotros
3
.

Nos dedicamos a convocar a los vecinos con un doble propsito: por un lado buscamos que la comunidad local
perciba que en este espacio pueden realizarse diferentes actividades culturales, que no solamente respondan a las
tradicionalmente desarrolladas en un museo, por ejemplo: la conservacin, resguardo, exhibicin y anlisis
formal de piezas arqueolgicas. Por el otro, la realizacin de un ciclo de cine-debate fue planificada como una
suerte de excusa para acercar a los vecinos al museo, con el objeto de contarles acerca del proyecto y con la
intensin explcita de que ellos que pudieran participar de la construccin colectiva que se propone. Atendiendo
a este propsito llevamos adelante una serie de actividades de difusin, particularmente a travs de las radios
locales (medio de comunicacin que llega a todas las localidades del Departamento de Iglesia), as como tambin
a travs del reparto de folletera en distintos negocios.

Durante la planificacin de la actividad de cine-debate, la discusin se encontr centrada en la eleccin de
pelculas que nos permitiesen acercar problemticas actuales que, entendemos, son pasibles de integrar el campo

2
Otras de las actividades realizadas fueron: conservacin y restauracin de piezas arqueolgicas de las colecciones de la Unin Vecinal de
Rodeo, reacondicionamiento de la sala de exhibicin, inventario de colecciones arqueolgicas, etc.
3
Citado de las grabaciones realizadas durante el trabajo de discusin al interior del grupo 11/01/2010
TOMO IV - 1460
Soledad Biasatti, Fausto Battaggia, Bruno Rosignoli y Alejandro Bruno
de competencia de la arqueologa, si bien desde el discurso tradicional de la disciplina se niegue u omita su
pertinencia. Cabe aclarar, que en la produccin acadmica de los arquelogos de la regin, y fundamentalmente
en el discurso de aquellos que son considerados como las voces autorizadas acerca del pasado prehispnico de
la provincia, predomina un posicionamiento terico de corte fuertemente histrico-cultural, en el que las
discontinuidades entre las distintas culturas, y por supuesto entre stas y la sociedad actual son sumamente
acusadas (por ejemplo Gambier 2000; Garca 2002, entre otros). Desde este discurso se inhabilita la posibilidad
de que los sujetos en este caso los pobladores de la comunidad de Rodeo- puedan entenderse as mismos como
parte de esa historia contada por otros, para apropiarse de ese pasado despojado por la retricas cientfico-
estatales, las cuales han cumplido la funcin principal de deslegitimar las reivindicaciones identitarias tnicas y
sociales en la provincia. Es por ello que uno de los objetivos que perseguimos con la proyeccin consista en
abrir el debate acerca de problemticas identitarias actuales que desde el rtulo de lo arqueolgico o lo
indgena son percibidas por los vecinos de la localidad como ajenas a su cotidianeidad. Atendiendo a estas
consideraciones, para la primera fecha del ciclo de cine decidimos proyectar un documental acerca del reclamo
de distintos grupos mapuches debido a la expropiacin de sus tierras, as como tambin elegimos otras pelculas
relacionadas con la problemtica del agua y la explotacin de recursos naturales en la zona por emprendimientos
de minera a cielo abierto, entre otras.

Durante las tareas de difusin, una buena parte de los vecinos con los que pudimos conversar haban manifestado
inters en las actividades propuestas, poniendo particular nfasis en que las colecciones arqueolgicas deban
permanecer en Rodeo y en la importancia que stas revisten con respecto a la identidad y el pasado local.
Asimismo, consideramos que la difusin tuvo buena llegada, dado que gran parte de los vecinos haban
escuchado la invitacin por la radio o ledo los afiches y muchos de ellos nos manifestaban su deseo de
participar. A partir de esta situacin consideramos que la actividad contara con una gran convocatoria. Pese a
ello, el da de la proyeccin, en contraposicin a nuestras expectativas, acudieron alrededor de diez personas, en
su mayora nios (entre 5 y 13 aos), quienes se acercaron a ver, precisamente, el documental que bamos a
proyectar, ya que ante nuestro ofrecimiento de cambiarlo por una animacin para que no se aburran, nos
replicaron que venan a ver pelculas de indios.

En la actividad de proyeccin, los nios se quedaron sentados frente a la pantalla durante unos 25 minutos (el
documental duraba 55 minutos) y luego se fueron levantando, pidiendo permiso para salir de la sala. En el
transcurso de la misma haba fragmentos en los que se subtitulaba y nosotros les leamos a los ms pequeos
para que pudieran entender el sentido de lo que se deca en el documental. A la salida nos reunimos para
preguntarles que les haba parecido y conversar sobre algunos de los ejes temticos que propona el film y que
nos interesaba remarcar (la posibilidad de pensar en identidades indgenas actualmente, sus luchas por las tierras,
el uso de la lengua). Por otro lado el debate con las personas que permanecieron hasta el final continu dentro de
la sala sobre estos mismos ejes, y se presentaron los objetivos del proyecto del museo y los trminos en los que
invitamos a sumarse: la construccin colectiva.

Posteriormente, realizamos el debate al interior del grupo, al cual llamamos bajada grupal. Este ejercicio, que
no es meramente intelectual, es un elemento central de nuestro trabajo donde cada uno de nosotros vuelca sus
inquietudes, sentires, dudas, miedos, reflexiones, apreciaciones en relacin a la experiencia de lo que sucedi en
cada actividad, entrevista o situacin en particular. Este se constituye como un espacio de construccin colectiva
donde se va entramando la subjetividad de cada integrante del grupo en una puesta en comn da a da.

Cmo formar parte del todo
Esta actividad nos lleva a hacernos algunas preguntas en tanto trabajo que pretende una construccin colectiva,
pero cmo se hace en la prctica diaria? Quizs una de las principales dificultades con las que nos encontramos,
y que la actividad del cine-debate puso en evidencia, es que tanto las problemticas que pretendemos atender
como el modo de hacerlo implican una proyeccin a largo plazo, requieren un trabajo sostenido y en nuestra
participacin en cada trabajo de campo o en cada una de las actividades slo vemos una pequea parte, lo cual
entra en conflicto con nuestras expectativas de ver resultados. Pero qu resultados queremos observar? Cual
es la tarea que pretendemos terminar? Qu parte nos falta? Qu sera el todo cuando hablamos de
construccin colectiva?

En una profundizacin llevada adelante en los debates pudimos explicitar posteriormente como parte de los
supuestos del grupo que entendamos por aquello que deberan ser los resultados en tanto mirada heredada
de arqueologas tradicionales con las que nos formamos, las cuales tienden a cerrar preguntas ms que a
plantearse nuevas dudas y/o a proponer cambios en situaciones que slo se diagnostican. Adems Cmo se
TOMO IV - 1461
CAPTULO 29 - MESA REDONDA 2
unen las partes? Cuales son las partes? Las partes son los grupos que forman el Colectivo, la comunidad,
nosotros como Cayana, otros arquelogos de la provincia, otros museos de la zona...? o las partes son
momentos dentro de un proceso, es decir, cada uno de los vnculos que se van estrechando en cada experiencia?
aunque no importa tanto el resultado, como el proceso que est en marcha: ...seis menos cuarto estaba que me
arrancaba los pelos(refiriendo a la actividad que iniciaba 17.30hs) pero despus entend lo que era la lgica, la
primera vez, lo que nos choca a nosotros es que nos estamos metiendo en 15 das en algo que empez hace
mucho y va a terminar dentro de mucho, de alguna forma uno quiere ver.
4
Poder pensar en acercarnos a la
comunidad para establecer espacios de socializacin en donde -en palabras de Kush- desaparecen las
demarcaciones entre observador y observado en tanto ambos asumen la plenitud de s mismos, o sea su mutua
alteridad (1978: 64).

La desconfianza como elemento de trabajo
Detrs de algunos elementos de ingenuidad, ansiedad, ganas y expectativas esperamos que la gente de la
localidad se abriera y participara desde el primer da de trabajo nuestro. El propsito de llegar a los vecinos de
Rodeo fue realizado y en su momento cremos que eso asegurara su participacin. Pensamos que, al escuchar lo
que nosotros tenamos para decir acerca del proyecto tenamos su consentimiento y aceptacin. Pero cuando no
tuvimos la concurrencia esperada el da de la proyeccin comenzamos a notar que habamos pasado por alto
algunas advertencias. Es decir que, cuando regresamos sobre nuestros cuadernos y grabaciones de los debates
posteriores a las tareas de difusin nos enfrentamos con el hecho de que no era tan claro que la gente iba a
participar.

Muchas de las personas con las que hablamos nos comentaron sobre las grandes dificultades que tuvieron con grupos
de arquelogos, de cmo saqueaban el lugar y se llevaban las piezas arqueolgicas, dejaban promesas y nunca ms
regresaban. Es por ello que cuando nos presentamos como grupo de arquelogos, muchos pobladores, directamente
asocian nuestro trabajo con este modo de entender la arqueologa a travs de este tipo de experiencias profundamente
sentidas en la zona, tal como nos lo dijo una vecina de manera clara y contundente: sigan y sigan ustedes excavando
y llevndose todo! Yo ya los conozco!
5
. De esta manera, ms all de que nosotros pretendamos hacer otro tipo de
arqueologa, debemos recorrer un largo camino para desandar aquellos deteriorados vnculos entre los pobladores
locales y arquelogos en el Departamento de Iglesia.

En este sentido, algunas cuestiones que no debemos perder de vista al momento de considerar los resultados
que arroj para el grupo la jornada del ciclo de cine, son los medios a travs de los cuales centramos nuestra
invitacin, as como los lugares por los cuales distribuimos los folletos. La fuerza masiva que tienen las radios en
la localidad se ve atravesada, en muchos casos, por la cercana de sus directivos con determinadas empresas
privadas transnacionales. De aqu que esta relacin haga que, si bien los vecinos se enteran e interesan de las
actividades, desconfan sobre que sectores (polticos y/o econmicos) estn detrs de ellas.

Reflexiones finales
Una de las dificultades surgidas durante la experiencia de trabajo en la localidad de Rodeo, es decir la
contradiccin entre nuestras expectativas y la falta de concurrencia a la actividad descripta en esta ponencia, nos
llev a reconocer que suponamos a priori que los vecinos se involucraran desde un principio con nuestra
propuesta, supuesto que se vio reforzado por las respuestas positivas que habamos venido recogiendo durante
las actividades de difusin. En este sentido, quizs olvidamos que los vecinos no necesariamente dejaran de
vernos como un arquelogo ms, por el solo hecho de presentar lo que nosotros consideramos como una
propuesta diferente. Entendemos que esto nos lleva a reconocer nuevamente la centralidad del trabajo sostenido
y a largo plazo, atendiendo a una historia conflictiva entre aquellos que vienen de afuera (arquelogos,
empresas privadas y transnacionales, universidad, turistas, etc.) y los vecinos, acostumbrados a que se lleven
todo o no escuchen (en tanto vienen a dictar cursos o talleres depositando informacin en sus oyentes).

Por otra parte, a la luz de otras actividades que se propusieron durante el mismo mes de trabajo de campo y que
se llevaron adelante con resultados alentadores para el grupo
6
,
2
consideramos que la participacin y el

4
Citado de las grabaciones realizadas durante el trabajo de discusin al interior del grupo 11/01/2010
5
Esto le expres una vecina de Rodeo a una integrante de nuestro grupo, en un local comercial durante las tareas de difusin. Tras eso, cerr
la puerta con un golpe y se retir enojada.
62
Vase, por ejemplo, otros trabajos presentados en esta Mesa Redonda: LO LDICO Y LO ARQUEOLGICO: UNA RELACIN
POSIBLE de Mara Cecilia Hope y Jaquelina Marcela Salinas y CONSTRUYENDO NUEVAS FORMAS DE DILOGO: UNA
TOMO IV - 1462
Soledad Biasatti, Fausto Battaggia, Bruno Rosignoli y Alejandro Bruno
intercambio resultan ms sencillos en espacios ya institucionalizados, como son las escuelas o la colonia de
verano, en tanto que la actividad del cine debate implic el desafo de crear un espacio nuevo. A su vez la tarea
de convocar al museo tiene la doble problemtica de tener que desandar no slo la experiencia previa de los
vecinos de la zona con los arquelogos y profesionales universitarios en general, sino tambin la mirada
existente sobre lo que es y lo que debera ser un museo.

Finalmente, ms all de las dificultades del trabajo colectivo y de la propuesta de una construccin colectiva y
dialgica del conocimiento estamos seguros que esta dinmica genera relaciones duraderas a largo plazo
basadas en vnculos de confianza.

Agradecimientos
La reflexin plasmada en este escrito forma parte de las actividades que realizamos grupalmente durante todo el
mes de enero de 2010 en la localidad de Rodeo, donde participamos junto con Selene Araya, Pablo Aroca, Ana
Bertazzo, Luciano Bonfatti, Rogelio Castillo, Amelia Dhabar, Victoria Duarte, Dbora Egea, Mara Soledad
Galimberti, Mara Paz Godoy, Mara Beln Guirado, Cecilia Hope, Carina Jofr, Fernando Lucero, Antonela
Marinelli, Valeria Martn, Mariela Morales, Cristian Naranjo, Alberto Ramrez, Jaquelina Salinas, Sabrina
Todaro, Oscar Varela. A cada uno de ellos, nuestro afectuoso reconocimiento.

Bibliografa
Biasatti, S.; Gonzalez, G.; Compay, G.; Jofr, I. C. 2006. Una Visin De Las Relaciones Entre Arqueologa Y
Educacin. Actas Del VIII Congreso Argentino De Antropologa Social. Salta.
Biasatti, S, Galimberti, M.S., Jofr, I.C., Aroca, P., Lucero, F. y Hope, C. 2009. Pensando y construyendo
colectivamente el presente-pasado- futuro en San Juan. Publicacin de Conferencias y Resmenes del 2do Seminario
Magistral Las sociedades de los paisajes semi-ridos y ridos del centro-oeste argentino y 8vas Jornadas de
Investigadores en Arqueologa y Etnohistoria del Centro-Oeste del pas. Pp. 102. Laboratorio de Arqueologa y
Etnohistoria. Departamento de Historia. Universidad Nacional de Ro Cuarto. Crdoba (Argentina).
Situaciones, Colectivo de Investigacin Militante. 2004. Algo ms sobre la Militancia de Investigacin. Notas al
pi sobre procedimientos e (in)decisiones. En: http://www.situaciones.org/ consultado 22 marzo 2010.
Gambier, M. 2000. Prehistoria de San Juan. 2 Edicin Ansilta Editora. San Juan.
Gambier, M. y C. T. Michieli. 1985. La investigacin arqueolgica y la difusin museogrfica de sus resultados para
la formacin de la conciencia histrica de la comunidad. En Vol. 14. Publicaciones. Universidad Nacional de San
Juan, Facultad de Filosofa, Humanidades y Artes, Instituto de Investigaciones Arqueolgicas y Museo. San Juan.
Garca, A. 2002. Una mirada a los reclamos modernos de identidad huarpe. Scripta Nova. Revista electrnica de
geografa y ciencias sociales, Universidad de Barcelona, Volumen VI. Nmero 109. En:
www.ub.es/geocrit/sn/sn-109.htm consultado 15 marzo 2010.
Grosso, J. L. 2007. El revs de la trama. Cuerpos, semiopraxis e interculturalidad en contextos poscoloniales.
Revista Arqueologa sudamericana. Volumen. 2. Nmero 3: 184-212, Departamento de Antropologa,
Universidad del Cauca Facultad de Humanidades, Universidad Nacional de Catamarca, Popayn y Catamarca.
Jofr, I.C. 2009. Arqueologa de las sociedades capayanas del norte de San Juan, Repblica Argentina. Crtica
a las narrativas discontinuistas de la arqueologa sanjuanina. Arqueologa Suramericana/Arqueologa Sul-
Americana. Volumen 4, Nmero 2: 146- 168. Gnecco, C. y Haber, A. (Editores). Departamento de Antropologa,
Universidad del Cauca Facultad de Humanidades, Universidad Nacional de Catamarca, Popayn y Catamarca.
Jofre, I.C., Biasatti, S., Galimberti, M.S., Aroca, P., Lucero, F. y Hope, C. 2009. El cuerpo indgena
patrimonializado. Anlisis y discusin de casos de pedidos de restitucin de cuerpos humanos a comunidades
originarias en la provincia de San Juan. Publicacin de Conferencias y Resmenes del 2do Seminario Magistral
Las sociedades de los paisajes semi-ridos y ridos del centro-oeste argentino y 8vas Jornadas de
Investigadores en Arqueologa y Etnohistoria del Centro-Oeste del pas. Pp. 103. Laboratorio de Arqueologa y
Etnohistoria. Departamento de Historia. Universidad Nacional de Ro Cuarto. Crdoba (Argentina).
Jofr, I.C. y S. Biasatti. 2010. QUEREMOS QUE LAS COSAS ARQUEOLGICAS SE QUEDEN AQU.
Representaciones sociales de la apropiacin simblica y material del pasado indgena en Rodeo. CD del IV
Congreso Interocenico de Estudios Latinoamericanos, X Seminario Argentino Chileno y IV Seminario Cono
Sur de Ciencias Sociales, Humanidades y Relaciones Internacionales. La travesa de la Libertad ante del
Bicentenario. Mendoza.
Kusch, R. 1978. Esbozo de una antropologa filosfica americana. Castaeda, Buenos Aires.

ARQUEOLGA INDISCIPLINADA TRANSDISCIPLINAR en el NORTE de SAN JUAN de Mara Soledad Galimberti; Fernando Lucero;
Ana Bertazzo y Cristian Naranjo.
TOMO IV - 1463
CAPTULO 29 - MESA REDONDA 2



ARQUEOLOGAS NATIVAS COMO UNA ELABORACIN COLECTIVA
Y LA MILITANCIA EN LA INVESTIGACIN
Ivana Carina Jofr
*
, Mara Beln Guirado Lpez
**
, Luciano Bonfatti
****
,
Selene Araya Lisette
***
y Pablo Daniel Aroca Negron
***


Resumen
Tras largo tiempo de desconocimiento de las identidades locales, la arqueologa en la provincia de San Juan
empieza a relacionarse con la produccin de historias locales buscando el surgimiento y revitalizacin de
memorias sociales hasta ahora postergadas, las cuales emergen en el marco de nuevos proyectos sociales. En este
breve ensayo buscamos plasmar algunos trasfondos tericos de una praxis social militante anclada en la apertura
de espacios de elaboracin colectiva. Pensamos que este es un camino posible -entre tantos- hacia la reflexin
crtica de nuestras realidades sociales, un camino que nos permite empezar a creer en la posibilidad de la
construccin colectiva de nuevas formas de sociabilidad en un contexto histrico poltico signado por la
disolucin de los lazos comunitarios.

Arqueologas nativas como elaboracin colectiva.
La experiencia colectiva encuentra lugar en las llamadas arqueologas nativas, lo que en Sudamrica, Gnecco
(2008) ha dado en llamar arqueologas del sentido local o prcticas polticas reaccionarias a la lgica
cultural dominante. Estas promueven y contribuyen a la construccin de espacios plurales y son tambin
movimientos de la arqueologa para insubordinarse en su relacin colonial con las comunidades locales (Haber
2008). Estas nuevas prcticas polticas en la actualidad de los proyectos arqueolgicos han tendido a
multiplicarse, aunque no siempre inscribindose en idnticos o similares caminos tericos y prcticas para
acometer cambios. La originalidad es una condicin para su existencia, porque ellas son elaboraciones prcticas,
no son modelos o recetas para hacer, dado que piensan y actan en y desde la situacin, sin concebir prcticas,
teoras ni sujetos a priori (Situaciones 2004).

Las arqueologas indgenas ocupan un lugar principal en este escenario de transformaciones en la poltica del
conocimiento del pasado de las comunidades (Gnecco 2008; Haber 2008; Jofr 2009; Mamani 1992; Smith y
Wobst 2005; Watkins 2001, 2004, entre otros). En San Juan, algunos de nuestros trabajos en curso (Jofr 2009)
plantean por primera vez en la provincia, y en la regin de Cuyo, la posibilidad de pensar arqueologas indgenas
como apropiaciones simblicas nativas de la cultura material indgena. Apoyadas estas en fuentes tericas
tradicionales (como son las fuentes histricas escritas y la cultura material arqueolgica), fuentes orales y
representaciones sociales actuales producidas por los sujetos en constante resignificacin simblica de su
presente, pasado y proyeccin de futuro. Esta arqueologa indgena introduce la responsabilidad autoral del
arquelogo/a, no slo desde la tica acadmico-profesional, si no desde su identidad como sujeto indgena en
tensin constante con los objetos de estudio de la arqueologa tradicional (Jofr 2009).

Otros autores como Funari (2001, 2004) tambin han denominado arqueologa pblica a estos nuevos
pluralismos, como expresiones horizontales y no jerrquicas de la diferencia, en trminos de economa poltica
como de interpretacin, lo cual implica arqueologas con pblicos, protagonistas y propsitos ms amplios
(Gnecco 2008). Esta arqueologa colectiva, pblica y plural puede concebirse como una cooproduccin en la
cual los sectores interesados colaboran, aprenden y producen historia de manera conjunta, aunque no sin
conflicto productivo (Gnecco 2008: 101).

Como sostiene Curtoni (2008), en Argentina los casos de participacin e involucramiento de actores locales
extra-acadmicos en proyectos arqueolgicos no han sido demasiados en la historia de la disciplina, aunque esto
pareciera estar revirtindose en los ltimos aos en algunas regiones del pas. Aqu en este texto quisiramos
hacer un breve ensayo de los fundamentos que atraviesan nuestra prctica social y poltica desde un Colectivo de

*
Cayana Colectivo de Arqueologa. Escuela de Arqueologa, Universidad Nacional de Catamarca, CONICET. E-mail:
ivcajofr@gmail.com/cayanacolectivodearqueologia@gmail.com
**
Cayana Colectivo de Arqueologa. Egresada de la carrera de Sociologia de la Universidad Nacional de San Juan. E-mail:
mabelenguirado@yahoo.com.ar
***
Cayana Colectivo de Arqueologa. Escuela de Arqueologa, Universidad Nacional de Catamarca. E-mail: gackt_ and_ hide@hotmail.com/
pablo_aroca@hotmail.com
****
Cayana Colectivo de Arqueologa. Facultad de Humanidades y Artes, Universidad Nacional de Rosario. E-mail: hausufel@hotmail.com
TOMO IV - 1465
CAPTULO 29 - MESA REDONDA 2
Investigacin-Accin-Militante vinculado a la arqueologa y a la co-produccin de saberes en la provincia de
San Juan.
Fundamentos tericos para introducirnos al sentido local y a la elaboracin colectiva de sentidos plurales.
Foucault (2002) sostena que la capacidad descriptiva de la arqueologa tiene lugar en cuatro frentes, a saber:
novedad, contradiccin, comparacin y transformacin. El primer frente se refiere a la originalidad, pero no en
trminos del origen, sino en trminos de la ruptura con lo ya-dicho y con lo regular (acumulacin de lo ya-dicho)
(Ricoeur 2004). Mientras que el segundo frente, la contradiccin, es aquel censurado por la investigacin
convencional, que se ha esforzado por "no multiplicar intilmente las contradicciones, no caer en la trampa de
las pequeas diferencias, no conceder demasiada importancia a los cambios, a los arrepentiemientos, a los
exmenes de conciencia, a las polmicas; no suponer que el discurso de los hombres se halla perpetuamente
minado en su interior por la contradiccin de sus deseos, de las influencias que han experimentado, o las
condiciones en que viven; sino admitir que si hablan, y si, entre ellos, dialogan, es mucho ms para superar esas
contradicciones y encontrar el punto a partir del cual puedan ser dominadas (Foucault 2002: 250). El autor
sentencia: "El discurso es el camino de una contradiccin a otra: si da lugar a las que se ven, es porque obedece
a las que se ocultan" (Foucault 2002: 254). Para Foucault las contradicciones son objetos que hay que describir
por s mismos, porque en ellos se encuentran la desviacin, la disensin, las asperezas del discurso (Ricoeur
2004).

El tercer frente de la arqueologa de Foucault, es el de la comparacin. Es aquel frente por el cual la arqueologa
se convierte en interdiscursiva (Ricoeur 2004). El estudio arqueolgico est siempre en plural: se ejerce en una
mutiplicidad de registros, recorre intersticios y desviaciones, y tiene su dominio all donde las unidades se
yuxtaponen, se separan, fijan sus aristas, se enfrentan, y dibujan entre ellas espacios en blanco (Foucault
2002: 263). Y en el ltimo frente, la arqueologa se juega su destino, en el cambio y las transformaciones. All la
arqueologa establece su conviccin de no multiplicar las diferencias, sino de negarse a reducirlas. La
arqueologa toma por objeto lo que habitualmente se toma como obstculo, pero no tiene la intencin de afirmar
las diferencias sino analizarlas, decir en que consisten y en diferenciarlas (Foucault op. cit.). Esas diferencias son
las discontinuidades, las cuales se convierten en foco de estudio. Pero no se confunda discontinuidad (ruptura)
con inactividad. En la historia de las ideas, las continuidades han sido empleadas como ley de referencia,
dndole estatuto para neutralizarlas, empujndolas hacia el lmite exterior del tiempo, a la pasividad original (op.
cit). La arqueologa se propone invertir esta disposicin, o ms bien, servirse uno de otro recprocamente:
mostrar como lo continuo est formado segn las mismas condiciones, y segn las mismas reglas que la
dispersin (op. cit).

En trminos fenomenolgicos, consideramos que nuestro texto arqueolgico es una representacin del pasado,
cuyos elementos se interpretan (Thomas 1996; Yates 1991). Asumimos que el movimiento de toda arqueologa
es cmplice de la reduccin de la estructuralidad de la estructura, e intenta siempre pensar esta ltima a partir de
una presencia plena y fuera de juego (Derrida 1989). De esta forma la tarea de la arqueologa sera la de reducir,
o someter a sospecha, el concepto de estructura centrada, que no es ms que el concepto de un juego fundado,
constituido a travs de una inmovilidad fundadora y de una certeza tranquilizadora que produce la posibilidad de
fijar sentido (Yates 1991). El centro adquiere muchos nombres, que aluden siempre a lo invariante de una
presencia: origen, fin, esencia, existencia, sustancia, sujeto, Dios, hombre, etc., y sus repeticiones, sustituciones,
transformaciones, permutaciones, quedan siempre fijadas en una historia de sentido, cuyo origen siempre puede
despertarse, o anticipar su fin, en la forma de la presencia (Derrida 1989).

Al fijar sentido, siempre se establece un centro, y por eso siempre hay una serie de sustituciones de centro a
centro, o lo que es lo mismo, un encadenamiento de determinaciones del centro. Por eso el acontecimiento de
ruptura es una repeticin, y todo lo que se diga de la estructuralidad de la estructura no pre-existe a la misma, no
est fuera de ella. El centro no tiene lugar fijo, no es un ente-presente, es solo una funcin, un no-lugar en el que
se representan sustituciones de signos hasta el infinito (op. cit.). Y este no-lugar esta inscripto en el campo del
lenguaje.
Por su parte, la elaboracin colectiva implica la crtica a la legitimidad del discurso cientfico y su rgimen de
produccin de verdades, su mtodo. Qu separa el conocimiento cientfico de lo que no lo es? Si la ciencia
busca la verdad, cuales son los fundamentos que dan rigor de verdad a los enunciados cientficos? Ya no hay
fuentes ltimas de verdad y la ciencia ha demostrado no ser una empresa acumulativa. La verdad puede tener
muchas fuentes y muchas interpretaciones que se hacen de esas fuentes, es tambin fruto de consensos y de
luchas, y es, finalmente, un producto histrico-social segn lo afirmaron Kuhn, Lkatos, y Feyerabend. Verdades
TOMO IV - 1466
Ivana Carina Jofr, Mara Beln Guirado Lpez, Luciano Bonfatti, Selene Araya Lisette y Pablo Daniel Aroca Negron
falibles, verdades provisorias, verdades consensuadas, en todos los casos el mtodo cientfico es un conjunto de
reglas cuya legitimidad no es un a priori.

Contra el mtodo, Feyerabend sostiene que si no se puede probar un mtodo a priori, entonces todo vale
(Feyerabend 1974). Su postura epistemolgica es parte de los fundamentos de la accin militante del colectivo,
la cual entendemos como una empresa de conocimiento contra-acadmica que intenta transformar realidades.
Prueba de esto ltimo son las crispaciones que genera nuestro proceder en los mbitos de la academia
tradicional, en donde no solo se confrontan posiciones terico-metodolgicas, si no que tambin se disputan y
dirimen intereses de orden poltico y social.

De la accin a la militancia en la investigacin.
Nuestro trabajo est orientado a un dilogo (Freire 2001). En tanto Colectivo de Investigacin-Accin-Militante
entendemos nuestra prctica arqueolgica como siendo parte de un pensar nuestra historia como enlazada a un
tiempo anterior que le da origen y la constituye inevitablemente, de esta forma dejamos de tratar con un pasado
de miles de aos para involucrarnos con un pasado que se haya inscripto en la memoria social de las prcticas y
saberes de los sujetos de las comunidades. Desde una postura dialgica, damos cuenta de una arqueologa que
parta de la articulacin de los distintos saberes en tensin, en un lugar donde las memorias del pasado se vuelven
una parte activa en el proceso de constitucin de sujetos histricos presentes, recobrando memorias de
dominacin y resistencias, de quiebres y continnums, de valores y sentidos, de dilogos y silencios (Jofr et al.
2008; Jofr y Gonzalez 2008).

Como sostiene Feyerabend, el mtodo rgido es poco til, la argumentacin es una nocin que se desarrolla en la
dialctica entre lo que es y lo que no es el objeto (Feyerabend 1974). La provocacin del autor tiene fundamento
en su preocupacin por la humanidad del acto cientfico. Feyerabend introduce la militancia en el corazn de
la epistemologa. Entre otras cosas, arremete contra la autonoma del campo cientfico, como una simplificacin
racionalista que pretende esterilizar la razn cientfica de cualquier otra razn humana que anida en el propio
cientfico. El mtodo, segn este autor, entra en conflicto tanto con el desarrollo de la individualidad del hombre
como con la misma historicidad de la produccin cientfica. Nuestro Colectivo de Investigacin-Accin-
Militante es ante todo un grupo humano movilizado por valores explcitos, dispuestos a irrumpir en el medio
para promover cambios, en una dinmica incesante de proyecciones, improvisaciones y cambios contingentes.
La dialctica puede que ria con una idea de la dinmica del acontecer, sin embargo, construir su objeto de
conocimientos en la interaccin y lejos de las certezas es, a nuestro entender, esa lucha abierta entre la verdad y
el error que construye el objeto. Lo cual hace de pretexto a fines mayores al conocimiento cientfico, pues busca
humanizar realidades sociales de expropiacin e injusticia; y como tal, se implica en el juego complejo de
relaciones de poder que definen el espacio social en que se desarrolla (Feyerabend 1974, 1989).

El colectivo echa mano de lo que surge, de la vorgine de ideas creativas y creadoras, dialoga tan pronto con el
arte como con los textos de la academia como con la expresin popular; y sus fundamentos se escapan de la
necesidad del rigor cientfico porque trasciende su objeto, es decir que no lo descarta sino que lo integra, lo
implica en un espectro mayor de militancia social y experiencia de creacin, valga decir, cientfica.

A diferencia de cualquier otro trabajo cientfico, el colectivo no tiene un objeto de estudio, pues creemos que
slo hay interaccin entre sujetos. Se trata de pensar ms all del Yo, lo cual supone romper las barreras del
emisor y el receptor, lograr desdibujar los lmites de ambos para la comunicacin. No obstante el nosotros
tampoco implica negar las individualidades, los sujetos particulares que hacen al colectivo (Cayana 2007).

Qu entendemos por militancia? En trminos prcticos es el abandono de la creencia del poder (como
dominacin) como nico vehculo de accin y transformacin social, la creencia en que nuestro pensamiento
puede agenciar sentidos tendientes a la creacin de otro orden de vida, ya no mediado por la dicotoma del poder
de unos sobre otros, o el empoderamiento de aquellos menos favorecidos en aquella relacin de opresin e
injusticia. Es decir, nuestro lugar como acadmicos puede ser otro, no aquel que alimente a estas relaciones de
dominacin, ya sea dominando o empoderando a otros. Por eso entendemos que nuestro pensamiento y la
poltica dependen de la capacidad de experiencia, de implicancia y de encuentro (Situaciones 2004). Esta
militancia se vincula a la creencia en un nuevo modo de sociabilidad que demanda una nueva disposicin del
sentir y del pensar. Pero es claro tambin que esta actitud que va ms all de la accin (la necesidad interna o
externa por la cual podemos sentirnos compelidos a actuar frente a una situacin que se nos presente ante
nuestros ojos como un acto de injusticia) tambin trae aparejados riesgos que hacen de la militancia la opcin
menos atractiva para muchos. Cmo vincularnos con la fragilidad de este surgimiento favoreciendo su
TOMO IV - 1467
CAPTULO 29 - MESA REDONDA 2
desarrollo y no contribuyendo a neutralizarlo an contra nuestras intenciones? De qu grado de ignorancia es
preciso armarse para hacer de la investigacin un autntico organizador de nuestras prcticas y no una mera
cobertura tctica? (Situaciones 2004). Estas son algunas de las tantas preguntas que ilustran los riesgos
implicados en la prdida de las seguridades que provee el mtodo, el camino acabado, el procedimiento del
manual, la prescripcin de las tradiciones cientficas frente a las inseguridades, a veces frustrantes, del ensayo de
otro tipo de realidad.

Conclusiones
Creemos que la arqueologa puede ayudar a pensar problemas sociales amplios, a destejer enmaraamientos de
sentidos ocultos en pretendidos juicios de verdad utilizados para justificar el destierro, la negacin de las
diferencias y los derechos histricos de los sujetos y comunidades avasallados en sus territorios, como as
tambin puede accionar para batallar contra la ignominia de los agentes funcionales al poder. Por eso pensamos
que la critica a los supuestos epistemolgicos y ontolgicos de la ciencia tambin debera hacernos tomar
conciencia de que la arqueologa implica una inadecuacin de los modos textuales en los cuales ella se
representa (Haber 2008). Es decir, slo la arqueologa vuelta sobre ella misma, vuelta objeto de su propio
conocimiento, puede encaminarse como prctica social honesta y comprometida. La elaboracin colectiva en el
campo de la arqueologa y ms all de ella puede ser, y de hecho lo es, una experimentacin a conciencia de un
deseo por encontrar en lo comn una conexin afectiva comunicativa que trascienda los lmites del
conocimiento.

Agradecimientos
Este trabajo fue realizado en el marco del proyecto Historias locales narradas a travs de los objetos: Muestra
arqueolgica en la Unin Vecinal de Rodeo (San Juan) financiado por el Ministerio de Educacin de la Nacin
a travs del Programa de Voluntariado Universitario, edicin 2009, y por el Ministerio de Cultura de la Nacin a
travs de la Convocatoria de Becas Grupales del Fondo Nacional de las Artes. Dicho proyecto se desarrolla en
colaboracin mutua entre el Colectivo de Arqueologa Cayana (con lugar de trabajo en la Escuela de
Arqueologa de la Universidad Nacional de Catamarca) y la Unin Vecinal de Rodeo.

Bibliografa
Cayana, Colectivo de Arqueologa. 2007. Declaracin de principios del Colectivo. Disponible online en:
www.cayanacolectivodearqueologia.wordpress.com, blog consultado por ltima vez el 1 de Mayo de 2010.
Curtoni, R. 2008. Acerca de las consecuencias sociales de la arqueologa. Epistemologa y poltica de la prctica.
Comechingonia 11: 29-45.
Derrida, J. 1989 La estructura, el signo y el juego en el discurso de las Ciencias Humanas. En: La escritura y la
diferencia. Anthropos. Barcelona.
Feyerabend, P. 1974. Contra el Mtodo. Editorial Ariel. Barcelona.
1989. Lmites de las Ciencias. Editorial Paids. Barcelona
Foucault, M. 2002. La arqueologa del saber. Siglo XXI editores. Buenos Aires.
Freire, P. 2001. Pedagoga del Oprimido. Siglo Veintiuno Editores, Buenos Aires.
Funari, P. 2001. Public Archaeology from a Latin America Perspective. Public Archaeology 1: 239-243.
2004. Public Archaeology in Brazil. En: Public Archaeology, editado por N. Merriman, pp. 202-210. Routledge,
Londres.
Gnecco, C. 2008. Manifiesto moralista por una arqueologa reaccionaria. En: Sed Non Satiata II. Acercamientos
Sociales en la Arqueologa Latinoamericana, compilado por Fliz Acuto y Andrs Zarankin, pp. 93-101.
Coleccin Contextos Humanos, Serie Intercultura-Memoria y Patrimonio. Encuentro Grupo Editor, Facultad de
Humanidades, Univeridad de los Andes. Crdoba.
Haber, A. F. 2008. A dnde estn los 99 tficos? Notas de campo de arqueologa subjuntiva. En: Sed Non
Satiata II. Acercamientos Sociales en la Arqueologa Latinoamericana, compilado por Fliz Acuto y Andrs
Zarankin, pp. 103-120. Coleccin Contextos Humanos, Serie Intercultura-Memoria y Patrimonio. Encuentro
Grupo Editor, Facultad de Humanidades, Univeridad de los Andes. Crdoba.
Jofr, I. C.; S. Biasatti, M. S. Galimberti, P. Aroca y G. Gonzlez. 2008. Doble aprendizaje en las escuelas
rurales del Norte de San Juan. Actas del Congreso Argentino de Antropologa Social, Mesa de Trabajo:
Arqueologas Educadas. Experiencias de trabajo y reflexin crtica de los modos de pensar el pasado y de
los modos hacer el presente a travs de la prctica arqueolgica. Posadas. Edicin digital online:
http://www.caas.org.ar/ Consultada por ltima vez el 10 de Abril de 2009.
Jofr, I. C. 2009 Arqueologa de las sociedades capayanas del norte de San Juan, Repblica Argentina. Crtica
a las narrativas discontinuistas de la arqueologa sanjuanina. Arqueologa Sudamericana. Volumen 4, Nmero 2:
146-168.
TOMO IV - 1468
Ivana Carina Jofr, Mara Beln Guirado Lpez, Luciano Bonfatti, Selene Araya Lisette y Pablo Daniel Aroca Negron
Jofr, I. C. y G. Gonzlez. 2008. En la radio han dicho que no se puede tocar nada... Reflexiones sobre el
patrimonio arqueolgico en la Provincia de San Juan (Repblica Argentina). Revista Chilena de Antropologa,
Nmero 19, tomo 2007-2008: 117-141.
Mamani Condori, C. 1992. Historia y prehistoria. Dnde nos encontramos los indios? En: Los aymaras frente a
la historia: Dos ensayos metodolgicos, pp. 1-16. Taller de Historia Oral Andina. Aruwiyiri, Chukiyawu.
Moore, H. 1991. Paul Ricoeur: Action, Meaning and Text. En: Reading Material Culture, pp. 85- 120, edited by
Christopher Tilley. Blackwell, Oxford and Cambridge.
Ricoeur, P. 2001. Del texto a la accin. Ensayos de Hermenutica II. Fondo de Cultura Econmica. Buenos
Aires.
2004. La memoria, la historia, el olvido. Fondo de Cultura Econmica, Buenos Aires.
Situaciones, Colectivo de Investigacin Militante. 2004. Algo ms sobre la Militancia de Investigacin.
En: Borradores de investigacin y otros textos, edicin digital
http://www.nodo50.org/colectivosituaciones/index.html, consultado por ltima vez el 01 de Mayo de 2010.
Smith C. y M. Wobst (Editores) 2005. Indigenous Archaeologies. Decolonizing Theory and Practice. Routledge,
Londres y New York.
Thomas, J. 1986. Time, Culture and Identity. An interpretive archaeology. Routledge, London.
Yates, T. 1991. Jacques Derrida: 'There is nothing outside of the text'. En: (1991) Reading Material Culture, pp.
206-280, edited by Christopher Tilley. Blackwell, Oxford and Cambridge.
Watkins, J. 2001. Indigenous Archaeology: American Indian Values and Scientific Practice. Worlds Of
Archaeology Series, Altamira Press.
2004. Becoming American or becoming Indian? NAGPRA, Kennewick and cultural afiliation. Journal of Social
Archaeology, vol 4: 60-80.

TOMO IV - 1469
CAPTULO 29 - MESA REDONDA 2










CAPTULO 30
MESA DE COMUNICACIONES 1

NORDESTE

Coordinadora
Flavia V. Ottalagano
CONICET-Facultad de Humanidades y Artes, UNR
Evaluadores
Laura Beovide
Departamento de Arqueologa
Museo Nacional de Antropologa, Uruguay
Carlos N. Ceruti
CONICET
Juan B. Leoni
CONICET-
Facultad de Humanidades y Artes (UNR)
Mariano Ramos
Director del PRORAHEP- DCS
Universidad Nacional de Lujan.
Mara Carolina Barboza
Centro de Estudios Interdisciplinarios en
Antropologa
Facultad de Humanidades y Artes, UNR, CONICET
Mara Ximena Senatore
Universidad de Buenos Aires
Universidad Nacional de la Patagonia Austral
Instituto Multidisciplinario de Historia y Ciencias
Humanas
IMHICIHU CONICET
Daniel Loponte
CONICET-INAPL
Flavia V. Ottalagano
CONICET-Facultad de Humanidades y Artes, UNR
Diana S. Tamburini
Facultad de Humanidades y Artes, UNR

NDICE

INVESTIGACIONES ARQUEOLGICAS EN EL DELTA SUPERIOR
ENTRERRIANO: SITIO CERRO PUESTO ACOSTA
(DEPARTAMENTO VICTORIA, PROVINCIA DE ENTRE ROS)
Flavia V. Ottalagano, Mariano H. Darigo, Keila Sulich y Lisandro Arelovich ....................................... 1475

INFORME PRELIMINAR SOBRE EL ANLISIS DE LOS MATERIALES
LITICOS DEL SITIO ARENAL CENTRAL EN LA ISLA MARTIN GARCIA
Mara Isabel Capparelli y Anala Dvila.................................................................................................. 1481

PRIMEROS RESULTADOS DEL ANLISIS DEL REGISTRO
ARQUEOLGICO DEL SITIO PAJAS BLANCAS
(CORONDA, PCIA. DE SANTA FE)
Julieta I. Sartori ......................................................................................................................................... 1487

ANLISIS DE CIDOS GRASOS EN ALFARERA ARQUEOLGICA
DEL HUMEDAL DEL PARAN INFERIOR.
AVANCES EN EL CONOCIMIENTO DE SU USO
Gabriela Naranjo, Laura Malec y Maricel Prez ....................................................................................... 1493

EVIDENCIAS DEL PRIMER ASENTAMIENTO ESPAOL
EN LA CUENCA DEL RIO DE LA PLATA
(SANCTI SPIRITUS 1527-1529), PROVINCIA DE SANTA FE
Guillermo Frittegotto, Fabian C. Letieri, Hctor Meletta,
Cecilia Arias y Mara E. Astiz ................................................................................................................... 1499

PRIMERAS APROXIMACIONES AL ESTUDIO DEL REGISTRO
ARQUEOLGICO DE LA PRIMERA OCUPACIN ESPAOLA
EN LA DESEMBOCADURA DEL RO CARCARA
(FUERTE SANCTI SPRITUS 1527-1529)
Gabriel Cocco, Cecilia Arias, Emmanuel Vargas y Cecilia Rey ............................................................... 1505

LAS GUARANES, LOS JESUITAS Y EL COTI GUAZ DE LA REDUCCIN
DE SANTA ANA: NUEVOS ABORDAJES SOBRE LA CONQUISTA
EN EL NORESTE ARGENTINO
Mara Victoria Roca ................................................................................................................................... 1511

PRIMERAS INTERVENCIONES EN EL PREDIO DE LA CASA
DE LA ADMINISTRACIN, SEDE DE LA COLONIZACIN
DEL NORTE SANTAFESINO, 1870, ALEJANDRA, SANTA FE
Irene Dosztal ............................................................................................................................................... 1517

ANLISIS DE MATERIALES ARQUEOLOGCOS CORRESPONDIENTES
AL PREDIO DE LA EX ESCUELA NORMAL DE SAN JUSTO:
PRIMEROS RESULTADOS.
Mara Beln Colasurdo y Federico Katalinich ............................................................................................ 1523
INVESTIGACIONES ARQUEOLGICAS EN EL DELTA SUPERIOR
ENTRERRIANO: SITIO CERRO PUESTO ACOSTA (DEPARTAMENTO
VICTORIA, PROVINCIA DE ENTRE ROS)
Flavia V. Ottalagano
*
, Mariano H. Darigo
**
, Keila Sulich
**
y Lisandro Arelovich
**


Introduccin
En este trabajo se presentan los primeros informes en relacin a las investigaciones arqueolgicas que se estn
llevando adelante en el Delta superior del ro Paran desde el ao 2009, concretamente en el sitio Cerro Puesto
Acosta (Departamento de Victoria, Provincia de Entre Ros). Los trabajos de campo realizados en este sitio se
enmarcan en un proyecto tendiente a incrementar la informacin emprica existente, como base para la
formulacin de consideraciones relacionadas con los comportamientos sociales y simblicos de las poblaciones
prehispnicas del rea.

Las investigaciones arqueolgicas en este mbito geogrfico se vieron por largo tiempo postergadas;
desarrollndose la mayora de ellas de acuerdo a una metodologa de campo no rigurosa, la cual imposibilitaba
dar cuenta del contexto de los materiales recuperados (Ottalagano 2007, 2009). Consecuentemente con esto, los
contenidos simblicos y sociales del los artefactos arqueolgicos fueron abordados desde los aspectos formales
de estos materiales, sin tener en cuenta las condiciones contextuales de los hallazgos (ej. ver Gonzlez 1977;
Serrano 1972). El presente trabajo, particularmente, intenta constituirse entonces como un avance hacia la
generacin de datos de campo, contribuyendo a acrecentar el cuerpo de informacin arqueolgica contextual
para el rea de influencia del Paran.

El sitio arqueolgico
Cerro Puesto Acosta (CPA) se ubica especficamente sobre la margen derecha del arroyo Salto (324719,9S y
60 319,9O), a metros de su interseccin con el arroyo San Lorenzo, en el Delta superior del ro Paran
(Figura 1). Se localiza a unos 40km al oeste de la ciudad de Victoria (Provincia de Entre Ros) y a 2km al norte
de la Ruta Nacional 174, que une esta ciudad con la de Rosario (Provincia de Santa Fe). Fue relevado en el curso
de investigaciones previas, que se vienen realizando desde el ao 2007 y que tienen como propsito abordar el
estudio general de las poblaciones asentadas especficamente en rea del Delta Superior del Paran. Como parte
de las mismas, se efectuaron relevamientos planimtricos con estacin total y recolecciones superficiales (ver
Bonomo et al. 2007; Bonomo et al. 2008).

El sitio se encuentra situado en un ambiente ligado a los regmenes de inundacin del ro Paran y sus afluentes
(Lewis 1981). La vegetacin del rea se relaciona generalmente con la altura del terreno; encontrndose, por
ejemplo: camalotales (Eichhornia sp.) sobre los cursos de agua, pajonales en las alturas medias (ej. Panicum
prionitis) y vegetacin arbrea en la parte alta de los albardones (ej. sauce: Salix humboldtian; aliso: Tessaria
integrifolia: espinillo del baado: Acacia caven; timb: Enterolobius contorstisiliquum; ceibo: Erythrina crita-
galli) (Gobierno de la Provincia de Santa Fe 1997; Rabin 2006). CPA se emplaza sobre un montculo de un
metro de altura en su parte ms elevada, y es posible registrar material cermico sobre su superficie, as como en
una amplia extensin de su barranca, esto es, en unos 280 m de costa del arroyo Salto. Prximo al mismo, se
encuentran dos elevaciones, separadas del cerro principal por unos 100m de distancia, en donde se detect
igualmente material arqueolgico a nivel superficial. Segn los comentarios del Sr. Acosta, y actual arrendatario
del campo donde se halla el sitio, estas elevaciones habran sido mayores unas dcadas atrs; con anterioridad a
las excepcionales inundaciones que las habran cubierto totalmente entre 1982-1983 (ver Boivin et al. 1997).
Una de estas elevaciones se presenta cubierta por vegetacin arbrea (ej. Acacia caven), en tanto que la otra, se
visualiza ms bien como un claro de forma circular.

El sitio se localiza en propiedad privada, en terrenos arrendados para actividades ganaderas. Esto hace que parte
del cerro se encuentre ocupado por las estructuras asociadas al puesto respectivo (ej. ranchadas, corrales,
alambrados, escalonados artificiales en la barranca), que se ven favorecidas por la elevacion del montculo. La
vivienda que forma parte del puesto, hoy ocupada solamente en forma temporaria, fue levantada 30 aos atrs,

*
CONICET-Facultad de Humanidades y Artes (UNR); flaviaott7@gmail.com
**
Facultad de Humanidades y Artes (UNR); ventolita@hotmail.com; kueilich@hotmail.com; li_are@yahoo.com
TOMO IV - 1475
CAPTULO 30 - MESA DE COMUNICACIONES 1
construyndose posteriormente el corral mayor. Por consiguiente, Cerro Puesto Acosta viene siendo
progresivamente afectado desde la dcada de 1980 por la accin antrpica, responsable de generar: remosin de
sedimentos y consiguiente modificacin de la estratigrafa arquelgica, fractura de materiales y, especialmente,
el desecho en el rea del sitio de tems modernos (ej. elementos de plstico, metal y vidrio) los cuales tienden a
mezclarse con aquellos arqueolgicos.

Por otra parte, CPA se halla alterado de manera importante por la accin hdrica, ya que su sector norte est
siendo destruido por el curso del arroyo Salto. Los procesos erosivos de este agente natural se potencializan
notablemente por el paso continuo de lanchas a motor, las cuales producen un oleaje considerable. Estos factores
conducen hacia la paulatina formacin barrancas, as como contribuyen al desmoronamiento de las mismas. De
esta manera, se ocaciona la destruccin de la matriz sedimentaria del sitio; situacin que deriva principalmente
en el transporte y redepsito de los materiales arqueolgicos. Por otro lado, a los procesos post-depositacionales
ya mencionados, se suma el pisoteo del ganado vacuno, el cual se constituye como otro de los agentes de
considerable perturbacin en el sitio. El ganado vacuno, si bien se desplaza libremente por todas las reas del
sitio, tiende a concentrarse mayormente en sus zonas ms elevadas, a la vez cubiertas de vegetacin arbrea, que
constituyen reparos de sombra y de refugio cuando el arroyo crece. El pisoteo, producto de la faunaturbacin,
estara incidiendo en la compactacin de los sedimentos, especialmente en lo que respecta a los primeros niveles,
esto es, en aproximadamente los 0,30m de profundidad; ocasionando la disminucin progresiva de la altura de
los montculos (ver tambin Bonomo et al. 2008).

Victoria
Rosario
Entre Ros
Argentina
Arroyo Salto
Cerro Puesto
Acosta
500m

Figura 1: Localizacin geogrfica del sitio Cerro Puesto Acosta.

Los primeros trabajos en el sitio
Los trabajos de prospeccin en el sitio incluyeron como primera medida el mapeo de las concentraciones de
materiales en la barranca, a fin de contar con una informacin de base para la posterior realizacin de los
sondeos. De esta manera se logr detectar 8 lugares donde los tems arqueolgicos, especialmente de alfarera,
tendan a aglutinarse en la superficie de la lnea de la costa. Las localizaciones que se ubicaron contiguas a la
vivienda del puesto, fueron las que presentaron mayor concentracin de materiales.

Para la excavacin de los sondeos se prefiri entonces los sectores de mayor altitud, que a su vez se
correlacionaban con las reas de mayor visibilidad de materiales en la barranca; intentando, por otro lado,
seleccionar aquellas zonas donde las alteraciones antrpicas fuesen menores. Por otro lado, y dado que uno de
los objetivos de los trabajos fue especificar las reas donde aparecan materiales en estratigrafa, se llevaron a
cabo una serie de sondeos en los montculos asociados al cerro principal, y prximos a un curso de agua
actualmente inactivo (Figura 2). Por consiguiente, se determinaron tres localizaciones diferentes para los
sondeos, seleccionadas en funcin de la elevacin del terreno, y su proximidad o bien su distancia con el arroyo
Salto: sector A (lnea de la costa: sondeos 2 a 6), sector B (montculos apartados de la costa y prximos al cauce
inactivo: sondeos 7 a 12), y sector C (rea intermedia entre ambos sectores: sondeo 1). Se excavaron en total 12
sondeos estratigrficos de 0,50m de lado, amplindose uno de ellos el de mayor material recuperado- a un
TOMO IV - 1476
Flavia V. Ottalagano, Mariano H. Darigo, Keila Sulich y Lisandro Arelovich
sondeo de 1m x 1m (sondeo 1). Se trabaj en capas artificiales de 5 cm, posicionndose tridimensionalmente los
hallazgos ms diagnsticos, especialmente en el caso del sondeo de mayores dimensiones.

El resultado de las prospecciones indic la presencia de sectores con diferentes densidades de materiales en
estratigrafa, as como cierta variabilidad en el material recuperado en cada uno. De esta manera, los sondeos
situados en la curva del arroyo (sondeos 2, 3, 4, 5) evidenciaron escasa densidad de materiales, los cuales se
encontraron altamente fragmentados. En ellos se registr exclusivamente tiestos pertenecientes a recipientes lisos
y muy escaso material faunstico; desde superficie y/o a partir de los 0,10m hasta los 0,40-0,55m de profundidad.
Los mismos se vincularon a una matriz sedimentaria marrn clara con contenido areno-arcilloso.

En contraste con estos casos, el sondeo 1 -situado algo ms alejado del curso del arroyo Salto- junto con el
sondeo 6ubicado a 2m de la barranca e inmediato a la vivienda- , registraron una alta densidad de alfarera en
estratigrafa (Figura 2). Los materiales se asociaron a un sedimento limoso marrn oscuro, sin cambios
apreciables a lo largo de la excavacin de los mismos. Ambos presentaron una importante potencia arqueolgica,
ya que la profundidad de aparicin de los hallazgos fue de hasta 0,95m, en el caso del sondeo 1, logrando superar
el 1,20m en el caso del sondeo 6. Si bien el material cermico registr un grado de fragmentacin menor en
ambos sondeos, la presencia sin embargo de elementos intrusivos modernos en los primeros 0,50m del sondeo 6,
revel las alteraciones antrpicas que afectan especialmente las reas prximas a la vivienda del puesto. En el
sondeo 1, por otra parte, se recuperaron los primeros restos de recipientes decorados con motivos representativos
zoomorfos en la estratigrafa del sitio, los cuales se situaron entre los 0,25m y 0,50cm de profundidad.

Los sondeos realizados en los montculos adyacentes al cauce inactivo, en tanto, advirtieron un sedimento
marrn claro areno-arcilloso muy compacto, causado posiblemente por el pisoteo del ganado que utiliza la
vegetacin del montculo como reparo de sombra. Estos sondeos demostraron una potencia menor a los dos
anteriores, ya que los materiales se localizaron desde superficie o desde los 0,10m hasta los 0,30m-0,55m. Sin
embargo, en contraste, exhibieron la particularidad de presentar una relativa abundancia de restos faunsticos;
recuperndose en los mismos el 75% (N=77) del total de los especmenes de la fauna recuperada en la totalidad
de los sondeos realizados durante el transcurso de la prospeccin. Tambin en este sector, y como se desarrollar
en mayor detalle en el apartado siguiente, se localizaron instrumentos seos y material faunstico modificado
antrpicamente.


100m
1
3
11
12
9
8
7
10
2
6
5
4

Figura 2: Ubicacin de los sondeos realizados.

Anlisis preliminar de los materiales arqueolgicos
La muestra total de la cermica analizada en esta oportunidad se agrup segn categoras de recipientes, es decir,
de acuerdo a si presentaban o no atributos decorativos. De esta manera, se computaron 48 fragmentos/bordes
pertenecientes a contenedores con algn tipo de decoracin (N=40 mediante tcnicas de pintura, N=5
mediamente tcnicas incisas, N=3 mediante modelado). En el caso de los fragmentos lisos, se prioriz
fundamentalmente el estudio de los bordes, dadas sus caractersticas diagnsticas (N=317). Para evitar
sobredimensionar la cuantificacin de los atributos analizados, en todos los casos en que fue posible se consider
como un nico tiesto a aquellos fragmentos que remontaban o que podan ser potencialmente asignables a una
misma vasija de acuerdo a sus caractersticas artefactuales. De esta muestra, el 87% se correspondi con
recipientes lisos, en tanto que en el 13% restante se relacion con contenedores cermicos decorados: con pintura
roja (y en algunos casos blanca) y por medio de tcnicas de modelado o incisin. En este ltimo grupo se incluy
TOMO IV - 1477
CAPTULO 30 - MESA DE COMUNICACIONES 1
un asa zoomorfa representativa de un ave con caractersticas falconiformes, la cual advierte un orificio de
suspensin a la altura de su cuello (Figura 3).





Figura 3: Asas zoomorfas de cermica: a) ave falconiforme con orificio de suspensin, b) asa indeterminada asociada a un
recipiente abierto con paredes ampliamente divergentes.

Para el anlisis de los atributos de forma y dimensin de los recipientes de cermica, se emplearon
categorizaciones implementadas en trabajos previos para el abordaje de la alfarera del rea del Paran (ver
Ottalagano 2009); as como tambin, fueron utilizados conceptos formulados por autores como Shepard (1963) y
Orton et al. (1997), entre otros. Los resultaron concernientes a los aspectos formales de la cermica indican un
predominio de las formas no restringidas por sobre las restringidas, tanto en el caso de los recipientes lisos como
en los decorados (Figura 4). Se registra particularmente una alta frecuencia de vasijas abiertas con paredes
medianamente divergentes y con contornos simples, en algunos casos provistas de asas en forma de arco y
orificios de suspensin. Si bien no se detectaron hasta el momento superficies pulidas en los artefactos
recuperados, un buen porcentaje present engobe como tratamiento superficial, tanto en sus caras internas como
externas (60% en recipientes decorados, 39% en recipientes lisos).

Formas abiertas (90%)
Formas cerradas (10%)
Recipientes lisos

Recipientes decorados
Formas abiertas (82%) Formas cerradas (18%)

Figura 4: Principales formas registradas en recipientes lisos y decorados.


Los ncleos de las alfareras se presentan usualmente con coloracin gris claro y oscuro, probablemente como
resultado del entorno reductor en que se produjo la cochura de las piezas, y del empleo de arcillas con
inclusiones orgnicas. El aspecto de las pasta suele ser compacto. Se distingue la presencia de tiestos molidos de
tamao generalmente fino (0,1-0,25mm) y medio (0,25-0,5mm), indicadores de antiplsticos intencionalmente
adicionados (Convencin Nacional de Antropologa 1966; Orton et al. 1997). Con respecto a los atributos
relacionados con la utilizacin de las alfareras, se registra una proporcin considerable de bordes y fragmentos
correspondientes a recipientes lisos con rastros de holln (N=19). En algunos casos, las adherencias de holln se
exhiben en la superficie interna de los artefactos (N=9), pudiendo ser indicativas de los restos de alimentos
cocinados dentro de los recipientes (Rye 1981). Los fragmentos con restos de holln resultan abundantes en los
sondeos efectuados en los sectores A y C, especialmente en lo que respecta al sondeo 6 (prximo a la vivienda
del puesto) y al sondeo 1 (contiguo al corral) (Figura 2).

Para el estudio preliminar de los materiales faunsticos se utiliz la terminologa presentada, entre otros autores,
por Mengoni Goalons (1988) y Salemme et al. (1991). La muestra de fauna, conformada por 102 especmenes
seos, se encontr con un grado de fragmentacin importante; hecho que dificult en gran medida la
disponibilidad de unidades anatmicas completas y la determinacin taxonmica. Se logr identificar
fundamentalmente la presencia de ejemplares de mamferos adaptados al ambiente acutico como el caso del
TOMO IV - 1478
Flavia V. Ottalagano, Mariano H. Darigo, Keila Sulich y Lisandro Arelovich
Myocastor coypus y posibles ejemplares de crvidos como por ejemplo Blastocerus dichotomus; de los cuales se
estara registrando una relativa mayor cantidad de elementos pertenecientes a la zona del esqueleto relacionada
con la cabeza, el segmento axial y los miembros posteriores. Tambin se registraron restos de peces,
especficamente de la Fam. Dorididae; as como, por otro lado, material malacolgico, especficamente de
Diplodon. Se detectaron en estos materiales huellas antrpicas, especialmente marcas de corte, as como
tambin, fracturas intencionales coincidentes con la presencia de alteraciones trmicas. La presencia
relativamente mayor de las marcas antrpicas en las difisis de los huesos largos podra ser indicativa de las
huellas de descarne de las presas (Mengoni Goalons 1988).

Consideraciones finales
Los sondeos realizados permitiran localizar distintos sectores en CPA con diferentes densidades de materiales
en estratigrafa y potencia arqueolgica; registrndose, por otro lado, cierta variabilidad en cuanto al material
recuperado en cada uno de los mismos. De esta manera se advierte, por ejemplo, concentraciones diferenciales
de materiales arqueofaunsticos; los cuales tienden a predominar, tanto cualitativa como cuantitativamente,
especialmente en el sector B. Asimismo, las actividades de prospeccin estaran evidenciando divergencias en
cuanto al registro de recipientes cermicos decorados en las diferentes reas consideradas, y tambin, con
respecto a los contenedores con rastros de utilizacin. De esta manera, la presencia de restos de vasijas con
decoracin incisa, modelada y pintada tiende a ser mayor particularmente en el sector C, al igual que la presencia
de artefactos cermicos con rastros de holln externo y adherencias internas. Por el contrario, el sector A denota
particularmente muy baja densidad de materiales, a escasa profundidad: particularmente fragmentos de pequeo
tamao pertenecientes a vasijas lisas y sin huellas de uso.

Estas cuestiones podran estar indicando, en primer lugar, la posibilidad que buena parte de CPA haya sido
erosionada por la accin hdrica del Salto; de modo tal que los sondeos que se ubican preferentemente en la
curva del arroyo estaran manifestando el remanente de un sitio de mayores dimensiones, actualmente destruido
por los procesos erosivos fluviales. Debe tenerse en cuenta, adems, que el rea principal del sitio -debido a que
constituye un sector de altitud en relacin al territorio circundante- coincide en parte con las construcciones
modernas; pudiendo verse sujeta a movimientos de sedimentos, y en consecuencia, a la posible modificacin de
la estratigrafa arqueolgica.

Por otra parte, y si se tiene especialmente en consideracin las elevaciones vinculadas al cerro principal (sector
B), estas divergencias encontradas podran estar indicando, asimismo, distintas ocupaciones para Cerro Puesto
Acosta, o bien la presencia de reas o sitios donde se habran podido desarrollar actividades especificas. La
probable presencia de sectores o de sitios con ocupaciones, por un lado, ms efmeras y/o ligadas a actividades
especficas (ej. en relacin a tareas de obtencin y procesamiento de recursos faunsticos) y, por el otro, sectores
con mayor intensidad de ocupacin y/o posiblemente vinculados al desarrollo de actividades de carcter
mltiple, constituye una de las cuestiones a evaluar en los futuros trabajos de campo.

Actualmente, la investigacion en el sitio se est desarrollando en funcin de incrementar la informacin para
cada uno de los sectores, mediante su excavacin sistemtica. Su progresivo deterioro, en especial la paulatina
destruccin de su barranca por la accin erosiva de las aguas del arroyo Salto, plantean la urgencia de las
investigaciones a realizar, a fin de evitar que estos agentes de alteracin sigan afectando la integridad de la
informacin arqueolgica que este sitio puede aportar.

Agradecimientos
Queremos agradecer especialmente a la familia Acosta por la amabilidad brindada. Tambin, a M. Bonomo y G.
Politis por darnos la posibilidad de incluir a Cerro Puesto Acosta en el desarrollo nuestras investigaciones.

Bibliografa
Boivin, M., A. Rosato y F. Balbi. 1997. Incidencia del evento de inundacin de 1982-83 sobre el asentamiento
humano en el rea de islas del Departamento Victoria (Entre Ros). Actas del V Congreso de Antropologa
social. http://www.naya.org.ar/congresos/contenido/laplata/LP3/26.htm (05 mayo 2009).
Bonomo, M., G. Politis y J. Castro. 2008. Primeros resultados de las investigaciones en el Delta superior del
Paran y su contribucin al atlas arqueolgico de la provincia de Entre Ros.
http://www.munivictoria.gov.ar/TrabajoFolia Histrica.pdf (07 agosto 2008).
Bonomo, M., G. Politis, C. Gianotti. 2007. Patrones de distribucin espacial de sitios arqueolgicos en el Delta
del Paran de la Provincia de Entre Ros. Trabajo presentado al XVI Congreso Nacional de Arqueologa
Argentina, Tomo I: 13. Jujuy.
TOMO IV - 1479
CAPTULO 30 - MESA DE COMUNICACIONES 1
Convencin Nacional de Antropologa. 1966. Primera Convencin Nacional de Antropologa. Universidad
Nacional de Crdoba, Crdoba.
Gobierno de la Provincia de Santa Fe. 1997. Sistema provincial de reas naturales protegidas. Publicacin de la
Asociacin Cooperadora de la E. Z. E., Santa Fe.
Gonzlez, A. R. 1977. Arte precolombino de la Argentina. Introduccin a su historia cultural. Imprenta Coni,
Buenos Aires.
Lewis, J.P. 1981. La vegetacin de la provincia de Santa Fe. GAEA 9: 121-148.
Mengoni Goalons, G. 1988. Anlisis de materiales seos faunsticos de sitios arqueolgicos. Xama 1: 71-120.
Orton, C., P. Tyers y A. Vince. 1997. La cermica en Arqueologa. Crtica, Barcelona.
Ottalagano, F. 2007. Algunos datos sobre las manifestaciones simblico-iconogrficas de las costas del Paran:
estudios cermicos en Las Mulas 1 (Provincia de Entre Ros). Arqueologa en las Pampas. Editado por C.
Bayn, A. Pupio, M.I Gonzlez, N. Flegenheimer y M, Frre, pp. 679-696. Sociedad Argentina de antropologa,
Buenos Aires.
Ottalagano, F. 2009. Aproximaciones al simbolismo de los grupos cazadores-recolectores de las Tierras Bajas
del Paran medio: un abordaje contextual del arte mobiliar cermico. Tesis para optar al grado de Doctor en
Humanidades y Artes con mencin en Antropologa (indita), Escuela de post-grado, Facultad de Humanidades
y Artes, Universidad Nacional de Rosario.
Rabin, A. 2006. Enciclopedia Geogrfica de la Provincia de Santa Fe. Fundacin UNR-La Capital, Rosario.
Rye, O. 1981. Pottery technology. Taraxacum, Washington.
Salemme, M., E. Tonni y L. Miotti. 1991. La determinacin sistemtica de mamferos en contextos
arqueofaunsticos. IInd Deya International Conference of Prehistory. Editado por W. H Waldren, J. A.
Ensenyant y R. C. Kennard, pp. 209-222. Bar International Series, Oxford.
Serrano, A. 1972. Lneas fundamentales de la arqueologa del Litoral (una tentativa de periodizacin). Instituto
de Antropologa de la Universidad de Crdoba, Crdoba.
Shepard, A. 1963. Ceramics for the archaeologist. Carnegie Institution of Washington, Washington.
TOMO IV - 1480
Flavia V. Ottalagano, Mariano H. Darigo, Keila Sulich y Lisandro Arelovich
INFORME PRELIMINAR SOBRE EL ANLISIS DE LOS MATERIALES
LTICOS DEL SITIO ARENAL CENTRAL EN LA ISLA MARTN GARCA
Mara Isabel Capparelli

y Anala Dvila



En este trabajo resumimos los principales aspectos tecnolgicos y morfolgicos de los materiales lticos
encontrados en el sitio Arenal Central de la isla Martn Garca en la provincia de Buenos Aires. Desde el ao
2003 se realizaron excavaciones arqueolgicas arrojando resultados novedosos en cuanto a las comunidades
guaranes a nivel regional (Bogan 2005, Capparelli 2005, 2007, Capparelli y Vzquez 2009 e. p.).

Martn Garca es una isla del delta de la provincia de Buenos Aires localizada al sur de la desembocadura del ro
Uruguay, dentro del ambiente del Ro de la Plata Superior y cercana al lmite sur del delta inferior de los ros Paran
y Uruguay. Est distante de la costa uruguaya a 3,5 Km. y a 46 Km. en lnea recta de la Ciudad de Buenos Aires.
Posee una superficie de 168 hectreas y una elevacin mxima sobre el nivel del mar de 28 m.

El origen geolgico de la isla Martn Garca corresponde al Cratn del Ro de la Plata siendo parte del Escudo de
Brasilia de ms de 1.8 millones de aos y caracterizada como Complejo gneo-metamrfico Isla Martn
Garca (Dalla Salda 1981). Los remanentes del Complejo se encuentran formando sierras bajas en el sur de
Brasil, en algunos sectores de Uruguay y en la provincia de Buenos Aires. Este origen marca la diferencia con el
resto de las islas del delta, formadas por acumulacin sedimentaria de los ros Paran y Uruguay (Codignotto
1996).

El material ltico correspondiente a este trabajo se colect del sitio Arenal Central, localizado a 34 10 50.2
de latitud Sur y 58 15 01,7 de longitud Oeste, en uno de los tres sectores de mdanos que han sobrevivido a la
explotacin humana, siendo el ms representativo en cuanto a magnitud y cantidad de material obtenido. El sitio
abarca una zona de dunas mviles rodeada de vegetacin xerfita que crece da a da y reduce su visibilidad.
Estas dunas tienen cierto grado de movilidad y en su mayora estn fijas al suelo a travs de la vegetacin y han
formado un suelo juvenil con horizonte A (ver Figura 1).















Figura 1: Arenal Central

Una de las principales caractersticas de la isla es que pueden encontrarse en su interior no slo diferentes
hbitats ecolgicos sino tambin una amplia variedad de materias primas lticas (Ver Figura 2).





*Universidad Nacional de La Plata, icapparelli@yahoo.com
** Universidad Nacional de La Plata, davilanalia@yahoo.com.ar

TOMO IV - 1481
CAPTULO 30 - MESA DE COMUNICACIONES 1













Figura 2: a) afloramiento gneo metamrfico en la zona de canteras al sur de la isla.
b) afloramiento metamrfico en la costa sur.


El resto de los lticos analizados que corresponden a ncleos, ncleos
testeados, y desechos de talla provienen de las areniscas conglomeradas del
ro Uruguay, cuando la erosin del ro las desintegra quedan en suspensin
rodados de cuarzo, gata, calcedonia, y micacitas, entre otros (Ver Figura
3). No tenemos certeza sobre la forma en que fueron trasladados hasta la
isla, si fueron en grandes bloques a fragmentar o como rodados. Como dato
interesante en las cuadrculas aparecen pequeos rodados de cuarzo
provenientes de las areniscas conglomeradas.

Figura 3: Fragmento de arenisca conglomerada extrada del ro Uruguay, Entre
Ros. Imagen obtenida del Museo de Ciencias Naturales Prof. Antonio
Serrano, Ciudad de Paran, Entre Ros.


Los lticos provienen de 16 cuadrculas de excavacin abarcando una superficie aproximada de 60,6 m
2
. El N
total de material ltico analizado es de 449, el cual constituye el 85 % del material recuperado. Los porcentajes
de tipo de materia prima que presenta el material ltico recuperado y la relacin que tiene considerando la
composicin geolgica anteriormente nombrada se observa en la Tabla 1.

Materia prima Porcentaje
Granito 60,10%
Arenisca 10,60%
Canto rodado: 3,10%
Calcedonia: 11%
Cuarzo 7%
Metamrfica 1,90%
Basalto 1,90%
Jaspe 1,06%
gata 0,41%
Gabro 1%
Gneis 0,60%
Micacitas 1,03%
Esquistos 0,30%
Tabla 1: Porcentajes por tipos de materia prima

La metodologa utilizada implica enfoques tecnolgicos y morfolgicos realizados a ojo desnudo y a travs de
intermediarios pticos, como lupas binoculares. Se considera necesario en un futuro complementar el anlisis de
los materiales mediante estudios experimentales y altos aumentos, el cual permitir establecer los rastros de
TOMO IV - 1482
Mara Isabel Capparelli y Anala Dvila
sustancias trabajadas. En primera instancia se ha realizado una observacin del conjunto. En funcin de las
caractersticas morfolgicas que respondan a la funcionalidad de la pieza se efectu un anlisis tipolgico de los
distintos materiales, basado en la clasificacin realizada por Aschero (1975, 1983).

En la observacin macroscpica de los atributos se consideraron los siguientes grupos tipolgicos:

1) Lito no modificado, (LNM), 2) Lito potencialmente modificados (LPM): se observan aspectos que podran
responder a la funcionalidad de la pieza, como ser la presencia de hoyuelos, 3) Desechos de talla (DT) siguiendo
la clasificacin realizada por Aschero (1975, 1983).
4) Instrumento (I) se consider como un grupo, dentro del cual se incluyen los siguientes subgrupos:
A-Hachas,
B-Litos modificados por su uso (LMU): no manufacturados pero que portan evidencias de utilizacin como
Afiladores, Alisadores y artefactos de Molienda. Los Activos o superiores como Molino de mano o Moledora,
Pasivos o inferiores, como los Morteros (Babot 2004).
5) Ncleo testeado (Nd): se considera aquellos ncleos de reducido tamao que presentan alguna falla de la
materia prima y se caracterizan por presentar lascados aislados (Armentano 2004). Esta definicin es vlida para
diferenciarla del de Ncleos planteado por Aschero (1975,1983).

Para el anlisis individual de cada una de las piezas se confeccion una ficha para registrar variables referidas a
los atributos tecnolgicos y morfomtricos. Como variables del atributo tecnolgico se consideraron la materia
prima, forma base, ngulo de retoque, taln, asociacin entre piezas del conjunto, estadio, y el estado de la
pieza. Como variables del atributo morfomtrico se consideraron las dimensiones.

Del total de la muestra el porcentaje correspondiente a DT, N, y Nd constituye el 25,85%, un 69,04 %
corresponden a LNM, un 3,56 % a LPM de granito, y gabro en una menor proporcin, y el 1,55 % restante
corresponde a Instrumentos. En la Figura 4 puede observarse la composicin tipolgica del material recuperado.
Se puede observar que los tipos de artefactos que predominan son los desechos de talla, luego siguen los ncleos,
Instrumentos y en igual proporcin los Ncleo testeados.

977
310
16
100
0
200
400
N Nd I LNM LPM DT

Figura 4: Composicin tipolgica del material recuperado.

En el conjunto de la muestra conformada por DT, N, y Nd se encuentran presentes ncleos de gata,
Calcedonia, Cuarzo y Jaspe en un 1,90 % y los definidos como ncleos testeados de Calcedonia, Cuarzo, Jaspe
en 1,68%. Dentro de los LNM el 60,84 % es de granito, y el 39,16% es arenisca, y materiales varios como canto
rodado, Gneis, Micacitas, esquistos y metamrfica.

Como resultado del anlisis del conjunto pueden realizarse las siguientes observaciones: La utilizacin del
granito fue muy variada, suelen aparecer como ecofactos en ncleos de fogones, como instrumentos punzantes y
en forma de rodado siendo la ms utilizada como mano de mortero.

TOMO IV - 1483
CAPTULO 30 - MESA DE COMUNICACIONES 1
La arenisca rojiza est presente en varios afiladores y alisadores, observndose a nivel macroscpico las huellas
de uso. El cuarzo se presenta en dos variedades uno es translcido, el cual ha sido aprovechado para la
elaboracin de pequeas lascas retocadas, y un cuarzo de aspecto hialino de color blanco que se presenta en 2
ncleos de tamao muy pequeo y pequeas lascas de descortezamiento.

La cantidad de instrumentos formalizados por retoque es escasa. Del total de la muestra el 1,55 % corresponde a
Instrumentos: un alisador de granito rodado y dos alisadores de arenisca; dos Afiladores uno de granito y otro
de arenisca y un Artefacto activo de molienda correspondiente a una mano sobre granito rodado.

Se destaca la presencia de un Hacha de mano metamrfica que presenta lascados dstales, profundos en ambas
caras y bien diferenciados (Ver Figura 5).

Figura 5: Conjunto de alisadores, afiladores, hachas de mano, mano de mortero.

El total de la muestra analizada presenta un 66,20 %.de corteza. Los desechos de talla son de tamaos mediano-
pequeos y conforman el 22,27% de la muestra total, distinguindose 31 lascas, de las cuales 24 son de
calcedonias sin presencia de retoque; 2 son de cuarzo, una es translcida y otra hialina, con presencia de retoque
unifacial, corto directo y taln natural; 3 son de basalto y 2 son de composicin metamrfica sin evidencias de
lascados y taln natural. Adems se observan 14 lascas de descortezamiento, 9 esquirlas, y 58 fragmentos
indeterminados debido a su alto grado de fracturacin (Ver Figura 6).








Figura 6: En orden lasca retocada, ncleos, y lascas sin retoque.

Consideraciones finales
Teniendo en cuenta los resultados anteriores y considerando que la isla es el nico afloramiento rocoso de la
zona, este factor podra haber incidido, entre otras decisiones, en la eleccin del lugar de asentamiento. Los
recursos lticos utilizados provienen en su mayora del basamento cristalino conformado por rocas de granitos
gnisicos, ultrabsicos y metamrficos de mucha antigedad. Las fuentes de aprovisionamiento estn
localizadas al sur de la isla en afloramientos aislados, y en el oeste de la pista de aterrizaje. La distancia a pie de
estas fuentes es de 3 Km. El resto de las materias primas utilizadas parecieran proceder de los conglomerados de


TOMO IV - 1484
Mara Isabel Capparelli y Anala Dvila
arenisca cuya composicin encuentra relacin con el tipo de materiales y el bajo porcentaje con que se
encuentra: Canto rodado, Calcedonia, Cuarzo, Metamrfica, Basalto, Jaspe, gata, Gneis, Micacitas, Esquistos.

Como dato interesante para la arqueologa regional la presencia de un hacha de mano, e implementos como
manos de mortero y morteros, y otros elementos potencialmente utilizados, estaran indicando algn tipo de
actividad relacionada con la recoleccin/procesamiento de vegetales silvestres.

La presencia de lascas retocadas, abundantes esquirlas, lascas de descortezamiento, fragmentos indeterminados y
ncleos es relevante ser mencionada, ya que constituye un aporte a las investigaciones realizadas en la isla hasta
el momento, considerando la escasa evidencia de material ltico recuperado.

Bibliografa
Aschero, C. 1975. Ensayo para una clasificacin morfolgica de artefactos lticos aplicada a estudios tipolgicos
comparativos. Informe al CONICET. Buenos Aires. Manuscrito.
Aschero, C. 1983. Ensayo para una clasificacin morfolgica de artefactos lticos aplicada a estudios
tipolgicos comparativos. Apndices A C. Revisin. Ctedra de Ergologa y Tecnologa (FFyL-UBA). Buenos
Aires. Manuscrito
Armentano G. M. 2004. Un ndulo testeado es un ncleo? Ponencia presentada en la II Jornada taller
Morfologa macroscpica en la clasificacin de artefactos lticos: innovaciones y perspectivas. Facultad de
ciencias Naturales e IML Universidad Nacional de Tucumn. San Miguel de Tucumn.
Babot, M. del P. 2004. Hacia una clasificacin morfolgico-funcional de artefactos de molienda. Ponencia
presentada en la II Jornada taller Morfologa macroscpica en la clasificacin de artefactos lticos:
innovaciones y perspectivas. Facultad de ciencias Naturales e IML Universidad Nacional de Tucumn. San
Miguel de Tucumn.
Bogan, S. 2005. Anlisis del material faunstico del sitio arqueolgico Arenal Central, Isla Martn Garca. Actas
de las VI Jornadas Chivilcoyanas en Ciencias Sociales y Naturales. CD. Chivilcoy.
Capparelli, M. I. 2005. Martn Garca: testimonio de los ltimos avances guaranes. Actas de las VI Jornadas
Chivilcoyanas en Ciencias Sociales y Naturales. CD. Chivilcoy.
Capparelli, M. I. 2007. Martn Garca antes del despensero de Sols. Actas del XVI Congreso Nacional de
Arqueologa, Tomo I: 41. San Salvador de Jujuy, Argentina.
Capparelli, M. I. y F. Vzquez. 2009. Arqueologa de la isla Martn Garca. Actas del III Encuentro de Discusin
arqueolgica del Noroeste. Santo Tom, Santa Fe. En prensa.
Codignotto, J. O. 1996. El delta del Paran y el estuario del Ro de la Plata. Acta del XIII Congreso de Geologa
Argentina. Acta: 4-10. Buenos Aires.
Dalla Salda, L.1981. El basamento de la Isla Martn Garca, Ro de la Plata. Revista de la Asociacin Geolgica.
Argentina 36 (1): 29-43.
TOMO IV - 1485
CAPTULO 30 - MESA DE COMUNICACIONES 1
PRIMEROS RESULTADOS DEL ANLISIS DEL REGISTRO
ARQUEOLGICO DEL SITIO PAJAS BLANCAS
(CORONDA, PCIA. DE SANTA FE)
Julieta I. Sartori
*


Introduccin
El sitio Pajas Blancas (de aqu en ms PB) se encuentra localizado en la Cuenca Inferior del ro Coronda, ms
especficamente se sita a los 32 6 37 de latitud Sur y a los 60 44 35 de longitud Oeste (ver Figura 1). Por
su ubicacin corresponde a un sitio de isla que se encuentra prximo a las localidades de Coronda y San Fabin
(Prov. de Santa Fe) y en los perodos de crecientes queda enmarcado dentro de la Laguna de Coronda.














Figura 1. Ubicacin del sitio PB en la Provincia de Santa Fe. Fuente Google Earth.

Los trabajos de campo realizados en el sitio se llevaron a cabo en el marco del proyecto El uso del espacio en la
Cuenca Media e Inferior del ro Salado que es dirigido por la Dra. M. R Feuillet Terzaghi y se viene
desarrollando en la zona desde el ao 2003. A su vez este proyecto mayor incluye otro proyecto que es
Variabilidad arqueofaunstica en la Cuenca Media e Inferior del ro Coronda y que se est realizando desde el
pasado ao mediante una beca de postgrado de CONICET. Las investigaciones contaron tambin con el apoyo
de la municipalidad y el museo de Coronda.

Los sondeos realizados en Pajas Blancas dieron como resultado la recuperacin de restos faunsticos, cermicos,
lticos y seos humanos. Respecto de estos ltimos cabe sealar que si bien no se realiz la excavacin
especfica de los enterratorios fueron localizados al menos tres individuos en diferentes sectores del sitio. Cabe
sealar que dado que la investigacin de este sitio y sus materiales se encuentran en su primera etapa, no se
cuenta an con fechados radiocarbnicos que den una fecha precisa de la ocupacin del sitio.

En este trabajo se presentan los primeros resultados del anlisis del registro arqueolgico recuperado y se discute
la posible funcionalidad del sitio en relacin con otras localidades arqueolgicas de la zona. Se considera que el
estudio de los materiales de un sitio de isla contribuye a profundizar el conocimiento del uso del espacio que
habran realizado las poblaciones que habitaron la zona en el pasado en este tipo de paisaje en particular.

Medio ambiente
La disponibilidad de recursos ha sido reconocida como uno de los factores que influye para la eleccin del
asentamiento de los grupos humanos en el pasado (Bettinger 1991, Kelly 1995). En este sentido cabe destacar
que la cuenca media e inferior del ro Coronda es un ambiente en el cual actualmente se hallan disponibles una
gran cantidad de recursos debido a que se encuentra en la zona de transicin entre el sector Pampsico y el sector
de Delta e Islas del Paran (SPANP 1997). De esta forma el ambiente se caracteriza por poseer especies tpicas
del sector Pampsico, tales como Cavia aperea y Chaetophractus villosus; pero tambin especies tpicas del
sector de Delta e Islas del Paran, con lo cual cuenta con una variada fauna adaptada a la vida acutica. Dentro

*
CONICET-Instituto Nacional de Antropologa y Pensamiento Latinoamericano -FUNDARQ. julisartori@gmail.com

Pajas Blancas
Santa Fe
Entre Ros
TOMO IV - 1487
CAPTULO 30 - MESA DE COMUNICACIONES 1
de la misma puede mencionarse al carpincho (Hydrochaerus hidrochaerys), lobito de ro (Lontra longicaudis),
coipo (Myocastor coypus), yacar (Caiman sp.), coriy (Eunectes notaeus) y tortuga de ro (Phrynops sp. e
Hydromedusa sp.) (SPANP 1997).

Cabe destacar que dado que el Humedal del Paran Inferior, se encuentra en la Ecoregin del Delta e Islas del
Paran (sensu Burkart et al. 1999) en la zona cercana a los sitios pueden encontrarse adems de roedores y
moluscos, crvidos tales como el venado de las pampas y el ciervo de los pantanos (Ozotoceros bezoarticus, y
Blastoceros dichotomus respectivamente) (Cabrera y Yepes 1971).

La fauna ictcola se encuentra representadas por dos rdenes principales: Characiformes y Siluriformes. Entre los
primeros se encuentran el dorado (Salminus), el sbalo (Prochilodus platensis), la boga (Leporinus sp.), el pac
(Piaractus mesopotmicus), y las mojarras (Aphiyocharax sp., Astyanax sp.); y entre los Siluriformes el surub
(Pseudoplatystoma coruscans), bagre (Pimelodus claris y Rhamdia sapo), armado (Pterodoras granulosus) y
vieja del agua (Plecostomus commersoni) (Ringuelet 2004).

La zona se caracteriza por un clima clido y hmedo con precipitaciones de 1000 mm anuales. La vegetacin
predominante es de flechillas con arbustos de poca altura aunque posee selvas marginales y bosques edficos
xerfilos, en los cuales predominan el algarrobo (Prosopis sp.), el saco (Sambucus sp.) y el omb (Phytolacca
dioica). Asimismo, las especies ms representativas de la zona son el curup (Sapium haematosperum), el sauce
criollo (Salix humboltiana), el espinillo (Acacia caven), el chaar (Geoffroea decorticans), la tusca (Acacia
caven), el aromo (Acacio aromo) y la cina cina (Parkinsonia aculeata) (SPANP 1997). La relevancia de estas
especies radica en que las mismas poseen vainas y frutos comestibles, de los cuales una vez procesados puede
obtenerse harina, bebidas (eg. mediante la fermentacin de los frutos del chaar o de la fermentacin de las
vainas del algarrobo) y dulces naturales (eg. miel de algarrobo y arrope) (Loponte 2008).

Materiales y mtodos
En el sitio Pajas Blancas fueron realizados siete sondeos exploratorios con el objeto de establecer el potencial
arqueolgico del sitio adems, de su extensin (tanto en sentido N-S, como E-W). Los pozos de sondeo se
realizaron de 50x50 cm y en los casos en que no fueron hallados restos humanos- hasta una profundidad real de
50 cm, que era donde apareca la napa. Se establecieron niveles artificiales de 10cm. y se procedi al cernido en
agua del sedimento extrado. Dado que en la zaranda no aparecan restos arqueolgicos y el sedimento al ser
arcilloso dificultaba este procedimiento se decidi tomar muestras de sedimentos de cada nivel para cernir en
laboratorio. En todos los sondeos fueron recuperados materiales arqueolgicos correspondientes a restos seos
humanos, arqueofaunsticos, cermicos, ltico, ocre y carbn.

Los sondeos fueron planteados en los distintos sectores del sitio en donde aparecan concentraciones de material
en superficie y pudo observarse que en aquellos que se realizaron en la parte ms alta aparecan restos seos
humanos. Los mismos no fueron excavados dado que excedan los lmites de esta primera etapa exploratoria del
sitio. Mezclados con los restos humanos apareca espculas de ocre, cermica y restos faunsticos. En aquellos
sondeos en que no aparecieron enterratorios los materiales aparecieron mezclados con carboncillos y restos
seos calcinados. Cabe aclarar que dado que no se llev a cabo la excavacin completa ni la extraccin de los
restos seos humanos, no se presenta aqu el anlisis de los mismos. Por lo tanto este trabajo se enfoca en
realizar un anlisis preliminar- de los restos cermicos, faunsticos y lticos.

En cuanto a los aspectos metodolgicos para el anlisis del material cermico se tuvieron en cuenta los criterios
desarrollados por diversos autores que plantean que la confeccin de tecnologas requiere de elecciones
especficas, las cuales determinarn luego las propiedades formales de los artefactos (Orton et al. 1993; Rice
1996; Rye 1981; Schiffer 1987, entre otros). Considerando que el presente anlisis constituye un primer
acercamiento a los materiales, en la muestra se realiz el reconocimiento a nivel macroscpico de algunos
atributos que se vinculan con los aspectos tecnolgicos, tipolgicos y funcionales de las piezas cermicas. Entre
los mismos se observ la presencia decoracin (pintura e incisiones) y otras dos modificaciones de las
superficies: agujeros de suspensin y presencia de holln. Por ltimo se registr que haba diferentes tipos de
espesor entre los tiestos.

En lo que respecta a la metodologa del anlisis arqueofaunstico se realiz la identificacin anatmica y
taxonmica utilizando los criterios de la sistemtica biolgica, tratando de alcanzar el nivel taxonmico y
anatmico ms preciso (Salemme et al. 1988). En aquellos casos en que por el grado de astillamiento y/o
conservacin de los materiales no fue factible asignarlos a categoras taxonmicas superiores (i.e. Familia,
TOMO IV - 1488
Julieta I. Sartori
Orden, Clase) fueron considerados como fragmentos indeterminados -indet-. Para la estimar la abundancia y
diversidad taxonmica se utilizaron las medidas convencionales de NISP y MNI (Grayson 1984; Lyman 1994,
Mengoni Goalons 1988). A su vez en los especmenes se observaron aspectos que se vinculan con el
procesamiento de las presas, como lo son las huellas de corte y alteraciones trmicas (Lyman 1994; Mengoni
Goalons 1999). Por otro lado tambin se relev la incidencia de agentes tafonmicos que habran afectado el
conjunto, como las marcas de races (Wood y Johnson 1978), las manchas de manganeso, y la meteorizacin
(Behrensmeyer 1978).

Por ltimo en lo que respecta al material ltico dado que slo fue hallado una arenisca con huellas de uso se
plantea aqu su potencial funcionalidad, quedando para anlisis futuros la identificacin ms precisa de la
materia prima y su lugar de origen (entre otros aspectos).

El registro arqueolgico de Pajas Blancas
En el presente trabajo se realiz el anlisis de los materiales recuperados de los primeros 30cm. de los 5 pozos de
sondeo que fueron excavados hasta los 50cm de profundidad real. La muestra cermica de estos niveles est
constituida por 255 fragmentos cermicos los cuales varan en su tamao y espesor. As los fragmentos ms
grandes miden entre los 10 y los 7 cm., constituyendo los mismos slo el 2,3% de la muestra. El resto de los
fragmentos se ubican entre los 5 y los 3cm, (97,7%), aunque tambin se hallaron fragmentos muy pequeos (<
2cm). En cuanto a los espesor la mayora se encuentran entre los 4-6 cm (84% de la muestra) aunque tambin
fueron hallados escasos (N=2) fragmentos que eran menores a 1cm de espesor. Fueron hallados bordes en un
7,8% y la decoracin incisa se hall en 7 fragmentos. En cuanto a la pintura de las superficies la misma se
encontr -tanto en las caras internas como externas- en 4 fragmentos el color rojo y uno el color blanco.
Respecto a las otras modificaciones de las superficies que fueron relevadas cabe mencionar que se registr la
presencia de holln en un tiesto y la presencia de un agujero de suspensin en otro. De lo primero cabe
mencionar que el holln se encontr en la cara interna del tiesto, lo cual podra indicar que el descarte o la rotura
del material se realiz prximo a algn rea de combustin activa (Prez y Caardo 2004). El agujero registrado
en el otro tiesto, por su parte, podra cumplir la funcin de servir de suspensin para el traslado de los recipientes
o estar vinculados con la reparacin de una pieza rota.

La fauna cuenta con un NISP de 161 especmenes y si bien posee representado seis taxones los ms abundantes
corresponden a Myocastor coypus (coipo) y al macrotaxn Peces (ver Tabla 1).

Taxa NISP NISP%
Myocastor coypus 37 22,9
Macrotaxn Peces 102 63,3
Hydrochaerus hidrochaerys 1 0,62
Blastoceros dichotomus 2 1,24
Tupinambis merianae 1 0,62
Ave indet. 7 4,35
Indeterminados 11 6,83
TOTAL 161 100
Tabla 1. Representacin taxonmica del sitio PB.

En cuanto a Myocastor coypus este roedor de tamao mediano posee un MNI de 3, obtenido de las
hemimandbulas recuperadas en tres de los pozos. Dado que fueron hallados todos los elementos del esqueleto
del coipo se estima que hubo un procesamiento in situ del mismo. Un caso similar ocurre con los peces de los
cuales fueron recuperados elementos del crneo, vrtebras y costillas.

Las aves, que por lo general en los registros de la zona se encuentran escasamente representadas, cuentan en PB
con una representacin mayor si se tiene en cuenta el NISP para este taxn. Las partes anatmicas corresponden
a falanges (N=5), un fragmento de hmero distal y uno de tarso-metatarso.

El elemento de Hidrochaerys hidrochaerys corresponde a una tercera falange sin fusionar y no present huellas
de accin antrpica. Otro taxa que se encuentra escasamente representado es Tupinambis merianae, del cul se
recuper slo una vrtebra.
TOMO IV - 1489
CAPTULO 30 - MESA DE COMUNICACIONES 1
En cuanto a las alteraciones de las superficies seas en los elementos slo dos especmenes presentaron huellas
de corte, las mismas se encuentran en una falange correspondiente a B. dichotomus y la otra en un fmur de M.
coypus. Diez vrtebras de pez y tres costillas presentaron alteraciones trmicas, aunque la presencia de
manganeso dificult la identificacin de los huesos quemados ya que este agente tie la superficie de un color
marrn-negruzco. Si en cambio fueron observados in situ gran cantidad de especmenes calcinados pero por su
tamao (< 0,5 cm) no pudieron ser identificados a nivel anatmico-taxonmico.

Respecto a los agentes tafonmicos que habran incidido en la muestra se observ que los materiales se vieron
afectados por manchas de manganeso y races. Si bien ningn epsecmen present estadios de meteorizacin
mayor a 2, las superficies se encontraban en muchos casos exfoliadas. Ningn elemento present marcas de
roedores o carnvoros, con lo cual se descarta la acumulacin de restos producto de alguno de estos agentes.

En cuanto al nico material ltico hallado el mismo corresponde a una arenisca y dado a que en su superficie
mayor fueron observados a nivel macroscpico la presencia de surcos, se estima que el mismo habra sido
utilizado como afilador para reactivar otros artefactos, aunque stos ltimos no fueron hallados en el sitio.

Discusin
Si bien lo aqu expuesto constituye un anlisis preliminar de los materiales recuperados en el sitio Pajas Blancas,
cabe mencionar que el sitio cont con un registro compuesto por distintos materiales arqueolgicos, siendo los
ms abundantes los restos cermicos. No obstante esto debe tenerse en cuenta que es probable que los restos
seos humanos tengan una distribucin mayor que la registrada por el momento, ya que se observ que los
enterratorios se localizaban slo en aquellos sondeos que fueron realizados en la parte ms alta del sitio.

La asociacin de todos los materiales arqueolgicos recuperados demuestran el uso de este espacio durante el
pasado. Cabe sealar que el hecho de que se hallen restos seos humanos localizados en el sector ms alto del
sitio, sumado a la escasa presencia de fauna, hacen pensar en que el sitio habra funcionado, fundamentalmente,
como un rea de enterratorios. En este sentido se considera que el sitio se encuentra localizado en un sector
estratgico por su cercana con dos grandes sectores de tierra firme: 1) la zona de la actual ciudad de San Fabin
y Coronda -Santa Fe- y 2) la hoy Ciudad de Diamante -Entre Ros-. Desde el sitio se accede a una gran
visibilidad ya que el mismo se encuentra sobre elevado respecto de una amplia zona circundante (al menos unos
15 km a la redonda). Esta caracterstica la poseen otros sitios de la Cuenca del ro Salado-Coronda, en los cuales
fueron hallados tambin enterratorios (Sartori 2008).

El registro arqueofaunsitco de PB estara mostrando eventos de ocupacin ocasional del sitio dado que no se han
hallado grandes concentraciones de restos faunsticos. As los recursos que se encuentran con mayor
representacin son de bajo ranking (eg. coipo y peces), mientras que los de alto rendimiento (eg. ciervo) se
encuentran escasamente representados. Es decir que en este sitio se refleja la explotacin casi exclusiva de
recursos acuticos, que habran sido los ms abundantes en la zona y que se caracterizan por encontrarse
disponibles durante todo el ao y no conllevan demasiado tiempo de bsqueda-captura ni procesamiento. Este
patrn que se observa en PB, se repite en otros sitios de enterratorios que se ubican cercanos, en los cuales los
conjuntos faunsticos estn representados por pocos especmenes y se caracterizan adems por una baja
diversidad taxonmica (Sartori 2008, 2009). Respecto a los materiales cermicos cabe mencionar que su
asociacin con restos faunsticos y carbn podra estar reflejando la presencia en el sitio de reas de consumo. El
que haya cermica en sitios en donde predominan presas de pequeo porte podra indicar que se realiza un
aprovechamiento intensivo, ya que el empleo de la alfarera para la coccin de los alimentos permite obtener un
mayor rendimiento de los mismos.

Si bien en el sitio fueron hallados materiales cermicos, faunsticos y lticos, cabe mencionar aqu que la baja
concentracin de los mismos hace pensar en el sitio como un rea fundamentalmente de enterratorios, en la cual
se habran desarrollado ocupaciones breves, tal vez vinculadas con las prcticas mortuorias all realizadas. Por
otra parte, otro aspecto que apoyara la funcionalidad de PB como un rea de enterratorios es que durante las
crecidas es probable que el sitio quedara asilado de las zonas de tierra firme y dada las dimensiones del mismo
(200 m aproximadamente) no es un espacio que pueda sustentar una gran cantidad de poblacin; con lo cual las
ocupaciones se podran haber visto limitadas por las variaciones estacionales que se producen en el nivel del
agua que circunda el sitio. Otro aspecto que debe ser considerado respecto de la particularidad del
emplazamiento de PB es que la potencial ocupacin del sitio durante los momentos de crecientes conlleva a
pensar en algn tipo de medio para llegar al mismo (eg. canoas), ya que sera imposible a pie. Si bien este hecho
ha sido registrado para los grupos indgenas de la zona por cronistas europeos durante el momento de contacto
TOMO IV - 1490
Julieta I. Sartori
y a posteriori-, y para otras zonas cercanas se propone el uso de las mismas (Acosta y Musali 2002, Loponte
2008), an no se cuenta con evidencias arqueolgicas que sustenten este hecho. Para considerar esta posibilidad
debern realizarse investigaciones que tengan en cuenta la disponibilidad y acceso de materia prima para la
construccin de este medio que habran permitido el acceso a sitios como PB.

Palabras finales
En este trabajo se ha realizado el anlisis preliminar de los materiales arqueolgicos recuperados en PB y a partir
de ellos se ha intentado discutir la funcionalidad del sitio. La propuesta esbozada es una hiptesis que deber ser
contrastada a medida que se profundice en el anlisis y el conocimiento de este sitio.

Por ltimo cabe destacar que el haber realizado la prospeccin del sitio Pajas Blancas es de suma importancia
para el conocimiento de una zona que en materia de anlisis arqueolgicos sistemticos se encuentra
escasamente estudiada. Dado que el presente anlisis se enmarca dentro de un proyecto ms amplio, se considera
que los datos que se obtengan podrn ser incluidos dentro de problemticas ms amplias que permitirn llegar a
un mayor conocimiento de los grupos humanos que habitaron la zona en el pasado.

Bibliografa
Acosta, A. y J. Musali. 2002. Ictioarqueologa del sitio La Bellaca 2 (Pdo. de Tigre, Pcia. de Buenos Aires).
Informe preliminar. Intersecciones en Antropologa 3: 3-16.
Behrensmeyer, A. 1978. Taphonomic and ecologic information from bone weathering. Paleobiology 4: 150-162.
Bettinger, R. 1991. Cazadores-recolectores: teora arqueolgica y evolutiva. Plenum Press, Nueva York.
Burkart, R., N. Brbaro, R. Snchez, y D. Gmez. 1999. Ecoregiones de la Argentina. Administracin de
Parques Nacionales. Programa de Desarrollo Institucional Ambiental. Secretara de Recursos Naturales y
Desarrollo Sustentable.
Cabrera, A y J. Yepes. 1971. Mamferos sudamericanos (vida, costumbres y descripcin). Historia Natural
Ediar. Compaa Argentina de Editores, Buenos Aires.
Grayson, D. 1984. Quantitative Zooarchaeology. Topics in the Analysis of Archaeological Faunas. Academic
Press. INC.
Kelly, R. 1995. The foraging spectrum. Diversity in hunter-gatherer lifeways. Smithsonian Institution Press,
Washington.
Lyman, R. 1994. Vertebrate taphonomy. University Press, Cambridge.
Loponte, D. 2008. Arqueologa del Humedal del Paran Inferior (Bajos Ribereos meridionales). Asociacin
Amigos del Instituto Nacional de Antropologa y Pensamiento Latinoamericano. Secretara de Cultura de la
Nacin, Buenos Aires.
Mengoni Goalons, G. 1999. Cazadores de guanaco de la estepa patagnica. Coleccin de Tesis Doctorales.
Sociedad Argentina de Antropologa, Buenos Aires.
Orton, C., P. Tyers y A. Vince. 1993. Pottery in Archaeology. University Press, Cambridge.
Prez, M y L. Caardo. 2004. Produccin y uso de cermica en el norte de la provincia de Buenos Aires.
Aproximaciones Contemporneas a la Arqueologa Pampeana. Perspectivas tericas, metodolgicas, analticas
y casos de estudio. Editado por G. Martnez, M.A Gutierrez, R. Curtoni, M. Bern y P. Bern, pp. 335-
347.Facultad de Ciencias Sociales, Universidad Nacional del Centro de la Provincia de Buenos Aires.
Rice, P. 1996. Recent ceramic analysis. Function, Style and Origins. Journal of Archaeological Research 4 (2):
133-161.
Ringuelet, R. 2004. Zoogeografa y ecologa de los peces de aguas continentales de la Argentina y
consideraciones sobre las reas ictiolgicas de Amrica del Sur. Ecosur 2 (3): 1-122.
Rye, O. S. 1981. Pottery Technology: Principles and reconstruction. Taraxacum, Washington.
Salemme, M., L. Miotti y E. Tonni. 1988. La determinacin sistemtica de los mamferos en el anlisis
arqueofaunstico. De procesos, contextos y otros huesos. Editado por N. Ratto y A. Haber, pp. 23-30.Facultad de
Filosofa y Letras de la UBA, Buenos Aires.
Sartori, J. 2008. La cuenca inferior del ro Salado: un desafo para el anlisis arqueofaunstico. Tesis para optar
por el grado de Licenciatura en Antropologa. Facultad de Humanidades y Artes, UNR.
2009. La fauna en la Cuenca Inferior del ro Salado: los Sitios Familia Primn y Ro Salado Coronda II, como
casos de estudio. Maml Mapu: pasado y presente desde la arqueologa pampeana. Editado por M. Bern, L.
Luna, M. Bonomo, C. Montalvo, C. Aranda y M. Carrera Aizpitarte (comp.), pp. 215-228. Libros del Espinillo,
Buenos Aires. En prensa.
Schiffer, M. B. 1987. Formation Processes of the Archaeological Record. University of New Mexico Press,
Albuquerque.
TOMO IV - 1491
CAPTULO 30 - MESA DE COMUNICACIONES 1
SPANP (Sistema provincial de Areas Naturales Protegidas de Santa Fe). 1997. Sistema Provincial de reas
Naturales Protegidas. Gobierno de la Provincia de Santa Fe, Santa Fe. Administracin de Parques Nacionales.
Publicacin de la Asociacin Cooperadora de la E.Z.E. Talleres Grficos de Imprenta Ciscato, Santa Fe.
Wood, W. and D. Johnson. 1978. A survey of disturbance processes in archaeological site formation. Advances
in Archaeological Method and Theory 1: 539-601.
TOMO IV - 1492
Julieta I. Sartori
ANLISIS DE CIDOS GRASOS EN ALFARERA ARQUEOLGICA
DEL HUMEDAL DEL PARAN INFERIOR. AVANCES
EN EL CONOCIMIENTO DE SU USO
Gabriela Naranjo
*
, Laura Malec
*
y Maricel Prez
**


Introduccin
El empleo de alfarera ha sido una prctica muy extendida entre los grupos prehispnicos que habitaron el
humedal del ro Paran inferior (o HPI). En efecto, la cermica constituye la evidencia artefactual ms abundante
en todos los depsitos arqueolgicos del rea, y su densidad de hallazgos es probablemente una de las ms
elevadas de toda la regin (Loponte 2008; Loponte et al. 2004; Loponte y Acosta 2003, 2008; Prez y Caardo
2004). Sin embargo, los enfoques relacionados con el uso de la cermica no han sido enfatizados en el rea de
estudio. La produccin y el uso masivo de la alfarera poseen una estrecha relacin con la organizacin
econmica y especialmente con la preparacin y consumo de alimentos. Por esta razn, su anlisis habitualmente
se efecta en relacin con aquellas conductas (Arthur 2002; Henrickson y McDonald 1983; O Brien et al. 1994).
Lamentablemente, esto ltimo no ha sucedido en la arqueologa local, probablemente porque esta aproximacin
no es sencilla (Loponte 2008).

La forma en que los grupos humanos aprovecharon los recursos alimenticios constituye un aspecto primordial de
su organizacin. En este sentido, el estudio del uso especfico de la cermica (sensu Rice 1996) apunta a
entender la dinmica misma de las poblaciones humanas del pasado. La estructura porosa de este material
favorece la absorcin y retencin de la materia orgnica, por lo cual el anlisis de los residuos qumicos ha sido
utilizado para responder a diversos problemas vinculados al empleo efectivo de la alfarera arqueolgica,
logrando resultados satisfactorios (e.g. Charters et al. 1993; Dudd et al. 1999; Evershed et al. 2003; Morton y
Schwarcz 1988). De esta manera, esta herramienta arqueomtrica representa una lnea de investigacin por
medio de la cual es posible conocer aspectos de la variabilidad funcional de estos conjuntos artefactuales y
aportar informacin acerca de cuestiones relacionadas con el procesamiento de recursos y conductas alimenticias
de los grupos que habitaron esta subregin durante el final del Holoceno tardo.

La mayora de los trabajos que aplicaron esta metodologa se han orientado hacia el anlisis de los residuos
lipdicos en las cermicas y en varios de ellos se logr establecer el uso de diferentes alimentos en la antigedad
(e.g. Copley et al. 2003; Eerkens 2002; Reber y Evershed 2004). Estos compuestos, al ser insolubles en agua,
constituyen un excelente objeto de estudio arqueolgico, ya que su hidrofobicidad limita la prdida por
disolucin en aguas subterrneas y por ello suelen estar presentes en cantidades relativamente elevadas en los
tiestos cermicos.

En general, la composicin acdica vara entre las distintas especies animales y vegetales. En algunos anlisis
realizados sobre lpidos en muestras experimentales se observ la variacin en la composicin de los mismos al
degradarse y se determinaron relaciones entre los diferentes cidos grasos comnmente presentes. Luego se
intent aplicar estas relaciones en las piezas arqueolgicas, con el fin de establecer si la alfarera poda asociarse
al consumo de determinados tipos de alimentos tales como carne, semillas, pescado, races (Barnard 2008;
Eerkens 2005; Malainey et al. 1999). Sin embargo, no es sencillo interpretar esas relaciones debido a la
ubicuidad de la mayor parte de los cidos grasos y a la potencial mezcla de mltiples fuentes alimenticias.
Adems, dos factores dificultan la interpretacin de los resultados. En primer lugar, la mayor parte de los
residuos analizados proviene de vasijas utilizadas para coccin, por lo que el perfil lipdico puede estar alterado
por la exposicin de los alimentos a las altas temperaturas. En segundo lugar, aunque los lpidos son menos
susceptibles a la degradacin que otros compuestos presentes en los alimentos (como las protenas o los cidos
nucleicos), la oxidacin e hidrlisis contribuyen a su descomposicin, cuyo grado depende del contexto
ambiental en que se ubican los depsitos arqueolgicos y del tiempo transcurrido. Por ltimo, es importante
destacar que no todos los cidos grasos se oxidan a la misma velocidad ya que, por ejemplo, los insaturados se
alteran mucho ms rpidamente que los saturados.


*Departamento de Qumica Orgnica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires. malec@qo.fcen.uba.ar
**CONICET Instituto Nacional de Antropologa y Pensamiento Latinoamericano. maricelperez@gmail.com
TOMO IV - 1493
CAPTULO 30 - MESA DE COMUNICACIONES 1
En el HPI existe un nico antecedente (Prez y Caardo 2002), de carcter preliminar, que permiti el
reconocimiento de componentes de los alimentos en general. Se procesaron tres tiestos cermicos arqueolgicos
procedentes del sitio Tmulo de Campana (partido de Campana, provincia de Buenos Aires) para explorar la
presencia de cidos grasos, y se lo complement con estudios actualsticos comparativos. Los anlisis efectuados
sobre muestras arqueolgicas permitieron determinar la presencia de los mismos compuestos que los detectados
en vasijas modernas utilizadas para hervir Siluriformes y tejido muscular y adiposo de M. coypus. El aporte
brindado por estos resultados es que permiten sostener que la alfarera en el rea se orient, en alguna medida, al
hervido de las presas. Esta hiptesis cuenta con otras lneas argumentativas, como los niveles de fragmentacin
de huesos largos de grandes mamferos y de los crneos de P. granulosus, como as tambin los depsitos de
carbn presentes en una importante fraccin de los recipientes cermicos (ver Acosta 2005; Loponte 2008;
Loponte y Acosta 2008; Prez y Caardo 2002, 2004).

Objetivos
Para este trabajo se analiz la composicin acdica de los extractos lipdicos obtenidos de fragmentos de
cermica procedentes de depsitos arqueolgicos ubicados en el HPI. A partir de los resultados obtenidos, y en
combinacin con informacin arqueolgica, se propone explorar algunos aspectos vinculados con las estrategias
de uso de la alfarera. Este objetivo surge en respuesta a la escasez en el rea de estudio de las conductas
alimenticias y su relacin con la organizacin econmica.

Ambiente y registro arqueolgico
Los anlisis de cidos grasos residuales efectuados para este trabajo corresponden a piezas provenientes de
depsitos ubicados en el rea de Bajos Ribereos (Bonfils 1962) meridionales (o BRM), sector continental del
humedal. El registro arqueolgico de los BRM (< 2 ka
14
C AP) seala la existencia de un sistema bsicamente
cazador-recolector, con un esquema de lugar central o CPF (central place foraging), con alta estabilidad
residencial, rangos de accin terrestres pequeos y probablemente extendidos en algunos casos en el mbito
fluvial, mediana a alta densidad demogrfica y una economa basada en la pesca (aunque con diversos grados de
intensidad) y en los vegetales silvestres, algunos de los cuales pudieron ser parcialmente manipulados.
Asimismo, es posible considerar el desarrollo de conductas de almacenamiento y consumo diferido (Loponte
2008; ver tambin Loponte et al. 2004; Loponte y Acosta 2003). En este marco, es posible sostener que una gran
parte de la alfarera estuvo ntimamente relacionada con la organizacin econmica de los grupos humanos. Esta
asociacin parece haber buscado principalmente el aumento de la eficiencia en la extraccin de nutrientes y en la
tasa de retorno de los alimentos, ampliando la palatabilidad y la variedad de los productos consumidos. De esta
forma, el empleo de la cermica estuvo inmerso en el proceso de intensificacin en la explotacin del espacio.
Este esquema tambin puede ser visto dentro de un proceso creciente de explotacin y consumo nuclear de
algunos recursos, especialmente los peces, roedores y vegetales. A su vez, esto es concurrente con el incremento
en la generacin de subproductos y el significativo aumento en la complejidad tecnolgica y social de los BRM
durante la ltima fase del Holoceno reciente (Loponte 2008; Loponte y Acosta 2008).

Composicin de la muestra
Se analizaron los lpidos en siete tiestos cermicos provenientes de dos depsitos arqueolgicos de los BRM,
ambos en estratigrafa (ver Tabla 1). Los sitios corresponden a la fase final del Holoceno reciente, con una
antigedad inferior a 2 ka
14
C AP.



Tabla 1. Conformacin de la muestra. Antigedad de los depsitos arqueolgicos.

Los fragmentos seleccionados pertenecen a la base de las vasijas o a porciones del cuerpo cercanas a la misma,
ya que se espera que all se encuentre la mayor concentracin de residuos. Asimismo, todos corresponden a
cermica presumiblemente utilitaria, sin decoracin pintada ni incisa, presentando abundante holln en la cara
externa, por lo que es probable que haya sido utilizada para la coccin de alimentos. Se analiz, adems, una
muestra de sedimento de La Bellaca sitio 2 para evaluar la posible interferencia de lpidos del suelo absorbidos
en la cermica.



n SITIO Aos Cal. AP (+/- 2s) LAB. Bibliografa original
4 Tmulo de Campana sitio 2 (TC) 1640 +/- 70 1710 - 1380 Beta 172059 Lafn 1971; Loponte y Acosta 2003
3 La Bellaca sitio 2 (LB2) 680 +/- 80 729 - 528 LP-1263 Acosta y Loponte 2003
Aos
14
C AP (+/- 1s)
TOMO IV - 1494
Gabriela Naranjo, Laura Malec y Maricel Prez
Metodologa
Se utilizaron aproximadamente 2 g de cada muestra, cuya superficie fue raspada previamente para eliminar
cualquier tipo de contaminacin lipdica exgena. Se moli en mortero y los lpidos se extrajeron por sonicacin
utilizando 10 ml de una mezcla de cloroformo - metanol (2:1) (Folch et al. 1957). Los extractos de solventes se
centrifugaron, filtraron y luego se evaporaron bajo corriente de nitrgeno gaseoso. Los steres metlicos de los
cidos grasos (EMAG) se prepararon por transesterificacin directa utilizando cido sulfrico 1% en metanol
(80C, 1 hora) y cloroformo como solvente (Indarti et al. 2005). La mezcla se enfri, se adicionaron 5ml de
solucin de NaCl 5% y los steres metlicos se extrajeron con hexano, el que luego se elimin con corriente de
nitrgeno. Los EMAG se redisolvieron en hexano para su anlisis por cromatografa gas-lquido, utilizando un
cromatgrafo gaseoso Shimadzu 17A (Japn), equipado con inyector split-splitless, detector de ionizacin de
llama y una columna capilar DB-23 ((50%-cianopropil)-metilpolisiloxano), 30m x 0.25mm di x 0.25m espesor
de pelcula (J&W Scientific, USA). Las inyecciones fueron realizadas por triplicado en modo split (relacin
1:10), empleando nitrgeno como gas portador (flujo = 0,5 mL/min.). La temperatura del inyector y detector fue
de 230 C. El anlisis se llev a cabo utilizando el siguiente programa de temperatura: 5 minutos a 140 C y
luego un incremento hasta 190 C a 4 C/min., manteniendo esta temperatura por 13 minutos; posteriormente, a
una velocidad de 50 C/min., la temperatura se llev a 200 C y se mantuvo por 2 minutos.

Resultados y discusin
La Tabla 2 resume los porcentajes de los cidos grasos identificados en cada muestra analizada. En el sedimento
de La Bellaca sitio 2 no se registraron lpidos. Aunque la falta de deteccin no implica necesariamente su
ausencia, esto permite reducir la posibilidad de contaminacin de los tiestos con lpidos procedentes de la matriz
sedimentaria.
Tabla 2. Composicin acdica de las muestras (% cidos grasos).

En primer lugar, es de destacar la presencia de cido linoleico (18:2) en todos los fragmentos cermicos
estudiados. En particular, algunas de las piezas de Tmulo de Campana (TC) muestran contenidos
llamativamente elevados de este compuesto. El mismo, al ser poliinsaturado, resulta altamente susceptible a la
oxidacin, por lo que la proporcin que se detecta en los residuos arqueolgicos es, en realidad, mucho menor
que la contenida en la fuente alimenticia original. En general, existen pocos trabajos que mencionen el registro
de cido linoleico en residuos arqueolgicos (e.g. Buonasera 2007; Reber y Evershed 2004). En aquellos casos,
su presencia fue atribuida al procesamiento y/o consumo de granos, ya que los mismos poseen porcentajes muy
elevados de este cido graso. En los lpidos de algunas especies como maz y algarrobo, el cido linoleico es el
componente mayoritario (Mazzuca y Balzaretti 2003).

Tambin se identificaron cidos grasos saturados como el lurico (12:0), mirstico (14:0), pentadecanoico (15:0),
margrico (17:0) y esterico (18:0); y monoinsaturados como el palmitoleico (16:1) y oleico (18:1).

En la interpretacin de los resultados, y a fin de minimizar errores producidos por procesos oxidativos, existe
consenso sobre la preferencia por analizar relaciones entre cidos grasos antes que valores absolutos. Eerkens
(2005) sugiere que, como no todos los cidos grasos se degradan a la misma velocidad, las relaciones entre
aquellos que lo hacen a velocidades similares pueden ser tiles para identificar diferentes tipos de alimentos. Al
aplicar las proporciones propuestas por este autor a los resultados obtenidos en el presente trabajo para las
muestras de TC, se observa que los valores coinciden con los correspondientes a granos (seeds) y son, adems,
cercanos a los que presentan los mamferos terrestres. Las conclusiones son similares cuando utilizamos las
relaciones entre cidos grasos propuestas por Barnard (2008). En cuanto a los fragmentos de La Bellaca sitio 2, y
de acuerdo a los criterios sugeridos por ambos autores, se observa que los resultados en una de las muestras
(LB2 5) coinciden con los de TC. Sin embargo, en las dos muestras restantes, los lpidos podran corresponder
tanto a granos como as tambin a races, animales terrestres o peces.
TOMO IV - 1495
CAPTULO 30 - MESA DE COMUNICACIONES 1
Debe tenerse en cuenta que los resultados representan generalmente una combinacin de los diferentes alimentos
que fueron contenidos, procesados y/o consumidos en las vasijas cermicas. No obstante, segn los valores de
composicin acdica registrados, el conjunto de las muestras apunta a una predominancia de los granos.

Conclusiones
La interpretacin de los residuos orgnicos slo puede ser completa si los resultados de los anlisis bioqumicos
se combinan con datos arqueolgicos, histricos y etnogrficos (Barnard 2008). La identificacin de los lpidos
en las muestras arqueolgicas es consistente con los recursos explotados por los grupos de cazadores-
recolectores del HPI hacia el final del Holoceno. De acuerdo a los resultados obtenidos para las muestras de TC,
se observa fundamentalmente un aporte de compuestos de origen vegetal. En el caso de LB2, la presencia de
stos es menos preponderante, con mayor mezcla de fuentes alimenticias. Si bien era esperable obtener valores
que indicaran una marcada incidencia de los peces en la dieta (ver Acosta et al. 2009; Loponte 2008; Loponte y
Acosta 2008), hay que sealar que los lpidos de estos taxones son altamente insaturados y se degradan con
rapidez, dificultando a menudo su reconocimiento.

El importante componente vegetal en la dieta parece relacionarse con el consumo de especies silvestres y/o
manipuladas, aunque no se puede descartar el consumo de maz. Es probable que los grupos locales hayan
adoptado estrategias de intensificacin sobre recursos abundantes, predecibles y palatables, que se pueden
obtener en masa y que son susceptibles de ser almacenados, como los peces migratorios y los vegetales. Adems,
estos ltimos constituyen recursos ideales para ser explotados por todas las clases sexo-etarias. Probablemente,
algunos cazadores-recolectores del HPI (BRM inclusive) tuvieron conductas relacionadas con la generacin de
palmares y parches productivos, incluyendo algunos huertos. En este marco, el empleo de la cermica habra
tenido un rol importante en el proceso de intensificacin en la explotacin de recursos, maximizando la
eficiencia en la extraccin de nutrientes (Loponte 2008; ver tambin Loponte et al. 2004; Loponte y Acosta
2008).

Perspectivas futuras
La continuidad de este estudio plantea una agenda de trabajo para poder avanzar en el conocimiento del uso
especfico de la alfarera, apuntando a determinar su importancia como parte de las estrategias econmicas y su
papel en el proceso de complejizacin que se registra hacia el final del Holoceno entre las sociedades del sector
centro-oriental de la Regin Pampeana (ver Loponte 2008; Loponte et al. 2004; Loponte y Acosta 2003, 2004,
2008). En primera instancia, se debera ampliar el tamao de la muestra a fin de generar mayor precisin en los
resultados y aumentar la representatividad de los conjuntos cermicos del rea.

Por otro lado, una cuestin importante para profundizar es la implementacin de estudios actualsticos y anlisis
complementarios. En los casos en que sea factible, el estudio de los granos de almidn en semillas promete
alcanzar una identificacin de los alimentos ms especfica. Por su parte, la experimentacin resulta
imprescindible para conocer y evaluar ciertos aspectos de la composicin y degradacin de los cidos grasos,
tanto modernos como arqueolgicos. En este sentido, se debe contemplar diferentes recursos (vegetales, peces,
ungulados, roedores, etc.), incluyendo su procesamiento, coccin y almacenamiento, de modo que sea posible
comparar los resultados y precisar la identificacin a nivel especfico a la vez que se descartan los problemas de
contaminacin.

Bibliografa
Acosta, A. 2005. Zooarqueologa de Cazadores-Recolectores del Extremo Nororiental de la Provincia de
Buenos Aires (Humedal del Ro Paran Inferior, Regin Pampeana, Argentina). Tesis para optar por el ttulo de
Doctor en Ciencia Naturales. Facultad de Ciencias Naturales y Museo, Universidad Nacional de La Plata.
Indita.
Acosta, A. y D. Loponte. 2003 (1999). Laguna La Bellaca sitio 2. Informe preliminar. Actas XIII Congreso
Nacional de Arqueologa Argentina, Tomo III: 291-299. Crdoba.
Acosta, A., S. Escudero, R. Feuillet Terzaghi, D. Loponte y L. Prez Jimeno. 2009. Conectando registros:
variabilidad arqueolgica en la cuenca del Paran. Maml Mapu: pasado y presente desde la arqueologa
pampeana. Editado por M. Bern, L. Luna, M. Bonomo, C. Montalvo, C. Aranda y M. Carrera Aizpitarte, pp.
241-252. Editorial Libros del Espinillo, Ayacucho, Provincia de Buenos Aires.
Arthur, J. W. 2002. Pottery use-alteration as an indicator of socioeconomic status: an ethnoarchaeological study
of the Gamo of Ethiopia. Journal of Archaeological Method and Theory 9: 331-355.

TOMO IV - 1496
Gabriela Naranjo, Laura Malec y Maricel Prez
Barnard, H. 2008. The use of Eastern Desert ware as suggested by lipid residues in the walls of the vessels.
Eastern Desert ware. Traces of the inhabitants of the Eastern Desert in Egypt and Sudan during the 4th-6th
centuries CE. Tesis dotoral. Faculty of Archaeology, Leiden University.
Bonfils, C. 1962. Los suelos del Delta del Ro Paran. Factores generadores, clasificacin y uso. Revista de
Investigacin Agrcola INTA 16: 257270.
Buonasera, T. 2007. Investigating the presence of ancient absorbed organic residues in groundstone using GC-
MS and other analytical techniques: a residue study of several prehistoric milling tools from central California.
Journal of Archaeological Science 34: 1379-1390.
Charters, S., R. P. Evershed, L. J. Goad, P. W. Binkhorn y V. Denham. 1993. Quantification and distribution of
lipid in archaeological ceramics: implications for sampling potsherds for organic residue analysis and the
classification of vessel use. Archaeometry 35: 211-223.
Copley, M. S., R. Berstan, S. N. Dudd, G. Docherty, A. J. Mukherjee, V. Straker, S. Payne y R. P. Evershed.
2003. Direct chemical evidence for widespread dairying in prehistoric Britain. Proceedings of the National
Academy of Sciences of the United States of America 100 (4): 1524-1529.
Dudd, S. N., R. P. Evershed y A. M. Gibson. 1999. Evidence for varying patterns of explotation of animal
products in different prehistoric traditions based on lipids preserved in surface and absorbed residues. Journal of
Archaeological Science 26: 1473-1482.
Eerkens, J. 2002. The preservation and identification of pion resins by GC-MS in pottery from the Western
Great Basin. Archaeometry 44: 95105.
2005. GC-MS analysis of fatty acid ratios of archaeological potsherds from the Western Great Basin of North
America. Archaeometry 47: 83-102.
Evershed, R.P., V. R. Anderson-Stojanovic y E. R. Gebhard. 2003. New chemical evidence for the use of
combed ware pottery vessels as beehives in ancient Greece. Journal of Archaelogical Science 30: 1-12.
Folch J., M. Lees y G. H. Sloane Stanley. 1957. A simple method for the isolation and purification of total lipids
from animal tissue. Journal of Biological Chemistry 226: 497-509.
Henrickson, E. F. y M. A. McDonald. 1983. Ceramic form and function: An ethnographic search and an
archaeological application. American Anthropologist 85: 630-643.
Indarti E, M.I. Abdul Majid, R. Hashim y A. Chong. 2005. Direct FAME synthesis for rapid total lipid analysis
from fish oil and cod liver oil. Journal of Food Composition and Analysis 18: 161-170.
Lafn, C. R. 1971. Introduccin a la arqueologa del Nordeste argentino. Relaciones de la Sociedad Argentina de
Antropologa 5 (2): 119-152.
Loponte, D. M. 2008. Arqueologa del Humedal del Paran inferior (Bajos Ribereos Meridionales). Editado
por D. Loponte y A. Acosta. Serie Arqueologa de la Cuenca del Plata, Vol. I. 479 pgs. Instituto Nacional de
Antropologa y Pensamiento Latinoamericano, Buenos Aires.
Loponte, D. y A. Acosta. 2003. Arqueologa de cazadores-recolectores del sector centro-oriental de la Regin
Pampeana. RUNA, Archivo para las Ciencias del Hombre 24: 173-212.
2004. Late Holocene hunter-gatherers from the Pampean wetlands, Argentina. Zooarchaeology of South
America. Editado por G. L. Mengoni Goalons. British Archaeological Reports, International Series 1298: 39
57. Oxford.
2008. El registro arqueolgico del tramo final de la cuenca del Plata. Entre la tierra y el agua: Arqueologa de
humedales de Sudamrica. Compilado por D. Loponte y A. Acosta, pp. 125-164. AINA, Editorial Los
Argonautas, Buenos Aires.
Loponte, D., A. Acosta y J. Musali. 2004. Complejidad Social. Cazadores, recolectores y horticultores de la
regin Pampeana. Aproximaciones Contemporneas a la Arqueologa Pampeana. Perspectivas tericas,
metodolgicas, analticas y casos de estudio. Editado por G. Martnez, M. Gutirrez, R. Curtoni, M. Bern y P.
Madrid, pp. 41-61. Facultad de Ciencias Sociales, UNCPBA, Olavarra.
Malainey, M. E., R. Przybylski y B. L. Sherriff. 1999. Identifying the former contents of Late Precontact Period
pottery vessels from Western Canada using gas chromatography. Journal of Archaeological Science 26: 425-
438.
Mazzuca, M. y V. T. Balzaretti. 2003. Fatty acids, sterols and other steroids from seeds of Patagonian Prosopis
species. Journal of the Science of Food and Agriculture 83: 1072-1075.
Morton, J. D. y H. P. Schwarcz. 1988. Stable isotope analysis of food residues from Ontario ceramics.
Proceedings of the 26th International Archaeometry Symposium. Editado por R. Farquarhar, pp. 89-93.
University of Toronto, Canada.
O Brien, M. J., T. D. Holland, R. J. Hoard y G. L. Fox. 1994. Evolutionary implications of design and
performance characteristics of prehistoric pottery. Journal of Archaeological Method and Theory 1: 259-304.

TOMO IV - 1497
CAPTULO 30 - MESA DE COMUNICACIONES 1
Prez, M. y L. Caardo. 2002. Produccin y uso de cermica en el norte de la provincia de Buenos Aires.
Trabajo presentado en el III Congreso de Arqueologa de la Regin Pampeana Argentina. Facultad de Ciencias
Sociales, UNCPBA, Olavarra.
Prez, M. y L. Caardo. 2004. Produccin y uso de cermica en el norte de la provincia de Buenos Aires.
Aproximaciones Contemporneas a la Arqueologa Pampeana. Perspectivas tericas, metodolgicas, analticas
y casos de estudio. Editado por G. Martnez, M. Gutirrez, R. Curtoni, M. Bern y P. Madrid, pp. 335-347.
Facultad de Ciencias Sociales, UNCPBA, Olavarra.
Reber, E. A. y R.P. Evershed
2004. Identification of maize in absorbed organic residues: a cautionary tale. Journal of Archaeological Science
31: 399410.
Rice, P. 1996. Recent ceramic analysis. Function, style and origin. Journal of Archaeological Research 4 (2):
133-161.
TOMO IV - 1498
Gabriela Naranjo, Laura Malec y Maricel Prez
EVIDENCIAS DEL PRIMER ASENTAMIENTO ESPAOL EN LA
CUENCA DEL RO DE LA PLATA (SANCTI SPIRITUS 1527-1529)
PROVINCIA DE SANTA FE
Guillermo Frittegotto
*
, Fabin C. Letieri
**
, Hctor Meletta
***
,
Cecilia Arias
***
y Mara E. Astiz
**


Introduccin
En este trabajo se presentan los resultados parciales alcanzados en la segunda etapa del proyecto de investigacin
vinculados con la localizacin del primer asentamiento espaol en el ro de la Plata, la poblacin y posterior
construccin del Fuerte Sancti Spritus, en la localidad de Puerto Gaboto (Provincia de Santa Fe), durante la cual
se realizaron estudios arqueolgicos y geofsicos (Frittegotto et al. 2009). Dicho proyecto iniciado en el ao
2006 tuvo como objetivo general localizar y recuperar evidencias arqueolgicas relacionadas con el fuerte
fundado por Sebastin Caboto en 1527 en la confluencia de los ros Carcara y Coronda.

En esa primera etapa el rea de estudio se delimit sobre una superficie de 17,5 kilmetros cuadrados,
comprendiendo ambas mrgenes del ro Carcara (Localidad de Puerto Gaboto, margen norte y Distrito de
Timbes, margen sur). Se efectuaron prospecciones areales, recolecciones en superficie y sondeos, todo ello con
el fin de identificar posibles sitios arqueolgicos y analizar su distribucin dentro del paisaje. Como resultado se
localizaron diversos sitios donde se conservan evidencias materiales que pueden ser asociadas tanto a las
poblaciones aborgenes locales como al primer asentamiento espaol en la regin del Plata.

De todos los sitios identificados dentro el rea de estudio, en el sitio Eucaliptus, emplazado en el sector sureste,
se ha recuperado una cantidad considerable de material arqueolgico de procedencia europea, asociado tambin,
a artefactos de manufactura local.

A partir de los resultados obtenidos en la primera etapa de investigacin, en el ao 2008 se inici la segunda
parte, plantendose como objetivo general el anlisis especfico del sitio Eucaliptus localizado en el rea de la
desembocadura del ro Carcara con el ro Coronda a fin de analizar los procesos culturales vinculados con la
presencia espaola de principios del siglo XVI.

En este sitio en particular se intensificaron los trabajos de campo arqueolgicos (dada las altas concentraciones
de material de origen europeo) con el propsito de recuperar la mayor cantidad de materiales arqueolgicos que
permitieran proporcionar informacin relevante sobre este primer asentamiento espaol en la Cuenca del Ro de
La Plata. Por lo tanto, este trabajo se enfoca en describir los indicadores arqueolgicos y geofsicos que dan
sustento a una de las hiptesis planteadas en el proyecto de investigacin, sobre la presencia efectiva de Caboto
en el rea. Dichos hallazgos en el sitio representan el momento inicial del contacto hispano-indgena para el rea
de la Cuenca del Plata, previo a la fundacin de ciudades.

Ubicacin geogrfica del rea de estudio
La localidad de Puerto Gaboto se ubica a los 32 25' S y 60 47' W, en el Departamento San Jernimo de la
provincia de Santa Fe; se halla geogrficamente a orillas del Ro Coronda en su lmite E y sobre la margen N del
ro Carcara por el S, a unos 70 Km. al N de la ciudad de Rosario (ver Figura 1). Desde el punto de vista
ambiental, se encuentra localizada en el sector oriental de la regin de la Pampa Ondulada, que limita con la
llanura aluvial del Paran. El sitio Eucaliptus se encuentra localizado en el sector sur de la planta urbana de
Puerto Gaboto, en el terreno de una vivienda particular dentro de la manzana delimitada por las calles Prez,
Hurtado, Zavala y el talud donde comienza la planicie aluvial del ro Carcara. El contexto geomorfolgico de
este sitio es en el talud de la barranca pampeana, a 3,5 m sobre la parte baja del trasalbardn de la margen Norte
del ro Carcara.


*
Guillermo Frittegotto - Universidad Abierta Interamericana - e-mail: guillefri@yahoo.com.ar
**
Fabian C. Letieri - Museo Histrico Provincial de Rosario e-mail: fabian@letieri.net
***
Hctor Meletta - Museo Histrico Provincial de Rosario UNR e-mail: hectormeletta@hotmail.com
***
Cecilia Arias Museo Histrico Provincial de Rosario UNR e-mail: arias_amc@hotmail.com
**
Mara E. Astiz Museo Histrico Provincial de Rosario e-mail: mariaeugeniastiz@gmail.com
TOMO IV - 1499
CAPTULO 30 - MESA DE COMUNICACIONES 1













Consideraciones generales
Inicialmente, la decisin de realizar sondeos y excavaciones arqueolgicas sistemticas en el sitio Eucaliptus
obedece a tres consideraciones puntuales que provienen de distintas fuentes de informacin:

- Documentacin escrita: las crnicas y archivos documentales expresan, de manera imprecisa, la ubicacin del
fuerte Sancti Spritus y un casero de hasta 20 casas en la margen norte del ro Carcara en las cercanas de su
desembocadura en el Coronda (Astiz et al. 1987).

- Informantes claves: durante el transcurso de la primera etapa de este proyecto se cont con los datos
proporcionados por algunos vecinos de la localidad de Puerto Gaboto, quienes brindaron informacin con
relacin a ciertos hallazgos en la zona cercana y circunscripta al sitio Eucaliptus (fragmentos cermicos de
origen europeo, cuentas de vidrio, entre otros).

- Prospecciones arqueolgicas: Las primeras prospecciones y sondeos exploratorios realizados en este sitio
durante el transcurso de los aos 2006 y 2007 permitieron establecer la presencia de una alta densidad y
variabilidad de objetos arqueolgicos de diferentes materiales y procedencias (local y europeos), que en
principio fueron asignables al perodo colonial temprano.

- Estudios geomorflogicos y fotointerpretacin area: estos hallazgos pudieron ser vinculados con estudios
geomorfologicos y de fotointerpretacin area previos, realizados por el gelogo Martn Iriondo en el ao 1987.
Iriondo establece que dentro de los rasgos geomorfolgicos observados, uno de ellos presenta caractersticas que,
desde una perspectiva arqueolgica, podra revestir cierto inters para su investigacin. Precisamente este rasgo
se localiza dentro del predio donde se ubica el sitio Eucaliptus.
La realizacin de 20 sondeos estuvo dirigida a definir las caractersticas del registro arqueolgico dentro del sitio
Eucaliptus. Esto es, tipo de materiales y su grado de asociacin dentro de la matriz sedimentaria. Tambin, se
especificaron tendencias en la distribucin del registro arqueolgico, se recuperaron nuevas evidencias (de
origen local y europeo) y se identificaron los sectores con mayor densidad de materiales y presencia de artefactos
de origen europeo del siglo XVI.

Los Estudios Geofsicos y su Correlacin con el Registro Arqueolgico del Sitio Eucaliptus
A partir de los datos obtenidos particularmente en el sitio Eucaliptus, los estudios se enfocaron con mayor
especificidad en cuanto a la distribucin espacial de los hallazgos; se realizaron relevamientos topogrficos en
Figura 1: Localizacin geogrfica de Puerto Gaboto (Fuente Atlas IGM)
TOMO IV - 1500
Guillermo Frittegotto, Fabian C. Letieri, Hctor Meletta, Cecilia Arias y Mara E. Astiz
detalle y anlisis geofsicos (a cargo del Equipo de Geofsica Aplicada de la Universidad de Buenos Aires), lo
que implic redefinir e intensificar el mtodo aplicado a los trabajos arqueolgicos de campo.

Se aplicaron diferentes tcnicas de exploracin en el terreno: induccin electromagntica con fuente controlada,
mtodo geoelctrico y georadar, permitiendo detectar anomalas o rasgos no naturales, esto es, la identificacin
de estructuras de adobe en el subsuelo. Como resultado de estos estudios se puede observar en las plantas de
datos un conjunto de rasgos lineales, la mayora de ellos con orientaciones de aproximadamente 45 respecto de
los bordes de ambos sectores, adems de algunas anomalas relativamente pequeas en extensin. Muchos de
estos rasgos son bastante rectos, y forman ngulos de 90 entre s, lo que indica una probabilidad alta de que
tengan origen cultural. Debido a que las seales presentan muy bajos contrastes en la intensidad cuando se vara
la posicin y el tiempo, no es posible establecer interpretaciones certeras de los orgenes de los rasgos
observados, aunque s es posible mencionar que los mismos parecen originarse en pequeas fluctuaciones del
grado de compactacin y/o de la humedad y en pequeos desniveles en el suelo (Osella 2009).

As, mediante la implementacin de estas diferentes tcnicas de estudio del terreno (arqueolgicas, geofsicas y
topogrficas) se obtuvieron datos acerca de las caractersticas distintivas, rasgos superficiales y subterrneos del
sitio.

Teniendo en cuenta los resultados arrojados por los estudios geofsicos, las excavaciones arqueolgicas se
circunscribieron al sector que presenta una mayor densidad de materiales y a la presencia de las anomalas y
rasgos (estructuras) detectados. Dicho sector se localiza en el extremo sureste del sitio con una extensin de 30 x
30 m de lado (900 m), y fue subdividida en dos partes iguales: sector 1 (al norte) y sector 2 (al sur). Dentro de
esta rea se realizaron las prospecciones geofsicas y excavacin de cuadriculas sobre uno de los rasgos
detectados por el georadar en el sector 2 del sitio.

Se excavaron 13 cuadrculas de 1 m de lado; se localizaron dos rasgos de estructuras de tierra cruda con una
orientacin N-S, asociados a material arqueolgico de manufactura local y europea. Estas estructuras se
encuentran entre los 0,50 y 0,90 m de profundidad y estn compuestas por loess de la formacin Tezanos Pinto,
apisonado, el que se diferencia del sedimento que contiene los restos arqueolgicos, conpuesto por material
coluvial. Este tipo de sedimento sera ms apto para construir muros o paredes de tierra apisonada (tapia) por su
mayor plasticidad y capacidad de compactacin (Ramonell com pers. 2009). Entre ambos rasgos se localiz una
capa con carbn de 0,20 m de espesor que contiene restos de cuentas de vidrio fundidas y restos de madera
quemada. Las cuentas de collar de vidrio venecianas que se encontraban depositadas fueron expuestas a
temperaturas muy altas, lo cual ocasion que se fundieran y fusionaran entre si.

De acuerdo al anlisis realizado sobre este contexto arqueolgico en particular, puede establecerse una fuerte
asociacin de los artefactos recuperados con esta capa sedimentaria con carbn ubicada entre dos de los rasgos
de tierra cruda como indicadores que pueden relacionarse con un evento de incendio.

Por otra parte, se excav una trinchera dentro del sector sureste del sitio donde tambin se localizaron estos
mismos rasgos a una profundidad de 0,50 m. El rasgo mas visible se encuentra ubicado entre las cuadrculas J14
y J15, donde se observa la lnea que marca la discordancia entre dos tipos de sedimentos; siendo el de la
estructura ms consolidado. Sobre el nivel del rasgo (a unos 2 m de distancia hacia el E) se localiz y excav un
enterratorio primario extendido con ajuar funerario. Tomando como referencia las caractersticas y los niveles en
donde se hallaron tanto el enterratorio (y elementos asociados) como los rasgos que se relacionan con la
estructura de tierra cruda, se puede decir de manera preliminar que ambos corresponden a eventos diferentes. Si
bien es necesario profundizar los estudios y continuar con las excavaciones, es probable que el enterratorio sea
posterior a la construccin de las estructuras. Asimismo, la disposicin y los elementos asociados al esqueleto se
correlacionan con las costumbres funerarias de los grupos cazadores recolectores que habitaron el rea en
momentos previos, contemporneos y posteriores al primer asentamiento espaol.

Artefactos Recuperados en el Sitio Eucaliptus:
La totalidad de materiales recolectados durante las campaas arqueolgicas realizadas en el sitio Eucaliptus,
durante los aos 2006 a 2009 es de aproximadamente 24.000 objetos. Es importante aclarar que una parte de este
material se encuentra constituido por fragmentos cermicos muy pequeos y situacin similar se presenta con los
objetos de metal, seo, vidrio, ltico y madera.


TOMO IV - 1501
CAPTULO 30 - MESA DE COMUNICACIONES 1
Material cermico:
El material cermico recuperado dentro del rea de estudio presenta una amplia variabilidad de tcnicas
priMaras y secundarias (Schifer y Skibo 1987, 1997) aplicadas sobre los instrumentos cermicos (Braun 1983;
Burton y Simon 1996). Estos atributos diferenciales se refieren a las tcnicas de construccin de los implementos
cermicos, a las caractersticas de la pasta, proceso de coccin, aplicacin de engobes, pinturas, incisiones, entre
otros. En este sentido, es importante volver a destacar que slo en el sitio Eucaliptus se observan caractersticas
distintivas en cuanto a las tcnicas aplicadas con relacin a su procedencia local o europea; los indicadores de
objetos de procedencia europea ms relevantes se encuentran representados por el uso del torno para el levantado
de la pieza, aplicacin de la tcnica de vidriado superficial, composicin de la pasta y el uso de instalaciones
permanentes (hornos) para la coccin de los artefactos (Frittegotto et al. 2007; Senatore 1995).

Material vtreo:
Los fragmentos de vidrio y cuentas de vidrio hallados en el sitio Eucaliptus conforman otro indicador que marca
la presencia europea en el rea. Algunos ejemplares presentan un estado de meteorizacin avanzado por la
incidencia de factores naturales (lluvia, exposicin prolongada a la luz solar, entre otros) que estaran indicando
que dichos materiales no tienen un origen actual relativo. Los vidrios presentan una superficie generalmente
irregular con impurezas dentro de la masa vtrea, que evidencia una tcnica no tan depurada como la utilizada
para la formacin de objetos de vidrios actuales.

Se ha constatado una mayor cantidad y variabilidad morfolgica de cuentas de collar (enteras o fragmentadas)
observndose diferentes modelos: circulares, esfricas, tubulares (transparentes, o de color azul, blanco, rojo o
combinado formando motivos de lneas finas en todo el cuerpo de la cuenta), facetadas y estrelladas. Entre las
ms frecuentes se encuentran las denominadas Nueva Cdiz que fueron una de las cuentas que ingresaron ms
tempranamente en Amrica a principios del siglo XVI y fueron registradas en sitios hispano-indgenas
americanos, junto con las cuentas de tipo Chevron (Deagan 1987).

Material seo:
Se recuperaron numerosos fragmentos seos, astillas y pequeos huesos correspondientes a vrtebras de peces,
huesos largos, vrtebras y mandbulas de mamferos pequeos. Estos ltimos generalmente asociados a lentes de
tierra cocida o carbn; sin embargo, no puede establecerse hasta el momento que dichos fragmentos o piezas se
encuentren asociados a actividades de coccin de alimentos dado el reducido sector que ocupan estas lentes
aisladas de carbn dentro de la matriz sedimentaria.

En esta coleccin se destaca la presencia de 13 dados pequeos de hasta 0,5 cm de largo (origen europeo) y un
pendiente confeccionado con un hueso largo de roedor que presenta un orificio suspensor en uno de sus
extremos, asociado al enterratorio.

Metales y material ltico:
Se han recuperado objetos y fragmentos metlicos identificndose algunos clavos forjados y un dedal. El
material ltico se encuentra escasamente representado, en su mayora se encuentra constituido por cantos rodados
y un fragmento pequeo de una punta de proyectil confeccionada en calcedonia.

Con respecto al objetivo principal de este proyecto vinculado con la localizacin de evidencias arqueolgicas
relacionadas con el primer asentamiento espaol, el sitio Eucaliptus es donde se ha hallado una alta
concentracin de artefactos de origen europeo (aproximadamente ms de 1.200 objetos) no registrados en
ninguno de los restantes sitios dentro del rea en estudio. El sitio presenta la particularidad de tener una cantidad
considerable de material arqueolgico de origen local y en segundo lugar de material arqueolgico de origen
europeo; tambin un tercer aspecto que confluye es la presencia de los rasgos (estructuras) en asociacin con el
registro arqueolgico hallado.

Consideraciones finales
Considerando el contexto histrico del rea bajo estudio y en funcin del objetivo que vincula la bsqueda y
localizacin del emplazamiento del Fuerte Sancti Spritus en 1527, los resultados alcanzados a partir de los
trabajos de campo arqueolgicos y geofsicos evidencian la presencia de la cultura material espaola de
principios del siglo XVI en el sitio Eucaliptus. Por otro lado, se pueden remarcar las siguientes conclusiones:

- Si bien en toda esta superficie delimitada (tanto en el distrito de Timbes como en Puerto Gaboto) se han
identificado numerosos sitios arqueolgicos, en el sitio Eucaliptus se han recuperado, en excavacin y en
TOMO IV - 1502
Guillermo Frittegotto, Fabian C. Letieri, Hctor Meletta, Cecilia Arias y Mara E. Astiz
superficie, materiales arqueolgicos de origen europeo. Los hallazgos se manifiestan con una alta densidad, esto
es, ms de 10 objetos por m.

- Hasta el momento el rea excavada constituye apenas el 1,27% sobre un total de 900 m.que tiene el sector
sureste del sitio Eucaliptus. Es decir, actualmente se ha intensificado las excavaciones sobre una muestra muy
pequea del sitio, lo cual estara indicando un gran potencial con relacin a eventuales hallazgos relacionados
con este primer asentamiento europeo.

- Como resultado de las prospecciones geofsicas y del trazado de las cuadrculas (en concordancia con las
prospecciones), los resultados obtenidos pusieron de manifiesto la evidencia de estructuras de tierra cruda con
una traza geomtrica y lineal relacionadas al asentamiento espaol del siglo XVI. Estas estructuras o rasgos
geofsicos aparecen asociados a un registro arqueolgico cuya variabilidad artefactual se vincula con diversos
tipos de cuentas de vidrio (Chevron, Nueva Cdiz, tubulares, circulares, entre otras); cermica vidriada, maylica
y trece dados confeccionados en hueso.

- En las excavaciones se han registrado numerosos hallazgos de materiales quemados o fundidos. Muchas de las
cuentas recuperadas presentan sus formas alteradas por haber sido expuestas a una fuente de calor intensa y se
han hallado asimismo cuentas pegadas debido al mismo proceso. Casos similares se han presentado con los
fragmentos de cermica vidriada. Estos indicadores son importantes ya que podran estar relacionados con la
destruccin e incendio del poblado y fuerte de Sancti Spritus.

Si bien el rea de excavacin es menor al 2% de la superficie del sitio, la cantidad de materiales hallados es
significativamente elevada. De los 23.850 objetos, 832 son fragmentos de cermica de origen europeo y 350
cuentas de collar (179 enteras y 171 fragmentadas) por lo que se espera que la continuacin de los trabajos de
campo y laboratorio permitan avanzar y profundizar el conocimiento acerca de este primer emplazamiento
europeo en la Cuenca del ro de La Plata: el poblado y fuerte de Sancti Spritus.

Bibliografa
Astiz, M. E. y A.Tom. 1987. Localizacin y Descripcin de Sancti Spiritus. Cuadernos del Instituto Nacional
de Antropologa 12: 203-251.
Braun, D. P. 1983. Pots as tools. Archaeological Hammers and Theories. Editado por Bay James A. Moore and
Arthur S. Keene, pp. 107-134. Academic Press, New York
Burton J. H. y A. W. Simon. 1996. A pot is not a rock: a reply to Neff, Glascock, Bishop and Blackman.
American Antiquity 61 (2): 405-413.
Deagan K 1987. Artefacts of the Spanish colonies of Florida and Caribbean, 1500-1800. Vol. 1. Smithsonian
Institution Press, Washington D.C.
Frittegotto, G., G. Cocco, F. C. Letieri, M. A. Astiz, C. Ramonell y M. Prez. 2007. Investigacin cientfica en el
sitio histrico de Puerto Gaboto. Proyecto de Arqueologa: Localizacin del primer asentamiento espaol en el
Ro de La Plata, localidad de Puerto Gaboto, Provincia de Santa Fe. Informe Final (Primera Etapa). En archivo:
Consejo Federal de Inversiones, Buenos Aires. Manuscrito
Frittegotto, G., G. Cocco, F. C. Letieri, M. Prez y M. E. Astiz. 2009. Investigacin cientfica en el sitio histrico
de Puerto Gaboto. Proyecto de Arqueologa: localizacin del primer asentamiento espaol en el Ro de La Plata,
localidad de Puerto Gaboto, Provincia de Santa Fe. Informe Final (Segunda Etapa). En archivo: Consejo Federal
de Inversiones, Buenos Aires. Manuscrito
Osella, A. 2009. Prospeccin geofsica en Puerto Gaboto. Informe. Proyecto de Arqueologa: Localizacin del
primer asentamiento espaol en el Ro de La Plata, localidad de Puerto Gaboto, Provincia de Santa Fe (Segunda
Etapa). Consejo Federal de Inversiones, Buenos Aires. Manuscrito
Schiffer, M. B. y J. M. Skibo 1987. Theory and experiment in the study of technological change. Current
Anthropology 28: 595-622.
1997. The explanation of artifact variability. American Antiquity 62 (1): 27-50.
Senatore, M. X. 1995. Tecnologas Nativas y Estrategias de Ocupacin Espaola en la Regin del Ro de La
Plata. Historical Archaeology in Latin America 11. Editado por Stanley South, pp. 40-48. University of South
Carolina. Columbia S.C.
TOMO IV - 1503
CAPTULO 30 - MESA DE COMUNICACIONES 1
PRIMERAS APROXIMACIONES AL ESTUDIO DEL REGISTRO
ARQUEOLGICO DE LA PRIMERA OCUPACIN ESPAOLA EN
LA DESEMBOCADURA DEL RO CARCARA
(FUERTE SANCTI SPRITUS 1527-1529)
Gabriel Cocco
*
, Cecilia Arias**, Emmanuel Vargas** y Cecilia Rey
**


Introduccin
En este trabajo se analiza la distribucin del registro arqueolgico de la ocupacin Espaola en el rea de la
desembocadura del ro Carcara en el Coronda producido a principios del siglo XVI con el asentamiento
instalado por Sebastin Caboto en 1527, el cual fue destruido e incendiado en 1529.

El Fuerte Sancti Spritus fue el primer asiento espaol en la Cuenca del Ro de la Plata y representa un punto
clave en el estudio del proceso de conquista y colonizacin espaola en Sudamrica en un territorio que hasta el
momento se hallaba ocupado por sociedades cazadoras recolectoras y horticultoras.

Este estudio se basa los trabajos realizados a partir del Proyecto de investigacin arqueolgica: Localizacin del
primer asentamiento espaol en el ro de la Plata, localidad de Puerto Gaboto, impulsado por el Ministerio de
Innovacin y Cultura de la Provincia de Santa Fe y financiado por el Consejo Federal de Inversiones (Frittegotto
et al. 2009). Como resultado se localizaron sitios arqueolgicos indgenas en ambas mrgenes del ro Carcara
y evidencias de la presencia espaola en el sector sureste de la localidad de Puerto Gaboto. Las mismas proceden
del sitio Eucaliptus, donde se realizaron excavaciones arqueolgicas que posibilitaron recuperar material de
origen europeo asociado a artefactos de manufactura local que fueron relacionados con el asentamiento espaol
de Sebastin Caboto establecido en el lugar a principios del siglo XVI.

Tomando como base estos trabajos, se presentan las primeras aproximaciones al estudio del registro
arqueolgico de la primera ocupacin espaola en la desembocadura del ro Carcara con el fin de identificar
los procesos de formacin cultural y natural que actuaron a nivel regional, local y en el sitio Eucaliptus.

El registro arqueolgico en el rea de desembocadura del ro Caracara
En un rea de 17,5 kilmetros cuadrados se realizaron prospecciones areales, recolecciones de superficie y
sondeos con el fin de identificar sitios arqueolgicos y analizar su distribucin dentro del paisaje. Como
resultado de estas actividades se localizaron diversos sitios arqueolgicos donde se conservan evidencias
materiales que pueden ser asociadas a las poblaciones aborgenes locales como al primer asentamiento espaol
en la cuenca del Ro de La Plata. Paralelamente se realizaron estudios geolgicos y geomorfolgicos focalizados
en relacionar el registro arqueolgico con la dinmica del paisaje, esto es: sus transformaciones con relacin a
los sistemas hdricos del ro Carcara (cuenca inferior) y el ro Coronda en los ltimos 500 aos (Frittegotto et
al. 2007).

De acuerdo a los estudios realizados por el gelogo Carlos Ramonell (Frittegotto et al. 2007), se pueden
reconocer en el rea estudiada tres unidades geomorfolgicas: a) Planicie Pampeana: en esta unidad las
geoformas dominantes en el rea de estudio son los paleovalles fluviales (y paleointerfluvios) de escaso relieve
relativo y poco desarrollo areal (cuencas de orden menor). Estos valles fueron modelados antes de la
sedimentacin de los limos elicos de la Fm. Tezanos Pinto, que los cubre y enmascara. Sobre Tezanos Pinto se
ubica un paleosuelo parcialmente erosionado sobre el que se depositaron los limos grises de la Fm. San
Guillermo con edades asignables al Holoceno Superior. En cuanto a los procesos naturales que actan en la
transformacin del registro arqueolgico, se observan algunas manifestaciones aisladas de erosin hdrica (por
lavaje pluvial), y la pedognesis es el principal proceso natural de transformacin de su superficie. El contacto
entre la Planicie Pampeana con las unidades geomorfolgicas de gnesis fluvial se da mediante tres tipos de
taludes: a) barrancas erosivas activas modeladas por los cauces del Coronda y del Carcara; b) taludes de fuerte
pendiente sujetos a erosin hdrica por lavaje pluvial superficial o subterrneo; y c) taludes de entre 2 y 10, en
los que se registr reptacin ladera abajo del coluvio/suelo. Estos taludes corresponden a los laterales del valle
del ro Carcara, donde la Planicie Pampeana se conecta con la planicie de inundacin de la Faja Aluvial. b)

*
Departamento de Estudios Etnogrficos y Coloniales, Ministerio de Innovacin y Cultura, Pcia. de Santa Fe.
**
Facultad de Humanidades y Artes, UNR Museo Histrico Provincial Julio Marc, Pcia de Santa Fe.
TOMO IV - 1505
CAPTULO 30 - MESA DE COMUNICACIONES 1
Sistema Aluvial del ro Paran: se identificaron complejos de barras de punta formados por el ro Coronda. Sobre
margen izquierda, frente a la desembocadura del Carcara, el ro Coronda ha construido un nico albardn
lateral, que actualmente est siendo erosionado tambin. El resto de la superficie correspondiente a esta unidad
geomorfolgica fue originada por la dinmica de migracin lateral de tales cursos, como Las Caitas, Paranacito
y Fray Fausto, principalmente. c) Faja Aluvial del ro Carcara: la geoforma ms extendida es la de su planicie
de inundacin, en cuya superficie se reconocen unos pocos albardones bien desarrollados. La estratigrafa de la
unidad, el mecanismo dominante de formacin de la planicie es la acrecin vertical de sedimentos durante las
inundaciones fluviales, sean estas propias del ro o inducidas por el remanso que impone el sistema del Paran
sobre el efecto de remanso.

El registro arqueolgico en la regin se encuentra contenido dentro de las unidades correspondientes a la Fm.
San Guillermo, el Aluvio del Sistema del ro Paran y el Aluvio Reciente a Precolombino del ro Carcara. Las
cuales seran unidades estratigrficas sincrnicas en parte, al menos hasta los ca. 1000 aos A.P., cuando habra
cesado la depositacin de los limos elicos de la primera de ellas. Las principales transformaciones del paisaje y
de los sistemas hdricos de los ros Coronda y Carcara en los ltimos 500 aos, de acuerdo a los estudios
geolgicos realizados no han experimentado cambios significativos. Se puede establecer que la estructura bsica
del paisaje actual fue la prcticamente la misma al momento de la llegada de los espaoles. Las transformaciones
ms evidentes en la planicie ocurrieron en las zonas de contacto con los cauces del ro Carcara y el ro
Coronda por el modelado erosivo lateral, por erosin hdrica (lavaje pluvial) o reptacin de suelo observado en
los taludes pampeanos menos abruptos.

La Distribucin del Registro Arqueolgico en el rea de Estudio:
A partir de los estudios arqueolgicos y geolgicos realizados se delimitaron tres zonas teniendo en cuenta los
siguientes criterios: 1) zonas de alta densidad de materiales: ms de 10 tems por metro cuadrado; 2) zonas de
media densidad de materiales: entre 5 y 1 tem por metros cuadrado; y 3) zonas de baja densidad: 1 tem por
metro cuadrado. En cuanto a su localizacin dentro del paisaje las reas de alta densidad se encuentran en
relacin al ro Carcara, algunas dentro de la Faja aluvial del ro, otras sobre la planicie pampeana o abarcando
reas de contacto entre estas dos unidades. Asimismo, puede observarse que se localizan en las cercanas de la
desembocadura del ro Carcara en el Coronda. Otro aspecto a destacar es que los mayores procesos de
trasformacin cultural se han producido en las zonas ubicadas sobre la margen izquierda del ro Carcara que
abarca el rea donde actualmente se encuentra el ejido urbano de Puerto Gaboto. Mientras que sobre la margen
derecha la accin de los procesos antrpicos fue menor, ya que son reas rurales con vegetacin autctona
dedicadas al pastoreo de animales (Frittegotto et al. 2007).

El registro arqueolgico del sitio Eucaliptus (fuerte Sancti Spritus)

El sitio se localiza en el sector sur de la localidad de Puerto Gaboto, en el fondo del terreno de una vivienda
particular, propiedad de Rogelia Durn. El mismo se ubica en la manzana delimitada por la calle Prez, Hurtado,
Zavala y el talud donde comienza la planicie aluvial del ro Carcara. El rea estudiada abarca una superficie de
2.255 metros cuadrados dentro de la cual se realizaron sondeos, prospecciones geofsicas y excavaciones
sistemticas por medio de cuadrculas y trincheras (ver figura 1).

El contexto geomorfolgico de este sitio es en el talud de la barranca pampeana, a 3,5 m sobre la parte baja del
tras-albardn de la margen Norte del ro Carcara. Por el sur el sitio est limitado por una plataforma de erosin
producida por los procesos hdricos del ro Coronda. De acuerdo a los relevamientos topogrficos realizados, se
puede observar que la superficie del sitio tiene un declive hacia el Sur en la misma direccin del talud con una
diferencia de 1 metro entre el sector ms alto y el ms bajo. La estratigrafa del sitio se compone de una capa de
origen coluvial, de textura limosa y coloracin pardo oscura (esta tonalidad se asocia a procesos edficos
actuales que operan en el manto coluvial) donde se encuentran depositados los materiales arqueolgicos. En el
sector sureste del sitio esta capa llega a tener un espesor de 1,20 m, apoyndose sobre el techo de la formacin
Tezanos Pinto conformada por limos de origen elico de color pardo anaranjado.

TOMO IV - 1506
Gabriel Cocco, Cecilia Arias, Emmanuel Vargas y Cecilia Rey

Figura 1: Localizacin del Sitio Eucaliptus y rea estudiada.

La Distribucin Espacial del Registro Arqueolgico en el Sitio
Previo a la realizacin de excavaciones, se realizaron nuevos sondeos exploratorios, relevamientos topogrficos
de detalle y prospecciones geofsicas. Mediante la utilizacin de diferentes tcnicas de exploracin del terreno y
del subsuelo se detectaron diferentes tipos de rasgos y se determinaron los lmites del sitio para poder definir
luego los sectores a excavar. De acuerdo a esto, se realizaron: Planimetras del sitio y reas aledaas localizando
los rasgos principales del terreno y la topografa; paralelamente se realizaron sondeos para determinar los lmites
del sitio y las reas con diferente concentracin de material; posteriormente se llevaron a cabo prospecciones
geofsicas con el objetivo de detectar en el subsuelo la presencia de estructuras arqueolgicas y concentraciones
de materiales que puedan haberse conservado del asentamiento espaol. Si bien las unidades de extraccin
fueron establecidas al azar, la mayor recurrencia de hallazgos se observan en el sector sureste del sitio (ver figura
2). Posteriormente esta tendencia fue reafirmada a partir de la realizacin de las prospecciones geofsicas y las
excavaciones arqueolgicas.



Figura 2: localizacin de las excavaciones en el sitio Eucaliptus
TOMO IV - 1507
CAPTULO 30 - MESA DE COMUNICACIONES 1
Anlisis de la Distribucin del Registro Arqueolgico en el Sector Sureste del Sitio
Con el fin de realizar una primera aproximacin al contexto de asociacin de los artefactos recuperados en el
sitio, se analizan en este trabajo las distribuciones del material arqueolgico en relacin a la matriz sedimentaria
y estructuras de tierra cruda en el sector sureste del sitio con el fin de identificar patrones de depositacin
producidos por procesos culturales y naturales. En este lugar, las cuadrculas fueron planteadas en base a los
resultados de las prospecciones geofsicas. Se excavaron 13 unidades (totalizando 25 metros cuadrados) en el
lugar donde se localiz un rasgo lineal que conforma una superficie de forma rectangular con una orientacin
Norte-Sur. Las excavaciones se realizaron en cuadrculas de 1 metro de lado por niveles artificiales de 5
centmetros, registrando tridimensionalmente los tems arqueolgicos recuperados y cerniendo el sedimento
extrado en zaranda de malla fina. Dentro de las cuadrculas se localizaron dos estructuras de tierra cruda que
tienen una orientacin Norte-Sur (ver figura 3) y que se encuentran asociadas a material arqueolgico de
manufactura local y europea. Dichas estructuras se localizan entre los 50 y 90 centmetros de profundidad y
estn compuestas por loess de la formacin Tezanos Pinto, apisonado. Se diferencia del sedimento que contiene
los restos arqueolgicos, el cual est compuesto por material coluvial.

Los materiales asociados presentan una variabilidad artefactual que se vincula a la ocupacin espaola y a las
poblaciones indgenas locales: Est compuesta por 336 cuentas de collar enteras, fragmentadas y unidas entre s
de diversos tipos (Chevron, Nueva Cdiz, tubulares, circulares, entre otras); 345 fragmentos de cermica europea
(vidriada, no vidriada y maylica), 12 dados confeccionados en hueso, 8.726 fragmentos de cermica de
manufactura local lisa, incisa y pintada.

Considerando la ubicacin de las estructuras de tierra cruda tal como se muestra en la figura 3, se puede decir
que existe un agrupamiento de la cermica europea en las cuadrculas A6, A7 y B7, las cuales se localizan entre
los rasgos detectados y donde se recuperaron materiales hasta los niveles ms profundos. Con relacin a esto, en
el nivel XII se observa una abrupta desaparicin del material cermico en las cuadrculas ubicadas al Oeste del
rasgo 1, coincidiendo con un aumento en la consistencia del sedimento y el nivel donde comienzan a aparecer los
muros.

Figura 3: plano de las cuadrculas excavadas y estructuras de tierra cruda localizadas

Como puede observarse en las figura 4, la cermica local y europea se distribuye diferencialmente dentro el rea
excavada. Por una parte, la cermica local es mucho ms abundante que la europea y se distribuye ms
uniformemente en las cuadrculas presentando los mayores ndices en las cuadrculas A6, B7 y B11, pero
concentrndose la mayor cantidad de tiestos en los niveles superiores y decayendo su presencia paulatinamente
hacia los niveles inferiores. Por otra parte, la cermica europea aparece mayormente agrupada en las cuadrculas
A6, A7 y B7. La presencia de este tipo de tem en el perfil de las excavaciones muestra un pico mximo en los
niveles III y IV, decayendo hasta casi desaparecer en el nivel X, y aumentando nuevamente en los niveles
inferiores cercanos a los 0,90 metros de profundidad.

TOMO IV - 1508
Gabriel Cocco, Cecilia Arias, Emmanuel Vargas y Cecilia Rey


Figura 4: Grficos de distribucin de cermica local y europea por cuadrculas y por niveles excavados

Un agrupamiento similar al descripto anteriormente se observa para la cuentas de collar, donde la mayor
densidad de hallazgos se sita en las cuadrculas A6 y B7. Por otra parte, de las 336 cuentas recuperadas en las
excavaciones de estas 13 cuadrculas, un 53% presenta la caracterstica de haber estado expuesta a altas
temperaturas. Esto se evidencia en fragmentos de vidrio derretido que mantiene el color de las cuentas (por
ejemplo en las Chevron y Nueva Cadiz) y cuentas pegadas entre s formando bloques. Acerca de este ltimo caso
se destaca un bloque o bochn recuperado en el nivel XIX de la cuadrcula B7 compuesto por ms de 50 cuentas
de diferentes capas de colores (tipo Chevron) unidas entre s formando una sola pieza.

La presencia de artefactos expuestos a altas temperaturas tambin fue observada en la cermica vidriada y otros
artefactos de vidrio -an no determinados- (ver figura 5). En el caso del rea de excavacin analizada, los
materiales con estas caractersticas se encuentran depositados en una capa de 20 cm de espesor que contiene
carbn en los niveles XVI y XIX de las cuadrculas A6, A7 y B7. En estas mismas unidades se hallaron 13
dados confeccionados en hueso de 0,5 cm de lado aproximadamente. El hallazgo de estos dados junto con las
concentraciones de cuentas y cermica europea en este subsector del sitio localizado dentro de dos estructuras de
tierra cruda contrasta con las distribuciones observadas para el resto de las cuadrculas analizadas.



Figura 5: distribucin diferencial de cuentas en las cuadrculas

Otro aspecto a analizar, son los procesos posdepositacionales de perturbacin del sitio y las ocupaciones
posteriores. En el sitio se han detectado procesos antrpicos de transformacin en el sitio producto de la
actividad humana actual tales como la construccin de viviendas, pozos de basura, cultivo de hortalizas y
TOMO IV - 1509
CAPTULO 30 - MESA DE COMUNICACIONES 1
forestacin. Dentro del rea estudiada, estos procesos solo han afectado la superficie del sitio y sectores
puntuales del mismo, como en el caso de los pozos de basura (uno de ellos afecta los primeros niveles de la
cuadrcula B7) y la presencia de los rboles con el subsecuente proceso de floraturbacin.

Consideraciones finales
Si bien los objetivos planteados al principio exceden la extensin de este trabajo, a partir del estudio del contexto
ambiental y del sitio Eucaliptus se pueden hacer algunas consideraciones en cuanto a los patrones de
depositacin y los procesos culturales y naturales que los originaron. En un contexto regional, el registro
arqueolgico de este sitio es diferente a los otros sitios detectados y asignados a ocupaciones indgenas de
cazadores recolectores. Esta diferencia, se puede observar no solo en las caractersticas de los materiales
recuperados (la cultura material europea), sino tambin en la presencia de estructuras de tapia con formas
lineales que nunca haban sido observadas en esta regin para otro tipo de sitio. Por otra parte, en trabajos
anteriores (Cocco y Letieri 2010) se sostuvo la hiptesis de que este sitio es producto de la ocupacin espaola
de Sebastin Caboto, la cual se refuerza a partir de anlisis de un conjunto de evidencias materiales que apoyan
esta afirmacin: la identificacin de los materiales europeos como contemporneos a otros sitios hispanos de la
gran Cuenca del Caribe (Deagan 2002) y la presencia de estructuras de tapia asociadas a estos materiales.
Asimismo, una primera evaluacin de los conjuntos de artefactos recuperados en las cuadrculas A6, A7 y B7 en
relacin a estas estructuras permite afirmar que habra sido producida por procesos culturales de depositacin
relacionados a la presencia de un asentamiento permanente. Otro aspecto que est siendo analizado es la
presencia de materiales europeos con evidencias de haber estado sometidos a altas temperaturas, los cuales se
concentran tambin en las cuadrculas localizadas entre las estructuras de tapia. Estos materiales podran ser
relacionados con el incendio del fuerte Sancti Spritus en 1529, pero si bien existen evidencias que apoyan esta
afirmacin, an es necesario realizar anlisis ms precisos y extender el rea de las excavaciones.

Bibliografa
Deagan, K. 2002. Artifacts of the Spanish Colonies of Florida and the Caribbean 1500-1800. Volumen 1 y 2.
Smithsonian Institution Press, Washington and London.
Frittegotto, G., F. Letieri, G. Cocco., M. A. Astiz, C. Ramonell, M. Perez. 2007. Proyecto: Localizacin del
primer asentamiento espaol en el Ro de La Plata, localidad de Puerto Gaboto, Pcia de Santa Fe. Informe Final.
En archivo: Consejo Federal de Inversiones. Exp. N77960001. Buenos Aires. Manuscrito
Frittegotto, G., G. Cocco, F. C. Letieri 2009. Proyecto: Localizacin del primer asentamiento espaol en el Ro
de La Plata, localidad de Puerto Gaboto, Pcia de Santa Fe. Informe Final (Segunda Etapa). En archivo: Consejo
Federal de Inversiones. Exp. N98590001. Buenos Aires. Manuscrito
Cocco, G. y F. Letieri. 2010. Proyecto: localizacin del primer asentamiento espaol en la Cuenca del Ro de la
Plata - Fuerte Sancti Spitirus 1527-1529 localidad de Puerto Gaboto. Maml mapu: pasado y presente desde la
Arqueologa pampeana. Editado por M. Bern, L. Luna, M. Bonomo, C. Montalvo, C. Aranda y M. Carrera
Aizpitarte, pp. 215-226. Editorial Libros del Espinillo, Ayacucho, Pcia. de Buenos Aires.

TOMO IV - 1510
Gabriel Cocco, Cecilia Arias, Emmanuel Vargas y Cecilia Rey
LAS GUARANES, LOS JESUITAS Y EL COTI GUAZ DE LA
REDUCCIN DE SANTA ANA: NUEVOS ABORDAJES SOBRE
LA CONQUISTA EN EL NORESTE ARGENTINO
Mara Victoria Roca
*


Introduccin
Este trabajo tiene como fin presentar un anlisis del coti guaz de Santa Ana (Misiones), un espacio femenino
presente en algunas de las 30 reducciones jesutico-guaranes que fundaron los religiosos de la Compaa de
Jess en las zonas aledaas a los ros Paran y Uruguay, desde comienzos del siglo XVII hasta su extraamiento
en 1767. Parte de la investigacin que aqu se incluye se encuentra desarrollada en mi tesina de Licenciatura
1
. Al
mismo tiempo, esta presentacin propone repensar los contenidos mismos de la arqueologa del NEA, una
arqueologa que ha girado principalmente en torno a cazadores recolectores, dejando el campo de las misiones,
por diferentes razones, para otras disciplinas.

Realizamos esta investigacin desde la Arqueologa Histrica, teniendo en cuenta su carcter multidisciplinario
y la inclusin de diferente tipo de fuentes de informacin (Orser 2000), caractersticas que potencian su poder
interpretativo. Acordamos con Quiroga cuando sostiene que si la arqueologa se hace a un lado cuando se cuenta
con documentos escritos, como pretenden algunos autores, esto implica la profundizacin de la separacin pre-
historia/historia. Creemos que esto muchas veces ha derivado en prejuicios propios del Evolucionismo Clsico,
en el establecimiento de fronteras en el campo del conocimiento y en la inhibicin y circunscripcin de la
prctica arqueolgica misma, que por mucho tiempo cedi los estudios sobre reducciones jesuitas a la Historia y
la Arquitectura, por ejemplo. Afirmamos con la autora que es posible y hasta necesario realizar estudios incluso
si existen documentos (Quiroga 2005: 91). Por su parte, Rocchietti propone hablar de sitios con documentacin
histrica asociada, cuya naturaleza dialctica se expresa en ...un circuito de confrontacin y convalidacin entre
los materiales de una formacin arqueolgica y lo que dicen los documentos. (1998: 142).

Diferentes miradas para un mismo espacio
Especficamente, durante el estudio realizado por nosotros se utilizaron fuentes priMaras
2
, fuentes secundarias
3

e informacin pictrica
4
, buenas herramientas en medio de la caracterstica subrepresentacin del coti guaz y
las guaranes. Segn los autores trabajados, el coti guaz sera una estructura que poda o no estar presente en
una reduccin; sus opciones de ubicacin eran: en el costado de la plaza que constitua el ncleo principal, del
lado del cementerio, separado del mismo; o en un extremo del casco urbano, alejada de los edificios principales.
En cuanto a su arquitectura, cabe esperar que se comporte como el resto de los edificios: una serie de
habitaciones contiguas de sillares y adobe, rodeadas por galeras internas y externas, y con un patio interior.
Quienes ingresaban all eran mujeres que respondan a los adjetivos de solas (viudas, casadas cuyos maridos
estaban ausentes, hurfanas, solteras, sin familia) o castigadas (adlteras, quienes cometieron algn delito).
Tambin estaran las ancianas y enfermas. Estas mujeres estaban vigiladas por una mujer mayor y la/s puerta/s
del coti guaz debera/n estar cerrada/s. Sus vidas giraban en torno a las actividades textiles. Aparentemente, al
menos algunas de ellas, estaban autorizadas a salir, para ocuparse del arreglo floral de la iglesia y el cementerio,
adems de lavar ropa y juntar agua. Su sustento corra por cuenta de la comunidad.

Con respecto a la informacin pictrica trabajada, se ordenaron aquellos mapas en donde figura el coti guaz,
utilizando una periodizacin segn la fecha de confeccin: a) poca Jesuita; b) poca post-Jesuita; y c) Actuales.

Analizamos tambin las expresiones contenidas en los distintos tipos de fuentes consultadas. Algunas de ellas
son: en las fuentes secundarias Cotiguaz o Cotyguaz (casa grande o albergue grande), Tupancir (casa de la
madre de Dios), Casa de Recogidas, Casa de la Virgen, Casa de correccin. En los planos: poca Jesuita:

*
Facultad de Humanidades y Artes, UNR/ vicroca@hotmail.com.
1
El trabajo de campo contenido en ella se llev adelante en el marco del Proyecto Arqueologa de Santa Ana (Misiones) y del Convenio de
Colaboracin Metodolgica entre la UNR y la UNaM.
2
Perams (1946), Cardiel, Muriel, Snchez Labrador y rdenes del Provincial de 1714. Por falta de disponibilidad de las fuentes se decidi
recurrir a Furlong (1962), quien cita los extractos enteros de las obras de dichos autores cuando refieren al coti.
3
Bruxel (1996), Busaniche (1955), Fernndez Ramos (1929), Furlong (1962), Glvez (1995), Hernndez (2000), Kellog (2005), Lugones
(1945), Martnez Valebona (2008), Pla (2008), Susnik (1984).
4
Mapas de diferentes pocas incluidos en Gutirrez y Maeder (1994).
TOMO IV - 1511
CAPTULO 30 - MESA DE COMUNICACIONES 1
Casa de las Recogidas, Domus Viduarum
5
. poca post-Jesuita: Casa de Misericordia, Casa de Posada,
Casa para Hurfanos de Ambos Sexos, Establecimiento para Hurfanos, Edificio para Viudas y
Hurfanas, Casa de Hurfanos, Casa de Hurfanos e Impedidos y Asilo-Hospital. Actuales: coti guaz

Para el desarrollo de la investigacin se trabaj con la siguiente hiptesis: La existencia del coti guaz de Santa
Ana, sus caractersticas fsicas y su relacin con los otros espacios de esta reduccin, estara descubriendo el lado
femenino del sistema de dominacin y conquista hacia los Guaranes, llevado adelante por los Jesuitas. As, el
informe de campo, producto de las pioneras excavaciones de los aos 2003 y 2006
6
, fue analizado a la luz de
dicha hiptesis.

Finalmente, nuestra ltima herramienta para el abordaje del coti guaz provino de una exploracin del universo
femenino en las reducciones, en donde estudiamos la relacin de los jesuitas con las mujeres entendidas como
objeto sagrado, fuente de pecado- y a las mujeres indgenas viviendo en contexto reduccional donde domina la
idea de separacin de esferas masculina y femenina as como la lucha contra la poligamia-.
7
























Figura 1: Croquis de Santa Ana donde se seala al
coti guaz. Fuente: www.misiones.gov.ar


Repensando el coti guaz de la reduccin de Santa Ana
A partir del anlisis de fuentes priMaras, secundarias, informacin pictrica, consideraciones respecto del
universo femenino en las reducciones e intervenciones arqueolgicas, que permiti conocer las nociones acerca
de las mujeres viviendo en las reducciones administradas por Jesuitas, abordaremos, a continuacin, las
relaciones espaciales que establece el coti guaz con algunas de las estructuras del espacio urbano de Santa Ana.
(Figura 1) El coti guaz de esta reduccin es una estructura situada al oeste del ncleo principal de esta
reduccin; al igual que sus edificios ms importantes, su posicin es elevada con respecto a la plaza. Esta
elevacin estara indicando, como sostiene Poujade (2000), mayor jerarqua de esta construccin con respecto al

5
Esta expresin corresponde a un plano contenido en una obra del Padre Perams del ao 1793. No obstante, hemos decidido incluirla en la
poca Jesuita por estar incluida en una publicacin muy cercana a la poca de expulsin y por ser su autor un Jesuita que vivi en las
reducciones.
6
Sus resultados, junto con la descripcin de los recintos y materiales hallados, han sido presentados en diferentes instancias, razn por la
cual no me detendr en este punto. Ver, por ejemplo, Poujade et al. (2008, 2006), Poujade, Autral y Rocchietti (2009), entre otros.
7
En Roca (2008) se presenta un detalle de dicha exploracin.
TOMO IV - 1512
Mara Victoria Roca
resto de los edificios que rodean la plaza de esta misin pero menor con respecto al templo y colegio. Tiene una
gran abertura (entrada) hacia la plaza, interdigitada por dos puertas con cerrojos; en su interior hay un gran patio.
Por otra parte, los resultados de las intervenciones tambin permitieron establecer la existencia de dos puertas
correspondientes a dos recintos del frente, las cuales estaran habilitando un canal de comunicacin hacia la
plaza, aparte de la abertura recientemente sealada. Esta situacin sorprende si pensamos en que, segn las
instrucciones, el coti debera encerrar y que en ninguna de las fuentes consultadas se mencionan estas puertas,
sino que tendra que haber slo una entrada principal, verificada en las excavaciones. Sern estas puertas
propias del perodo Jesutico? Posee hoy en sus lados N, S y E cuatro recintos, y seis en el W. De acuerdo con
las intervenciones realizadas, algunos recintos estaran comunicados; no obstante, no sera posible dar una vuelta
completa al coti guaz por el interior de estos recintos. Qu tipo de comunicacin sera la permitida? Y nos
volvemos a preguntar: Sern estas aberturas producto de la obra ignaciana? No tenemos noticia de la existencia
de ventanas que habilitaran algn tipo de comunicacin (visual, sonora) con el exterior (las fuentes no las
mencionan y los restos materiales no las muestran, ya que de haber habido, sus restos desaparecieron con la
cada del techo y la desintegracin del adobe). Podemos sugerir la existencia de ventanas hacia el interior, es
decir, hacia el patio, de la misma manera que, segn fuentes, ocurra con el colegio, otorgando al coti un silencio
y aislamiento mayores con el exterior. En caso de ser as, y siguiendo a Kern (1997), las habitaciones del coti
guaz se estaran conformando como lugares cerrados, solitarios, en donde sus moradoras podran realizar sus
actividades (hilanza, quiz rezos).

Hasta el momento, la nica comunicacin directa entre el patio del coti guaz y la plaza est dada por una
entrada con doble puerta y con, aparentemente, dos personas a cargo de las mismas segn las fuentes. Estaran
continuamente cerradas? Habra habido, entonces, una portera -seora mayor- de total confianza de los
ignacianos y estricta conducta moral (femenina, adentro) y un portero (masculino, afuera) para asegurar el
control sobre estas mujeres. Esta situacin nos hace pensar en la posibilidad de fugas por parte de ellas y en
intentos de entrada por parte de otros habitantes de la misin, ambas situaciones no aceptadas bajo el orden
Jesuita. Plaza y coti guaz, entonces, son espacios cercanos -el primero un abierto, el segundo un cerrado-, con
acceso directo (gran entrada). Si la plaza era el centro de vida social y reunin de los pobladores de Santa Ana, el
coti guaz viene a oponrsele, al ser ste un lugar que, bsicamente, excluye, separa y segrega determinado tipo
de mujeres Guaranes. Creemos poder sostener que habra habido en el coti guaz, al menos a nivel sonoro,
cierta intrusin a travs de los cantos y msica ejecutados durante las celebraciones en la plaza, en los cuales a
ellas no les estara permitido participar. Otra posibilidad sera que slo algunas mujeres tuvieran permiso para
salir, lo cual podra explicar el porqu algunos autores hablan sobre la entrada voluntaria al coti. Este punto nos
hace pensar en la posibilidad de un tratamiento diferencial hacia las moradoras de este lugar.

Observamos en fuentes y estudios arqueolgicos, que entre el coti guaz y el ncleo principal estamos, en cuanto
a su materialidad, ante el mismo tipo de construccin, por lo que el lugar de las mujeres no desentonara con el
resto de la misin (exceptuando la magnificencia de la iglesia); su edificio se acerca, en cuanto a forma, al
colegio de los padres, afirmando esta idea de espacio cerrado con un patio interno. Si tomamos en cuenta lo
postulado por el Kern (1997), respecto del patio del claustro, es posible entender al patio interno del coti guaz -
la mayor abertura de este espacio- como una va de comunicacin con el cielo (Dios). Y si consideramos la idea
de separacin de esferas masculina y femenina que hemos postulado para la vida reduccional, podemos concebir
al claustro como un espacio exclusivamente masculino dentro de la misin, mientras que el coti guaz sera
netamente femenino, y la entrada de un Jesuita slo se dara en caso de necesidad espiritual. As, entendemos a
ambos espacios como opuestos, en donde el coti guaz (femenino) quedara subordinado al claustro (masculino),
teniendo en cuenta las nociones de la poca y la diferencia de altura en el emplazamiento. Por otro lado,
encontramos al claustro al este del centro-iglesia, mientras que el coti guaz se ubica al oeste del mismo, lo que
podra, quiz, indicar alguna vinculacin entre el saliente (que sale a la luz) y el poniente (que se esconde).

Con respecto a la relacin entre el coti guaz y la iglesia, tiene que ver con la asistencia a la misa por parte de
sus moradoras. Si asumimos que participaban de la misma con el resto de los Guaranes de la misin, es de
suponer que ocuparan el lugar de la iglesia asignado a las mujeres. Sin embargo, nos inclinamos a pensar que
todas las actividades espirituales se realizaran al interior del coti guaz y que, nicamente aquellas que
voluntariamente entraban, voluntariamente podran salir (por ejemplo, para asistir a la misa).
A partir de las intervenciones realizadas
8
y de las fuentes consultadas creemos que, a pesar de la actual pared

8
Los trabajos de campo realizados en el 2008 son especialmente tiles al respecto al postular que, en principio, el coti guaz habra sido
construido con anterioridad a la extensin (hacia el N) del cementerio. Poujade, Austral y Rocchietti (2008).
TOMO IV - 1513
CAPTULO 30 - MESA DE COMUNICACIONES 1
lindante en comn, originalmente, estaba separado del cementerio y del resto del ncleo de poder de la misin.
Por otro lado, si tenemos en cuenta la proximidad del coti guaz con el camposanto podemos pensar en el
primero como un lugar ms bien tranquilo y silencioso (al igual que el lugar donde descansan aquellos que ya no
estn), siendo esta serenidad interrumpida por las celebraciones (ocasionales) ocurridas en la plaza.

Considerando el conjunto de edificios al sur de la plaza, y si lo anterior es cierto, podemos sostener que el coti
guaz (al menos para algunas reducciones) habra sido una construccin aislada, separando sus habitantes del
resto de la misin, interrumpiendo la va comunicativa iniciada en los talleres y que contina, luego de los dos
patios, con la iglesia y el cementerio. Esta situacin constructiva viene a reforzar la idea de aislamiento y
encierro que se menciona en las fuentes estudiadas, al tiempo que fundamenta en el plano de la materialidad la
separacin de esferas.

Respecto de las viviendas de las familias Guaranes, el coti guaz de Santa Ana se encuentra en una posicin de
separacin por estar alineado con el ncleo principal; el eje este-oeste estara dividiendo la misin en dos y, en
este caso, el coti guaz quedara del lado de los edificios ms importantes de esta reduccin; como construccin
tambin es distinta, al ser un espacio cerrado con patio interno. Sin embargo, podemos sealar una similitud en
cuanto a que sus paredes combinan sillares y adobe, y a que envuelven los espacios con galeras perimetrales
como, segn estudios y fuentes, estara ocurriendo con estas dos estructuras.

Entre el coti guaz y los talleres de Santa Ana, observamos un alejamiento en cuanto a su ubicacin, al situarse
los talleres en el sector E, luego del claustro. Esta situacin afirmara, una vez ms, la separacin de las esferas
masculina y femenina en las reducciones; de la misma manera que las otras Guaranes de Santa Ana, las mujeres
del coti guaz estaran realizando sus actividades de hilanza dentro de ese espacio, sin utilizar los talleres.

Otro aspecto a considerar, ahora en cuanto al cabildo. De confirmarse que est al E de la plaza, volveramos a
encontrarnos con una relacin de separacin, es decir, alejamiento de uno de los centros de poder del pueblo. No
tenemos conocimiento respecto de la existencia de una crcel en Santa Ana. De todas maneras, y considerando
lo afirmado en las fuentes en cuanto a la funcin de castigo del coti guaz, sera interesante profundizar la
vinculacin entre las mujeres destinadas a la crcel y las destinadas al coti.

Teniendo en cuenta las apreciaciones realizadas, podemos postular al coti guaz como un constructivo separado
del resto de las estructuras de la misin, afirmando la idea de separacin de las esferas masculina y femenina en
todos los mbitos de la vida y tambin de la muerte. El mismo habra estado pensado para poder establecer
algunas instancias de comunicacin entre algunos de sus recintos y con algunos sectores del exterior. An no es
posible establecer con claridad de qu manera habra funcionado esta puerta de acceso a la plaza (espacio
pblico, de vida social) y las puertas de los dos recintos del frente, que tambin dan a la plaza. Considerando lo
expuesto, creemos que el coti guaz de Santa Ana se inserta en la estructura de dominacin propia del perodo
colonial, llevada a cabo, en el caso abordado de contextos reduccionales de Guaranes, por los religiosos de la
Compaa de Jess. Las coronas papales encontradas en l vendran a reforzar su presencia y recordarles esta
nueva situacin a las moradoras del coti. Cabe incluir aqu a las actividades de evangelizacin conquista
espiritual- como incluidas en el mismo proceso de dominacin. Si la abundancia de mujeres propia de la
poligamia- estaba interfiriendo con el establecimiento de los ideales cristianos de los Jesuitas, el coti guaz, al
encerrar un determinado tipo de mujeres, y constituirse a s mismo como cerrado dentro de otro cerrado
(Rocchietti 2006), podra estar dando una repuesta constructiva a esta situacin. El encierro habra tenido tanto
funciones de proteccin como de castigo, al incluir a aquellas que se encontraban solas (desprotegidas), y a las
adlteras que obraban contra las nuevas reglas que se queran establecer. As, quienes se alejaban de la familia
cristiana, cuya residencia eran las viviendas pensadas para ese tipo de familia, habran sido confinadas a este
espacio, transformndose, as, en estructuras complementarias en la lucha jesuita contra la poligamia.

Podemos suponer en el coti guaz de la reduccin de Santa Ana, quiz, un ambiente de instruccin -tranquilo y
silencioso- de una nueva moralidad representada por los ideales de la poca, maneras de ser mujer ante un
nuevo Dios, otras costumbres matrimoniales basadas en el comportamiento sexual modlico de esos tiempos,
diferentes formas de relacionarse socialmente. Hurfanas, solteras y adlteras habran tenido all oportunidad de
conocer distintas maneras de actuar, aisladas (al menos fsicamente) del resto de la vida misionera.

Reflexiones finales
Considerando lo expuesto, podemos presentar al coti guaz de Santa Ana como una estructura cerrada, con un
gran patio interno y compuesta por recintos, galeras internas y externas. El tipo de construccin nos indica que
TOMO IV - 1514
Mara Victoria Roca
corresponde al ltimo perodo; tambin, lo podemos ubicar en el grupo de los coti que prolongan el ncleo
principal. Gracias al estudio sobre los planos se pudo establecer que al menos casi la mitad de las reducciones
tenan un coti guaz, lo que nos habla de que Santa Ana no constitua una excepcin, sino que esta prctica de
encierro estara formando parte de la poltica de la administracin jesuita. Decamos ms arriba, que este espacio
separado, aislado- estaba destinado a albergar, encerrar, aislar, proteger y castigar entre sus paredes a lo que
podemos presentar como dos tipos de mujeres: las solas y las castigadas. As, pudimos ver que a las
primeras, las une el hecho de estar solas, en cuyo caso la comunidad, al asistirlas, vendra a ocupar el lugar -
masculino- que les est faltando. A ellas, el coti guaz las recibe. Por otro lado, el coti guaz estara albergando
mujeres con vida censurable, segn parmetros cristianos, oponindose a las anteriores. A ellas, este espacio las
sanciona. A todas, las encierra. Segn lo estudiado, vimos que hay total acuerdo en que ste era un espacio
netamente femenino, cerrado con cerrojo, creado por mentes masculinas (los religiosos de la Compaa de
Jess), segn parmetros masculinos (los de la Iglesia Catlica de principios de siglo XVIII). Dentro del coti
guaz las Guaranes habran experimentado (temporalmente?) nuevas maneras de comportarse
(disciplinamiento), de proceder (instruccin), de obrar (moral), en fin, nuevas maneras de ser (un ande reko
distinto del conocido) dentro de una nueva espacialidad (la arquitectura reduccional). Por otro lado, hemos
esbozado de qu manera el coti guaz se constituye, entre otras cosas, en una respuesta constructiva a la lucha
contra la poligamia, encarada a partir de una nueva religiosidad -diferente de la Guaran tradicional- que
considera a las mujeres como fuente de pecado, a la vez que objeto sagrado. Es tambin, sealamos, la
materializacin de la idea de separacin de las esferas masculina y femenina en el mbito de la reduccin, al
tiempo que constituye un mecanismo de control de las mujeres, por lo que ellas representaban, tanto para los
Jesuitas, como para el resto de los Guaranes.

En fin, es a partir de este tipo de consideraciones que entendemos al espacio coti guaz y al tipo de mujeres que
este alberg, como un componente clave en el sistema de dominacin y conquista llevado adelante por los
ignacianos, en nombre de la Iglesia y del Estado Espaol, ambos actores indiscutibles de las polticas coloniales
llevadas adelante en el Nuevo Mundo. Es fundamental no perder de vista que algunas de sus expresiones
materiales -pequeas ruinas e imponentes sitios monumentales- se encuentran en las actuales provincias de
Misiones y Corrientes, parte del antiguo sistema reduccional Jesutico-Guaran y de nuestro noreste argentino.

Bibliografa
Bruxel, A. S.J. 1996. Los treinta pueblos. Editores Asociados, Montevideo.
Busaniche, H. 1955. La Arquitectura de las Misiones Jesuticas Guaranes. El Litoral, Santa Fe.
Fernndez Ramos, R. 1929. Apuntes Histricos sobre Misiones. Talleres Espasa-Calipe, Madrid.
Furlong, G. 1962. Misiones y sus pueblos de Guaranes. Buenos Aires.
Glvez, L. 1995. Guaranes y Jesuitas. De la Tierra sin mal al Paraso. Ed. Sudamericana, Buenos Aires.
Gutirrez R. y E. Maeder. 1994. Atlas histrico y urbano de la regin del NEA. Instituto de Investigaciones
Geohistricas-Conicet Fundanord, Resistencia.
Hernndez, J. L. 2000. Las madres indias tambin tienen corazn. Historia de las mujeres en Argentina.
Direccin de F. Gil Lozano, V. Pita y M. G. Ini. Coordinacin editorial: M. Sacchi, pp. 49-65. Taurus, Buenos
Aires.
Kellogg, S. 2005. Weaving the Past. A History of Latin America`s Indigenous Women from Phehispanic Period
to the Present. Oxford University Press, New York.
Kern, A. A. 1997. Anlise do plano urbano das missoes Jesutico-Guaranis: um estudo comparativo com os
mosteiros medievais. Anais da XVII Reuniao: 85-96.
Lugones, L.1945. El Imperio Jesutico (Ensayo Histrico). Publicaciones de la Comisin Argentina de Fomento
Interamericano, Editorial Bajel, Buenos Aires.
Martnez Valebona, O. 2008. La estructura de las reducciones Guaranes. www.cervantesvirtual.com. Fecha de
consulta: Mayo 2008.
Orser, C. 2000. Introduccin a la Arqueologa Histrica. Asociacin Amigos del Instituto Nacional de
Antropologa, Buenos Aires.
Perams, J. L. 1946 [1791]. La Repblica de Platn y los Guaranes. Emec Editores, Buenos Aires.
Pla, J. 2008 [1975]. El Barroco Hispano Guaran. http://www.bvp.org.py/ Fecha de consulta: Mayo 2008.
Poujade, R. 2000. Arqueologa de las Reducciones Jesuticas de Guaranes de Misiones. Actas del I Congreso de
Arqueologa Histrica Argentina: 541-552. Buenos Aires.
Poujade, R., A. Austral, y A. M. Rocchietti 2009. Santa Ana: Arqueologa Colonial y Arqueologa del
Colonialismo en la Paraquaria. Actas Primer Simposio de Arqueologa Colonial. Cayast. En prensa.
Poujade, R., A. Austral y A. M. Rocchietti 2008. Arqueologa de la Misin Jesutica de Santa Ana. Informe para
el Convenio. Manuscrito.
TOMO IV - 1515
CAPTULO 30 - MESA DE COMUNICACIONES 1
Poujade, R., C. Gutirrez, A. Austral y A. M. Rocchietti 2008. La poltica de las Misiones: el cotyguaz de Santa
Ana. Actas de las XII Jornadas Internacionales sobre Misiones Jesuticas. Publicacin en CD. Buenos Aires.
Poujade, R., A. Austral, A. M. Rocchietti y N. De Grandis 2006. Arqueologa de Santa Ana, Misin Jesuita
(Misiones Argentina). Actas III Congreso Nacional de Arqueologa Histrica. Rosario. En prensa.
Quiroga, L. 2005. Disonancias en Arqueologa Histrica: la experiencia del Valle del Bolsn. Revista Werken 7:
89-109.
Roca, M. V. 2008. Discusiones en torno al coti guaz de Santa Ana: aportes sobre el lado femenino de la
conquista. Actas de las XII Jornadas Internacionales sobre Misiones Jesuticas. Publicacin en CD. Buenos
Aires.
Rocchietti, A. M. 2006. Informe sobre Santa Ana. Convenio UNR-UNaM. Manuscrito.
Rocchietti, A. M. 1998. Arqueologa Histrica: Teora y prctica de las formaciones arqueolgicas americanas.
Revista de la Escuela de Antropologa, UNR 4: 139-145.
Susnik, B. 1984. La cultura indgena y su organizacin social dentro de las misiones Jesuticas. Suplemento
Antropolgico 19 (2): 7-17.




TOMO IV - 1516
Mara Victoria Roca
PRIMERAS INTERVENCIONES EN EL PREDIO DE LA CASA DE LA
ADMINISTRACIN, SEDE DE LA COLONIZACIN DEL NORTE
SANTAFESINO, 1870, ALEJANDRA, SANTA FE
Irene Dosztal



Resumen
En el marco de las investigaciones para la tesis doctoral Arqueologa Histrica de La Casa de La Administracin
1873, asentamiento sede del proyecto geopoltico Alexandras Colony, Alejandra, Santa Fe, se propone la
intervencin en el predio de la misma para profundizar la realidad santafesina en el momento de la colonizacin
fomentada desde el Gobierno Nacional y Provincial a mediados del siglo XIX.

Este constructivo que comienza a levantarse en 1873 se convierte en la sede administrativa y comercial del norte
santafesino; adems, sirvi de vivienda del director y administrador y tras su empalizaba cobijaba a los primeros
colonos en viviendas precarias de adobe y techo de paja.

Es por ello que la eleccin del lugar responde a la idea de obtener registros materiales de contextos domsticos
de un sector que sufri diferentes ocupaciones, por lo que poseera una secuencia completa de ocupacin anterior
al contacto, siendo que el proyecto urbanizador de la colonizacin se llev a cabo sobre el indgena
preexistente y contina siendo habitado.

En esta oportunidad se dar cuenta de los resultados de las primeras intervenciones realizadas en este predio.

Colonizacin del norte santafesino
La cada de Rosas y la separacin de Buenos Aires del resto del pas ocurrida pocos meses despus de la batalla
de Caseros (1852), provocaron profundos cambios en la provincia. Santa Fe se convirti a raz de su posicin
geogrfica en una provincia estratgicamente militar y puntal econmico de la Confederacin Argentina.
Rosario fue el principal puerto de la Nacin y lleg a competir con el de Buenos Aires.

En los casi nueve aos corridos desde el derrocamiento de la dictadura hasta el triunfo porteo en la batalla de
Pavn, Santa Fe gan tierras al desierto y vio surgir sus dos primeras colonias agrcolas, precursoras de la bien
denominada revolucin en las pampas (De Marco 1992:77).

Esta revolucin pampeana se gener a raz de la creacin, por parte de los distintos gobiernos posteriores a la
batalla de Caseros, de un programa poltico cuyo principal inters era lograr la atraccin de inmigrantes
laboriosos a los que se les otorgara facilidades para establecer colonias agrcolas en el desierto santafesino
habitado por lo que consideraban tribus nmadas potencialmente hostiles.

Gobernar es poblar era, entonces, la consigna urgente y necesaria y para facilitarla el prembulo de la
Constitucin proclam los beneficios de la libertad para todos los hombres del mundo que quisieran habitar el
suelo argentino (Gianello 1978:354).

Es as, como una nueva etapa se abra en la provincia de Santa Fe, organizando el pas bajo una Constitucin
Nacional, fomentando la colonizacin agrcola e inmigracin extranjera, abierta al comercio internacional,
poblando sus tierras que formaran numerosos pueblos. El objetivo era cambiar la fisonoma de las enormes
extensiones de tierra tanto la Norte de la capital provincial como al Sur y al Oeste.

En la provincia de Santa Fe se practicaron principalmente dos tipos de colonizacin; una oficial y otra privada.
Prevaleciendo la primera de ellas en nuestra zona de inters: el norte santafesino. En la colonizacin oficial el
Estado actuaba como intermediario a travs de las concesiones de tierras a empresario o compaas
colonizadoras.

Licenciada en Antropologa. Becaria de CONICET, Museo Universitario Florentino y Carlos Ameghino, Facultad Ingeniera, Cs. Exactas y
Agrimensura, Universidad Nacional Rosario.
Escuela de Antropologa. Facultad de Humanidades y Artes. Universidad Nacional Rosario. irene@fceia.unr.edu.ar
TOMO IV - 1517
CAPTULO 30 - MESA DE COMUNICACIONES 1
Los empresarios compraban al gobierno provincial tierras a precios muy bajos a cambio de lo cual el Estado les
exiga ciertas obligaciones respecto de la cantidad de pobladores a establecer as como de las facilidades de
vivienda, entrega de semillas, utensilios, etc., que el empresario deba entregar al colono (Zebeiro 2007: 329).

Para implementar estos requisitos y para comerciar los productos, el Estado crea las denominadas casas centrales
de administracin. Las mismas cumplieron un papel significativo principalmente en esta primera etapa de
colonizacin oficial, cuando unas pocas colonias estaban aisladas en la inmensidad del territorio (Gallo 2004).

Es as como a partir de 1852, poblamiento de la frontera e inmigracin eran la clave para la trasformacin
definitiva de la provincia en una sociedad civilizada poblada por familias laboriosas que lograran por fin vencer
al desierto tan temido por las autoridades provinciales y nacionales.

Este cambio en el imaginario de la poblacin, de ver como un desierto las grandes extensiones de tierra a verlas
como una pampa verde y productiva, fue gracias al gran estmulo que viajeros, inspectores, profesionales que
recorrieron las insipientes colonias resaltando por encima de las diversidades y conflictos sociales y culturales
existentes, la productividad inconmensurable de la tierra. Es as como tras la visita a Colonia Alejandra de uno
de los inspectores concluye:

[] despus de estos antecedentes ninguna duda puede quedar, de que esta colonia ser antes de muchos aos,
uno de los puntos de la Provincia de Santa F ms importante y floreciente; pues entraa en s todos los
elementos propios para impulsar su desarrollo, imprimindolo un rapidsimo progreso. Puede decirse que su
porvenir est asegurado (Wilcken 1872: 143).

Alexandrass Colony un caso de colonizacin oficial
Colonia Alejandra fue fundada en 1870 por la compaa extranjera Thomson Bonar & Co. con sede en Londres,
Inglaterra, su marco legal se clasifica como una colonia oficial.

Los Seores J. Thomson y T. Bonar obtuvieron por ley de la Provincia de Santa Fe la compra de un terreno de
25 leguas a razn de 300 pesos bolivianos por legua cuadrada, tras la lnea de frontera norte de la provincia, con
la condicin de establecer en una colonia de 150 a 200 familias.

La colonia situada a 230 kilmetros de Santa Fe capital, entre el Ro San Javier y el Arroyo Saladillo Amargo.
Linda al sur con las tierras de la Colonia Elosa y al norte con el Arroyo Malabrigo. Las 25 leguas estn
compuestas por 9 de altura dominante apta para la agricultura, 13 leguas compuestas por un terreno anegadizo y
cubierto de impenetrables pajonales; otra zona presenta bosques de algarrobo y andubay, que dejan entre s una
o dos leguas de tierra limpia para el cultivo. El inspector Nacional de las Colonias, Guillermo Wilcken enviado
por la Comisin Central de Inmigraciones del Estado Nacional recorre Colonia Alejandra en 1872. En marzo de
ese ao encuentra una poblacin compuesta por 5 familias valdenses, 2 inglesas, 2 irlandesas, 2 vascos
espaoles; adems de grupo de jvenes solteros ingleses y franceses que junto al personal de la Administracin y
peones de campo formaban un total de 130 personas. (Wilcken 1872)

Contando la colonia con dos aos de existencia, en 1872 los primeros inmigrantes que tenan sus terrenos
designados, todava vivan en el predio de una cuadra de superficie perteneciente a la Administracin compuesto
por edificios de adobe con techo de paja rodeados de una empalizada de andubay a pique y a los alrededores de
la misma.

Esto se debe a que las condiciones de seguridad no eran brindadas por el Estado Nacional; argumentando ste
que la especulacin por el precio de las tierras llev a la Compaa Colonizadora a invertir fuera de la frontera
nacional.

Luego de innumerables quejas de los vecinos por los enfrentamientos vividos, la situacin se convirti en un
problema diplomtico. Los dilogos epistolares entre el Sr. Macdonell (Cnsul General Britnico en Argentina)
y Earl Granville (Conde de Londres); entre el Cnsul General y el Sr. Avellaneda, Ministro de Justicia, y los
propios vecinos con el presidente Sarmiento (Tourn: Indito), llevaron al Gobierno Nacional a tomar la decisin
de trasladar la frontera norte hasta el lmite natural arroyo El Rey (Reconquista, Santa Fe). Esta intervencin
militar fue llevada a cabo en los ltimos das de abril de 1872 a cargo del Gral. Manuel Obligado (Figura 1).
TOMO IV - 1518
Irene Dosztal

Figura 1: Evolucin de la frontera Norte de la provincia de Santa Fe.
Arqueologa Histrica en un Sitio de Frontera:
El predio de la Casa de La Administracin es el eje central de esta investigacin, considerando que a travs del
registro arqueolgico profundizaremos en el conocimiento sobre el estilo de vida mantenido por primeros grupos
que habitaron y administraron Colonia Alejandra.

Se coincide con Trinchero (2007) en la definicin de frontera como indicador de frentes de expansin.
Entonces, la nocin de frontera expansiva hace referencia al espacio que es preciso colonizar. Este adquiere
dimensiones de un terreno vaco, conjugando el soslayamiento de la estructura social existente, y la invisibilidad
del papel regulador del Estado en torno a estas expectativas. (Trinchero 2007)

Al ubicarse tras la frontera norte, los administradores, hombres solteros y peones comenzaron a construir en
1870, un fuerte y dentro de l precarias viviendas de adobe con techo de paja. Un par de aos despus, como se
expuso anteriormente, algunos colonos construyeron sus viviendas en los alrededores ya que les otorgaba mayor
seguridad.

A travs de los aos el proyecto de la gran colonia agrcola de origen ingls fue declinando tras la muerte de los
principales interesados. Por esta razn la compaa vende en 1885 la colonia a la sociedad espaola Zubelzu y
Ortz. En la escritura de venta con fecha 13 de abril de 1885 se lee:
[] los Sres. J. Thomson J. Bonar y Compaa segn el poder bastante ya relacionado al principio de la
presente vende al compareciente Don. Antonio Zubelzu lo siguiente: Primero. Un establecimiento de campo
situado en esta Provincia al Norte la ciudad de Santa Fe denominado Colonia Alexandra con todo lo
edificado, clavado, plantado y all existente, tiles, enseres, poblaciones, y derechos y acciones que pudieran
tener los propietarios y les correspondiesen, como igualmente con todo y cualquier contrato con Colonos y
arrendatarios [] (Escritura de Venta 1885, folio 18697)

Por esta razn el registro esperado que se busca obtener estara compuesto por materiales de contextos
domsticos de un territorio que sufri diferentes ocupaciones: 1) poseyendo una secuencia completa de
ocupacin anterior al contacto, siendo que el proyecto urbanizador de la colonizacin se llev a cabo sobre el
territorio ancestral de los grupos originarios de la regin y contina siendo habitado. La Casa de la
Administracin fue construida por un grupo de ingleses en 1873, quienes habitaron en ella ms de 10 aos. Tras
la venta de la colonia, llega a la administracin una sociedad espaola; en ambos momentos la casa estuvo
habitada por los administradores principales y por decenas de empleados y peones. Alrededor de 1945 esta
sociedad vende la propiedad a sus dueos actuales, la familia Moore. 2) su ubicacin en el trazado fundacional
constitua un espacio de relevancia, por lo que los restos hallados corresponderan a los principales vecinos
fundadores.

Al da de hoy se llevaron adelante dos intervenciones de campo en el predio de la Casa de la Administracin (Figura
2). El objetivo de la primera de ellas fue el relevamiento topogrfico utilizando nivel ptico (Figura 3); definiendo de
este modo variaciones en el microrelieve del sitio: montculos, desniveles y reas de nivelacin pareja.
TOMO IV - 1519
CAPTULO 30 - MESA DE COMUNICACIONES 1

Figura 2: Predio de la Casa de la Administracin.



Figura 3: Relevamiento topogrfico con nivel ptico

Luego del anlisis en el laboratorio de los datos obtenidos, se planific los objetivos de futuras intervenciones:
realizar sondeos en reas claves para determinar presencia/ausencia de estructuras (Chiavazza y Pietro 2007)
(Senatore 2007):
1. Sondeo en reas de montculos (confirmar presencia de estructuras)
2. Sondeo en espacios abiertos sin montculos ni desniveles
3. Sondeo en reas de desnivel (zanjas)

Junto al planteo de estos objetivos surgen estos interrogantes, estas intervenciones: Permitirn elaborar una
secuencia estratigrfica de referencias para el sitio arqueolgico y sus variaciones como resultado de la
modificacin cultural de distintos sectores? Podrn determinar la relacin existente entre los microrelieves y el
comportamiento del registro arqueolgico subsuperficial? Los montculos se relacionan a antiguas estructuras?
La presencia de desnivel implica presencia de estructuras negativas como zanjas o empalizada perimetral?

A principios de marzo de 2010 se llevaron adelante dos sondeos de 1 m2, en reas muy especficas del terreno.
Uno se realiz en un montculo, hallando a 10 cm. de profundidad ladrillos de 15 cm. de ancho por 30 cm. de
largo. Se continu la lnea de los mismos hallando una estructura de 5, 16 metros de ancho y 10, 16 metros de
largo. El extremo SW, de lo que denominamos Estructura 1, se encuentra perturbada por las races de un timb.






Figura 4: Baldosas provenientes de
Marselle fabricantes St. Henry
TOMO IV - 1520
Irene Dosztal
En el extremo SE donde se plante el sondeo; se llev adelante una cuadrcula de 1 m
2
. En la excavacin se
hallaron fragmentos de ladrillos

y de baldosas de origen francs (Figura 4), especficamente de Marselle
fabricantes St. Henry, similares a las que posee la Casa de la Administracin en su galera.

La estructura posee tres filas de ladrillos, en la pared este se hall a la altura de la tercera fila de ladrillos el piso
de la habitacin. El mismo est compuesto por tierra apisonada.


Figura 5: Perfil cuadrcula extremo SE Estructura 1

El segundo de los sondeo se realiz en un rea abierta en las cercanas del Casa de la Administracin, donde
florecan dos lneas de ladrillos de canto. Estas lneas formaban un sendero de forma irregular (Figura 6) con
piso de ladrillos; el cul desemboca en una estructura, denominada Estructura 2 (Figura 7). El contorno de la
estructura tambin presenta ladrillos de canto, lo que confirma que se trata de un pequeo patio con piso de
ladrillos, que por su posicin no corresponde a una habitacin. Posiblemente, los primeros colonos descansaban
a la sombra de antiguos timbs.


Figuras 6 y 7: Detalle del Sendero y Estructura 2

Estas primeras intervenciones en el predio de la Administracin nos posibilit obtener un acercamiento a la
dinmica depositacional del sitio y nos permiti entender la incidencia de los procesos de formacin naturales, y
a su vez, la importancia de los procesos culturales en la estructuracin del espacio El relevamiento de estas dos
estructuras y futuras estructuras pensadas en relacin a la Casa de la Administracin, nos permitir plantear un
posible plano de los primeros aos de la colonia.

La Estructura 1 coincide con la descripcin del inspector Wilcken, que como se dijo anteriormente, incluye en su
informe viviendas en los alrededores de la Administracin. La Estructura 2 corresponde al estilo de vida que los
administradores traan de su Inglaterra natal y deseaban conservan en estas nuevas tierras, como por ejemplo la
composicin escnica de sus jardines.

Bibliografa
Chiavazza, H. y C. Prieto. 2007. Arqueologa Histrica de Santa Cruz de la sierra La Vieja. Editorial El Pas,
Bolivia.
De Marco, M. . 1992. El resurgimiento republicano y el despertar del progreso econmico-social (1852-
1880). Historia de Santa Fe. Librera APIS Rosario.
Gallo, E. 2004. La pampa gringa. La colonizacin agrcola en Santa Fe (1870-1895), Edhasa, Buenos Aires.
TOMO IV - 1521
CAPTULO 30 - MESA DE COMUNICACIONES 1
Gianello L. 1978. Historia de Santa Fe. Coleccin: Historia de Nuestra Provincia N 5. Ediciones Plus Ultra,
Santa Fe.
Senatore, M. X. 2007. Arqueologa e historia en la Colonia Espaola de Floridablanca. Patagonia siglo XVIII.
Editorial Teseo, Buenos Aires.
Tourn Pavillon. indito, Correspondencia y Documentos de la Alexandra Colony, Santa Fe
Trinchero, H. 2007. Aromas de lo Extico. Retornos del Objeto. Editorial Coleccin Complejidad Humana,
Buenos Aires.
Wilcken, G. 1872. Las Colonias. Informe sobre el estado actual de las colonias agrcolas de la Repblica
Argentina. Presentado a la Comisin Central de Inmigraciones, Buenos Aires
Zebeiro, B. 2007. Un mundo rural en cambio. Nueva Historia Argentina. Liberalismo, Estado y Orden Burgus
(1852-1880). Direccin del tomo M. Bonaudo, pp. 293-362. Editorial Sudamrica, Buenos Aires.
Fuentes:
Escritura de Venta de Colonia Alexandra, 13 de abril de 1885. Archivo del Colegio de Escribanos de la
Provincia de Santa Fe, Segunda Circunscripcin. Ciudad de Rosario.
TOMO IV - 1522
Irene Dosztal
ANLISIS DE MATERIALES ARQUEOLGICOS CORRESPONDIENTES AL
PREDIO DE LA EX ESCUELA NORMAL DE SAN JUSTO: PRIMEROS
RESULTADOS
Mara Beln Colasurdo
*
y Federico Katalinich
**


Resumen
El presente trabajo tiene como objetivo general dar a conocer las primeras aproximaciones del anlisis de los
materiales arqueolgicos resultantes de la intervencin realizada en el predio de la ex Escuela Normal de la
localidad de San Justo (Departamento San Justo, Provincia de Santa Fe). Dichos materiales fueron recuperados a
partir del requerimiento de la secretara de cultura de la Municipalidad de dicha ciudad. En esa oportunidad se
evaluaron estructuras localizadas en el edificio, las cuales fueron detectadas debido a las obras de remodelacin
realizadas en el mismo.

Si bien las expectativas del imaginario local eran que los restos hallados correspondieran al Fuerte de Feli (el
cual formaba parte de la lnea de fortines de la provincia de Santa Fe durante el siglo XVIII) el mismo nunca
estuvo emplazado en ese lugar. Segn las fuentes escritas en dicho predio funcion la comandancia y vivienda
del Coronel Manzanares y posteriormente la Escuela Normal.

En este sentido, el objetivo especfico de esta comunicacin, es determinar a partir de los datos obtenidos del
anlisis de los restos seos de fauna y de los restos de contenedores vtreos y cermicos, el perodo temporal al
que corresponden los mismos, a fin de determinar con qu momento de ocupacin se correlacionan dichos tems
arqueolgicos.

Introduccin
La intervencin en el predio de la Ex escuela Normal de la ciudad de San Justo se realiz a raz de las obras de
remodelacin realizadas en el predio. Durante dichas obras se dejaron al descubierto una serie de estructuras, por
debajo de los pisos actuales. Ante este hecho, la secretara de cultura de la Municipalidad de la ciudad de San
Justo, solicita se evalen los hallazgos con el objeto de determinar a qu perodo temporal correspondan las
mismas y si posean algn tipo de valor histrico

En otra oportunidad el predio haba sido objeto de sondeos exploratorios. En el ao 2000, Carlos Ceruti y
Gabriel Cocco trabajaron en otro sector del edificio (en el ala opuesta a la intervencin actual) al detectarse un
piso de caractersticas particulares. En esa ocasin se lleg a la conclusin que el inmueble en reparacin se
trataba de una construccin de finales del siglo XIX y en parte del siglo XX, la cual haba sufrido diversas
remodelaciones a lo largo del tiempo.

Si bien las expectativas locales apuntaban a que los restos de las estructuras localizados correspondieran al
Fuerte de Feli, dichas expectativas se podran interpretar como una especulacin del imaginario colectivo ante
la ausencia de fuentes documentales. La intervencin arqueolgica fue realizada sin ningn tipo de expectativas
previas por parte de los profesionales encargados. Se considera aqu al registro arqueolgico como independiente
de las fuentes escritas, con capacidad para informar por s mismo, como as tambin informar acerca de cosas
que no pueden decirse desde otro registro, porque puede contribuir a la interpretacin de los procesos culturales
de forma distinta a la de la historia (Cleland 2001). Esta perspectiva terica no reniega del registro documental,
sino que no subsume bajo ste al registro arqueolgico; por el contrario, al reconocerle su autonoma propia, la
investigacin se enriquece ya que los temas y problemas a tratar y resolver son diferentes.

A partir de lo expuesto el relevamiento y los sondeos realizados, as como el anlisis de los tems arqueolgicos
(restos seos de fauna y contenedores vtreos y cermicos) expuestos en est comunicacin, hablan de una
cronologa temporal posterior al emplazamiento del fuerte, correspondiendo a ocupaciones posteriores del
edificio.



*
CONICET - ISHIR /CESOR
**
UNR FHyAR - Escuela de Antropologa.
TOMO IV - 1523
CAPTULO 30 - MESA DE COMUNICACIONES 1
Contexto histrico
A raz de las expectativas generadas desde el imaginario colectivo de que los restos sean del fuerte, es que se
considera necesario tener en cuenta algunos datos histricos referidos a la historia de San Justo y de la ocupacin
del espacio de este edificio. El fuerte conocido como Esquina del Salado o Feli (en honor al Virrey Olaguer
Feli) fue terminado de construir en el ao 1794 por Prudencio Mara de Gastaaduy (quien lo bautiz Feli),
dando as por terminada la obra que haba sido planificada entre 1789 y 1790 por orden del Teniente de
gobernador de Santa Fe Melchor de Echage y Anda, en el transcurso del gobierno del Virrey Arredondo
(Alemn, 1970).

En relacin a la localizacin del fuerte de Feli, no existe acuerdo, debido a que ruinas no fueron halladas hasta
el momento. Carlos Beck Bernard en sus crnica de viaje y haciendo mencin a su visita a San Justo en 1869,
cuando la poblacin estaba emplazada en el Rincn de Avechuco, menciona que en inmediaciones al poblado
existen las ruinas de un fuerte espaol que se denominaba Esquina Grande (Beck Bernard 1872 en Avila et al.
1968). No se sabe a ciencia cierta qu fue lo que Beck Bernard quiso decir con inmediaciones, y la Esquina
Grande corresponde a un rea de proporciones extensas, por lo que se ha asumido que el fuerte podra
localizarse a la altura de San Justo. En este sentido el plano anexado en la obra de Alemn (1997:16) lo sita
frente a Colonia Angeloni, donde estuvo la primera fundacin de San Justo. Por otra parte el plano
confeccionado por Gastaaduy del ao 1795 ubica al fuerte a 4 leguas al NO de la desembocadura del A San
Antonio en el Salado, y a 6 leguas de la desembocadura del A Arizmendi, sobre el que aparece representado el
Fuerte Soledad. De acuerdo a esto y coincidiendo con el informe presentado por Ceruti y Cocco en el ao 2000 a
la Municipalidad de San Justo: se debera de buscar el fuerte a la altura de Villa Saralegui, entre el A del
Pantanoso (al norte) y la Caada del Curup, al sur, 28 km al NNO de la actual ciudad de San Justo y a 37,5 km
de su primera fundacin (Ceruti y Cocco 2000:12).

Como se mencion anteriormente el primer emplazamiento de San Justo se encontraba en el Rincn de
Avechuco, siendo su actual emplazamiento dado por Simn de Iriondo quien adquiri las tierras al Banco de
Londres y Ro de la Plata (Avila et al. 1968). El Coronel Francisco Romero Manzanares en 1882 fue designado
Subdelegado Poltico de las Colonias y Campaas del Norte, con residencia en Cayastacito y en 1884 se traslada
de Cayastacito a San Justo (Avila et al. 1968), donde de acuerdo al folleto publicado por el Museo Histrico de
San Justo (1993), se instala el 1 de diciembre de 1884, donde hoy se encuentra la Escuela Agrotcnica y la
escuela de Enseanza Media para Adultos N 104, calle Cabal N 426). La construccin que se emplaz all era
sede de la Subdelegacin Poltica de las Colonias y Campaas del Norte, y domicilio del Coronel Romero
Manzanares, quien el 31 de diciembre de 1890, al crearse el Dpto. San Justo, fue nombrado Jefe Departamental
de Polica, cargo que desempe hasta su muerte, el 14 de julio de 1893 (Avila et al. 1968). La Sra. Ada
Colombo menciona que tambin funcionaba en el lugar de residencia del Coronel Manzanares un oratorio donde
la gente se reuna para rezar. Por otra parte la casa tambin funcion de acuerdo a los escritos como escuela.
Posteriormente en el edificio de Cabal 426 se instala la Escuela Graduada Provincial de primeras letras, que
funcion entre 1909 y 1910, cuando se fund la Escuela Normal Nacional Repblica de Mxico (Garca de
Gmez 1989: 15).

Detalle de la intervencin
Las tareas de excavacin se iniciaron en el aula que se denomin Independencia, donde se emplazaba una
estructura de ladrillos en forma de L. Dicha estructura corresponde a las paredes de una habitacin la cual
probablemente sea de finales del siglo XIX y principios del XX (de acuerdo a las tcnicas constructivas y el tipo
de ladrillos utilizado). En la misma se llevaron a cabo cinco pozos de sondeo de 1m x 1 m, a ambos lados como
de las estructuras (denominados PS1, PS2, PS 3, PS 4 y PS 5). En todos ellos se hallaron tems arqueolgicos
aislados: fragmentos de loza, fragmentos de vidrio, restos seos de fauna y fragmentos de baldosa.

Posteriormente se trabaj en la penltima aula del sector Sur sobre calle Independencia, la cual se denomin
Pieza Aljibe, donde se localiz una estructura circular que correspondera a un aljibe. El mismo se encontraba
relleno con escombros, los que en parte fueron removidos, localizndose en su interior: 1 botella de gres Sello:
Lovatt & Lovatt Notts. Laugley Mill, fragmentos de madera quemada, fragmentos de metal, fragmentos de
vidrio y fragmentos de mampostera. En el Aula Piso Habitacin Independencia realizando un sondeo sobre la
pared Oeste, se comprob la existencia de lo que se podra denominar un pozo de basura en el que se localizaron
numerosos materiales en los sondeos realizados, estos fueron: fragmentos de vidrio; 1 botella de vidrio completa
(sin sello); 1 botella de Vidrio Sello: Cervecera Ro Segundo, 1 botella de vidrio. Sello: Fratelli Branca Milano;
1 canica de vidrio; fragmentos de loza; canica de cermica; botones de ncar; fragmentos de mampostera;
TOMO IV - 1524
Mara Beln Colasurdo y Federico Katalinich
fragmentos de cscara de huevo posiblemente de and; fragmentos de madera quemada; elementos seos de
fauna y fragmentos de metal.

Anlisis de los materiales
Lo que fue tenido en cuenta para el anlisis de los restos faunsticos fueron los datos que aportan informacin en
lo que se refiere al perodo temporal del sitio. La metodologa empleada fue la habitual en anlisis de restos
seos de fauna. Los criterios utilizados para la identificacin anatmica y taxonmica son los planteados por
Berwick (1975), Grayson (1984), Lyman (1994) y Mengoni Goalons (1988). Para la estimacin de la
abundancia taxonmica se calcul el nmero de especmenes identificados por taxn (NISP) y su correlacin en
porcentaje (NISP%). En cuanto a las huellas presentes en los huesos, se tomaron las marcas de sierra manual, de
serrucho y de sierra elctrica, dado que estos aportan informacin acerca del perodo temporal.

En lo que se refiere a las especies representadas, como puede observarse en la Tabla 1, las mismas corresponden
a especies introducidas. Slo se registra una placa de dasipdido, como elemento representativo de fauna
autctona. La mayor cantidad de huellas de sierra relevadas (ver Tabla 2) fueron las de aspecto liso y derecho,
similar a los cortes actuales realizados con sierra elctrica, por lo que se asume que dichos elementos
corresponden a un contexto ms actual (Silveira y Lanza 1999). Tambin pueden sealarse las huellas realizadas
con algn tipo de sierra manual o serrucho, donde los cortes son de bordes denticulados y escalonados (Seijas y
Cereda 1999) que tambin hablan de una cronologa tarda.










Tabla 1: NISP y NISP % por Gnero/especie

Tabla 2: Tipos de aserrado por taxn y elemento


En cuanto al anlisis de las botellas presentes en el registro, tambin se tuvieron en cuenta (al igual que con los
restos seos de fauna) los datos que aportan informacin sobre la cronologa aproximada para las mismas. Como
TAXON CANTIDAD ELEMENTO TIPO DE ASERRADO
Mammalia
10
Costillas y astillas 4 aserrado liso y derecho-
6 escalonadas
Bovidae 3 Vrtebras y hueso largo Aserrado liso y derecho
Ovis aries
4
Costillas Aserrado liso y derecho
Bos taurus
8

Costillas / huesos largos / cadera
5 aserrado liso y derecho
2 escalonadas -1 los dos tipos
Gnero/especie NISP NISP%
Mammalia 136 58.87%
Dasipodidae 0
Dasypus hybridus 1 0.46%
Bovidae 5 2.16%
Bos taurus 11 4.76%
Ovis aries 4 1.73%
Ave 29 12.55%
Gallus gallus 25 10.82%
Indet 20 8.65%
TOTAL
231 100%
TOMO IV - 1525
CAPTULO 30 - MESA DE COMUNICACIONES 1
primer punto es importante sealar que el Nmero Mnimo de Botellas fue calculado a partir de los fragmentos
de picos y bases. El resultado es un mnimo de 11 botellas (10 de vidrio y 1 de gres). Las caractersticas de las
mismas se expresan en la Tabla N 3.

A partir de la escala utilizada por Parks Canada Glass Glossary (Jones 1991) se procedi al anlisis de los picos,
colores y bases de las botellas encontradas. Respecto al anlisis de los picos, los mismos poseen un labio oblicuo
y un anillo regular. Este tipo de terminacin consta de un anillo inferior regular y un labio en forma de anillo
oblicuo (MacKearin and MacKearin 1941:425) y dicha tcnica se utiliza desde 1820 en adelante. En cuanto al
anlisis de las bases, como primer punto importante a sealar es la forma cilndrica de las mismas. El cambio de
la botella de forma acebollada a la cilndrica se dio en Europa precisamente en los finales del siglo XVIII, por lo
que en Amrica siempre se las considera como del siglo XIX. Las bases encontradas poseen marca de pontil
1
de
arena, este tipo de marca consiste en un pliegue de vidrio en el pontil que fue adoptado para ajustarse al contorno
basal y luego hundido en arena para que el vidrio del pontil no se adhiera a la base de la botella. Este tipo de
bases se usan a partir del siglo XVIII (Jones 1991:95). Con respecto al color del vidrio, este es un campo
subjetivo en DAACS. Sin embargo algunos protocolos para catalogo han desarrollado la siguiente descripcin de
opciones para el color: mbar, amatista, aqua, azul, marrn, incolora, gris/ahumado, verde, verde claro, verde
moderno, prpura, no identificable, blanco y amarillo. Para este trabajo se utilizo una clasificacin de 3 tipos de
colores: marrn, verde e incolora (DAACS 2008). Las marrones se encuentran representadas por 14 fragmentos,
este tipo de color incluye las botellas modernas de cerveza o soda y no se debe confundirse con las de color
mbar, las cuales son ms rojas y claras. Por su parte, se identificaron 33 fragmentos de color verde, cuya
produccin fue importante durante el S. XVIII. Que haya botellas color verde y marrn puede estar indicando un
uso continuo del espacio. Solo 1 fragmento color incoloro fue identificado, por lo cual es difcil analizar su
utilizacin y consumo.


PARTE CANTIDAD COLOR MARCAS CRONOLOGA APROX.
Pico 1 incoloro - Desde S XIX
Hombro con pico
completo
1 Verde Branca Milano 1845
Hombro con pico
completo
1 Verde - 1820
Base 3 Verde - Desde S XVIII
Base con cuerpo 1 Verde Cervecera Ro Segundo 1884
Base/patada/ taln 1 Verde - Desde S XVIII
Botella completa 1 marrn Marca de etiqueta de papel 1903
Tabla 3: Caractersticas y cronologa de las botellas

La botella de gres relevada est completa (en tres fragmentos que remontan) y en su cara lateral inferior de la
base tiene un sello que dice Lovat & Lovat Langley Mill- Nott. Langley Mill es el nombre de la ciudad de
emplazamiento de la fbrica de cermica ubicada en Reino Unido. Dicha fbrica tuvo distintos periodos de
propiedad la cual Lovat y Lovat funciono de 1895 a 1930. Este artefacto ostenta un color marrn y un pico
donde su labio posee una forma de pico vertedor el cual da una pauta que esta botella era comnmente utilizada
y rellenada.

Resultados
Segn los datos obtenidos del anlisis de los restos seos de fauna y los contenedores de vidrio y gres, se puede
afirmar que los restos arqueolgicos corresponden a ocupaciones posteriores a 1840. Teniendo en cuenta lo
expuesto en el predio que ocupa el edificio de la ex escuela Normal habit el Coronel Manzanares, quien residi
en el lugar a fines del S XIX, con lo cual de ser as los elementos hallados podran vincularse con esta ocupacin.

1
En la terminologa de los estudios realizados sobre botellas de vidrio se denomina push-up a la caracterstica de la base que fue empujada
hacia adentro de la cavidad del cuerpo con un pontil u otra herramienta mientras se haca el pico o terminacin. Las diferentes tcnicas de
empontilado (los distintos pontiles) dejan marcas identificables y caractersticas en las bases o push-ups.
TOMO IV - 1526
Mara Beln Colasurdo y Federico Katalinich

Los datos obtenidos de las huellas de corte presentes en los restos seos de vacas y ovejas, dan cuenta de que
fueron realizadas con serruchos o sierras manuales, incluso algunas evidencian el uso de sierras elctricas
similares a las actuales. Dichos datos estn relacionados con lo planteado para Buenos Aires por Schvelzon y
Silveira (2001) quienes reportan la utilizacin de hachas hasta mediados del siglo XIX y estiman la introduccin
de serrucho o sierra manual hacia finales de la dcada de 1840. Ante la falta de datos de la zona y sin realizar
una correlacin directa, pueden tomarse como referencia dichos datos e inferir que las marcas de corte presentes
en la fauna relevada son posteriores a 1840.

A partir del anlisis de las botellas de vidrio, se lleg a una datacin aproximada entre 1860-1880 (Berge 1980).
Las botellas de este perodo todava estaban producindose mediante tcnicas de manufactura algo toscas, pero
comenzaba a tener lugar un cambio. Aunque los colores todava tenan poca importancia, eran ms refinados y
claros, tendencia que se acenta a partir de 1880. Se produce tambin un refinamiento en la preparacin de la
terminacin, ya que las costuras de los moldes en este perodo concluyen justo sobre sta, indicando que se la
elaboraba separada del cuerpo (Kendrick 1966:47).

Una caracterstica importante de algunas botellas que aparecieron a partir de 1869 fue la de grabarlas con los
nombres de contenidos, fabricantes, distribuidores, slogans, y mensajes. Esta prctica casi desapareci con el
advenimiento de las mquinas automticas de botellas (1903), extendindose ampliamente el uso de etiquetas de
papel pegadas al contenedor (Kendrick 1966:71). Dichas caractersticas aparecen en las botellas analizadas, por
ejemplo, la botella base /cuerpo con marca cervecera ri segundo que corresponde aproximadamente a 1884,
el hombro con pico completo con marca Branca Milano (1845), el color de los recipientes y las marcas de
etiquetas en algunos fragmentos. Que se haga referencia a una cronologa comprendida entre los aos 1860-1880
no significa que todos los artefactos encontrados sean de ese mismo perodo (por ejemplo, el gres encontrado
pudo haber sido utilizado regularmente y su tenencia por un tiempo prolongado).

Concluyendo, los datos aportados por el anlisis de los materiales arqueolgicos se correlacionan con la
cronologa de las estructuras, siguiendo la clasificacin de las medidas de los ladrillos y la correspondencia en
siglos realizada en el informe de intervencin realizado por Ceruti y Cocco (2000). Las medidas de los ladrillos
de las estructuras relevadas corresponden a las utilizadas en la construccin sobre finales del siglo XIX y
principios del XX, esto aporta un dato ms a la hiptesis de que los restos recuperados pertenezcan a la
comandancia del Coronel Manzanares o de la primera escuela de graduados, ya que la ocupacin del espacio fue
continua.

Consideraciones finales
Las principales discrepancias epistemolgicas en Arqueologa Histrica nacen de la discusin del tipo de vnculo
que debe establecerse entre los restos materiales y los documentos escritos. Los sitios arqueolgicos histricos se
distinguen por la presencia de evidencia histrica, que puede ser integrada a los estudios arqueolgicos. Adems
de las distintas fuentes de informacin de la arqueologa como son el contexto ambiental-social del sitio, los
artefactos, las estructuras, la arquitectura, etc., se utiliza tambin un corpus de evidencia histrica, como
documentos escritos, fotos, crnicas, descripciones, cartas y mapas, etc. El registro arqueolgico aporta datos
independientes y el registro histrico contextualiza dichos datos en un momento determinado de los procesos
histricos, pero no es subsumido por este ltimo.

Si bien los materiales recuperados se encuentran en la primera etapa de estudio, se continuar con el anlisis del
resto de los tems, que pueden aportar datos sobre la cronologa, sobre todo los contenedores y vajilla de loza.
Otra lnea de anlisis que puede desarrollarse es la interrelacin e integracin de cuerpos de datos provenientes
de conjuntos arqueolgicos de base material diferente, como ser la loza, el vidrio y la fauna, a los fines de
evaluar pautas de consumo. Dicha integracin aportara una mirada ms acabada sobre la categora consumo en
un tiempo y espacio geogrfico determinado, enriqueciendo la interpretacin de los comportamientos de grupos
del pasado.

Es necesario hacer referencia a que a pesar que el emplazamiento no corresponde al fuerte (como el imaginario
colectivo supuso) es de sumo inters preservarlo y analizar todo lo localizado, ya que constituye un testimonio
material del pasado y la identidad de los sanjustinos.



TOMO IV - 1527
CAPTULO 30 - MESA DE COMUNICACIONES 1
Bibliografa
Alemn, B. 1970. El problema del indio en la historia de Santa Fe desde la Revolucin de Mayo hasta la
Organizacin Nacional. Historia de las Instituciones de la Pcia. de Santa Fe, T. III: 39-81. Ed. Oficial, Santa Fe.
Aultman, J y K. Grillo. The Digital Archaeological Archive of Chesapeake Slavery Octubre 2003.
http://www.daacs.org/ (13 de marzo de 2010).
vila, J, R. Garca de Gmez, M. Songzoni y B. Alemn. 1968. Historia de San Justo (1868-1968). Ed.
Belgrano, Santa Fe.
Berge, D. 1980. Simpson Spring Station: Historical Archaeology in Western Utah. Cultural Resources Series
No.6. Brigham Young University Museum of Peoples and Cultures, Utha.
Berwik, D. 1975. Valoracin del anlisis sistemtico de los restos de fauna en sitios arqueolgicos. Chungara
5: 125-140.
Ceruti, C y G. Cocco. 2000. Informe de Comisin de Servicio. Informe Tcnico elevado a la Municipalidad de
San Justo. Manuscrito.
Cleland, C.H. 2001. Historical Archaeology Adrift? Historical Archaeology 35:1-8.
Garca de Gmez, R. 1989. San Justo. Su historia (1868-1988). La Casa del Libro Editor, San Justo.
Garca, L, R, Surez y A, Lezama. 1997. El material vtreo de los sitios histricos en reas rurales del Depto. de
colonia: tipologa y cronologa. Arqueologa uruguaya hacia el fin del milenio. Actas del IX Congreso Nacional
de Arqueologa. Tomo II: 49-64. Montevideo.
Grayson, D. 1984. Quantitative Zooarchaeology. Topics in the Analysis of Archaeological Faunas. Academic
Press. Orlando.
Jones, O. 1991. Glass bottle push-up and pontil marks. Approaches to material culture. Research for Historical
Archeologists. Historical Archeology. 8:87-88.
Kendrick, J .1966. Price Supplement to The Antique Bottle Collector. Edwards Brothers, Inc., Ann Arbor, MI.
Lyman, R. 1994. Vertebrate taphonomy. Cambridge University Press, Cambridge.
MacKearin, G y H. MacKearin. 1941. The development of the automatic glass bottle Machines. Glass
Techonology 1 (1): 25-50.
Mengoni Goalons, G. 1988. Anlisis de materiales faunsticos de sitios arqueolgicos. Xama 1: 71-120.
Seijas, M. y M. Cereda. 1999. Arqueologa histrica de Quilmes, Anlisis de arqueofauna. Actas del XII
Congreso Nacional de Arqueologa de la Argentina, Tomo I: 509-514, Universidad Nacional de la Plata. La
Plata.
Schvelzon, D. y M. Silveira.2001. Excavaciones arqueolgicas en San Isidro. Dunken, Buenos Aires.
Silveira, M. y M. Lanza. 1999. Zooarqueologa de un sitio histrico en la ciudad de Buenos Aires, Michelangelo.
Actas del XII Congreso Nacional de Arqueologa de la Argentina, Tomo I: 515-522. La Plata.




TOMO IV - 1528
Mara Beln Colasurdo y Federico Katalinich
CAPTULO 31
MESA DE COMUNICACIONES 2

NOROESTE I (SALTA Y JUJUY)

Coordinadores
Salomn Hocsman
CONICET. Instituto de Arqueologa y Museo (IAM), FCNeIM
UNT - Instituto Superior de Estudios Sociales (ISES)
UE CONICET- UNT
Gabriel Lpez
CONICET Instituto de Arqueologa
FFyL, UBA.
Evaluadores
Claudia Aranda
Museo Etnogrfico
Juan B. Ambrosetti
FFyL, UBA
Mara del Pilar Babot
Instituto Superior de Estudios Sociales
(CONICET-UNT)
Instituto de Arqueologa y Museo (FCNeIML, UNT)
Fabiana Bugliani
CONICET
Museo Etnogrfico
Juan B. Ambrosetti
FFyL, UBA
Natalia Chiappe Snchez
CONICET- Museo de Antropologa
Universidad Nacional de Crdoba.
Mara Lorena Cohen
Instituto Superior de Estudios Sociales
(CONICET-UNT)
Instituto de Arqueologa y Museo (FCNeIML, UNT)
Mariano Colombo
CONICET, Municipalidad de Necochea
Alejandra Elas
CONICET
Instituto Nacional de Antropologa y Pensamiento
Latinoamericano
Jennifer Grant
CONICET
Instituto Nacional de Antropologa y Pensamiento
Latinoamericano
Rodolphe Hoguin
CONICET- Instituto de Arqueologa
FFyL, UBA
Andrs Izeta
CONICET-Museo de Antropologa
Universidad Nacional de Crdoba
Sara M. L. Lpez Campeny
Instituto Superior de Estudios Sociales
(CONICET-UNT)
Instituto de Arqueologa y Museo (FCNeIML, UNT)
lvaro Rodrigo Martel
Instituto Superior de Estudios Sociales
(CONICET-UNT)
Instituto de Arqueologa y Museo (FCNeIML, UNT)
Jorge Martnez
Instituto Superior de Estudios Sociales
(CONICET-UNT)
Instituto de Arqueologa y Museo (FCNeIML, UNT)
Cecilia Mercuri
CONICET- Instituto de Arqueologa
FFyL, UBA
Federico Restifo
CONICET
Instituto de Arqueologa, FFyL, UBA.
Mara Clara Scabuzzo
CONICET. Facultad de Ciencias Naturales y Museo
Universidad Nacional de La Plata
Jos Vaquer
CONICET- Instituto de Arqueologa
FFyL, UBA
Matas Medina
rea de Arqueologa y Etnohistoria
CONICET CEH





NDICE

EL REGISTRO DE LOS SITIOS ARQUEOLGICOS DE CAFAYATE
Y QUEBRADA DE LAS CONCHAS (SALTA)
Rossana Ledesma, M. Lo Celso, Claudia Subelza, M. Lujn Bravo,
Macarena Ossola, Jimena Villarroel y Eduardo Rodrguez ...................................................................... 1533

AVANCES DE LAS INVESTIGACIONES DE TRES SITIOS ARQUEOLGICOS
EN LA QUEBRADA DE LAS ARCAS, DPTO. DE CACHI, PCIA. DE SALTA:
ELEMENTOS PRELIMINARES PARA UN ANLISIS REGIONAL
Luciana Yazlle, Ana Luca Mondada y Jorge Esteban Cabral ................................................................... 1539

RESTOS SEOS HUMANOS RECUPERADOS EN FUERTE ALTO 1
Vernica Seldes, Mara Fernanda Zigaran y Jorge Cabral ....................................................................... 1545

ARQUEOLOGA REGIONAL EN LA PUNA DE SALTA:
PRIMERAS APROXIMACIONES AL ESTUDIO DE LOS SALARES
CENTENARIO, RATONES Y POCITOS
Gabriel Lpez ........................................................................................................................................... 1551

PROSPECCIONES EN LAS CUENCAS HIDROGRFICAS
DE LA SIERRA DE COBRES, SALTA, ARGENTINA
Pablo Mignone .......................................................................................................................................... 1557

PRCTICAS PASTORILES TARDAS EN LA CUENCA DEL RO GRANDE DE SAN JUAN.
UNA APROXIMACIN DESDE LOS PERFILES ETARIOS DE CAMLIDOS
Juan M. Maryaski ................................................................................................................................... 1563

RELEVAMIENTO Y EXCAVACIONES SISTEMTICAS EN
CUEVA DE CRISTBAL (EL AGUILAR, PUNA DE JUJUY):
RESULTADOS PRELIMINARES
Salomn Hocsman, Alfredo Dionicio Calisaya,
Aldo Agustn Gernimo y Romina Eliana Piccn Figueroa ..................................................................... 1569

VOLVIENDO A LA FUENTE: APROVISIONAMIENTO DE
CUARCITAS EN LAS CANTERAS DE LA MATADERA
(EL AGUILAR, JUJUY, ARGENTINA)
Alfredo Dionicio Calisaya ......................................................................................................................... 1573

SOCIEDADES ALDEANAS EN EL SECTOR NORTE DE
LA QUEBRADA DE HUMAHUACA: PRINCIPALES ASPECTOS
DEL COMPONENTE TEMPRANO DE ANTUMPA
(DPTO. HUMAHUACA, JUJUY)
Juan Bautista Leoni ................................................................................................................................... 1577

LA UTILIZACIN DE RECURSOS FAUNSTICOS EN UN
SITIO AGROALFARERO TEMPRANO: EL CASO DE ANTUMPA
(DPTO. HUMAHUACA, JUJUY)
Julieta I. Sartori, Anah Hernndez y Juan Bautista Leoni ...................................................................... 1583

RESULTADOS DE LAS INVESTIGACIONES SOBRE
OCUPACIONES TARDAS EN AZUL PAMPA, HUMAHUACA, JUJUY
Lidia Clara Garca .................................................................................................................................... 1589

EL PUKARA DE PERCHEL (DPTO. TILCARA, JUJUY): UN CASO DE
ENTIERRO DE ADULTOS EN URNA EN LA QUEBRADA DE HUMAHUACA
Agustina Scaro y Lautaro Lpez Geronazzo ............................................................................................ 1593


PREGUNTAS ARQUEOLGICAS Y RESPUESTAS DESDE LA CERMICA
EN LA QUEBRADA DE LA CUEVA, HUMAHUACA, JUJUY
Paola Silvia Ramundo ............................................................................................................................. 1599

DISTRIBUCIN, DISPONIBILIDAD Y ACCESIBILIDAD
DE MATERIAS PRIMAS LTICAS EN LA QUEBRADA DE LA CUEVA
(DEPARTAMENTO DE HUMAHUACA, PROVINCIA DE JUJUY)
Susana Prez ............................................................................................................................................ 1605

PROCESOS DE CONSTRUCCIN DE IDENTIDAD
Y MEMORIA COLECTIVA. BIOGRAFA DE CAMPO MORADO,
QUEBRADA DE HUMAHUACA
Solange Fernndez Do Rio, Melina Dcima, Mara Alejandra Llago,
Jazmn Ohanian y M. de las Victorias Villa ............................................................................................ 1611

VIDA TIL Y MUTABILIDAD MORFOLGICA DE LOS
IMPLEMENTOS DE LABRANZA AGRCOLA: LAS FORMAS TPICAS
Y ATPICAS DEL PERODO TARDO DE LA PUNA ORIENTAL
(PCIA. DE JUJUY, ARGENTINA)
Julio Csar valos .................................................................................................................................... 1615

EL PERODO HISPANO INDGENA EN LA QUEBRADA
DE HUMAHUACA. UNA VISIN DESDE LA BIOARQUEOLOGA
Humberto Maman y Vernica Seldes ..................................................................................................... 1621

ZOOARQUEOLOGA DEL SITIO MALKA. LOCALIDAD DE TILCARA.
(QUEBRADA DE HUMAHUACA, PROVINCIA DE JUJUY)
Pablo Valda .............................................................................................................................................. 1627




EL REGISTRO DE LOS SITIOS ARQUEOLGICOS DE CAFAYATE Y
QUEBRADA DE LAS CONCHAS (SALTA)
Rossana Ledesma

, M. Lo Celso

, Claudia Subelza

, M. Lujn Bravo

,
Macarena Ossola

, Jimena Villarroel

y Eduardo Rodrguez



Introduccin
En esta ponencia se sintetizan los resultados de las investigaciones realizadas desde el ao 1997 en el marco de
sucesivos proyectos, trabajos y becas financiados por el Consejo de Investigacin de la Universidad Nacional de Salta
(Lo Celso y Ledesma, 2004 y 2005; Ledesma, 1999; Subelza, 2003 b, 2008; Bravo, 2007, 2010; Ledesma, 2009b).
La zona de investigacin se encuentra en la confluencia de los ros Calchaqu y Santa Mara, y en el sector sur de
la Quebrada del Ro Las Conchas. Se caracteriza por su diversidad de paisaje, variacin estacional y numerosos
sectores de aprovisionamiento de materias primas. Adems presenta ocho accesos naturales que lo conectan con
el Valle de Lerma, Valle Yocavil, la Puna y las Selvas Occidentales.
Se han definido dos unidades de muestreo denominadas microregiones Cafayate y Santa Brbara que cuentan
con sitios arqueolgicos en diferentes grados de conservacin como campos de cultivo, enterratorios, aleros con
arte rupestre, bloques con grabados y aldeas.
El objetivo general del proyecto en vigencia ha sido el de contextualizar funcional y temporalmente a los sitios
del Sur del Valle Calchaqu. Especficamente, se busca integrar los sitios en su territorio y elaborar medidas de
proteccin del patrimonio arqueolgico.
Para ello se trabaja bajo la definicin de patrimonio como construccin social y en esta lnea se han transferido
los resultados de investigacin a diferentes actores sociales del Municipio Cafayate: escuelas de Educacin
General Bsica, centro de artesanos y Municipalidad por medio de la elaboracin de material didctico y
jornadas de actualizacin docente.

Metodologa
El registro arqueolgico en el Sur del Valle Calchaqu muestra ocupaciones humanas continuas desde tiempos
formativos, por lo que se estima que las delimitaciones territoriales se deben haber efectuado con diversos tipos
de marcadores grficos como arte rupestre, enterratorios, aldeas y campos de cultivo.
Para considerar la variacin temporal de estos marcadores grficos se analizaron los cambios en los patrones de
diseos (cermica y arte rupestre), las distintas ocupaciones humanas en los sitios arqueolgicos, la
funcionalidad de los mismos y las unidades de paisaje en que estaban implantados. Se elabor una base de datos
con informacin (descriptiva y de conservacin) y se conjugaron los datos de hbitat, proximidad a recursos
naturales y caminos. Tambin se estimaron los usos posibles del yacimiento (enterratorios, campo de cultivo,
residencia, pastoreo, talleres, etctera).
Los antecedentes recopilados de las investigaciones del Noroeste Argentino, Norte de Chile y del Valle
Calchaqu diferan en objetivos, metodologas y tcnicas empleadas. Por ello fue necesario establecer criterios
analticos de recurrencia basados en el registro arqueolgico, la documentacin, la interpretacin y los materiales
arqueolgicos asociados. Esto se realiz con el objetivo de buscar indicadores que permitan ubicar
cronolgicamente de manera relativa a los materiales arqueolgicos y establecer las posibles relaciones a corta y
larga distancia efectuadas en tiempos prehispnicos.
Definitivamente, la falta de un catlogo de los sitios arqueolgicos del municipio de Cafayate fue el obstculo al
momento de comenzar este trabajo, situacin que fue salvada con el registro de campo que se realiz. La base de
datos informtica confeccionada es abierta y permite la inclusin de nuevos datos, imgenes, mapas, datos de
conservacin e intervenciones efectuadas. La misma fue entregada a la Secretara de Cultura de la Provincia de
Salta con la salvedad expresa de que la informacin presentada sea tenida en cuenta para promover la
conservacin de los sitios antes de ser promocionados al turismo (Ledesma, 2005b).

CEPIHA - CIUNSA. Universidad Nacional de Salta. roledesma@arnet.com.ar

CONICET- CEPIHA- CIUNSA. Universidad Nacional de Salta



TOMO IV - 1533
CAPTULO 31 - MESA DE COMUNICACIONES 2

Asimismo, se ha trabajado de manera integrada con los materiales arqueolgicos y los correspondientes
contextos de hallazgo. Debido a la variedad del registro y de sus indicadores fue necesario que los integrantes del
proyecto realicen especializaciones en arte rupestre, tecnologa cermica y arqueobotnica.
Para cumplir el objetivo de promover la conservacin del patrimonio arqueolgico, las actividades arqueolgicas
se llevan a cabo en forma simultnea e integrada con la participacin de antroplogos sociales.

Resultados
El registro de sitios comenz con La Banda de Arriba y actualmente asciende a veintiocho, de los cuales cinco
poseen arte rupestre. La presencia de sitios al aire libre, y en particular de bloques y aleros sin estratigrafa,
limit notablemente las posibilidades de efectuar dataciones absolutas. Sin embargo, se realizaron fechados para
El Divisadero y La Banda de Arriba. Si bien la tipologa cermica orientaba a incluir las ocupaciones desde el
perodo Formativo Superior, ahora se cuenta con mayor sustento al respecto. Tanto los grupos de referencia
cermicos como las dataciones realizadas avalan la ocupacin durante los perodos Formativo Superior y
Desarrollos Regionales (Lo Celso y Ledesma, 2005; Ledesma, 2005a; Subelza, 2008).

Sitio Referencia Material Fecha BP Intervalo de calibracin a 1
La Banda de Arriba 1 LP 2043 Hueso 1110 90 Cal 885 1046
El Divisadero. LP 2021 Carbn 420 70 Cal 1448 1512
El Divisadero. LP 2006 Carbn 520 60 Cal 1399 1460
El Divisadero. LP 1913 Carbn 560 50 Cal 1327 1351
Figura N 1 Fechados radiocarbnicos. Sitios La Banda de Arriba 1 y El Divisadero.

La densidad de sitios arqueolgicos y la particular geografa, exigi tener muy presente a los factores
econmicos entre los motivos que hicieron preferible esta zona para ser habitada y controlada. Cada una de las
unidades de paisaje (sierra, pie de sierra, fondo de valle y caadas) se definieron por medio de sitios
arqueolgicos georeferenciados (GPS), suelos, geomorfologa, estratigrafa, hidrologa, altitud y vegetacin. En
la generacin de las unidades se proces digitalmente la imagen satelital LANDSAT 5 TM 231077/78 a travs
de los siguientes pasos: georeferenciacin de las bandas individuales en base a cartografa e imgenes,
generacin de componentes principales y factor de ndice ptimo (OIF), empleo de mtodo de clasificacin no
supervisada (CLUSTER) y ejecucin del mdulo de clasificacin supervisada para la determinacin definitiva de
las unidades ambientales. Todos los procesos digitales se realizaron con el software Idrisi Kilimanjaro (Ledesma,
2009b).

Definidas las unidades de paisaje (campo y gabinete), las mismas se cotejaron con los resultados de la
excavacin efectuada en El Divisadero y se registraron algunos bienes exticos a la zona de estudio como el
cebil, man y obsidiana, y otros locales que fueron utilizados en la tecnologa calchaqu tanto domstica como
ritual. Se destacan en este corpus de recursos vegetales manipulados para momentos de Desarrollos Regionales a
Geoffroea decorticans Jacq. (chaar), Prosopis L. (algarrobo), Arachis L. (man), Parapiptadenia excelsa
Griseb. c.f.r. (cebil) y Zea mays. Ya en el en perodo Inca, se registr el uso de los mismos recursos ya
mencionados adems de la variedad Zea mays var. amylacea (Sturtevant) Parodi, Capia; Zea mays var.
oryzaea Kuleshov, Pisingallo, y Zea Mays Marrn. La presencia en el registro de momentos Hispano -
Indgena qued evidenciada con la aparicin de Prunus persica (durazno) y Hordeum vulgare (cebada) (Bravo,
2007; 2010).

Otras materias primas locales fueron identificadas en el proceso de produccin de pinturas rupestres como yeso,
cuarzo y plagioclasas. Todos los componentes han sido registrados en las muestras de pared, estratigrafa y
fuentes de materia prima (Ledesma, 2005 a).

Adems de analizar la disponibilidad de recursos, las unidades de paisaje fueron adecuadas para considerar la
implantacin de los sitios en determinados espacios. Pero resulta que en la variedad de elecciones realizadas, las
poblaciones prehispnicas (P. Formativo y Desarrollos Regionales) han preferido la proximidad a los accesos
naturales y tradicionales al valle, especficamente en suelos con buena estabilidad. Como una constante, los
sitios no suelen ser visualizados a distancia, al contrario, desde ellos es posible observar claramente los accesos y
panormicas al valle. Si bien es posible advertir desde los mismos a otros sitios, es necesario conocer
acabadamente la ubicacin (Ledesma, 2006-2007; Ledesma, 2009b).


TOMO IV - 1534
Rossana Ledesma, M. Lo Celso, Claudia Subelza, M. Lujn Bravo, Macarena Ossola,
Jimena Villarroel y Eduardo Rodrguez


Figura N 2 Microregiones Cafayate y Santa Brbara. Ubicacin de sitios arqueolgicos sobre
unidades de vegetacin (LANDSAT 5 TM 231077/78)

Igualmente, en esta aparente invisibilidad de los sitios se puede considerar al arte rupestre como un sistema
codificado de comunicacin y que por sus caractersticas no se tratara de uno solo. El primero de ellos
corresponde al producido por los caravaneros y que reproducen en sus jaranas o paskanas informacin menos
puntual y precisa. Si bien puede ser discutible la existencia de un arte rupestre propio de estos grupos
caravaneros, habra que tener en cuenta la existencia de algunos pasadizos de comunicacin entre yungas, valle y
puna. Un segundo sistema puede ser discutido para el Perodo Formativo que se caracteriza por las figuras
compuestas (rasgos de distintos animales), felinos y mscaras. En tercer lugar, la presencia de figuras humanas
que representan a guerreros (plasmados en la cermica santaMarana) da cuenta de un sistema ms extendido en
los valles Calchaqu, Santa Mara, de Lerma y en Guachipas con sus particularidades estilsticas (Ledesma,
2005a; Ledesma, 2009b).
En una primera instancia se propuso emplear los rasgos arquitectnicos como indicador cronolgico pero la
parcialidad del registro en superficie no permite aseverar sobre el patrn de asentamiento y ha excedido
notablemente las posibilidades de estudio en esta instancia de investigacin.
Definitivamente, la cermica representada en vasijas completas como en fragmentos han resultado ms que
diagnsticas y se ha podido verificar la secuencia y tipologa dada para microregiones prximas pero con las
consecuentes particularidades locales (Ledesma, Subelza y Bravo, 2007; Ledesma y Subelza, 2009).
Los grupos de referencia de La Banda de Arriba elaborados por C. Subelza (2008) han permitido
sistematizar el material y estimar en primera instancia una cronologa relativa para el Formativo Superior a
partir de su correlacin con estilos de microrregiones aledaas. Luego fueron corroborados con un fechado
reciente para La Banda de Arriba 1 (Ledesma y Subelza, 2009). El grupo Valle Arriba o Cafayate definido
por A. Serrano (1958) para el perodo de Desarrollos Regionales integra ciertos elementos morfolgicos,
icnicos y simblicos de las urnas santaMaranas. La reciente revisin de Nastri (2008) muestra algunas
correlaciones como la forma y dimensiones pero diferencias en cuanto a los motivos plasmados en las
urnas. No sera necesaria una modificacin del grupo Cafayate, pero si integrar nuevos grupos o variantes
que pudieran dar cuenta de los movimientos de poblaciones ocurridos desde el siglo XIV.

Otro aspecto de anlisis para el indicador cermico ha incorporado el estudio tecnolgico. Se ha comenzado a
conformar una base de datos para fuentes de arcillas de la zona con la identificacin fsico-qumica de muestras
seleccionadas con ayuda de ceramistas locales. A su vez, el anlisis de una muestra arqueolgica recuperada de
SSALCAF 9 (Segunda ocupacin) corrobora la bsqueda y utilizacin de materias primas procedentes de
Quebrada de las Conchas (Subelza, 2008). Los anlisis de procedencia continan con la bsqueda de pigmentos
para la decoracin cermica y parietal.

TOMO IV - 1535
CAPTULO 31 - MESA DE COMUNICACIONES 2

Entre las acciones de promocin y conservacin del patrimonio arqueolgico se realizaron talleres de
capacitacin para los artesanos locales quienes solicitaron material que incluyera iconografa prehispnica para
poder plasmar en sus obras. El equipo confeccion material impreso que inclua diseos de arte rupestre y de
cermica de la zona de Cafayate. En una segunda instancia, a los docentes de EGB y Polimodal de la zona se les
dict un curso de perfeccionamiento gratuito y con puntaje avalado por el Ministerio de Educacin de la Provincia de
Salta. Se abordo una serie de temticas referidas a la historia de los Valles Calchaques y como producto de este
encuentro se confecciono una cartilla denominada Valles de historia que trata aspectos geogrficos, arqueolgicos e
histricos de la regin. Este material fue publicado posteriormente por la editorial de la Universidad Nacional de Salta.

Sitio
Tareas
de ampo
Indicadores
arqueolgicos
Antecedentes
SSALCAF 1 La Banda de
Arriba 1
1 A-B
Buliubasich et al, 1991; Ledesma, 1999; Lo Celso et
al, 2000; Lo Celso y Ledesma 2005; Subelza y Bravo
2004; Ledesma y Subelza, 2009
SSALCAF 2 La Banda de
Arriba 2
2-3 C-D Ledesma,1999; Lo Celso y Ledesma, 2004, 2005
SSALCAF 3 La Banda de
Arriba 3
2-3 C-D-B
Ledesma, 1999; Lo Celso y Ledesma,2004,2005;
Ledesma y Subelza, 2009
SSALCAF 4 La Banda de
Arriba 4
2-3 C-D-B
Ledesma, 1999; Lo Celso y Ledesma, 2004, 2005;
Ledesma y Subelza, 2009
SSALCAF 5 Ro Seco 2-3 C-D
Ledesma, 1999; Lo Celso y Ledesma, 2004, 2005;
Ledesma y Subelza, 2009
SSALCAF 6 Ro Colorado 2-3 C-B-E
Ledesma, 1999; Lo Celso y Ledesma, 2004, 2005;
Ledesma y Subelza, 2009
SSALCAF 7 Molinos de Piedra 2 C-D-B
Ledesma, 1999; Lo Celso y Ledesma, 2004, 2005;
Ledesma y Subelza, 2009
SSALCAF 8 San Luis 2-3 C-D-B-E
Ledesma, 1999; Lo Celso y Ledesma, 2004, 2005;
Ledesma y Subelza, 2009
SSALCAF 9 El Divisadero 1-3-4
A-C-D- B-E-
F
Ambrosetti, 1895; Toscano, 1898; Quiroga,1931;
Ledesma, 1999; Lo Celso y Ledesma, 2004, 2005;
Ledesma y de Hoyos 2001; Ledesma, 2004, 2005a,
2005b; Ledesma y Subelza, 2009
SSALCAF10 La Banda de
Arriba 5
2 A
Lo Celso y Ledesma, 2004, 2005; Ledesma y Subelza,
2009
SSALCAF 11 El Alisar 2-4 C-D-E-F
Lo Celso y Ledesma, 2004, 2005; Ledesma, 2005b;
Ledesma y Subelza, 2009
SSALCAF 16 Tres Cerritos 2-4 F de Hoyos 2005; Ledesma y Subelza, 2009
SSALCAF 17 Los Morteritos 4 B Ledesma, 2006-2007; Ledesma y Subelza, 2009
SSALCAF 18 La Banda de
Arriba 6
1 A-B Ledesma y Subelza, 2009
SSALCAF 20 Yacochuya 2 A-C-E Ledesma, 2009
SSALCAF 21 El Mollar 2 E Ledesma y Subelza, 2009
SSALCAF 22 Arroyo Colorado 2 E Ledesma y Subelza, 2009
SSALCAF 23 Chimpa 5 C-E Heredia, 1974
SSALCAF 24 Quince Caciques 5 A Bravo, 1965 (El Tribuno)
SSALCAF 25 Piedras Pintadas 4 F Ledesma, 2009
SSALCAF 26 Chuscha 5 C-E Subelza, 2003a.; Ledesma y Subelza, 2009.
SSALCAF 27 Toroyaco 5 C-E Tarrag y Scattoln, 1999
SSALCAF 28 Santa Teresita 3 C
SSALCAF 12 Santa Brbara 2 E Ledesma, 2006-2007; Ledesma y Subelza, 2009
SSALCAF 13 Confluencias 2 A Ledesma, 2006-2007; Ledesma y Subelza, 2009
SSALCAF 14 Ro Negro 2 A Ledesma, 2006-2007; Ledesma y Subelza, 2009
SSALCAF 15 Ta Jacinta 2-3 C-D Ledesma, 2006-2007; Ledesma y Subelza, 2009
SSALCAF 19 Las Figuritas 4-5 F-A
Maidana, 1968; Schobinger, 1985; Ledesma y
Subelza, 2009
Referencias
1 Excavacin
2 Registro
3 Recoleccin superficial
4 Relevamiento arte rupestre
5 Antecedentes
A Enterratorios
B Bloques con cazoletas
C Fragmentos cermicos
D Lascas
E Arquitectura remanente
F Arte rupestre
Figura N 3 Listado de Sitios Arqueolgicos en el Sur del Valle Calchaqu. Microregin Cafayate
TOMO IV - 1536
Rossana Ledesma, M. Lo Celso, Claudia Subelza, M. Lujn Bravo, Macarena Ossola,
Jimena Villarroel y Eduardo Rodrguez

Bibliografa
Ambrosetti, J. B. 1895. Las grutas pintadas y los petroglifos de la provincia de Salta. Boletn del Instituto
Geogrfico Argentino, N16, pp: 26-34
Buliubasich, C., G. Plaza y N. Acreche. 1991. Estudio de un contexto Formativo en el Valle Calchaqu. Sitio La
Banda de Arriba, Cafayate. Informe presentado al Museo de Antropologa de Salta. Manuscrito.
Bravo, R. 1965. Quince Caciques Diario El Tribuno, Salta (9/5/1965)
Bravo, M. 2007. Anlisis botnico en un sitio formativo del sector meridional del Valle Calchaqu: El
Divisadero, Cueva de los Camlidos (Cafayate, Salta). Informe final beca de estudiantes avanzados CIUNSa.
Universidad Nacional de Salta. Manuscrito.
Bravo, M. 2010. Anlisis botnico en el sitio arqueolgico: El Divisadero, Cueva de los Camlidos (Cafayate,
Salta). Tesis de licenciatura en Antropologa, Facultad de Humanidades. Universidad Nacional de Salta.
Manuscrito.
de Hoyos, M. 2005. El arte de sonrer en la Salamanca de Tres Cerritos. Cafayate, Salta. Revista Arqueologa
13, Instituto de Ciencias Antropolgicas (UBA). Buenos Aires, pp: 9-44
Heredia, O. 1974. Investigaciones arqueolgicas en el sector Meridional de las Selvas Occidentales. Revista del
Instituto de Antropologa. N5. Fac. de Filosofa y Humanidades, Univ. Nacional de Crdoba, pp: 73-132
Ledesma, R. 1999. Determinacin de estrategias adaptativas formativas a partir de puntas de proyectil, en el sur
del Valle Calchaqu. Informe Final de Beca de Investigacin para estudiantes avanzados, Consejo de
investigacin Universidad Nacional de Salta. Manuscrito.
Ledesma, R. 2004. El Alisar y El Divisadero. Dos Sitios Arqueolgicos con Pinturas Rupestres en Cafayate,
Salta. Cuadernos N15, Universidad Nacional de Salta Facultad de Humanidades, pp: 31-46
Ledesma, R. 2005 a. Contexto de produccin de pinturas rupestres en El Divisadero (Cafayate, Salta, Repblica
Argentina). Andes. Antropologa e Historia. N16. CEPIHA. Facultad de Humanidades. Universidad Nacional
de Salta, pp: 305-323
Ledesma, R. 2005 b. Avance de investigacin y planeamiento especial de proteccin en el sitio arqueolgico El
Divisadero, Cafayate, Salta. Pacarina 5. Arqueologa y Etnologa Americana. Facultad de Humanidades y
Ciencias Sociales. Universidad Nacional de Jujuy, pp: 101-111
Ledesma, R. 2006-2007. Integracin de sitios con Arte Rupestre y su territorio en la Microregin Cafayate
(Provincia de Salta). Cuadernos del Instituto Nacional de Antropologa N21. Buenos Aires, pp: 115-132
Ledesma, R. 2009a. Estudio de territorialidad en el Sur del Valle Calchaqu. En Seplveda, M.; L. Briones y J.
Chacama (Eds.). Crnica sobre las piedras. Arte rupestre de las Amricas. Ediciones Universidad de Tarapac,
Arica. Chile. pp: 245-256
Ledesma, R. 2009b. El arte rupestre en el Sur del Valle Calchaqu (Salta, Argentina). Estudio de territorialidad
por medio de marcadores grficos. Tesis para la obtencin del grado de doctor. Facultad de Filosofa y Letras.
Universidad de Alcal, Alcal de Henares (Espaa). Manuscrito.
Ledesma, R. y M. de Hoyos. 2001. El Divisadero: Cien aos despus... Arte rupestre en Cafayate, provincia de
Salta. Arte rupestre y regin; arte rupestre, menhires y tacitas en el Sur de Bolivia, NO de Argentina y Norte de
Chile. Fernndez Distel, A. (Comp.) Anuario del CEIC N2. Facultad de Humanidades y ciencias Sociales.
Universidad Nacional de Jujuy. pp: 151-164
Ledesma, R. C. Subelza y L. Bravo. 2007. Una Reevaluacin del Sitio Formativo La Banda de Arriba (Cafayate,
Salta). Actas del XVI Congreso Nacional de Arqueologa Argentina. Tomo II, Jujuy. pp: 307-312
Ledesma, R. y C. Subelza. 2009. Alcances y limitaciones para caracterizar las ocupaciones formativas en
Cafayate. Andes. Antropologa e Historia. N20. Edicin Especial. CEPIHA. Facultad de Humanidades.
Universidad Nacional de Salta. pp: 75-109.
Lo Celso, M., B. Lescano y E. Barbarn. 2000. El impacto del Perodo Formativo en la zona sur del valle
Calchaqu: La Banda de Arriba (Cafayate), Salta. Informe final del Proyecto de investigacin N 702, CIUNSa,
Universidad Nacional de Salta. Manuscrito.
Lo Celso, M. y R. Ledesma. 2004. Aportes sobre evidencias Formativas en el municipio de Cafayate (Salta).
Actas XV Congreso Nacional de Arqueologa Argentina, Ro Cuarto. Mesa de Comunicaciones Noroeste
Argentino. Versin Digital.
Lo Celso, M. y R. Ledesma. 2005. Sitios arqueolgicos formativos en el municipio de Cafayate (Salta). Avances
de investigacin. I Jornadas de Antropologa. Facultad de Humanidades, Universidad Nacional de Salta. pp:
267-282.
Maidana, O. 1968. Nacimientos y Alemana (dos litogramas en la Quebrada de Las Conchas, provincia de
Salta). Direccin de Cultura, Salta.
Nastri, J. 2008. La figura de las largas cejas de la iconografa santaMarana. Chamanismo, sacrificio y
cosmovisin Calchaqu. Boletn del Museo Chileno de Arte Precolombino. Vol. 13. N1. pp: 9-34.
Quiroga, A. 1931. Petrografas y Pictografas de Calchaqu. Universidad Nacional de Tucumn.
TOMO IV - 1537
CAPTULO 31 - MESA DE COMUNICACIONES 2

Schobinger, J. 1985. rea de los agricultores y pastores andinos (Puna, Valles y Quebradas del Noroeste
Argentino, Regin Cuyana). Arte Rupestre de la Argentina. Cazadores de la Patagonia y Agricultores Andinos.
Schobinger, J. y C. Gradn (eds). Encuentro, Madrid. pp. 50-79.
Serrano, A. 1958. Manual de Cermica Indgena. Ed. Assandri, Crdoba.
Subelza, C. 2003a. Apuntes preliminares acerca del material cermico formativo del sitio Chuscha, Cafayate
Pcia. de Salta. VIII Congreso Nacional y I Latinoamericano de estudiantes de Arqueologa. Universidad Nac. de
Salta. Manuscrito
Subelza, C. 2003b. Aproximacin al manejo de recursos para la produccin de Cermica Formativa en la
Microregin Cafayate (Pcia. de Salta). Informe final de beca para estudiantes avanzados Consejo de
Investigacin, Universidad Nacional de Salta.
Subelza, C. 2008. Manejo de recursos para el proceso productivo de la cermica Formativa en el sector
meridional del valle Calchaqu y sus implicancias sociales. Tesis de Grado Licenciatura en Antropologa.
Facultad de Humanidades, Universidad Nacional de Salta. 2008, Manuscrito.
Subelza, C. y L. Bravo. 2004. Grupos de referencia de cermica formativa para el sector Meridional del Valle
Calchaqu: Sitios La Banda de Arriba y Chuscha, Depto. Cafayate, Salta. Actas XV Congreso Nacional de
Arqueologa Argentina. Ro Cuarto, Crdoba. Mesa de comunicaciones de estudiantes. Versin digital.
Tarrag, M. y M. Scattoln. 1999. La problemtica del Perodo Formativo en el Valle de Santa Mara. Actas del
XII Congreso Nacional de Arqueologa Argentina. Tomo 1. La Plata, pp: 142-153.
Toscano, J. 1898. La regin calchaquina: pginas de historia pre y postcolombina y de arqueologa
calchaquina, Buenos Aires.
TOMO IV - 1538
Rossana Ledesma, M. Lo Celso, Claudia Subelza, M. Lujn Bravo, Macarena Ossola,
Jimena Villarroel y Eduardo Rodrguez

AVANCES DE LAS INVESTIGACIONES DE TRES SITIOS ARQUEOLGICOS
EN LA QUEBRADA DE LAS ARCAS, DPTO. DE CACHI, PCIA. DE SALTA:
ELEMENTOS PRELIMINARES PARA UN ANLISIS MICROREGIONAL
Luciana Yazlle
*
,
25
Ana Luca Mondada
**
y Jorge Esteban Cabral
***


Introduccin
La intencin de este trabajo es presentar brevemente los resultados preliminares de las investigaciones llevadas a
cabo en tres sitios vecinos ubicados sobre la margen oriental de la quebrada de Las Arcas, en la localidad de
Cachi Adentro, departamento de Cachi, provincia de Salta.
En funcin de actividades de prospeccin en dicha quebrada, la planimetra de los sitios y algunos resultados de
excavaciones, as como a travs de la descripcin, anlisis y comparacin del modo de emplazamiento y
caractersticas constructivas, se espera efectuar un acercamiento a las particularidades de la organizacin
espacial de estos asentamientos.

A continuacin, se presenta el estado de la cuestin de las investigaciones en curso desarrolladas en los sitios
conocidos como La Hoyada (SSalCac 144-145), Epifanio Burgos (SSalCac 170) y Choque (SSalCac 17).
Mediante su descripcin y anlisis, en base a un abordaje metodolgico consistente en la comparacin de la
organizacin interna de los poblados, el tipo de estructuras presentes, el lugar de emplazamiento, la superficie
ocupada y la distancia relativa entre los mismos, se busca proveer elementos que permitan comenzar a formular
planteos sobre las caractersticas del patrn espacial, sus criterios funcionales y la posibilidad de una ocupacin
contempornea; y de esta forma, realizar un aporte a la discusin sobre los procesos por los que atravesaron las
poblaciones prehispnicas del Norte del Valle Calchaqu.

Quebrada de Las Arcas
La quebrada de Las Arcas, ubicada hacia el oeste del pueblo de Cachi, tiene una extensin aproximada de 16 km
y se encuentra recorrida de norte a sur por el ro homnimo, el cual constituye uno de los afluentes ms
importantes del ro Calchaqu. A lo largo del recorrido de dicha quebrada se encuentran ubicados diversos sitios
arqueolgicos emplazados a muy corta distancia (entre 2 y 4 km) entre s, que presentan una amplia variabilidad
respecto del patrn de emplazamiento y organizacin interna. En los extremos de la quebrada de Las Arcas se
emplazan dos sitios multicomponentes de gran tamao: ubicada al norte, se encuentra la localidad arqueolgica
de Las Pailas (SSalCac 18) (Tarrag, 1980) y llegando al lmite sur, con una extensin de aproximadamente 20
hectreas se encuentra el sitio de Borgatta (SSalCac 16), que actualmente es investigado por DeMarrais (2001).
Los otros sitios identificados, de norte a sur a lo largo de la quebrada son: Cancha San Miguel (SSalCac 171),
Choque (SSalCac 17), Epifanio Burgos (SSal Cac 170) y La Hoyada (SSalCac 144), los cuales -con excepcin
de SSalCac 171- se encuentran ubicados sobre las mrgenes orientales de la quebrada de Las Arcas.

Entre los aos 2005 y 2008 se realizaron prospecciones en la quebrada de Las Arcas, en colaboracin con el
Museo Arqueolgico de Cachi Po Pablo Daz (Cabral et al., 2008). Como resultado de dichas prospecciones,
se focalizaron las investigaciones en tres sitios: La Hoyada (SSalCac 144-145), Epifanio Burgos (SSalCac 170) y
Choque (SSalCac 17). En cada uno de ellos se llev a cabo un relevamiento planimtrico con el objetivo de
obtener una aproximacin a la organizacin interna de los poblados, as como de analizar en primera instancia su
disposicin y organizacin y de realizar una caracterizacin de la variabilidad de las estructuras que conforman
cada sitio. El avance de los resultados de este estudio se presenta a continuacin:
CHOQUE (SSALCAC 17)

A una distancia aproximada de 3km del sitio Las Pailas, en la parte norte de la Quebrada, se localiza un sector en
donde pueden distinguirse dos emplazamientos edificados, separados por una distancia de 100 m entre s. Estos
sitios, denominados como Choque Norte y Choque Sur
1
, se disponen siguiendo el margen izquierdo de la

*
CEPHIA, Facultad de Humanidades, Universidad Nacional de Salta. lyazlle@argentina.com
**
Facultad de Humanidades, Universidad Nacional de Salta. ana_lu17@hotmail.com
***
Museo Arqueolgico de Cachi- Facultad de Humanidades, Universidad Nacional de Salta. jorgitoca_84@hotmail.com
1
Si bien se ha considerado en el contexto de esta investigacin -y de forma preliminar- como integrantes del sitio Choque a estos dos
sectores edificados, las referencias publicadas previamente sobre el sitio SSalCac 17 parecen aludir mayormente (si bien no explcitamente)
a lo que aqu se denomina Choque Sur (Daz, MS; Tarrag y Daz, 1972; De Lorenzi y Daz, 1977; Pollard, 1983).
TOMO IV - 1539
CAPTULO 31 - MESA DE COMUNICACIONES 2

Quebrada, y presentan una organizacin espacial dismil. Entre medio de ambos se encuentran, de forma aislada,
muros simples que presentan un alto grado de deterioro.

El sitio arqueolgico que se ubica hacia el suroeste - Choque Sur- consta de 3,2 hectreas y se encuentra situado
en un terreno muy irregular, el cual se encuentra atravesado por dos crcavas de aproximadamente 5m de ancho
y 3m de profundidad. En una de ellas se encontraron dos tumbas que fueran motivo de un rescate realizado por
Daz en 1983, y de las que se obtuvieron restos de crneos y huesos dispersos, algunos fragmentos de urnas
cermicas, y lajas que funcionaban como tapas de las tumbas (Daz, Ms).
El patrn de instalacin est constituido por dos tipos de construcciones principales: por un lado, se encuentran
tramos de muros que corresponderan a posibles estructuras, pero que debido a los sucesivos aluviones de
sedimentos provenientes de la parte superior del cerro, se hallan muy deteriorados y casi completamente
enterrados, hacindose visibles en extensiones muy cortas, que frecuentemente no superan los 3 metros. Los
muros son, en su gran mayora, simples, presentando ngulos rectos, a pesar de que se han encontrado tambin
unas pocas estructuras pequeas de aparente forma circular. A la vez, se localizan ciertas acumulaciones
artificiales de tierra (o montculos), cuya superficie se encuentra nivelada, a modo de terrazas. Estos montculos
se ubican de forma relativamente escalonada sobre la pendiente.

El hecho de que no pueda identificarse ninguna estructura completa dificulta la determinacin de la presencia de
recintos. En este sentido, cobran mucha importancia las consecuencias de los fenmenos de arrastre, dado que
han modificado en gran medida la superficie del sector, influyendo en el grado de dispersin y de acumulacin
de las evidencias muebles. El material cermico que se ha registrado disperso sobre toda la superficie del sector,
muestra un alto grado de variabilidad con respecto a atributos de pasta y decoracin (entre los que se destacan
los tipos rojo moncromo de buena calidad, con decoracin pintada de tipo santaMarana y sin decoracin). El
material ltico en superficie es escaso, registrndose algunas lascas y preformas, principalmente de obsidiana,
as como varios instrumentos de molienda (manos, conanas y morteros) desplazados hacia el fondo de las
crcavas.

El otro sitio, ubicado a 100m hacia el Noroeste de aqul y denominado Choque Norte, est localizado sobre una
quebrada subsidiaria rumbo sud-noroeste, por la que recorren varios cauces de agua estivales que desembocan en
el ro Las Arcas. Es un sitio que abarca un permetro de alrededor de 6 hectreas, en las que se distribuyen de
forma dispersa estructuras y montculos longitudinales y angostos. El estado de conservacin de las estructuras
es mejor que el del caso anterior, debido principalmente a que la pendiente es mucho menor, haciendo posible la
identificacin de grupos de recintos, los cuales se distribuyen por el noreste y el este del sector, con
caractersticas constructivas variadas. En su mayora, las estructuras presentan formas subcirculares, su tamao
vara entre los 10 y 20 metros de dimetro, y estn constituidas por muros dobles.

Hacia el noreste del sitio se distingue tambin un sector nivelado artificialmente que atraviesa casi todo el ancho
de esa porcin y que presenta una hilera de pequeos muros delimitan dicha porcin. Estos muros podran haber
funcionado a modo de contencin o posiblemente para nivelar el terreno.
En lo que respecta a los montculos, stos estn situados desde la mitad del sector hacia el sur, principalmente en
zonas donde no hay evidencias de estructuras, y consisten en acumulaciones de rodados con un largo de hasta
100m y un ancho que vara entre los 2 y los 3 m. Se disponen siguiendo la pendiente del terreno, presentando
algunos de ellos tramos de muros en su parte inferior.

La densidad de material en superficie particularmente la cermica, disminuye notablemente con respecto a los
dems casos estudiados, al igual que su variedad y calidad. En general, la cermica presente en este sector es roja
y de fabricacin tosca, tanto los fragmentos decorados como los sin decoracin.

Epifanio Burgos (SSALCAC 170)
El sitio Epifanio Burgos se encuentra emplazado sobre la margen oriental del ro Las Arcas a 8 km hacia el
noroeste del pueblo de Cachi. El mismo abarca alrededor de 2 hectreas sobre una ladera con una pendiente de
orientacin noroeste suroeste. El sitio presenta estructuras en dos faldeos distintos sobre la misma ladera, ya
que actualmente la formacin de una crcava de escurrimiento produjo la destruccin de parte de las evidencias,
seccionando el emplazamiento en dos, aunque se registra una menor presencia de estructuras en el sector N que
en el S.

La planta de Epifanio Burgos exhibe un patrn concentrado, conformado por estructuras que presentan
variabilidad tanto en su diseo arquitectnico como en las tcnicas constructivas. Se reconocieron en el sitio
TOMO IV - 1540
Luciana Yazlle, Ana Luca Mondada y Jorge Esteban Cabral

aproximadamente 30 estructuras entre las que se identificaron 9 recintos circulares, 3 recintos rectangulares y 12
montculos, as como un muro perimetral y tramos de muros, algunos de ellos, aparentemente relacionados con
la contencin de la pendiente, y otros, posiblemente, parte de recintos cubiertos por los diversos procesos de
formacin de sitio. El muro perimetral est constituido mayormente por un pircado simple, que en algunos
tramos se convierte en doble.

El patrn ms frecuente registrado en el sitio es el de tipo circular, el cual se manifiesta ms claramente hacia el
sector este del mismo y se corresponde con recintos de planta circular y subcircular, con un dimetro variable
entre 4 y 12 m. Dispersos entre los recintos, y muchos de ellos asociados a su vez a recintos circulares, se
presentan estructuras monticulares, que se distribuyen con mayor densidad en los sectores en los que la
pendiente es ms abrupta. El patrn rectangular parece registrarse ms claramente hacia la mitad oeste del sitio,
en el sector inferior del faldeo.

Los montculos presentan formas variables, pudindose distinguir entre aquellos que exhiben un permetro
circular y los que muestran una forma ms bien ovalada. Se trata de estructuras artificiales cuyo dimetro vara
aproximadamente entre 5 y 8 m con una altura mxima aproximada de 1 a 1,50 metros. Por otro lado, es posible
distinguir en la mayora de ellos tramos de muros simples asociados, ya sea rodeando el permetro basal y/o
sobre el extremo superior de los mismos. El emplazamiento de los montculos en el sitio se encuentra asociado a
los sectores de mayor concentracin de estructuras habitacionales, registrndose, en la mayora de los casos, en
proximidad a estructuras circulares.

Las excavaciones realizadas en uno de los montculos del sitio permitieron definir una estratigrafa homognea,
un solo estrato de relleno, y ningn nivel de ocupacin que permita considerar que la funcionalidad del mismo
corresponda al de una estructura habitacional. Dicho montculo sera producto de un evento intencional de
construccin, en donde los muros registrados tanto en superficie como en el interior del mismo, presentan escasa
calidad constructiva y aparente caracterstica de muros expeditivos, que podran haber sido realizados con el fin
de contener el relleno.

Los restos arqueolgicos recuperados formando parte del sedimento de relleno presentaron un palimpsesto de
materiales en los que la cermica decorada caracterstica del perodo de Desarrollo Regionales se encuentra en
gran proporcin, asociada con otros estilos cermicos ms tempranos en el relleno del montculo. Esto
posibilitara plantear que la construccin de esta estructura se llev a cabo en las ltimas ocupaciones del sitio.

La Hoyada (SSALCAC 144)
El sitio correspondera a un conglomerado de estructuras que varan en su tipo, las cuales se distribuyen sobre la
primera y segunda terraza de la margen izquierda del ro Las Arcas. Asociados a estas, hemos registrado en
superficie una importante cantidad de fragmentos cermicos, como as tambin la presencia de grabados
rupestres. El sitio presenta una extensin aproximada de unas 4ha y es atravesado por el camino vecinal que une
el paraje Las Pailas con el poblado actual de Cachi.

El patrn de instalacin corresponde a un conglomerado de recintos circulares y rectangulares conjuntamente
con montculos que se presentan en el terreno de manera dispersa. Resulta llamativa la densidad de estructuras,
habiendo contabilizado un total de treinta y seis, las cuales en algunos casos renen hasta dos recintos circulares
o rectangulares.

La presencia de estructuras circulares es mayor en relacin a los recintos rectangulares o subrectangulares. Sin
embargo, en ambos casos constituyen grandes recintos que pueden alcanzar unos diez metros de largo o de
dimetro. Esto pareciera suceder con el recinto excavado con anterioridad por Kirsten Olsen (Museo de Cachi,
1999), el cual correspondera a una estructura subrectangular, de muro doble y ngulos redondeados en cuya
base se observan grandes piedras que, en algunos casos, evidencian un trabajo de canteado.
Tambin son llamativos algunos muros simples que se ubican sobre los sectores de mayor pendiente, los cuales
corresponden a hileras simples de rodados que se disponen de manera perpendicular a la pendiente y que
sugieren una funcionalidad relativa a la contencin de las estructuras.

En cuanto al patrn monticular, ste puede observarse con menor frecuencia, ms aun si tomamos en cuenta la
extensin del sitio en comparacin a lo registrado en Epifanio Burgos (Cabral et al, 2008; Yazlle, 2009) o
Borgatta (Pollard, 1983; DeMarrais 2001). En este caso, los montculos se encuentran en los lugares en que el
terreno posee un desnivel gradual. Generalmente se conforman por una planta relativamente circular y se
TOMO IV - 1541
CAPTULO 31 - MESA DE COMUNICACIONES 2

encuentran asociados a muros pequeos que parecieran corresponder a estructuras contiguas, sin que pueda
observarse sobre la superficie algn rasgo arquitectnico que funcionara a modo de contencin o delimitacin.

Uno de los hallazgos ms notorios de La Hoyada, es la presencia de grabados rupestres ubicados a menos de 10
m de los recintos habitacionales, sobre la margen de la terraza sureste que limita con una pequea quebrada
subsidiaria al ro Las Arcas. Los petroglifos corresponden a 15 figuras, algunas muy deterioradas, entre las que
se distinguen motivos tumiformes, serpentiformes, antropomorfos y geomtricos. Respecto al anlisis de las
ocupaciones en el sitio, toma relevancia el hallazgo realizado por Po Pablo Daz, (Daz, Ms), correspondiente a
una tumba abovedada, del tipo en bota, encontrada accidentalmente por la erosin provocada por lluvias
estivales. Aunque todava queda por aclarar la relacin entre el enterratorio y el contexto habitacional, este
hallazgo confirma la utilizacin del sitio durante el perodo Hispano- indgena.

Quebrada de Las Arcas: elementos para la discusin
Los sitios arqueolgicos forman parte de un registro que se entiende como espacialmente continuo, por lo que no
pueden ser considerados como entidades separadas del contexto que los rodea, sino que deben considerarse
como parte integrante del paisaje, a mayor escala, entendiendo por el mismo una realidad histrica y
socialmente producida, la cual guarda directa relacin con la forma de racionalidad del grupo humano que lo
gener, as como con las estrategias de apropiacin de la naturaleza y el entramado simblico de esta poblacin
(Criado, 1991, 1999) (Troncoso, 2001: 2). En tal lgica, el espacio geogrfico y el paisaje, tanto a escala de la
regin, como a escala del sitio, del recinto, o an a escala del artefacto, son construcciones sociales, expresiones
fenomenolgicas de los procesos sociales y naturales a lo largo de perodos continuos de tiempo, y, por tanto,
llevan implcitas formas de organizacin y percepcin del espacio, que son reflejo y producto de los procesos
socioculturales en los que sus habitantes se vieron involucrados.

El Valle Calchaqu en general, y particularmente el sector norte, que es donde se ubica el rea de estudio, ha
dado muestras, a lo largo de los muchos aos que lleva siendo investigado, de la existencia de una amplia
variedad y cantidad de formas de asentamiento, en un intervalo de tiempo prolongado en muchos casos con
ocupaciones continuas, desde los asentamientos de cazadores-recolectores hasta la actualidad. La quebrada de
Las Arcas, asimismo, da evidencias en su conjunto de la complejidad de los procesos de ocupacin y la vida de
las sociedades del norte del Valle Calchaqu.

La misma constituye una zona muy frtil en donde las condiciones de habitabilidad son altas, con un curso de
agua permanente, como lo es el ro Las Arcas, y con tierras altamente aptas para el cultivo. Estas caractersticas
sugieren la posibilidad de que se haya tratado de un espacio de localizacin privilegiado para los habitantes
prehispnicos de la regin, hiptesis que apoya el hecho de que, a lo largo del tiempo, haya sido el lugar de
establecimiento de diversos asentamientos de caractersticas variadas, los cuales se suceden de forma casi
continua a lo largo de la misma.

Estos sitios presentan, entre otras caractersticas comunes, su ubicacin a escasa distancia entre s, sobre las
mrgenes frtiles del ro homnimo, en pequeas quebradas aledaas, con excepcin de Las Pailas que se ubica
sobre el fondo de la quebrada principal. Por un lado, tenemos dos sitios multicomponentes de gran extensin:
Borgatta (SSalCac 16) y Las Pailas (SSalCac 18). Sus ocupaciones son claves para comprender la dinmica de
las poblaciones de la quebrada de Las Arcas y del Valle Calchaqu Norte.

Por otro lado, se registran otros sitios de tamao ms reducido, pero no por ello de menor complejidad interna
que los anteriormente mencionados; La Hoyada (SSalCac 144-145), Choque (SSalCac 17) y Epifanio Burgos
(SSalCac 170), ubicados sobre la margen oriental de la quebrada, y Cancha San Miguel (SSalCac 171), sobre la
margen occidental. Este ltimo fue recientemente registrado por el Museo Arqueolgico de Cachi, y se
caracteriza por un escaso nmero de estructuras que se encuentran dispersas y poco definidas por el alto grado de
erosin.
Con respecto a la temporalidad de las ocupaciones en la quebrada de Las Arcas, sta pareciera abarcar un rango
muy amplio, desde los inicios del perodo de Desarrollos Regionales hasta entrado el perodo de contacto
hispano-indgena. Los fechados existentes corresponden a un montculo-basural excavado por Pollard en
Borgatta, que dieron los siguientes resultados: 125785 DC, 118489 DC, 1202140 DC, 111089 DC 111989
DC, donde ...las colecciones de la superficie del sitio Borgatta demuestran que la ocupacin del sitio comienza
antes y termina ms tarde que el perodo representado por el montculo basural excavado (Pollard, 1983: 78).
Con posterioridad, DeMarrais (2001) public una sntesis sobre el sitio en la que discute su ocupacin
TOMO IV - 1542
Luciana Yazlle, Ana Luca Mondada y Jorge Esteban Cabral

prolongada, al igual que la del sitio Las Pailas (Tarrag, 1980), tambin representativo del perodo de
Desarrollos Regionales.

En el caso de Epifanio Burgos, un fechado proveniente del piso de ocupacin de un Recinto subcircular (R10)
arroja un resultado de 560 70 AP (Yazlle, 2009). El contexto fechado, se encontr asociado a cermica
santaMarana y a fragmentos de una pieza de cermica ordinaria, cuyas formas son similares a otras halladas en
Borgatta y Tero, relacionadas con ocupaciones del perodo de Desarrollos Regionales, pertenecientes a las
colecciones del Museo Arqueolgico de Cachi. Sin embargo, la presencia de elementos tales como la
variabilidad de cermica evidenciada en el montculo excavado, parte de la cual se asocia a estilos caractersticos
del Formativo en la regin, o la variabilidad respecto de la arquitectura registrada, permiten pensar que el sitio
probablemente estuvo ocupado antes de dicho perodo.

En ninguno de los sitios mencionados existen elementos que permitan identificar de manera clara la presencia
incaica en la Quebrada de Las Arcas, con excepcin de Choque, sitio para el cual se hace referencia a la
excavacin de una tumba de la que se recuper material de posible filiacin incaica (De Lorenzi y Daz, 1977).
Sin embargo, esta posible presencia de material incaico, por el momento, solo puede identificarse en dicho
hallazgo aislado. Por otro lado, y en base a un trabajo de seriacin cermica, Pollard identific a Choque como
una aldea-cementerio con ocupaciones pertenecientes al Perodo Medio (600 - 1000 d.C.) y al Tardo (1000 -
1400 d.C.) (Pollard, 1983).
A la vez, como se ha dicho, existen antecedentes en el sitio La Hoyada de su utilizacin en el momento de
contacto hispano-indgena (Daz, MS).

Si bien las evidencias indican la posibilidad de un perodo de ocupacin tan extenso de la Quebrada, resulta de
importancia destacar que es en el Perodo de Desarrollos Regionales cuando parece haber estado ms
densamente ocupada, dado que todos los sitios mencionados presentan abundante material perteneciente a este
intervalo. En ese sentido, es posible tambin observar algunas regularidades manifiestas en la disposicin y las
caractersticas espaciales de los sitios. En la mayora de los casos, se trata de patrones concentrados que
comparten elementos comunes, tales como la coexistencia de estructuras circulares, rectangulares y montculos,
y que en muchos casos evidencian similitudes respecto de los patrones constructivos, que, posiblemente,
respondan a soluciones arquitectnicas vinculadas con aspectos especficos de los espacios de localizacin de
cada sitio. Por otro lado, estos mismos elementos se presentan con variaciones particulares en el seno de cada
emplazamiento.

Los trabajos llevados a cabo actualmente sobre los sitios expuestos abren lneas particulares que, esperamos,
permitan aclarar el panorama respecto de la ocupacin de la Quebrada de Las Arcas. Si bien en este trabajo no se
exponen detalladamente los resultados del anlisis de cada sitio respecto del patrn de asentamiento,
recolecciones de superficie, excavaciones y el anlisis del material recuperado en cada contexto, mucha de esta
informacin se encuentra siendo analizada a fin de contar con elementos para comenzar a situar estos sitios en
relacin con otros aledaos del rea, y a su vez para definir indicadores ms claros que permitan asociaciones
temporales y cronolgicas que posiblemente se manifiesten en relacin a las particularidades regionales.

Si bien las investigaciones se encuentran, en la mayora de los casos, en etapas iniciales, consideramos que los
interrogantes aqu planteados constituyen una contribucin a la discusin sobre los procesos regionales
particulares, y de esta forma, son un aporte al conocimiento de la Arqueologa regional.

Bibliografa
Ambrosetti, J.B. 1907 Exploraciones Arqueolgicas en la ciudad Prehistrica de La Paya (Valle Calchaqu,
Provincia de Salta). Facultad de Filosofa y Letras, Seccin Antropologa n 3, Buenos Aires.
Baldini, L., E. Baffi, L. Quiroga y V. Villamayor 2004 Los Desarrollos Regionales en el valle Calchaqu, Salta.
Relaciones de la Sociedad Argentina de Antropologa XXIV: 59-80. Buenos Aires.
Cabral, J.; L. Yazlle.; A.L. Mondada y M. C. Rivolta 2008 Aportes al conocimiento del Formativo Final e inicios
de los Desarrollos Regionales en la Quebrada de Las Arcas, Valle Calchaqu Norte (Salta, Argentina). Actas de
las IX Jornadas de Investigacin en Ciencias Sociales. Universidad Nacional de Jujuy, Jujuy.
Debenedetti, S. 1908 Excursin arqueolgica a las ruinas de Kipn (Valle Calchaqu-Provincia de Salta).
Publicaciones de la Seccin Antropolgica, 4. Facultad de Filosofa y Letras, Universidad de Buenos Aires,
Buenos Aires.
De Lorenzi, M. y P.P. Daz 1977 La ocupacin incaica en el sector septentrional del Valle Calchaqu. Estudios
de Arqueologa 2: 43-59, Museo Arqueolgico de Cachi, Prov. de Salta.
TOMO IV - 1543
CAPTULO 31 - MESA DE COMUNICACIONES 2

Demarrais, E. 2001 La Arqueologa del Norte del Valle Calchaqu. Historia Argentina Prehispnica. Compilado
por E. Berberian y A. Nielsen. Vol 1: 289-346., Ed. Brujas, Crdoba.
Daz, P.P. Libretas de campo, Museo Arqueolgico de Cachi, Salta. Manuscrito.
Daz, P.P. 1983 Sitios Arqueolgicos del Valle Calchaqu. Estudios de Arqueologa, 3- 4. Museo Arqueolgico
de Cachi, Salta.
Pollard, G. 1983 Nuevos aportes a la Prehistoria del Valle Calchaqu, Noroeste argentino. Estudios de
Arqueologa N 3-4: 69-92, Museo Arqueolgico de Cachi, Salta.
Tarrag, M.N. 1980 Los asentamientos aldeanos tempranos en el sector septentrional del Valle Calchaqu,
Provincia de Salta y el desarrollo agrcola posterior. Estudios Atacameos 5, Antofagasta, Chile.
Tarrag, M.N. Y P.P. Daz 1972 Sitios Arqueolgicos del Valle Calchaqu. Estudios de Arqueologa N1: 49-61,
Museo Arqueolgico de Cachi, Salta.
Tarrag, M.N. Y P.P. Daz 1977 Sitios Arqueolgicos del Valle Calchaqu. Estudios de Arqueologa N2: 63-71,
Museo Arqueolgico de Cachi, Salta.
Yazlle, L. 2009. Organizacin de los espacios residenciales en el sitio Epifanio Burgos (Valle Calchaqu Norte)
durante el Formativo y su transicin hacia los Desarrollos Regionales Tesis para optar al ttulo de Licenciado en
Antropologa, Facultad de Humanidades, Universidad Nacional de Salta.
TOMO IV - 1544
Luciana Yazlle, Ana Luca Mondada y Jorge Esteban Cabral

RESTOS SEOS HUMANOS RECUPERADOS EN FUERTE ALTO 1
Vernica Seldes
*
, Mara Fernanda Zigarn
**
y Jorge Cabral
***



Resumen
En este trabajo se presentan los resultados del anlisis de un conjunto de restos arqueolgicos, recuperados en
junio del 2006 en la calle principal del barrio Fuerte Alto de Cachi (Salta). El sitio, que corresponde al perodo
de Desarrollos Regionales (siglos IX al XV) se encuentra altamente perturbado por la construccin de un barrio
por encima y alrededor del mismo.

En las tareas de rescate se registr la presencia de una estructura rectangular de piedras que contena una urna
con restos seos humanos y fragmentos de piezas cermicas. Tanto los restos seos como la cermica fueron
rpidamente extrados del lugar para ser analizados posteriormente en laboratorio.
Se trata de un entierro compuesto por un total de cinco individuos depositados en posicin genuflexa. Se realiz
la estimacin de edad, determinacin de sexo y anlisis de estilo de vida y estado de salud a travs de
indicadores de estrs nutricional, metablico, dieta, estrs funcional, traumas e infecciones, incorporndose el
anlisis de prcticas deformatorias en el crneo.

A partir del anlisis de los indicadores mencionados se concluye que los individuos registran casos de hipoplasia
del esmalte e hiperostosis portica (estrs nutricional y metablico), caries, desgaste del esmalte dental,
osteoartritis y estrs msculo esqueletal (estrs funcional), traumas e infecciones.

Introduccin
El valle Calchaqu, que recorre de norte a sur los territorios de Salta, Tucumn y Catamarca, se caracteriza por
ser una fosa tectnica de aproximadamente 200 km de longitud emplazada en el macizo puneo y parte de la
cordillera oriental; presenta extensos depsitos de pie de monte, conos aluviales y bajadas, y varios niveles
aterrazados de formacin reciente. El departamento de Cachi (figura 1), por su parte, se ubica en el sector
septentrional del valle Calchaqu, al oeste de la provincia de Salta, en la convergencia de los ros Cachi y
Calchaqu a 2280 msnm formando parte de la regin valliserrana (Tarrag, 1974 y 1976).

El Valle Calchaqu, hacia el perodo de desarrollos regionales (siglos X al XV) se presenta como un complejo
escenario; en este sentido, las investigaciones en la regin dan cuenta de procesos de incremento de la poblacin,
concentrada en aglomerados con instalaciones defensivas, acompaados de un momento de intensificacin de la
produccin agrcola con evidencias de intercambios interregionales (Tarrag, 2000).

A pesar de constituir una de las regiones del Noroeste Argentino y de los Andes Meridionales ms exploradas
por la arqueologa, es mucho lo que se desconoce acerca de sus prcticas mortuorias, incluso para el perodo de
Desarrollos Regionales, el perodo que ms ha sido estudiado en la regin.

Muchas de las descripciones acerca de las caractersticas de los entierros corresponden en su mayora a las
investigaciones de principios del siglo pasado (Ambrosetti, 1907, Debenedetti, 1908); las mismas son
fragmentarias y no logran dar cuenta del comportamiento mortuorio de los pueblos prehispnicos. Sumado a
esto, son escasos los restos seos humanos en conexin anatmica y con informacin acerca de su contexto,
disponibles para su anlisis bioarqueolgico. Sin embargo esta situacin est comenzando a revertirse en los
ltimos aos con las investigaciones de investigadores como Acuto, Baldini, De Marrais, Daz, Raffino, Pollard,
Tarrag, entre otros (Baldini y Baffi, 2007).

En este trabajo nos proponemos dar a conocer los resultados preliminares del anlisis de un conjunto de restos
seos humanos recuperado mediante el trabajo de rescate en una de las calles de acceso al barrio Fuerte Alto. El

*
CONICET INAPL, vseldes@yahoo.com.ar
**
Universidad Nacional de Salta, Museo de Arqueologa de Alta Montaa, Salta. mail: coquizigaran@yahoo.com.ar
***
Universidad Nacional de Salta, mail: jeco_antropoloco@yahoo.com.ar
TOMO IV - 1545
CAPTULO 31 - MESA DE COMUNICACIONES 2

objetivo es realizar aportes al conocimiento del estilo de vida de los pueblos que habitaron los Valles calchaques
en tiempos prehispnicos
1
.



Figura 1: Ubicacin de los valles Calchaques

En este trabajo nos proponemos dar a conocer los resultados preliminares del anlisis de un conjunto de restos
seos humanos recuperado mediante el trabajo de rescate en una de las calles de acceso al barrio Fuerte Alto. El
objetivo es realizar aportes al conocimiento del estilo de vida de los pueblos que habitaron los Valles calchaques
en tiempos prehispnicos
2
.

Fuerte Alto fue mencionado por Debenedetti (1908) y Ardisone (1940 y 1942) siendo adscripto, por similitudes con
los sitios de La Paya y Kipn, al perodo de Desarrollos Regionales. Tambin Daz y Tarrag lo mencionan en su
descripcin de sitios arqueolgicos de Cachi y lo ubican sobre una terraza alta en la margen izquierda del ro Cachi,
cerca de 1.5 km del pueblo. Posee recintos dispersos los cuales se encuentran limitados por un muro de contencin; en
los mismos se recuper cermica Santa Mara en superficie (Tarrag y Daz, 1972).

El sitio se encuentra altamente impactado, en parte debido a la reciente construccin de un barrio por sobre las
estructuras prehispnicas y en los alrededores del mismo. Por consiguiente, este rescate constituye una
interesante fuente de informacin de un sitio que corre riesgo de desaparecer bajo las construcciones actuales
(Figuras 2 y 3).


1
El estudio del material cermico que lo acompaaba se llevar a cabo en otro trabajo
2
El estudio del material cermico que lo acompaaba se llevar a cabo en otro trabajo
TOMO IV - 1546
Vernica Seldes, Mara Fernanda Zigaran y Jorge Cabral


Figura 2: Vista del rescate 1 Figura 3: Vista del rescate 2

En junio del 2006, se inform al Museo Arqueolgico Pablo Pio Daz de la aparicin de restos humanos en
una de las calles del barrio Fuerte Alto. En conjunto con personal del museo, residentes de Cachi y los autores,
se realiz el rescate de los restos mencionados. Los mismos se encontraban dentro de una urna que haba sido
depositada en una estructura rectangular de piedras a modo de pircado lateral. La urna se encontraba fracturada
en uno de sus bordes por lo que parte de su contenido colaps hacia el exterior de la misma (Figura 4).


Figura 4: Urna dentro de estructura

Una vez recuperado el material seo del interior de la urna se realiz la estimacin de edad, utilizando las
propuestas de Fazekas y Kosa (1978) para perinatos, Scheuer y Black (2000) para infantiles y subadultos y
Brooks y Suchey (1990) y Bass (1995) para adultos y maduros. Para la determinacin de sexo se utilizaron los
estandares de Buikstra y Ubelaker (1994).

El anlisis del estilo de vida y estado de salud de los individuos constituye una importante fuente de informacin
sobre los pueblos prehispnicos; en este caso se tomaron los indicadores bioarqueolgicos de estrs nutricional -
metablico (hiperostosis portica, cribra orbitalia, lneas de hipoplasia del esmalte), dieta (prdida dental
antemortem, caries, desgaste del esmalte dental), estrs ocupacional (osteoartritis y estrs msculo esqueletal),
traumas (fracturas, golpes) e infecciones (periostitis, osteomielitis) (Aufderheide y Rodrguez Martn, 1998;
Goodman et al., 1984; Huss-Ashmore et al., 1982; Larsen, 1987 y 1997; Martin et al., 1985). Tambin se
evaluaron las prcticas deformatorias del crneo, considerando que las mismas constituyen un indicador de sus
sistemas de sealizacin y comunicacin de la identidad grupal o individual vinculados con la pertenencia a
grupos tnicos (Bloom, 2005).

Resultados
Los anlisis bioarqueolgicos realizados en los restos seos provenientes de Fuerte Alto sealan la presencia de
cinco individuos, uno de sexo masculino y edad adulta, uno de sexo femenino y edad adulto joven, dos infantiles
y un perinato.

TOMO IV - 1547
CAPTULO 31 - MESA DE COMUNICACIONES 2

El individuo adulto de sexo masculino no presenta ningn indicador de estrs nutricional, pero s caries y un
intenso desgaste del esmalte dental. La presencia de inserciones musculares marcadas y de osteoartritis en
diferentes zonas (osteoartritis leve y moderada en cubito derecho, radios, costillas, fmur, tibia, e intensa en
vrtebras cervicales, dorsales y lumbares con lipping) nos permite inferir que realiz actividades recurrentes que
implicaron una sobreexigencia fsica que comprometi extremidades inferiores, superiores y tronco. En el crneo
se observ un posible trauma con evidencias de remodelacin sea. La deformacin intencional del crneo
registrada corresponde a la variante tabular erecta.

El individuo de sexo femenino presenta porosidad en el occipital que sugerira la presencia de estrs nutricional
(lneas de hipoplasia del esmalte e hiperostosis portica), desgaste del esmalte dental leve a moderado,
osteoartritis de tipo leve en columna vertebral y evidencia de procesos infecciosos (periostitis). Por ltimo se
registr deformacin intencional del crneo de tipo tabular erecta.

Uno de los individuos infantiles est representado por pocos elementos. Por tal motivo no fue posible estimar la
edad con mayor grado de precisin. Sin embargo, a partir de los pocos restos recuperados, fue posible observar
por un lado que no presentaba evidencias de cribra orbitalia y por el otro que tena deformacin craneana del
tipo tabular erecta.
El otro de los individuos infantiles (individuo 2) de 6 aos 24 meses de edad presenta lneas de hipoplasia del
esmalte y desgaste de tipo moderado a intenso lo que podra estar indicando, sobre todo teniendo en cuenta la
edad, que los mismos pudieron haber sido utilizados como herramientas. Tambin este individuo presenta
deformacin craneana tabular erecta.

Del perinato se recuperaron algunos pocos restos seos; a partir de las observaciones realizadas sobre los
mismos se seala la ausencia de evidencias de estrs nutricional e infecciones.

Discusin
Del anlisis bioarqueolgico se desprende la homogeneidad en las prcticas deformatorias, ya que los cuatro
individuos que han podido analizarse tienen deformacin tabular erecta. No hay diferencias entre ellos en lo
referido a esta prctica.

Slo el individuo de sexo femenino presenta hiperostosis portica; se ha planteado que la misma se desarrolla en
individuos que en algn momento de su vida vieron deteriorada su situacin nutricional o bien que han sufrido
de infecciones crnicas; ambas situaciones pueden predisponer al desarrollo de anemias (Huss Ashmore et al,
1982; Larsen, 1987).

Tanto el individuo adulto de sexo femenino como uno de los individuos infantiles presentan lneas de hipoplasia
del esmalte dental. Distintos factores se han sugerido como posible explicacin para la aparicin de estas lneas,
desde enfermedades hemolticas, nacimiento prematuro, infecciones, deficiencias dietarias de vitaminas A, C y
D; y la ms aceptada hoy en da: trastornos metablicos por diversos estados de enfermedad y malnutricin
durante los primeros aos de vida (Aufderheide y Rodrguez Martin, 1998).

En cuanto a los indicadores de dieta, uno de los individuos (adulto de sexo masculino) presenta caries; los casos
analizados no alcanzan para realizar comparaciones, pero no hay que perder de vista las posibles diferencias de
edad y la resistencia individual a la posibilidad de contraer caries (Larsen, 1997, Powell, 1985).

Ambos individuos adultos tienen, en mayor o menor medida, desgaste del esmalte dental; el mismo podra
responder a la inclusin en las harinas de partculas desprendidas de las piedras de moler que implica el consumo
involuntario de materiales abrasivos (Larsen, 1987). En el caso del individuo infantil; el hecho de haber
registrado desgaste del esmalte dental podra asociarse a la utilizacin de la dentadura como herramienta
(Larsen, 1997).

Respecto a los indicadores de estrs funcional, mientras que el individuo de sexo masculino registra osteoartritis
leve a moderada en ambas extremidades e intensa en la columna as como estrs msculo esqueletal, la mujer
slo tiene osteoartritis de tipo leve en la columna. El contraste entre ambos podra deberse a la diferencia de edad
pero tambin al tipo de actividad desarrollada por cada uno (Bourke, 1967).

TOMO IV - 1548
Vernica Seldes, Mara Fernanda Zigaran y Jorge Cabral

El trauma que se observa en el crneo del individuo de sexo masculino todava contina analizndose; de todas
maneras se suele considerar como predominantemente representativo de violencia interpersonal, siendo su
asignacin a situaciones de conflicto (Knowles 1983; Torres Rouff et al., 2005).
A modo de conclusin, en este trabajo se pone de relevancia la informacin que puede brindar la bioarqueologa
y la necesidad de contar con mayor cantidad de trabajos sobre restos humanos que permitan continuar realizando
aportes al conocimiento de la forma de vida de los pueblos que habitaron los valles Calchaques en el Perodo de
Desarrollos Regionales.

Bibliografa
Ambrosetti, J. B. 1907. Exploraciones arqueolgicas de la ciudad prehistrica de La Paya (Valle Calchaqu,
provincia de Salta). Publicaciones de la Seccin Antropolgica 3. Universidad de Buenos Aires.
Ardissone, R. 1940. La instalacin indgena en el Valle Calchaqu. Anales del Instituto de Etnografa Americana
I: 169 189, Buenos Aires.
Ardissone, R. 1942. Un ejemplo de instalacin humana en el Valle Calchaqu. El pueblo de Cachi. Monografas
del Instituto de Estudios Geogrficos 1. Universidad Nacional de Tucumn.
Aufderheide, A. y C. Rodrguez Martin. 1998. The Cambridge Enciclopedia of Human Paleopathology.
Cambridge University press, Cambridge.
Baldini, L. y E.I. Baffi. 2007. Aportacin al estudio de prcticas mortuorias durante el Perodo de Desarrollos
Regionales. Entierros de vasijas utilitarias del sector central del valle Calchaqu (Salta, Argentina). Revista
Espaola de Estudios Americanos 37 (1): 7 26. Espaa
Bass, W. 1995. Human Osteology. Missouri Archaeological Society Special Publication. Fourth Edition.
Columbia, Missouri.
Bloom, D. 2005. Embodying borders: human body modification and diversity in Tiwanaku society. Journal of
Anthropological Archaeology 24: 1-24.
Brooks, S. y J. Suchey 1990. Skeletal age determination based on the os pubis: a comparison of the Acsadi
Nemeskeri and Suchey y Brooks method. Human Evolution 3 (3): 227 238.
Bourke, J. B. 1967. A review of the Paleopathology of the Arthritic. Diseases in Antiquity. Editado por D.
Brothwell y A. Sandison, pp. 352 370. Charles Thomas publisher. Springfield, Illinois.
Buikstra, J. y D. Ubelaker. 1994. Standards for Data Collection from Human Skeletal Remains. Arkansas
Archaeological Survey Research Series, 44. Arkansas.
Debenedetti, S. 1908. Excursin arqueolgica a las ruinas de Kipn (Valle Calchaqu, provincia de Salta).
Publicaciones de la Seccin Antropolgica 4. Universidad de Buenos Aires.
Fazekas, G. y M. Kosa. 1978. Forensic Fetal Osteology. Akademiai Kiad, Budapest.
Goodman, M, D. Martin, G. Armelagos y G. Clark. 1984. Indicators of stress from bone and teeth.
Paleopathology at the origins of agriculture. Editado por. M. Cohen y G. Armelagos, pp. 13 49. Academic
Press, New York.
Huss Ashmore, R., A. Goodman y G. Armelagos. 1982. Nutritional inference from paleopathology. Advances
in Archaeological Method and Theory 5. Editado por M. Schiffer, pp. 395 473. Academic Press, New York.
Knowles, A. 1983. Acute traumatic lesions. Diseases in Ancient Man: 61 83. Ed. Hart.
Larsen, C. 1987. Bioarcheological interpretations of subsistence economy and behavior from human skeletal
remains. Advances Archaeological Method and Theory 10. Editado por M. Schiffer, pp. : 339 -445. Academic
press, New York.
Larsen, C. 1997. Bioarcheology: interpretating behavior from the human skeleton. Cambridge studies in
biological anthropology 21. Cambridge University press, Cambridge.
Martin, D., A. Goodman y G. Armelagos. 1985. Skeletal pathologies as indicators of quality and quantity of diet.
The Analysis of Prehistoric Diet 8. Editado por R. Gilbert y J. Mielke, pp. 227 279. Academic press, Orlando
Powell, M. 1985. The Analysis of Dental Wear Caries for Dietary Reconstruction. The Analysis of Prehistoric
Diet, captulo 10: 307-358. Ed. Gilbert y Mielke. Academic Press. Orlando.
Scheuer, L. y S. Black. 2000. Development Juvenil Osteology. Academic Press. San Diego, California.
Tarrag, M. 1974. Aspectos ecolgicos y doblamiento prehispnico en el Valle Calchaqu, provincia de Salta,
Argentina. Revista del Instituto de Antropologa 5: 195-216, Crdoba.
Tarrag, M. 1976. Arqueologa del Valle Calchaqu. Etnia, 23 y 24: 1-35, Museo Etnogrfico Municipal
Dmaso Arce, Olavarra, Buenos Aires.
Tarrag, M. 2000. Chacras y pukara. Desarrollos sociales tardos. Nueva Historia Argentina, captulo 1: Los
Pueblos originarios y la conquista: 257 300. Ed. Sudamericana, Buenos Aires.
Tarrag, M. y P. Diaz. 1972. Sitios arqueolgicos del valle Calchaqu. Estudios de Arqueologa 1: 49 61.
Torres Rouff, C. y M. A. Costa Junqueira. 2005. Violence in times of changes: the Late Intermediate Period
in San Pedro de Atacama. Chungara 37 (1): 75 83. Arica, Chile.
TOMO IV - 1549
CAPTULO 31 - MESA DE COMUNICACIONES 2



ARQUEOLOGA REGIONAL EN LA PUNA DE SALTA: PRIMERAS
APROXIMACIONES AL ESTUDIO DE LOS SALARES CENTENARIO,
RATONES Y POCITOS
Gabriel Lpez



Introduccin
En este trabajo se presentan los resultados de investigaciones arqueolgicas recientes desarrolladas en la Puna de
Salta. A partir de la informacin arqueolgica registrada en la cuenca de Pastos Grandes (Lpez 2008, 2009), se
decidieron ampliar las prospecciones hacia reas vecinas. Los resultados obtenidos en Pastos Grandes
permitieron distinguir una secuencia de ocupaciones humanas a lo largo del Holoceno temprano, medio y tardo.
De esta manera, si bien en este trabajo se presentan los primeros resultados de las prospecciones en reas con un
vaco de informacin arqueolgica, en el futuro, se espera que esta ampliacin en la escala espacial de anlisis,
contribuya al estudio del cambio cultural en las ocupaciones humanas a nivel regional.

Las nuevas prospecciones se llevaron a cabo en los salares de Centenario-Ratones y en el salar de Pocitos, al sur
y al oeste de Pastos Grandes, respectivamente. El ambiente es similar en ambas reas.

Los salares de Centenario y Ratones se caracterizan por un paisaje extremadamente desrtico con escasa
vegetacin (salvo en algunas vegas puntuales) y suelos limo-arenosos sometidos a una fuerte erosin. La altura
promedio, al igual que en Pastos Grandes, es superior a los 4000 msnm. En este contexto, la economa actual se
basa en el pastoreo de llamas por grupos familiares pequeos y la actividad minera. Entre la fauna presente
tambin se destacan los camlidos silvestres, incluidos los guanacos, los cules se observan en espacios
puntuales.

El salar de Pocitos presenta caractersticas similares a los otros salares de la regin, y tambin existen algunas
vegas que permiten el pastoreo de llamas y ovicpridos. Adems cuenta con antiguos cauces de agua y
paleovegas que dejaron formaciones con turba fsil en sectores circundantes al salar de Pocitos, como Zelallos.
Asimismo existen vegas en quebradas ubicadas al norte del salar de Pocitos que contienen cauces de agua
temporarios. Estas quebradas presentan las mayores alturas del rea de Pocitos, superiores a 4000 msnm, pero en
el fondo de cuenca donde se encuentra el salar la altura ronda los 3800 msnm.

Los resultados arqueolgicos de las prospecciones se presentan aqu de manera general y deben ser tomados
como una primera aproximacin al estudio de reas con un vaco de informacin.

El registro arqueolgico en los salares de Centenario y Ratones: los sitios de Inca Viejo
La prospeccin arqueolgica en esta rea fue dirigida al reconocimiento de sitios mencionados por pobladores
locales en un sector llamado Inca Viejo. Se trata de un sector alto en los cerros que rodean el salar de Ratones en
direccin Este. En primer trmino se evidenci el sitio arqueolgico Poblado Inca Viejo, el cual se ubica en un
talud debajo de una vega que desciende entre los cerros, con un arroyo de bajo caudal de agua en la actualidad.
Sin embargo, se espera que en el pasado esta vega haya estado muy activa y haya proporcionado el agua
necesaria para el establecimiento de un poblado. De todas formas los estudios paleoambientales sern
importantes al respecto.

El Poblado Inca Viejo consiste de distintas estructuras arqueolgicas de formas diversas, tanto de planta
rectangular como circular. Aunque an no se tom la planta del sitio parecen predominar las primeras. En este
sentido, tradicionalmente patrones con plantas rectangulares o cuadrangulares fueron asignadas a momentos
pastoriles tardos e incaicos. Al respecto, la cermica, mayoritariamente, es de tonalidad rojiza dada por una
coccin oxidante. En general presenta engobe y pintura post-coccin de distintos colores. La pintura se detecta
en motivos geomtricos, como bandas rectangulares, tringulos o lneas. De todas maneras, se debe reconocer
que se trata de fragmentos recolectados en superficie, principalmente de cuerpos de cermica aunque tambin
hay bordes y cuellos.

CONICET, Instituto de Arqueologa, FFyL, UBA. Email: gabelope@yahoo.com


TOMO IV - 1551
CAPTULO 31 - MESA DE COMUNICACIONES 2

En trminos generales, el patrn arquitectnico y las caractersticas de la cermica sugieren una cronologa
relativa del Poblado Inca Viejo posterior al 1000 AP, o sea, correspondiente a momentos tardos del desarrollo
pastoril en la puna, y posiblemente a momentos incaicos.

Entre la evidencia arqueolgica en el sitio, se detect una roca transportable con varios morteros hechos en la
misma, lo que indica probablemente la importancia que habran tenido los productos vegetales en este poblado.
A su vez, la existencia de corrales arqueolgicos es un indicador de la presencia de prcticas pastoriles. Se
espera que el pastoreo de llamas haya sido la estrategia econmica predominante para los pobladores de este
sitio, en especial considerando la existencia de la vega mencionada anteriormente con pasturas para los rebaos.
En este sentido, si bien en la actualidad el agua y las pasturas son escasas, se espera que en el pasado la vega
haya permitido el establecimiento del poblado. De hecho, existen reocupaciones subactuales del sitio y
reutilizacin de los corrales, lo cual indica su ubicacin estratgica.

Otro punto para destacar acerca de este sitio es la importante frecuencia de estructuras arqueolgicas y evidencia
artefactual en superficie a una altura de 4245 msnm. En el futuro se deber indagar acerca del rol relevante que
pudo haber cumplido el sitio en el contexto regional de las tierras altas de Salta en momentos tardos, dada la
escasez de sitios de magnitud similar o superior en este contexto altitudinal.

Por otra parte, tambin en Inca Viejo pero a ms de 2 km del sitio descripto, se registr otro sitio de alto potencial
arqueolgico tanto en superficie como en capa. El sitio es una cueva o caverna profunda que se adentra en el cerro
en el cual se encuentra, conformando una formacin natural con distintas galeras y oquedades. Por el momento su
magnitud total es inestimable dada la presencia de estas oquedades y conductos que comunican distintas galeras.
De todas maneras la prospeccin se llev a cabo en la cueva principal conformada por una cavidad amplia que llega
a los 13 m de profundidad desde la lnea de goteo. La entrada de la cueva tiene 6,3 m de ancho, y se ubica en una
zona escarpada del cerro en la que se encuentra. La entrada est parcialmente tapada por derrumbe de sedimentos
por gravedad de arriba hacia abajo. Por fuera de la cueva, existe una pequea plataforma natural que permite
visualizar gran parte del salar de Ratones. La altitud en que se encuentra la cueva es de 4312 m. Este sitio fue
denominado como Cueva Inca Viejo. En este sentido, se espera que la cueva haya sido ocupada desde momentos
tempranos por cazadores recolectores, tal como se registr en el sitio Alero Cuevas, ubicado en la cuenca de Pastos
Grandes a 80 km y con ocupaciones a lo largo del Holoceno temprano, medio y tardo (Lpez 2009). Esta
expectativa se debe especialmente a la escasez de refugios para cazadores recolectores en la regin. Sin embargo se
espera tambin que de existir estas ocupaciones tempranas, las mismas podran estar tapadas por sedimentos a gran
profundidad. Esto se sostiene en los sondeos realizados, que no permitieron llegar hasta la roca de base y que
parecen indicar una alta tasa de depositacin de sedimentos y material arqueolgico. En las primeras capas de los 2
sondeos realizados, el material arqueolgico registrado fue diverso. La presencia de fragmentos de cermica en
algunos casos diagnstica, como la oscura pulida comn en contextos pastoriles tempranos (Olivera 2001), o
algunos fragmentos similares en la pasta y coccin a los del sitio Poblado Inca Viejo, que seran ms tardos,
pueden ser considerados como indicadores de cronologa relativa. Sin embargo, lo ms llamativo en los sondeos
realizados es la abundante frecuencia de plumas de una diversidad de aves. Entre ellas, se registraron muchas
plumas verdes y rosadas, estas ltimas posiblemente de flamencos.

Tambin se registr una alta frecuencia de huesos, en proceso de anlisis, que en su mayora corresponderan a
camlidos. Asimismo, se detectaron restos vegetales, entre ellos granos de maz y otras semillas en estudio. Por
lo tanto, la potencialidad del sitio es alta en cuanto a la diversidad y buena conservacin de los hallazgos.

Sin embargo, lo ms atractivo a nivel visual resulta la presencia de paneles de arte rupestre. Se trata de pinturas
mayormente de color negro, que conforman distintas imgenes. La representacin ms comn es la de camlidos
naturalistas y esquemticos que en algunos casos forman escenas compartidas con figuras antropomorfas.
Tampoco se descarta que las imgenes representen cronologas distintas sobre todo al observarse algunas
pinturas (en baja frecuencia) de color rojo, en particular de un antropomorfo y una figura circular. Si bien, por el
momento no hay un estudio detallado del arte rupestre y por lo tanto no se cuenta con las herramientas para
establecer una cronologa relativa y una comparacin regional, se espera que estos paneles, en su mayora
correspondan a momentos de amplio desarrollo del pastoreo en la puna. Esto se desprende por ejemplo, de una
imagen de camlidos alineados y atados (Figura 1), la cual es comn en contextos tardos asociados al trfico
caravanero (Aschero 2000, Martel y Aschero 2007). Sin embargo, no se han registrado por el momento como en
los sitios del Alto Loa u otras regiones, llamas con carga (ver Berenguer 1999). De todas maneras, la asociacin
de varias representaciones en la cueva con el pastoreo de llamas, indica la importancia que tena esta actividad en
este contexto.
TOMO IV - 1552
Gabriel Lpez





















Figura 1: Pintura rupestre en el sitio Cueva Inca Viejo. Vase el detalle de los camlidos atados en fila.

El registro arqueolgico en el salar de Pocitos
El salar de Pocitos era un rea con un vaco de informacin arqueolgica, por lo que la campaa de noviembre
de 2009 fue importante para realizar una primera aproximacin al anlisis del registro arqueolgico. La
necesidad de investigar el rea de Pocitos naci a partir de los trabajos en Pastos Grandes, ubicado 60 km al
Este. En Pastos Grandes una de las materias primas ms utilizadas a lo largo del Holoceno para la confeccin de
instrumentos lticos, fue la obsidiana proveniente de Quirn. Esta fuente de obsidiana se encuentra a unos 15 km
del salar de Pocitos, y por lo tanto, se gener una nueva pregunta de investigacin acerca de las conexiones
sociales entre Pastos Grandes y Pocitos. Se busca determinar as dinmicas de poblamiento e historias de
ocupacin compartidas entre las dos reas, como tambin sus particularidades.

Los primeros resultados de la prospeccin en Pocitos permitieron reconocer distintos sitios arqueolgicos. Entre
ellos se destaca Zelallos, por presentar un geoambiente propicio para las ocupaciones humanas. Sin embargo, en
la actualidad, la vega que constituye este sector se encuentra poco activa, por el contrario, el geoambiente es seco
y el agua es escasa. De todas formas, los vestigios dejados por paleovegas y formaciones aluvionales son
enormes. Se trata de distintas crcavas con turba fsil asociadas en algunos casos con evidencia arqueolgica.
Este paisaje requiere indagar en los procesos de formacin que afectaron el registro arqueolgico. Entre estas
formaciones naturales, tambin existen distintas oquedades y cuevas pequeas de roca calcrea, con potencial
informacin arqueolgica. De hecho, una pastora local, descubri en la dcada de 1970, un esqueleto humano
flexionado, sin la cabeza, en una camada de paja y con ajuar (entre ellos un astil). Lamentablemente, esta
informacin se perdi, pero aumenta la posibilidad de que se encuentre este tipo de evidencia en otras oquedades
y cuevas.

Con respecto a la cronologa estimada para las ocupaciones humanas de este sector, an es prematuro sealar
alguna aproximacin firme. Sin embargo, la expectativa general es que se trate fundamentalmente de
ocupaciones humanas de cazadores recolectores entre el Holoceno medio y comienzos del Holoceno tardo. Esto
se sustenta en la evidencia arqueolgica registrada en superficie en un sector de Zelallos, el cual tiene una fuerte
erosin elica. All se registraron distintas estructuras arquitectnicas, principalmente aglomeraciones de rocas
con forma irregular, aunque tambin se determin la presencia de una estructura circular (Estructura 1) que
podra tratarse de un parapeto de caza, tal como los que describen Aschero y Martnez (2001) para Antofagasta
de la Sierra. La ubicacin de esta estructura indica una alta visualizacin de distintos sectores, lo cual es
fundamental para la caza. Esto porque se ubica en una pequea planicie sobre una elevacin que rodea la vega de
Zelallos.

En este contexto, alrededor de la estructura 1 de Zelallos, se registraron distintos artefactos cronolgicamente
diagnsticos, particularmente distintas puntas lanceoladas (Figura 2A) e incluso un artefacto lanceolado
unifacial (Figura 2B), fechado en capa en Pastos Grandes entre finales del Holoceno medio y comienzos del
TOMO IV - 1553
CAPTULO 31 - MESA DE COMUNICACIONES 2

Holoceno tardo. A su vez, se recuper un fragmento basal de punta lanceolada confeccionada en una roca
volcnica posiblemente local (Figura 2C), de caractersticas similares al tipo Quebrada Seca C recuperado en
capas correspondientes al Holoceno medio del sitio Quebrada Seca 3 en Antofagasta de la Sierra (Aschero y
Martnez 2001). Tambin es importante destacar la ausencia de cermica.

La prospeccin en la margen noreste del salar de Pocitos, permiti distinguir dos concentraciones arqueolgicas
a las que se denomin sitios Rodrguez 1 y 2, por encontrarse cerca del puesto de la familia del mismo apellido.
Sin embargo, en amplios sectores del borde del salar, no se determinaron evidencias arqueolgicas.

Entre el material arqueolgico caracterstico, se recuperaron distintas puntas lanceoladas fragmentadas, que
pueden relacionarse con las encontradas en Zelallos, por lo que se podra estar ante contextos cronolgicos
similares, ms si se tiene en cuenta la ausencia de cermica. En los sitios Rodrguez 1 y 2, principalmente se
registraron desechos de talla distribuidos en extensiones lineales de alrededor de 200 m. La materia prima
predominante en este contexto es la obsidiana proveniente de la fuente de Quirn, la cual es local, porque se
encuentra a alrededor de 15 km de estos sitios y dentro de la cuenca de Pocitos-Quirn.

En la fuente, la obsidiana se presenta en bochones de diversos tamaos, observndose su presencia a lo largo del
Abra de Quirn. Por lo tanto, era esperable su alta representacin en el registro arqueolgico del salar de Pocitos.

Hacia el norte, el salar de Pocitos est rodeado por cerros que lo dividen del salar de Rincn. Estos cerros
presentan distintas quebradas con alto potencial arqueolgico, por lo que en el futuro se profundizarn los
estudios en este sector. Igualmente, al pie de estos cerros, en la margen norte del salar de Pocitos, la evidencia
arqueolgica es notable. Se registraron varias estructuras arqueolgicas mayormente circulares, aunque
lamentablemente ubicadas en un sector fuertemente erosionado por los vientos. Tambin se evidenciaron
acumulaciones rocosas de origen antrpico. En una campaa reciente, se realizaron distintos sondeos con el
objetivo de obtener material para fechar y determinar de esta manera una asignacin cronolgica para el registro
arqueolgico de este sector, pero la evidencia en capa result sumamente escasa.

Hacia el Noroeste del salar de Pocitos se encuentra una zona llamada Pozo Cavado, que presenta la mayor
diversidad arqueolgica del rea. En la campaa de marzo de 2010, se registraron distintos sitios arqueolgicos.
Actualmente, esta zona es poco frecuentada por pobladores de Pocitos. Uno de los sitios presenta una alta
frecuencia de estructuras de patrn circular y por sus caractersticas podra corresponder cronolgicamente al
denominado Perodo Agroalfarero Temprano. Otro de los sitios que se destaca por su diversidad arqueolgica
se ubica en el talud de uno de los cerros que rodean al salar de Pocitos hacia el oeste. La frecuencia de hallazgos
en superficie es llamativa, registrndose varias puntas lanceoladas comunes en contextos de cazadores del
Holoceno medio, como as tambin estructuras posiblemente correspondientes a parapetos, ubicadas en un lugar
que cuenta con una alta visualizacin de distintos sectores del paisaje. Sin embargo, el sitio ms llamativo por su
ubicacin y diversidad arqueolgica se encuentra en un sector sobreelevado que conforma una formacin de
tierra limo-arcillosa en el borde del salar de Pocitos. Para ser ms exactos, se trata de una extensin de tierra
rodeada por el salar, que se ubica enfrente del sitio con parapetos antes mencionado. En este contexto, se
presenta una formacin rocosa (posiblemente volcnica), que contiene distintos aleros y reparos. Estos refugios
naturales se ubican de forma continua a lo largo de la formacin rocosa. En los taludes de estos aleros y a lo
largo del borde del salar en este sector, la evidencia arqueolgica es frecuente y diversa. Sin embargo, se
destacan principalmente distintas puntas lanceoladas y lminas, que en Pastos Grandes se asociaron con
contextos del Holoceno medio y comienzos del Holoceno tardo.

En uno estos aleros se realiz un sondeo de 0,5 x 0,5 m con el fin de registrar la estratigrafa y obtener material
para fechar. Debajo de una capa de limo hmedo inicial, en la que se registraron marlos de maz, se registr una
capa de paja, mayormente disgregada. Ms abajo, se evidenci una capa constituida con bloques de roca
cristalizada (sal), que parecan marcar el fin de la estratigrafa. De todas formas, una vez excavada esta capa, de
alrededor de 15 cm, el sedimento volvi a ser de limo hmedo y con gran frecuencia de especmenes seos y
desechos de talla y artefactos lticos, entre ellos una punta de obsidiana gris y morfologa lanceolada. Por debajo,
otra capa carbonosa producto posiblemente de un fogn, con alta frecuencia de hallazgos, certific la
continuidad de la estratigrafa. La excavacin hasta el nivel estril ser en la prxima campaa. De todas
maneras, las caractersticas estratigrficas y la evidencia arqueolgica en capa y en superficie parecen indicar
una secuencia cronolgica larga, con ocupaciones humanas de contextos de produccin de alimentos y tambin
de cazadores tempranos. Este tipo de secuencia larga evidenciado en este sector de Pozo Cavado se registr
TOMO IV - 1554
Gabriel Lpez

tambin en Pastos Grandes, en el sitio Alero Cuevas, con ocupaciones en el Holoceno temprano, medio y tardo
(Lpez 2008).

En suma, la continuidad de las prospecciones y excavaciones en el salar de Pocitos ser determinante para
establecer la cronologa de las ocupaciones humanas y el cambio cultural.



















Figura 2. Artefactos cronolgicamente diagnsticos en Pocitos. A. Punta lanceolada fragmentada. B. Artefacto
lanceolado unifacial. C. Base de punta lanceolada tipo Quebrada Seca C

Conclusin
La investigacin realizada en Pastos Grandes, que permiti detectar ocupaciones humanas en el Holoceno
temprano, medio y tardo, result un punto de partida para indagar en los procesos de cambio cultural en una
escala espacial ms amplia. Por ejemplo, la extensa distribucin de la obsidiana proveniente de Quirn en
distintas reas como Pastos Grandes, indica conexiones sociales y potencialmente procesos compartidos en la
escala regional. En esa direccin se contina investigando y se espera que en el futuro se puedan obtener
resultados fructferos que permitan profundizar en problemticas tales como procesos de complejidad social,
aumento en el tamao de los grupos, domesticacin de camlidos, cambios demogrficos, innovaciones
tecnolgicas, etc. De hecho, estos temas pudieron ser desarrollados en Pastos Grandes, en el marco de una
perspectiva evolutiva, a partir de evidencia arqueolgica en capa y en superficie (Lpez 2008, 2009). Por eso
siguiendo esta lnea terica se profundizar la comparacin regional para determinar historias de ocupacin
comunes como tambin sus diferencias. En este marco, la informacin arqueolgica generada por Hernn
Muscio en San Antonio de los Cobres (ver Muscio 2004), es importante para entender los procesos de cambio en
escala regional.

Agradecimientos
Agradezco a Cecilia Mercuri por haber participado conmigo en la campaa de noviembre de 2009 y a Federico
Coloca y Juan Pablo Orsi en la campaa de marzo de 2010. Tambin agradezco a Rodolphe Hoguin y Federico
Restifo por aportes que ayudaron a mejorar el trabajo. A Sebastin Abeledo por su ayuda e informacin con
respecto a la cueva de Inca Viejo. Agradezco fundamentalmente a la familia Rodrguez, en Pocitos, que nos
abri las puertas de su hogar. Ellos son Santiago, Leonarda y Gonzalo. Tambin a Mario Sanhueso por su coraje
y solidaridad, y a todos sus compaeros mineros que son un ejemplo de lucha, esfuerzo y verdadera vida en
comunidad. Tambin a Alejandra, maestra de Pocitos por su lucha cotidiana.

BIbliografa
Aschero, C. 2000. Figuras humanas, camlidos, y espacios en la interaccin circumpunea. En Arte en las
rocas. Arte rupestre, menhires y piedras de colores en Argentina, editado por M. Podest y M. de Hoyos, pp. 15-
44. Sociedad Argentina de Antropologa y Asociacin Amigos del Instituto Nacional de Antropologa y
Pensamiento Latinoamericano. Buenos Aires
Aschero, C. y J. Martinez. 2001. Tcnicas de caza en Antofagasta de la Sierra, Puna Meridional Argentina.
Relaciones de la Sociedad Argentina de Antropologa XXVI: 215- 241.
TOMO IV - 1555
CAPTULO 31 - MESA DE COMUNICACIONES 2

Berenguer, J. 1999. El evanescente lenguaje del arte rupestre en los Andes Atacameos. En Arte rupestre en los
Andes de Capricornio, pp. 9-56. Museo Chileno de Arte Precolombino.
Lpez, G. 2008 Arqueologa de Cazadores y Pastores en Tierras Altas: Ocupaciones humanas a lo largo del
Holoceno en Pastos Grandes, Puna de Salta, Argentina. BAR S1854, South American Archaeology Series 4,
Oxford.
2009. Diversidad arqueolgica y cambio cultural en Pastos Grandes, Puna de Salta, Argentina, a lo largo del
Holoceno. Relaciones de la Sociedad Argentina de Antropologa XXXIV: 149-176.
Muscio, H. 2004. Dinmica Poblacional y Evolucin Durante el Perodo Agroalfarero Temprano en el Valle de
San Antonio de los Cobres, Puna de Salta, Argentina. Tesis Doctoral, Facultad de Filosofa y Letras,
Universidad de Buenos Aires.
Martel, A. y C. Aschero. 2007. Pastores en accin: Imposicin iconogrfica vs. Autonoma temtica.
Produccin y circulacin prehispnica de bienes en el sur andino, compilado por A. Nielsen, M. Rivolta, V.
Seldes, M. Vzquez y P. Mercolli, pp. 329-350. Editorial Brujas.
Olivera, D. 2001. Sociedades Agropastoriles Tempranas: El Formativo Inferior del Noroeste Argentino. En
Historia Argentina Prehispnica, ed. por E. Berberin y A. Nielsen. Tomo 1: 83-125. Editorial Brujas. Crdoba,
Argentina.

TOMO IV - 1556
Gabriel Lpez

PROSPECCIONES EN LAS CUENCAS HIDROGRFICAS DE
LA SIERRA DE COBRES, SALTA, ARGENTINA
Pablo Mignone
*



Introduccin
Presentamos resultados parciales de las investigaciones desarrolladas en los sectores meridionales de la Sierra de
Cobres, departamento de Los Andes, localidad de San Antonio de los Cobres. Este cordn corre paralelo al ro
San Antonio de norte a sur. Enmarca el pueblo de San Antonio de los Cobres por el oeste y tiene como altura
mxima al cerro Negro (5020msnm), tambin conocido por los lugareos como Volcn.

Nos centramos en dos sectores: uno, la planicie aluvial que desciende desde las faldas del Cerro Negro, mxima
elevacin de la Sierra mencionada, registrando en Pampa de los Patos parapetos de forma semilunar simple y un
conjunto de 6 estructuras, sitio que hemos denominado segn su homnimo. El segundo sector elegido, el cerro
Pompeya (4097msnm) se encuentra ubicado en la parte meridional de la Sierra de Cobres y en l se observa la
demarcacin de un circuito desde la base hasta la cima, jalonado por estructuras rectangulares compuestas,
caminos, taludes de contencin, apachetas y seales, coronando el conjunto estructuras cumbreras que se abren
hacia el este, desde las cuales se obtiene una visin perfecta de los santuarios de altura circundantes.

La evidencia arqueolgica cubre un amplio espectro temporal, desde el perodo Tardo de la historia
prehispnica del NOA (siglos X a XV, Tarrag 2000) a travs de la cermica, y el perodo inmediatamente
posterior, Inca (1470-1530d.C.) evidenciado en la arquitectura. Se identifica tambin una etapa histrica y
subactual evidenciada por vidrio industrial perteneciente a botellas de aguardiente, cerveza y ginebra, que datan,
algunas de ellas, de mediados del siglo XX (del Ingenio La Esperanza, Jujuy), ltimo tramo histrico del
transporte de ganado hacia Chile.

Estas investigaciones forman parte de un objetivo mayor, consistente en la aproximacin a la complejidad que
encierra el mbito de la montaa para la historia humana, traspasando los lmites espaciales y temporales
tradicionales de la arqueologa de alta montaa, insertndola de lleno en el contexto actual de la arqueologa
surandina, y a las sociedades estudiadas (cazadoras-recolectoras, agricultoras y el contexto estatal inkaico),
dentro del mismo proceso histrico y del mismo mbito, el andino. En definitiva, una mirada ampliada hacia una
arqueologa regional y diacrnica en relacin a las montaas de los Andes.

Antecedentes de investigacin
Los antecedentes arqueolgicos en la Puna de Salta son reducidos, destacndose los trabajos realizados por
investigadores de la Universidad de Buenos Aires centrados en San Antonio de los Cobres y las quebradas
transversales al ro San Antonio y en la localidad de Santa Rosa de los Pastos Grandes (citamos como ejemplo,
Azcune y Gmez 2002; Lpez 2003 y 2005; Muscio 2006, entre otros). Las investigaciones abarcan un amplio
abanico temporal, desde el estudio de la movilidad y estrategia de subsistencia de sociedades cazadoras-
recolectoras a la etnografa y las consecuencias adaptativas del abandono de formas tradicionales de subsistencia
(Azcune y Gmez 2002; Lpez 2003). Estos antecedentes muestran que la ocupacin temporal se centr en las
quebradas que ofrecen resguardo y recursos de agua y pasturas, donde la presencia de fauna favoreci
inicialmente la actividad de cazadores y recolectores (ca. 10.000-8.000 AP, Lpez 2009) y el cultivo de baja
escala como alfalfa y haba en la actualidad (Lpez 2005).

Los sectores puntuales prospectados no tienen antecedentes dentro de la arqueologa argentina, pero s de la
Historia de Salta. Pampa de los Patos, por ejemplo, es mencionado por Atilio Cornejo como el lugar por donde
Almagro hizo su entrada, siempre siguiendo la Puna, para llegar a Chile (Cornejo 1937: 54).

Antes de nuestras investigaciones no se consideraba la presencia inkaica en San Antonio de los Cobres o sectores
cercanos, ms all de los santuarios de altura de Acay, Chai y Tuzgle, adems de una mencin en comunicacin
personal de un tambo inkaico cercano a Matancillas (Muscio com pers.).
El Cerro Pompeya

*
Unidad de Antropologa, Instituto Nacional de Ciencias Humanas, Sociales y Ambientales, Centro Cientfico y Tecnolgico, Mendoza.
pimignone@mendoza-conicet.edu.ar.
TOMO IV - 1557
CAPTULO 31 - MESA DE COMUNICACIONES 2

La base de este cerro se encuentra a 2km hacia el sudoeste del pueblo de San Antonio de los Cobres. Posee
estructuras desde su base hasta la cima, comenzando por una estructura de planta rectangular (1 en Figura1) con
una subdivisin interna, a la vera de un pequeo arroyo de variabilidad estacional y que cruza de sudeste
noroeste. El cauce del mismo es surcado por un camino de 90cm de ancho, de orientacin predominante 20
Norte, apuntalado con un talud (2 en Figura 1) que cruza el pequeo ro y otro que guarda del derrumbe de la
margen occidental.

La estructura posee 4,59 m (largo mayor) por 2,5 m de ancho. Su lado mayor est orientado perfectamente hacia
el norte (0). El aparejo de los muros es de pirca seca sin relleno e imita la construccin con ladrillos industriales
macizos o panes de adobe, en muros de doble hilada actuales. Se colocaron de forma paralela dos lajas oblongas,
de 0,30m x 0,10m, con poco espacio intermedio, y de manera perpendicular dos lajas menores, paralelas entre s.
El ancho de los muros vara entre 0,20 a 0,30 cm y su alto no sobrepasa los 0,40 cm. Presenta una subdivisin
interna resultando en dos ambientes conectados por una abertura de 0,46 cm. Se conecta con el exterior, hacia el
oeste, a travs de una abertura de 0,40cm. No hay indicios de que estuviese techada, pero s de una cimentacin
por debajo de la superficie, lo que habla de una ereccin antigua. No se observan otros indicios culturales en las
superficies internas o externas. En cambio, en los alrededores del puente que cruza el pequeo cauce, se
registraron innumerables fragmentos de botellas actuales, muchos de ellos de ginebra y sidra (identificados por
inscripciones parciales y etiquetas).

Este puente se encuentra a 19 m al sureste de la estructura y consta, como mencionamos, de un talud de
contencin al lado del cual corre el camino y otro talud perpendicular que asegura el acarreo de la barranca
oeste. El primero est construido con lajas apiladas, planas y alargadas, dispuestas perpendicularmente al eje del
camino y de medidas similares a los componentes de la estructura antes descriptas. Este talud tiene 2,43 m de
largo, 0,50 cm de alto y 30 cm de ancho, con una orientacin al norte magntico de 30. El segundo talud, posee
0,4 m de alto, 0,84 m de largo y 0,23 m de ancho, con una orientacin de 260.

En ascenso hacia la cima, siguiendo una direccin de 239, a 118 m de distancia del conjunto anterior y a 3899
msnm, se identific una mesa o misa, estructura rectangular de uso ritual con fines propiciatorios. Est
construida con adobe y lajas apiladas, mide 0,50 cm de alto por 0,40 de ancho y 1,2 m de largo,
aproximadamente. Presenta entre las piedras restos de paja iros adems de ramas de arbustos del lugar. El
camino hacia la cima, formado por filosas lajas, est sealado en parte con rocas de cuarzo apiladas o puestas en
lugares estratgicos, para sortear las dificultades que presenta la subida. Se observan tambin lajas de casi 0,50m
de largo clavadas en la tierra y aseguradas con piedras en su base como seales del mismo tenor.

A los 4080msnm se emplaza un refugio rectangular (3 en Figura 1) de casi 3 m de largo por 1,70 m de ancho y
entre 0,60 y 1,3 m de altura, apoyado contra la roca. Posee una entrada de 0,60 cm que mira hacia el este
(orientada a 90). La tcnica constructiva de sus muros se asemeja a la de la estructura de la base, con filas
paralelas de lajas planas y largas sobre las que se apoyan en sentido perpendicular lajas menores. Hacia la base,
la tcnica cambia hacia un doble alineamiento de rocas irregulares con relleno de cascajo ms fino. Los muros
oeste y este, presentan en algunos espacios vacos estos rellenos de piedras de menor tamao facilitando el
aislamiento de los vientos del oeste (fro de arriba, seal de heladas cordilleranas para los lugareos) y del este
y sudeste (fro de abajo, vaticinio para las lluvias de la temporada estival).

Desde la misma se puede observar a travs de su entrada el pueblo de San Antonio de los Cobres y el cerro Terciopelo,
mientras que por encima de sus muros se ve la cadena de la Sierra de Cobres con sus cumbres bajas hacia el norte,
entre ellas el Cerro Negro (5020 msnm), por el oeste y por el este el Nevado de Acay (5760 msnm).

Hacia el sur (298), a 7 m lineales y 4097 msnm, se encuentra la estructura de la cima (4 en Figura 1). Consiste
en un recinto semicircular de dimetro mayor de 3,98 m, con muros dobles de 1 m de alto y 0,40 cm de ancho
regular. Presenta en superficie, a diferencia de la anterior, botellas rotas de sidra, vino y ginebra. Debajo de una
laja plana ubicada hacia el centro de la misma, se observaron ofrendas de coca, leos en pedazos pequeos y
vidrio de botellas, mostrando un uso ritual. El acceso a la estructura se realiza a travs de una entrada de 0,85m
de ancho, orientada a 60 hacia el norte magntico. Sobre el lado occidental, construida sobre el muro, se observa
unga apacheta, de 1,2m de alto y 0,75m de ancho, hallazgo poco comn sobre un muro cumbrero. La tcnica de
construccin es la pirca seca con un apilamiento de rocas irregulares en alternancia de doble hilera, en caso de
piedras de menor tamao, e hilera simple, ante el uso de lajas grandes.

TOMO IV - 1558
Pablo Mignone

Por otra parte, se pudieron visualizar dos estructuras menores, a 3 m hacia el oeste de la anterior, consistentes en
pequeos alineamientos de piedras en forma semicircular (5 y 6 en Figura 1). La ms cercana a la estructura
cumbrera se encuentra abierta hacia el norte y asemeja un parapeto. Tiene 0,50 m de dimetro, 0,15 m de alto en
sus muros y est formado por piedras planas sin trabajar, como todo el conjunto descrito hasta el momento. Estas
piedras no pasan los 0,30 m de largo. La segunda, ms alejada, est compartimentada en dos mitades,
asemejando un 8. Su largo mximo es de 1,2 m y su ancho de 0,50 m aproximadamente. La altura de la
acumulacin de piedras que la forman llega a los 0,30 m de alto.

Un conjunto de 3 apachetas, desciende el filo por el norte distancindose entre 90 y 154 m de la estructura de la
cumbre. Dos de ellas poseen cada una, adems de la acumulacin de rocas pequeas, una laja parada. Presentan
una asociacin superficial con botellas de vidrio rotas. Las tres estn alineadas con la apacheta de la estructura
cumbrera.

Pampa de los Patos
El rea se encuentra a 8 km hacia el norte del sitio anterior, en las cercanas de una mina abandonada, conocida
como Los Patos. Las prospecciones cubrieron 3 km
2
presentando 5 parapetos que se ubican al pie de las
barrancas, dominando las aguadas que discurren hacia el ro San Antonio, sirviendo de refugio para los fuertes
vientos occidentales. Las estructuras semilunares tienen medidas regulares, alcanzando 1,5m de largo, con ancho
de muros de 0,30-0,35 m. La nica evidencia encontrada en ellos, fueron fragmentos de botellas, aparentemente
de aguardiente del Ingenio La Esperanza, Jujuy, de mediados del siglo XX. Cubren un desnivel de 200 m, desde
3773 msnm hasta 3960 msnm, aumentando el gradiente desde el 1 al 5 a medida que se avanza contra la serrana.

Hacia el norte de este conjunto, a 2km ubicamos el sitio Pampa de los Patos. El sitio se encuentra a 3860msnm
aproximadamente, entre dos cauces fluviales. En la figura 1 vemos los cuatro recintos definidos como A, B
(recintos subrectangular y subcuadrangular, respectivamente), C (Recinto Perimetral Compuesto), D (recinto
semicircular abierto) y E (cuadrngulo cerrado). Las estructuras evidencian una utilizacin prehispnica,
histrica y contempornea, de tal manera que la prctica ganadera ha llevado a la reconfiguracin de los recintos,
convirtiendo a dos de ellos en corrales.

El recinto A posee 12 m de largo por 5 m de ancho aproximadamente. Tiene una orientacin predominantemente
este-oeste en sus lados mayores. Posee una abertura de 1m sealada por piedras lajas paradas de canto a modo de
jambas, ubicada en el lado este. Cuenta con al menos dos tcnicas constructivas identificables: en el muro este
se observan piedras planas de 0,5 m de alto por 0,3 m de ancho, clavadas de canto en el suelo formando una
hilera de 1,5 m de largo (nico sector conservado del muro), mientras que en el resto la tcnica constructiva es
de doble pircado de piedras seleccionadas por sus caras planas (no se observ evidencia de canteo) y relleno de
piedras y arena. Presenta un alto grado de destruccin, sin encontrarse los restos de muros en las cercanas, por
lo que se infiere su desarticulacin actual para reacondicionar las estructuras B y C, cuyos muros alcanzan 1,7m
de alto. Los muros se conservan parcialmente en el lado este (alrededor de 1,5 m) como mencionamos,
errticamente en el sur y norte, y sin solucin de continuidad en el oeste, alcanzando alturas de 0,30 m. Hacia el
centro de la construccin y en superficie se recuperaron fragmentos de cermica.

En direccin oeste, a 59 m se encuentra la estructura B, construccin subcuadrangular de mayores dimensiones
que la anterior (12,85 m de largo por 12,68 m de ancho), siguiendo sin embargo la misma orientacin este-oeste
de sus lados mayores. La entrada de la estructura se encuentra en el lado este, est delimitada por dos piedras
lajas alargadas clavadas en el suelo que alcanzan una altura de 0,9 m. La abertura que delimitan es de 1,45 m. El
muro donde se encuentra presenta un ancho que oscila entre los 0,30 y 0,40 m por 0,90 m de altura en su parte
ms elevada. Se conservan las cuatro paredes, con la excepcin de puntuales derrumbes en el muro sur y norte.
Se levantan con hileras simples sin argamasa, de rocas de 0,30 y 0,40 m de largo. Estn apuntaladas en los
sectores inferiores con piedras de gran tamao (1,40 m por 0,50 m), parcialmente enterradas. Esta misma tcnica
se observa en el siguiente recinto descrito, el Recinto Perimetral Compuesto (RPC en adelante), en todos sus
componentes.

El RPC est conformado por 4 sub-recintos. El primero, es un semicrculo de 3m de dimetro, algo aplanado en
su eje este-oeste. La entrada se orienta hacia el este y la forman dos piedras alargadas de 0,70 m de largo, que
dejan una abertura de 0,40 m. Los muros alcanzan 1,70 m de altura y estn construidos en alternancia de tcnicas
que incluye una hilera simple de piedras planas con mezcla de barro (dirigida a evitar que penetre el viento del
oeste) y un doble pircado formado por dos lajas planas y alargadas paralelas sobre las cuales se apoyan dos
piedras menores perpendiculares. En esta formacin no se observa relleno y en los restantes muros que no tienen
TOMO IV - 1559
CAPTULO 31 - MESA DE COMUNICACIONES 2

contacto con los fuertes vientos occidentales. Presenta una ventana rectangular (0,43 m por 0,12 m) por la cual se
ve la serrana que flanquea Pampa de los Patos por el oeste, y dos nichos; uno mide 0,34 m por 0,22 m y el otro
0,44 m por 0,29 m la segunda. El segundo sub-recinto presenta tres caractersticas constructivas diferentes. La
pared oeste posee la misma tcnica de hilera simple de piedras con relleno de barro antes mencionada; la este,
donde se encuentra el acceso (de 1,04 m), est formada por 4 lajas clavadas en el suelo, de 0,40 cm de alto,
formando una hilera de 0,74 m de largo; el muro norte colinda con el tercer subrecinto y posee, al igual que el
muro sur compartido con el primer subrecinto, una doble hilera de lajas superpuestas de forma transversal.

Igual conjuncin de tcnicas poseen el tercer y cuarto subrecinto. Las jambas del tercero se encuentran derruidas,
dejando un acceso de 1,36 m, mientras que la pared este del cuarto, est formada por piedras de gran tamao
apiladas que dejan un espacio de entrada de 0,56 m. Salvo en sus lados orientales, todos los componentes del
RPC presentan un refuerzo de grandes piedras (mayores a 0,30m de largo) insertas en el suelo a modo de
scalos. Los muros en todos los sectores tienen un espesor comprendido entre 0,30 y 0,40 m.

Es posible que el RPC se completara en su momento con otra construccin menor hacia el sur, adosada al
semicrculo, ya que se proyectan de l dos muros, uno de 0,84 m de largo formado por 3 lajas paradas, y otro
mayor, de 2,6 m de largo y 1,8 m de alto por un espesor uniforme de 0,4 m. A 0,60 m de esta pared y sobre el
RPC, se encuentra una estructura rectangular de 0,6 m por 0,3 m aproximadamente, con su tapa derruida
(formada por piedras planas), bajo la cual se encontraron fragmentos cermicos.

La estructura E es semicircular abierta y est ubicada hacia el noroeste, a 29 m de la estructura B. Posee 2,8 m de
dimetro, un acceso de 0,72 m formado por lajas paradas y muros de grandes piedras planas clavadas en la tierra
sobre las que se asientan piedras menores, entre las cuales se dispuso una mezcla de barro, arena y piedras
pequeas. A 26m hacia el sudeste del RPC se hall una pequea construccin cuadrangular cerrada, de 0,8 m de
largo aproximado en todos sus lados, considerada como estructura D.

Pudieron observarse 9 concentraciones puntuales de cermica (78 fragmentos en total) entre estas estructuras y un
conjunto de piezas de basalto poco formalizadas con signos de percusin, adems del material de vidrio industrial
perteneciente a botellas de vino, cerveza, aguardiente y sidra. Con respecto a la cermica, fue clasificada
tentativamente segn las tcnicas de coccin (firing techniques, definidas por Rye 1988) en 3 grupos, A, B y C.

El grupo A (n=39) se caracteriza por responder a una coccin en atmsfera oxidante, con un color uniforme de
pasta, salvo algunos fragmentos (n=7) que presentan diferencias de color entre el ncleo (rojizo) y la superficie.
Segn Rye esto se debe a que una parte de la vasija puede haber estado en contacto directo con el fuego, siendo
la temperatura y no la atmsfera de coccin la variable interviniente. La superficie externa es alisada al igual que
la interna, con una aplicacin de pintura rojiza rojiza en la primera y naranja en la segunda. Las tcnicas de
acabado de superficie varan entre la aplicacin de alisado (n=26) y pulido (n=12). El espesor de las paredes es
de 0,6cm en promedio.

El grupo B (n=18), presenta indicios de una coccin en atmsfera reductora. Se incluyen fragmentos negros,
toscos, de inclusiones grandes que traspasan las superficies rugosas (n=2). Las paredes poseen entre 0,7 y 0,9 cm
de espesor. Tambin se distinguen fragmentos naranja-rojizo interior y exterior, de paredes alisadas (n=7).

El grupo C (n=21), por ltimo, cuyos representantes formaron parte de piezas cocidas en atmsfera oxidante,
incompleta, cuya caracterstica ms sobresaliente es un centro gris o negro, distinto del color de la superficie o
subsuperficie inmediata. Son 21 fragmentos, cuyo espesor vara entre 0,8 y 1 cm.

Este recuento forma parte de las investigaciones que venimos desarrollando en un intento de contextualizacin
de los llamados santuarios de altura dentro de la prehistoria regional, brindando una visin general de la historia
de esta particular zona que alterna por igual sitios formativos, tardos-incas, histricos y sub-actuales tanto en sus
cumbres como en quebradas aledaas y a la vera de cauces fluviales.

Asimismo, buscamos aportar al conocimiento del cordn montaoso de la Sierra de Cobres, con prospecciones
extensivas de su vertiente sur, poco relevada, y que manifiesta tambin evidencia arqueolgica muy variada,
desde los clsicos refugios semilunares de cazadores de guanacos y pastores, antiguos y modernos, hasta un
tambo incaico y un santuario de altura, siendo estas las primeras nociones de la presencia incaica en la zona.

TOMO IV - 1560
Pablo Mignone

En lugar de aislar el fenmeno ritual en las montaas, buscamos aportar a su estudio teniendo en mente siempre
que la continuidad y complejidad de la ocupacin humana punea exige discurrir por la totalidad del proceso
ms que compartimentar circunstancialmente lo que corresponde a un continuum histrico.

Agradecimientos
El autor desea expresar su agradecimiento al Consejo Nacional de Investigaciones Cientficas y Tecnolgicas
por otorgar la beca doctoral con la cual se llevan a cabo estas investigaciones; al Dr. Roberto Brcena, por
aceptar su direccin y guiar generosamente hacia su concrecin; al Lic, Christian Vitry, por su co-direccin y
apoyo en los trabajos de campo; al evaluador del escrito por sus valiosas sugerencias y justas correcciones, al Dr.
Hernn Muscio, por facilitar generosamente informacin indita sobre la presencia incaica en la zona; al
personal administrativo del INCIHUSA; a la Unidad de Antropologa de esta institucin; al Museo de
Antropologa de Salta y a la Municipalidad de San Antonio de los Cobres, por facilitar los permisos de
excavacin

Bibliografa
Azcune, C. y M. Gmez. 2002. Ecologa evolutiva y estrategias reproductivas de los pastores puneos:
aproximacin arqueolgica. Perspectivas Integradoras entre Arqueologa y Evolucin. Teora, Mtodos y Casos
de Aplicacin. Editado por G. Martnez y J. Lanata, 77-98, INCUAPA, Buenos Aires.
Beorchia Nigris, A., 1984. El Enigma de los Santuarios Indgenas de Alta Montaa. Revista del Centro de
Investigaciones Arqueolgicas de Alta Montaa (CIADAM) T. 5, Universidad Nacional de San Juan, Argentina.
Cornejo, Atilio.1937. Apuntes histricos sobre Salta. Talleres Grficos Ferrari, Buenos Aires.
Lpez, G. 2003. Pastoreo y caza de camlidos en el Temprano de la Puna de Salta: datos osteomtricos del sitio
Matancillas 2. Intersecciones en Antropologa n4, 17-27. Universidad Nacional del Centro de la Provincia de
Buenos Aires.
Lpez, G. 2005. Descripcin breve de la investigacin arqueolgica en Pastos Grandes, Puna de Salta.
Intersecciones en Antropologa 6: 219-222. Universidad Nacional del Centro de la Provincia de Buenos Aires.
Lpez, G. 2009. Diversidad arqueolgica y cambio cultural en Pastos Grandes, puna de Salta, a lo largo del
Holoceno. Relaciones XXXIV: 149-176. Sociedad Argentina de Antropologa.
Muscio, H. J. 2006. Una aproximacin evolutiva a la complejidad y al orden social durante el perodo temprano
a travs del estudio de representaciones rupestres. El caso de la Quebrada de Matancillas, Puna Argentina.
Estudios Atacameos 34, 9-30. Universidad Catlica del Norte, Chile.
Rye, O. 1988. Pottery Technology. Principles and reconstruction. The manual son archaeology. TAraxacum-
Washington.
Tarrag, M. 2000. Chacras y pukara. Desarrollos sociales tardos. Nueva Historia Argentina. Los pueblos
originarios y la conquista, Dirigido por Myriam Tarrag, pp. 257-300. Sudamericana, Buenos Aires.
TOMO IV - 1561
CAPTULO 31 - MESA DE COMUNICACIONES 2


PRCTICAS PASTORILES TARDAS EN LA CUENCA DEL RO GRANDE DE
SAN JUAN. UNA APROXIMACIN DESDE LOS PERFILES ETARIOS DE
CAMLIDOS
Juan M. Maryaski
*


Introduccin
El objetivo de este trabajo es contribuir al conocimiento de los modos de explotacin de camlidos entre las
poblaciones prehispnicas tardas surandinas. Especficamente se indaga en el manejo de rebaos domsticos a
partir de la distribucin de clases etarias. El anlisis se centra en los materiales zooarqueolgicos de comienzos
del Perodo de Desarrollos Regionales (900-1450 d.C., en adelante PDR) recuperados en el sitio Chipihuayco
(Provincia de Sud Chichas, Departamento de Potos, Bolivia). Este sitio est ubicado en la quebrada de Talina y
forma parte de la cuenca media del ro Grande de San Juan (fig. 1), un rea cuya historia prehispnica recin
comienza a estudiarse en profundidad pero que, segn la informacin generada hasta ahora, alberg una
importante cantidad y densidad de poblacin en momentos tardos (Nielsen et al. 2008). Etnohistricamente est
relacionada con la parcialidad Chicha, la cul tuvo una distribucin que, trascendiendo los frtiles valles
agrcolas del suroeste boliviano, alcanz el norte de la actual Puna argentina (Krapovickas y Aleksandrowicz
1986). Asimismo, la cuenca del ro Grande de San Juan est asociada a la produccin de cermica atribuida al
estilo alfarero Yavi, de gran dispersin en el mbito circumpuneo (vila 2009).

Chipihuayco es un conglomerado residencial situado a ca 3200 msnm, sobre una meseta en la margen derecha
del ro Talina. Con aproximadamente 50 has de superficie constituye uno de los sitios ms grandes de la regin.
En este trabajo, no obstante, nos enfocamos en los conjuntos de comienzos del PDR, los cules no
necesariamente se generaron durante el momento de mayor extensin del asentamiento. De esta manera, el
contexto estudiado conforma un caso til para comenzar a abordar el problema de la evolucin de las prcticas
pastoriles tardas en un rea de importante peso en el proceso social prehispnico. En este sentido, los resultados
alcanzados se evalan en el marco de la informacin regional disponible y de las hiptesis formuladas en torno a
esta problemtica.

El pastoreo surandino post-1000 d.c.
El PDR se caracteriza a lo largo del espacio surandino por
importantes cambios en la cultura material, en los
patrones de asentamiento y en los circuitos de
intercambio supra-regionales. Ms all de las diversas
interpretaciones acerca de su carcter (Tarrag 2000,
Nielsen 2006) estos cambios se consideran como
indicadores de severas transformaciones tanto en las
relaciones interpoblacionales como en las formas de
organizacin poltica y econmica de las sociedades
tardas.
En este contexto se ha sealado la existencia en algunas
regiones de un cambio en las prcticas pastoriles, inferido
a partir de una tendencia al aumento de camlidos adultos
en el registro zooarqueolgico a partir del ca. 1000 d.C. y
en contraste con la informacin disponible para
momentos previos (Olivera 1997, Izeta 2007). Esta
caracterstica del registro tardo se ha observado en
distintos sitios residenciales y generalmente se ha
interpretado como evidencia de que las prcticas
pastoriles tardas incorporan, junto con la produccin de
carne, un inters en la obtencin de productos
antemortem o secundarios, especficamente fibra y
animales cargueros (Olivera 1997). De este modo, se ha

*
Facultad de Filosofa y Letras, UBA (Argentina) Correo electrnico: juanmki@gmail.com
TOMO IV - 1563
CAPTULO 31 - MESA DE COMUNICACIONES 2

Taxn Unidad I Unidad II Unidad III NISP NISP%
Artiodactyla 71 684 44 799 42,14
Camelidae 71 816 101 988 52,11
Cervidae 0 4 0 4 0,21
Canidae 0 0 1 1 0,05
Rodentia 0 5 15 20 1,05
Mammalia 16 50 5 71 3,74
Avis 0 8 0 8 0,42
Chaetophractus sp. 0 5 0 5 0,26
NISP 158 1572 166 1896 100,00
NID 397 2388 170 2955
NR 555 3960 336 4851
Tabla 1. Abundancia taxonmica de Chipiwayko S1
sugerido hipotticamente que la produccin textil para el intercambio y el aumento del trfico caravanero
habran promovido este tipo de prcticas pastoriles (Olivera 1997).

El fundamento de estas interpretaciones se basa en la posibilidad de relacionar determinadas estrategias de
matanza selectiva de animales con el aprovechamiento de tipos de productos especficos (Wing 1977). Siguiendo
este razonamiento, el nfasis en la obtencin de carne promueve el sacrificio de las cras antes que alcancen la
edad adulta, mientras que el inters en los productos secundarios, por el contrario, privilegia la supervivencia de
los individuos del rebao para garantizar el suministro de dichos productos. En ausencia de otros agentes de
mortalidad, y asumiendo una composicin estable del rebao a travs del tiempo, estas dos situaciones
generaran perfiles de mortalidad con distintas proporciones de adultos, juveniles y cras (Greenfield 1988).
Arqueolgicamente, esto es pasible de ser estimado a partir del anlisis de los restos seos de animales
(O'Connor 2000).

Sin embargo los modelos tericos utilizados para distinguir entre ambos modos productivos han sido construidos
en el marco de las investigaciones sobre el pastoralismo de ovicpridos en el Viejo Mundo (Greenfield 1988,
Arbuckle et al. 2009 para una sntesis), por lo que su incorporacin acrtica a los contextos andinos es al menos
problemtica (Yacobaccio 2007). La cra de animales orientada en forma predominante a la obtencin de fibra y
transporte parece ser, en todo caso, una consecuencia de la conquista Inka (Madero 1993, 1994, Yacobaccio
2007). Para el perodo que nos ocupa, en cambio, distintas investigaciones coinciden en sealar la presencia de
estrategias mixtas, que combinan la produccin de carne con la obtencin de productos secundarios (Madero
1993, Cicala 1998, Mercolli 2004, Yacobaccio 2007). Las investigaciones etnoarqueolgicas realizadas entre
pastores puneos indican que este tipo de situaciones generan una composicin etaria con un marcado
predominio de adultos (Madero 2000-02, Yacobaccio 2007). Tomando como punto de partida estas
investigaciones nos ocuparemos de las estrategias de matanza de camlidos en Chipihuayco. A continuacin se
detalla el contexto estudiado, se describen las caractersticas generales del conjunto y se exponen los criterios
metodolgicos empleados en el anlisis.

Materiales y mtodos
La muestra analizada proviene de un basural (S1) de aproximadamente un metro de potencia excavado a partir de un
perfil expuesto por la construccin de un camino actual. Se distinguieron tres unidades estratigrficas, las cules fueron
tratadas como un nico conjunto para el anlisis osteomtrico y etario ya que dos fechas radiocarbnicas ubican la
formacin del depsito durante el PDR temprano (ca 900-1250 d.C.) (Nielsen com. per.).

La abundancia y diversidad taxonmica de la muestra se asemeja a la mayora de los conjuntos tardos de la sub-
rea circumpunea (tabla 1). Predominan las categoras Camelidae y Artiodactyla, conformando ms del 90% de
la muestra. Esta ltima categora se compone principalmente de astillas de hueso largo que, ante la presencia de
crvido (Hippocamelus sp.), no pudieron atribuirse con seguridad a camlidos (De Nigris 2004). No obstante,
dada la baja representacin de especmenes de crvido, es muy probable que la mayora de los artiodctilos
identificados sean camlidos.

Con el fin de evaluar el grado de
incidencia de los factores posdepo-
sitacionales en la integridad del conjunto
se registraron los estadios de meteo-
rizacin y se correlacion la represen-
tacin de partes (en MAU%) con los
valores de densidad sea (de Elkin 1995).
Estos arrojaron valores moderados en
todos los casos. Para la Unidad I se
obtuvo r: 0,444 (p. <0,05), para la Unidad
II r: 0,567 (p. <0,05) y finalmente, para la
Unidad III r: 0,415 (p <0,05). Asimismo,
los estadios de meteorizacin 0 y 1 son
predominantes en los taxones de mayor tamao corporal -Artiodactyla, Camelidae, Cervidae y Canidae- en las
tres unidades (fig. 2). Esto indica condiciones de preservacin relativamente buenas a lo largo de la secuencia.
Para estimar la importancia de los camlidos domsticos en el conjunto se utilizararon tcnicas univariadas y
bivariadas. La primera se basa en la existencia de un gradiente de tamao en los camlidos surandinos que tiene
a la llama como especie de mayor tamao, seguido por el guanaco -ambos dentro del grupo de camlidos
TOMO IV - 1564
Juan M. Maryaski

grandes-, la alpaca y la vicua -estos dos dentro del grupo de
camlidos pequeos (Elkin 1996, Mengoni Goalons y
Yacobaccio 2006, Izeta et al. 2009a). De esta manera se midi el
ancho de las superficies articulares de primeras y segundas
falanges (N: 17) y se calcul, en una escala logartmica
(Meadow 1987), las distancias de dichos valores con las medidas
obtenidas para guanaco andino, procedente de Salta (medido por
Mengoni Goalons y Elkin). Para el anlisis bivariado se utiliz
el ancho y el espesor de la cara articular proximal de las
primeras falanges (N: 9). En este caso se realizaron grficos de
dispersin de ambas medidas, comparndolas con valores de
llama, guanaco y vicua actuales con el fin de determinar
agrupamientos. Las medidas comparativas fueron obtenidas de
Grant (2008) e Izeta et al. (2009a), se utilizaron los protocolos
de Elkin (1996) y se distinguieron falanges delanteras y traseras
ya que presentan diferencias osteomtricas significativas (Kent
1982, Izeta et al. 2009a).

Para determinar la estructura de edad de la poblacin se utiliz la informacin derivada del estado de fusin de
los huesos del esqueleto poscraneal. El fundamento de este mtodo es que distintos centros de osificacin
fusionan en diferentes etapas durante los primeros aos de vida del individuo y que esas etapas son relativamente
constantes (O'Connor 2000: 92). De esta manera, la abundancia de elementos fusionados y no fusionados es
informativa de las edades de muerte. En lneas generales se considera que este mtodo, en comparacin con el
anlisis del desgaste y la erupcin dentaria arroja resultados de resolucin ms gruesa (Arbuckle et al. 2009),
pero tiene la ventaja de poder aplicarse sobre conjuntos como el que nos ocupa, donde la presencia de
mandbulas y maxilares aptos para el anlisis es escasa.

La presencia/ausencia de fusin fue cuantificada a partir del MNE (calculado segn criterios en De Nigris 2004).
Esto tuvo como fin evitar la sobre-representacin de elementos seos. Para determinar las edades de muerte se
utilizaron las secuencias de fusin disponibles para alpaca (Lama pacos, tomada de Kent 1982 y modificada en
De Nigris 2004) y guanaco norpatagnico (Lama guanicoe, tomada de Kaufmann 2009). En este sentido,
consideramos necesario enriquecer la base de referencia, evaluando toda la informacin disponible para la
familia Camelidae con el fin de sacarle el mximo provecho al conjunto analizado. De esta manera, se cotejaron
los resultados obtenidos a partir de estas dos referencias. En lneas generales, ambas secuencias son semejantes
en cuanto al orden en que fusionan los distintos huesos, aunque en la secuencia establecida para guanaco
norpatagnico se observan edades de fusin ms tardas con respecto a las observadas en alpaca. Este
desplazamiento ronda los 6-12 meses, salvo en los casos de hmero distal-trclea/epicndilos y tibia distal-
epfisis distal, que muestran mayor variacin. A partir de estas referencias, se definieron 4 clases de edad como
intervalos de 12 meses que abarcan desde el nacimiento hasta los cuatro aos de vida del individuo. Para el caso
de la secuencia de alpaca la cuarta clase es inexistente ya que luego de los 36 meses todos los huesos estaran
fusionados (Kent 1982, De Nigris 2004).

Resultados
Los resultados osteomtricos mostraron la
presencia de ambos grupos de tamao, aunque la
frecuencia de espcimentes es mayor en el grupo
grande. El anlisis univariado permiti identificar
que 14 casos (un 82%) se ubican por encima o en
torno al estndar de guanaco andino actual. De
stos, 11 casos (un 65% del total) se encuentran
por encima del mismo y 3 presentan valores que
corresponden a guanaco o llama pequea. El grupo de camlidos pequeos cuenta con slo 3 especmenes. Los
resultados del anlisis bivariado (figura 5) son coherentes con estas tendencias, ya que arrojaron una mayora de
especmenes de tamao grande. Las medidas de falanges traseras (N: 6) se ubican en todos los casos en torno o
por encima de los valores de llama actual. Distinta es la situacin en el caso de las falanges delanteras, ya que
dos especmenes se ubican en torno a los valores de vicua, mientras que uno se encuentra prximo al valor de
guanaco. De cualquier manera, ambas tcnicas muestran que cerca de dos tercios de los especmenes medidos
pueden ser atribuidos a camlidos ms grandes que los guanacos andinos actuales, posiblemente llamas, mientras
L. pacos (N: 77) L. guanicoe (N: 126)
Clase Edad (meses) %F %NF %F %NF
1 0 a 12 64 36 66 34
2 12 a 24 42 58 64 36
3 24 a 36 18 82 44 56
4 36 a 48 - - 20 80
< de 36 meses 42 58 42 58
Tabla 2. Proporciones de fusionados y no fusionados por clase de edad.
TOMO IV - 1565
CAPTULO 31 - MESA DE COMUNICACIONES 2

que menos de la quinta parte de los mismos pueden ser asignados con
seguridad a vicuas. Estos resultados, aunque de carcter preliminar,
permiten establecer la importancia de los camlidos domsticos en el
conjunto bajo estudio. En el futuro debern incorporarse nuevas
medidas y tcnicas osteomtricas (Izeta 2007, Grant 2008) con el fin
de ajustar y confirmar o no estas tendencias.

Con respecto a la distribucin de clases de edad, como puede
observarse en las figuras 3 y 4 y en la tabla 2, la proporcin de casos
fusionados disminuye claramente a medida que avanzamos hacia las
clases de edad ms avanzadas, an considerando ambas secuencias.
A su vez el predomino de casos no fusionados es muy marcado en el
intervalo correspondiente a la clase ms adulta, ya sea que tomemos
la referencia de L. pacos (82% entre los 24 y 36 meses) o de L.
guanicoe (80% entre los 36 y 48 meses). Esto, siguiendo la metodologa expuesta, es indicativo de una escasa
supervivencia de individuos adultos. Ms an, independientemente de los centros de osificacin que
computemos, se registra una proporcin alta de animales muertos a partir de los dos aos de vida. Sin embargo,
la primera clase de edad presenta el predominio de casos fusionados con proporciones del orden de los dos
tercios. En suma, an considerando la variacin existente en la construccin de las clases de edad, los resultados
muestran una alta cantidad de individuos sacrificados entre los dos y los cuatro aos, existiendo en cambio una
mayor supervivencia de animales antes del primer ao de vida.


Al comparar estos resultados con los obtenidos en otros sitios
residenciales tardos ubicados en valles y quebradas surgen
contrastes interesantes. Las muestras de Rincn Chico 15, Las
Mojarras 1 (Pratolongo 2008) y del B2 del Pucar de Tilcara (Cicala
1998), presentan perfiles de edad dominados por individuos adultos,
con rangos de entre el 66% y el 87%. Por otro lado, el componente
pre-Inka (Unidad B) de La Huerta (Madero 1993) y Quebrada del
Cementerio (Mercolli 2004) registran proporciones ms parejas.

Asi mismo, en un trabajo reciente Izeta y coautores (2009b) observan
que el registro zooarqueolgico posterior al 1000 d.C. muestra en los
valles y quebradas una tendencia hacia la mayor supervivencia de
camlidos por encima de los dos o tres aos de edad. El conjunto estudiado en Chipihuayco, en cambio, parece
haberse formado de manera predominante por individuos subadultos. Esta tendencia es inversa a la esperada segn las
observaciones etnoarqueolgicas de sistemas pastoriles mixtos (fibra/carne) de la Puna jujea, dnde los perfiles
etarios muestran una proporcin mayor de huesos fusionados en todas las clases de edad y un claro predominio de
stos en la categora de 24 a 36 meses (Yacobaccio 2007: 151).

Consideraciones finales
EL registro zooarqueolgico de Chipihuayco parece apoyar la idea un manejo pastoril orientado al consumo de
carne, ya que la mayora de los camlidos seran sacrificados entre el nacimiento y la edad en que alcanzan el
mayor tamao corporal. Al respecto es importante mencionar que se ha mostrado que el rendimiento de los
camlidos en este rango etario no es inferior a aqul correspondiente al de los camlidos adultos (Olivera 2001).
TOMO IV - 1566
Juan M. Maryaski

Aunque estos patrones no permiten hablar de una "especializacin" en estos productos, mucho menos se
corresponden con un inters en maximizar la vida til de los animales en funcin de los productos antemortem
que stos puedan ofrecer.

En este sentido, es importante destacar que las estrategias de matanza selectiva de camlidos observadas deben
situarse en el contexto econmico y ecolgico de la cuenca media del ro Grande de San Juan, un rea de gran
importancia agrcola y demogrfica en momentos tardos (Nielsen et al. 2008). Esto podra explicar las
diferencias con los patrones de matanza observados en las situaciones de manejo pastoril de los pastores puneos
actuales (Madero 2000-02, Yacobaccio 2007). Se ha sealado la existencia de tendencias diferentes en la
explotacin de camlidos, al menos desde el primer milenio AD, entre algunas zonas de puna y los valles mas
bajos (Izeta 2007, Izeta et al. 2009b). Una perspectiva de trabajo futura es evaluar si la importancia relativa del
pastoreo y la agricultura incidieron en los tamaos de los rebaos y los criterios de matanza, determinando
distintas composiciones etarias en los conjuntos zooarqueolgicos. Esta cuestin puede resolverse en la medida
en que se incorporen muestras de diferentes tipos de localidades -i.e. puestos- y contextos intrasitio que amplen
la perspectiva ms all de las reas de descarte en asentamientos residenciales. Una escala de anlisis regional
permite acceder a un panorama ms ajustado de las prcticas pastoriles tardas y su variabilidad. Asimismo, la
incorporacin del anlisis del desgaste y la erupcin dentaria, en la medida en que conforma una lnea
independiente para la construccin de perfiles de edad, podra contribuir a afinar las tendencias obtenidas.

Por otra parte, hay que considerar que los perfiles etarios surgidos del anlisis corren el riesgo de estar
promediando camlidos silvestres y domsticos, aunque los datos osteomtricos sobre especmenes fusionados
arrojaron, hasta ahora, un rol importante para las actividades pastoriles. Finalmente, hay que mencionar que el
uso de las secuencias de fusin de alpaca y guanaco norpatagnico demostr ser til en la medida en que, an
considerando que la construccin de las clases es diferente en ambos casos, permiti contar con perfiles etarios
coherentes entre s y contribuy a acercarnos a la variabilidad observada en los conjuntos comparados.

Agradecimientos
Agradezco especialmente a Axel Nielsen y Marana De Nigris por la orientacin recibida en distintos aspectos
de este trabajo. A Andrs Izeta y Pablo Mercolli por sus comentarios, sugerencias y aporte bibliogrfico.
Tambin a Julio valos, Malena Vzquez y Florencia vila por las conversaciones sobre la problemtica
arqueolgica regional. Lo expuesto aqu es de mi responsabilidad.

Bibliografa
Arbuckle, B., A. ztan y S. Glur, S. (2009). The evolution of sheep and goat husbandry in central Anatolia.
Anthropozoologica 44 (1): 129-157.
vila, F. (2009). Interactuando desde el estilo. Variaciones en la circulacin espacial y temporal del estilo
alfarero yavi. Estudios Atacameos 37: 29-50.
Cicala, B. (1998). Ganadera de camlidos en el Pucar de Tilcara: avances en el estudio de una muestra sea. En
Los Desarrollos Locales y sus Territorios, B. Cremonte (ed.): 305-317. UNJU.
De Nigris, M. (2004). El Consumo en Grupos Cazadores Recolectores. Un Ejemplo de Patagonia Meridional.
Sociedad Argentina de Antropologa, Buenos Aires.
Elkin, D. (1995). Volume density of South American camelid skeletal parts. International Journal of
Osteoarchaeology 5: 2937.
Elkin, D. (1996). Arqueozoologa de Quebrada Seca 3: Indicadores de Subsistencia Temprana en la Puna
Meridional Argentina. Tesis Doctoral. FFyLL, Universidad de Buenos Aires. M.S.
Grant, J. (2008). El Recurso Camelidae en Sitios de la Puna Meridional Argentina: Una Aproximacin
Osteomtrica. Tesis de licenciatura, FFyLL, UBA. MS.
Greenfield, H (1988). The origins of milk and wool production in the old world: a zooarchaeological perspective
form the Central Balkans. Current Anthropology 29 (4): 573-594.
Izeta, A (2007). Zooarqueologa del Sur de los Valles Calchaques (Provincias de Catamarca y Tucumn,
Repblica Argentina). Anlisis de Conjuntos Faunsticos del Primer Milenio AD. BAR International Series,
Oxford.
Izeta, A., C. Otaola y A. Gasco (2009a). Estndares mtricos y variabilidad en falanges proximales de camlidos
sudamericanos. Su importancia como conjunto comparativo para interpretaciones en arqueologa. Revista del
Museo de Antropologa 2 (1): 169-180.
Izeta, A., S. Urquiza y L. Baldini (2009b). La arqueofauna del Perodo Tardo en el NOA. Una aproximacin
desde los conjuntos del sitio Molinoa I (Provincia de Salta, R. Argentina). Arqueologa 15: 63-84.
TOMO IV - 1567
CAPTULO 31 - MESA DE COMUNICACIONES 2

Kaufmann, C. (2009). Estructura de Edad y Sexo en Guanaco. Estudios Actualsticos y Arqueolgicos en Pampa
y Patagonia. Sociedad Argentina de Antropologa, Buenos Aires.
Kent, J. D. (1982). The Domestication and Exploitation of South American Camelids: Methods of Analysis and
Their Application to Circum-lacustrine Archaeological Sites in Bolivia and Per. Tesis Doctoral. Washington
University, St. Louis.
Krapovickas, P y S. Aleksandrowicz (1986). Breve visin de la cultura Yavi. Anales de Arqueologa y Etnologa,
Tomo XLI-XLII.
Madero, C. (1993). Explotacin faunstica, tafonoma y economa en Humahuaca antes y despus de los
Yupanki. En Inka: Arqueologa, Historia y Urbanismo del Altiplano Andino, R. A Raffino (ed.): 145168.
Buenos Aires, Corregidor.
Madero, C. (1994). Ganadera incaica en el noroeste argentino: anlisis de la arqueofauna de dos poblados
prehispnicos. Relaciones de la Sociedad Argentina de Antropologa 19: 145-169.
Madero, C. (2000-02). Modelo etnoarqueolgico de estructura etaria en contextos pastoriles actuales de la puna
de Jujuy. Cuadernos del INAPL 19- 285-399.
Meadow, R. (1987). Techniques for comparing bone measerument data from small samples. Presentado en
Northeastern Faunal Analysis Conference. Storrs, Connecticut. MS.
Mengoni Goalons, G. y H. Yacobaccio. 2006. The domestication of south american camelids . A view from the
South-Central Andes . En Documenting Domestication. New Genetic and Archaeological Paradigms, M. Zeder,
D. Bradley, E. Emshwiller y B. Smith (eds.), pp. 228-244. University of California Press. Berkeley.
Mercolli, P. (2004). Un Aporte Desde el Estudio de las Arqueofaunas de un Sitio de Quebrada de Humahuaca
Correspondiente al Perodo de Desarrollos Regionales. Tesis de licenciatura, FFyLL, UBA. MS.
Nielsen, A. (2006). Pobres Jefes: Aspectos Corporativos en las Formaciones Sociales Pre-Inkaicas de los Andes
Circumpuneos. En Contra la Tirana Tipolgica en Arqueologa: Una Visin desde Sudamrica, C. Gnecco y
C. Langebaek (eds.): 121-150. Universidad de los Andes-Ceso, Bogot.
Nielsen, A., J. C. valos, F. vila, J. P. Guagliardo y L. Lpez (2008). Reapertura de las investigaciones
arqueolgicas en San Juan Mayo. Presentado en IX Jornadas de Investigacin en Humanidades y Ciencias
Sociales, S. S. de Jujuy.
O'Connor, T. (2000). The Archaeology of Animal Bones. Sutton Publishing, Gloucestershire.
Olivera, D. (1997). La importancia del recurso camelidae en la puna de Atacama entre los 10.000 y 500 aos AP.
Estudios Atacameos 14: 2941.
Olivera, D. (2001). Perfil etario y rendimiento econmico de Lama glama. En El Uso de los Camlidos a Travs
del Tiempo, G. Mengoni Goalons, D. Olivera y H. Yacobaccio (eds.): 179-202. Del Tridente, Buenos Aires.
Pratolongo, G (2008). Estudio de los restos faunsticos de dos sitios tardos en el valle de Yocavil, Provincia de
Catamarca: Rincn Chico 15 y Las Mojarras 1. En Estudios Arqueolgicos en Yocavil, M. Tarrag y L.
Gonzlez (eds.): 83-126. Asociacin Amigos del Museo Etnogrfico Juan B. Ambrosetti, Buenos Aires.
Tarrag, M. (2000). Chacras y pukara: desarrollos sociales tardos. En Nueva historia argentina, Tomo I, M.
Tarrag (ed.): 257-300. Sudamericana, Buenos Aires.
Yacobaccio, H. (2007). Andean Camelid herding in the South Andes: ethnoarchaeological models for
archaeozoological research. Anthropozoologica 42 (2): 143-154.
Wing, E. (1977). Caza y pastoreo tradicionales en los Andes peruanos. En Pastores de Puna. Uywamichiq
Punarunakuna, J. Flores Ochoa (ed.): 121-130. Instituto de Estudios Peruanos, Lima.
TOMO IV - 1568
Juan M. Maryaski

RELEVAMIENTO Y EXCAVACIONES SISTEMTICAS EN CUEVA DE
CRISTBAL (EL AGUILAR, PUNA DE JUJUY):
RESULTADOS PRELIMINARES
Salomn Hocsman
*
,
26
Alfredo Dionicio Calisaya
**
,
Aldo Agustn Gernimo
***
y Romina Eliana Piccn Figueroa
****


El sitio Cueva de Cristbal ha tenido un papel destacado en el conocimiento de las primeras ocupaciones agro-
pastoriles de la Puna Argentina (3000-2500 AP), brindando informacin relevante sobre: 1) la aparicin de la
cermica en el Noroeste Argentino (Fernndez 1988/89; Garca 1995); 2) las caractersticas y variabilidad del
Grupo Estilstico B definido por Aschero et al. (1991) (Fernndez 1988/89, 1995) y su vinculacin con capas
arqueolgicas datadas en el sitio en cuestin (Fernndez 1988/89; Fernndez et al. 1992); 3) la presencia de
cultgenos -tubrculos muy posiblemente domesticados en carbonizaciones en el interior de los tiestos-
(Fernndez et al. 1992) y 4); la asociacin de las representaciones rupestres -antropomorfos- y la cermica con
puntas apedunculadas de apariencia Arcaica (Fernndez et al. 1992; Fernndez 1996).

Esta serie de evidencias, de relevancia para el abordaje de la transicin de cazadores-recolectores a sociedades
agro-pastoriles en la Puna argentina, llevaron a que se realizaran nuevamente en el sitio excavaciones
sistemticas y relevamiento del arte rupestre. En este trabajo se presentan y discuten las actividades de campo
realizadas y una serie de resultados preliminares obtenidos.

Cueva de Cristbal se encuentra localizado en la porcin Oeste del Macizo de La Matadera, constituido por la
Formacin Pirgua (Rodrguez Fernndez et al. 1999), entre las Sierras de Aguilar y Alta, a aproximadamente 10
km de la localidad de El Aguilar. Sus coordenadas geogrficas son 23 1663,9 Latitud Sur y 65 3663,7
Longitud Oeste. Se encuentra a 3755 metros sobre el nivel del mar.

Se trata de un abrigo rocoso, aunque no es una cueva como su nombre lo indicara, sino un alero con un
importante reparo, definido por una pared de roca que conforma una visera y seis bloques de gran tamao
desprendidos del afloramiento, tres hacia el Nor-Noroeste y los otros tres restantes hacia el Suroeste. En vista de
planta, se asemeja a una U con el lado izquierdo parcialmente trunco. El eje mayor del espacio reparado tiene
una extensin de 16 metros y su direccin es Noroeste-Sureste

El alero rocoso presenta dos accesos, uno situado al Norte, entre dos bloques, de dimensiones reducidas, y el otro
al Oeste, ms amplio, donde las dos series de bloques se interrumpen, estando dicho espacio delimitado por una
lnea de piedra de 8 metros lineales construida mediante tres hiladas de rocas de regular tamao, parcialmente
desarmada. De esta forma, se estructuran dos grandes sectores: uno de mayor reparo, al Norte, delimitado por la
pared de roca y tres bloques, con una visera importante en el techo que protege de los elementos, y otro de menor
reparo hacia el Suroeste, definido por cuatro bloques y la estructura de piedra, prcticamente en su totalidad a
cielo abierto.

Si bien el Dr. Fernndez (1988/89) en su trabajo sobre el sitio seal que el espacio reparado presentaba
dimensiones reducidas, en realidad esto no es tan as, ya que el espacio comprendido por la pared de roca, los
bloques y la estructura de piedra involucra una superficie de aproximadamente 95m
2
. A esto se deben sumar dos
sectores por fuera del rea reparada, aunque inmediatos a la misma, que presentan materiales arqueolgicos en
superficie: uno de 9m
2
, vinculado al acceso Norte mencionado y otro entre dos bloques situados al Noroeste, de
1,5m
2
. Al respecto, es posible que uno de estos sectores corresponda a la zaranda de las excavaciones de J.
Fernndez, lo que debe ser evaluado a futuro. El rea bajo techo de roca se encuentra hacia el Este del abrigo y
comprende unos 45m
2
.


*
CONICET. Instituto de Arqueologa y Museo (IAM), FCNeIML, UNT - Instituto Superior de Estudios Sociales (ISES), UE CONICET-
UNT. shypb@arnet.com.ar
**
Instituto de Arqueologa y Museo (IAM), FCNeIML, UNT. alfredocalisaya@hotmail.com
***
Instituto de Arqueologa y Museo (IAM), FCNeIML, UNT. aldo_geronimo@yahoo.es
****
Instituto de Arqueologa y Museo (IAM), FCNeIML, UNT. romipiccon@yahoo.com

TOMO IV - 1569
CAPTULO 31 - MESA DE COMUNICACIONES 2

Las excavaciones realizadas por el Dr. Fernndez consistieron en una trinchera de 1,75x0,95m en el sector Norte
del reparo rocoso (Fernndez 1988/89). Dada la fertilidad arqueolgica obtenida en esa primera intervencin, se
decidi continuar las excavaciones en dicho sector, abarcando un rea de 9m
2
. Por otra parte, se excavaron 2,5
m
2
debajo del Panel A definido por Fernndez (1988/89), de manera de vincular las representaciones rupestres
con evidencias estratigrficas. Cabe destacar que Fernndez lo haba hecho, pero en relacin con su excavacin
del sector Norte, no con el sedimento inmediatamente debajo del panel.

La secuencia estratigrfica definida para el sector Norte a partir de las excavaciones en rea coincide en general
con la descripta por Fernndez (1988/89). El rea excavada se caracteriza por un fuerte buzamiento hacia el Sur
y por evidenciar hacia el Este, contra la pared del alero, un rea de remocin pluvial, que es acompaada, al Sur,
por cada de perfiles por gravedad. La secuencia se conforma de la siguiente forma:

- Nivel 1: constituido por arena suelta de color rojizo-amarillento producto de la desagregacin de las areniscas
aflorantes; contiene cantidad variable de clastos provenientes de la roca de caja. Presenta abundante materia
vegetal actual. Es arqueolgicamente estril. Su potencia es variable, de 1 cm a los 16 cm. Se corresponde con la
Capa E de Fernndez (1988/89).

- Nivel 2: Se diferencia claramente del nivel suprayacente porque es marcadamente compacto y duro. Su
coloracin tambin es un criterio importante, puesto que vara de pardo-rojizo a grisceo claro y oscuro en
funcin del contenido variable de ceniza y carbones. Color 10YR6/2 (light brownish gray). La nica estructura
reconocida es una cubeta de ceniza y dos estructuras de cavado de pequeo tamao hacia el techo del nivel
(agujeros de poste?). Se recuperaron gran cantidad de fragmentos cermicos, as como artefactos formatizados
tallados bifaciales y unifaciales, desechos de talla, ncleos y artefactos de molienda. Tambin cuentas, restos
minerales y fsiles. Los restos faunsticos son abundantes, aunque se presentan muy astillados, situacin que se
ve potenciada por el grado de compactacin del sedimento que dificulta su extraccin. El nivel, en toda su
potencia, contiene gran cantidad de carbones pero no se llega a definir un rea de dispersin carbonosa. La
potencia de este nivel va de los 10 a los 25 cm, engrosndose hacia el Norte. Se corresponde con las capas D y C
de J. Fernndez en cuanto a caractersticas estratigrficas y de contenido arqueolgico, aunque no se encontr la
interposicin de la camada delgada de restos de combustin sealada por Fernndez (1988/89), motivo de
discriminacin en dichas capas.

- Nivel 3: se lleg al techo de este nivel. Sin embargo, la ocurrencia de un perfil y la excavacin de un cuadrante
hasta la base del nivel -piso de roca- permiten realizar algunas consideraciones. En general es menos compacto y
de coloracin ms oscura que el nivel 2. La existencia de marcadas diferencias de coloracin dentro de este nivel
llev a dividirlo en 3a y 3b. Cabe destacar que ambos tienen la misma posicin estratigrfica, es decir, subyacen
al nivel 2, y a la vez, colindan entre si. As, 3a se encuentra hacia el Este del rea excavada contra la pared de
roca, y se correspondera a la capa B de Fernndez (1988/89). Su color es 7,5YR4/3 (brown). Por su parte, 3b se
dispone hacia el Oeste del rea excavada. Su color es 10YR3/1 (very dark gray). Lamentablemente la porcin
excavada de 3b es mnima, y los materiales artefactuales y ecofactuales recuperados no brindaron pistas sobre su
cronologa.

Para entender mejor la estratigrafa se deben tener en cuenta las caractersticas del piso del reparo rocoso. El
mismo est formado por una serie de bloques de gran tamao, que presentan sus aristas redondeadas por erosin,
que, en conjuncin con la pared de roca, forman una serie de tabiques, dando lugar a cubetas de acumulacin que
conforman espacios segregados naturalmente. Esto podra explicar la depositacin de la secuencia 3a-2-1 en la
porcin Norte y Este del rea excavada y la distribucin y extensin de cada nivel, y del nivel 3b, hacia el Oeste.
Lo interesante es que esto podra significar una temporalidad distinta de este ltimo nivel, lo que requiere ser
evaluado en el futuro prximo.

Cueva de Cristbal fue definida por J. Fernndez no como un sitio residencial, sino como un lugar donde se
desarrollaron actividades restringidas y excepcionales en el marco de prcticas rituales o propiciatorias
(Fernndez 1988/89; Fernndez et al. 1992). Sin embargo, las evidencias recolectadas producto de las
excavaciones en rea dan cuenta de una situacin distinta, donde lo residencial o domstico adquiere pleno
sentido; por ejemplo, gran cantidad de artefactos formatizados tallados vinculados con tareas de
procesamiento/consumo y de restos faunsticos astillados quemados y sin quemar, as como de numerosos tiestos
con evidencias de uso en forma de carbonizaciones.

TOMO IV - 1570
Salomn Hocsman, Alfredo Dionicio Calisaya, Aldo Agustn Gernimo y Romina Eliana Piccn Figueroa

Los trabajos de campo y de laboratorio han permitido, entre otros aspectos, ampliar el nmero de
representaciones figurativas de antropomorfos asignables al Grupo Estilstico B (Aschero et al. 1991), ahondar
en las superposiciones de las mismas y definir nuevas tonalidades presentes en el sitio en base a observaciones
directas realizadas sobre los paneles rupestres y al tratamiento digital de imgenes; establecer la presencia de
cultgenos a partir del anlisis de microfsiles en tiestos y artefactos de molienda siguiendo la metodologa
propuesta por Babot (2004, 2007) para el estudio de residuos y sustancias adheridas en artefactos arqueolgicos
y definir correspondencias con diseos de puntas de proyectil pedunculados y apedunculados presentes en
contextos de la Puna Argentina y del desierto del Norte de Chile con cronologa entre 3500 y 1800 aos AP;
particularmente, interesan las marcadas afinidades con piezas con pednculo destacado, aletas entrantes obtusas
y/u hombros y limbo lanceolado o triangular de lados convexos recuperadas en sitios de la Quebrada de Tuln y
de Antofagasta de la Sierra.

Finalmente, el estudio de los contextos y materiales recuperados en Cueva de Cristbal suministran informacin
sumamente relevante sobre las caractersticas del proceso transicional de cazadores-recolectores a sociedades
agro-pastoriles en la Puna Argentina, desde distintas lneas de evidencia. Evidentemente, este sitio residencial en
reparo rocoso esta asociado a otros, cercanos o lejanos. La expectativa, entonces, es identificar localmente las
bases residenciales de actividades mltiples, a cielo abierto, a las que podra estar asociado.

Agradecimientos
Al Dr. Juan Schobinger por toda la ayuda y el apoyo brindado. A la Compaa Minera Aguilar S.A. por la ayuda
logstica brindada. A Cecilia Mercuri, Eduardo Mauri, Luca G. Gonzlez Baroni, Sebastin H.M. Maman
Segura, Valeria Lpez y Carmen Andrada por su inestimable ayuda en la excavacin del alero. Este trabajo se
realiz en el marco de los Proyectos PIP-CONICET N 0461, FONCYT-PICT N 1567 y CIUNT N 26/G424,
dirigidos por S. Hocsman.

Bibliografa
Aschero, C.A.; M.M. Podest y L.C. Garca. 1991. Pinturas rupestres y asentamientos cermicos tempranos en la
Puna Argentina. Arqueologa 1: 9-49.
Babot, M.P. 2004. Tecnologa y utilizacin de artefactos de molienda en el Noroeste Prehispnico. San Miguel
de Tucumn, Tesis para optar al grado de Doctora en Arqueologa, Facultad de Ciencias Naturales e Inst. M.
Lillo, Universidad Nacional de Tucumn.
Babot, M.P. 2007. Granos de almidn en contextos arqueolgicos: posibilidades y perspectivas a partir de casos
del Noroeste argentino. Paleoetnobotnica del Cono Sur: estudios de casos y propuestas metodolgicas.
Compiladoras M.B. Marconetto, M.P. Babot & N. Oliszewski, 95-125. Ferreyra Editor para el Museo de
Antropologa, Facultad de Filosofa y Humanidades, Universidad Nacional de Crdoba, Crdoba.
Fernndez, J. 1988/89. Ocupaciones alfareras (2860160 aos AP) en la cueva de Cristbal, Puna de Jujuy,
Argentina. Relaciones de la Sociedad Argentina de Antropologa XVII(2) -NS-: 139-178.
Fernndez, J. 1995. Arte rupestre prhistorique des Andes de Jujuy, Rpublique Argentine. Internacional
Newsletter on Rock Art 11: 18-23.
Fernndez, J. 1996.Munitayoc, nuevo sitio con cermica temprana (1000 aos AC) en la Puna Jujea. Actas y
Memorias del XI Congreso Nacional de Arqueologa Argentina, Dcimo Primera Parte, Arqueologa del
Temprano en el Noroeste Argentino, pp. 51-58. San Rafael, Mendoza.
Fernndez, J.; H. Panarello y A. Ramos. 1992. El anlisis de elementos traza y de las relaciones entre istopos
estables del carbono en cermicas del Temprano (3000 aos A.P.) de la Puna jujea, como indicadores de su
manufactura autctona y funcionalidad probable. Cuadernos de la Facultad de Humanidades y Ciencias
Sociales 3: 13-19.
Garca, L.C. 1995. Las primeras cermicas en la Puna de Jujuy. Cuadernos de la Facultad de Humanidades y
Ciencias Sociales 5: 75-80.
Rodrguez Fernndez, L.; N. Heredia; R. Seggiaro y M. Gonzlez. 1999. Estructura andina de la cordillera
oriental en el rea de la Quebrada de Humahuaca, provincia de Jujuy, NO de Argentina. Trabajos de Geologa
21: 321-332.

TOMO IV - 1571
CAPTULO 31 - MESA DE COMUNICACIONES 2


VOLVIENDO A LA FUENTE: APROVISIONAMIENTO DE CUARCITAS EN LAS
CANTERAS DE LA MATADERA (EL AGUILAR, JUJUY, ARGENTINA)

Alfredo Dionicio Calisaya*1
*



Introduccin
Este trabajo forma parte de las investigaciones que se vienen desarrollando en la microrregin del Aguilar
(Provincia de Jujuy, Argentina) a travs de diferentes proyectos dirigidos por S. Hocsman, que retoman los
trabajos cientficos realizados por J. Fernndez durante la dcada del 60 al 70.

El objetivo del mismo es presentar los avances logrados en la caracterizacin de las reas de aprovisionamiento y
la conformacin de la estructura regional de los recursos lticos en la Depresin de Aguilar, a travs de
prospecciones sistemticas realizadas en el paraje conocido como Quebrada de La Matadera, ya que se entiende
que la localizacin y establecimiento de las reas de aprovisionamiento de las materias primas son de suma
importancia para discutir la organizacin tecnolgica de los grupos humanos que ocuparon y explotaron la
regin (Bern et al. 1995; Flegenheimer et al. 1996; Ratto y Garca 1996; Bayn et al 1999; Flegenheimer y
Bayn 1999, 2002; Escola 2002; Bayn y Flegenheimer 2004; Bonomo 2005) permitiendo plantear posibles
circuitos de movilidad, transporte e intercambio, a travs de la comparacin de los vestigios encontrados en las
canteras y los sitios circundantes a las mismas (Ratto 1991; Chaparro 2001).

La importancia que tiene la Quebrada de La Matadera para el aprovisionamiento de rocas tiles para la talla se
debe a que colinda y se nutre de materiales rocosos de la Sierra de Cajas, siendo esta ltima la nica fuente
importante de rocas cuarcticas presente al Este de la microrregin de la Depresin del Aguilar; debido a la
presencia de importantes afloramientos del Grupo Mesn (Cmbrico), que en momentos cuaternarios se
depositan en las laderas de la Sierra de Cajas en forma de bloques (Aceolaza 1968) potencialmente explotables.

Antecedentes
El paisaje de la Quebrada de La Matadera, desde un punto geolgico, presenta una direccin Norte-Sur
conformando sus limites el faldeo Este de la Sierra de Cajas donde afloran cuarcitas del Grupo Mesn (Cmbrico
Superior), que apoyan sobre lutitas del Grupo Santa Victoria (Ordovcico), siendo su limite oriental un relicto de
las areniscas rojizas del Subgrupo Pirgua (Cretcico Inferior) (Aceolaza 1968; Rodrguez Fernndez et al.
1998).

La localidad arqueolgica de La Matadera consta de varios sitios arqueolgicos identificados por Fernndez en
la dcada de 1960. Los mismos son sitios al aire libre, asignables a grupos cazadores recolectores de diferentes
momentos cronolgicos que se correlacionan con otros distribuidos por toda la regin (Fernndez 1971, 1968;
Yacobaccio1984; Lavalle y Julien 1984/1987).

Interesa particularmente el sitio Sacadero de Plata, un sitio al aire libre prximo a la fuente de cuarcita
investigada, a partir del cual Fernndez realiza una discriminacin de lo que l supone una nueva industria,
denominada Aguilarense, caracterizada por la presencia de una serie de elementos caractersticos, a saber,
grandes ncleos polidricos, lascas laminares de seccin tetragonal, hachuelas de mano monofaciales y la
ausencia de puntas de proyectil (Fernndez 1968).

Otro sitio ubicado en sta localidad es Cueva de Cristbal, que debe su importancia a la presencia de una de las
primeras evidencias de ocupaciones agro-pastoriles y de uso de tecnologa cermica en la Puna Argentina
(Fernndez 1988/89).

Las canteras de rocas cuarcticas situadas en la Quebrada de La Matadera, sobre el faldeo Este de la Sierra de
Cajas, fueron mencionadas en los trabajos de Fernndez (1971, 1988/89), pero nunca fueron estudiadas en
profundidad, a pesar de haber realizado recolecciones sistemticas en sitios prximos a las mismas (Fernndez
1971).


*
Instituto de Arqueologa y Museo. Facultad de Ciencias Naturales e I.M.L. Universidad Nacional de
Tucumn. alfredocalisaya@hotmail.com

TOMO IV - 1573
CAPTULO 31 - MESA DE COMUNICACIONES 2
A partir del ao 2008, Hocsman y equipo, volvieron a retomar las investigaciones arqueolgicas en la regin,
que pretenden contribuir al estudio de la transicin de grupos cazadores-recolectores a sociedades agropastoriles
a travs de diferentes lneas de evidencia. En este marco, se realizaron prospecciones sistemticas tendientes a la
re-localizacin de los sitios estudiados por Fernndez y a la localizacin de nuevos sitios arqueolgicos.

Metodologa
La Quebrada de La Matadera fue recorrida de forma sistemtica, abarcando un rea de 3 Km. de largo por 1,5
Km. de ancho, mediante tcnica pedestre, a travs de diferentes transectas que recorran la quebrada en direccin
Norte-Sur, como tambin Este-Oeste a fin de abarcar toda la extensin del rea de inters y poder tomar
diferentes muestras de roca para su posterior anlisis. Los datos fueron registrados con la ayuda de GPS y
volcados a fichas preestablecidas tomando en cuenta criterios geolgicos y arqueolgicos (Nami 1992; Franco y
Borrero 1999; Bern y Curtoni 2002; Flegenheimer y Bayn 2002; Hocsman et al. 2003; Barros y Messineo
2004; Bellelli 2004; Escola 2004; Belardi et al 2006), a fin de comenzar a analizar la variabilidad de las rocas
cuarcticas, su distribucin y posicin respecto del paisaje, dentro de las canteras.

Las muestras de rocas recolectadas fueron seleccionadas teniendo en cuenta diferentes caractersticas (dureza,
fractura, matriz, textura, color, etc.) (Nami 1992) para discutir la variabilidad en la oferta de rocas locales dentro
de la Quebrada de La Matadera. Todos estos datos fueron puestos en relacin a la informacin de los distintos
afloramientos geolgicos en la zona (Aceolaza 1968; Rodrguez Fernndez et al. 1998; Fernndez 1971), como
tambin la relacin espacial con los sitios prximos.

Resultados
Aunque por el momento no se cuenta con los anlisis petrogrficos, podemos mencionar que las cuarcitas del
Grupo Mesn aparecen en forma de bloques grandes que presentan diferencias respecto a su calidad para la talla
(sensu Nami 1986). A nivel de textura, son de grano mediano a fino, homogneas con una fractura concoidal
buena a muy buena siendo escasas las rocas con fractura irregular o subconcoidal. Por lo general presentan, una
coloracin griscea, observndose en menor medida cuarcitas de colores marrones, blanquecinas o verdosas,
siendo casi nula la presencia de cuarcitas de coloraciones rojizas.

La explotacin de la cuarcita en la quebrada se dio a partir del aprovechamiento de ndulos de tamaos que
varan entre los 20 y los 60 cm de dimetro, distribuidos a lo largo de todo el sector Oeste de la quebrada,
llegando incluso al borde de las laderas de arenisca del Subgrupo Pirgua.

En cuanto a la morfologa de los ncleos abandonados dentro de las canteras, se puede observar una gran
diversidad, siendo los ncleos polidricos y amorfos los ms frecuente, registrndose en menor cantidad ncleos
de extracciones laminares y bifaciales.

Si bien entendemos que la coloracin de las rocas no es una caracterstica diagnstica de calidad, se ha
observado una recurrencia en los ndulos blanquecinos de cuarcita: aunque en muchos casos se observ
evidencias de testeado, no fueron utilizados como ncleos. Esto puede deberse a su dureza a la hora de ser
tallados, siendo muy tiles, en cambio como percutores de gran tamao.

A travs de las diferentes transectas realizadas, se observo que los bloques de cuarcita se encuentran depositados
por lo general sobre las lutitas, aunque en la parte inferior de la quebrada en la zona prxima al emplazamiento
del sitio denominada Sacadero de Plata (Fernndez 1971) aparecen sedimentos de origen elicos, constituidos
principalmente por materiales arenosos y areno-arcillosos que rellenaron parcialmente la quebrada (Fernndez
1968), siendo estos sedimentos factibles de ser excavados para poder definir posibles cronologas relativas,
debido a los procesos de acumulacin elica a la que esta sujeta la regin en general (Tchilinguirian y Pereyra
2001).

A partir de las investigaciones en curso en la Quebrada de La Matadera, la misma puede ser considerada como
un gran sistema de sitios canteras y canteras-taller tendientes al aprovisionamiento de cuarcitas, observndose
diferentes reas de explotacin. As, las canteras se ubican en el sector Oeste de la quebrada sobre la ladera de la
Sierra de Cajas, donde se observan los bloques de cuarcita de mayor tamao, como as tambin muchos ncleos
no transportables a partir de los cuales se extrajeron formas-base. Es muy escasa la presencia de lascas. Las
mayores concentraciones se dan en el sector Norte y sobre las lomadas centrales de la quebrada, aprovechando la
visual que se tiene desde esa posicin a los accesos de la misma. Dentro de esta categora estaran englobados los
sitios II y III mencionados por Fernndez (1971).
TOMO IV - 1574
Alfredo Dionicio Calisaya

Los sitios considerados como cantera-taller, por lo general, se encuentran distribuidos en el fondo de la
quebrada, prximos al cauce temporal, compuestos por una gran cantidad de desechos de talla, ncleos de menor
tamao que permiten su transporte y la presencia de esbozos de piezas bifaciales y bifaces descartados o
abandonados en el lugar. Siendo la zona con mayor densidad de evidencias el rea circundante al sitio Sacadero
de Plata (Figura 6, en Fernndez 1971). Fernndez consider a este ltimo sitio como diagnostico de la
Industria Aguilarense, que conformara parte de este sistema de sitios, considerndolo como una cantera-taller,
siendo necesario para corroborar esta hiptesis el anlisis de los materiales recolectados por Fernndez que
superaran las seis mil piezas, ya que el sitio fue prcticamente desmantelado por dichas recolecciones.

Por ultimo, se han registrado una serie de campamentos-taller a cielo abierto al Este de la quebrada, sobre la
ladera del Subgrupo Pirgua o prximos a ella, los mismos se caracterizan por ocupar zonas con poca pendiente
con una gran extensin en el terreno, presentando artefactos formatizados confeccionados en diferentes materias
primas de origen tanto local como no local. Dentro de estos sitios se pueden observar diferente tipos de ncleos
de cuarcita (laminares, bifaciales, polidricos y amorfos), algunos agotados y la presencia de Bifaces. Es
importante mencionar que en alguno de estos sitios se encontraron entre sus evidencias artefactos de molienda,
activos y pasivos, como tambin estructuras circulares de dimensiones menores a 70 cm elaboradas con rocas
planas clavadas. De esta forma, La Matadera XV y Antumpa identificados por Fernndez (1971), se trataran de
campamentos-taller, a los cuales tenemos que agregar tres nuevos sitios registrados por nosotros.

Es notoria la densidad de sitios presentes en la quebrada, como as tambin la densidad en la explotacin dentro
de las canteras. Esto puede ser tomado como un indicador de la importancia que tenia esta quebrada dentro de
los circuitos de circulacin que habran tenido los grupos humanos que ocuparon la regin, siendo la extraccin
de lascas grandes como formas-base para la confeccin de artefactos, una actividad que fue muy importante y
sostenida a lo largo del tiempo.

Agradecimientos
A Salomn Hocsman por toda la ayuda y el apoyo brindados a lo largo de estos aos. A Luca G. Gonzlez
Baroni, Sebastin Maman Segura, Valeria Lpez, Romina Piccn Figueroa, Aldo Gernimo, Cecilia Mercuri,
Eduardo Mauri, y Carmen Andrada por la importante ayuda prestada en el campo. Este trabajo fue posible
gracias a una Beca CIUNT en el marco del Proyectos CIUNT N 26/G424, PIPCONICET N 0461 y FONCYT-
PICT N 1567, dirigidos por S. Hocsman.

Bibliografia
Aceolaza, G. 1968. Geologa estratigrfica de la regin de la Sierra de Cajas. Dpto. Humahuaca (Provincia
de Jujuy). Revista de la Asociacin Geolgica Argentina XXIII(3): 207-222.
Barros, P. y P. Messineo, 2004. Identificacin y aprovisionamiento de chert o ftanita en la cuenca superior del
arroyo Tapalqu (Olavarra, provincia de Buenos Aires, Argentina). Estudios Atacameos 28: 87-103.
Bayon, C., N. Flegenheimer, M. Valente y A. Pupio. 1999. Dime cmo eres y te dir de dnde vienes: La
procedencia de rocas cuarcticas en la regin pampeana. Relaciones de la Sociedad Argentina de Antropologa
XXIV: 187-235.
Bayn, C. Y N Flegenheimer. 2004. Cambio de planes a travs del tiempo para el traslado de roca en la pampa
bonaerense. Estudios Atacameos 28: 59-70.
Belardi, J. B., P. Tiberi, Stern C. y A. Snico. 2006. Al Este del Cerro Pampa: ampliacin del rea de
disponibilidad de obsidiana de la Pampa del Asador (Provincia de Santa Cruz). Intersecciones en
Antropologa 7: 27-36.
Bellelli, C. 2004. Tecnologa y materias primas a la sombra de Don Segundo. Una cantera-taller en el valle de
Piedra Parada. Intersecciones en Antropologa 6: 75-92.
Bern, M., L. Migale y R. Curtoni. 1995. Hacia la definicin de una base regional de recursos lticos en el rea
del Curac. Una cantera taller: Puesto Crdoba (La Pampa, Argentina). Relaciones de la Sociedad
Argentina de Antropologa XX: 111-128.
Bern, M. y R. Curtoni. 2002. Propuesta metodologilla para la caracterizacin arqueolgica de canteras y
talleres de la meseta del fresco (La Pampa Argentina). En Del mar a los salitrales. Diez mil aos de historia
pampeana en el umbral del tercer milenio, D. Mazzanti, M. Bern y F. Oliva (Eds.), pp. 171-184.
Universidad Nacional de Mar del Plata, Mar del Plata.
Bonomo M. 2005. Costeando las llanuras. Arqueologa del litoral martimo pampeano. Buenos Aires, Sociedad
Argentina de Antropologa. Coleccin Tesis Doctorales.
TOMO IV - 1575
CAPTULO 31 - MESA DE COMUNICACIONES 2
Chaparro, M. G. 2001. La organizacin de la tecnologa ltica en sociedades pastoriles prehistricas (desde CA
2.000 AP) en la Quebrada de Inca Cueva: el caso de la cueva 5 (Jujuy, Argentina). Arqueologa 11: 9-47.
Escola, P. S. 2002. Disponibilidad de recursos lticos y fuentes de aprovisionamiento en el sector de la puna
meridional. Mundo de Antes 3: 65-84.
Escola, P. S. 2004. Variabilidad en la explotacin y distribucin de obsidianas en la Puna Meridional Argentina.
Estudios Atacameos 28: 9-24.
Fernndez, J. 1968 El Aguilarense. Bases para su ubicacin dentro de las culturas preceramicas del Noroeste
Argentino. Anales de Arqueologa y Etnologa 23: 5-73.
Fernndez, J. 1971. La Edad de la Piedra en la Puna de Atacama. Una investigacin regional y cronolgica; una
aportacin de la ciencia geogrfica a la solucin del problema vinculado a la temprana instalacin humana en
Sudamrica. Revista del Instituto de Antropologa. 3 Serie, Volumen I.
Fernndez, J. 1988/89. Ocupaciones alfareras (2860160 aos AP) en la cueva de Cristbal, Puna de Jujuy,
Argentina. Relaciones de la Sociedad Argentina de Antropologa XVII (2) -NS-: 139-178.
Franco, N.V. y E. Aragn. 2004. Variabilidad en fuentes secundarias de aprovisionamiento ltico: El caso del sur
del Lago Argentino (Santa Cruz, Argentina). Estudios Atacameos 28: 71-85.
Franco; N. V. y L. A. Borrero 1999 Metodologa de anlisis de la estructura regional de recursos. En En los tres
reinos: prcticas de recoleccin en el cono sur de Amrica, editado por C. A. Aschero, M. A. Korstanje y P. M.
Vuoto, pp. 27-37. Instituto de Arqueologa y Museo, Facultad de Ciencias Naturales e Instituto Miguel Lillo.
Universidad Nacional de Tucumn, Tucumn.
Flegenheimer, N., S. Kain, M. Zarate, A. Barna.1996. Aprovisionamiento de cuarcitas en Tandilia, las canteras
del Arroyo Diamante. Arqueologa 6: 117-140.
Flegenheimer, N. y C. Bayn. 1999. Abastecimiento de rocas en sitios pampeanos tempranos: Recolectando
colores. En En los tres reinos: Prcticas de recoleccin en el cono sur de Amrica, C. Aschero, A. Korstanje,
P. Vuoto (Eds.), pp. 95-107. Ediciones Magna Publicaciones, Tucumn.
Flegenheimer, N. y C. Bayn. 2002. Cmo, cundo y dnde. Estrategias de abastecimiento ltico en la pampa
bonaerense. En Del mar a los salitrales. Diez mil aos de historia pampeana en el umbral del tercer milenio,
D. Mazzanti, M. Bern y F. Oliva (Eds.), pp. 231-241. Universidad Nacional de Mar del Plata, Mar del Plata.
Hocsman, S., C. Somonte, M. P. Babot, A. R. Martel y A. Toselli. 2003. Anlisis de los materiales liticos de un
sitio a cielo abierto del area valliserrana del NOA: Campo Blanco, Tucumn. Cuadernos de la Facultad de
Humanidades y Ciencias Sociales 20: 325-350.
Lavalle, D. y M. Julien. 1984-1987. Programme Jujuy. Equipe de Recherche N 313. Prehistoire des Regions
Andines. Rapport Scientifique. Centre Nacional de la Recherche Scientifique.
Nami, H. G. 1986. Arqueologa experimental, tecnologa, artefactos bifaciales y modelos. Estado actual de
conocimiento en Patagonia y Tierra del fuego. Anales del Instituto de la Patagonia 18: 157-176.
Nami, H. G. 1992 El subsistema tecnolgico de la confeccin de instrumentos lticos y la explotacin de los
recursos del ambiente: una nueva va de aproximacin. Shincal 2: 33-53.
Ratto, N. 1991. Elecciones de rocas y diseo de artefactos: propiedades fsico-mecnicas de las materias primas
lticas del sitio Inca Cueva c-4 (Jujuy-Argentina). Actas del XI Congreso de Arqueologa Chilena (1988), pp.
121-137.
Ratto N. y M. F. Garca 1996. Disponibilidad y aprovisionamiento de materias primas lticas: muestreo piloto en
sectores de la costa norte de Tierra del Fuego (Argentina). Arqueologa 6: 223-258.
Rodrguez Fernndez, L., N. Heredia, R. Seggiaro y M. Gonzlez. 1998. Estructura andina de la cordillera
oriental en el rea de la Quebrada de Humahuaca, provincia de Jujuy, NO de Argentina. Trabajos de Geologa
21: 321-332.
Tchilinguirian, P. y F. Pereyra. 2001. Geomorfologa del sector Salinas Grandes-Quebrada de Humahuaca,
provincia de Jujuy. Revista de la Asociacin Geolgica Argentina 56(1): 3-15.
Yacobaccio, Hugo D. 1984. Aproximacin a la funcin de los asentamientos preceramicos en la Puna y su borde
oriental (Jujuy, Argentina). Estudios Atacameos 7: 61-69.
TOMO IV - 1576
Alfredo Dionicio Calisaya

SOCIEDADES ALDEANAS EN EL SECTOR NORTE DE LA QUEBRADA DE
HUMAHUACA: PRINCIPALES ASPECTOS DEL COMPONENTE TEMPRANO
DE ANTUMPA (DPTO. HUMAHUACA, JUJUY)
Juan Bautista Leoni
*


Antumpa y el Perodo Temprano en la Quebrada de Humahuaca
Como es bien sabido, el Perodo Agroalfarero Temprano o Formativo (ca. 1000 a.C. 800 d.C.) en el NOA se
caracteriz, en trminos generales, por el desarrollo de sociedades aldeanas basadas en poblados estables,
centradas en torno a economas de tipo productivo (agricultura en pequea escala, pastoreo de camlidos) y con
una organizacin sociopoltica mayormente igualitaria, con escasa diferenciacin interna y centralizacin
poltica; por supuesto, este proceso se manifest tambin con particularidades locales. El rea de la Quebrada de
Humahuaca parece haber compartido estas caractersticas generales con el resto del NOA, aunque el registro
arqueolgico para este momento de la trayectoria de desarrollo cultural prehispnica es en general muy
fragmentario.

Se conocen pocos sitios para el rea de la Quebrada de Humahuaca correspondientes a este perodo (e.g.
Estancia Grande [Salas 1948], El Alfarcito [Zaburln et al. 1996], Vizcarra [Nielsen 2001:187-189], Til 20
[Mendona et al. 1991] y Til 22 [Rivolta 1996; Rivolta y Albeck 1992], Malka [Nielsen 2001:187-188]; entre
otros). Se trata en general de poblados o aldeas dispersas conformadas por recintos aislados o grupos de recintos
asociados con estructuras de cultivo, y se ubican en general (aunque no exclusivamente) en la parte inferior o
media de quebradas tributarias de la quebrada principal por la que fluye el ro Grande. Esta ubicacin espacial se
explica generalmente como obedeciendo a la intencin de los habitantes de asentarse en lugares desde donde
pudiera accederse fcilmente a variados ambientes con recursos naturales diferenciados con mnimos
desplazamientos (Olivera y Palma 1986), aunque como sostienen otros autores (e.g. Albeck 1992-93:57; Nielsen
2001:187, 225) tambin podra ser el resultado en parte, de sesgos en las muestras arqueolgicas disponibles. Por
ejemplo: la baja visibilidad arqueolgica de los sitios tempranos ubicados en el fondo de la Quebrada de
Humahuaca por estar cubiertos por gruesas capas de sedimentos aluviales o por haber estado ubicados en lugares
que fueron reocupados permanentemente en los siglos posteriores, haran difcil o incluso imposible su
localizacin actual.

Es en este contexto que Antumpa ha ganado reconocimiento en la literatura arqueolgica argentina, al ser
uno de los pcos sitios ascribibles al perodo Temprano en el mbito de la Quebrada de Humahuaca. El
sitio fue mencionado por primera vez por Alberto R. Gonzlez (1977:355-356; Gonzlez y Prez 1972:60),
quien lo ubic tentativamente en el perodo Agroalfarero Temprano, en base a diferencias y similitudes
con sitios conocidos de la Quebrada de Humahuaca y la regin Valliserrana del NOA. Posteriormente,
Mara I. Hernndez Llosas, Susana Renard de Coquet y Mercedes Podest (1983-85) realizaron una
prospeccin sistemtica y excavaciones exploratorias en el sitio, confirmando la caracterizacin original
de Gonzlez y obteniendo un fechado radiocarbnico de 1360 70 AP (LATYR LP-105; sin calibrar)
(Hernndez Llosas et al. 1983-85:526-527). Mara E. Albeck (2000), Lidia Garca (2003) y Alicia
Fernndez Distel (1997) realizan nuevas descripciones de los restos arqueolgicos de Antumpa, aunque
sin encarar investigaciones sistemticas en el mismo. Las actividades de investigacin en Antumpa se
retomaron en 2006, en el marco del Proyecto Arqueolgico Antumpa/Chaupi Rodeo (Leoni 2007), y hasta
el momento han incluido la prospeccin, mapeo y realizacin de excavaciones y recolecciones
superficiales sistemticas en Antumpa, as como el reconocimiento y prospeccin del tramo inferior de la
Quebrada de Chaupi Rodeo, entorno inmediato del sitio.

Caractersticas generales del sitio
Antumpa se ubica en el sector norte de la Quebrada de Humahuaca, en el ngulo que forma la confluencia de los
ros Grande y su afluente el Chaupi Rodeo, a unos 3 km al sureste de la actual poblacin de Hiplito Yrigoyen o
Iturbe (Figura 1). El sitio destaca por su ubicacin geogrfica clave, en un rea de transicin ambiental entre la
Puna hacia el oeste, la Quebrada de Humahuaca hacia el sur y los valles orientales y yungas hacia el este. El

*
CONICET- Instituto de Arqueologa, Facultad de Filosofa y Letras, Universidad de Buenos Aires.
Facultad de Humanidades y Artes, Universidad Nacional de Rosario.
jbleoni@hotmail.com
TOMO IV - 1577
CAPTULO 31 - MESA DE COMUNICACIONES 2

ncleo del sitio arqueolgico se ubica sobre la terraza de la margen izquierda del ro Chaupi Rodeo y gran parte
del amplio faldeo adyacente. Los restos arqueolgicos se distribuyen entre los 3300 y 3600 msnm, ocupando una
vasta rea de unas 160 hectreas de extensin, aunque la mayor densidad de ocupacin se ubica en las cotas ms
bajas, sobre la terraza del ro Chaupi Rodeo, en lo que parece haber constituido el ncleo de la ocupacin
humana del lugar, desde tiempos prehispnicos hasta el presente.

Arroyo Charcomayoc
Ro
Chaupi Rodeo
Ro
Grande
N
Montculo
Quebrada de
Humahuaca
Antumpa
Quebrada de
Chaupi Rodeo
Iturbe
Humahuaca
Uqua
Tilcara
Maimar
Purmamarca
Tumbaya
Volcn
San Salvador de Jujuy
Argentina
N
Borde de barranca o terraza
Viviendas y estructuras modernas
Hondonada o posible canal/acequia
Camino para vehculos
Sendero
Estructuras y muros arqueolgicos
Referencias:

Figura 1. Plano general del sitio arqueolgico de Antumpa.

El componente Temprano de Antumpa
Se describen a continuacin los elementos principales que definen al componente Temprano del sitio. ste
adquiere gran importancia dado lo escaso del registro arqueolgico conocido para este perodo en la Quebrada de
Humahuaca, en particular el correspondiente a aldeas y/o asentamientos permanentes o semipermanentes. Por lo
tanto, Antumpa encierra importantes claves para entender cmo se desenvolvi este perodo en la regin.

Recintos circulares
Una caracterstica fundamental del sitio, que llev originalmente a A.R. Gonzlez a caracterizarlo como
Temprano, es la presencia de recintos circulares, tpicos (aunque no exclusivos) del Perodo Temprano en el
NOA. En Antumpa estos recintos se encuentran diseminados entre de los cuadros de cultivos y hacen pensar en
una aldea dispersa, similar a las que existan en la misma poca en otras regiones del NOA. Sin embargo su
visibilidad arqueolgica es muy baja y parecen haber sido muy perturbados por factores tanto antrpicos
(reutilizacin, agricultura), como naturales (erosin). La excavacin de algunos de ellos ha producido resultados
dispares. As, el Recinto 2 (cuya excavacin fue iniciada por Hernndez Llosas et al. [1983-85] y continuada por
nosotros), produjo evidencias contextuales y artefactuales de ocupacin temprana, pero el Recinto 5 y estructuras
asociadas no produjeron evidencias significativas de ocupacin de ningn tipo. Asimismo, se han identificado
restos de recintos de forma rectangular (e.g. Recinto 7), as como reas de ocupacin cuya configuracin
arquitectnica no ha podido ser definida con claridad. Ambos casos se encuentran asociados claramente con
canchones y, al igual que los recintos circulares, hacen pensar que se trataba o bien de viviendas o bien de
estructuras de ocupacin temporaria relacionadas con las actividades agrcolas.

Montculo
Desde los primeros reconocimientos del sitio se identific la presencia de, al menos, dos estructuras monticulares
que se destacan notoriamente de su entorno inmediato. Uno de ellos, situado cerca del borde de la terraza del Ro
Chaupi Rodeo, tiene una estructura circular en su parte ms alta (Figura 2). Segn pobladores locales, esta
estructura circular fue utilizada hasta tiempos recientes para trillar el trigo, aunque por sus caractersticas
constructivas, emplazamiento y dimensiones nos inclinamos a pensar que se trata de un recinto arqueolgico
temprano, reutilizado a tal fin.

Una meta de las investigaciones ha sido determinar si este montculo era de origen cultural y, en caso de serlo, si
su formacin se deba a la existencia de sucesivas ocupaciones, si se trataba de un basural, o si responda a una
acumulacin intencional de material para elevar el terreno con fines no determinados. Con este fin,
TOMO IV - 1578
Juan Bautista Leoni

0 5 10 15 20 m
N
3355
Sendero/
crcava
Corrales
modernos
Puesto
moderno
abandonado
Excavaciones
Terraza del ro
Chaupi Rodeo
Cuadrcula 3
Cuadrculas
1 y 4
Cuadrcula 2
Cuadrcula 5
Cuadrcula 6
desarrollamos excavaciones exploratorias en la cima del montculo que han permitido confirmar que su origen es
claramente cultural. Asimismo, se identific en su base arquitectura temprana bien conservada. Se ha
identificado, con seguridad, parte de un recinto circular, que parece haber sido abandonado y luego rellenado con
material de descarte, as como secciones de un muro recto y del muro de otro recinto de forma an determinada.
En las capas estratigrficas directamente asociadas con estas paredes se han hallado evidencias de reas de
combustin as como gran cantidad de artefactos y restos de fauna, tal vez relacionados con el uso de estos
recintos. Suponemos que estas estructuras conformaban un conjunto, que podra haber constituido el o uno de los
ncleos principales de la ocupacin temprana del sitio. Evidencias fragmentarias (e.g. posibles secciones de
muros y niveles de ocupacin) en los niveles estratigrficos sobre esta arquitectura temprana, haran suponer que
el lugar fue reocupado luego de que los recintos originales fueron enterrados, aunque an resta explorar esta
posibilidad a partir de la realizacin de nuevas excavaciones.
























Figura 2. Plano del montculo con ubicacin de las cuadrculas excavadas.

El conjunto de artefactos recuperado en las excavaciones realizadas en el montculo, recintos circulares y otros
sectores del sitio, responde en general a las caractersticas esperables para el Perodo Temprano. As, se han
hallado azadas/palas lticas y puntas de proyectil, estas ltimas principalmente de obsidiana, triangulares y
pedunculadas, as como fragmentos de rama horizontal de pipas cermicas, cuentas y ornamentos de diferentes
materiales, artefactos lticos con bordes denticulados de funcin no determinada, agujas de hueso y un anillo
de cobre. La cermica es en general de tipo utilitaria y sin decoracin, aunque se han recuperado tiestos con
decoracin aplicada similar a la de estilos cermicos utilizados en los valles orientales y tierras bajas.

Los fechados radiocarbnicos obtenidos hasta la fecha, provenientes en su gran mayora de los niveles
estratigrficos inferiores del montculo y asociados con la arquitectura temprana y conjuntos artefactuales antes
mencionados, indicaran que la ocupacin de esta parte del sitio tuvo lugar entre los siglos IV y IX de nuestra
era, es decir la parte final del Perodo Temprano (Figura 3); aunque todava no han podido discernirse fases de
ocupacin ms discretas dentro de este lapso general. Asimismo, se obtuvieron fechados de mucha mayor
antigedad (alrededor de 1000 aos AC) (Figura 3), aunque en materiales redepositados, utilizados como relleno
del montculo. Si bien no tienen un contexto bien definido, y por lo tanto no constituyen evidencia clara de una
ocupacin anterior, permiten conjeturar que efectivamente existi algn tipo de ocupacin humana en el sitio en
esos tiempos. Es sugestivo que varias cuevas y aleros relativamente cercanos, ubicados en la Puna o borde de
Puna (e.g. Inca Cueva, Cueva Cristbal, Pintoscayoc) han producido ocupaciones con fechados semejantes
(Fernndez 1988-89; Garca y Carrin 1992; Hernndez Llosas 1998). Localizar evidencias contextualmente
claras de una ocupacin de esta antigedad en Antumpa permitira explorar la articulacin que exista entre estos
TOMO IV - 1579
CAPTULO 31 - MESA DE COMUNICACIONES 2

sitios, que muestran ocupaciones breves y especficas, con Antumpa, que probablemente funcionara como un
lugar de residencia ms permanente.

LP-105
LP-1897 LP-1899
Recinto 2
AD 1000
AD 500
0
500 AC
1000 AC
1500 AC
AD 900
AD 800
AD 700
AD 600
AD 400
AD 300
AD 200
AD 100
100 AC
200 AC
300 AC
400 AC
600 AC
700 AC
800 AC
900 AC
1100 AC
1200 AC
1300 AC
1400 AC
LP-1996 Montculo
Cuad. 3,
Capa D
LP-2014
1 Sigma
2 Sigma
Montculo
Cuad 1, Capa D
Montculo
Cuad. 1, Capa B
Montculo
Cuad. 1, Capa c
LP-2122
Montculo
Cuad. 3, Capa C
LP-2137
Montculo
Cuad 6, Capa C
LP-2265

Figura 3. Fechados radiocarbnicos de Antumpa calibrados con programa CALIB 5.0.2html (Stuiver, M., P.J. Reimer y R.
Reimer, CALIB Radiocarbon Calibration, http://calib.qub.ac.uk/calib/calib.html).

Posibles instalaciones agrcolas
Un aspecto principal caracteriza al sitio y es la gran extensin de probables instalaciones agrcolas prehispnicas.
La distribucin de estos restos arquitectnicos no es homognea, pudindose definir dos sectores bien
diferenciados, delimitados en general por una antigua terraza que atraviesa el sitio en direccin general norte-sur.
En el sector ms bajo del sitio, ubicado hacia el oeste de esta lnea, se distribuyen amplias extensiones de
cuadros de forma rectangular, trapezoidal y cuadrangular construidos de manera muy regular, de entre 20 y 30 m
de lado. Como instalacin agrcola especfica, estos conjuntos de cuadros parecen corresponder a lo que Raffino
(1975: Nota 8) definiera como canchones o bancales de cultivo y se habran empleado para la produccin de
cultivos microtrmicos resistentes al fro y a la altura como papa, oca, quinoa y kiwicha (Albeck 1992:96)

El otro sector claramente diferenciado se encuentra ubicado hacia el este, sobre la antigua terraza, extendindose
hacia cotas ms elevadas sobre un amplio faldeo. Aqu las estructuras difieren notablemente en forma y tamao,
consistiendo en grandes cuadros de forma rectangular y cuadrangular, as como algunos con paredes curvadas,
combinados con largas acumulaciones de piedras, a veces sinuosas, que se extienden sin formar un patrn claro,
generalmente en sentido longitudinal a la pendiente, por cientos de metros. Los cuadros en este sector alcanzan
hasta 100 m de lado y no se han observado recintos circulares asociados con estas estructuras, ni material
arqueolgico en superficie en densidad significativa. Como se ha sealado anteriormente (Leoni 2007:190-191),
las estructuras en este sector podran reflejar un proceso de expansin del rea agrcola que nunca fue concluido
completamente. As, los cuadros de mayor tamao tal vez hubieran sido posteriormente subdivididos ms
regularmente, y las largas lneas de piedras podran constituir el primer paso en el despedre de las reas elegidas
para la construccin de las instalaciones agrcolas, o bien las paredes troncales a partir de las cuales se
construiran los conjuntos de cuadros.

Consideraciones finales
Se han presentado en este trabajo los principales elementos que conforman el componente Temprano de
Antumpa. Sin embargo, apenas hemos iniciado la tarea de interpretar cmo estos diversos elementos se
articularon en el pasado, tanto en el plano sincrnico como diacrnico. Resta profundizar en el entendimiento de
la traza y organizacin espacial de la ocupacin del sitio, aunque preliminarmente se puede plantear la existencia
de uno o varios ncleos de ocupacin densa representados por los montculos, y de estructuras y recintos que
parecen mostrar un uso menos intenso y continuo, tal vez relacionado con el desarrollo temporario de tareas
agrcolas. La vasta extensin de presumibles instalaciones relacionadas con la prctica de la agricultura
(canchones y cuadros, lneas de despedre, paredes de contencin), apunta a una instalacin humana en el lugar
centrada en torno a la agricultura, que busc incorporar un amplia rea de terraza y faldeo pedemontano al
cultivo. La asociacin directa entre algunas estructuras y reas con evidencias de ocupacin temprana con
TOMO IV - 1580
Juan Bautista Leoni

canchones y cuadros indica con certeza que el desarrollo de las prcticas agrcolas comenz en el Perodo
Temprano. Sin embargo, resulta incierto determinar con precisin la cronologa de la construccin, uso,
remodelacin y/o ampliacin de estas extensas instalaciones agrcolas. Si bien sus caractersticas constructivas,
en general simples y sin redes de irrigacin destacables, las diferencian notablemente de las ms complejas
instalaciones agrcolas del Tardo (e.g. Rodero, Coctaca, El Alfarcito) y las asemejan ms bien a las esperables
para el Perodo Temprano, no podemos descartar an que al menos parte de ellas correspondan a momentos ms
tardos de la secuencia de ocupacin del sitio.

En suma, las investigaciones en curso en Antumpa han comenzado a producir informacin valiosa en relacin al
Perodo Temprano en el rea de la Quebrada de Humahuaca, que sin duda contribuir a mejorar el entendimiento
actual del desarrollo de las sociedades aldeanas en esta parte del NOA. La informacin obtenida hasta el
momento aporta a la comprensin tanto de la organizacin social y poltica de la poca, como del proceso de
desarrollo de la agricultura prehispnica y de las interacciones con otras zonas ambientales, en especial los valles
orientales y las yungas.

Bibliografa
Albeck, M.E. 1992. El ambiente como generador de hiptesis sobre dinmica sociocultural prehispnica en la
Quebrada de Humahuaca. Cuadernos FHYCS-UNJU 3:95-106.
Albeck, M.E. 1992-93. reas agrcolas y densidad de ocupacin prehispnica en la Quebrada de Humahuaca,
Avances en Arqueologa 2:56-77.
Albeck, M.E. 2000. La vida agraria en los Andes del sur. Nueva Historia Argentina: Los pueblos originarios y la
conquista. Editado por M. Tarrag, pp. 187-228. Editorial Sudamericana, Buenos Aires.
Fernndez, J. 1988-89. Ocupaciones alfareras (2860 160 aos A.P.) en la cueva de Cristbal, Puna de Jujuy,
Argentina. Relaciones de la Sociedad Argentina de Antropologa, Nueva Serie XVII:139-182.
Fernndez Distel, A. 1997. Diccionario arqueolgico de Jujuy. Editorial MILOR, Salta.
Garca, L.C. 2003. Azul Pampa en etapas productivas. Cuadernos FHyCS-UNJU 20:15-35.
Garca, L.C. y F.I. Carrin. 1992. El Formativo de la Puna de Jujuy: Inca Cueva Alero 1. Cuadernos FHYCS-
UNJU 3:21-33.
Gonzlez A.R. 1977. Arte Precolombino de la Argentina. Introduccin a su historia cultural. Filmediciones
Valero, Buenos Aires.
Gonzlez A.R. y J.A. Prez. 1972. Argentina indgena, vsperas de la conquista. Paids, Buenos Aires.
Hernndez Llosas, M.I. 1998. Pintoscayoc: Arqueologa de quebradas altas en Humahuaca. Tesis Doctoral
indita, Facultad de Filosofa y Letras, Universidad de Buenos Aires.
Hernndez Llosas, M.I., S. Renard de Coquet y M.M. Podest. 1983-85. Antumpa (Departamento Humahuaca,
Provincia de Jujuy). Prospeccin, excavacin exploratoria y fechado radiocarbnico. Cuadernos del Instituto
Nacional de Antropologa 10:525-531.
Leoni, J.B. 2007. Investigaciones arqueolgicas en Antumpa y la Quebrada de Chaupi Rodeo (Depto.
Humahuaca, Jujuy): contribuciones al estudio del perodo Temprano en el sector norte de la Quebrada de
Humahuaca. Revista de la Escuela de Antropologa XIII:183-196, Facultad de Humanidades y Artes,
Universidad Nacional de Rosario.
Mendona, O., A. Bordach, M. Ruiz y B. Cremonte. 1991. Nuevas evidencias del Perodo Agroalfarero
Temprano en Quebrada de Humahuaca: los hallazgos del sitio Til 20 (Tilcara, Jujuy). Comechingonia 7:29-48.
Crdoba.
Nielsen, A.E. 2001. Evolucin Social en la Quebrada de Humauaca (AD 700-1536). Historia Prehispnica
Argentina. Tomo I. Editado por E.E. Berberin y A.E. Nielsen, pp. 171-264. Editorial Brujas, Crdoba.
Olivera, D.E. y J.R. Palma. 1986. Sistemas adaptativos prehispnicos durante los perodos agro-alfareros de la
Quebrada de Humahuaca, Jujuy, R.A. Cuadernos del Instituto de Antropologa 11:75-98.
Raffino, R. 1975. Potencial ecolgico y modelos econmicos en el N.O. argentino. Relaciones de la Sociedad
Argentina de Antropologa, Nueva Serie IX:21-45.
Rivolta, M. C. 1996. Calle Lavalle y Sorpresa: Aportes a la investigacin arqueolgica de la Quebrada de
Humahuaca. XV Aniversario Museo Arqueolgico Eduardo Casanova. Instituto Interdisciplinario de Tilcara,
pp.129-135. Tilcara.
Rivolta, M. C. y M.E. Albeck. 1992. Los asentamientos tempranos en la localidad de Tilcara: Sjuj Til.22
Provincia de Jujuy. Cuadernos FHYCS-UNJU 3:86-93.
Salas, A. 1948. Un nuevo yacimiento arqueolgico en la regin Humahuaca. Actas y Memorias del XXVIII
Congreso Internacional de Americanistas, pp. 643-648. Pars.
TOMO IV - 1581
CAPTULO 31 - MESA DE COMUNICACIONES 2

Zaburln, M.A., H.E. Maman, S.R. Dip y M.E. Albeck. 1996. S Juj Til-41: Alfarcito. Variaciones sobre un
clsico. Actas y Memorias del XI Congreso Nacional de Arqueologa Argentina (13 Parte). Revista del Museo
de Historia Natural de San Rafael (Mendoza). Tomo XXV (1/4), pp. 71-86. San Rafael, Mendoza.
TOMO IV - 1582
Juan Bautista Leoni

LA UTILIZACIN DE RECURSOS FAUNSTICOS EN UN SITIO
AGROALFARERO TEMPRANO: EL CASO DE ANTUMPA
(DPTO. HUMAHUACA, JUJUY)
Julieta I. Sartori
*
, Anah Hernndez
**
y Juan Bautista Leoni
***


Introduccion
En el presente trabajo se presentan los primeros resultados obtenidos del anlisis de los materiales
arqueofaunsticos provenientes del sitio Antumpa. Este sitio se encuentra localizado en el sector norte de la
Quebrada de Humahuaca (Dpto. Humahuaca, Pcia. de Jujuy) y posee un significativo componente de
ocupacin correspondiente al Perodo Agroalfarero Temprano o Formativo (ca. 1000 a.C. 800 d.C.) segn
las cronologas comnmente empleadas en el rea (Albeck 2000; Gonzlez 1977; Gonzlez y Prez 1972;
Hernndez Llosas et al. 1983-85; Leoni 2009; Olivera y Palma 1997). El material arqueofaunstico analizado
corresponde a restos recuperados de la excavacin de un montculo de origen cultural, en cuya base se
hallaron vestigios de arquitectura y conjuntos artefactuales caractersticos del Perodo Temprano. Los
fechados radiocarbnicos asociados a estos niveles estratigrficos indicaran que existi una ocupacin
considerable en esta parte del sitio entre los siglos IV y IX de nuestra era, es decir la parte final del perodo
considerado (ver infra).

El conjunto arqueofaunstico est compuesto fundamentalmente por camlidos aunque tambin fueron
hallados escasos elementos pertenecientes a Hippocamelus sp. y a Rhea americana. Para poder inferir el tipo
de utilizacin que se habra dado de los camlidos que son el taxn ms representado- se realiz la
estimacin de la edad diferencindose entre: 1) subadultos (<36 meses) y 2) adultos (>36 meses). Dentro de
cada grupo de edad se relevaron aquellos atributos que permiten inferir el tipo de aprovechamiento que se
habra realizado de las presas para lo cual se determin la presencia de huellas de corte, negativos de impacto,
alteraciones trmicas y tipo y estado de fractura. Asimismo se tuvo en cuenta la accin de agentes
tafonmicos que habran incidido en la muestra.

La relevancia del estudio aqu presentado radica en que son escasos los datos disponibles hasta el momento
para la zona en este rango temporal, por lo cual este trabajo contribuye a profundizar los conocimientos acerca
de la interaccin entre los grupos humanos y los animales en un momento de la trayectoria de desarrollo
cultural prehispnica regional.

Localizacin y marco ambiental del sitio
Antumpa se ubica en el sector norte de la Quebrada de Humahuaca, en el ngulo que forma la confluencia de
los ros Grande y Chaupi Rodeo, a unos 3 km al sureste de la actual poblacin de Hiplito Yrigoyen o Iturbe.
El sitio se destaca por su ubicacin geogrfica clave, en un rea de transicin ambiental entre la Puna -hacia
el oeste-, la Quebrada de Humahuaca -hacia el sur- y los valles orientales y yungas -hacia el este. El ncleo
del sitio arqueolgico se ubica sobre la terraza de la margen izquierda del ro Chaupi Rodeo, a unos 3300
m.s.n.m., aunque vastas extensiones de campos de cultivo arqueolgicos cubren gran parte del amplio faldeo
adyacente hasta alcanzar una altura mxima de 3600 m.s.n.m.

En la actualidad el clima en la zona es fro y seco en invierno, y clido y seco en verano, aunque con gran
amplitud trmica diaria (Buitrago y Larran 1994). Las precipitaciones son escasas (ca. 300 mm en promedio)
y las heladas son frecuentes en invierno, lo que dificulta la prctica de la agricultura. No existen estudios
especficos sobre las condiciones ambientales en la regin en el pasado y de los posibles cambios
experimentados a travs del tiempo. Las variaciones en las precipitaciones habran tenido su correlato en la
distribucin de las distintas comunidades vegetales y animales, con la consiguiente variabilidad en los
recursos disponibles para las poblaciones humanas de la zona en el pasado.

*
CONICET-Instituto Nacional de Antropologa y Pensamiento Latinoamericano -FUNDARQ.
julisartori@gmail.com
**
Escuela de Antropologa. Facultad de Humanidades y Artes. Universidad Nacional de Rosario.
anahihernandez87@hotmail.com
***
CONICET- Instituto de Arqueologa, Facultad de Filosofa y Letras, Universidad de Buenos Aires. Facultad de Humanidades y Artes,
Universidad Nacional de Rosario. jbleoni@hotmail.com
TOMO IV - 1583
CAPTULO 31 - MESA DE COMUNICACIONES 2


En trminos fitogeogrficos, el entorno geogrfico de Antumpa se ubica en las Provincias Prepunea, Punea
y Altoandina (Ruthsatz y Movia 1975), aunque el sitio mismo est emplazado en la primera. La Provincia
Prepunea se caracteriza por la presencia de estepa arbustiva con predominio de especies como la leja
(Baccharis boliviensis), churqui (Prosopis ferox) y cactceas, en especial cardones (Trichocereus pasacana) y
variedades rastreras del gnero Opuntia.

La fauna corresponde al Dominio Andino y se caracteriza por la presencia de roedores como el cuis (Cavia
tschudii sodalis), quirquinchos (Chaetophractus nationi), huemules (Hippocamelus antisensis), guanacos
(Lama guanicoe) y vicuas (Vicugna vicugna). Tambin hay aunque no son muy abundantes actualmente-
carnvoros como zorros (Cerdocyon thous jucundus), gatos de monte (Ocifelis geoffroyi salinarum) y pumas
(Puma concolor), y gran variedad de aves adaptadas a las condiciones ambientales de la montaa, como el
cndor andino (Vultur gryphus) y diversos tipos de rapaces y palomas. En el pasado habitaban tambin
andes o suris (Rhea americana) (Daz y Brquez 2002; Perz Golln 1968).

Procedencia de los materiales analizados
El componente Temprano de Antumpa est representado fundamentalmente por recintos circulares, de baja
visibilidad arqueolgica y alto grado de perturbacin, que se hayan dispersos entre las vastas extensiones de
canchones y cuadros de cultivo que cubren el sitio, as como por al menos una estructura monticular ubicada
cerca del borde de la terraza del Ro Chaupi Rodeo con una estructura circular muy erosionada en su parte
ms alta. Las excavaciones exploratorias revelaron inmediatamente el origen cultural de este montculo,
constituido por una gran acumulacin de material arqueolgico principalmente secundario sobre restos de
arquitectura temprana en su base. En efecto, las excavaciones permitieron identificar restos bien preservados
de un recinto circular y fragmentos de muros rectos, as como posibles niveles de ocupacin con presencia de
reas de combustin asociados con esta arquitectura temprana.

El material faunstico analizado proviene de estos posibles niveles de ocupacin, de los que se han obtenido
fechados radiocarbnicos que indican una ocupacin correspondiente a los finales del Perodo Temprano (LP-
1996, 1330 +/- 70 AP; LP-2122, 1360 +/- 80 AP). El conjunto de artefactos recuperado junto al material
faunstico responde en general a las caractersticas esperables para el Perodo Temprano. As, se han hallado
palas/azadas lticas, puntas de proyectil pequeas pedunculadas con aletas (principalmente de obsidiana),
fragmentos de rama horizontal de pipas cermicas (presumiblemente empleadas para fumar cebil), cuentas de
diferentes formas y materiales, artefactos lticos dentados sobre lajas finas de funcin no determinada, agujas
de hueso y un anillo de cobre que se supone formaba parte de un artefacto de madera. La cermica es en
general de caractersticas simple y utilitaria, aunque se han recuperado numerosos tiestos con decoracin
aplicada similar a la de estilos cermicos utilizados en los valles orientales y tierras bajas.

Mtodos
Metodolgicamente se procedi a la determinacin de la edad de muerte de los camlidos presentes en el
conjunto arqueofaunstico. Para ello se tom como criterio la fusin de epfisis establecida por Kent (1982)
para la alpaca (Lama pacos). Si bien es sabido que la secuencia vara entre diferentes especies -y a su vez
dentro de cada una segn el sexo, el tipo de alimentacin, ambiente y si se encuentran domesticadas o en
estado silvestrehay una secuencia que es comn a todos los Artiodactylos. De este modo, si bien en el registro
del sitio posiblemente se encuentran presentes distintas especies de camlidos, el criterio de Kent se considera
vlido debido a que en este trabajo se pretende poder ordenar secuencialmente los diferentes huesos (Mengoni
Goalons 1999) y no realizar una asignacin directa sin tener en cuenta lo antes mencionado. Por otro lado,
otro criterio que suele ser utilizado para la determinacin etaria es la erupcin y desgaste dentario. En el
conjunto recuperado del sitio no pudo realizarse tal asignacin debido a que las hemimandbulas y los
maxilares en pocos casos presentaban las piezas dentarias y en los casos en que s los presentaban, los mismos
se encontraban fragmentados y en mal estado de conservacin.

Por otra parte, se decidi relevar en la muestra aquellos atributos que se vincularan con las etapas de
procesamiento y consumo final de las presas. Particularmente se observaron en los materiales huellas de corte,
raspado, negativos de impacto, alteraciones trmicas y tipo y estado de la fractura (Mengoni Goalons 1999,
Outram 2001). Asimismo se tuvo en cuenta la incidencia de agentes tafonmicos entre los cuales se identific
la presencia de marcas de races, carnvoros, roedores, manganeso y meteorizacin (Lyman 1994,
Behrensmeyer 1978).

TOMO IV - 1584
Julieta I. Sartori, Anah Hernndez y Juan Bautista Leoni

En cuanto al anlisis morfomtrico que suele realizarse para la determinacin especfica de especies silvestres
(L. guanicoe y V. vicugna) vs. domesticadas (L. glama y L. pacos) cabe hacer algunas consideraciones
respecto de su aplicacin para el caso que aqu se estudia. La bibliografa arqueolgica se ha basado
fundamentalmente en la medicin de falanges debido a que se las considera como uno de los elementos ms
confiables. Particularmente se consider que este criterio no era aplicable a la muestra de falanges
recuperadas debido a que las mismas no presentaban los requerimientos mnimos que deben tener los
elementos para poder realizarla (ver L`Heureux 2007). As de las 24 falanges representadas 11 se encuentran
sin fusionar. Dentro del grupo de las fusionadas slo 10 fragmentos corresponden a epfisis proximales, de las
cuales debieron ser dejadas de lado dos especmenes por presentar estados de meteorizacin elevados (3 en la
escala de Behrensmeyer) y alteraciones trmicas, las cuales modifican la estructura cristalina del hueso
produciendo una reduccin en el tamao del mismo (Miotti 1992). Por lo expuesto, la muestra qued
conformada slo por ocho elementos medibles, con lo cual se considera que es una muestra poco
representativa. Este hecho se registra tambin en otros elementos seos (eg. metapodios, hmeros, etc) que al
encontrarse fragmentados o con estados de meteorizacin elevados hacen que la muestra de cada uno quede
constituida por muy pocos especmenes. No obstante esto y aunque el anlisis osteomtrico no se realiza en el
presente trabajo, el mismo est siendo llevado a cabo mediante una ampliacin de la muestra y se espera que
los resultados arrojen consideraciones que conjuntamente con las que aqu se plantean ayuden a dilucidar el
tipo de aprovechamiento al que habran estado sometidos los camlidos en el sitio.

Anlisis
La muestra aqu analizada posee un NISP de 693 especmenes (ver Tabla 1). Entre los taxa representados los
camlidos constituyen el 98,3% (N=347) de la muestra. En el conjunto tambin se recuper un especmen
correspondiente a Rhea americana, uno a Hippocamelus sp., tres restos pertenecientes a crictidos y uno a
Ave indeterminada.

Hippocamelus sp. 1 0,14
Rhea americana 1 0,14
Vicugna vicugna 1 0,14
Camelidae 347 50
Artiodactyla 155 22,3
Cricetidae 3 0,43
Ave 1 0,14
Mammalia 114 16,4
Indet. 69 10,3
TOTAL 693 100
Taxa NISP NISP%

Tabla 1. Abundancia taxonmica del sitio Antumpa.

Coherente con los objetivos del presente trabajo se procede a realizar el anlisis de los camlidos que son el
taxa ms representado y de los que se considera se encuentran presentes en el registro producto de la accin
antrpica.

Un aspecto que debe tenerse en cuenta respecto del NISP del conjunto, es que si bien gran cantidad de
especmenes fueron asignados al orden de Artiodactyla por no poseer zonas diagnsticas, es probable que los
mismos pertenezcan a la Familia Camelidae, ya que son el taxn predominante. Asimismo gran cantidad de
especmenes, si bien pudieron ser asignados a la mencionada Familia, debieron ser catalogados como
indeterminados respecto a su clase de edad por encontrarse fragmentados y sin los sectores de fusin. Se
considera que es de gran relevancia tener en cuenta a estos fragmentos como un grupo separado de aquellos
que pudieron ser determinados de forma ms precisa ya que de haberlos incluidos dentro de alguno de los
subconjuntos (adultos subadultos) se estara produciendo un sesgo en el anlisis de la muestra.

El NISP para los camlidos adultos es de 96 especmenes de los cuales se encuentran ms representados
aquellos elementos correspondientes al esqueleto apendicular, particularmente los fragmentos de metapodios
(N=13), falanges (N=16) y astrgalos (N=14). No obstante esto cabe sealar que todas las partes del esqueleto
TOMO IV - 1585
CAPTULO 31 - MESA DE COMUNICACIONES 2

se encuentran representadas para esta clase. Por otra parte en este subconjunto se encuentra presente una
falange que fue identificada mediante criterios morfolgicos -y por su tamao- como perteneciente a V.
vicugna. Cabe mencionar que de todos los elementos presentes en la muestra, este es el nico que parece
pertenecer a un camlido pequeo, aunque se espera que los datos osteomtricos arrojen informacin ms
precisa al respecto.

En cuanto a las huellas de corte para este subconjunto, las mismas se encuentran presentes en un 17% (N=16)
y estaran vinculadas tanto a actividades de desarticulacin como de procesamiento. Los negativos de impacto
fueron hallados en slo cuatro elementos que corresponden a huesos largos con lo cual se estima que los
mismos se vinculan con la extraccin de mdula sea.

Los especmenes de este subconjunto poseen estados de meteorizacin bajos, ya que slo un 9,3% (N=9)
present estados altos (3 en adelante). Agentes que afectaron el registro en una alta proporcin son las
manchas de manganeso y las races (43% y 26% respectivamente). Ambos factores han producido una
modificacin de las superficies seas, haciendo que en muchos casos se dificulte la observacin de otros
atributos que fueron aqu relevados (eg. huellas de corte). Las marcas de roedores slo se encuentran
presentes en 4 elementos de este conjunto y las marcas de carnvoros en dos. Por ltimo las alteraciones
trmicas se hallan en seis elementos correspondientes a las extremidades de los miembros apendiculares de
los camlidos (eg. astrgalo, 1 falanges y metapodios), las cuales podran estar vinculadas con tcnicas de
coccin ms que con procesos de descarte, ya que muestran una coloracin negruzca que no cubre el 100% de
la superficie lo cual indicara que no fueron expuestos directamente ni durante un tiempo prolongado al fuego.

Respecto de aquellos elementos que no pudieron ser asignados a una clase de edad, los mismos pertenecen
fundamentalmente a fragmentos de costillas (N=66), de vrtebras (N=22), de crneo (N=8) y difisis de
diversos huesos largos (N=26). Las huellas de corte se encuentran presentes en un 11% (N=19) y
fundamentalmente (73%) en las costillas. En uno de estos ltimos elementos fue hallada una huella de
raspado. Respecto a los procesos tafonmicos, ocho especmenes se vieron afectados por marcas de roedores
mientras que un elemento cont con un puncture (sensu Binford 1981). Las marcas de races y las manchas de
manganeso arrojan valores similares a las observadas para el conjunto de camlidos adultos.

El conjunto de los camlidos subadultos est compuesto por un NISP de 79 elementos, de los cuales pudo
establecerse que al menos 6 especmenes corresponderan a neonatos (< 3 meses). Las huellas de corte se
encuentran en los huesos del autopodio y en las epfisis de los miembros apendiculares (radio-cbito y
metapodio), lo cual indicara desarticulacin. A diferencia del subconjunto de los adultos, no fueron
registradas alteraciones trmicas y la meteorizacin afecta en menor medida a los elementos, ya que slo en
dos casos se registraron estados mayores a 2. Las manchas de manganeso y races afectaron en un 19% a la
muestra, mientras que un especmen cont con marcas de roedores y otros dos con marcas de carnvoros.

Hay una baja presencia de roedores en el sitio y probablemente esto no se deba a un sesgo de muestreo, dado
que todo el sedimento fue tamizado utilizando zarandas de 0,2 cm de malla. Se considera que los tres
especmenes presentes en el registro habran ingresado por causas naturales dado que perteneceran a
crictidos y no presentan ninguna alteracin antrpica. En cuanto a la presencia de R. americana e
Hippocamelus sp. si bien sus NISP corresponden a un nico elemento, hay una diferencia que debe sealarse
aqu. Esta es que el elemento que pertenece al ave corresponde a una tibia-tarzo que presenta una fractura
antrpica, mientras que el elemento que corresponde al crvido es un fragmento de asta el cul no presenta
seales de haber sido utilizado. As, la presencia de este ltimo taxn en el registro podra estar dada por
factores no antrpicos, ya que este crvido cambia regularmente su cornamenta, y adems en el sitio no se
encontr ningn otro elemento que pertenezca a este taxn. Por ltimo otro factor que refuerza esta idea es
que el fragmento de asta present estadios de meteorizacin elevados (4) lo cual probablemente se vincule con
una inestabilidad depositacional del mismo.

Discusin
Considerando la representacin por edades de los camlidos tenemos que para el subconjunto de camlidos
adultos se hallan representados tanto camlidos grandes como pequeos. Entre los primeros no puede
establecerse an si los mismos corresponden a L. glama y/o L. guanicoe, mientras que entre los segundos es
altamente probable que el elemento hallado corresponda a vicua.

TOMO IV - 1586
Julieta I. Sartori, Anah Hernndez y Juan Bautista Leoni

Teniendo en cuenta los fechados radiocarbnicos del sitio y la predominancia de los camlidos por sobre los
otros taxa representados es que se considera a modo de hiptesis el posible desarrollo de prcticas pastoriles
en Antumpa. Las mismas estaran vinculadas a un proceso de sedentarizacin con desarrollo de prcticas
agrcolas, ya que en el sitio se hallaron palas y azadas que se vinculan con esta actividad, adems de la
presencia de estructuras que podran haber sido utilizadas como canchones de cultivo. Por otro lado, es
probable que en el sitio tambin se hayan llevado a cabo eventos de caza, probablemente oportunsticas, de
especies salvajes como el and y la vicua. En el caso de este ltimo taxn se dificulta aqu el poder
establecer las estrategias utilizadas para su obtencin dado que, por el momento, el conjunto analizado no
presenta tendencias claras en tal sentido. En cuanto al and la baja representacin de partes esqueletales
podra deberse a un transporte selectivo de la presa. La presencia en el registro de puntas de proyectil podra
estar vinculadas con dichas actividades. El que se haya realizado una estrategia complementaria de pastoreo-
caza ya ha sido registrada para otros sitios formativos de la zona (ver por ejemplo Izeta y Scattolin 2006,
Olivera y Palma 1997) y se condice con el ambiente transicional en el que se emplaza Antumpa.

Consideraciones finales
El anlisis preliminar del componente arqueofaunsitico de Antumpa evidencia que en el sitio hubo un
aprovechamiento casi exclusivo de camlidos. Aunque el presente trabajo constituye una primer aproximacin
al anlisis de los materiales, se propone aqu a modo de hiptesis que si bien podra haber habido una
estrategia complementaria de pastoreo-caza, esta ltima actividad tambin se habra orientado hacia la
explotacin preferencial de los camlidos por sobre otros taxa (eg. and, huemul y roedores). En tal sentido
se considera que el emplazamiento del sitio en una zona ecotonal habra favorecido el desarrollo de un
proceso de sedentarizacin con prcticas agrcolas as como tambin la cra de camlidos; al mismo tiempo
que permitira continuar con la caza y recoleccin de recursos silvestres de regiones adyacentes sin necesidad
de una alta movilidad.

Por ltimo se considera que las hiptesis aqu esbozadas debern ser contrastadas con los nuevos datos que
surjan al profundizar el anlisis del registro arqueofaunstico, pero tambin los dems materiales recuperados
en el sitio. De este modo se podr establecer con mayor certeza el tipo de subsistencia de los grupos que
habitaron Antumpa en el pasado.

Bibliografa
Albeck, M.E. 2000. La vida agraria en los Andes del sur. Nueva Historia Argentina: Los pueblos originarios y la
conquista. Editado por M. Tarrag, pp. 187-228. Editorial Sudamericana, Buenos Aires.
Behrensmeyer, A.K. 1978. Taphonomic and ecologic information from bone weathering. Paleobiology 4:150-62.
Binford, L. 1981. Bones: Ancient Men and Modern Myths. Academic Press, Orlando.
Buitrago, L.G. y M.T. Larran. 1994. El clima de la Provincia de Jujuy. Ctedra de Climatologa y Fenologa
Agrcola, Facultad de Ciencias Agrarias, Universidad Nacional de Jujuy.
Daz, M.M. y R.M. Barquz. 2002. Los mamiferos de Jujuy. Editorial Colin Sharp, Buenos Aires.
Gonzlez A.R. 1977. Arte Precolombino de la Argentina. Introduccin a su historia cultural. Filmediciones
Valero, Buenos Aires.
Gonzlez A.R. y J.A. Prez. 1972. Argentina indgena, vsperas de la conquista. Paids, Buenos Aires.
Hernndez Llosas, M.I., S. Renard de Coquet y M.M. Podest. 1983-85. Antumpa (Departamento Humahuaca,
Provincia de Jujuy). Prospeccin, excavacin exploratoria y fechado radiocarbnico. Cuadernos del Instituto
Nacional de Antropologa 10:525-531.
Izeta, A.D y M. C. Scattolin 2006. Zooarqueologa de una unidad domstica Formativa. El caso de Loma Alta
(Catamarca, Argentina). Intersecciones en Antropologa 7: 193-205.
Kent, J.K. 1982. The domestication and explotation of the South American camelids: methods of analysis and
their application to circum-lacustrine archaeological sites in Bolivia and Peru. Tesis Doctoral, Washington
University.
L`Heureux, G.L. 2007. El estudio arqueolgico del proceso coevolutivo entre las poblaciones humanas y las
poblaciones de guanacos en Patagonia meridional y norte de Tierra del Fuego. British Archaeological Reports
(BAR), Oxford.
Leoni, J.B. 2009. Archaeological investigations at Antumpa (Jujuy, Argentina): Contributions to the
characterization of the Early Ceramic period in the Humahuaca region. Andean Past 9:317-322.
Lyman, R.1994. Vertebrate taphonomy. Cambridge University Press, Cambridge.
Mengoni Goalons, G. 1999. Cazadores de guanacos de la estepa patagnica. Coleccin de Tesis Doctorales.
Sociedad Argentina de Antropologa, Buenos Aires.
Miotti L. 1992. La experimentacin simulativa de fracturas y marcas seas y sus implicancias arqueolgicas.
TOMO IV - 1587
CAPTULO 31 - MESA DE COMUNICACIONES 2

Arqueologa Contempornea 3: 39-61.
Olivera, D.E. y J.R. Palma. 1997. Cronologa y Registro Arqueolgico en el Formativo Temprano en la Regin
de Humahuaca. Avances en Arqueologa 3: 77-100.
Outram, A.K. 2001. A new approach to identifying bone marrow and grease exploitation: why the
Indeterminate fragments should not be ignored. Journal of Archaeological Science 28:401- 410.
Prez Golln, J.A. 1968. Subrea de Humahuaca. Actas y Memorias del XXXVII Congreso Internacional de
Americanistas, Vol. 2, pp. 273-293.
Ruthsatz, B. y C.P. Movia. 1975. Relevamiento de las estepas andinas del noreste de la Provincia de Jujuy.
FECIC, Buenos Aires.
TOMO IV - 1588
Julieta I. Sartori, Anah Hernndez y Juan Bautista Leoni

RESULTADOS DE LAS INVESTIGACIONES SOBRE OCUPACIONES
TARDAS EN AZUL PAMPA, HUMAHUACA, JUJUY
Lidia Clara Garca



Resumen
Dentro del Proyecto UBACYT F-018, Alto Sapagua, centro de Azul Pampa, Jujuy, Argentina, 2008-10, dirigido
por la autora, nos planteamos investigar las modalidades de asentamiento y subsistencia de las economas
productoras de alimentos iniciales a plenas como el desarrollo de las de cazadores-recolectores en el sector norte
de la quebrada de Humahuaca, a partir de la domesticacin de especies animales y/o vegetales. Para esto, se
estudiaran arqueolgicamente distintos sectores areas de investigacin que brindan evidencias sobre el perodo
3.000-1000 A.P., evidenciando los orgenes de la vida sedentaria y productiva as como la base de su desarrollo
posterior. En la figura 1 pueden verse las principales reas investigadas actualmente.


Figura 1. Carta Rodero 1-50.000 (IGM) con las principales reas trabajadas actualmente.

Las temticas para el estudio de estos procesos incluyen: modelos de ocupacin del medio geogrfico,
tecnologa, sistemas de subsistencia y relaciones inter e intra-asentamientos; incluyendo en este ltimo el estudio
de la organizacin funcional y espacial de las actividades en las estructuras habitacionales y la composicin de
los conjuntos ergolgicos, faunsticos y vegetales. Asimismo, se previ obtener informacin del impacto de tales

CONICET Instituto de Arqueologa, Facultad de Filosofa y Letras, UBA. lcgarciaster@gmail.com


TOMO IV - 1589
CAPTULO 31 - MESA DE COMUNICACIONES 2

actividades sobre el ambiente y acerca de la evolucin del mismo a travs del estudio de columnas polnicas y su
comparacin con anlisis previos.

Esperamos contribuir con nuestra tarea conjunta a la preservacin de los sitios arqueolgicos, colaborando para
su defensa, puesta en valor y construccin del museo local centro interpretativo, con los pobladores locales.

Objetivos generales
Investigar las modalidades de asentamiento y subsistencia de las sociedades con economas productoras de
alimentos iniciales a plenas en la microrregin Azul Pampa. A travs del estudio arqueolgico de distintos
sectores areas de investigacin dentro de la misma, obtener evidencias sobre interaccin, as como informacin
sobre los procesos socio-culturales, su transformacin e intensificacin.

A travs del anlisis palinolgico de diferentes muestras en contextos naturales y arqueolgicos, se pretende
aportar a la discusin y responder interrogantes sobre la evolucin del paisaje, el clima y diferentes pautas de
subsistencia de los grupos humanos en el borde oriental de la Puna jujea. En este marco, merece especial
atencin la aparicin y desarrollo de la agricultura y la ganadera, considerando que hay escasa informacin al
respecto, especialmente en sitios con ocupacin sedentaria y actividad agrcola.

Adems, la determinacin de cultgenos y perturbaciones posiblemente ocasionadas por el pastoreo, nos
permitirn ampliar el conocimiento sobre los primeros cultgenos localizados y su intensificacin hacia
momentos de inicio de los Desarrollos Regionales. Comparando este desarrollo paralelamente con los
indicadores de pastoreo en el mismo lapso.

Los mapeos detallados de las ocupaciones y reocupaciones de los sitios a lo largo del tiempo, con diferentes
caractersticas, interaccin y fines, ser una tarea de base que aportar a las comparaciones posteriores con otras
microrregiones y bloques temporales.

A estos interrogantes se intentar responder con los anlisis ya iniciados sobre evidencias cermicas, lticas, de
colecciones museolgicas, biolgicas humanas, fechados, y otras a integrar.

Todas estas investigaciones buscarn dar luz sobre los cambios en el estilo de vida e interaccin de los grupos
humanos desde el Formativo Inferior Inicial hasta sus momentos tardos en la microrregin Azul Pampa,
Departamento Humahuaca, Provincia de Jujuy.

Estado actual del conocimiento sobre el tema
En general, se asocia el inicio de una economa productiva con la aparicin de cermica (Cohen 1984:268).

Las "sociedades formativas" en el NOA merecen un replanteo, desde el uso mismo de estos trminos. El "estadio
formativo", revisado ya por Willey y Phillips en 1958, abra la posibilidad a la variabilidad en cuanto a las
economas que sostenan estas sociedades. Se combinaba un modelo evolucionista bsico en el sentido de
"marcha hacia un estadio clsico", as como el encuadre difusionista. Planteaban una "revolucin agrcola de
marcha lenta" como base teortica para su estadio "preformativo", y aunque admitan otras fuentes de
sostenimiento econmico como caza, pesca y recoleccin, no tuvieron en cuenta el pastoreo para estos inicios, y
siguieron considerando a la agricultura como nico medio bsico de desarrollo demogrfico, que permitira el
establecimiento de aldeas estables en estos inicios de la llamada "sociedad compleja" en el NOA. Hubo muchos
replanteos posteriores (Olivera 1988, 2001 entre otros para una sntesis de los planteos vigentes). Sin embargo, la
existencia de una "bien estable vida aldeana sedentaria", no se cuestiona.

Un modelo que da cuenta del inicio de la produccin de alimentos es el del stress, producido por cambios
ambientales, aumento de la poblacin, cambios significativos en el sedentarismo, propiedad, territorialidad y
estrategias de reduccin del riesgo que pueden identificarse como habiendo ocurrido por primera vez solo unos
milenios antes de la domesticacin. En cambio, el modelo de competencia socioeconmica, tiene como base la
competencia entre individuos para el control del poder y la riqueza en comunidades complejas de cazadores-
recolectores. Este ltimo, ha sido criticado por Keeley sobre la base de sus datos inter-culturales sobre
cazadores-recolectores (Hayden en Price y Gebauer 1995:286-290). Los autores dejan de lado explicaciones ms
tradicionales del cambio hacia la agricultura, tales como la influencia de los ambientes marginales y las
presiones poblacionales. Enfatizan en cambio, la importancia de las reas ricas en recursos, en las cuales
comenz la agricultura, las complejas organizaciones sociales ya establecidas, el advenimiento de la
TOMO IV - 1590
Lidia Clara Garca

intensificacin econmica y la competencia. Como cristalizacin de estos cambios, aparecen nuevas
tecnofacturas como la cermica.

Planteamos revalorizar las evidencias "formativas" iniciales tempranas en cuevas y aleros, en Tres Cruces-Iturbe
(Humahuaca, Jujuy) como parte de asentamientos complementarios dentro de un sedentarismo anual (Rafferty
1985) en el cual se alterna su utilizacin para diferentes propsitos, combinando las ocupaciones en cuevas y
aleros con otras a cielo abierto en campos ms bajos cercanos y vinculados.

Las investigaciones arqueolgicas en la microrregin Azul Pampa (Aschero 1988), se desarrollaron con
diferentes encuadres desde hace ca cien aos (Boman 1908, Schuel 1919/1920, 1930, Gonzlez 1963, etc.).
Particularmente, las investigaciones sobre cazadores- recolectores en la Quebrada de Inca Cueva bajo la
direccin de C. Aschero, brindaron un importante aporte con respecto al desarrollo de tales sociedades hasta el
formativo temprano o inferior inicial (Aschero 1994).

Su encuadre, desde la unidad espacial de anlisis, la integracin del indicador arte rupestre, los estudios de
material ltico y fundamentalmente la visin de este devenir en trminos de proceso en lugar de reemplazo de
poblaciones para el comienzo del sedentarismo y la produccin de cermica, dieron lugar a nuestro trabajo a
partir de dichos lineamientos. Los aportes de Yacobaccio (1990), considerando la importancia de Inca Cueva
como zona de concentracin de nutrientes, tambin aportaron en mucho a nuestros planteos.

Resultados
Hasta el momento, hemos obtenido cinco fechados radiocarbnicos para el Antigal de Alto Sapagua, que se
integran a los ocho obtenidos anteriormente para Inca Cueva y sus contextos (Garca 1998/9). Contamos tambin
con el nico fechado que se ha realizado para el Pukara de Hornaditas, informado por el Latyr con autorizacin
del Dr. H. Yacobaccio. Con lo cual, tenemos a nivel microrregional un buen panorama de las ocupaciones que
nos interesan desde el Formativo Inferior Inicial hasta la ocupacin Inka, Hispano Indgena y actual, que en
muchos de los casos, se superponen. Hemos realizado un mapa detallado del antigal de Alto Sapagua que
muestra nuestras principales intervenciones en l, as como las superposiciones mencionadas (Garca y
Fernndez Do Ro 2008), como puede verse en la Figura 2.


Figura 2. Mapa del antigal de Alto Sapagua con las ocupaciones arqueolgicas y actuales as como el emplazamiento
de las intervenciones arqueolgicas principales.

Bibliografa
Aschero, C. A. 1988. De punta a punta: produccin, mantenimiento y diseo de puntas de proyectil precermicas
de la puna argentina. Precirculados de las ponencias cientficas presentadas a los Simposios del IX Congreso
Nacional de Arqueologa Argentina: 219-229. Simposio: Las Unidades de Anlisis para el estudio del cambio
cultural en Arqueologa. Universidad de Buenos Aires. Facultad de Filosofa y Letras. Instituto de Ciencias
Antropolgicas.
Aschero, C.A. 1994. Reflexiones desde el arcaico tardo (6000-3000 ap). Rumitacana. Revista de antropologa.
Direccin de Antropologa de Catamarca, ao 1, n 1:13-17.
TOMO IV - 1591
CAPTULO 31 - MESA DE COMUNICACIONES 2

Boman, E. 1992 (1908) Antiquits de la Rgion Andine de la Rpublique Argentine et du dsert d'Atacama.
Imprimerie Nationale, Vol. 2, Pars, Francia. Reedtado UNJu.
Cohen, M. N. 1984. La crisis alimentaria de la prehistoria. La superpoblacin y los orgenes de la agricultura.
Alianza Universidad, S.A., Madrid.
Garca, L.C. 1998/9. Arqueologa de Asentamientos Formativos en la Puna Oriental y su borde, Provincia de
Jujuy: el cambio hacia una vida crecientemente sedentaria y productiva en Azul Pampa, Departamento de
Humahuaca. Tesis para optar al grado de Doctor de la Universidad de Buenos Aires, rea Arqueologa. M.S.
Garca, L. C. y Fernndez Do Ro, S. 2008. La ocupacin humana en la quebrada de Zapagua (Puna de Jujuy).
En prensa como captulo de libro Arqueologa en las Tierras Altas de Argentina. Evolucin y Cambio Cultural.
Editado por los Dres. H. Muscio y G. Lpez, compiladores. B.A.R., Oxford, Inglaterra.
Gonzlez, A. R. 1963. Problemas arqueolgicos de la Puna Argentina. A P. B. Gimpera, en el
Septuagsimo...:373-384. Inst. Nac. de Antrop. e Hist. Nat., Univ. Nac. Autnoma, Mjico.
Olivera, D. E. 1988. La opcin productiva: Apuntes para el anlisis de sistemas adaptativos de tipo Formativo en
el Noroeste Argentino. Precirculados de las Ponencias Cientficas a los Simposios del IX Cong. Nac. de
Arqueologa Argentina: 83-101. I. De Ciencias Antropolgicas (U.B.A.). Buenos Aires.
Olivera, D. E. 2001. Sociedades agropastoriles tempranas: El formativo inferior del Nosoeste Argentino. En
Historia Argentina Prehispnica, Tomo I: 83-125. Ed. Brujas. Dir. De E. Berberin y A. E. Nielsen. Crdoba.
Price, D. T. y Gebauer, A. B. 1995. Last hunters first farmers. New perspectives on the prehistoric transition to
agriculture. School of American Research. Advanced Seminar Series. Santa Fe, New Mexico.
Rafferty, J. 1985. The archaeological record of sedentariness. Recognition, developments and implications. In
Advances in Archaeological Method and Theory, vol. 8, edited by M. B. Schiffer, pp.113-156. Academic Press,
New York.
Schuel, K. 1919/1920. Libreta de viaje: Primera Expedicin Muz Barreto, MS en la Divisin
Arqueologa, Museo de Ciencias Naturales de La Plata.
Schuel, K. 1930. Ruinas de las poblaciones de los indgenas de la provincia de Jujuy. V Reunin de la Sociedad
Argentina de Patologa del Norte Argentino. Vol. II 1430-1451. Buenos Aires.
Willey, G. y Phillips, P. 1958. Method and Theory in American Archaeology. University of Chicago Press,
Chicago.
Yacobaccio, H. D. 1990. Sistemas de asentamiento de los cazadores-recolectores Tempranos de los Andes
Centro-Sur. Tesis para optar al grado de Doctor en Filosofa. Especialidad Arqueologa. Facultad de Filosofa y
Letras. Universidad de Buenos Aires.
TOMO IV - 1592
Lidia Clara Garca

EL PUKARA DE PERCHEL (DPTO. TILCARA, JUJUY): UN CASO DE
ENTIERRO DE ADULTOS EN URNA EN LA QUEBRADA DE HUMAHUACA
Agustina Scaro
*
Lautaro Lpez Geronazzo
**


Las prcticas mortuorias, en tanto ritos de pasaje, marcan una transicin en la que interactan el cuerpo y alma
del difunto y la sociedad a la que pertenece, considerando que el ritual funerario es realizado por los vivos y para
los vivos (Cremonte y Gheggi 2008, Carr 1995; Charles y Buikstra 1995). En el mundo andino se enfrenta a la
muerte como una parte de la vida, ya que no se rompen los vnculos entre el difunto y la comunidad, por lo que
la experiencia de la muerte es tanto una experiencia personal como comunitaria, ya que en esta cosmovisin el
mundo de los muertos no es algo separado del de los vivos (Alez Garca 2001; Bascop Caero 2001). En este
trabajo se presenta un contexto funerario hallado en el Pukara de Perchel (Dto. Tilcara, Quebrada de
Humahuaca). Se trata del entierro primario de un individuo adulto en el interior de una urna. Este tipo de
hallazgos es inusual en la Quebrada, por lo que la urna funeraria recuperada en Perchel brinda una oportunidad
para avanzar en la comprensin de este tipo de prcticas mortuorias.

El Pukara de Perchel se ubica en el sector medio de la Quebrada de Humahuaca, a 2.700 m.s.n.m. en la parte ms
elevada de un morro en el Angosto de Perchel sobre la margen occidental del ro Grande (23 29 latitud sur - 65
21 longitud oeste). La ubicacin sobre este angosto permite al Pukara controlar visualmente el territorio
comprendido entre Tilcara (11 km al sur del sitio) y Huacalera (6 km al norte). El emplazamiento del sitio y su
acceso restringido debido a las abruptas laderas del morro hacia el norte y el este nos hablan de un lugar de
ubicacin estratgica y de fcil defensa desde el cual es posible controlar los movimientos en el fondo de valle
(Scaro 2009).

Las estructuras prehispnicas relevadas en Perchel se disponen en tres escalones altitudinales: la cima del cerro,
(2.709 m.s.n.m.), el espoln sur (2.698 m.s.n.m.) por donde se accede al sitio, y el espoln norte (2.690
m.s.n.m.) donde se observa la mayor densidad de estructuras arqueolgicas, aunque su conservacin es muy
pobre debido al importante declive de las laderas en este sector. Fue en el espoln norte donde rescatamos una
urna funeraria (Figura 1) en abril del 2008. El hallazgo fue realizado por el ingeniero Weivel de la ciudad de San
Salvador de Jujuy, despus de que las ltimas lluvias del verano revelaran parte de la gran olla de cermica.















Figura 1. Localizacin de la urna funeraria hallada en el Pukara de Perchel.

Cuando iniciamos la excavacin de este entierro, observamos que los fragmentos cermicos de diversos tamaos
no guardaban ningn orden, ya que, la disposicin original de los tiestos haba sido alterada por quien realiz el
hallazgo. El individuo enterrado se encontraba a 25 cm por debajo de la superficie actual del terreno y miraba
hacia el sur. El esqueleto estaba completamente articulado y presentaba una posicin genuflexa, con las manos
cruzadas sobre las rodillas y la cabeza apoyada sobre los brazos (Figura 2). Una vez retirado el cuerpo nos
encontramos con lajas de color verde y morado y con un bloque de cuarcita rosada que ubicados donde debera

*
CONICET (IDGyM). Universidad Nacional de Jujuy. teye29@hotmail.com
**
Facultad de Humanidades y Ciencias Sociales, UNJu. lautaro260@hotmail.com
TOMO IV - 1593
CAPTULO 31 - MESA DE COMUNICACIONES 2

estar la base de la gran urna. Por debajo de estos se hall una pequea lasca de obsidiana, ubicada en el estrato
estril. Alrededor de la urna se observ un sedimento arcilloso, indicando tal vez