Está en la página 1de 5

GENTICA REVERSA

Anlisis genotpico de plantas de lneas


mutantes de Arabidopsis thaliana mediante PCR

Integrantes: Karla Delgado, Daniel Tichy. Laboratorio Ingeniera gentica y
biotecnologa Vegetal, BIT210. Profesor Miguel Ibeas.

Introduccin
El estudio de los genes ha sido
clsicamente estudiado para, con
ayuda de tcnicas moleculares, situar
y clonar genes de organismos cuyos
fenotipos se presentan mutados en
ciertos aspectos
(1)
. Sin embargo, el
desarrollo de nuevas tcnicas, (como
tilling, mRNAi o mutagnesis
insercional, en la cual se enfocar este
prctico), ha permitido generar una
extensa base de datos de organismos,
(por secuenciacin), por lo que
conociendo ya la secuencia de
genomas, se puede realizar una
mutacin en sectores de ste y estudiar
su implicancia en el fenotipo de los
organismos mutados, estudio que es
conocido como gentica reversa.
Para la generacin de estas mutantes,
se puede realizar mutagnesis con T-
DNA, la cual se basa en la insercin de
un fragmento de ADN por medio de la
bacteria Agrobacterium tumefaciens,
fragmento que se encuentra codificado
en un plsmido que se inserta en el
genoma del organismo en cuestin de
forma azarosa
(2)
. El uso de estos
agentes insercionales permite la
identificacin de genes mutados de
manera relativamente sencilla, por
medio de comparacin con el genoma
de la base de datos o con el organismo
silvestre, realizando adems tcnicas
menos costosas como electroforesis
(2)
.
La planta mutante estudiada en este
prctico es de la lnea Salk_123659,
que tiene una mutacin realizada
mediante insercin de T-DNA en el gen
Atg310800 que se encuentra en el
cromosoma 3. (Ver figura 1). Este gen
codifica para protena Bzip28, factor de
transcripcin putativo atado a la
membrana
(4)
.
El objetivo de este prctico es realizar
la genotipificacin de esta lnea
mutante para as determinar si la
insercin es de forma heterocigota u
homocigota. Esto se realizar mediante
PCR utilizando 3 partidores distintos,
(uno para el borde RB o LB, y otros
dos: uno forward y otro reverse).
(5)

Figura 1. Representacin de la
insercin de T-DNA en el gen
At3g10800.

Materiales y mtodos
Extraccin de material genmico
Para la extraccin, se utiliz una planta
de Arabidopsis thaliana que haba sido
crecida y mutada previamente,
realizndose una extraccin de DNA
para la planta completa debido a que
su tamao era reducido, asegurando
as mayor cantidad de material
gentico para extraer. Se homogeniz
en 200 l de buffer TNE/SDS, (200 mM
Tris-HCl pH 8, 250 mM NaCI, 25 mM
EDTA pH 8, 0.5%SDS) durante unos
minutos.
Se realiz centrifugacin durante 5
minutos a 12000 rpm y se recuper el
sobrenadante. Se agreg 200 l de
isopropanol para precipitar el DNA
presente y se realiz un vortex por 5
segundos. Para concentrar el material
gentico presente en un pellet, se
centrifug por 5 minutos a 12000 rpm y
se elimin el sobrenadante. El pellet se
lav con 200 l de Etanol 70%, y luego
se centrifug por 5 minutos a 12000
rpm. Se elimin el sobrenadante, y en
este paso, se deba mantener el tubo
sobre papel durante una hora para
asegurar una mayor pureza del
material gentico obtenido. Finalmente,
el pellet se resuspendi en 20 l de
agua. Paralelamente, se realiz esta
misma extraccin para la planta
silvestre (WT), para que sirviera de
control.
Reaccin de PCR
Para este paso, se agregaron 9 l de
cada mezcla, (que se diferencian en los
primers utilizados; un mezcla WT y una
mezcla MT) y 2 l de DNA genmico
extrado anteriormente. Cada tubo se
marc como 4.1 (para la mezcla WT) y
4.2 (para la mezcla MT). Los
contenidos de cada tubo se muestran
en las tabla 1.

Mix Contenido Marca
1) 2)
10X buffer (+MgCl2) 2,5 l
10 mM dNTPs 0,25 l
Taq polimerasa 0,2 l
Agua 20 l
DNA genmico 2 l
10 l Primer Scr659F 0,5 l
4.1
4.2
1) WT
10 l Primer Scr659R 0,5
l
4.1
2) MT 10 l Primer LBb1.3 0,5 l 4.2
Tabla 1. Se muestra la informacin de los
tubos que contienen cada Mix utilizado en
el prctico, Mix 1 WT y Mix 2 MT. El
nmero 4 corresponde al grupo
correspondiente, y se muestra que
contena cada mix. Mix se refiere a mezcla.

El programa que se utiliz para la
amplificacin fue el siguiente:

Desnaturalizacin inicial 94C 10 min
Desnaturalizacin 94C 30 seg.
Annealing 50C 30 seg.
Extensin 72C 1 min 30 seg.
Extensin Final 72C 10 min
Realizndose 35 ciclos.

Las secuencias de los partidores
utilizados se muestran en la tabla 2:

Partidor Secuencia

Scr659F

5' CGAACTACATTCATCATACAACACA 3'

Scr659R

5'CAACTATCTCTCTCACCATGACTAA 3'

LBb1.3 5'

5' ATTTTGCCGATTTCGGAAC 3'
Tabla 2. Se muestran los partidores y su
correspondiente secuencia usados en cada
mix (ver tabla 1).

Electroforesis
Se prepar un gel de agarosa al 1% en
buffer TAE 1X, donde se carg 20 ul de
cada muestras, (las mutantes
realizadas por cada grupo con cada
mix, y adems la extraccin realizada
de la planta silvestre con cada mix),
adems 5ul del marcador de peso
molecular, (100 bp NEB DNA ladder).
Se agreg 5 l de buffer de carga 6X a
cada muestra y se carg en el gel, se
encendi la fuente de poder y se corri
el gel a 100 volt entre 30 y 40 minutos.
Resultados
Visualizacin de las ampliaciones PCR
en gel de agarosa
Tal como se explic previamente el
material genmico extrado, que en
total fue de 8 plntulas completas de
Arabidopsis thaliana, 6 de ellas
previamente transformadas y 2 de
cepas silvestres, fue sometido a
amplificacin por PCR usando las dos



















mezclas de partidores previamente
mezcla de partidores mencionadas en
la tabla 1 y 2, con los 16 productos
obtenidos se realiz una electroforesis,
como se explic previamente, cuyos
resultados fueron los siguientes:
(Fig. 2A) De estos 16 productos,
solamente 3 se amplificaron
correctamente, 1.2(wt) 5.1 (wt) y 5.2. El
primero mostr una banda de
aproximadamente de 400pb y otra de
1000pb, la segunda mostr resultados
similares y la tercera solamente mostr
una banda de aproximadamente




















400pb. De las 13 que no mostraron
ninguna, una (3.2) mostr un
degradado signo de fragmentacin. Los
resultados esperados (Fig. 2B) difieren
totalmente de los obtenidos pues se
esperaban bandas de
aproximadamente 500pb para la
presencia del alelo silvestre y una
banda de aproximadamente 200pb
para el alelo mutante. La presencia de
una sola banda es prueba de
homocigosis y la presencia de ambas
prueba de heterocigosis.
Fig.2
A) Gel de electroforesis de agarosa al 1% de los fragmentos amplificados por PCR, de Arabidopsis thaliana,
obtenidos con los partidores Scr659F y Scr659R en 1.1(wt),2.1, 3.1, 4.1, 5.1, 5.1(wt) y 6.1. Y con los partidores
Scr65 Scr659F y LBb1.3 5' en 1.2, 1.2(wt), 2.2, 3.2, 4.2, 5.2, 5.2(wt) y 6.2. Por otra parte corresponden a plantas
cepa silvestre 1.1(wt) 1.2(wt) 5.1(wt) y 5.2(wt) St corresponde al estndar de peso molecular 100 bp DNA Ladder de
New England Biolabs inc.
B) Gel de electroforesis de agarosa al 1% con los resultados esperados de los fragmentos amplificados por PCR,
de Arabidopsis thaliana, obtenidos con los partidores Scr659F y Scr659R en los carriles wt y con los partidores
Scr65 Scr659F y LBb1.3 5' en mut. Col-0 corresponde a la cepa silvestre, bZip28-1.5 corresponde a una lnea de
mutantes insercionales homocigotos del gen Atg310800,bZip28-1.6 corresponde a una lnea de mutantes
insercionales heterocigotos del gen Atg310800. L corresponde al estndar de peso molecular1 kb Plus DNA Ladder
de OGeneRuler.


A
B
Discusin
Los resultados en primera instancia
parecen ser contradictorios, y los son,
de los 16 productos esperados solo se
obtuvieron 3, esto puede ser explicado
debido a en primera instancia una
extraccin de material gentico
deficiente, ya sea porque en el proceso
de homogenizacin se perdi la gran
mayora de la muestra, porque no se
recuper suficiente sobrenadante
despus de la primera centrifugacin o
porque se elimin el pellet junto con el
sobrenadante despus de la segunda
centrifugacin o despus de la tercera.
En segunda instanciar esto pudo haber
sido debido a problemas al momento
de realizar la amplificacin PCR, ya sea
por haber tomado una alcuota de
mezcla WT/MT carente de partidores o
que la muestra haya sido tan pequea
que se haya evaporado tras la primera
subida de temperatura, otra posibilidad
pero ms pequea es que el partidor
LBb1.3 5' se haya encontrado
degradado o mal diseado, lo cual
explicara la ausencia de
amplificaciones en los productos que
fueron amplificados con este partidor, a
excepcin de 1.2(wt) y 5.2 pero esto se
explicar a continuacin. En tercera
instancia puede haberse debido a una
deficiente carga de los productos en el
gel de agarosa, pero esta posibilidad es
la menos probable, siendo la primera la
ms plausible. Una vez analizadas las
bandas obtenidas estas vuelven a ser
contradictorias entre s, tanto 1.2 (wt)
como 5.1 (wt) muestran la misma
banda de aproximadamente 400pb, a
pesar de que supuestamente se usaron
mezclas de partidores distintas para
amplificar cada uno, una posible
explicacin a esto es que al momento
de tomar la alcuota de la mezcla, o de
cargar la muestra en el gel la1.2(wt) se
haya cambiado por la 1.1(wt) o la
5.1(wt) se haya cambiado por la
5.2(wt). Tambin se observa una banda
del mismo tamao en 5.2 usando la
mezcla de partidores MT, una posible
explicacin a este resultado es que
como ocurri con las muestras de las
cepas silvestres, la muestra mutante
5.2 se haya intercambiado con la 5.1 al
momento de cargar el gel, o se hayan
tomado las alcuotas de mezcla de
partidores al revs, as mismo la
presencia de una banda del mismo
tamao que la plantas de cepa silvestre
es otra contradiccin, una posible
explicacin a esto es que o las cepas
silvestres no eran silvestres y eran
mutantes o que la muestra 5.2 de la
cepa mutante posee al menos un alelo
silvestre que fue amplificado con la
mezcla de partidores WT y no MT
como se supone debi haber sido. Otro
incgnita es la presencia de una banda
de 1000pb tanto en 5.2 como en
1.2(wt) una posible explicacin a esto
es que los partidores hayan hibridado
en zonas distintas a las originalmente
ideadas y se haya amplificado un
fragmento que est al lmite de la
procesividad de la Taq polimerasa,
estando as en baja proporcin en
comparacin a la otra banda. En
sntesis como principal teora para
explicar estos resultados y su
diferencia con respecto a los resultados
esperados, teniendo en cuenta que la
hiptesis con mayor probabilidad de ser
cierta es aquella que se basa en menos
asunciones es que la muestra 5.2
posee al menos una banda con el alelo
silvestre y que se carg al cambiada
con respecto a 5.1, lo mismo ocurri
para 1.2(wt) con 1.1(wt), mientras que
la ausencia de bandas en los otros 13
productos se debi probablemente a
una extraccin deficiente.

Conclusiones
En vista de los resultados
contradictorios y la gran cantidad de
asunciones que hay que formular para
explicarlos, junto con el hecho de que
menos del 20% de los productos
esperados fue amplificado
exitosamente es pertinente concluir que
no se logr realizar la genotipificacin
de la lnea mutante es decir, no se
logr determinar si las plantas de
estudio son heterocigotas u
homocigotas para la insercin
analizada.



















Referencias
(1) Griffiths, J .F. A. et al.
(2002). Gentica. McGraw-Hill
Interamericana
(2) Patrick J. Krysan1, Jeffery C.
Young. (1999)T-DNA as an Insertional
Mutagen in Arabidopsis. The plant Cell.
(3) Jakoby, M.,Weisshaar, B.,Droge-
Laser, (2002). bZIP transcription
factors in Arabidopsis. Encontrado a
travs de www.arabidopsis.org
(4) Gua de laboratorio N4:
Genotipificacin de Mutantes
Insercionales mediante PCR,
Universidad Andrs Bello.

Biolabs. 100 bp NEB DNA ladder,
producto N3231, www.neb.com
Sambrook, J., Fritsch, E.F. and
Maniatis, T. Molecular Cloning: A
Laboratory Manual (2nd Ed.). 1989.