Está en la página 1de 11

EJERCICIOS DE BIOLOGA CIENCIAS AMBIENTALES 2009-10 PRIMER CUATRIMESTRE

Ejercicios de Biologa Ciencias Ambientales 2009/2010

INTRODUCCIN
El estudio de los seres vivos es competencia de la biologa, buscando comprender el ser vivo en su conjunto as como las interacciones que tiene con el medio y con otros organismos vivos que dan lugar a un ecosistema. Para poder realizar su labor, ha de emplear una gran diversidad de tcnicas y mtodos que permitan analizar cmo es el organismo y cmo se producen los distintos procesos que dan lugar a la vida tal y como hoy la conocemos. La asignatura de Biologa de la licenciatura de Ciencias Ambientales incluye crditos prcticos que se han dividido en prcticas presenciales de laboratorio, a realizar en los Centros Asociados, y ejercicios. Mientras en las prcticas presenciales el alumno inicia el contacto con el trabajo experimental, la obtencin y el anlisis de resultados, el objetivo de estos ejercicios es proporcionar al alumno una visin complementaria sobre fenmenos de larga duracin que hacen imposible su realizacin en unas prcticas presenciales. El objetivo que se persigue es ofrecer una perspectiva ms amplia de los distintos aspectos que estudia la biologa y acercarse a los problemas y las tcnicas ms comunes en el laboratorio.

EJERCICIO 1
Anlisis del ADN
Los objetivos de este ejercicio son: - familiarizarse con el uso del cdigo gentico para obtener la secuencia de una protena a partir de un gen - analizar como una misma secuencia de ADN puede dar distintos pptidos segn el marco de lectura que se emplee - comprobar los efectos de los distintos tipos de mutaciones puntuales sobre una secuencia gnica Al secuenciar un ADN, este puede corresponder a una secuencia codificante o no codificante. Por ello, uno de los primeros pasos para analizar una secuencia y su posible inters es estudiar si presenta un marco de lectura que pueda dar lugar a una protena. Toda secuencia presenta tres marcos de lectura, ya que segn el nucletido que se escoja para iniciar la cuenta de codones se pueden leer unos tripletes u otros. Por lo tanto, el primer paso es obtener los tres marcos de lectura posibles y decidir cul de ellos es el ms probable que se utilicepara dar lugar a la protena. La presencia de varios tripletes correspondientes a codones STOP en una secuencia indica que, probablemente, ese marco de lectura no sea el que se emplea para la traduccin. 1.- En este primer ejercicio se proporciona una secuencia de ADN que el alumno va a emplear para determinar los tres marcos posibles de lectura u ORF (de su nombre en ingls, Open Reading Frames), segn considere el primer, segundo o tercer nucletido de la secuencia como la base inicial del comienzo de la lectura, que podran dar lugar a tres posibles pptidos tericos. SECUENCIA DE ADN 5TACCTTTATTCTGTGAATAGAACGAAAAACATACATACAAGATGCCAGAAGAAGCAGAGACC TTTGCATTCCAGGCTGAGATTGCTCAGCTGATGTCCCTGATCATCAAC3 SECUENCIA DE ADN DE LOS TRES POSIBLES MARCOS DE LECTURA ORF1:

ORF2:

ORF3:

Ejercicios de Biologa Ciencias Ambientales 2009/2010 2.- Al estudiar una secuencia de ADN debemos tener en cuenta en qu zona del gen nos encontramos. Si sabemos que la secuencia que estudiamos se encuentra al inicio del gen, debemos buscar un codn de iniciacin. Si nos encontramos en la zona media del gen, entonces no deben aparecer codones STOP pero si es posible que haya codones de inicio ya que estos corresponden al aminocido metionina, que adems de en la posicin inicial puede encontrarse en otros lugares. Finalmente, si nos encontramos en la zona terminal del gen debemos prestar atencin a la aparicin de codones STOP, que indican el fin de la traduccin. La secuencia que se ha proporcionado corresponde a la zona de inicio de un gen, por lo que una vez determinados los tres marcos de lectura posible, es necesario buscar un codon de iniciacin y realizar la traduccin de la secuencia de ADN a partir del mismo. La tabla del cdigo gentico que se encuentra a continuacin es la que se emplea normalmente en los laboratorios, se indican los codones en forma de ADN (que corresponden a la hebra complementaria a la que se transcribe) permitiendo trabajar directamente con las secuencias de ADN, ya que siempre se emplean stas para describir los genes en las publicaciones. Como se puede comprobar, es equivalente a la que suele presentarse en los libros de texto, que muestra los codones en forma de ARN. Por lo tanto, el codn ATG se corresponde al codn AUG en forma de secuencia de ARN. TABLA DEL CDIGO GENTICO SEGUNDA POSICIN T C A TAT Tyr [Y] TAC Tyr [Y] TAA Ter [end] TAG Ter [end] CAT His [H] CAC His [H] CAA Gln [Q] CAG Gln [Q] AAT Asn [N] AAC Asn [N] AAA Lys [K] AAG Lys [K] GAT Asp [D] GAC Asp [D] GAA Glu [E] GAG Glu [E] G TGT Cys [C] TGC Cys [C] TGA Ter [end] TGG Trp [W] CGT Arg [R] CGC Arg [R] CGA Arg [R] CGG Arg [R] AGT Ser [S] AGC Ser [S] AGA Arg [R] AGG Arg [R] GGT Gly [G] GGC Gly [G] GGA Gly [G] GGG Gly [G] T C T A E G R C T E C R A A G T P C O A S G I C T I C A N G

TTT Phe [F] TCT Ser [S] P TTC Phe [F] TCC Ser [S] R T TTA Leu [L] TCA Ser [S] I TTG Leu [L] TCG Ser [S] M CTT Leu [L] CCT Pro [P] E R C CTC Leu [L] CCC Pro [P] CTA Leu [L] CCA Pro [P] A CTG Leu [L] CCG Pro [P] P ATT Ile [I] ACT Thr [T] O ATC Ile [I] ACC Thr [T] S A ATA Ile [I] ACA Thr [T] I ATG Met [M] ACG Thr [T] C GTT Val [V] GCT Ala [A] I GTC Val [V] GCC Ala [A] G GTA Val [V] GCA Ala [A] N GTG Val [V] GCG Ala [A]

SECUENCIA PROTEICA DESDE EL PUNTO DE INICIACIN (ATG)

3.- Observando la tabla del cdigo gentico se puede ver que existen varios aminocidos codificados por ms de un codon Qu ventajas ofrece esta redundancia? 4.- Utilizando el ORF que corresponde a la secuencia proteica proponga un ejemplo de los siguientes tipos de mutaciones sobre la secuencia de ADN: a.- Mutacin sin sentido b.- Mutacin con sentido c.- Mutacin sinnima d.- Insercin e.- Delecin 5.- Empleando el pptido obtenido en el punto 2, indique los pptidos resultantes de cada tipo de mutacin tienen algn efecto sobre la estructura de la protena? y sobre su funcin? Razone su respuesta.

Ejercicios de Biologa Ciencias Ambientales 2009/2010

EJERCICIO 2
Digestin de ADN con enzimas de restriccin
Los objetivos de este ejercicio son: - familiarizarse con el uso de las enzimas de restriccin - conocer las enzimas de restriccin y su funcin - conocer algunas de las tcnicas de laboratorio en que se emplean Las enzimas de restriccin se emplean habitualmente en los laboratorios que se dedican a la investigacin en biologa molecular y celular as como en el diagnstico y diversas aplicaciones biotecnolgicas. A menudo, se combinan con otras herramientas, como puedan ser los plsmidos, dando lugar a potentes mtodos que, hoy en da, hacen que sean imprescindibles para el desarrollo de muchos estudios de biologa molecular. 1.- En la figura se muestra un ADN lineal, que se corta con una serie de enzimas de restriccin. Indique en la tabla el tamao en pares de bases (pb) de los fragmentos de ADN que se obtienen al realizar las digestiones con las enzimas sealadas en cada caso. Los nmeros corresponden al nmero de pares de bases del ADN, siendo su tamao total de 1500 pares de bases.

a
0

c
500

d
1000

b
1500

Digestin A: Digestin B: Digestin C: Digestin D: Digestin AB:

Digestin AC: Digestin AD: Digestin BC: Digestin BD: Digestin CD:

2.- En la figura se muestra un plsmido, un ADN circular de origen procaritico, con un tamao de 4000 pares de bases. En el mismo hay cinco sitios de restriccin, que corresponden a tres enzimas (a, b y c). La presencia de cinco sitios y solo tres enzimas indica que una o ms de las enzimas pueden tener ms de un sitio de corte. En la parte derecha de la figura se muestra el resultado de una electroforesis en un gel de agarosa de los productos de las digestiones con las enzimas de restriccin. En la electroforesis se separan los fragmentos de ADN generados, como consecuencia del corte con las enzimas, en funcin de su tamao. El tamao, como se ha comentado antes, se expresa en pares de base. El gel tiene siete carriles que corresponden a: M.- este carril corresponde al marcador, consiste en una serie de fragmentos de ADN con un tamao conocido que se emplean como referencia para conocer el tamao de los fragmentos obtenidos en la digestin con las enzimas de restriccin. a.- este carril corresponde a los fragmentos de ADN obtenidos al digerir el plsmido con la enzima a. b.- este carril corresponde a los fragmentos de ADN obtenidos al digerir el plsmido con la enzima b. c.- este carril corresponde a los fragmentos de ADN obtenidos al digerir el plsmido con la enzima c. ab.- este carril corresponde a los fragmentos de ADN obtenidos al digerir el plsmido con las enzimas a y b al mismo tiempo. ac.- este carril corresponde a los fragmentos de ADN obtenidos al digerir el plsmido con las enzimas a y c al mismo tiempo. bc.- este carril corresponde a los fragmentos de ADN obtenidos al digerir el plsmido con las enzimas b y c al mismo tiempo.

Ejercicios de Biologa Ciencias Ambientales 2009/2010

M
0

ab ac bc

3500

500
5000 pb 4000 pb 3500 pb 3000 pb

3000

4000 pb
2500 1500

2500 pb

1000

2000 pb 1500 pb

1000 pb 800 pb 600 pb 400 pb

2000
200 pb

Para realizar esta parte hay que situar en la figura del plsmido las enzimas de acuerdo con los resultados de las digestiones. Es importante recordar que las digestiones pueden dar como resultado fragmentos de diferente secuencia pero de igual tamao, que en la electroforesis migrarn juntos aunque la banda resultante tendr entonces ms intensidad. 3.- Las enzimas de restriccin reconocen secuencias palindrmicas. Explique que son las secuencias palindrmicas y que ventajas ofrecen para este tipo de enzimas. 4.- Las enzimas de restriccin se emplean en tcnicas de biologa molecular y tienen su origen en la clula procariotica. Explique cual es la funcin original de este tipo de enzimas en este tipo de clula.

Ejercicios de Biologa Ciencias Ambientales 2009/2010

EJERCICIO 3
La clula eucariota: estructura y fisiologa
Los objetivos de este ejercicio son: - conocer la estructura general de la clulas - identificar los distintos orgnulos celulares - conocer la funcin de los distintos orgnulos celulares La clula es la unidad bsica que se encuentra en los eucariotas, existiendo incluso organismos que se componen nicamente de una sola clula. Su morfologa puede ser muy diversa, dependiendo generalmente del entorno en que se encuentra y la funcin que realiza, pero es posible determinar una serie de caractersticas comunes a la mayora de las clulas. En este ejercicio nos aproximaremos a la estructura bsica de la clula y analizaremos sus principales componentes. 1.- En la figura se muestra una clula eucariota. Identifique en la misma los distintos orgnulos, qu tipo de clula es? Razone su respuesta.

10 3 11

9 2 4 5 1 6 7

8
2.- Realice un cuadro donde se resuman las distintas funciones que realiza cada uno de los orgnulos sealados en la figura. 3.- La membrana plasmtica es una parte importante de la clula, describa brevemente su estructura indicando la funcin de cada uno de los elementos que la conforman. 4.- La clula se encuentra en un entorno con el que interacciona, dndose un intercambio de productos entre el interior y el exterior celular. Para poder llevar a cabo este intercambio se han desarrollado distintos tipos de transporte a travs de la membrana. Explique en qu consiste cada uno de ellos comentando cmo se producen.

Ejercicios de Biologa Ciencias Ambientales 2009/2010

EJERCICIO 4
El gen: estructura bsica en los eucariotas
Los objetivos de este ejercicio son: - familiarizarse con la estructura de un gen - identificar los elementos que participan en la transcripcin - conocer el proceso de obtencin de una protena El gen es la unidad de transcripcin bsica. Consta de varios elementos que tienen importancia tanto en el proceso de transcripcin como en el de traduccin. A pesar de que en un principio se asoci la presencia de un gen a la de un producto proteico, hoy en da se sabe que un gen da lugar a un ARN pero este no siempre se traduce por lo que existen genes cuya molcula funcional es el mismo ARN al que dan lugar. En este ejercicio nos centraremos en un gen tipo que codifica para una protena pero se ha de tener presente que existen muchas variaciones sobre este esquema bsico que originan una gran diversidad de formas de control de la transcripcin y de la traduccin. 1.- En la figura se muestra el esquema general de un gen transcrito por ARN polimerasa II. Se representan varios elementos estructurales e implicados en la transcripcin. Site cada uno de los elementos en la figura y explique brevemente qu es cada uno de ellos indicando su papel en la transcripcin.
1 2 3 4
Exn Intrn Secuencia TATA Secuencias reguladoras

5 6 7

Punto de inicio de la transcripcin Punto de fin de la transcripcin ARN polimerasa

2.- En la clula podemos encontrar diversos tipos de ARN, cules son?, qu estructura tienen?, qu funcin llevan a cabo? 3.- El ARNm sufre una serie de procesos de maduracin entre los que se encuentra el splicing, en cual se produce la eliminacin de los intrones para dar lugar al ARNm maduro. Una forma de splicing es el llamado splicing alternativo. Comente en qu consiste y la utilidad que tiene para la clula. 4.- Tras la maduracin del ARNm se produce su traduccin. Realice un dibujo del proceso de la traduccin indicando los elementos que participan en la misma.

Ejercicios de Biologa Ciencias Ambientales 2009/2010

EJERCICIO 5
Biologa celular: divisin y diferenciacin
Los objetivos de este ejercicio son: - familiarizarse con el proceso del ciclo celular - conocer las distintas fases que componen la divisin celular La clula es una entidad dinmica que puede ser por si misma un organismo completo o formar parte de un ser multicelular. En el caso de los seres unicelulares, su interaccin con el medio es directa y a la hora de reproducirse presentan diversas formas de divisin que dan lugar a las clulas hijas. En el caso de los seres multicelulares, hay un desarrollo a partir de una clula inicial que se divide dando lugar a clulas que se diferencian para formar los rganos y los sistemas que conforman el cuerpo del individuo. Adems, durante la vida del individuo existen clulas que se dividen y diferencian, regenerando o reparando diversas partes del cuerpo. 1.- En la figura se presenta un esquema bsico con nueve situaciones distintas que puede sufrir una clula a lo largo de su vida. Cada uno de los trminos mostrados en la tabla corresponde a una de esas situaciones, representadas por un nmero en el dibujo. Indique la correspondencia entre los trminos y las descripciones que se dan de acuerdo con el esquema. Transformacin Diferenciacin Senescencia Apoptosis Necrosis Fase S Fase G2 Fase G1 Mitosis La clula se especializa y cesa su divisin Arresto irreversible del crecimiento celular Muerte celular La clula se desdiferencia dividindose descontroladamente La clula se prepara para la divisin La clula replica su ADN Muerte celular programada Divisin celular La clula crece

1 2 3 4 5

9 8

Ejercicios de Biologa Ciencias Ambientales 2009/2010 2.- Un tumor se produce como resultado de la transformacin celular al producirse un desequilibrio en el control del ciclo celular que origina una divisin descontrolada. De las nueves situaciones que se presentan en la figura, cules piensa que pueden ser mecanismos celulares que impiden el progreso de la clula transformada? Razone la respuesta. 3.- La apoptosis y la necrosis son dos tipos de muerte celular. Explique brevemente las diferencias entre cada una de ellas y la utilidad de la apoptosis en un organismo multicelular durante su desarrollo. 4.- Adems de la mitosis, en los organismos pluricelulares existe otro tipo de divisin celular que permite la formacin de los gametos denominada meiosis. Realice un esquema comparativo de la mitosis y la meiosis exponiendo las diferencias y las semejanzas entre ambos tipos de divisin. Dibuje las distintas fases de la meiosis de una clula de un organismo que tiene 2n = 8 cromosomas.

Ejercicios de Biologa Ciencias Ambientales 2009/2010

EJERCICIO 6
Anlisis de la herencia de enfermedades genticas
Los objetivos de este ejercicio son: - saber como analizar los caracteres genticos - familiarizarse con el planteamiento y la resolucin de problemas de gentica - aprender la utilizacin de la nomenclatura y la forma de responder a los problemas de gentica En este ejercicio el alumno se aproxima a la herencia mendeliana de caracteres monognicos para deducir datos genticos a partir de genealogas y calcular probabilidades de herencia de caracteres tanto a nivel de genotipo como de fenotipo. Como ejemplo se va a realizar el estudio de la enfermedad conocida como fibrosis qustica en una familia. La fibrosis qustica es una enfermedad de origen gentico, de carcter monognico, determinada por un alelo recesivo autosmico. Hoy da se ha avanzado mucho en su estudio, y se disponen de numerosos datos acerca de la base gentica y molecular de esta enfermedad. El gen normal se encuentra localizado en el cromosoma 7 humano, y codifica una protena de transporte que se localiza en la membrana de las clulas e interviene en el transporte de iones cloruro. Existe un alelo recesivo que produce una protena no funcional. Cuando una persona es homocigota para este alelo manifiesta la enfermedad, caracterizada por secreciones mucosas anormalmente densas en las clulas que tapizan los pulmones, los rganos digestivos y reproductores, provocando graves trastornos de salud. Su frecuencia es alta en la raza blanca, siendo de aproximadamente uno en 2500 frente a uno de cada 17000 nios negros nacidos con esta enfermedad. Es una enfermedad grave, aunque la severidad de los sntomas varan de paciente en paciente. Puede llegar a producir graves trastornos respiratorios, con degeneracin pulmonar que provoca la muerte. No obstante, existe tratamiento paliativo, que requiere medicacin diaria para aliviar los sntomas. Actualmente se investiga en nuevos frmacos y se estn realizando ensayos de terapia gnica. Una pareja formada por un hombre y una mujer, ambos con antecedentes familiares de la enfermedad, estn considerando tener hijos y deciden someterse a un estudio para analizar previamente las posibilidades de transmitir esta enfermedad, aunque ninguno de ellos presenta sntomas de la misma. Para lo cual le piden consejo. En primer lugar, analice los antecedentes familiares de ambos. En la figura se representa el rbol genealgico de la mujer (8) y del hombre (9).

afectado afectada gemelas

fallecido

5 6 7 8 9 10 11 12

?
Como puede observar, el padre de la mujer as como dos hermanas gemelas del hombre padecen la enfermedad. 10

Ejercicios de Biologa Ciencias Ambientales 2009/2010 1.- Con estos datos es posible deducir los genotipos de todos los representados en el esquema? Cules sern los posibles genotipos de 8 y 9? Posteriormente, se decide realizar un anlisis gentico a nivel molecular dando como resultado que ambos, 8 y 9, son portadores del alelo (q) de la fibrosis qustica. Con estos datos responda a las cuestiones que le plantea la pareja, considerando nicamente este gen (cromosoma 7, alelos Q y q) y los cromosomas sexuales. 2.- Cuntos tipos de vulos diferentes puede producir la mujer? 3.- Cuntos tipos de espermatozoides diferentes puede producir el hombre? 4.- Cul es la probabilidad de tener un hijo varn sano y no portador? 5.- Cul es la probabilidad de tener un descendiente (varn o hembra) sano? 6.- Cul es la probabilidad de tener una hija portadora de la enfermedad? 7.- Les gustara tener una pareja (nio y nia) ambos sanos y no portadores cul es la probabilidad de que se cumplan sus deseos? 8.- Ponindose en el supuesto de que su primer hijo hubiera nacido ya con la enfermedad cul sera la probabilidad de que su segundo hijo naciera con la enfermedad tambin?

11