Journal of Archaeological Science 33 (2006) 77e88 http://www.elsevier.

com/locate/jas

Ancient olive DNA in pits: preservation, amplication and sequence analysis

Rivka Elbaum a,*, Cathy Melamed-Bessudo b, Elisabetta Boaretto c, Ehud Galili d, Simcha Lev-Yadun e, Avraham A. Levy b, Steve Weiner a
Structural Biology Department, The Weizmann Institute of Science, Rehovot 76100, Israel b Plant Sciences Department, The Weizmann Institute of Science, Rehovot 76100, Israel c Environmental Science and Energy Research Department, The Weizmann Institute of Science, Rehovot 76100, Israel d Israel Antiquities Authority, POB 180 Atlit, Israel e Department of Biology, Faculty of Science and Science Education, University of Haifa e Oranim, Tivon 36006, Israel Received 4 April 2005; received in revised form 16 June 2005; accepted 22 June 2005
a

Abstract The olive tree (Olea europaea) was domesticated by vegetative propagation of selected wild individuals with superior fruit. Later, new cultivars were established repeatedly from feral trees or from crosses between wild, feral, and domesticated trees. Thus the genetic background of many contemporary domesticated lines is a mixture of ancient cultivars and local wild trees. Ancient DNA may illuminate the complicated process of olive domestication because such DNA sequences provide data about ancient genomes that existed closer to the domestication events. Well preserved DNA must be available for such studies, even though in the Mediterranean region, where olive cultivation took place, the climatic conditions are not favorable for DNA preservation. To select for well preserved pits we measured their proportions of lignin by IR spectroscopy, and correlated this with parameters of DNA quality such as template length in an olive-specic repeat array, and template quantity as determined by real-time PCR amplication. Archaeological pits that passed these tests did contain high quality ancient DNA. We present the rst ancient olive DNA sequences and compare them to modern wild, feral and domesticated lines. 2005 Elsevier Ltd. All rights reserved.
Keywords: Olea europaea; aDNA; Infrared; Lignin; ITS1; TrnT-L spacer; OeGEM86 repeat

1. Introduction Olive (Olea europaea L.) is one of the earliest fruit trees to be cultivated. Archaeological evidence for intensive exploitation of olive fruit is present already in the 6th millennium B.C. (calibrated) in the late Neolithic submerged site of Kfar Samir, Israel [14]. Like many other fruit trees, the olive was domesticated by

* Corresponding author. Tel.: C972 8 934 2552; fax: C972 8 934 6062. E-mail address: rivka.elbaum@weizmann.ac.il (R. Elbaum). 0305-4403/$ - see front matter 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.jas.2005.06.011

vegetative propagation of selected wild individual trees (O. europaea var. oleaster) that carry superior fruit. Therefore, the genetic distance of the cultivated lines from the wild trees is very small [38]. Domestication of wild olives is thought to have recurred repeatedly around the Mediterranean by selection of superior individuals from feral trees (crosses between two cultivated lines) and from crosses between domesticated and local wild or feral trees, that grew in the vicinity of olive groves. This process has continued until modern times [39]. Thus, the genetic background of the dierent olive lines today is a mixture of ancient cultivars and local wild trees. This genetic structure is evident in the

78

R. Elbaum et al. / Journal of Archaeological Science 33 (2006) 77e88

mitochondric [5] and plastidic DNA [7]. It is also manifested in the quantity of heterochromatin tandem repeats [8] and in pit morphology [34]. Information from ancient DNA will provide data about genomes that are closer to the original wild populations and thus may elucidate the processes of olive domestication. Several ancient DNA (aDNA) studies have addressed questions concerning domestication of crops. Ancient DNA sequences were used to investigate maize (Zea mays) domestication. The analysis showed that the accumulation of mutations in maize occurs at a greater rate than in other grasses. Thus the high polymorphism found in ancient and modern maize sequences is in agreement with a monophyletic origin [13], as was shown by modern DNA analysis [22]. Selection of specic alleles in maize was shown to start as early as 4000 years ago and to continue at least until 2000 years ago [18]. Another crop that was studied by aDNA is the grape (Vitis vinifera). Microsatellite analysis of archaeological grape seeds from European sites supports the assumption that gene ow is very minor between cultivars from dierent European regions. In two cases out of three the ancient grape variety was found to be genetically related to the modern local variety [21]. To study olive domestication using aDNA, a reliable source for ancient olive DNA must be established. However, regions of olive cultivation, including the coastal plain of Israel with its hot Mediterranean climate, are not favorable for DNA preservation [20]. If the sample is well preserved, the chances of nding authentic aDNA are larger and the reliability of the results is much improved. Therefore several attempts were made to establish a general rule for predicting aDNA quality by monitoring the preservation state of other components in the sample. It was suggested that amino acid racemization occurs under similar conditions as DNA depurination, which is one of the major decay reactions of DNA. Measurement of the ratio of the two enantiomers of aspartic acid was directly correlated to the ability to amplify aDNA [25]. In this assessment it is assumed that both DNA and sample proteins are exposed to the same environmental conditions. When pyrolysis gas chromatographyemass spectrometry was applied to studies of ancient bones, many of the amino acids detected were typical of collagen. On this basis it was suggested that collagen content in bones is associated with DNA preservation [26]. This result was conrmed by calculating the fraction of collagen in bone powder and correlating it with the ability to amplify DNA extracted from the same bone [15]. Collagen and hydroxyapatite integrity were shown to predict the ability to amplify DNA in bones, and are thought to be in physical connectivity with DNA molecules occluded in bones. It has also been shown that the maximal length of PCR products from bone aDNA is linearly correlated to the amount of insoluble collagen in the bone

(M. Salamon, personal communication). Such general tools have not been developed for plant tissues. One of the major challenges in studying aDNA of botanical remains is thus to identify the best preserved samples for ancient DNA analysis before its extraction. In addition to increasing the reliability of the results, this will reduce the time and resources spent on analysing less well preserved samples. To select for the best preserved olive pits we monitored the degradation of cellulose and lignin, the two major biochemical components of wood. As DNA is less stable than cellulose and lignin [12], the presence of badly preserved wood components implies that the DNA should not be well preserved. This is true providing that the DNA and the lignin and cellulose are exposed to similar chemical conditions. DNA was shown to exist in dry modern and old wood samples [9]. Infrared (IR) spectroscopy is commonly used to characterize modern wood [31] and estimations of archaeological wood preservation by IR is possible [19]. One of the advantages of IR analysis is that it requires only a fraction of a milligram. We present a simple method to assess the preservation state of the woody part of olive pits using IR spectroscopy, and correlate it to parameters of DNA quality such as template length in an olive-specic repeat array, and template quantity as determined by real-time PCR amplication. These methods enabled us to choose fossil olive pits containing well preserved aDNA for phylogenetic analysis. This approach is probably also applicable to other types of botanical remains.

2. Materials and methods 2.1. Olive materials Modern leaves and pits were collected from 28 trees representing 13 dierent lines of cultivated olives, 10 wild trees, and 5 feral trees (Table 1). Fossil pits that originated from three archaeological sites are described below. The desiccated pits were kept at ambient conditions until extraction. The waterlogged pits were kept in tap water until extraction. 2.1.1. Kfar Samir Waterlogged olive pits and pulp were excavated in a submerged site o the Carmel coast south of Haifa. Olive pits were collected from an installation that was presumably used for olive oil extraction at a water depth of about 1 m. The olive pits were dated to the period 5530e4570 B.C. [14]. Three pits were analyzed for DNA. 2.1.2. Nahal Megadim outlet Waterlogged olive stones and oak acorns were found in a clay deposit o the Carmel coast, ca 3 km north of

R. Elbaum et al. / Journal of Archaeological Science 33 (2006) 77e88 Table 1 Modern olive cultivars and wild plants studied Line 1 2 3 4 5 6 Amigdalolea Bosana Gemelek Manzanillo Picudo Nabali-baladi # of Origin individuals 1 1 1 1 1 1 1 1 1 1 1 1 1 Greece Sardinia Turkey Spain Spain West Bank, Israel Syria Lebanon Gat-Shmanim, Israel Kfar Hanina, Israel Italy Spain Rehovot, Israel Collection location Beit Beit Beit Beit Beit Beit Dagana Dagana Dagana Dagana Dagana Dagana

79

80 mg of spectroscopic grade KBr. The spectrograms were obtained from an average of 30 spectra collected at 4 cm1 resolution.

2.3. DNA extractions and manipulations 2.3.1. Modern DNA CTAB extraction (based on [6] with modications) and degradation Fresh olive leaves (about 5 g) were frozen to 80  C. Without defrosting they were ground with sand in a mortar cooled by liquid nitrogen. The powder was transferred to a cool 50 mL tube and mixed with 20 mL 2! CTAB (100 mM TriseHCl, pH 8, 1.4 M NaCl, 20 mM EDTA pH 8, 2% CTAB, 1% sodium disulte) preheated to 65  C. The mixture was incubated while shaking at 65  C for 60 min. Then 10 mL of 24:1 chloroform/isoamyl-alcohol was added and the tubes were shaken for another 20 min at room temperature. The mixture was centrifuged for 20 min at 4000 rpm (3220 g) and the supernatant was recovered. Chloroform/isoamyl-alcohol extraction was repeated and 20 mL of isopropanol was added to precipitate the DNA. The samples were stored at 20  C overnight and centrifuged at 4  C for 5 min at 4000 rpm. The pellet was washed in 20 mL of 76% ethanol/10 mM ammonium acetate solution by shaking for 20 min. The pellet was extracted with a Pasteur pipette, dried on clean paper and transferred to a 2-mL tube for additional drying. After the pellet was dried it was redissolved in 0.5 mL Tris 10 mM at 65  C for 15 min to obtain about 1 mg/mL DNA. Degradation of the DNA was performed by sonication with a probe (Microson XL by Misonix, intensity used was 3V, level 8.5) 10 times; 10 s under sonication and 30 s on ice. The same DNA was subject to 1 or 2 J ultraviolet light (FLX-20.M, Vilber Lourmat).

7 Sourani 8 Souri 9 Souri 10 Souri 11 Coratina 12 Oleaster 13 Unknown

Beit Dagana Beit Dagana Beit Dagana Beit Dagana

14 Wild population 10 15 Feral population 5 of a souri variety

a

Beit Dagana Beit Dagana Weizmann Institute of Science Carmel mountain, Carmel mountain, Israel Carmia ridge Carmel mountain, Carmel mountain, Israel north of Elyakim junction

The international olive line collection in the Institute of Horticulture, Agricultural Research Organization, Volcani Center, P.O.B. 6, Bet-Dagan 50250, Israel.

Atlit, at a water depth of 2e3 m. One olive pit (RTT 4805) was 14C-dated to 6115 G 45 year BP, which corresponds to 5230e4850 B.C. for 95.4% probability. Six pits were analyzed for DNA. 2.1.3. Qumran Layers of the Iron-Age, Roman, Byzantine, and Mamluk periods were exposed in a cave on the west side of the Dead Sea rift valley. Hundreds of desiccated olive pits, mixed with charred olive pits, date palm pits, and goat faeces were found in the Byzantine layer. One desiccated pit (Qumran 3) analyzed for aDNA, was also 14 C-dated (RTT 4898) to 1430 G 35 year BP, which corresponds to 540e670 A.D. for 95.4% probability. Ten desiccated pits from the same layer were analyzed for DNA. Dating of Qumran and Nahal Megadim outlet pits was performed by the Radiocarbon Dating Laboratory in the Weizmann Institute of Science, Rehovot, Israel. Calibrated ages in calendar years were obtained from the calibration tables in Stuiver et al. [32] by means of the 2003 version OxCal v. 3.9 of Bronk Ramsey. 2.2. Infrared spectroscopy Fourier Transform Infrared (FTIR) spectra were measured using a portable spectrophotometer (MIDAC Corp., Costa Mesa, CA, USA). Pellets were produced by mixing about 0.1 mg of powdered sample with about

2.3.2. Ancient DNA extractions Olive aDNA was extracted in a laminar ow hood (ADS Laminaire, MV-9, France) located in a clean lab dedicated for this purpose only. All equipment was rst wiped with bleach (NaOCl, 3% w/v) and then exposed to UV light for at least 1 h inside the laminar ow hood. One of two extraction methods was applied on 20e 50 mg of a single desiccated pit or about 100 mg of a single waterlogged pit. The DNeasy Plant Mini Kit (Qiagen) was used according to the manufacturers instructions with minor changes. We used twice the amounts of sample and buers recommended by the manufacturer. Elution of the DNA was done with 100 mL 10 mM Tris buer at pH 8.3 preheated to 65  C. The elution was repeated twice with the same solution. The second extraction was a CTAB based extraction [30].

80

R. Elbaum et al. / Journal of Archaeological Science 33 (2006) 77e88

2.4. PCR conditions The PCR setup was performed in the same laminar ow hood used for the aDNA extraction, using dedicated pipettes and aerosol barrier tips. Equipment was wiped with bleach (NaOCl, 3% w/v) and then the equipment and reagent tubes were exposed to UV light for at least 1 h before setting up the mix. PCR reactions were performed in a nal volume of 50 ml. Each reaction contained 0.25 mM concentrations of deoxynucleotide triphosphates, 1x reaction buer, 10 pmol primers (Table 2), 2.5e5 U of Taq polymerase (AmpliTaq gold, Applied Biosystems), and 1e5 ml of template DNA and made up to a nal volume of 50 ml with nuclease-free water (ltering system EASYpure UV/UF, Barnstead, Iowa, USA). Thermocycling in an MJ Research PTC 200 gradient cycler (MJ Research, Inc., Boston, Mass., USA) consisted of 50 cycles of denaturation at 95  C for 30 s, annealing (Table 2) for 30 s, extension at 72  C for 30 s, and a nal extension at 72  C for 10 min. Samples were held at 4  C until analysis. A total of 10 ml of each PCR product was run on a 3% agarose gel in 1x TAE buer. Quantitative PCR was measured on the iCycler iQ Real-Time PCR machine, Biorad. Reaction mixes of 25 or 50 mL were prepared by adding water (ltering system EASYpure UV/UF, Barnstead, Iowa, USA), 10 pmol of forward and reverse HPLC grade primers (Table 2), and 0.1e5 mL DNA extract to 1 ! iQ SYBR Green Supermix (Biorad). At least two no-template negative controls were included in each PCR run. In order to estimate the quantity of the starting template in the aDNA samples there is a need to use a standard sample with a known amount of starting template. For that we used the lowest band of the PCR product of the OeGEM86 repeat. This band was obtained by amplifying twice a very degraded aDNA sample. The sample concentration was estimated on an agarose gel, and then it was diluted. A calibration curve was built from amplications of 400 fg, 40 fg, 4 fg, and 0.4 fg, where the lowest concentration contains about 4000 repeat units.
Table 2 Primer sequences, annealing temperatures and predicted product lengths Primer position OeGEM86, 11e66 (gi: 11230700) ITS1 91e147 (gi: 9623199) ITS1 23e183 (gi: 9623199) TrnT-TrnL spacer 327e415 (gi: 1534085) Primer sequence

To test for inhibition of the aDNA extract, 2 mL of modern olive DNA degraded by sonication and UV radiation was added to a PCR mix containing aDNA extract. The degraded DNA was added to the tubes in a dierent lab, after all the other tubes were already placed inside the PCR machine. 2.5. Cloning and sequencing PCR products were inserted into a pGEM-T Easy vector (Promega), which was then inserted into XL1Blue competent cells (Stratagene). Competent cells were grown on LB/Amp medium containing IPTG and X-gal (Sigma). White colonies were selected for a second growth, and the inserts were sequenced with an ABI 3700 DNA analyser machine (Applied Biosystems) using T7 primer. Sequence alignment was done using CLUSTAL W (OeGEM86 and TrnT-L [35]) and MUSCLE (Internal Tanscribed Spacer 1 (ITS1), [10]). Grouping of the ITS1 sequences was performed with SATCHMO [11]. Calculation of the OeGEM86 consensus sequence and similarity was done with PRETTY (GCG software package release 10.3). 3. Results The rst step involved the development of an eective assay for screening the archaeological olive pits in order to identify those that are most likely to yield well preserved DNA. We then assessed the state of preservation of the DNA directly, and nally the DNA sequences were analyzed. 3.1. Infrared screening for the fossil olive pits most likely to yield well preserved DNA Many fossil olive pits are black in color and may be totally or partially charred. As DNA is not preserved if the sample has been exposed to temperatures above 250  C [36], and this may not even cause visible charring, it is essential to rst distinguish between

Annealing (  C) 58 56 56 56

Product length 76, lowest band C 86 bp each additional band 75 bp 180 bp 109 bp

F e TTTGGCGAATTGCTAGTCTAA R e CCCGAAGTTATCATGAAATCA F e GACATGCTCGGCCTAACAAAC R e GGCACCRAAGGGCAAGCGA F e AYGAACTCGAYCCATGACACGT R e ATGCACACCYTGTCCCCGAG F e AACATTCCTCCGCTTTCATTC R e ATATGTCTCTCTTCCTGCCAC

Position of the primers is according to the accession number (in parenthesis).

R. Elbaum et al. / Journal of Archaeological Science 33 (2006) 77e88

81

charred and non-charred pits. As charred material generally has a characteristic rather featureless infrared spectrum [29], this is a convenient and rapid approach for screening. If the olive pit is not charred, then its infrared spectrum is particularly helpful in terms of assessing its state of preservation. The two major bio-molecules of the woody olive endocarp (and wood in general) are cellulose and lignin. These have quite dierent infrared spectra, and their relative proportions can be semiquantitatively assessed from their IR spectra [31]. We have chosen to estimate the relative amount of lignin by measuring the area under the lignin aromatic absorption peak at around 1510 cm1, normalized to the area under the CeH stretch absorption at around 2927 cm1. We call the ratio between the two areas the L-ratio (Fig. 1). Based on ve measurements, we calculated the average L-ratio of the fresh olive pits to be 0.20 G 0.01. Table 3 lists the L-ratios obtained for the uncharred fossil olive pits analyzed from both waterlogged and desiccated environments. The waterlogged pits contained higher proportions of lignin compared to fresh pits (L-ratio O 0.2), implying mainly cellulose degradation, whereas some of the desiccated pits contained more cellulose than lignin (L-ratio ! 0.2). Spectra of charred pits do not contain the two absorption peaks for the L-ratio calculation (Fig. 2). 3.2. Assessment of DNA quality with the OeGEM86 repeat array Olive pit aDNA was detected by polymerase chain reaction (PCR). To minimize the danger of false detection, primers were designed to target the OeGEM86 olive repeat (gi: 11230700). This is a tandem repeat array

of 86 bp that is present in up to 40,000 copies per picogram genomic olive DNA [8]. Furthermore, it is not present in other species (according to the NCBI on-line database). PCR of the repeat was performed on modern olive (O. europaea) DNA as well as on DNA extracted from tomato (Lycopersicon esculentum), tobacco (Nicotiana tabacum), wheat (Triticum turgidum), rice (Oryza sativa) and arabidopsis (Arabidopsis thaliana). Only the olive sample gave a specic PCR product (data not shown). Because the primers amplify a tandem repeat, the amplication results in a ladder with fragments spaced by 86 bp. We hypothesized that this could be a useful indicator of DNA preservation, as the better the quality of the preserved DNA, the longer would be the template and thus the fragments amplied [1]. To examine this possibility, modern olive DNA was degraded by sonication and exposure to ultraviolet light, and then amplied using the OeGEM86 primers (Fig. 3). Shorter PCR products were preferably amplied with increasingly harsh treatment, compared to untreated DNA. The product length was even smaller when the template amount was reduced. Reduction of the product length was also detected in cases when an aDNA extract containing PCR inhibitors was added to a modern DNA template. In these cases the aDNA concentration in the amplication reaction was optimized according to the largest volume of aDNA extract that did not inhibit the modern DNA amplication. We therefore concluded that ladder detection upon amplication of the OeGEM86 repeat array is an indicator of fossil olive pit DNA quality. Ancient olive DNA was extracted from 19 pits and was amplied using the OeGEM86 primers (Fig. 4, Table 3). Three of the four pits that showed more than

Intensity (arbitrary units)

2929

1512

4000

3500

3000

2500

2000

1500

1000

500

Frequency (cm-1)
Fig. 1. Infrared spectrum of a fresh olive pit. The marked peaks are of the lignin aromatic vibration (1512 cm1) and methyl vibration (2925 cm1). The L-ratio is calculated by dividing the area under the lignin peak by the area under the methyl peak.

82

R. Elbaum et al. / Journal of Archaeological Science 33 (2006) 77e88

Table 3 The L-ratio calculated from infrared absorptions of the olive pits, the number of OeGEM86 repeat bands obtained by PCR on 1 mL extract, the number of OeGEM86 initial templates in 1 mL extract estimated by qPCR and the amplication results of the ITS1 and TrnT-L loci Sample 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Modern (5 pits) KS 1a KS 2 KS 3 Qumran 1 Qumran 2 Qumran 3 Qumran 4 Qumran 5 Qumran 6 Qumran 7 Qumran 8 Qumran 9 Qumran 10 NM 1 NM 2 NM 3 NM 4 NM 5 NM 6 L-ratio (IR) 0.20 G 0.01 0.45 0.45 0.47 0.09 0.23 0.19 0.20 0.21 0.12 0.32 0.22 0.22 0.16 0.53 0.53 0.49 0.36 0.60 0.57 Repeat bands (PCR) O10 4 1 1 0 1 10 2 10 1 1 0 1 1 1 1 1 0 1 1 Initial template number (qPCR) ca 10,000,000/ng 2000 nm 4 0 0 40,000 4000 400 4 4 0 0 40 4 4 4 0 4 40 ITS1 amplication U na nm nm nm nm U na na nm nm nm nm nm na na na nm na na TrnT-L amplication U nm nm nm nm nm nm nm U nm nm nm nm nm na nm na nm na nm

KS e Kfar Samir, NM e Nahal Megadim outlet, U e amplication of the expected fragment (conrmed by direct sequencing), na e amplication of non-specic fragment or no amplication, nm e not measured. a The aDNA was extracted 1.5 years before the qPCR was performed. The IR spectrum was taken when the sample was not completely dry.

one band had L-ratios identical to modern olive pits. Amplication of extracts from some of the waterlogged olive pits from Nahal Megadim (NM) resulted in the amplication of the lowest molecular weight band of the ladder. This enabled us to read the sequence directly in two cases. Cloning of the aDNA product was not successful. Fig. 5 shows the alignment of six sequences published by Contento et al. [8], two ancient sequences,
2927

and eight sequences isolated by PCR and cloning from a live olive tree (O. europaea cv. Souri) from the GatShemanim monastery, Jerusalem. The sequence similarity of the modern sequences to a consensus sequence was calculated to be 87e96%, which is similar to the value reported [8]. The ancient sequences show lower similarity of 76% (NM1) and 73% (NM5). These sequences contained many ambiguous bases. The presence of

1510

Desiccated well preserved (Qumran 3)

Intensity (arbitrary units)

Desiccated badly preserved (Qumran 1)

Waterlogged (NM1)

Charred

1500

2000

2500

3000

Frequency (cm-1)
Fig. 2. Infrared spectra of charred, waterlogged and desiccated olive pits. The peaks marked are used to calculate the L-ratio. The waterlogged pit produced a spectrum similar to pure lignin, while the desiccated degraded pit spectrum is very similar to a pure cellulose spectrum. The well preserved desiccated pit has a spectrum similar to a fresh pit.

R. Elbaum et al. / Journal of Archaeological Science 33 (2006) 77e88

83

500bp 331bp 242bp 110bp 67bp

Fig. 3. Amplication of modern olive genomic DNA that was degraded by sonication and exposure to ultraviolet light with the OeGEM86 repeat primers. Lane 1 e untreated DNA (1 ng amplied), lane 2 e DNA exposed to 1 J UV light (1 ng amplied), lane 3 e DNA exposed to 2 J UV light (1 ng amplied), lane 4 e DNA exposed to 2 J UV light (0.1 ng amplied).

with the OeGEM86 tandem repeat as the target sequence [28]. Estimation of the number of OeGEM86 units in the aDNA sample was calculated according to amplications of a known amount of a single unit. The single unit was obtained by amplifying twice a very degraded aDNA sample. The starting concentration of the single unit was evaluated on an agarose gel. The sample was diluted and a calibration curve was built from amplications of 400 fg, 40 fg, 4 fg, and 0.4 fg, where the lowest concentration contains about 4000 repeat units. We found a correlation between the L-ratio, the number of OeGEM86 bands amplied from the aDNA, and the number of starting templates (Table 3): If only one band is amplied by conventional PCR, the number of starting templates is between 4 and 40 molecules, and the L-ratio diers from the modern values. When more bands are observed, the number of starting templates is 400e40,000. The better-preserved DNA contains fragments longer than two repeats, meaning longer than 150 bp. It is found in pits with L-ratios in the range of fresh pits (L Z 0.19e0.21). 3.4. Amplication of chloroplast ancient olive DNA sequence Better-preserved pits were analyzed for less abundant sequences using PCR. A desiccated olive pit from the Byzantine period in Qumran (Qumran 5; 600 AD) was found to be very well preserved based on its L-ratio of 0.21. This pit produced about 10 bands when the OeGEM86 repeat was amplied, and the amount of starting template was estimated to be about 400 molecules using real-time qPCR. We describe here the

ambiguous bases is expected in a repeat sequence and also in ancient and partly damaged DNA. Considering the specicity of the primers, this result supports the presence and authenticity of aDNA in the ancient olive pits. 3.3. Real-time quantitative PCR In order to better estimate the amount of aDNA in the pits, real-time quantitative PCR (qPCR) was used

Qumran 3

sm

Qumran 6

sm

NM 6

sm

L- ratio:

0.19

0.10

0.57

Fig. 4. Examples of aDNA amplication by OeGEM86 repeat. L-ratio values of the olive pits are indicated below each lane. Arrows indicate the amplied products. Sample identication is according to Table 3. sm e DNA size marker Invitrogen Low DNA Mass Ladder (2000, 1200, 800, 400, 200, 100 bp).

84

R. Elbaum et al. / Journal of Archaeological Science 33 (2006) 77e88

1 TTTGTTCGTT TTTGGCGAAT .......... .......... A...A.T... .......... ..G....T.. .......... .......A.. ..C.-.C... .......... ......A... .......... .C-....... .......... .......... .......A.. .......... ......T... .......... ...T...... .......... ....G..... ....AA.... CC.....A.. ......C... 89 ACTTCGGG......... ......... ......... ......... ......... ......... ......... N........ N........ ....T.A.. ......... C..N..... ...NAC..G N........

consensus Gat-Shmanim-1 Gat-Shmanim-7 Gat-Shmanim-8 OeGEM86-3 OeGEM86-5 OeGEM86-2 OeGEM86-4 Gat-Shmanim-2 Gat-Shmanim-3 Gat-Shmanim-5 OeGEM86-1 OeGEM86-6 Gat-Shmanim-6 NM1 Gat-Shmanim-4 NM5

ATTCG-ATTG .......... .......... .........A .......... .......... ....A..... .......... ......T... .......... ........N. .......... .......... ........N. CC..C.... .NC....... .A...TA... AN......A. ........N.

TGCTAGTCTA .......... .......... .......... .......... .......... .C........ ..A....... .......... .......... .......... ....T..... ..AT...... ....C.....

GAATCGAGCC .......... .........A .......... ........T. .......... .....A.A.. .....A.A.. .........A C........T ....T...T. .......... .......... N......N.. ....NAG... ...A...C.. .G.AG.CA.A

AATGAAAAGT ..A....... ..A....... .G.A...G.. A......T.A ..A......A .......... .........A .......... G....TT.C. .......... .........C ..C......A .G........ C.N....C.N .......... ..........

GRT-TTTTGA .GC..C..C. .GC..C..C. .GC....... .AC.A..... .AG....... .A........ .A........ .G........ .G........ .A........ .A........ .G........ TG........ .GCG...... .G........ .G.....

TTTCATGATA .....G.... .....G.... .......... ......A... ......T... .......... ......A... GG .......... .......... .......... .......... .......... .C.TC..... ..........

Fig. 5. Alignment of six sequences published by Contento et al. [8] (OeGEM86 1e6), two ancient sequences from Nahal Megadim outlet (NM 1, 5), and eight sequences isolated by PCR and cloning from a live olive tree (O. europaea cv. souri) from the Gat-Shemanim monastery, Jerusalem (GatShmanim 1e8). Bases that are identical to the consensus sequence are marked by dots, and gaps are marked by dashes.

amplication of a 109-bp segment of the TrnT-TrnL chloroplast spacer. This region is conserved in the dierent genetic lines of O. europaea [3]. The amplication was performed in the qPCR instrument, and was stopped as soon as a product began accumulating. This avoided amplication of low concentration contaminants. The sequence of the product was identical to the database for modern O. europaea (Fig. 6) and to the sequences we obtained from ve modern O. europaea lines (domesticated and wild). Since the sequences were obtained directly from the PCR product, the chromatograms were not clear and only 35 bases could be read. Cloning was not performed because of the lack of polymorphism in the sequences. 3.5. Sequence analysis of aDNA from the ribosomal DNA To obtain more information about olive genetic evolution under domestication, we amplied another more informative location: the internal transcribed spacer 1 of the ribosomal DNA (ITS1). This sequence is present in the plant genome in hundreds to thousands of copies that evolved to give one sequence by concerted evolutionary processes [37,4,2]. It is commonly used for phylogenetic analysis in many species [33,27,24], and is polymorphic among O. europaea sub-species [16]. We designed primers to amplify a short fragment of 75 bp that spans a polymorphic region and thus might be informative as to the samples origin. Another desiccated olive pit from Qumran (Qumran 3; 600 AD) was found to be very well preserved with an L-ratio of 0.19. It produced about 10 PCR bands and 40,000 starting templates for the OeGEM86 repeat. We were able to amplify and clone the short ITS1 fragment in this

sample. From three dierent PCR reactions 11 clones were sequenced. The sequences of three of these clones could not be identied, and eight were found to be similar, but not identical, to the O. europaea ssp. europaea ITS1 sequence (gi: 37650547). In Fig. 7 are aligned the sequences of eight clones of aDNA, where each PCR reaction is noted by a dierent letter, and other olive ITS1 sequences. Three cloned sequences contain 1e2 base substitutions compared to the other clones that may be a consequence of damaged bases in the fossil template, Taq polymerase mistakes, or real polymorphism in the ITS1 units of the olive genome. To better interpret the origin of the ancient ITS1 sequences, 28 dierent lines of domestic, feral, and wild olives were studied. Sequences of the ITS1 region were obtained directly from the PCR products. In two lines, dierent sequences were obtained for dierent locations of primers. Alignment of the sequences revealed that many sequences are similar to the ancient sequence (Fig. 7). The base substitutions that appear only in some of the clones are unique to the ancient DNA, and are therefore considered the result of template DNA damage or as artefacts of the PCR amplication. The clones from PCR reaction a are all identical and without new mutations compared with the modern sequences. We therefore chose this sequence to represent the ancient sequence. While grouping the ITS1 sequences we found that the ancient sequence is most similar to the published sequences of O. europaea ssp. laperrinei (gi: 9623199) and O. europaea ssp. cerasiformis (gi: 9623202), containing two mutations. We showed that Qumran 3, dated to the Byzantine period, had signicant potential for containing informative aDNA by monitoring the level of preservation of lignin. We then conrmed this by amplication of the

371 gi|1534085 AAAAAAGAAT CGACCGTTCA AGTATTGCAA ATTGCATGGG AAAAGTGGCA Qumran 5 T CGACCGTTCA AGTATTGCAA ATTGCATGGG AAAA

Fig. 6. Sequence alignment of two identical olive ancient sequences of the chloroplast TrnT-TrnL spacer obtained from Byzantine Qumran 5 olive pit, with modern O. europaea ssp. europaea. (gi: 1534085).

R. Elbaum et al. / Journal of Archaeological Science 33 (2006) 77e88

91 bosana-2 (Sardinia) GACCCGCTCC gi9623198 ........-gi37650547 .......... wild 8 ...T....-oleaster (Spain) ...T....-wild 2-2 ...T....-souri (Kfar Hanina) ...T....-wild 3 ...T....-wild 4 ...T....-wild 1 ...T....-wild 9 ...T.K..-coratina (Italy) ...T.K..-amigdalolea (Greece)...T.K..-wild 10 ...T....-wild 7 ...T....-wild 6 ...T....-wild 5 ...T....-gemelek (Turkey) ...T.T..-souri (Gat Shmanim) ...T....-feral 12 ...T....-feral 14 ...T....-O. eu. (Reovot) ...T....-feral 13 ...T....-picudo (Spain) ...T....-sourani (Suria) ...T....-souri (Lebanon) ...T....-nabali-baladi (Leb) ...T....-feral 15 ...T....-feral 11 ...T....-bosana 1 ...T....-gi9623200 ........-manzanillo (Spain) ........-wild 2-1 ........-gi9623201 ...AT...-gi9623202 ...AT...-gi9623199 ...AT...-clone c3 ...AT...-clone b1 ...AT...-clone a2 ...AT...-clone a1 ..AT...-clone a3 ...AT...-clone a4 ...AT...-clone c2 ...AT...-clone c1 ...AT...-141 AATCTCGGTG ..C.C.AAC. ..C.C...C. ..-.C..AY. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.Y..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.Y..AC. ..-.Y..AC. ..-.Y..AC. ..-.Y..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..-.C..AC. ..C.C..A.. ..C.C..A.. ..C.C..A.. ..C.C..AC. ..C.C..AC. ..C.C..AC. ..C.C...C. ..C.C...C. ..C.C...C. ..C.C...C. ..C.C...C. ..C.C...C. ..C.C...C. ..C.C...C.

85

ATCGACGTGC ---------G......C.. ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

ACGA--ACGA ---------G..CTCG..C ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

TCCCATCACA ---------G...G..G.. ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

CAGCCTAACG .G.......A .G...C.... .G.......A .K.......A .K.......A .K.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A .G.......A

CGAAAAGCGT .......T.. .......... T......Y.. T......... TS........ T......... TS........ TS........ TS........ T......... T......... T......... T......... T......... T......... T......... T......... T......... T......... T......... T......... T......... T......... T......... T......... T......... T......... T......... T......... TA........ TA........ TA........ RA........ C......... C......... C......... C......... C......... C......... C......... C......... C......... C.........

TAAGGAACAC C..A...... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C......... C...A..... C....C.... C.T....... C......... C......... C......... C......... C......... C......... C.........

TCAAGGT ......C ......C ....... ...G... ....... ....... ....... ....... ....... ....... ....... ....... .... ....... ....... ....... ....... ......K ....... ....... ....... ....... ....... ....... ....... ....... ....... ....... ....... ......C ......C ......C ......N ......C ......C .T....C ......C ......C ......C ......C ......C .T.T..C .T....C

Fig. 7. Sequence alignment of cloned sequences obtained from PCR amplication of the ITS1 region of Byzantine Qumran 3 olive pit, 28 modern olive lines, and six published sequences of sub-species of O. europaea (gi: 9623198 e ssp. cuspidata, gi: 9623199 e ssp. laperrinei, gi: 9623200 e ssp. cerasiformis, gi: 9623201 e ssp. laperrinei, gi: 9623202 e ssp. cerasiformis, gi: 37650547 e ssp. europaea). Bases that are identical to the rst sequence are marked by dots, and gaps are marked by dashes. The single mutated bases that are unique to some of the clones are marked by black background. Coordination numbers are according to O. europaea ssp. europaea (gi: 37650547).

OeGEM86 repeat, and estimation of the DNA quality and quantity. Lastly, we obtained a reproducible unique sequence of the ITS1 in dierent PCR reactions and dierent clones. All these observations support the authenticity of our results.

4. Discussion This work presents a method to select olive pits for aDNA analysis by testing their preservation state, rst at a general biochemical level, and then at the DNA level. This allowed us to screen 19 olive pits and to select the best preserved material for DNA analysis. Using this approach we report, for the rst time, authentic sequences of DNA isolated from fossil olive pits. 4.1. Infrared pre-screening Choosing the best source for aDNA analysis may improve the quality of the research, limit the amplication of contaminants and focus eorts on the most promising samples. In the Mediterranean region, the

chances of DNA surviving the relatively high ambient temperatures and humidity are low. Selection for samples that are preserved at the molecular level must be done at the molecular level, as visual inspection is misleading. Infrared (IR) spectroscopy provides information about the molecular state of the specimen. The measurement is simple, and it is easy to handle many samples in a short time with the loss of only a fraction of a milligram of material per sample. Here we use IR to monitor degradation of a wooden substance, the endocarp of olive pits, and show that it can be a predictor of the preservation state of the DNA of the wood. Our assessment of the preservation state of the pits is based on the fraction of lignin in the wood, and may be applied to other woody materials. Selection of well preserved samples according to the IR spectrum increases the chances of nding well preserved aDNA. In fact, all the fossil pits that produced L-values in the range of modern olive pits contained well preserved aDNA. The preservation level dened by IR spectroscopy is supported by our aDNA assays and thus should be used as a standard method in aDNA analysis from olive pits, and may be applied to similar remains from other species.

86

R. Elbaum et al. / Journal of Archaeological Science 33 (2006) 77e88

4.2. Assessment of DNA quality with the OeGEM86 repeat array The length of the DNA template for a PCR reaction is directly related to the preservation state of the DNA [17]; the longer, the better preserved. To estimate the length of the ancient DNA in the olive pits we developed a simple assay based on amplication of the olivespecic OeGEM86 repeat array. The high copy number in this array and its specicity to olives make it a very sensitive assay for the presence of olive DNA. Amplication of only a single repeat was typical of samples where the genomic DNA was massively degraded. On the other hand, we showed that samples that contained templates for longer pieces of the OeGEM86 repeat, as seen in a ladder of DNA fragments, were more likely to produce informative DNA sequences. Our control experiments showed that damaging the DNA causes a reduction in the ladder height. This together with the correlation between lignin IR absorption, amplication, and abilities to sequence PCR products, verify that the ladder is a good indicator of olive DNA quality. 4.3. Real-time PCR quantication PCR of the OeGEM86 repeat could successfully quantify the number of templates using real-time quantitative PCR (qPCR), because the quantication was based on measuring the entire amount of double stranded DNA synthesized (by SYBR green), rather than the number of fragments (using uorescent primers). Since the primers do not form dimers eciently during the reaction, most of the double stranded DNA that is synthesized is the desired product, and the quantication is possible. Comparing qPCR results to the conventional amplication of the repeat we nd that the information from both methods is similar and is in agreement with the IR characterization. Based on these results, samples possessing long fragments of aDNA available for PCR were chosen. The sequences that were analyzed using this selection system are more reliable, because we showed that they are derived from samples that are biochemically well preserved, and contain authentic olive aDNA. 4.4. Sequence analysis of aDNA from the ITS1 repeat The ITS1 is an array of repeats that is subject to concerted evolution. Thus on the species level it converges into one sequence. We found variation in modern sequences of the same individual in separate PCR reactions. This may indicate one of the following scenarios: variability within the ITS array because of an unnished conversion process; two or more independent rDNA loci, or presence of ITS1 pseudogenes [2]. Because

aDNA is partially degraded, we could amplify only 75 bp of the fossil ITS1 sequence, and worked with the same fragment length in the modern material. This limited our abilities to check the origin of the polymorphism within the same genome. Nevertheless, this set of data enabled us to compare the Byzantine ITS1 sequence to modern ones, and to show that the former is dierent from all modern sequences analyzed. This supports the authenticity of the ancient sequence, excluding the possibility of any local source of contaminant amplication and cloning. 4.5. Preservation of olive pits In this study ancient pits from waterlogged and dry environments were checked. We found that the desiccated assemblage contained better-preserved pits than the waterlogged assemblages. We do not correlate this to the age of the pits, as DNA degradation occurs within much shorter times [23]. The aDNA degradation of the waterlogged pits may have happened rapidly after excavation. The pits were taken from their underwater preserving environment (presumed to be anaerobic) and were exposed to oxygen and light that may have aected the wood and aDNA they contain. Another factor that may play a major role in the preservation is the manner in which the fresh olives were treated by the original olive producers before deposition in the sediment. The waterlogged pits were probably untreated, and used for oil, at least in Kfar Samir [14]. Salted and pickled olives were probably common in the desert area, as no evidence for local olive trees was found. Variations of the L-ratio were observed in modern pickled olives, (L Z 0.16 G 0.08, measured in nine pits), and resembled the values of the desiccated collection. This supports the assumption that the Qumran olives were pickled.

5. Conclusions We present here a series of assays that enabled us to select the best preserved aDNA by initial biochemical sample selection, using infrared spectroscopy. This was followed by further selection from the chosen samples, based on direct assessment of the aDNA quality by conventional PCR. Finding the best preserved sample is possible using this approach, and therefore the chances of identifying an interesting sequence of lower abundance in the genome increase greatly. Real-Time qPCR was used for DNA quantication, as well as a method to halt the amplication after a minimal number of cycles were performed. This minimizes the artifacts introduced by the Taq polymerase after many cycles. Sequences of fossil olive remains were isolated for the rst time, analyzed, and compared to modern sequences. We expect that the selection method presented here will make it possible to choose additional well preserved fossil olive pits and to

R. Elbaum et al. / Journal of Archaeological Science 33 (2006) 77e88

87

isolate more informative sequences that may contribute to a better understanding of olive domestication. Assessment of wood degradation by IR may be applied to other woody plant parts and facilitate authentic aDNA isolation in other species as well.

Acknowledgements We thank Yuval Peleg for supplying the olive pits from Qumran, Dr. Bengamin Avidan for supplying modern olive leaves and pits, Michal Salamon for the information about DNA preservation in relation to collagen preservation in archaeological human bones, and Prof. Angela Schlumbaum for analyzing aDNA from 2 of the waterlogged olives in her lab. This study was funded in part by generous support from Mr. George Schwartzmann, Sarasota, Florida, by the BIKURA foundation, and by the Kimmel Center for Archaeological Science at the Weizmann Institute. S.W. holds the Dr. Walter and Dr. Trude Borchardt Professorial Chair in Structural Biology.

References
[1] R.G. Allaby, K. ODonoghue, R. Sallares, M.K. Jones, T.A. Brown, Evidence for survival of ancient DNA in charred wheat seeds from European archaeological sites, Anc. Biomol. 1 (1997) 119e129. [2] I. Alvarez, J.F. Wendel, Ribosomal ITS sequences and plant phylogenetic inference, Mol. Phylogenet. Evol. 29 (2003) 417e 434. [3] L. Baldoni, C. Guerrero, K. Sossey-Aloui, A.G. Abbott, A. Angiolillo, R. Lumaret, Phylogenetic relationships among Olea species, based on nucleotide variation at a non-coding chloroplast DNA region, Plant Biol. 4 (2002) 346e351. [4] B.G. Baldwin, M.J. Sanderson, J.M. Porter, M.F. Wojciechowski, C.S. Campbell, M.J. Donoghue, The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny, Ann. MO Bot. Gard. 82 (1995) 247e277. , Multiple origins for Mediterranean olive [5] G. Besnard, A. Berville (Olea europaea L. ssp. europaea) based upon mitochondrial DNA polymorphisms, C.R. Acad. Sci. III 323 (2000) 173e181. , Cytoplasmic [6] G. Besnard, B. Khadari, P. Villemur, A. Berville male sterility in the olive (Olea europaea L.), Theor. Appl. Genet. 100 (2000) 1018e1024. , Olea europaea [7] G. Besnard, B. Khadari, P. Baradat, A. Berville (Oleaceae) phylogeography based on chloroplast DNA polymorphism, Theor. Appl. Genet. 104 (2002) 1353e1361. [8] A. Contento, M. Ceccarelli, M.T. Galeti, F. Maggini, L. Baldoni, P.G. Cionini, Diversity of Olea genotypes and the origin of cultivated olives, Theor. Appl. Genet. 104 (2002) 1229e1238. [9] S. Dumolin-Lapegue, M.H. Pemonge, L. Gielly, P. Taberlet, J.R. Petit, Amplication of oak DNA from ancient and modern wood, Mol. Ecol. 8 (1999) 2137e2140. [10] R.C. Edgar, MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Res. 32 (2004) 1792e1797.

[11] R. Edgar, K. Sjo lander, SATCHMO: sequence alignment and tree construction using hidden Markov models, Bioinformatics 19 (2003) 1404e1411. [12] G. Eglinton, G. Logan, Molecular preservation, Philos. Trans. R. Soc. Lond. B (1991) 315e328. [13] F.O. Freitas, G. Bendel, R.G. Allaby, T.A. Brown, DNA from primitive maize landraces and archaeological remains: implications for the domestication of maize and its expansion into South America, J. Archaeol. Sci. 30 (2003) 901e908. [14] E. Galili, D.J. Stanley, J. Sharvit, M. Weinstein-Evron, Evidence for earliest olive-oil production in submerged settlements o the Carmel coast, Israel, J. Archaeol. Sci. 24 (1997) 1141e1150. n, Bone [15] A. Go therstro m, M.J. Collins, A. Angerbjo rn, K. Lide preservation and DNA amplication, Archaeometry 44 (2002) 395e404. [16] J. Hess, J.W. Kadereit, P. Vargas, The colonization history of Olea europaea L. in Macaronesia based on internal transcribed spacer 1 (ITS-1) sequences, randomly amplied polymorphic DNAs (RAPD), and intersimple sequence repeats (ISSR), Mol. Ecol. 9 (2000) 857e868. [17] M. Hofreiter, D. Serre, H.N. Poinar, M. Kuch, S. Pa a bo, Ancient DNA, Nat. Rev. Genet. 2 (2001) 353e360. [18] V. Jaenicke-Despres, E.S. Buckler, B.D. Smith, M.T.P. Gilbert, A. Cooper, J. Doebley, S. Pa a bo, Early allelic selection in maize as revealed by ancient DNA, Science 302 (2003) 1206e 1208. [19] A.L. Kirillo, E.A. Mikolajchuk, Quantitative estimation of archaeological wood degradation degree by infra-red Fourier transform spectroscopy, Wet organic archaeological materials, Working group 7, vol. 1, The 9th Tiennial Meeting Dresden, German Democratic Republic, August 1990, pp. 239e240. [20] T. Lindahl, Instability and decay of the primary structure of DNA, Nature 362 (1993) 709e715. [21] J.F. Manen, L. Bouby, O. Dalnoki, P. Marinval, M. Turgay, A. Schlumbaum, Microsatellites from archaeological Vitis vinifera seeds allow a tentative assignment of the geographical origin of ancient cultivars, J. Archaeol. Sci. 30 (2003) 721e729. [22] Y. Matsuoka, Y. Vigouroux, M.M. Goodman, J. Sanchez, E. Buckler, J. Doebley, A single domestication for maize shown by multilocus microsatellite genotyping, Proc. Natl Acad. Sci. U.S.A. 99 (2002) 6080e6084. [23] S. Pa a bo, Ancient DNA: extraction, characterization, molecular cloning, and enzymatic amplication, Proc. Natl Acad. Sci. U.S.A. 86 (1989) 1939e1943. [24] E.J. Parkin, R.K. Butlin, Within- and between-individual sequence variation among ITS1 copies in the meadow grasshopper Chorthippus parallelus indicates frequent intrachromosomal gene conversion, Mol. Biol. Evol. 21 (2004) 1595e1601. [25] H.N. Poinar, M. Hoss, J.L. Bada, S. Pa a bo, Amino acid racemization and the preservation of ancient DNA, Science 272 (1996) 864e866. [26] H.N. Poinar, A.B. Stankiewicz, Protein preservation and DNA retrieval from ancient tissues, Proc. Natl Acad. Sci. U.S.A. 96 (1999) 8426e8431. lez, G.A. Dover, Patterns of variation in [27] C. Polanco, A.I. Gonza the intergenic spacers of ribosomal DNA in Drosophila melanogaster support a model for genetic exchanges during XeY pairing, Genetics 155 (2000) 1221e1229. [28] M. Pruvost, E.M. Geigl, Real-time quantitative PCR to assess the authenticity of ancient DNA amplication, J. Archaeol. Sci. 31 (2004) 1191e1197. [29] R. Shahack-Gross, O. Bar-Yosef, S. Weiner, Black-coloured bones in Hayonim Cave, Israel: dierentiating between burning and oxide staining, J. Archaeol. Sci. 24 (1997) 439e446. [30] A. Schlumbaum, J.M. Neuhaus, S. Jacomet, Coexistence of tetraploid and hexaploid naked wheat in a Neolithic lake dwelling

88

R. Elbaum et al. / Journal of Archaeological Science 33 (2006) 77e88 of Central Europe. Evidence from morphology and ancient DNA, J. Archaeol. Sci. 25 (1998) 1111e1118. T.P. Schultz, M. Curry Templeton, G.D. McGinnis, Rapid determination of lignocellulose by diuse reectance Fourier transform infrared spectrometry, Anal. Chem. 57 (1985) 2867e2869. M. Stuiver, P.J. Reimer, E. Bard, J.W. Beck, G.S. Burr, K.A. Hughen, B. Kromer, G. McCormac, J. Van-der-Plicht, M. Spurk, INTCAL98 radiocarbon age calibration, 24,000-0 cal BP, Radiocarbon 40 (1998) 1041e1083. Y. Sun, D.Z. Skinner, G.H. Liang, S.H. Hulbert, Phylogenetic analysis of sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA, Theor. Appl. Genet. 89 (1994) 26e32. J.F. Terral, N. Alonso, R.B. Capdevila, N. Chatti, L. Fabre, , B. Pradat, N. Rovira, G. Fiorentino, P. Marinval, G.P. Jorda P. Alibert, Historical biogeography of olive domestication (Olea europaea L.) as revealed by geometrical morphometry applied to biological and archaeological material, J. Biogeogr. 31 (2004) 63e77. J. Thompson, D. Higgins, T.J. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specic gap penalties and weight matrix choice, Nucleic Acids Res. 22 (1994) 4673e4680. J. Threadgold, T.A. Brown, Degradation of DNA in articially charred wheat seeds, J. Archaeol. Sci. 30 (2003) 1067e1076. L. Wen-Hsiung, Concerted evolution of multigene families, Molecular Evolution, Sinauer Associates, Inc., Publishers, Sunderlnd massachusetts 01375, USA, 1997, pp. 309e334. D. Zohary, M. Hopf, Domestication of Plants in the Old World, second ed., Clarendon Press, Oxford, 1993. D. Zohary, P. Spiegel-Roy, Beginnings of fruit growing in the old world, Science 187 (1975) 319e327.

[31]

[35]

[32]

[36] [37]

[33]

[38] [39]

[34]