Está en la página 1de 22

Definicin

Por tanto, podemos definir a la clula como la unidad morfolgica y funcional de todo ser vivo. De hecho, la clula es el elemento de menor tamao que puede considerarse vivo. Como tal posee una membrana de fosfolpidos con permeabilidad selectiva que mantiene un medio interno altamente ordenado y diferenciado del medio externo en cuanto a su composicin, sujeta a control homeosttico, la cual consiste en biomolculas y algunos metales y electrolitos. La estructura se automantiene activamente mediante el metabolismo, asegurndose la coordinacin de todos los elementos celulares y su perpetuacin por replicacin a travs de un genoma codificado por cidos nucleicos. La parte de la biologa que se ocupa de ella es la citologa.

Definicin
Por tanto, podemos definir a la clula como la unidad morfolgica y funcional de todo ser vivo. De hecho, la clula es el elemento de menor tamao que puede considerarse vivo. Como tal posee una membrana de fosfolpidos con permeabilidad selectiva que mantiene un medio interno altamente ordenado y diferenciado del medio externo en cuanto a su composicin, sujeta a control homeosttico, la cual consiste en biomolculas y algunos metales y electrolitos. La estructura se automantiene activamente mediante el metabolismo, asegurndose la coordinacin de todos los elementos celulares y su perpetuacin por replicacin a travs de un genoma codificado por cidos nucleicos. La parte de la biologa que se ocupa de ella es la citologa.

Caractersticas
Las clulas, como sistemas termodinmicos complejos, poseen una serie de elementos estructurales y funcionales comunes que posibilitan su supervivencia; no obstante, los distintos tipos celulares presentan modificaciones de estas caractersticas comunes que permiten su especializacin funcional y, por ello, la ganancia de complejidad.15 De este modo, las clulas permanecen altamente organizadas a costa de incrementar la entropa del entorno, uno de los requisitos de la vida.16

Caractersticas estructurales

La existencia de polmeros como lacelulosa en la pared vegetal permite sustentar la estructura celular empleando un armazn externo.

Individualidad: Todas las clulas estn rodeadas de una envoltura (que puede ser una bicapa lipdica desnuda, en clulas animales; una pared de polisacrido, en hongos y vegetales; una membrana externa y otros elementos que definen una pared compleja, en bacterias Gram negativas; una pared de peptidoglicano, en bacterias Gram positivas; o una pared de variada composicin, en arqueas)9 que las separa y comunica con el exterior, que controla los movimientos celulares y que mantiene el potencial de membrana. Contienen un medio interno acuoso, el citosol, que forma la mayor parte del volumen celular y en el que estn inmersos los orgnulos celulares. Poseen material gentico en forma de ADN, el material hereditario de los genes y que contiene las instrucciones para el funcionamiento celular, as como ARN, a fin de que el primero se exprese.17 Tienen enzimas y otras protenas, que sustentan, junto con otras biomolculas, un metabolismo activo.

Caractersticas funcionales

Las enzimas, un tipo de protenas implicadas en el metabolismo celular.

Las clulas vivas son un sistema bioqumico complejo. Las caractersticas que permiten diferenciar las clulas de los sistemas qumicos no vivos son:

Nutricin. Las clulas toman sustancias del medio, las transforman de una forma a otra, liberan energa y eliminan productos de desecho, mediante el metabolismo. Crecimiento y multiplicacin. Las clulas son capaces de dirigir su propia sntesis. A consecuencia de los procesos nutricionales, una clula crece y se divide, formando dos clulas, en una clula idntica a la clula original, mediante ladivisin celular. Diferenciacin. Muchas clulas pueden sufrir cambios de forma o funcin en un proceso llamado diferenciacin celular. Cuando una clula se diferencia, se forman algunas sustancias o estructuras que no estaban previamente formadas y otras que lo estaban dejan de formarse. La diferenciacin es a menudo parte del ciclo celular en que las clulas forman estructuras especializadas relacionadas con la reproduccin, la dispersin o la supervivencia. Sealizacin. Las clulas responden a estmulos qumicos y fsicos tanto del medio externo como de su interior y, en el caso de clulas mviles, hacia determinados estmulos ambientales o en direccin opuesta mediante un proceso que se denomina quimiotaxis. Adems, frecuentemente las clulas pueden interaccionar o comunicar con otras clulas, generalmente por medio de seales o mensajeros qumicos, como hormonas, neurotransmisores, factores de crecimiento... en seres pluricelulares en complicados procesos de comunicacin celular y transduccin de seales. Evolucin. A diferencia de las estructuras inanimadas, los organismos unicelulares y pluricelulares evolucionan. Esto significa que hay cambios hereditarios (que ocurren a baja frecuencia en todas las clulas de modo regular) que pueden influir en la adaptacin global de la clula o del organismo superior de modo positivo o negativo. El resultado de la evolucin es la seleccin de aquellos organismos mejor adaptados a vivir en un medio particular.

Las propiedades celulares no tienen por qu ser constantes a lo largo del desarrollo de un organismo: evidentemente, el patrn de expresin de los genes vara en respuesta a estmulos externos, adems de factores endgenos.18 Un aspecto importante a controlar es la pluripotencialidad, caracterstica de algunas clulas que les permite dirigir su desarrollo hacia un abanico de posibles tipos celulares. En metazoos, la gentica subyacente a la determinacin del destino de una clula consiste en la expresin de determinados factores de transcripcin especficos del linaje celular al cual va a pertenecer, as como a modificaciones epigenticas. Adems, la introduccin de otro tipo de factores de transcripcin mediante ingeniera gentica en clulas somticas basta para inducir la mencionada pluripotencialidad, luego este es uno de sus fundamentos moleculares.19

Tamao, forma y funcin

Comparativa de tamao entre neutrfilos, clulas sanguneas eucariotas (de mayor tamao), y bacterias Bacillus anthracis, procariotas (de menor tamao, con forma de bastn).

El tamao y la forma de las clulas depende de sus elementos ms perifricos (por ejemplo, la pared, si la hubiere) y de su andamiaje interno (es decir, el citoesqueleto). Adems, la competencia por el espacio tisular provoca una morfologa caracterstica: por ejemplo, las clulas vegetales, polidricas in vivo, tienden a ser esfricas in vitro.20 Incluso pueden existir parmetros qumicos sencillos, como los gradientes de concentracin de una sal, que determinen la aparicin de una forma compleja.21 En cuanto al tamao, la mayora de las clulas son microscpicas, es decir, no son observables a simple vista. A pesar de ser muy pequeas (un milmetro cbico de sangre puede contener unos cinco millones de clulas),15 el tamao de las clulas es extremadamente variable. La clula ms pequea observada, en condiciones normales, corresponde a Mycoplasma genitalium, de 0,2 m, encontrndose cerca del lmite terico de 0,17 m.22 Existen bacterias con 1 y 2 m de longitud. Las clulas humanas son muy variables: hemates de 7 micras, hepatocitos con 20 micras, espermatozoides de 53 m, vulos de 150 m e, incluso, algunas neuronas de en torno a un metro. En las clulas vegetales los granos de polen pueden llegar a medir de 200 a 300 m y algunos huevos de aves pueden alcanzar entre 1 (codorniz) y 7 cm (avestruz) de dimetro. Para la viabilidad de la clula y su correcto funcionamiento siempre se debe tener en cuenta la relacin superficie-volumen.16 Puede aumentar considerablemente el volumen de la clula y no as su superficie de intercambio de membrana lo que dificultara el nivel y regulacin de los intercambios de sustancias vitales para la clula. Respecto de su forma, las clulas presentan una gran variabilidad, e, incluso, algunas no la poseen bien definida o permanente. Pueden ser: fusiformes (forma de huso), estrelladas, prismticas, aplanadas, elpticas, globosas o redondeadas, etc. Algunas tienen una pared rgida y otras no, lo que les permite deformar la membrana y emitir prolongaciones citoplasmticas (pseudpodos) para desplazarse o conseguir alimento. Hay clulas libres que no muestran esas estructuras de desplazamiento pero poseen cilios o flagelos, que son estructuras derivadas de un orgnulo celular (el centrosoma) que dota a estas clulas de movimiento.2 De este modo, existen multitud de tipos celulares, relacionados con la funcin que desempean; por ejemplo:

Clulas contrctiles que suelen ser alargadas, como las fibras musculares. Clulas con finas prolongaciones, como las neuronas que transmiten el impulso nervioso. Clulas con microvellosidades o con pliegues, como las del intestino para ampliar la superficie de contacto y de intercambio de sustancias. Clulas cbicas, prismticas o aplanadas como las epiteliales que recubren superficies como las losas de un pavimento.

respiracin: Esencial para la vida, es el proceso por medio del cual las clulas producen energa al utilizar las sustancias alimenticias y el oxgeno absorbido, para tal fin, y adems producir dixido de carbono y agua.

Absorcin: Es la capacidad de las clulas para captar sustancias del medio.

Secrecin: Es el proceso por medio del cual la clula expulsa materiales tiles como una enzima digestiva o una hormona.

Excrecin: Es la eliminacin de los productos de desecho del metabolismo celular.

Reproduccin: Es el proceso de divisin celular.

Existen procesos fsico-qumicos como la difusin, la activacin y la desactivacin en el crecimiento celular y orgnico.

Pese a las muchas diferencias de aspecto y funcin, todas las clulas estn envueltas en una membrana llamada membrana plasmtica que encierra una sustancia rica en agua llamada citoplasma. En el interior de las clulas tienen lugar numerosas reacciones qumicas que le permiten crecer, producir energa y eliminar residuos. El conjunto de estas reacciones se llama metabolismo (trmino que proviene de una palabra griega que significa cambio). Todas las clulas contienen informacin hereditaria codificada en molculas de cido desoxirribonucleico (ADN); esta informacin dirige la actividad de la clula y asegura la reproduccin y el paso de los caracteres a la descendencia. Estas y otras numerosas similitudes (entre ellas muchas molculas idnticas o casi idnticas) demuestran que hay una relacin evolutiva entre las clulas actuales y las primeras que aparecieron sobre la tierra.

Composicin qumica.
En los organismos vivos no hay nada que contradiga las leyes de la qumica y

la fsica. La qumica de los seres vivos, objeto de estudio de la bioqumica, est dominada por compuestos de carbono y se caracteriza por reacciones acaecidas en solucin acuosa y en un intervalo de temperaturas pequeo. La qumica de los organismos vivientes es muy compleja, ms que la de cualquier otro sistema qumico conocido. Est dominada y coordinada por polmeros de gran tamao, molculas formadas por encadenamiento de subunidades qumicas; las propiedades nicas de estos compuestos permiten a clulas y organismos crecer y reproducirse. Los tipos principales de macromolculas son las protenas, formadas por cadenas lineales de aminocidos; los cidos nucleicos, ADN y ARN, formados por bases nucleotdicas, y los polisacridos, formados por subunidades de azcares.

La clula utiliza las sustancias que penetran en ella como materia prima para construir otras sustancias ms complejas, o como combustible para obtener energa. Los componentes, como aminocidos, lpidos, monosacridos, agua y los elementos minerales, son usados para formar sustancias orgnicas ms complejas y mantener toda la organizacin celular. Por ejemplo, los aminocidos son encadenados para producir molculas proteicas (sntesis), las que son ordenadas para formar estructuras ms complejas. Este proceso es lo que se conoce como anabolismo, y el proceso de destruccin se denomina catabolismo. El anabolismo es la formacin de compuestos a partir de clulas simples; y el catabolismo es el proceso productor de energa contrario al anterior; es decir, va de molculas complejas a molculas simples. Todos los seres vivos tienen molculas orgnicas, como protenas, hidratos de carbono, lpidos y cido nucleico. Pero tambin poseen molculas inorgnicas, como el agua y las sales minerales; de hecho, alrededor de dos tercios del peso total de tu cuerpo (80 por ciento) es agua, elemento que cumple varias funciones en los sistemas vivos, permitiendo que ocurran todas las reacciones qumicas del metabolismo celular. Protenas Las enzimas son protenas producidas por las clulas, que regulan la rapidez y especificidad de las miles de reacciones qumicas celulares. Las enzimas son protenas producidas por las clulas, que regulan la rapidez y especificidad de las miles de reacciones qumicas celulares. Todos los seres vivos tienen en su interior un sinnmero de protenas, cada una de las cuales cumple una funcin especfica. Como ya dijimos, las protenas se forman por la unin de pequeas molculas llamadas aminocidos, cadena que recibe el nombre de pptido, y su unin forma un polipptido. Este grupo de nutrientes se encarga bsicamente de formar y renovar las clulas de nuestro cuerpo. Adems, distribuye el agua contenida, forma enzimas, hormonas y anticuerpos y, en ltima instancia, nos proporciona energa. Las enzimas son protenas producidas por las clulas, que regulan la rapidez y especificidad de las miles de reacciones qumicas celulares. Estas reacciones son fundamentales para todos los fenmenos vitales, como la respiracin,

crecimiento, contraccin muscular, conduccin nerviosa, fotosntesis, digestin, entre otros. Lpidos o grasas Estos nutrientes son tan poderosos que son capaces de proporcionar ms del doble de energa por gramo que los carbohidratos, ya que estos ltimos pueden transformarse en grasa y almacenarse. Si bien los lpidos son ms importantes que los hidratos de carbono, lo son menos que las protenas. cidos nucletidos Estos cidos son molculas orgnicas formadas por la conexin de unidades llamadas nucletidos. Existen dos tipos: el cido ribonucleico (ARN) y el cido desoxirribonucleico (ADN), del que seguramente has escuchado hablar. Los cidos ribonucleicos (ARN) estn formados por una cadena de nucletidos que se pliega de diferentes formas, segn sea su funcin al interior de la clula. Est el ARN mensajero, que es el menos plegado de los tres que existen, y su funcin es llevar la informacin gentica desde los cromosomas de la clula hacia el lugar de sntesis de las protenas. El ARN de transferencia est doblado como un trbol, y su tarea es llevar aminocidos hacia los ribosomas, para luego unirlos y formar las protenas. Finalmente, el ARN ribosomal se preocupa, junto con las protenas, de estructurar a los ribosomas y son los que traducen el mensaje gentico. Por su parte, el cido desoxirribonucleico (ADN) es el que contiene el mensaje gentico para toda la funcin y organizacin celular. Es, en definitiva, la molcula que controla todos los procesos que hemos mencionado como vitales para los seres vivos, adems de ser el principal constituyente de los cromosomas celulares. La membrana plasmtica La funcin principal de esta membrana es controlar rigurosamente todos los elementos que entran y salen de la clula. Esta membrana, llamada tambin membrana celular, es la que rodea toda la parte exterior de la clula. Est compuesta de dos capas de molculas de lpidos y de protenas, que se desplazan lateralmente dentro de ciertos lmites. La funcin principal de esta membrana es controlar rigurosamente todos los elementos que entran y salen de la clula. Sin duda es selectiva, ya que slo permite el paso de ciertas sustancias. Estas membranas pueden contener varios tipos de protena receptora, cada una de las cuales responde a una molcula especfica. Algunas protenas se unen las unas a las otras para formar conexiones entre clulas. Lquido y slido Cuando la clula ingiere sustancias en forma masiva, nos encontramos con la endocitosis, un mecanismo de transporte que va hacia el interior de la clula. En el caso de que las sustancias sean ms pequeas o lquidas, se habla de pinocitosis (beber); si es de mayor volumen o se ingiere algo slido,

hablamos de fagocitosis (comer). Por ejemplo, las clulas encargadas de la defensa fagocitan bacterias, las que son encerradas por las prolongaciones de la membrana plasmtica e introducidas en la clula. Luego de ser digeridas estas bacterias, sus molculas resultantes se utilizan para las necesidades estructurales de las clulas defensoras, y los residuos que no sirven son excretados al medio extracelular. Este proceso se conoce con el nombre de exocitosis. Control celular El cido desoxirribonucleico (ADN) se encuentra en el ncleo de la clula. Es una cadena de bases nitrogenadas que contiene toda la informacin bsica sobre las caractersticas de cada persona. Es la materia de la que estn hechos los genes y se encarga de todo el funcionamiento, crecimiento y reproduccin de la clula. El ADN da las instrucciones para que se formen o sinteticen protenas, las que controlan funciones especficas de la clula. El ADN tambin tiene la capacidad de hacer copias o rplicas de su molcula. Este proceso es fundamental para la transferencia de la informacin gentica a travs de sucesivas generaciones. Los genes Los hidratos de carbono son compuestos de carbono, hidrgeno y oxgeno, que se dividen de acuerdo a su complejidad en monosacridos, disacridos y polisacridos. Los monosacridos, como lo dice su nombre, estn compuestos por una sola molcula de carbohidrato; los disacridos, en cambio, como la sacarosa -o azcar comn-, lactosa -azcar de la leche- y maltosa, estn configurados por la unin de dos monosacridos. Los polisacridos, en cambio, estn constituidos por cadenas de monosacridos, como el almidn y el glucgeno.

procesos fisiolgicos Irritabilidad: Es la capacidad del protoplasma para responder a un estmulo. Es ms notable en las neuronas y desaparece con la muerte celular. Conductividad: es la generacin de una onda de excitacin (impulso elctrico) a toda la clula a partir del punto de estimulacin. Esta y la irritabilidad son las propiedades fisiolgicas ms importantes de las neuronas.

Contractilidad: es la capacidad de una clula para cambiar de forma, generalmente por acortamiento. Est muy desarrollada en las clulas musculares. Respiracin: Esencial para la vida, es el proceso por medio del cual las clulas producen energa al utilizar las sustancias alimenticias y el oxgeno absorbido, para tal fin, y adems producir dixido de carbono y agua. Absorcin: Es la capacidad de las clulas para captar sustancias del medio. Secrecin: Es el proceso por medio del cual la clula expulsa materiales tiles como una enzima digestiva o una hormona. Excrecin: Es la eliminacin de los productos de desecho del metabolismo celular. Reproduccin: Es el proceso de divisin celular. Existen procesos fsico-qumicos como la difusin, la activacin y la desactivacin en el crecimiento celular y orgnico.

PROCESOS FISIOLOGICOS

RESPIRACION

Respiracin, proceso fisiolgico por el cual los organismos vivos toman oxgeno del medio circundante y desprenden dixido de carbono. El trmino respiracin se utiliza tambin para el proceso de liberacin de energa por parte de las clulas, procedente de la combustin de molculas como los hidratos de carbono y las grasas. El dixido de carbono y el agua son los productos que rinde este proceso, llamado respiracin celular, para distinguirlo del proceso fisiolgico global de la respiracin. La respiracin celular es similar en la mayora de los organismos, desde los unicelulares, como la ameba y el paramecio, hasta los organismos superiores (vase Metabolismo). Para ms informacin sobre la respiracin en plantas, vase Fotosntesis. EXCRECION

Fisiologa celular es el estudio biolgico del mecanismo de la interaccin de la clula y en su entorno. El trmino "fisiologa" se refiere a todas las funciones normales que tienen lugar en un organismo vivo. La absorcin de agua por las races, la produccin de alimentos en las hojas, y el crecimiento de los brotes hacia la luz, son ejemplos de la fisiologa vegetal. El metabolismo hetertrofo de los alimentos derivados de las plantas y los animales y el uso de movimiento para obtener los nutrientes son caractersticos de la fisiologa animal.

En el contexto de la fisiologa humana, la fisiologa celular trmino a menudo se aplica especficamente a la fisiologa del transporte de membrana, la transmisin neuronal, y la contraccin muscular. En general, stos cubren la digestin de alimentos, la circulacin de la sangre. y la contraccin de los msculos y, por lo tanto, son aspectos importantes de la fisiologa humana. Para una descripcin ms completa de la funcin fisiolgica general de las clulas humanas, ver el artculo sobre la biologa celular

-----------------------------------------------------------El cido desoxirribonucleico o ADN es la molcula que contiene la informacin de la vida. Su descubrimiento pasar a la Historia como uno de los grandes avances del s. XX. Ya en 1.869 Friedrich Mieschen logr aislarlo a partir de glbulos blancos, pero nunca supo de su importancia. En 1.953 James Watson y Francis Crick descubrieron la estructura y el comportamiento del ADN, lo que les vali el nbel de medicina en 1.962. El ADN es el responsable del parecido entre padres e hijos, y de que exista un molde comn para cada especie. Contiene toda la informacin gentica, las instrucciones de diseo de todos y cada uno de nosotros. Y del resto de seres vivos, desde la bacteria ms simple hasta el organismo ms complejo. En el ADN hay decenas de miles de genes. Son los encargados de fabricar las protenas necesarias para el desarrollo de las distintas funciones vitales. La mayor parte del ADN est en el ncleo de las clulas. Cada clula de nuestro cuerpo almacena una copia de esta informacin. Cada molcula de ADN se compone de dos cadenas de nucletidos que se cruzan entre s en forma de doble hlice. Es esa imagen tan caracterstica que nos viene a la mente cuando se habla del ADN.

Los nucletidos son, en realidad, unas molculas ms pequeas, y hay de cuatro tipos: adenina (A), timina (T), citosina (C) y guanina (G). Los cuatro se combinan para formar el cdigo gentico, del mismo modo que las letras se combinan para formar palabras: ATTC TCGA... Toda esta informacin est dispersa por el ncleo. Pero, cuando la clula va a dividirse, se ordena en pequeos paquetes en forma de bastoncillos: los cromosomas. En las clulas humanas hay 23 pares de cromosomas en total. La informacin en ellos est muy compactada, pues contienen la de los miles de genes. Cuando la clula se divide, la informacin se transmite y el ADN crea una copia de s mismo. La nueva copia debera ser idntica. Pero no lo es. Lo habitual es que en el proceso se cometan fallos. Entonces, hablamos de mutaciones. Todos

tenemos algunas mutaciones en nuestros genes. La mayora carecen de importancia. Algunas veces, en cambio, pueden provocar enfermedades o consecuencias muy graves. Las mutaciones no siempre son negativas. A veces aportan una ventaja sobre el resto de individuos y contribuyen a la evolucin de la especie. Esto ha ocurrido en la historia de la evolucin, aunque no es lo habitual.

FUNCIN: El ADN tiene como funcin la de actuar como depsito fundamental de informacin gentica, ya que transmite los caracteres biolgicos a la descendencia, controla y coordina todos los procesos y actividades celulares, participa en los mecanismos de herencia y gentica celular. Presenta propiedades exclusivas que son la duplicacin, autoduplicacin o replicacin (capacidad para originar molculas de ADN hijas) la transcripcin ( capacidad de codificar al ARN mensajero dentro del ncleo celular) y la mutacin (capacidad de alterar su cdigo gentico).

Como complemento del ADN est el ARN que traduce la informacin del ADN en sntesis de protenas, por eso, el dogma de la biologa celular y molecular es. ADN + ARN= Protenas.

El ARN mensajero (ARNm o mRNA de su nombre en ingls) es el cido ribonucleico que contiene la informacin gentica procedente del ADN , es decir, determina el orden en que se unirn los aminocidos. El ARN mensajero es un cido nucleico monocatenario, al contrario que el ADN que es bicatenario de doble hebra helicoidal.
El cido ribonucleico

De manera sencilla, el ARN (cido ribonucleico) es el material gentico responsable de trasferir o ms bien transcribir la informacin o instrucciones del ADN para construir proteinas. Cumple otras funciones, pero para tener una idea general basta. Para las clulas eucariontas (como las de nosotros), el ADN es el cdigo gentico en el ncleo de las clulas con toda la informacin necesaria para construir nuestro organismo; el ARN lleva a cabo las instrucciones presentes en este "plano" y convierte estras instrucciones en protenas, uno de los bloques bsicos con los que estamos hechos. Llendo a lo ms tcnico, el ARN es muy parecido al ADN, pero difiere en importantes detalles: en la clula el ARN es de una sola "hebra" (mientras que el ADN es de dos hebras), y los nucletidos del RNA contienen ribosa, mientras que los del DNA contiene desoxiorribosa (como la ribosa pero con un tomo menos de oxgeno).

El ARN sale del nucleo a travs de una serie de poros presentes en la membrana del propio ncleo. Supongo que la siguiente pregunta sera: y cundo sabe el ARNm que ya est listo para salir? Pues es as una vez que ha madurado lo suficiente. Y es que un ARNm recin sintetizado se diferencia bastante del que podemos encontrar ms tarde en el citosol. ste ha sufrido varios procesos (poliadenilacin del extremo 5, eliminacin de intrones, etc.) y son la culminacin de estos procesos los que actan como seales que indican que el ARN ya est maduro.

En biologa celular, se denomina orgnulos (o tambin organelas, organelos, organoides o mejor elementos celulares) a las diferentes estructuras contenidas en el citoplasma de las clulas, principalmente las eucariotas, que tienen una forma determinada. La clula procariota carece de la mayor parte de los orgnulos.

Los organelos son estructuras que se encuentran dentro de la clula las cuales desarrollan una serie de mecanismos fisiolgicos y bioqumicas, los cuales permiten a la clula respirar, comer etc. Los organelos de la clula son: Ncleo: Organelo de forma esfrica el cual esta delimitado por una membrana doble. Este contiene la informacin gentica (ADN). Su funcin es coordinar todas las actividades de la clula y tambin forma parte en la reproduccin de la misma. Membrana celular: Delimita a la clula, le da su forma, permite la entrada y salida de sustancias y es el medio por el cual esta se comunica con el medio que la rodea. Ribosomas: Son organelos ovoides o esfricos que pueden estar en el citoplasma o en el retculo endoplasmico rugoso y la funcin de estos es la sntesis de protenas para la clula.

El citoplasma. Consiste en una estructura celular cuya apariencia es viscosa. Se encuentra localizada dentro de la membrana plasmtica pero fuera del ncleo de la clula. Hasta el 85% del citoplasma est conformado por agua, protenas, lpidos,carbohidratos, ARN, sales, minerales y otros productos del metabolismo. Adems en su interior estn localizados ciertos orgnulos como mitocondrias, plastidios, lisosomas, ribosomas, centros omas, esferosomas, microsomas, diferenciaciones fibrilares y las inclusiones. Al citoplasma tambin se le conoce como la matriz citoplasmtica, y su apariencia es la de sustancia viscosa.

FUNCIONES DE LA MEMBRANA CELULAR


La funcin bsica de la membrana plasmtica es mantener el medio intracelular diferenciado del entorno. La combinacin de transporte activo y pasivo hace de la membrana plasmtica una barrera selectiva que permite a la clula diferenciarse del medio. Los esteroides, como el colesterol, tienen un importante papel en la regulacin de las propiedades fsico-qumicas de la membrana regulando su resistencia y fluidez. La membrana celular es una doble capa de lpidos que acta como una barrera que separa los medios interior y exterior de la clula.

A travs de ella, se transmiten mensajes que permiten a las clulas realizar sus funciones. Contiene receptores especficos que permiten a la clula interaccionar con mensajeros qumicos. Su grosor es de aproximadamente 7.5 a 10 nanmetros (nm). Es tan fina que no se puede observar, con el microscopio ptico, siendo solo visible con el microscpico electrnico. La importancia de la membrana celular radica en que la clula necesita recibir, constantemente, materiales para llevar a cabo sus funciones vitales, y los materiales de desecho se deben eliminar. Controla el paso de sustancias entre la clula, y su ambiente, permite que ingresen ciertas sustancias que actan como nutrientes del exterior. Las dems funciones de la membrana, como son el reconocimiento y unin de determinadas sustancias en la superficie celular. A estas protenas se les llaman receptores celulares. Los receptores estn conectados a sistemas internos que solo actan cuando la sustancia se une a la superficie de la membrana. Mediante este mecanismo actan muchos de los controles de las clulas.

Funciones especficaS
Asla el citoplasma del medio externo Regula el intercambio de sustancias esenciales ente el citoplasma y el medio externo. Se comunica con otras clulas. Identifica a las clulas como pertenecientes a una especie y como miembros particulares de estas especies. En los organismos multicelulares los tipos celulares especficos, con frecuencia, presentan marcas moleculares nicas, sobre sus superficies celulares. La membrana tiene encomendadas muchas funciones que se encuentran muy relacionadas, por lo que resulta difcil su estudio por separado.

Funcin estructural
Constituye la frontera fsica que mantiene separado el contenido celular del medio extracelular y delimita la forma de la clula. Gran elasticidad en las clulas aisladas y en las superficies libres de las que forman tejidos.

Funcin de intercambio de sustancias


A travs de la membrana entran unas sustancias, en su mayor parte nutrientes, y salen otras que pueden ser productos de desecho o de secrecin elaborados por la clula. Las caractersticas ms importantes de una membrana celular, su

permeabilidad selectiva, es decir, la posibilidad de discriminar qu sustancias pueden o no atravesarla. Existen dos modalidades de transporte, activo y pasivo.

La membrana celular, plasmtica o citoplasmtica es una estructura laminar formada principalmente por lpidos y protenas que recubre a las clulas y define sus lmites. plasma es la parte lquida de los fluidos sanguneos o de la linfa en donde es posible hallar componentes en suspensin. Tambin se trata de la linfa o sangre que carece de clulas. El plasma sanguneo, por lo tanto, es el compuesto lquido y acelular de la sangre. En l se puede hallar agua en un 90% y numerosas sustancias que estn disueltas en ella, entre las que aparecen protenas, lpidos, glcidos y diversos desechos del metabolismo.

un cromosoma es una cadena de ADN (es decir la informacion gentica) enrotllada y empaquetada con histaminas (unas proteinas). Esta cadena se desenrotlla para poder ser leda y sino se empaqueta guardada en el nucleo de la clula. en resumen: los cromosomas son el conjunto de la informacin gentica de un individuo, no slo determinan si eres hombre o mujer sin que determinan todos tus rasgos genticos (es decir, no determinan que tengas una cocatriz o una peca) pero si que determinan el color de tus ojos, si eres propenso a ***** pecas por el sol, cmo es tu pelo...

El rgano ms conspicuo en casi todas las clulas animales y vegetales es el ncleo; est rodeado de forma caracterstica por una membrana, es esfrico y mide unas 5 m de dimetro. Dentro del ncleo, las molculas de DNA y protenas estn organizadas en cromosomas que suelen aparecer dispuestos en pares idnticos. Los cromosomas estn muy retorcidos y enmaraados y es difcil identificarlos por separado. Pero justo antes de que la clula se divida, se condensan y adquieren grosor suficiente para ser detectables como estructuras independientes. El DNA del interior de cada cromosoma es una molcula nica muy larga y superenrrollada que contiene secuencias lineales de genes. stos encierran a su vez instrucciones codificadas para la construccin de las molculas de protenas y ARN necesarias para producir una copia funcional de la clula. El ncleo est rodeado por una membrana doble, y la interaccin con el resto de la clula (es decir, con el citoplasma) tiene lugar a travs de unos orificios llamados poros nucleares. El nucleolo es una regin especial en la que se sintetizan partculas que contienen ARN y protena que migran al citoplasma a travs de los poros nucleares y a continuacin se modifican para transformarse en ribosomas. El ncleo controla la sntesis de protenas en el citoplasma enviando mensajeros moleculares. El RNA mensajero (mRNA) se sintetiza de acuerdo con las instrucciones contenidas en el DNA y abandona el ncleo a travs de los poros. Una vez en el citoplasma, el mRNA se acopla a los ribosomas y codifica la

estructura primaria de una protena especfica. La llamada membrana nuclear parece ser, en relidad, una cisterna aplanada que se encuentra aplicada sobre la superficie del ncleo. Hay, por tanto, en ella dos unidades de membrana, una externa y otra interna. La capa externa es porosa, mientras que la interna es continua. No obstante, los poros estn normalmente obturados. Un detalle importante es que en la superficie externa de la membrana hay gran cantidad de ribosomas. Al parecer, la membrana nuclear presenta tambin permebilidad selectiva y delimita dos zonas, el carioplasma y el citoplasma, entre la que existe una diferencia de potencial.

LOS POROS NUCLEARES son un COMPLEJO de PROTENAS en la MEMBRANA NUCLEAR La envuelta nuclear no asla al ncleo, sino que es un punto de regulacin (una aduana) en el transporte de molculas (protenas y cidos nucleicos, subunidades ribosomales, iones, etc) entre el ncleo y el citoplasma. El componente de la envuelta nuclear que esta implicado en esta regulacin es el poro nuclear. Los poros observados por criofractura: A la izquierda se muestra una imagen parcial de una clula mostrado la membrana (m), el citoplasma (c) y el ncleo (n), donde encontramos los poros nucleares (derecha).

Crecimiento celular
Una serie de trastornos del crecimiento pueden ocurrir a nivel celular y pueden tener como consecuencia la evolucin posterior en cncer, en el que un grupo de clulas presentan un crecimiento incontrolado y una divisin ms all de los lmites normales, la invasin (intrusin y destruccin de tejidos adyacentes), y metstasis (diseminacin a otras partes del cuerpo a travs de la linfa o sangre).

El crecimiento celular es el proceso mediante el cual las clulas se reproducen y, de esa manera, pueden cumplir con su ciclo y funciones especficas en el organismo de los seres vivos. Pero un crecimiento celular descontrolado y fuera de las condiciones normales, puede devenir en enfermedades degenerativas y otras como el cncer. Lee todo en: Crecimiento celular | La gua de Biologa http://biologia.laguia2000.com/citologia/crecimientocelular#ixzz2hX1k4xvx Las clulas tienen un tiempo determinado de vida. Durante ese tiempo deben cumplir con todas sus funciones especficas y su ciclo de reproduccin y crecimiento celular. En tejidos sanos, el proceso de crecimiento celular debe funcionar armnicamente. Es decir, que la aparicin de nuevas clulas y la extincin de clulas viejas, mantienen un nmero casi idntico en cantidad. Es por ello que da a da mueren determinado nmero de clulas y aparece el mismo nmero de clulas nuevas para su reemplazo. Uno de los ejemplos ms claros del crecimiento celular se puede observar en las clulas de la piel o epidermis. Si observamos microscpicamente el proceso, podremos notar que el grosor de la capa exterior de la piel es idntico a una cantidad aproximada de doce clulas. En condiciones normales esta capa, llamada capa basal, est dividida en igual proporcin que las clulas que se desprendieron y quedaron sobre la superficie de la piel.

Lee todo en: Crecimiento celular | La gua de Biologa http://biologia.laguia2000.com/citologia/crecimientocelular#ixzz2hX1zcZzL

CRECIMIENTO CELULAR Durante el crecimiento y desarrollo normal existe un mecanismo muy preciso que permite a los rganos individuales alcanzar un tamao determinado, que por motivos prcticos, nunca se sobrepasa. Si un tejido es daado, las clulas supervivientes, en la mayora de los rganos, comienza a crecer y reemplazar las clulas daadas. Cuando este proceso se ha completado, se detiene; este es el mecanismo de control de crecimiento celular; mecanismo que se mantiene durante la vida. Aunque en el embrin la mayora de las clulas en el pueden proliferar (incrementar su nmero), no todas las clulas en el adulto mantienen esta habilidad. En la mayora de los rganos hay una reserva especial de clulas, clulas germinales, que son capaces de crecer en respuesta a determinados estmulos, como pueden ser una herida. Estas clulas germinales estn poco diferenciadas, de hecho cuanto mayor es la diferenciacin de las clulas menor es su capacidad de proliferar.

En tejidos normales, los ndices de crecimiento de nuevas clulas y la muerte de clulas viejas se mantienen en equilibrio. Cada da mueren miles de clulas de nuestro cuerpo. Cada da exactamente el nmero correcto exactamente de los tipos correctos de clulas toman el lugar de esas que mueren. Y si todo est en el orden adecuado de funcionamiento, ni siquiera lo notamos.

Crecimiento Celular Normal

Para explicar este proceso, observemos las clulas de la epidermis (la capa externa de la piel). La capa externa de la piel tiene el grosor de aproximadamente una docena de clulas. Bajo circunstancias normales, las clulas en la base de esta capa, llamada capa basal, se

dividen en exactamente la misma proporcin que las clulas liberadas de la superficie. Cada vez que se divide una de estas clulas basales, produce dos clulas. Una permanece en la capa basal y contina para dividirse otra vez. La otra migra hacia afuera de la capa basal y ya no puede dividirse. De esta manera, el nmero de clulas que se dividen en la capa basal, y el nmero de clulas que no se dividen en la capa externa permanecen igual.

Crecimiento celular normal

Muerte Celular La muerte celular de las clulas se llama muerte programada. La clula va a sufrir una serie de cambios intracelulares como reduccin de material gentico, reduccin de las organelas, rotura de todas las membranas celulares y reabsorcin de este material por macrfagos. Muerte patolgica celular. Se produce ante una agresin que no es controlada, se caracteriza por la no reutilizacin y reciclaje de las organelas y la reactivacin de los procesos de la inflamacin. La inflamacin tiene como finalidad aislar el foco agresivo.
EGN COMO SE LO MIRE, HAY ORGANISMOS INMORTALES HAY organismos como las bacterias, levaduras y amebas, que estn formados por una sola clula, y que son virtualmente inmortales. Por supuesto podemos matarlos usando antibiticos, hirviendo el caldo en que viven, o calentando a 200C las gasas e instrumentos de ciruga en cuyos resquicios se podran haber metido. Pero si bien puede morir por esas causas ajenas a su funcionar biolgico, normalmente un organismo unicelular no muere: cumplido su ciclo vital, simplemente se divide en dos hijas que continan viviendo y no queda ningn "cadver". Algo as como si tu abuela no hubiera muerto, sino que se hubiera dividido en tu mam y tu ta. Cuando en cambio una clula forma parte de un organismo multicelular, su destino final no es necesariamente el dividirse en dos hijas, sino que puede morir programadamente. Hace una generacin, la idea de que las clulas pudieran llevar en su seno un programa para suicidarse habra sido considerada luntica; pero hace diez aos se comenz a aceptar y hoy ya es incontrovertible. Para describirla debemos comenzar por introducir algunos conceptos elementales. LOS CDIGOS DE LA VIDA Las clulas contienen largusimas molculas de ADN, enroscadas una sobre otra como si se tratara de un collar de dos cadenas que giran sobre ellas mismas, constituido por piedras preciosas. Para seguir con la analoga, imaginemos que cada una de estas dos cadenas es una secuencia de cuatro tipos de gemas distintas (Amatista, Topacio, Crisoberita y Granate), de modo que si queremos especificar la secuencia de las piedras ensartadas en cierto fragmento de una de esas dos cadenas escribimos:

ATCTAAGTACCTGATTGCCAAATGC
Y ya que estamos imaginando collares, supongamos que ahora pedimos a un joyero que nos haga una segunda cadena, para ponerla junto a la primera y enroscarlas. Pero no le permitimos que la ensarte en un hilo como mejor le parezca, sino que se atenga a dos reglas: (1) que frente a cada gema A de la primera cadena enhebre una T en la complementaria (y viceversa, si hay una T que le enfrente una A); y (2) que cuando en la primera cadena vea una C contraponga una G en la segunda (y viceversa, si ve una G, contraponga una C). La cadena que fabricar este joyero ser entonces:

TAGATTCATGGACTAACGGTTTACG
As construido, el trozo de collar tendr dos cadenas complementarias, enfrentadas del siguiente modo:

ATCTAAGTACCTGATTGCCAAATGCcadena 1 TAGATTCATGGACTAACGGTTTACGcadena 2
Ahora conviene abandonar la analoga, porque el ADN no contiene gemas preciosas, sino molculas llamadas Adenina, Timina, Gitocina y Guanina, pero que obedecen las mismas reglas de ensarte y complementariedad (A con T y C con G). Tampoco hay joyeros moleculares, sino que la tarea est a cargo de varias enzimas y de una hueste de molculas ayudantes, en cuyo detalle no nos detendremos. Tambin conviene tener en cuenta que en nuestro ejemplo nos hemos limitado a fragmentos muy breves de una largusima doble cadena, y que si el ADN estuviera hecho realmente de piedras preciosas llegara al cielo; pero por suerte las ATCG son tan pequeas que todo el ADN de una clula cabe enrollado en su ncleo. Es fcil advertir que, si separamos las dos cadenas, se las damos a dos joyeros, y les pedimos que hagan una cadena complementaria a la que le entregamos, obedeciendo siempre la regla de enfrentar A con T y C con G, el artesano al que le demos la cadena 1 nos har la complementaria 2, y al que le entreguemos la 2 nos enhebrar la complementaria 1. Algo parecido hacen las clulas con sus cadenas de ADN cuando se dividen: separan sus dos cadenas de ADN y hacen una copia complementaria de cada una, de modo que las dos clulas hijas reciben rplicas exactas de las que tena la madre. Gracias a este legado de generacin celular en generacin celular, el huevo fecundado da origen a todas las clulas del organismo, que tienen por eso exactamente el mismo mensaje inscrito en el ADN. De pronto, de una hebra de la largusima cadena de ADN, se copia un fragmento, tambin complementariamente, pero con un cdigo ligeramente distinto de molculas (en el cual en lugar de gemas T hay gemas U), y se genera as una hebrita llamada "ARN mensajero". Este fragmentito 2 hecho de ARN sale del ncleo y difunde hasta unos cmulos moleculares llamados ribosomas. Los ribosomas tienen la propiedad de leer la secuencia de A, U, C y G del ARN, como t leeras la secuencia de letras de la notita y, obedeciendo el mensaje que indica esa secuencia, van ensartando aminocidos, y forman as un tercer tipo de hebra molecular llamada pptido. El segmento de ADN que especific la secuencia de esta hebra de pptidos se llama gene y la coleccin de todos los genes de una clula se denomina genoma. Resumiendo: el ADN tiene codificados los genes que especifican los pptidos que los ribosomas habrn de fabricar. La clula tiene luego todo un aparato de organelos subcelulares y enjambres de enzimas que actan sobre los diversos pptidos, agregndoles y quitndoles azcares, lpidos, etctera, y los convierten en protenas que controlan todas las reacciones qumicas de las que depende la vida y constituyen piezas clave del andamiaje y maquinaria celular. CMO SE IDENTIFICA AL GENE QUE CODIFICA UNA PROTENA DETERMINADA? Los bilogos moleculares enfrentan bsicamente tres situaciones. A veces conocen una protena y necesitan encontrar el gene que la codifica en la molcula de ADN; otras veces conocen una caracterstica de un bicho o una planta (alas puntiagudas, ojos azules, cuernos retorcidos, flores amarillas) y tambin necesitan encontrar al gene responsable. Pero hay una tercera situacin, en la que se las ingenian para anular un gene, para ver qu funcin celular se pierde, como cuando jugamos con las llaves de luz para ver si con ello encendemos un reflector de la sala o apagamos el farol del jardn. De ah en adelante se lanzan a buscar la protena codificada por el gene en cuestin y que tiene a su cargo dicha funcin. Es fcil imaginar entonces la sorpresa de los bilogos cuando, encendiendo y apagando genes, encontraron unos que tienen como funcin matar a la clula. As de simple: hay genes, que han pasado a llamarse genes de la muerte. En la nomenclatura de la gentica se llama mutacin letal a la que, por afectar un gene esencial no permite se geste un individuo vivo. En este caso, la mutacin es letal, pero el gene en cuestin no es un gene de la muerte, porque reservamos este nombre para los que intervienen en la muerte celular programada, cuya funcin especfica es indicarle a la clula cmo construir las armas moleculares necesarias para suicidarse. Pero estos conceptos todava no nos permiten entender por qu se deben suicidar esas clulas, de modo que tendremos que introducir ms informacin acerca de los genes. POR QU EN UN MISMO ORGANISMO HAY CLULAS DIFERENTES? Como dijimos ms arriba, todas las clulas somticas de un organismo (las que no son gametas) tienen un genoma idntico, es decir, todas tienen genes que codifican las mismas protenas. Entonces por qu unas clulas se convirtieron en neuronas, otras en osteoctos, otras en hepatocitos y otras en fibras musculares? La explicacin es anloga a la que resultara de observar que, si bien a varias personas les regalan el mismo manual de carpintera, unas eligen fabricarse mesas, otras camas, otras escaleras... y terminan as con un mobiliario diferente. Es decir, todas las clulas somticas de un organismo como el nuestro tienen los genes para hacer hemoglobina, rodopsina, insulina, pero no todas las expresan, porque unas eligen expresar el que codifica hemoglobina, otras el que expresa rodopsina y algunas el que especfica insulina. Y eso no es todo: algunos tipos de clulas leen y sintetizan unas pocas molculas de la protena codificada por un gene, y otras expresan ese mismo gene millones y millones de veces. Tal es el caso del reticulocito que, entre las cosas que hace para convertirse en eritrocito, expresa millones de veces el gene de hacer hemoglobina, pero unas pocas veces los genes codificadores de la enzima Na+,K+-ATPasas, mientras que una clula renal produce millones y millones de Na+,K+-ATPasas, pero ninguna de hemoglobina. El resultado de expresar ciertos genes y no otros, o de expresarlos un distinto nmero de veces, produce una asombrosa diversidad de tipos celulares. A decir verdad, a pesar de ser tan grande, el nmero de tipos celulares que se originan de la expresin genmica resulta irrisorio comparado con la cantidad astronmica de tipos que tericamente se podran construir. Esta restriccin del nmero de tipos celulares se explica porque los genes no tienen libertad de expresin: hay repertorios, programas genticos, en los que un gene slo se puede expresar a condicin de que antes se hayan expresado algunos otros, y que, una vez que se expresan, provocan la expresin de otros ms de la cascada programtica, como restaurantes que slo sirven mens fijos. De lo contrario "no tendra

sentido" que se leyeran los genes para fosforilar una protena, si no se leen tambin los que ordenan construir la protena que se ha de fosforilar, o que se han de pegar a tal subunidad, o que habrn de integrarse para formar cierto organelo. Hay tambin una coordinacin entre los genes que expresa una clula con los que expresan las vecinas, pues tampoco tendra sentido construir los msculos de una pata, si no se han de expresar tambin los genes responsables de que otras clulas fabriquen los huesos, vasos, nervios y tendones de esa pata. Hacer una pata, un ojo o un ala, implica desplegar temporal y espacialmente una combinacin impresionante de programas genticos. Un tipo celular dado tampoco expresa montonamente el mismo repertorio de genes a lo largo de toda su vida, pues atraviesa "edades", en las que recibe seales (hormonas, factores trficos, contactos excitatorios o inhibidores de sus vecinas, impulsos elctricos) que le activan o desactivan especficamente ciertos genes. Como resultado de dichas rdenes (o a veces por su interrupcin) se sintetizan ciertas molculas o se dejan de producir ciertas otras; as, dependiendo de su posicin en el organismo, se transforman en clulas epiteliales, seas, neuroblastos, reticulocitos y luego en neuronas, eritrocitos, adipocitos o timocitos, y ms tarde reciben nuevas seales que las estimulan para que se lancen a sintetizar rodopsina, bilirrubina o miosina, y posteriormente vuelven a recibir mensajes para que liberen al medio insulina, o cortisona, o paratohormona. Ese proceso por el que, a pesar de tener idntico genoma, unas clulas slo leen aquellos genes que las transforman en clulas epiteliales del duodeno que apenas viven cuatro das, o en neuronas que viven ochenta aos, se llama diferenciacin. Los bebs son "pluripotentes", pero luego, al crecer, uno puede elegir la carrera de derecho, su hermano dedicarse al levantamiento de pesas y su hermana consagrarse a la danza; eligen as destinos que implican paquetes coordinados de miles de acciones, que al cabo de un tiempo los harn diferentes en sus funciones y hasta en la estructura de sus cuerpos. Pero esas "diferenciaciones" podran no ser finales, sino que a los cuarenta y cinco aos el que se recibi de abogado se embarca en una carrera poltica, el forzudo se hace narcotraficante y la danzarina ama de casa. Tambin las clulas pueden lanzarse a nuevas ramas diferenciales, pero ya no conservan la pluripotencia que tena el huevo fecundado del que derivan. A cierta altura de su vida pueden activar genes de la muerte,por la accin de stos se suicidan y aceptan dcilmente que otras clulas vengan a devorar su cadver, porque a todo el organismo le conviene que, a cierta altura de su desarrollo, determinadas clulas se maten. No se trata de algo inslito: es normal contar con estos suicidios y entonces se habla de una muerte celular programada. Estos programas no parecen ser un paso final de toda diferenciacin, sino programas alternativos (Gerschenson y Rotello, 1992; Ponzoni y colaboradores, 1995). Pero estos nuevos conceptos, que ayudan a entender cmo se programan eritrocitos o neuronas, todava no nos explican por qu existen programas para matar a las clulas. Prosigamos. GENES QUE SE ELIMINAN Y GENES QUE SE CONSERVAN De pronto aparece un nuevo gene, en general por modificacin o combinaciones de segmentos de genes preexistentes. Si ese gene confiere una desventaja (imagnate un gene que codifica una hemoglobina defectuosa que no puede llevar oxgeno a los tejidos) el organismo que lo porta no est en condiciones de sobrevivir en la lucha por la vida, no se reproduce, no lega esos genes defectuosos a sus descendientes, y la "novedad gentica" desaparece de la faz de la Tierra. Pero cuando, por el contrario, confiere alguna ventaja, el organismo puede resultar victorioso, tener hijos y nietos equipados con el nuevo gene, y de ah en adelante este gene pasa a ser atesorado en el genoma de los descendientes (decimos: "se conserva" y "se propaga"). El hecho de que se eliminen los genes adversos y se propaguen los que confieren ventajas nos deja ms sorprendidos de lo que estbamos al principio, pues surge de nuevo la pregunta: qu ventaja confieren los genes de la muerte, como para haber sido tan atesorados, en el sentido de que, desde que aparecieron por primera vez en la escala biolgica (la que va desde los primitivos unicelulares al hombre actual), se hayan conservado tan celosamente y hayan sido legados a todos los descendientes? Puesto en otras palabras: qu ventajas confiere la muerte? A riesgo de irritarte, permtenos posponer nuevamente la respuesta, e introducir ms conceptos bsicos. CMO SE CONSTRUYE UN COMPLEJSIMO ORGANISMO A PARTIR DE UN HUEVO FERTILIZADO? Un primer requisito es, como ya discutimos, la diferenciacin celular que provee los diversos tipos celulares que se necesitan. Un segundo requisito es que haya un nmero adecuado de cada tipo. As, no tenemos ni un hgado tan grande que ocupe todo nuestro abdomen, ni uno tan pequeo que slo contenga cuatro hepatocitos. El problema es cmo "saben"3 las clulas cul es el nmero ptimo? Y es seguro que lo "saben", pues si nos extirpan medio hgado, los hepatocitos restantes se darn a la tarea de dividirse hasta restaurar todo el rgano. El estudio de cmo hace el organismo para optimizar el nmero y tipo de clulas que necesita es uno de los aspectos ms fascinantes de la biologa moderna. Para complementar este concepto: si te mudas a residir a una meseta 2 000 metros ms alta del lugar donde vives actualmente, tu organismo incrementara el "nmero ptimo" de glbulos rojos y tendrs poliglobulia. Pero cuando regreses lo volver a disminuir. Si de pronto te enyesan una pierna, tu organismo, al "ver" que ya no usas ciertos msculos, comenzar a atrofiarlos; pero cuando te quiten el yeso, el ejercicio le indicar que debe volverlos a restablecer. Ms an, si ahora te haces ciclista desarrollars tus msculos a un nivel superior al que tenas antes de enyesarte, y si en cambio te dedicas a la natacin, te los desarrollar tambin, pero de una manera distinta. Imagina que te acaban de construir una casa pero, cuando la vas a habitar, no puedes utilizar la cocina porque est llena de albailes, ni el dormitorio por los electricistas, ni el bao por los plomeros, ni el comedor por los pintores. T desearas que, una vez cumplida su tarea, esos obreros se hubieran "autoeliminado". Anlogamente, durante varias edades, notablemente las ltimas etapas de la vida fetal y las primeras de la niez, hay una impresionante eliminacin de clulas que, o bien ya cumplieron su funcin y ahora no se necesitan, o bien no la cumplieron correctamente. Todava no se entiende exactamente cmo "sabe" el organismo cul es el "nmero ptimo" de cada tipo celular, ni cmo considera" que una estructura determinada (un circuito neuronal, una papila gustativa de la lengua) est correctamente construida. Pero con la informacin disponible podemos plantear que sucede lo siguiente: Una clula recibe varios tipos de seales: 1) hormonas que le llegan con la circulacin desde glndulas distantes; 2) hormonas locales que le llegan desde clulas vecinas, difundindose por el lquido que las

rodea; 3) seales moleculares que ella misma lanz al medio y que ahora se pegan a sus propios receptores; 4 ) "hormonas que no se desprendieron de las clulas que las sintetizaron sino siguieron residiendo en sus membranas, pero pueden comunicar su mensaje cuando estas clulas tocan a sus vecinas, como cuando t, sin desprender tu mano, tocas el timbre de una casa, situacin que requiere por supuesto que esa casa haya "expresado" un timbre; 5) otras sustancias no llegan a recibir el nombre de hormonas, pero su importancia se reconoce lo suficiente como para llamarlas "factores" o "mediadores qumicos"; 6) seales elctricas que provienen de clulas vecinas. Algunas de esas seales le indican a la clula: "Enciende los genes necesarios para entrar en mitosis y multiplcate"; otras le dicen: "Activa tal o cual gene y ponte a producir miosina, actina, o queratina", es decir, "difernciate hacia tal o cual tipo celular" (ya sabes: neuronas, queratinocitos, timocitos, miocitos); otras, "apaga tal o cual gene, pues ya no necesitamos su producto", etctera. El organismo es implacable en que se cumplan esas rdenes estrictamente y, a su vez, las clulas tienen una obediencia apabullante. As, con sus seales, conmina a una neurona: "Expresa tales o cuales molculas, salas para controlar tu metabolismo y construirte un axn, hazlo crecer hasta que toques a la neurona Fulana y luego activa tus genes letales y suicdate". La clula obedece, su axn crece cinco centmetros y llega a comunicarse con Fulana, pero sta le tiene reservada una sorpresa, pues en cuanto es tocada, a travs de las seales que emanan del contacto le comunica: "En virtud de que cumpliste tu misin, te perdonamos: no actives tus genes letales". Por el contrario, si el axn se extravi, no encontr a Fulana, se pas de largo, o acaso lleg a contactar a una clula que no deba, constituyendo con sta un circuito espurio, que no sirve o acaso es contraproducente, nadie le anular la orden de que se suicide. De modo que esa profusin de muerte celular que ocurre sobre todo hacia el fin de la vida fetal y al principio de la niez, se debe en parte a que el organismo est borrando sus errores, eliminando clulas equivocadas y obreras que ya no necesita. T mismo puedes observar el trabajo de los genes letales en un charco de ranas, en el que los renacuajos nadan propulsndose con la cola. Llegado el renacuajo a cierta altura de su desarrollo, las clulas de la cola se suicidan ordenadamente, los renacuajos la pierden y se convierten en adultos "anuros". Ese proceso es similar a los que se llevaban a cabo en tu propio cuerpo, cuando te estabas gestando dentro del tero. Las clulas de tu pronefros (un antecesor de los riones) entraban en apoptosis, pasaban a desarrollar el mesonefros, que a su turno tambin tuvo un festival de clulas suicidas, y daba origen a los riones. Cuando eras feto tambin tenas los dedos unidos por una membrana interdigital como las ranas y los patos; de nio tenas timo, glndula que luego desapareci debido al suicidio de sus clulas, y toda la vida estars recambiando clulas merced a mecanismos de suicidio celular. Estos suicidios tienen ciertas peculiaridades que atrajeron la sospecha de los investigadores: 1) ocurren justo cuando se les necesita, en un momento demasiado preciso como para ser fortuitos; 2) cada estructura molecular o celular es desmembrada por enzimas "cmplices", especficamente sintetizadas para llevar a cabo la eliminacin sin dejar rastros; 3) generalmente, esos cmplices son siempre los mismos, ya que a pesar de tratarse de suicidios celulares de distintos tipos y en diversas edades del organismo, siempre estuvieron presentes en el lugar del suicidio; 4) son por dems atildados y pulcros, no dejan rastros (como dijimos, no queda ningn cadver celular) ni daan a los testigos presenciales (las clulas vecinas); 5) los cambios que sufre la clula suicida ocurren en secuencias demasiado regulares como para ser espontneas; 6) hay agentes externos que siempre se presentan, por lo tanto no pueden ser declarados "inocentes" y 7) los suicidios contrastan con otros procesos de muerte celular verdaderamente accidentados (necrosis), que se observan cuando te aplastas un dedo con la puerta, te pica una araa o te quema una brasa. Por eso la investigacin (muy lejos an de estar concluida) fue forjando la hiptesis de que se trata, como ya dijimos, de "muertes celulares programadas". Andrew Wylie, de la Universidad de Edimburgo, llam al proceso "apoptosis",4 trmino de raz griega que significa "desprendimiento de los ptalos de una flor" (Kerr y colaboradores, 1972). Vemos as una de las ventajas ms obvias de la muerte, en este caso celular: el desarrollo armnico de un organismo. Si por deficiencias genticas o manipulaciones experimentales se impiden esas muertes celulares, la consecuencia no es la vida eterna, sino la monstruosidad o el desarrollo de tumores, pues las clulas se lanzan a multiplicarse y diferenciarse de maneras anormales. Hoy se conocen varias instancias en las que los genes letales se quedan como sordos, no escuchan la orden de activarse, o la escuchan pero los mecanismos que deben ejecutar sus mandatos no los obedecen, y la clula queda as desconectada de lo que se da en llamar "homeostasis celular": crecen anrquicamente y, dependiendo de la situacin, pueden interrumpir la formacin de un tejido, de un rgano normal, o formar por su cuenta una masa tumoral. Hay clulas cancerosas que fabrican su propia orden de no morirse: lanzan al medio algunos factores, que luego ellas mismas reciben y as consiguen seguir vivas y reproducirse (Ishizaki y colaboradores, 1995). CMO TRABAJAN LOS GENES DE LA MUERTE? De joven, el pequeo gusano Caenorhabditis elegans llega a tener un mximo de 1 100 clulas, pero luego 131 sufren muertes celulares programadas, de modo que en el adulto slo quedan 969. Contar con un organismo multicelular de tan pocas clulas, cada una de ellas individualizada y con un pasado y un futuro conocidos, y de las que por lo tanto se sabe cules han de morir programadamente, permiti identificar algunos de los genes responsables de la apoptosis. No todos los genes que participan en la apoptosis son realmente mortferos. De esta forma, si a travs de manipulaciones experimentales se anulan los genes ced-3 o ced-4(figura 1), las 131 clulas condenadas se salvan de la muerte. Por supuesto, los genesced son considerados como candidatos a verdugos celulares. Pero no es tan simple, pues si se anula el gene ced-9, que tambin forma parte del programa apopttico, las 131 no se salvan, indicando que este gene no es mortfero, puesto que su producto estaba frenando a los verdaderamente fatales. Vale la pena, entonces, tener en cuenta que si bien a todos se les llama "genes de la muerte celular programada", algunos hacen el papel de "malos" y a otros de "buenos" y la muerte se da o no segn cuales ganen.

Figura 1. Esquema de la muerte celular programada de las clulas del nemtodo C. elegans. En la parte superior se ilustran los estados de la clula, en la parte media los genes que participan, y en la inferior aquellas etapas que son especficas para ciertas clulas y las que son comunes a todas. Las flechas indican activacin y las barras inhibicin. (Adaptado de Steller, 1995).
Decamos ms arriba que los genes que confieren alguna ventaja al organismo tienden a conservarse. En este sentido, los genes ced han de ser realmente tiles, pues se conservaron desde los nemtodos (el C. elegans es un nemtodo: un gusanito en forma de hilo) hasta nosotros. Y aqu conviene introducir algunos conceptos bsicos ms. Cuando se analizan las secuencias de bases de un gene dado a lo largo de toda la escala evolutiva, se encuentra que va acumulando alteraciones, pero conserva con todo cierta identidad que permite reconocer su estirpe, como cuando se reconoce la identidad y hasta la evolucin temporal del nombre Fernando, Fernndez, Hernando, Hernndez. Se ha encontrado que el ced-9 del C. elegans tiene 23% de similitud con el oncogene bcl-2de los mamferos, y que ste protege del suicidio a los linfocitos y a las neuronas. Se acepta entonces que los genes ced-9 y bcl-2 son homlogos. De la misma manera, una protena de los mamferos llamada ICE (interleukin-1 b-converting enzyme), que desempea un papel importante en la inflamacin, tiene una similitud de 28% con la protena

CED-3 del C. elegans. Por lo tanto, se acepta tambin

que los genes que las codifican (el ice de los mamferos y el ced-3 de los nemtodos) son homlogos.5 Recientemente se demostr que la sobreexpresin 6 de la protena ICE induce la muerte de las clulas de mamferos, pero puede ser bloqueada especficamente por el gene protector bcl-2 o ced-9 que, como dijimos ms arriba, es de nemtodos. Tambin puede ser anulada por la protena codificada por el gene crmA del virus que produce erupciones pustulosas en la vaca. Y aunque no te interesen las erupciones pustulosas de las vacas, permtenos contarte que cuando uno toma clulas de algn tejido, por ejemplo del rin humano, las disocia y las cultiva en una caja de Petri, se reproducen algunas generaciones y luego mueren. Pero hay trucos experimentales que permiten inmortalizar esa estirpe, haciendo que se sigan multiplicando por generaciones y generaciones. Uno de esos trucos es infectarlas con ciertos virus. La situacin sera la siguiente: esas clulas, separadas del rin en el que su existencia tena sentido (consulta el Apndice II), perdieron a las vecinas que les sealaban que deban mantener inactiva su maquinaria de la muerte. Ahora que estn cultivadas en la caja de Petri no los tienen silenciados, los expresan y se mueren. Pero cuando son infectadas por el virus la situacin cambia, pues "la vida" de estos virus depende de que haya clulas dentro de las cuales pueda reproducirse; por lo tanto, no les conviene que las clulas cultivadas mueran. En consecuencia, llevan consigo genes que, cuando son expresados por la clula invadida, hacen que las protenas resultantes ordenen: "No te amargues por esta solitaria existencia in vitro, carente de sentido; no te suicides, contina reproducindote." Esta contraposicin de seales (mtate, no te mates) se puede ver tambin en que ciertas protenas con un alto grado de similaridad en su secuencia de aminocidos, parecen competir por algn receptor que tiene a su cargo decidir si se ha de continuar o no con el proceso de apoptosis. Y as, el gene bcl-x produce dos protenas: una larga que protege a los linfocitos de la muerte en los cultivos, y una corta que por el contrario promueve su muerte, de modo que mientras estas dos protenas mantengan un equilibrio adecuado (que una no se exprese en mayor cantidad que la otra) el linfocito permanecer en el borde entre la vida y la muerte.

La necrosis
La necrosis de una clula sucede cuando algn agente externo (traumatismo, txico, agentes infecciosos, etc.) acta sobre ella induciendo su muerte. Las clulas que degeneran ocasionan una serie de reacciones locales que conducen a respuestas de tipo inflamatorio que son probablemente la manifestacin ms importante de este proceso.

La accin del agente inductor de la necrosis produce una alteracin en las membranas plasmtica y mitocondrial, donde se alojan las bombas inicas (fundamentalmente de Na+, K+ y Ca++) que se encargan de mantener el adecuado equilibrio inico intra-extracelular. Esta alteracin en

los sistemas homeostticos dispara un mecanismo de defensa frente a la alteracin de la homeostasis. As, el ncleo de la clula comienza a transcribir ADN con informacin para la sntesis de protenas protectoras de la clula (hsp heat-shock proteins-, chaperonas). En ocasiones estas protenas son capaces de restaurar las funciones celulares, pero en otras no y es entonces cuando la clula continuar de manera inevitable hacia su destruccin.

Los iones Na+ y Ca++ comienzan a entrar en la clula y son acompaados de agua, para mantener el equilibrio osmtico, lo que determina que los diversos organoides celulares (mitocondrias, retculo, etc.) sufran un proceso de hinchazn y fragmentacin intracelular (Figura 5). Asimismo el citosol se llena de agua y electrolitos y, la clula en su conjunto sufre un proceso de turgencia general que conduce a una vacuolizacin, ruptura de la membrana citoplasmtica e inicio de una reaccin inflamatoria por la liberacin de molculas proinflamatorias (Edinger y Thompson, 2004).