Está en la página 1de 8

Biomdica 2011;31(sup.

3):23-205
184
XX Congreso Latinoamericano de Parasitologa
Parsitos intestinales
PROTOZOOLOGA
Encephalitozoon intestinalis,
Enterocytozoon bieneusi y otros
parsitos intestinales en pacientes
positivos para VIH del Hospital
Universitario de Maracaibo, Estado
Zulia, Venezuela
Amparo Hernndez, ngela Bracho, Rafael Villalobos,
Solneumar Salazar, Naileth Arraiz
Servicio Autnomo Hospital Universitario de Maracaibo,
Maracaibo, Venezuela
Introduccin. Los microsporidios se consideran
parsitos causantes de infecciones emergentes y
oportunistas en individuos inmunocomprometidos
en todo el mundo.
El objeto de este estudio fue identificar las especies
de microsporidios intestinales en pacientes
con VIH-sida del Servicio Autnomo Hospital
Universitario de Maracaibo (SAHUM), donde no
existan estudios previos en esta materia.
Materiales y mtodos. Se obtuvieron 56 muestras
fecales de pacientes con diagnstico confirmado
de VIH, en un periodo de un ao. Se revisaron
sus historias clnicas para obtener datos sobre
conteo de CD
4
y carga viral. Las muestras se
analizaron mediante examen macroscpico
y microscpico con SSF y Lugol, mtodo de
concentracin de Ritchie, coloracin de Kinyoun,
coloracin Gram-cromtropo rpida y la tcnica de
reaccin en cadena de la polimerasa (PCR) para
la identificacin de Encephalitozoon intestinalis y
Enterocytozoon bieneusi. Para determinar el ji al
cuadrado y la correlacin de Spearman se utiliz el
paquete estadstico SPSS, versin 10.
Resultados. Se diagnosticaron protozoos como
Blastocystis hominis (17,65 %), Isospora belli
(17,65 %), Cryptosporidium spp. (7,84 %), complejo
Entamoeba histolytica/dispar (5,88 %), Entamoeba
coli (3,92 %), Giardia lamblia (3,92 %), Endolimax
nana (3,92 %), Cyclospora cayetanensis (3,92 %)
y Chilomastix mesnili (1,96 %). Entre los helmintos,
Ascaris lumbricoides, Trichuris trichiura y
Strongyloides stercoralis presentaron un porcentaje
de 27,27 % cada uno, e Hymenolepis nana, 18,18
%. Con la coloracin de Gram-cromtropo, 17
muestras evidenciaron esporas del filo Microspora,
lo que equivale a 33,33 % de prevalencia. Mediante
PCR las especies de microsporidios presentaron
36 % de prevalencia, y 10 pacientes presentaron
E. intestinalis, 4 E. bieneusi y 4 ambas especies.
Veinticuatro individuos presentaron conteos de
CD
4
dentro de los valores normales, mientras que
en 23 fueron menores de 200 clulas por mm
3

y en muchos de ellos se demostr infeccin por
microsporidios.
Conclusiones. Se determin una relacin
inversamente proporcional y estadsticamente
significativa entre el conteo de CD
4
y la presencia
de microsporidios en la muestra fecal.
Estandarizacin de un mtodo de
deteccin en agua de quistes de
Giardia spp., Blastocystis spp. y
ooquistes de Crypstosporidum spp.
Fabiana Mara Lora-Surez, Ral Eduardo Rivera, Jhon
Edward Garca, Jorge Enrique Gmez-Marn
Lnea de Giardiasis y Parsitos Intestinales, Grupo
de Estudio en Parasitologa y Micologa Molecular,
Centro de Investigaciones Biomdicas, Universidad del
Quindo, Armenia, Colombia
Introduccin. En Colombia, la Resolucin 2115 de
2007, en el captulo 3, establece la obligacin de las
empresas de agua potable a realizar la deteccin
en agua de Giardia spp. y Cryptosporidium spp., y
a efectuar mapas epidemiolgicos de riesgo para
estos parsitos y otros protozoos. Los mtodos
estndar para la deteccin son bastante costosos
y pueden llevar a encarecer los procesos de
control y tratamiento del agua, lo que puede llevar
al aumento de los costos de los servicios pblicos.
Objetivo. Desarrollar mtodos de control y vigilancia
de estos protozoos, eficientes y menos costosos,
incluyendo algunos que son de importancia en
las parasitosis intestinales, como es el caso de
Blastocystis spp.
Materiales y mtodos. Se evaluaron los mtodos
de deteccin para la concentracin de formas
parasitarias utilizando sales y precipitacin. Para
ello, a 20 litros de agua pura se les aadieron
formas parasitarias y se determin la sensibilidad
y la reproducibilidad del mtodo. Esta tcnica se
valid luego en el campo, tomando 50 muestras
de 20 L de agua por estacin en estaciones

Biomdica 2011;31(sup.3):23-205
185
XV Congreso Colombiano de Parasitologa y Medicina Tropical
ubicadas antes de la planta de tratamiento de
agua potable, durante y despus de ella; se
precipitaron por centrifugacin y se concentraron,
luego se observaron por microscopio ptico y por
inmunofluorescencia.
Resultados. La prueba tuvo una recuperacin
entre el 80 y el 90 %. En las muestras de campo,
en la planta y en la red de distribucin se encontr
Crypstosporidium spp., Giardia spp. y Blastocystis
spp. La forma parasitaria ms frecuente fue
Blastocystis spp., seguido de Giardia spp., y el
menos frecuente fue Crypstosporidium spp.
Conclusin. Se ha desarrollado un mtodo
eficiente, de bajo costo, para la deteccin de
protozoos. Este mtodo pudo ser aplicado con
xito en muestras de una planta de tratamiento y
de su red de distribucin.
Prevalencia de parasitosis intestinales
y factores de riesgo asociados en
escolares y adolescentes del Colegio
Chicamocha, seccin Kennedy I, del
municipio de Tuta, Boyac
Ivn Prez, Andrea Castaeda, Alexander Moreno, Fred
Manrique, Sandra Suescn-Carrero
Programa de Medicina, Facultad de Ciencias de la
salud, Universidad de Boyac, Tunja, Colombia
Introduccin. La prevalencia de la parasitosis
intestinales en Colombia, principalmente en
las reas rural y urbana marginal, ha sido
tradicionalmente alta debido a que las condiciones
socioeconmicas y sanitarias son deficientes.
El objetivo del estudio fue determinar la prevalencia
de parasitosis intestinales en escolares y
adolescentes del Colegio Chicamocha, seccin
Kennedy I, del municipio de Tuta, Boyac, e
identificar los factores de riesgo asociados
Materiales y mtodos. Se realiz un estudio de
corte transversal en 50 escolares y adolescentes
de 7 a 12 aos de edad, pertenecientes al 30
% de la poblacin. Se evalu la presencia de
parsitos intestinales de un examen coprolgico
directo y de la tcnica de concentracin de Ritchie
o centrifugacin con formol-ter, y de los factores
de riesgo asociados mediante una encuesta
estructurada, en la que se incluan aspectos
generales, de la vivienda, socioeconmicos,
biolgicos, de comportamiento y ambientales. El
procesamiento y anlisis estadstico se realiz
con el programa SPSS, versin 11.5 (SPSS Inc.
Chicago, USA). Se calcularon tablas de frecuencias
para las variables nominales.
Resultados. La prevalencia de parasitosis fue
de 96 %. Los parsitos ms frecuentes fueron
Blastocystis hominis (88 %), Giardia intestinalis (34
%), Entamoeba coli (56 %) y el complejo Entamoeba
histolica/dispar (24 %). La poliparasitosis fue muy
importante (84 %), y se encontraron hasta cuatro
especies por husped. El 54 % eran nias, de
predomino rural (n=27). El 72 % de la poblacin
tena mascotas en la casa. En general, las
condiciones de vivienda e higinicas eran buenas.
Conclusiones. Este estudio demuestra una alta
prevalencia de B. hominis en la poblacin con buen
acceso a servicios pblicos. Es necesario hacer
nfasis en los programas de control de zoonosis y
en la desparasitacin de las mascotas.
Control de transcripcin del gen de
la glucosamina-6-fosfato isomerasa
durante el enquistamiento de
Entamoeba histolytica
Jos Hugo Aguilar, Juan Pedro Laclette, Julio Csar
Carrero
Departamento de Inmunologa, Instituto de
Investigaciones Biomdicas, Universidad Nacional
Autnoma de Mxico, Mxico, D.F., Mxico
Introduccin. Entamoeba histolytica posee dos
estadios: el trofozoto y el quiste. El quiste, la forma
infectiva, es tetranucleado y es responsable de la
transmisin de la infeccin. Actualmente no existen
reportes de la obtencin de quistes maduros
de E. histolytica, ni los estmulos y mecanismos
implicados en el proceso de enquistamiento.
Recientemente, nuestro grupo describi un
protocolo para inducir enquistamiento in vitro de E.
histolytica, mediante el uso de estrs por oxidacin
(H
2
O
2
) y de algunos dicationes metlicos utilizados
como cofactores. Estos ensayos resultan en la
formacin de estructuras tipo quiste que presentan
caractersticas similares a las de un quiste maduro.
Asimismo, observamos un aumento de la expresin
de la glucosamina-6-fosfato isomerasa (Gln6Pi),
enzima clave en la ruta metablica del quiste en
otros protozoarios intestinales.
Con base en esto, el presente trabajo pretendi
abordar el papel de la Gln6Pi durante el proceso
de la formacin de estructuras tipo quiste de E.
histolytica.
Materiales y mtodos. Se hizo anlisis in silico de
la secuencia del gen de la Gln6Pi para el diseo
y la sntesis de siRNA. Hubo incorporacin de
los siRNA en trofozotos por medio de soaking,
y siembra en medio de cultivo TYIS33. La
induccin del enquistamiento se logr por medio


Biomdica 2011;31(sup.3):23-205
186
XX Congreso Latinoamericano de Parasitologa
de estrs de oxidacin. Se hizo extraccin de
ARN y de las protenas totales para la evaluacin
del silenciamiento (RT-PCR y Western blot,
respectivamente). La evaluacin fenotpica se hizo
por medio de microscopa y tincin con calcoflor
blanco.
Resultados. El silenciamiento del gen de la Gln6Pi
con el uso de siRNA, mostr una disminucin de la
expresin del ARNm y de la protena, que result
en el bloque de la formacin de la pared y por
tanto en la obtencin de estructuras tipo quiste
durante el enquistamiento.
Conclusiones. Los ensayos de silenciamiento de
gen de la Gln6Pi demostraron la participacin de la
enzima durante la formacin de la pared del quiste,
sugiriendo ser la limitante durante el proceso de
enquistamiento.
Confirmacin de la expresin
de Ubp6, candidata a enzima
desubicuitinadora en trofozotos de
Giardia intestinalis
Luisa Prada, Moiss Wasserman
Laboratorio de Investigaciones Bsicas en Bioqumica,
Universidad Nacional de Colombia, Bogot, D.C.,
Colombia
Introduccin. La marcacin de protenas con
ubicuitina puede generar su degradacin por
parte del proteosoma o su participacin en una
gran variedad de eventos celulares. Un grupo de
enzimas clave en la homeostasis de la ubicuitina
son las enzimas desubicuitinadoras; sobre estas
enzimas existen an muchos interrogantes de su
funcin y blancos de accin. En estudios previos
de nuestro grupo se ha reportado que el sistema
de ubicuitinacin es de gran importancia a lo largo
del ciclo de vida de Giardia intestinalis; utilizando
herramientas bioinformticas hemos identificado
candidatos de enzimas desubicuitinadoras,
entre las cuales se encuentra una secuencia
ortloga a Ubp6 en levadura, la cual se asocia al
proteosoma.
El objetivo del este estudio fue comprobar la
expresin de Ubp6 y determinar su localizacin en
trofozotos de G. intestinalis.
Materiales y mtodos. Mediante RT-PCR se
verific la expresin del gen Ubp6, en trofozotos
del parsito. El ORF de la enzima fue clonado en un
vector de expresin especfico para G. intestinales:
pTubHApac. El plsmido recombinante se utiliz
para transfectar parsitos, los cuales fueron
seleccionados por su resistencia a la puromicina. El
aumento de la expresin de la enzima fue verificada
mediante Western blot e inmunofluorescencia.
Resultados. Los experimentos de RT-PCR mostra-
ron que la candidata a enzima desubicuitinadora,
Ubp6, en G. intestinalis s se est expresando en el
estadio de trofozotos del parsito. La transfeccin
de los parsitos con el vector de expresin
permiti su aumento de expresin, la cual pudo ser
confirmada mediante Western blot.
Conclusiones. Este trabajo valida los resultados
de bioinformtica obtenidos por nuestro grupo de
investigacin ya que se pudo verificar la expresin
de la protena ortloga a Ubp6 en trofozotos de G.
intestinales.
Enzimas de la ruta de sntesis de
isoprenoides en Giardia intestinalis
Mara Anglica Caldern, Paula C. Hernndez,
Jacqueline Chaparro-Olaya
Laboratorio de Parasitologa Molecular, Universidad El
Bosque, Bogot, D.C., Colombia
Introduccin. Giardia intestinalis es un parsito
entrico que causa la enfermedad diarreica
llamada giardiasis. Este parsito sufre cambios
morfolgicos y bioqumicos que le permiten
sobrevivir en condiciones extremas, uno de ellos
es el enquistamiento. Se sabe que uno de los
factores necesarios para que este proceso ocurra
es la falta de colesterol en el medio en el que el
parsito se encuentra. Aunque se cree que Giardia
spp. no puede sintetizar colesterol de novo, se
ha demostrado la existencia de varios genes que
codifican para algunas enzimas que hacen parte de
la ruta de sntesis por medio de la cual el parsito
podra sintetizar colesterol.
En este trabajo verificamos la existencia y expresin
de seis de ellos en el estadio de trofozoto y en
parsitos sometidos al proceso de enquistamiento
in vitro.
Materiales y mtodos. Se realiz un trabajo
de bioinformtica en el que se analizaron las
secuencias de las protenas codificadas por los
genes de las enzimas fosfomevalonato cinasa,
preniltransferasa, isopentenil difosfato isomerasa,
farnesil difosfato sintasa y difosfomevalonato
decarboxilasa. Se disearon iniciadores para
amplificar estos genes por PCR sobre ADN de
trofozotos de Giardia spp. Los trofozotos se
sometieron al proceso de enquistamiento in vitro
y se analizaron los mismos genes por medio de
un RT-PCR sobre ARN de parsitos que formaron
quistes en diferentes perodos.


Biomdica 2011;31(sup.3):23-205
187
XV Congreso Colombiano de Parasitologa y Medicina Tropical
Resultados. Por medio de las tcnicas de PCR y
RT-PCR se encontr que los genes de las enzimas
fosfomevalonato cinasa, preniltransferasa, isopen-
tenil difosfato isomerasa, farnesil difosfato sintasa
y difosfomevalonato decarboxilasa se encuentran
presentes en el genoma del parsito y que sus
mensajeros se expresan en los trofozotos de Giardia
spp. y durante el proceso de enquistamiento.
Conclusiones. Estos resultados sugieren que
el parsito tiene las herramientas moleculares
para llevar a cabo la sntesis de farnesil difosfato,
molcula precursora de esteroles, dolicoles,
protenas preniladas y ubicuinona.
Expresin de la calmodulina durante la
diferenciacin de Giardia intestinalis e
identificacin de protenas de unin a
calmodulina
Magda E. Alvarado, Moiss Wasserman
Laboratorio de Investigaciones Bsicas en Bioqumica,
Universidad Nacional de Colombia, Bogot, D.C.,
Colombia
Introduccin. Los mecanismos que controlan los
procesos de diferenciacin (el paso de la forma
infectiva a la de replicacin, y viceversa) de Giardia
intestinalis se desconocen en gran medida. En
las clulas eucariontes, la protena calmodulina
regula importantes hechos entre los que se pueden
mencionar la diferenciacin, movilidad y metabolismo
de segundos mensajeros, entre otros.
El objetivo de este trabajo fue determinar si
haba cambios en la expresin y localizacin de
la calmodulina durante la diferenciacin de G.
intestinalis e identificar algunos de sus blancos que
se desconocen por completo en este parsito.
Materiales y mtodos. Para obtener clulas del
ciclo de vida completo se realizaron experimentos
de desenquistamiento y enquistamiento. Se
expres el gen de la calmodulina como una protena
recombinante que se utiliz para desarrollar un
anticuerpo especfico. Se evalu la expresin de
la calmodulina endgena por Western blot y la
localizacin celular por inmunofluoresencia. La
protena recombinante permiti aislar protenas
de unin a la calmodulina en experimentos de pull
down. Estas protenas fueron identificadas por
espectrometra de masas.
Resultados. Los experimentos de Western blot
indican que la calmodulina se expresa de forma
constitutiva durante la diferenciacin del parsito y
la inmunofluoresencia muestra que, posiblemente,
est involucrada en la movilidad del parsito. En
ensayos de pull down aislamos protenas que
se unen especficamente a la calmodulina de
una forma dependiente de calcio. Tres de ellas
fueron identificadas son GASP180, alfa-tubulina
y la piruvato fosfato dicinasa; las dos primeras
son protenas del citoesqueleto y la ltima es una
enzima de la gluclisis.
Conclusiones. Este es el primer reporte sobre
protenas de unin a la calmodulina en G. intestinalis
que es considerado un modelo de diferenciacin
muy interesante, y que indica que la calmodulina
est implicada en dos procesos vitales, la movilidad
y el metabolismo energtico.
La inmunizacin con baculovirus
recombinantes administrados por
mucosa confiere proteccin contra la
amibiasis heptica en el hmster.
D. M. Meneses-Ruiz
1
, H. Aguilar-Daz
1
, A. Luz-
Madrigal
2
, J. Hernndez-Ruiz
3
, M. Nequiz
3
, L. Vaca
2
, J.
P. Laclette
1
, J. C. Carrero
1
1
Departamento de Inmunologa, Instituto de
Investigaciones Biomdicas, Facultad de Medicina,
Universidad Nacional Autnoma de Mxico, Mxico,
D.F., Mxico
2
Departamento de Biologa Celular, Instituto de
Fisiologa Celular, Facultad de Medicina, Universidad
Nacional Autnoma de Mxico, Mxico, D.F., Mxico
3
Departamento de Medicina Experimental, Facultad de
Medicina, Universidad Nacional Autnoma de Mxico,
Mxico, D.F., Mxico
Introduccin. Entamoeba histolytica es el parsito
causante de disentera y absceso heptico
amebiano en humanos y ocasiona a nivel mundial
de 40 a 100 mil muertes anualmente. Los reportes
previos demuestran que una respuesta inmune
contra LC3 (un fragmento de la lectina de E.
histolytica de adherencia a las mucosas) es capaz
de conferir proteccin ante el reto de amebiasis
experimental. Por otra parte, se ha propuesto
recientemente al baculovirus AcNPV como un
novedoso vector para vacunas.
El objetivo de este trabajo fue determinar el grado
de proteccin conferida por la inmunizacin
en mucosa con baculovirus recombinantes en
el modelo experimental de absceso heptico
amebiano.
Materiales y mtodos. Se obtuvieron baculovirus
recombinantes AcNPV-LC3 clonando el gen de
LC3 bajo el control del promotor CMV en el vector
BacBlueCMV y por recombinacin homloga
con ADN de AcNPV en clulas de insecto. Se
caracterizaron por PCR, secuenciacin y Western


Biomdica 2011;31(sup.3):23-205
188
XX Congreso Latinoamericano de Parasitologa
blot. Se inmunizaron hmsteres por va oral y
nasal con 1 x 10
8
partculas virales de AcNPV-LC3
y AcNPV-WT; se retaron con 1 x 10
6
trofozotos
de E. histolytica en la vena porta y se evalu la
proteccin a los 7 das. Se determin la respuesta
inmunitaria especfica de antgenos mediante
ELISA y proliferacin celular. La estadstica para
evaluar proteccin y la respuesta inmune se
realiz utilizando pruebas de Fisher y ANOVA,
respectivamente. Los parmetros bioqumicos se
evaluaron en suero para determinar el grado de
afeccin heptica.
Resultados. Los datos de tres experimentos
indicaron que la inmunizacin oral con AcNPV-LC3
confiri proteccin estril con respecto a su control
(p<0,05) y que la respuesta inmune asociada
a sta, est dada por una respuesta humoral y
celular especfica de antgenos. Las pruebas de
funcin heptica mostraron correlacin con el dao
observado en animales sin proteccin.
Conclusiones. La inmunizacin de hmsteres con
AcNPV-LC3 es capaz de despertar una respuesta
humoral y celular especfica de antgeno, que
confiere proteccin ante el reto en absceso heptico
amebiano.
Estandarizacin de la tcnica de
PCR-RFLP para la identificacin de
subtipos de Blastocystis spp. a partir
de aislamientos humanos
Gloria D. Muoz, Diana C. Bucur, Ral E. Rivera,
Fabiana M. Lora, Jorge E. Gmez-Marn
Grupo de Estudio en Parasitologa Molecular,
Centro de Investigaciones Biomdicas, Universidad
del Quindo, Armenia, Colombia
Introduccin. Blastocystis spp. es un parasito
intestinal que posee una alta prevalencia y es
causante de una parasitosis intestinal inespecfica
pero poco se conoce sobre su papel como
patgeno primario y se ha sugerido una relacin
entre los subtipos con los sntomas presentados
por pacientes.
El objetivo de este trabajo fue estandarizar la tcnica
de PCR-RFLP para la identificacin de subtipos de
Blastocystis spp. de aislamientos humanos.
Metodologa. Una muestra fecal de un paciente con
diarrea que fue positivo para Blastocystis spp. en
el examen coprolgico, se cultiv en 10 % de suero
equino, 0,05 % L-asparagina y solucin de lactato
de Ringer, a 37 C con 5 % de CO
2
; posteriormente,
se utilizaron tres protocolos de extraccin de ADN,
uno enzimtico, DNAzol y el Wizard Genomic. Se
realiz una PCR utilizando los cebadores RD3(5`-
GGGATCCTGATCCTTCCGCAGGTTCACCTAC
3) y RD5 (5`- GGAAGCTTATCTGGTTGATCCTGCC
AGTA 3`) para la amplificacin del gen 18s de la
subunidad de ARN ribosmica de Blastocystis spp.
La identificacin de los subtipos se hizo mediante
RFLP utilizando dos enzimas de restriccin, RsaI y
Sau3A, segn los subtipos establecidos por Clark
en 1997.
Resultados. Se logr el cultivo de Blastocystis spp.
en el cual se observaron formas vacuolares, del cual
se realiz la extraccin del ADN. Posteriormente,
por PCR se obtuvo un amplificado de 1.800 pb
y, segn los patrones generados por el corte con
las enzimas Rsa I y Sau3A I, concuerdan con el
subtipo 1 segn lo propuesto por Clark en 1997.
Conclusiones. Se logr establecer para la lnea de
investigacin en parsitos intestinales un cultivo de
Blastocystis spp., subtipo I, y las condiciones para la
identificacin de los dems subtipos del parsito que
permitirn el desarrollo de investigaciones futuras.
Utilidad de la PCR frente a los mtodos
parasitolgicos convencionales en
el diagnstico de la infeccin por
Blastocystis spp.
M. V. Domnguez
1
, M. T. Gmez-Muoz
2
, R. Borrs
3
1
Servicio de Microbiologa, Hospital General,
Castelln, Espaa
2
Departamento de Sanidad Animal, Facultad de
Veterinaria, Madrid, Espaa
3
Departamento de Microbiologa, Facultad de Medicina
y Hospital Clnico Universitario, Valencia, Espaa
Introduccin. Blastocystis spp. son organismos,
incluidos en el reino Chromista, parsitos
intestinales del hombre y de varios animales, tanto
homeotermos como poiquilotermos. Blastocystis
spp. incluye 13 subtipos genticos, nueve de
ellos encontrados en humanos y animales. Es el
organismo ms frecuentemente observado en las
heces humanas y su relevancia clnica, motivo de
controversia. Aunque, los estudios recientes sealan
el probable poder patgeno para el hombre de los
subtipos 1, 4 y 7, el diagnstico de la blastocistosis
se basa en la observacin microscpica de prepa-
raciones fecales en fresco o de frotis teidos. Sin
embargo, existen publicaciones que describen
una mayor sensibilidad y especificidad de otros
procedimientos, como las tcnicas de amplificacin
genmica (PCR).
El objetivo de este estudio fue valorar la eficacia
diagnstica de la PCR frente a la observacin
microscpica.


Biomdica 2011;31(sup.3):23-205
189
XV Congreso Colombiano de Parasitologa y Medicina Tropical
Material y mtodos. Con las heces de 395
cerdos, diluidas con PBS (1:4 p/v) y filtradas a
travs de dos gasas, se prepararon alcuotas que
se conservaron con SAF o se congelaron para
estudio microscpico tras concentracin con ter
etlico y PCR, respectivamente. El ADN genmico
extrado (QiAmp1, DNA Stool Mini Kit; QIAGEN,
Valencia, CA) fue amplificado con los iniciadores
R1 y F1.
Resultados. La microscopa fue positiva en 41 %
de los casos frente a la PCR que lo fue en 44,6 %
(amplicn de 1.050 pb). La prevalencia global fue
de 184 casos (46,6 %), de los cuales 22 (12 %) y 8
(4,3 %) fueron exclusivamente diagnosticados por
PCR y microscopa, respectivamente. El anlisis
estadstico demuestra una buena concordancia
(92,4 %) y una fuerte correlacin (kappa=0,845)
entre ambos mtodos. Aunque, la PCR segn los
coeficientes de probabilidad, es ms eficaz para
confirmar la ausencia de infeccin.
Conclusiones. La concordancia entre ambos
procedimientos y la ausencia de mtodos molecu-
lares normalizados, aconsejan el mantenimiento
de la microscopa como mtodo diagnstico de
eleccin.
Induccin y transduccin en el
enquistamiento de Giardia duodenalis:
del estmulo a la expresin gnica
temprana
Ral Argello-Garca, Aurora Cleotilde Cervantes-Tovar,
Mara Luisa Bazn-Tejeda, Guadalupe Ortega-Pierres
Departamento de Gentica y Biologa Molecular, Centro
de Investigacin y de Estudios Avanzados, Instituto
Politcnico Nacional, Mxico, D.F., Mxico
Introduccin. La transformacin trofozoto-quiste
(enquistamiento) es una respuesta del protozoario
Giardia duodenalis modulada por colesterol y
sales biliares miceliares extracelulares. Su fase
inductiva comprende desde la transduccin del
estmulo, mediada por cascadas de sealizacin
implicando probablemente las cinasas ERK, hasta
la expresin de genes como las protenas de pared
qustica (CWP1-3).
En este trabajo se propuso determinar la duracin
de esta fase inductiva y si la ruta de sealizacin
intracelular involucraba la cinasa C de protenas
(gPKC) y enzimas tipo MAP cinasas, como Raf y
MEK, posiblemente acopladas a ERK.
Materiales y mtodos. El enquistamiento de
G. duodenalis se indujo por varios perodos en
medio TYI-S-33 que contena bilis bovina (5
mg/ml) a pH 7,8 en ausencia o en presencia de
inhibidores especficos para gPKC (hispidina),
MEK (PD920548) y Raf (GW50), entre otros. La
expresin de ARNm de los genes genes cwp1
(prueba) y ubicuitina (control constitutivo) se
analiz por RT-PCR. La citolocalizacin de la
gPKC, la fosforilacin de ERK1-2 y la probable
interaccin entre estas dos cinasas se evalu
mediante inmunofluorescencia, Western blot y
coinmunoprecipitacin, respectivamente.
Resultados. El aumento de la expresin de
ARNm del gene cwp1 fue significativa a partir
de los 20 minutos posteriores a la induccin del
enquistamiento, perodo en el que tambin la
gPKC present translocacin del citosol a la
membrana plasmtica y sta se revirti hacia las 2
horas, tiempo que concord con la desfosforilacin
progresiva de ERK1 y no de ERK2. Los
inhibidores de gPKC, Raf y MEK inhibieron de
forma significativa y dependiente de la dosis el
enquistamiento del parsito. En estos perodos
tambin se observ la coprecipitacin con gPKC
de una molcula con PM similar a ERK1.
Conclusiones. La transduccin del estmulo
inductor del enquistamiento de G. duodenalis
se efecta en un tiempo relativamente corto,
involucrando, posiblemente, un eje de sealizacin
gPKC-Raf1-MEK1-ERK1 que permite el amento
de la expresin de las las protenas de pared
qustica.
Mecanismos adaptativos y efectores
en la resistencia a albendazol in vitro
en Giardia duodenalis
Ral Argello-Garca
1
, Luz Mara Teresita Paz-
Maldonado
1
, Claudia Cervantes
1
, Maricela Cruz-Soto
1
,
Guillermo Mendoza
2
, Guadalupe Ortega-Pierres
1
1
Departamento de Gentica y Biologa Molecular,
Centro de Investigacin y de Estudios Avanzados,
Instituto Politcnico Nacional, Mxico, D.F., Mxico
2
Departamento de Bioqumica, Facultad de Medicina,
Universidad Nacional Autnoma de Mxico, Mxico,
D.F., Mxico
Introduccin. El albendazol es frecuentemente
prescrito contra la giardiasis aunque en campaas
de desparasitacin su administracin es
subptima, As, la resistencia al albendazol es un
problema creciente cuyas bases moleculares son
desconocidas. Este frmaco se une a la -tubulina
y puede afectar el manejo de la glucosa por el
parsito.
En este trabajo se analizaron clonas de G.
duodenalis resistentes a 1,35, 8 y 250 M de


Biomdica 2011;31(sup.3):23-205
190
XX Congreso Latinoamericano de Parasitologa
albendazol para determinar si la resistencia
implicaba una adaptacin en la utilizacin de
la glucosa, produccin de ATP y capacidad de
adhesin, as como participacin de mutaciones
en la -tubulina o metabolizacin diferencial
del albendazol al sulfxido (ABzSO) y sulfona
(AbzSOO) y los mecanismos efectores asociados.
Materiales y mtodos. Se secuenci el gene
-tubulina de cultivos sensibles y resistentes al
albendazol. La metabolizacin del frmaco se
determin por cromatografa de lquidos (HPLC).
Mediante anlisis protemicos se identificaron
molculas diferencialmente expresadas entre los
cultivos, con anlisis de expresin de los ARNm
correspondientes por RT-PCR. Se compar la
capacidad de crecimiento y de adhesin a clulas
epiteliales in vitro con glucosa o sin ella, as como
la produccin de ATP por luminometra.
Resultados. El gen -tubulina present secuencias
similares en cultivos sensibles y resistentes al
albendazol; pero la acumulacin de AbzSO y
AbzSOO fue menor en las clonas resistentes. Se
identificaron enzimas antioxidantes (NADH oxidasa,
tiorredoxina peroxidasa y flavodiferroprotena)
que fueron expresadas en exceso en las clonas
resistentes, las mismas que mostraron mayores
niveles de tioles intracelulares. La produccin de
ATP y la capacidad de adhesin fue menor en las
clonas resistentes, aunque la necesidad de glucosa
en el crecimiento fue similar.
Conclusiones. La resistencia al albendazol en G.
duodenalis presenta como mecanismos adaptativos
una menor eficiencia energtica asociada a una
menor capacidad de adhesin, y como mecanismo
efector, una respuesta antioxidante generalizada
ante el estrs por oxidacin generado por el
albendazol.
Caracterizacin molecular y
genotipificacin de cepas de
Trypanosoma rangeli aisladas de
los vectores Rhodnius pallescens,
Rhodnius colombiensis y Rhodnius
ecuadoriensis y los reservorios
Tylomis mirae y Bradypus variegatus
Simn L. Gamboa
1
, Daniel A. Urrea
1
, Gustavo A.
Vallejo
1
, Marta M. Teixeira
2
, Julio C. Carranza
1
1
Universidad del Tolima, Ibagu, Colombia
2
Universidade de So Paulo, So Paulo, Brasil
Introduccin. Los marcadores moleculares
mitocondriales (kDNA) y nucleares (SSUrDNA)
han indicado una amplia variabilidad gentica
en los aislamientos de Trypanosoma rangeli,
sugiriendo su segregacin en dos subpoblaciones
[KP1(+) y KP1(-)] o en cinco linajes (TrA-TrE),
respectivamente.
Es importante establecer la paridad entre ambos
marcadores para definir la estructura de la poblacin
del parsito y su relacin con los insectos vectores;
no obstante, los perfiles moleculares de SSUrDNA
de aislamientos de T. rangeli provenientes de
Rhodnius colombiensis y R. ecuadoriensis son
desconocidos. Adems, se encontraron nuevos
aislamientos del parsito en los huspedes silvestres
Tylomis mirae y Bradypus variegatus originarios del
Pacfico colombiano, siendo epidemiolgicamente
importante caracterizar estas cepas de acuerdo
con ambos marcadores moleculares.
Materiales y mtodos. Se obtuvieron aislamientos
de T. rangeli de R. colombiensis, R. ecuadoriensis,
B. variegatus y T. mirae naturalmente infectados.
Las cepas se mantuvieron en medio bifsico NNN/
LIT-SFB y se caracterizaron posteriormente con
los iniciadores S35/S36/KP1L. La definicin de los
linajes se hizo mediante PCR-RFLP de la regin V7-
V8 del SSUrDNA y anlisis filogenticos utilizando
el espaciador intergnico del gen miniexn.
Resultados. Se analizaron 25 aislamientos de
vectores y reservorios silvestres en este estudio.
La caracterizacin molecular revel que todos
ellos correspondan a la subpoblacin KP1(-) y al
linaje TrC de T. rangeli. Los anlisis filogenticos
usando el gen miniexn tambin sustentaron estos
resultados.
Conclusiones. Trypanosoma rangeli del linaje
TrC haba sido reportado nicamente en R.
pallescens y en humanos. Los resultados de este
trabajo confirman su presencia en otros vectores
y reservorios silvestres. Tambin corroboran la
homogeneidad gentica entre los aislamientos de
R. pallescens, R. colombiensis y R. ecuadoriensis,
los cuales parecen pertenecer a una misma lnea
evolutiva de vectores (linaje transandino). Adems,
es posible sugerir la presencia de R. pallescens
o R. colombiensis como vectores naturales de la
regin donde fueron encontrados los huspedes
silvestres analizados en este estudio.
Genotipificacin de Giardia duodenalis
mediante PCR-RFLP a partir de quistes
obtenidos de humanos y perros de
Ibagu, Tolima
Victoria Rodrguez
1,2
, Oneida Espinosa
1
, Julio Cesar
Carranza
1
, Sofa Duque
3
, Adriana Arvalo
3
, Gustavo
Adolfo Vallejo
1


Biomdica 2011;31(sup.3):23-205
191
XV Congreso Colombiano de Parasitologa y Medicina Tropical
1
Laboratorio de Investigaciones en Parasitologa
Tropical, Departamento de Biologa, Facultad de
Ciencias, Universidad del Tolima, Ibagu, Colombia
2
Facultad de Medicina Veterinaria, Universidad del
Tolima, Ibagu, Colombia
3
Laboratorio de Parasitologa, Instituto Nacional de
Salud, Bogot, D.C., Colombia
Introduccin. Giardia duodenalis es el agente
etiolgico de la giardiasis, enfermedad diarreica que
afecta humanos y un amplio rango de mamferos;
esta especie presenta una alta diversidad gentica
por lo que ha sido dividida en siete genotipos
(A-G), de los cuales, A y B han sido detectados
en humanos y otros animales, mientras que los
genotipos C a G presentan mayor especificidad de
husped.
En este estudio genotipificamos quistes de G.
duodenalis obtenidos de muestras fecales de
humanos y perros de Ibagu mediante PCR-
RFLP de los genes de -giardina y glutamato
deshidrogenasa (GDH) con el fin de dilucidar el
papel zoontico de algunos genotipos en los ciclos
de transmisin de este protozoario.
Materiales y mtodos. Las muestras fueron
sometidas a anlisis coproparasitolgico; las
positivas para G. duodenalis fueron sometidas a
concentracin de quistes por el mtodo de flotacin
de Faust, extraccin de cidos nucleicos y PCR-
RFLP utilizando iniciadores especficos para la
amplificacin de los genes de -giardina y GDH.
El control positivo fue la cepa MHOM/CO/04/G40
cedida por el Instituto Nacional de Salud.
Resultados. Se determin la prevalencia de G.
duodenalis en los humanos (11,78 %), as como en
los perros (14,28 %). Se genotipificaron 23 muestras
de origen humano, de las cuales, 11 (47,82 %)
correspondieron con el genotipo A, subgrupo A2/
A3, y 12 (52,17 %) con el genotipo B, subgrupos
BIII, BIV y mezclas BIII-BIV. Se genotipificaron
cuatro muestras de perros y se encontraron los
genotipos C (50 %) y D (50 %).
Conclusiones. Segn los genotipos de G.
duodenalis encontrados en las muestras
analizadas, no se evidenci interaccin entre los
ciclos de transmisin del humano y del perro, lo que
permite establecer que los huspedes estudiados
no presentaron infecciones zoonticas durante el
tiempo de estudio.